Retinoic acid signaling pathways in development and diseases.

PubMed

Das, Bhaskar C; Thapa, Pritam; Karki, Radha; Das, Sasmita; Mahapatra, Sweta; Liu, Ting-Chun; Torregroza, Ingrid; Wallace, Darren P; Kambhampati, Suman; Van Veldhuizen, Peter; Verma, Amit; Ray, Swapan K; Evans, Todd

2014-01-15

Retinoids comprise a group of compounds each composed of three basic parts: a trimethylated cyclohexene ring that is a bulky hydrophobic group, a conjugated tetraene side chain that functions as a linker unit, and a polar carbon-oxygen functional group. Biochemical conversion of carotenoid or other retinoids to retinoic acid (RA) is essential for normal regulation of a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids regulate various physiological outputs by binding to nuclear receptors called retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which themselves are DNA-binding transcriptional regulators. The functional response of RA and their receptors are modulated by a host of coactivators and corepressors. Retinoids are essential in the development and function of several organ systems; however, deregulated retinoid signaling can contribute to serious diseases. Several natural and synthetic retinoids are in clinical use or undergoing trials for treating specific diseases including cancer. In this review, we provide a broad overview on the importance of retinoids in development and various diseases, highlighting various retinoids in the drug discovery process, ranging all the way from retinoid chemistry to clinical uses and imaging. Copyright © 2013 Elsevier Ltd. All rights reserved.

Binding of vitamin A with milk α- and β-caseins.

PubMed

Bourassa, P; N'soukpoé-Kossi, C N; Tajmir-Riahi, H A

2013-05-01

The binding sites of retinol and retinoic acid with milk α- and β-caseins were determined, using constant protein concentration and various retinoid contents. FTIR, UV-visible and fluorescence spectroscopic methods as well as molecular modelling were used to analyse retinol and retinoic acid binding sites, the binding constant and the effect of retinoid complexation on the stability and conformation of caseins. Structural analysis showed that retinoids bind caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(retinol-)(α)(-caseins)=1.21 (±0.4)×10(5) M(-1) and K(retinol-)(β)(-caseins)=1.11 (±0.5)×10(5) M(-1) and K(retinoic acid-)(α)(-caseins)=6.2 (±0.6)×10(4) M(-1) and K(retinoic acid-)(β)(-caseins)=6.3 (±0.6)×10(4) M(-1). The number of bound retinol molecules per protein (n) was 1.5 (±0.1) for α-casein and 1.0 (±0.1) for β-casein, while 1 molecule of retinoic acid was bound in the α- and β-casein complexes. Molecular modelling showed different binding sites for retinol and retinoic acid on α- and β-caseins with more stable complexes formed with α-casein. Retinoid-casein complexation induced minor alterations of protein conformation. Caseins might act as carriers for transportation of retinoids to target molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

Evolution and the origin of the visual retinoid cycle in vertebrates.

PubMed

Kusakabe, Takehiro G; Takimoto, Noriko; Jin, Minghao; Tsuda, Motoyuki

2009-10-12

Absorption of a photon by visual pigments induces isomerization of 11-cis-retinaldehyde (RAL) chromophore to all-trans-RAL. Since the opsins lacking 11-cis-RAL lose light sensitivity, sustained vision requires continuous regeneration of 11-cis-RAL via the process called 'visual cycle'. Protostomes and vertebrates use essentially different machinery of visual pigment regeneration, and the origin and early evolution of the vertebrate visual cycle is an unsolved mystery. Here we compare visual retinoid cycles between different photoreceptors of vertebrates, including rods, cones and non-visual photoreceptors, as well as between vertebrates and invertebrates. The visual cycle systems in ascidians, the closest living relatives of vertebrates, show an intermediate state between vertebrates and non-chordate invertebrates. The ascidian larva may use retinochrome-like opsin as the major isomerase. The entire process of the visual cycle can occur inside the photoreceptor cells with distinct subcellular compartmentalization, although the visual cycle components are also present in surrounding non-photoreceptor cells. The adult ascidian probably uses RPE65 isomerase, and trans-to-cis isomerization may occur in distinct cellular compartments, which is similar to the vertebrate situation. The complete transition to the sophisticated retinoid cycle of vertebrates may have required acquisition of new genes, such as interphotoreceptor retinoid-binding protein, and functional evolution of the visual cycle genes.

Catalytic mechanism of a retinoid isomerase essential for vertebrate vision

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen

Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive because of uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for the treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligandmore » positioned in an adjacent pocket. With the geometry of the RPE65–substrate complex clarified, we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. Finally, these data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules.« less

Catalytic mechanism of a retinoid isomerase essential for vertebrate vision

DOE PAGES

Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; ...

2015-04-20

Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive because of uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for the treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligandmore » positioned in an adjacent pocket. With the geometry of the RPE65–substrate complex clarified, we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. Finally, these data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules.« less

Catalytic mechanism of a retinoid isomerase essential for vertebrate vision

PubMed Central

Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; Li, Qingjiang; Shi, Wuxian; Sui, Xuewu; Golczak, Marcin; Tochtrop, Gregory P.; Palczewski, Krzysztof

2015-01-01

Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase, RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive due to uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligand positioned in an adjacent pocket. With the geometry of the RPE65-substrate complex clarified we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. These data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules. PMID:25894083

All-trans-retinoic acid and 13-cis-retinoic acid: pharmacokinetics and biological activity in different cell culture models of human keratinocytes.

PubMed

Schroeder, M; Zouboulis, C C

2007-02-01

Despite its known biological effect on epithelial cells, 13- CIS-retinoic acid shows low binding affinity to either cellular retinoic acid-binding proteins or nuclear retinoid receptors compared to its isomer all- TRANS-retinoic acid. We have postulated a prodrug-drug relation with 13- CIS-retinoic acid which isomerizes to all- TRANS-retinoic acid. On the other hand, the biological effects of these two compounds can differ in the widely used cell culture models of HaCaT and normal primary keratinocytes. In this study, we seeded HaCaT and normal keratinocytes at high densities leading to early confluence in order to imitate high keratinocyte proliferation, such as in acne and psoriasis, while to model decreased keratinocyte proliferation, as in aged and steroid-damaged skin, cells were seeded at a low density. High performance liquid chromatography was administered to examine retinoid uptake and metabolism in monolayer HaCaT and normal keratinocyte cultures and the 4-methylumbelliferyl heptanoate assay to estimate cell growth at different cell densities. Major qualitative and quantitative differences were detected in the two cell types regarding intracellular 13- CIS-retinoic acid isomerization to all- TRANS-retinoic acid. On the other hand, the two retinoic acid isomers showed similar effects on cell growth of both cell types tested with increasing proliferation at low cell densities, but being rather inactive at high ones in normal keratinocytes and exhibiting an antiproliferative effect in HaCaT keratinocytes. The missing effect of retinoids on cell proliferation in high seeding densities of normal keratinocytes may indicate that the normalizing activity of retinoids on hyperkeratotic diseases, such as acne or psoriasis, is likely to be carried out by modulation of cell differentiation than cell growth. On the other hand, induced keratinocyte proliferation in low seeding densities may provide an explanation for the acanthosis induced by topical retinoids in aged and steroid-damaged skin.

Fenretinide

PubMed Central

Pavone, Mary Ellen; Malpani, Saurabh S.; Dyson, Matthew; Kim, J. Julie; Bulun, Serdar E.

2016-01-01

Objective: Fenretinide is a synthetic retinoid analogue that promotes apoptosis but has decreased toxicity when compared to other retinoids. We have previously shown that retinoic acid (RA) production in endometriotic tissue is decreased, resulting in reduced estrogen metabolism and apoptotic resistance. We hypothesize fenretinide may induce apoptosis in endometriotic cells and tissues, thereby reducing disease burden. Materials and Methods: Primary endometriotic stromal cells were collected, isolated, cultured, and treated with fenretinide in doses from 0 to 20 µmol/L. Cell count, viability, and immunoblots were performed to examine apoptosis. Quantitative reverse transcription-polymerase chain reaction from endometriotic cells treated with fenretinide was used to examine expression of genes involved in RA signaling including stimulated by RA 6 (STRA6), cellular RA binding protein 2 (CRABP2), and fatty acid binding protein 5 (FABP5). Endometriotic tissue was xenografted subcutaneously into the flanks of mice which were treated with fenretinide for 2 weeks, after which the mice were killed and lesion volumes calculated. Statistical analysis was performed using t test and analysis of variance. Results: Treatment with fenretinide significantly decreased total cell count (doses 5-20 µL) and viability (doses 10-20 µmol/L). Fenretinide increased protein levels of the apoptotic marker poly (ADP ribose) polymerase (starting at 10 µmol/L) and decreased proliferation marker proliferating cell nuclear antigen (10 µmol/L, starting at 8-day treatment). Examination of genes involved in retinoid uptake and action showed that treatment induced STRA6 expression while expression of CRABP2 and FABP5 remained unchanged. Fenretinide also significantly decreased the endometriotic lesion xenograft volume. Conclusions: Fenretinide increases STRA6 expression thereby potentially reversing the pathological loss of retinoid availability. Treatment with this compound induces apoptosis. In vivo treatments decrease lesion volume. Targeting the RA signaling pathway may be a promising novel treatment for women with endometriosis. PMID:26919975

Retinoids activate the irritant receptor TRPV1 and produce sensory hypersensitivity

PubMed Central

Yin, Shijin; Luo, Jialie; Qian, Aihua; Du, Junhui; Yang, Qing; Zhou, Shentai; Yu, Weihua; Du, Guangwei; Clark, Richard B.; Walters, Edgar T.; Carlton, Susan M.; Hu, Hongzhen

2013-01-01

Retinoids are structurally related derivatives of vitamin A and are required for normal vision as well as cell proliferation and differentiation. Clinically, retinoids are effective in treating many skin disorders and cancers. Application of retinoids evokes substantial irritating side effects, including pain and inflammation; however, the precise mechanisms accounting for the sensory hypersensitivity are not understood. Here we show that both naturally occurring and synthetic retinoids activate recombinant or native transient receptor potential channel vanilloid subtype 1 (TRPV1), an irritant receptor for capsaicin, the pungent ingredient of chili peppers. In vivo, retinoids produced pain-related behaviors that were either eliminated or significantly reduced by genetic or pharmacological inhibition of TRPV1 function. These findings identify TRPV1 as an ionotropic receptor for retinoids and provide cellular and molecular insights into retinoid-evoked hypersensitivity. These findings also suggest that selective TRPV1 antagonists are potential therapeutic drugs for treating retinoid-induced sensory hypersensitivity. PMID:23925292

Identification of heparin-binding EGF-like growth factor as a target in intercellular regulation of epidermal basal cell growth by suprabasal retinoic acid receptors.

PubMed Central

Xiao, J H; Feng, X; Di, W; Peng, Z H; Li, L A; Chambon, P; Voorhees, J J

1999-01-01

The role of retinoic acid receptors (RARs) in intercellular regulation of cell growth was assessed by targeting a dominant-negative RARalpha mutant (dnRARalpha) to differentiated suprabasal cells of mouse epidermis. dnRARalpha lacks transcriptional activation but not DNA-binding and receptor dimerization functions. Analysis of transgenic mice revealed that dnRARalpha dose-dependently impaired induction of basal cell proliferation and epidermal hyperplasia by all-trans RA (tRA). dnRARalpha formed heterodimers with endogenous retinoid X receptor-alpha (RXRalpha) over RA response elements in competition with remaining endogenous RARgamma-RXRalpha heterodimers, and dose-dependently impaired retinoid-dependent gene transcription. To identify genes regulated by retinoid receptors and involved in cell growth control, we analyzed the retinoid effects on expression of the epidermal growth factor (EGF) receptor, EGF, transforming growth factor-alpha, heparin-binding EGF-like growth factor (HB-EGF) and amphiregulin genes. In normal epidermis, tRA rapidly and selectively induced expression of HB-EGF but not the others. This induction occurred exclusively in suprabasal cells. In transgenic epidermis, dnRARalpha dose-dependently inhibited tRA induction of suprabasal HB-EGF and subsequent basal cell hyperproliferation. Together, our observations suggest that retinoid receptor heterodimers located in differentiated suprabasal cells mediate retinoid induction of HB-EGF, which in turn stimulates basal cell growth via intercellular signaling. These events may underlie retinoid action in epidermal regeneration during wound healing. PMID:10075925

Docking simulations suggest that all-trans retinoic acid could bind to retinoid X receptors.

PubMed

Tsuji, Motonori; Shudo, Koichi; Kagechika, Hiroyuki

2015-10-01

Retinoid X receptors (RXRs) are ligand-controlled transcription factors which heterodimerize with other nuclear receptors to regulate gene transcriptions associated with crucial biological events. 9-cis retinoic acid (9cRA), which transactivates RXRs, is believed to be an endogenous RXR ligand. All-trans retinoic acid (ATRA) is a natural ligand for retinoic acid receptors (RARs), which heterodimerize with RXRs. Although the concentration of 9cRA in tissues is very low, ATRA is relatively abundant and some reports show that ATRA activates RXRs. We computationally studied the possibility of ATRA binding to RXRs using two different docking methods with our developed programs to assess the binding affinities of naturally occurring retinoids. The simulations showed good correlations to the reported binding affinities of these molecules for RXRs and RARs.

Effects of retinoids on differentiation, lipid metabolism, epidermal growth factor, and low-density lipoprotein binding in squamous carcinoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ponec, M.; Weerheim, A.; Havekes, L.

The relationship among keratinocyte differentiation capacity, lipid synthesis, low-density lipoprotein (LDL) metabolism, plasma membrane composition, and epidermal growth factor (EGF) binding has been studied in SCC-12F2 cells. The differentiation capacity of the cells, i.e., ionophore-induced cornified envelope formation, was inhibited by various retinoids and stimulated by hydrocortisone. Retinoids that caused a significant reduction of cornified envelope formation, i.e., retinoic acid and 13-cis-retinoic acid, caused only minor changes in lipid synthesis and plasma membrane composition. Arotinoid ethylsulfone, having a minor effect on cornified envelope formation, caused a drastic inhibition of cholesterol synthesis resulting in changes in the plasma membrane composition. Hydrocortisonemore » stimulated cornified envelope formation but had only minor effects on lipid synthesis and plasma membrane composition. Of all retinoids tested, only arotinoid ethylsulfone caused a drastic increase in EGF binding, while hydrocortisone had no effect. These results clearly demonstrate that the plasma membrane composition is not related to keratinocyte differentiation capacity, but most likely does determine EGF binding. Furthermore, EGF binding does not determine keratinocyte differentiation capacity.« less

Identifying the receptor subtype selectivity of retinoid X and retinoic acid receptors via quantum mechanics.

PubMed

Tsuji, Motonori; Shudo, Koichi; Kagechika, Hiroyuki

2017-03-01

Understanding and identifying the receptor subtype selectivity of a ligand is an important issue in the field of drug discovery. Using a combination of classical molecular mechanics and quantum mechanical calculations, this report assesses the receptor subtype selectivity for the human retinoid X receptor (hRXR) and retinoic acid receptor (hRAR) ligand-binding domains (LBDs) complexed with retinoid ligands. The calculated energies show good correlation with the experimentally reported binding affinities. The technique proposed here is a promising method as it reveals the origin of the receptor subtype selectivity of selective ligands.

Plant-mediated silencing of the fatty acid- and retinoid-binding Pp-far-1 gene can reduce development of the root lesion nematode, Pratylenchus penetrans

USDA-ARS?s Scientific Manuscript database

Pratylenchus penetrans is one of the most important plant-parasitic nematodes and can act as a limiting factor of important agricultural, horticultural and industrial crops. Fatty acid- and retinoid- (FAR) binding proteins are unique to nematodes. The cDNA corresponding to a putative P. penetrans FA...

Increasing the intracellular availability of all-trans retinoic acid in neuroblastoma cells.

PubMed

Armstrong, J L; Ruiz, M; Boddy, A V; Redfern, C P F; Pearson, A D J; Veal, G J

2005-02-28

Recent data indicate that isomerisation to all-trans retinoic acid (ATRA) is the key mechanism underlying the favourable clinical properties of 13-cis retinoic acid (13cisRA) in the treatment of neuroblastoma. Retinoic acid (RA) metabolism is thought to contribute to resistance, and strategies to modulate this may increase the clinical efficacy of 13cisRA. The aim of this study was to test the hypothesis that retinoids, such as acitretin, which bind preferentially to cellular retinoic acid binding proteins (CRABPs), or specific inhibitors of the RA hydroxylase CYP26, such as R116010, can increase the intracellular availability of ATRA. Incubation of SH-SY5Y cells with acitretin (50 microM) or R116010 (1 or 10 microM) in combination with either 10 microM ATRA or 13cisRA induced a selective increase in intracellular levels of ATRA, while 13cisRA levels were unaffected. CRABP was induced in SH-SY5Y cells in response to RA. In contrast, acitretin had no significant effect on intracellular retinoid concentrations in those neuroblastoma cell lines that showed little or no induction of CRABP after RA treatment. Both ATRA and 13cisRA dramatically induced the expression of CYP26A1 in SH-SY5Y cells, and treatment with R116010, but not acitretin, potentiated the RA-induced expression of a reporter gene and CYP26A1. The response of neuroblastoma cells to R116010 was consistent with inhibition of CYP26, indicating that inhibition of RA metabolism may further optimise retinoid treatment in neuroblastoma.

Increasing the intracellular availability of all-trans retinoic acid in neuroblastoma cells

PubMed Central

Armstrong, J L; Ruiz, M; Boddy, A V; Redfern, C P F; Pearson, A D J; Veal, G J

2005-01-01

Recent data indicate that isomerisation to all-trans retinoic acid (ATRA) is the key mechanism underlying the favourable clinical properties of 13-cis retinoic acid (13cisRA) in the treatment of neuroblastoma. Retinoic acid (RA) metabolism is thought to contribute to resistance, and strategies to modulate this may increase the clinical efficacy of 13cisRA. The aim of this study was to test the hypothesis that retinoids, such as acitretin, which bind preferentially to cellular retinoic acid binding proteins (CRABPs), or specific inhibitors of the RA hydroxylase CYP26, such as R116010, can increase the intracellular availability of ATRA. Incubation of SH-SY5Y cells with acitretin (50 μM) or R116010 (1 or 10 μM) in combination with either 10 μM ATRA or 13cisRA induced a selective increase in intracellular levels of ATRA, while 13cisRA levels were unaffected. CRABP was induced in SH-SY5Y cells in response to RA. In contrast, acitretin had no significant effect on intracellular retinoid concentrations in those neuroblastoma cell lines that showed little or no induction of CRABP after RA treatment. Both ATRA and 13cisRA dramatically induced the expression of CYP26A1 in SH-SY5Y cells, and treatment with R116010, but not acitretin, potentiated the RA-induced expression of a reporter gene and CYP26A1. The response of neuroblastoma cells to R116010 was consistent with inhibition of CYP26, indicating that inhibition of RA metabolism may further optimise retinoid treatment in neuroblastoma. PMID:15714209

Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.

2007-12-21

In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferasemore » I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.« less

Characterization of three novel fatty acid- and retinoid-binding protein genes (Ha-far-1, Ha-far-2 and Hf-far-1) from the cereal cyst nematodes Heterodera avenae and H. filipjevi

USDA-ARS?s Scientific Manuscript database

Heterodera avenae and H. filipjevi are major parasites of wheat, reducing production worldwide. Both are sedentary endoparasitic nematodes, and their development and parasitism depend strongly on nutrients obtained from hosts. Secreted fatty acid- and retinoid-binding (FAR) proteins are nematode-spe...

DGAT1-deficiency affects the cellular distribution of hepatic retinoid and attenuates the progression of CCl4-induced liver fibrosis

PubMed Central

Yuen, Jason J.; Lee, Seung-Ah; Jiang, Hongfeng; Brun, Pierre-Jacques

2015-01-01

Background Diacylglycerol O-acyltransferase 1 (DGAT1) catalyzes the final step of triglyceride synthesis, transferring an acyl group from acyl-CoA to diacylglycerol. DGAT1 also catalyzes the acyl-CoA-dependent formation of retinyl esters in vitro and in mouse intestine and skin. Although DGAT1 is expressed in both hepatocytes and hepatic stellate cells (HSCs), we reported genetic and nutritional studies that established that DGAT1 does not contribute to retinyl ester formation in the liver. Methods We now have explored in more depth the role(s) of DGAT1 in hepatic retinoid metabolism and storage. Results Our data show that DGAT1 affects the cellular distribution between hepatocytes and HSCs of stored and newly absorbed dietary retinol. For livers of Dgat1-deficient mice, a greater percentage of stored retinyl ester is present in HSCs at the expense of hepatocytes. This is also true for newly absorbed oral [3H]retinol. These differences are associated with significantly increased expression, by 2.8-fold, of cellular retinol-binding protein, type I (RBP1) in freshly isolated HSCs from Dgat1-deficient mice, raising the possibility that RBP1, which contributes to retinol uptake into cells and retinyl ester synthesis, accounts for the differences. We further show that the retinyl ester-containing lipid droplets in HSCs are affected in Dgat1-null mice, being fewer in number but, on average, larger than in wild type (WT) HSCs. Finally, we demonstrate that DGAT1 affects experimentally induced HSC activation in vivo but that this effect is independent of altered retinoic acid availability or effects on gene expression. Conclusions Our studies establish that DGAT1 has a role in hepatic retinoid storage and metabolism, but this does not involve direct actions of DGAT1 in retinyl ester synthesis. PMID:26151058

N-retinylidene-phosphatidylethanolamine is the preferred retinoid substrate for the photoreceptor-specific ABC transporter ABCA4 (ABCR).

PubMed

Beharry, Seelochan; Zhong, Ming; Molday, Robert S

2004-12-24

ABCA4, a member of the family of ATP binding cassette (ABC) proteins found in rod and cone photoreceptors, has been implicated in the transport of retinoid compounds across the outer segment disk membrane following the photoactivation of rhodopsin. Mutations in the ABCA4 gene are responsible for Stargardt macular dystrophy and related retinal degenerative diseases that cause a loss in vision. To identify the retinoid substrate that interacts with ABCA4, we have isolated ABCA4 from rod outer segment disk membranes on an immunoaffinity matrix and analyzed retinoid compounds that bind to ABCA4 using high performance liquid chromatography and radiolabeling methods. When all-trans-retinal was added to ABCA4 in the presence of phosphatidylethanolamine, approximately 0.9 mol of N-retinylidene-phosphatidylethanolamine and 0.3 mol of all-trans-retinal were bound per mol of ABCA4 with an apparent K(d) of 2-5 microm. ATP and GTP released these retinoids from ABCA4, whereas ADP, GDP, and nonhydrolyzable derivatives, adenosine 5'-(beta,gamma-imido)triphosphate and guanosine 5'-(beta,gamma-imido)triphosphate, were ineffective. One mole of N-retinyl-phosphatidylethanolamine, the reduced form of N-retinylidene-phosphatidylethanolamine, bound per mol of ABCA4, whereas 0.3 mol of all-trans-retinal were bound in the absence of phosphatidylethanolamine. No binding of all-trans-retinol to ABCA4 was observed. Our results indicate that ABCA4 preferentially binds N-retinylidene-phosphatidylethanolamine with high affinity in the absence of ATP. Our studies further suggest that ATP binding and hydrolysis induces a protein conformational change that causes N-retinylidene-phosphatidylethanolamine to dissociate from ABCA4.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orfali, Nina; Department of Pharmacology, Weill Cornell Medical College, New York, NY 10065, USA.; McKenna, Sharon L.

Retinoids are a family of signaling molecules derived from vitamin A with well established roles in cellular differentiation. Physiologically active retinoids mediate transcriptional effects on cells through interactions with retinoic acid (RARs) and retinoid-X (RXR) receptors. Chromosomal translocations involving the RARα gene, which lead to impaired retinoid signaling, are implicated in acute promyelocytic leukemia (APL). All-trans-retinoic acid (ATRA), alone and in combination with arsenic trioxide (ATO), restores differentiation in APL cells and promotes degradation of the abnormal oncogenic fusion protein through several proteolytic mechanisms. RARα fusion-protein elimination is emerging as critical to obtaining sustained remission and long-term cure in APL.more » Autophagy is a degradative cellular pathway involved in protein turnover. Both ATRA and ATO also induce autophagy in APL cells. Enhancing autophagy may therefore be of therapeutic benefit in resistant APL and could broaden the application of differentiation therapy to other cancers. Here we discuss retinoid signaling in hematopoiesis, leukemogenesis, and APL treatment. We highlight autophagy as a potential important regulator in anti-leukemic strategies. - Highlights: • Normal and aberrant retinoid signaling in hematopoiesis and leukemia is reviewed. • We suggest a novel role for RARα in the development of X-RARα gene fusions in APL. • ATRA therapy in APL activates transcription and promotes onco-protein degradation. • Autophagy may be involved in both onco-protein degradation and differentiation. • Pharmacologic autophagy induction may potentiate ATRA's therapeutic effects.« less

Contribution of cellular retinol-binding protein type 1 to retinol metabolism during mouse development.

PubMed

Matt, Nicolas; Schmidt, Carsten K; Dupé, Valérie; Dennefeld, Christine; Nau, Heinz; Chambon, Pierre; Mark, Manuel; Ghyselinck, Norbert B

2005-05-01

Within cells, retinol (ROL) is bound to cytoplasmic proteins (cellular retinol-binding proteins [CRBPs]), whose proposed function is to protect it from unspecific enzymes through channeling to retinoid-metabolizing pathways. We show that, during development, ROL and retinyl ester levels are decreased in CRBP type 1 (CRBP1) -deficient embryos and fetuses by 50% and 80%, respectively. The steady state level of retinoic acid (RA) is also decreased but to a lesser extent. However, CRBP1-null fetuses do not exhibit the abnormalities characteristic of a vitamin A-deficiency syndrome. Neither CRBP1 deficiency alters the expression patterns of RA-responding genes during development, nor does CRBP1 availability modify the expression of an RA-dependent gene in primary embryonic fibroblasts treated with ROL. Therefore, CRBP1 is required in prenatal life to maintain normal amounts of ROL and to ensure its efficient storage but seems of secondary importance for RA synthesis, at least under conditions of maternal vitamin A sufficiency. Copyright 2005 Wiley-Liss, Inc.

Retinoid receptors, transporters, and metabolizers as therapeutic targets in late onset Alzheimer disease.

PubMed

Goodman, Ann B

2006-12-01

Vitamin A (retinoid) is required in the adult brain to enable cognition, learning, and memory. While brain levels of retinoid diminish over the course of normal ageing, retinoid deficit is greater in late onset Alzheimer disease (LOAD) brains than in normal-aged controls. This paper reviews recent evidence supporting these statements and further suggests that genes necessary for the synthesis, transport and function of retinoid to and within the ageing brain are appropriate targets for treatment of LOAD. These genes tend to be clustered with genes that have been proposed as candidates in LOAD, are found at chromosomal regions linked to LOAD, and suggest the possibility of an overall coordinated regulation. This phenomenon is termed Chromeron and is analogous to the operon mechanism observed in prokaryotes. Suggested treatment targets are the retinoic-acid inactivating enzymes (CYP26)s, the retinol binding and transport proteins, retinol-binding protein (RBP)4 and transthyretin (TTR), and the retinoid receptors. TTR as a LOAD target is the subject of active investigation. The retinoid receptors and the retinoid-inactivating enzymes have previously been proposed as targets. This is the first report to suggest that RBP4 is an amenable treatment target in LOAD. RBP4 is elevated in type-2 diabetes and obesity, conditions associated with increased risk for LOAD. Fenretinide, a novel synthetic retinoic acid (RA) analog lowers RBP4 in glucose intolerant obese mice. The feasibility of using fenretinide either as an adjunct to present LOAD therapies, or on its own as an early prevention strategy should be determined. (c) 2006 Wiley-Liss, Inc.

REACTIVITY PROFILE OF CONFORMATIONALLY-FLEXIBLE RETINOID RECEPTOR LIGANDS

EPA Science Inventory

Retinoids and associated derivatives represent a class of endogenousr hormones that bind to and activate different families of retinoic acid receptors (RARs, RXRs), and control many aspects of normal vertebrate development. Identification of potential RAR and RXRs ligands is of i...

The primary structure of fatty-acid-binding protein from nurse shark liver. Structural and evolutionary relationship to the mammalian fatty-acid-binding protein family.

PubMed

Medzihradszky, K F; Gibson, B W; Kaur, S; Yu, Z H; Medzihradszky, D; Burlingame, A L; Bass, N M

1992-02-01

The primary structure of a fatty-acid-binding protein (FABP) isolated from the liver of the nurse shark (Ginglymostoma cirratum) was determined by high-performance tandem mass spectrometry (employing multichannel array detection) and Edman degradation. Shark liver FABP consists of 132 amino acids with an acetylated N-terminal valine. The chemical molecular mass of the intact protein determined by electrospray ionization mass spectrometry (Mr = 15124 +/- 2.5) was in good agreement with that calculated from the amino acid sequence (Mr = 15121.3). The amino acid sequence of shark liver FABP displays significantly greater similarity to the FABP expressed in mammalian heart, peripheral nerve myelin and adipose tissue (61-53% sequence similarity) than to the FABP expressed in mammalian liver (22% similarity). Phylogenetic trees derived from the comparison of the shark liver FABP amino acid sequence with the members of the mammalian fatty-acid/retinoid-binding protein gene family indicate the initial divergence of an ancestral gene into two major subfamilies: one comprising the genes for mammalian liver FABP and gastrotropin, the other comprising the genes for mammalian cellular retinol-binding proteins I and II, cellular retinoic-acid-binding protein myelin P2 protein, adipocyte FABP, heart FABP and shark liver FABP, the latter having diverged from the ancestral gene that ultimately gave rise to the present day mammalian heart-FABP, adipocyte FABP and myelin P2 protein sequences. The sequence for intestinal FABP from the rat could be assigned to either subfamily, depending on the approach used for phylogenetic tree construction, but clearly diverged at a relatively early evolutionary time point. Indeed, sequences proximately ancestral or closely related to mammalian intestinal FABP, liver FABP, gastrotropin and the retinoid-binding group of proteins appear to have arisen prior to the divergence of shark liver FABP and should therefore also be present in elasmobranchs. The presence in shark liver of an FABP which differs substantially in primary structure from mammalian liver FABP, while being closely related to the FABP expressed in mammalian heart muscle, peripheral nerve myelin and adipocytes, opens a further dimension regarding the question of the existence of structure-dependent and tissue-specific specialization of FABP function in lipid metabolism.

Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

PubMed

Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

2011-02-11

Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters the endogenous metabolism of all-trans-retinoic acid in the rat.

PubMed

Schmidt, Carsten K; Hoegberg, Pi; Fletcher, Nicholas; Nilsson, Charlotte B; Trossvik, Christina; Håkansson, Helen; Nau, Heinz

2003-07-01

2,3,7,8-Tetrachlorodibenzo- p-dioxin (TCDD) is known to influence vitamin A homeostasis. In order to investigate the mechanism behind this retinoid disruption, male Sprague-Dawley rats were exposed to TCDD at doses ranging from 0.1 to 100 micro g/kg body weight, and were killed 3 days after exposure. Additional groups of rats were killed 1 and 28 days after a single oral dose of 10 micro g TCDD/kg body weight. Serum, kidney, and liver were investigated for retinoid levels, as well as gene expression and enzyme activities relevant for retinoid metabolism. Besides the well known effects of TCDD on apolar retinoids, i.e. decreased hepatic and increased renal retinyl ester (RE) levels, we have found dose-dependent elevation of all- trans-retinoic acid (all- trans-RA) levels in all investigated tissues. In the liver, 9- cis-4-oxo-13,14-dihydro-RA was drastically decreased by TCDD in a dose-dependent manner. In serum, cis-isomers of all- trans-RA, including 9,13-di- cis-RA, were significantly reduced already at the lowest dose level. Protein and mRNA levels of cellular retinol binding protein I (CRBP-I) in liver or kidneys were not significantly altered by TCDD exposure at doses at which retinoid levels were affected, making CRBP-I an unlikely candidate to account for the alterations in retinoid metabolism caused by TCDD. The expression and activities of relevant cytochrome P450 (CYP) enzymes with potential roles in all- trans-RA synthesis and/or degradation (CYP1A1, 1A2, and 2B1/2) were also monitored. A possible role of CYP1A1 in TCDD-induced all- trans-RA synthesis is suggested from the time-course relationship between CYP1A1 activity and all- trans-RA levels in liver and kidney. The significant alteration of the all- trans-RA metabolism has the potential to contribute significantly to the toxicity of TCDD.

LE135, a retinoid acid receptor antagonist, produces pain through direct activation of TRP channels

PubMed Central

Yin, Shijin; Luo, Jialie; Qian, Aihua; Yu, Weihua; Hu, Hongzhen

2014-01-01

Background and PurposeRetinoids, through their activation of retinoic acid receptors (RARs) and retinoid X receptors, regulate diverse cellular processes, and pharmacological intervention in their actions has been successful in the treatment of skin disorders and cancers. Despite the many beneficial effects, administration of retinoids causes irritating side effects with unknown mechanisms. Here, we demonstrate that LE135 [4-(7,8,9,10-tetrahydro-5,7,7,10,10-pentamethyl-5H-benzo[e]naphtho[2,3-b][1,4]diazepin-13-yl)benzoic acid], a selective antagonist of RARβ, is a potent activator of the capsaicin (TRPV1) and wasabi (TRPA1) receptors, two critical pain-initiating cation channels. Experimental ApproachWe performed to investigate the excitatory effects of LE135 on TRPV1 and TRPA1 channels expressed in HEK293T cells and in dorsal root ganglia neurons with calcium imaging and patch-clamp recordings. We also used site-directed mutagenesis of the channels to determine the structural basis of LE135-induced activation of TRPV1 and TRPA1 channels and behavioural testing to examine if pharmacological inhibition and genetic deletion of the channels affected LE135-evoked pain-related behaviours. Key ResultsLE135 activated both the capsaicin receptor (TRPV1) and the allyl isothiocyanate receptor (TRPA1) heterologously expressed in HEK293T cells and endogenously expressed by sensory nociceptors. Mutations disrupting the capsaicin-binding site attenuated LE135 activation of TRPV1 channels and a single mutation (K170R) eliminated TRPA1 activity evoked by LE135. Intraplantar injection of LE135 evoked pain-related behaviours. Both TRPV1 and TRPA1 channels were involved in LE135-elicited pain-related responses, as shown by pharmacological and genetic ablation studies. Conclusions and ImplicationsThis blocker of retinoid acid signalling also exerted non-genomic effects through activating the pain-initiating TRPV1 and TRPA1 channels. PMID:24308840

LE135, a retinoid acid receptor antagonist, produces pain through direct activation of TRP channels.

PubMed

Yin, Shijin; Luo, Jialie; Qian, Aihua; Yu, Weihua; Hu, Hongzhen

2014-03-01

Retinoids, through their activation of retinoic acid receptors (RARs) and retinoid X receptors, regulate diverse cellular processes, and pharmacological intervention in their actions has been successful in the treatment of skin disorders and cancers. Despite the many beneficial effects, administration of retinoids causes irritating side effects with unknown mechanisms. Here, we demonstrate that LE135 [4-(7,8,9,10-tetrahydro-5,7,7,10,10-pentamethyl-5H-benzo[e]naphtho[2,3-b][1,4]diazepin-13-yl)benzoic acid], a selective antagonist of RARβ , is a potent activator of the capsaicin (TRPV1) and wasabi (TRPA1) receptors, two critical pain-initiating cation channels. We performed to investigate the excitatory effects of LE135 on TRPV1 and TRPA1 channels expressed in HEK293T cells and in dorsal root ganglia neurons with calcium imaging and patch-clamp recordings. We also used site-directed mutagenesis of the channels to determine the structural basis of LE135-induced activation of TRPV1 and TRPA1 channels and behavioural testing to examine if pharmacological inhibition and genetic deletion of the channels affected LE135-evoked pain-related behaviours. LE135 activated both the capsaicin receptor (TRPV1) and the allyl isothiocyanate receptor (TRPA1) heterologously expressed in HEK293T cells and endogenously expressed by sensory nociceptors. Mutations disrupting the capsaicin-binding site attenuated LE135 activation of TRPV1 channels and a single mutation (K170R) eliminated TRPA1 activity evoked by LE135. Intraplantar injection of LE135 evoked pain-related behaviours. Both TRPV1 and TRPA1 channels were involved in LE135-elicited pain-related responses, as shown by pharmacological and genetic ablation studies. This blocker of retinoid acid signalling also exerted non-genomic effects through activating the pain-initiating TRPV1 and TRPA1 channels. © 2013 The British Pharmacological Society.

Inhibition of carcinogenesis by retinoids. [Review

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nettesheim, P.

1979-01-01

Progress made in recent years in the search for retinoids with anticarcinogenic activity is reviewed. There are many studies to be found in the literature which show no substantial effect of retinoids on carcinogenesis or tumor growth. Some of these negative findings may be related to the carcinogen dose used, the type of retinoid used, the dose, dose schedule or mode of administration of the retinoid. Others may indicate that the particular type of tumor or tumor system is, indeed, refractory to retinoids in general or to those retinoids that were tested. A great gap still exists in our knowledgemore » concerning the pharmake-kinetics of most retinoids their availability to various normal and cancerous tissues, and the role and existence of transport and binding proteins. There are studies which indicate that under certain conditions, particularly conditions of topical application, some retinoids may even enhance carcinogenesis. It seems, however, indisputable by now that some retinoids are effective inhibitors of carcinogenesis in some organ systems and can even inhibit the growth of some established tumors. While the mechanisms of these inhibitory effects are presently not understood, it does seem clear that they are not mediated via the cytotoxic mechanisms typical of chemotherapeutic agents. The hope that retinoids might become an effective tool to halt the progression of some neoplastic diseases, seems to be justified.« less

Azadirachtin Interacts with Retinoic Acid Receptors and Inhibits Retinoic Acid-mediated Biological Responses*

PubMed Central

Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B.; Sureshkumar, Chitta; Manna, Sunil K.

2011-01-01

Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies. PMID:21127062

Interphotoreceptor Retinoid-Binding Protein Protects Retinoids from Photodegradation

PubMed Central

Gonzalez-Fernandez, Federico; Betts-Obregon, Brandi; Yust, Brian; Mimun, Joshua; Sung, Dongjin; Sardar, Dhiraj; Tsin, Andrew T.

2015-01-01

Retinol degrades rapidly in light into a variety of photoproducts. It is remarkable that visual cycle retinoids can evade photodegradation as they are exchanged between the photoreceptors, retinal pigment epithelium and Müller glia. Within the interphotoreceptor matrix, all-trans retinol, 11-cis retinol and retinal are bound by interphotoreceptor retinoid-binding protein (IRBP). Apart from its role in retinoid trafficking and targeting, could IRBP have a photoprotective function? HPLC was used to evaluate the ability of IRBP to protect all-trans and 11-cis retinols from photodegradation when exposed to incandescent light (0 to 8,842 μW/cm2); time periods of 0 – 60 min, and bIRBP: retinol molar ratios of 1:1 to 1:5. bIRBP afforded a significant prevention of both all-trans and 11-cis retinol to rapid photodegradation. The effect was significant over the entire light intensity range tested, and extended to the bIRBP: retinol ratio 1:5. In view of the continual exposure of the retina to light, and the high oxidative stress in the outer retina, our results suggest IRBP may have an important protective role in the visual cycle by reducing photodegradation of all-trans and 11-cis retinols. This role of IRBP is particularly relevant in the high flux conditions of the cone visual cycle. PMID:25565073

Retinoids: fascinating up-and-coming scenario.

PubMed

Sardana, Kabir; Sehgal, Virendra N

2003-05-01

Retinoids have been in sharp focus ever since their introduction 30 years ago. They include any drug (s) that bind to retinoid receptors and elicit a biological response. Enormous information on the subject seems to embroil the recent literature. Practically it is impossible to clearly comprehend the undercurrents. The meticulously dispensing text envisages surmounting the perspective reader's predicaments. Accordingly, retinoids and their related facets namely retinoid receptors, classification, mode of action, and the pharmacological diversity have been precisely defined. Commonly used systemic retinoids too have been given a substantial fresh look along with their monitoring. Overall, adverse effects and relative and absolute contraindications have been scrupulously incorporated. Human immuno deficiency virus (HIV) and isoretinoid for acne, in particular, have been highlighted. Micronized isotretinoin formulations have also been taken care so also commonly used topical retinoids. Tretinoin and their newer formulation have also been accounted for along with tretinoin polymer cream. Adapalene, a new chemical entity possessing a unique physico-chemical activity similar to that of tretinoin has also been dealt with. Newer retinoids are likely to be a subject of intrigue. A focus on future potentials of retinoids is its special ingredient. The inclusion of details of rexinoid the most recent introduction in their purview is likely to invoke interest to further consolidate its reckoning in future. All in all the text of the paper should provide an insight into the current rumbling around retinoids.

Ligand recognition by RAR and RXR receptors: binding and selectivity.

PubMed

Sussman, Fredy; de Lera, Angel R

2005-10-06

Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

Structure of Zebrafish IRBP Reveals Fatty Acid Binding

PubMed Central

Ghosh, Debashis; Haswell, Karen M.; Sprada, Molly; Gonzalez-Fernandez, Federico

2015-01-01

Interphotoreceptor retinoid-binding protein (IRBP) has a remarkable role in targeting and protecting all-trans and 11-cis retinol, and 11-cis retinal during the rod and cone visual cycles. Little is known about how the correct retinoid is efficiently delivered and removed from the correct cell at the required time. It has been proposed that different fatty composition at that the outer-segments and retinal-pigmented epithelium could have an important role is regulating the delivery and uptake of the visual cycle retinoids at the cell-interphotoreceptor-matrix interface. Although this suggests intriguing mechanisms for the role of local fatty acids in visual-cycle retinoid trafficking, nothing is known about the structural basis of IRBP-fatty acid interactions. Such regulation may be mediated through IRBP’s unusual repeating homologous modules, each containing about 300 amino acids. We have been investigating structure-function relationships of Zebrafish IRBP (zIRBP), which has only two tandem modules (z1 and z2), as a model for the more complex four-module mammalian IRBP’s. Here we report the first X-ray crystal structure of a teleost IRBP, and the only structure with a bound ligand. The X-ray structure of z1, determined at 1.90Å resolution, reveals a two-domain organization of the module (domains A and B). A deep hydrophobic pocket was identified within the N-terminal domain A. In fluorescence titrations assays, oleic acid displaced all-trans retinol from zIRBP. Our study, which provides the first structure of an IRBP with bound ligand, supports a potential role for fatty acids in regulating retinoid binding. PMID:26344741

DNA Methylation of Cellular Retinoic Acid-Binding Proteins in Cervical Cancer.

PubMed

Arellano-Ortiz, Ana L; Salcedo-Vargas, Mauricio; Vargas-Requena, Claudia L; López-Díaz, José A; De la Mora-Covarrubias, Antonio; Silva-Espinoza, Juan C; Jiménez-Vega, Florinda

2016-01-01

This study determined the methylation status of cellular retinoic acid-binding protein ( CRABP ) gene promoters and associated them with demographic characteristics, habits, and the presence of human papilloma virus (HPV) in patients with cervical cancer (CC), low and high squamous intraepithelial lesions, and no intraepithelial lesion. Women (n = 158) were selected from the Colposcopy Clinic of Sanitary Jurisdiction II in Ciudad Juarez, Chihuahua, Mexico. Demographic characteristics and habit information were collected. Cervical biopsy and endocervical scraping were used to determine methylation in promoter regions by methylation-specific polymerase chain reaction technique. We found hemi-methylation patterns in the promoter regions of CRABP1 and CRABP2 ; there was 28.5% hemi-methylation in CRABP1 and 7.0% in that of CRABP2 . Methylation in CRABP1 was associated with age (≥35 years, P = 0.002), family history of cancer ( P = 0.032), the presence of HPV-16 ( P = 0.013), and no alcohol intake ( P = 0.035). These epigenetic changes could be involved in the CC process, and CRABP1 has the potential to be a predictive molecular marker of retinoid therapy response.

DNA Methylation of Cellular Retinoic Acid-Binding Proteins in Cervical Cancer

PubMed Central

Arellano-Ortiz, Ana L.; Salcedo-Vargas, Mauricio; Vargas-Requena, Claudia L.; López-Díaz, José A.; De la Mora-Covarrubias, Antonio; Silva-Espinoza, Juan C.; Jiménez-Vega, Florinda

2016-01-01

This study determined the methylation status of cellular retinoic acid-binding protein (CRABP) gene promoters and associated them with demographic characteristics, habits, and the presence of human papilloma virus (HPV) in patients with cervical cancer (CC), low and high squamous intraepithelial lesions, and no intraepithelial lesion. Women (n = 158) were selected from the Colposcopy Clinic of Sanitary Jurisdiction II in Ciudad Juarez, Chihuahua, Mexico. Demographic characteristics and habit information were collected. Cervical biopsy and endocervical scraping were used to determine methylation in promoter regions by methylation-specific polymerase chain reaction technique. We found hemi-methylation patterns in the promoter regions of CRABP1 and CRABP2; there was 28.5% hemi-methylation in CRABP1 and 7.0% in that of CRABP2. Methylation in CRABP1 was associated with age (≥35 years, P = 0.002), family history of cancer (P = 0.032), the presence of HPV-16 (P = 0.013), and no alcohol intake (P = 0.035). These epigenetic changes could be involved in the CC process, and CRABP1 has the potential to be a predictive molecular marker of retinoid therapy response. PMID:27867303

[Abnormal expression of genes that regulate retinoid metabolism and signaling in non-small-cell lung cancer].

PubMed

Kuznetsova, E S; Zinovieva, O L; Oparina, N Yu; Prokofjeva, M M; Spirin, P V; Favorskaya, I A; Zborovskaya, I B; Lisitsyn, N A; Prassolov, V S; Mashkova, T D

2016-01-01

Retinoids are signaling molecules that control a wide variety of cellular processes and possess antitumor activity. This work presents a comprehensive description of changes in the expression of 23 genes that regulate retinoid metabolism and signaling in non-small-cell lung cancer tumors compared to adjacent normal tissues obtained using RT-PCR. Even at early stages of malignant transformation, a significant decrease in ADH1B, ADH3, RDHL, and RALDH1 mRNA levels was observed in 82, 79, 73, and 64% of tumor specimens, respectively, and a considerable increase in AKR1B10 mRNA content was observed in 80% of tumors. Dramatic changes in the levels of these mRNAs can impair the synthesis of all-trans retinoic acid, a key natural regulatory retinoid. Apart from that, it was found that mRNA levels of nuclear retinoid receptor genes RXRγ, RARα, RXRα, and gene RDH11 were significantly decreased in 80, 67, 57, and 66% of tumor specimens, respectively. Thus, neoplastic transformation of lung tissue cells is accompanied with deregulated expression of key genes of retinoid metabolism and function.

Synergistic effects of acyclic retinoid and OSI-461 on growth inhibition and gene expression in human hepatoma cells.

PubMed

Shimizu, Masahito; Suzui, Masumi; Deguchi, Atsuko; Lim, Jin T E; Xiao, Danhua; Hayes, Julia H; Papadopoulos, Kyriakos P; Weinstein, I Bernard

2004-10-01

Hepatoma is one of the most frequently occurring cancers worldwide. However, effective chemotherapeutic agents for this disease have not been developed. Acyclic retinoid, a novel synthetic retinoid, can reduce the incidence of postsurgical recurrence of hepatoma and improve the survival rate. OSI-461, a potent derivative of exisulind, can increase intracellular levels of cyclic GMP, which leads to activation of protein kinase G and induction of apoptosis in cancer cells. In the present study, we examined the combined effects of acyclic retinoid plus OSI-461 in the HepG2 human hepatoma cell line. We found that the combination of as little as 1.0 micromol/L acyclic retinoid and 0.01 micromol/L OSI-461 exerted synergistic inhibition of the growth of HepG2 cells. Combined treatment with low concentrations of these two agents also acted synergistically to induce apoptosis in HepG2 cells through induction of Bax and Apaf-1, reduction of Bcl-2 and Bcl-xL, and activation of caspase-3, -8, and -9. OSI-461 enhanced the G0-G1 arrest caused by acyclic retinoid, and the combination of these agents caused a synergistic decrease in the levels of expression of cyclin D1 protein and mRNA, inhibited cyclin D1 promoter activity, decreased the level of hyperphosphorylated forms of the Rb protein, induced increased cellular levels of the p21(CIP1) protein and mRNA, and stimulated p21(CIP1) promoter activity. Moreover, OSI-461 enhanced the ability of acyclic retinoid to induce increased cellular levels of retinoic acid receptor beta and to stimulate retinoic acid response element-chloramphenicol acetyltransferase activity. A hypothetical model involving concerted effects on p21(CIP1) and retinoic acid receptor beta expression is proposed to explain these synergistic effects. Our results suggest that the combination of acyclic retinoid plus OSI-461 might be an effective regimen for the chemoprevention and chemotherapy of human hepatoma and possibly other malignancies.

Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

PubMed Central

Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

2017-01-01

Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

Ocular immunology in equine recurrent uveitis.

PubMed

Deeg, Cornelia A

2008-09-01

Equine recurrent uveitis (ERU) is a disease with high prevalence and relevance for the equine population, since it results in blindness. Over the last decade, important advancements have been made in our understanding of the underlying immune responses in this disease. ERU is mediated by an autoaggressive Th1 response directed against several retinal proteins. Interphotoreceptor-retinoid binding protein (IRBP) and cellular retinaldehyde-binding protein (CRALBP) are capable to induce ERU-like disease in experimental horses, with the unique possibility to activate relapses in a well-defined manner. Further, proteomic evidence now suggests that retinal Mueller glial cells (RMG) may play a fatal role in uveitic disease progression by directly triggering inflammation processes through the expression and secretion of interferon-gamma. Ongoing relapses in blind eyes can be associated with stable expression of the major autoantigens in ERU retinas. This review briefly summarizes the most significant developments in uveitis immune response research.

The Acyclic Retinoid Peretinoin Inhibits Hepatitis C Virus Replication and Infectious Virus Release in Vitro

NASA Astrophysics Data System (ADS)

Shimakami, Tetsuro; Honda, Masao; Shirasaki, Takayoshi; Takabatake, Riuta; Liu, Fanwei; Murai, Kazuhisa; Shiomoto, Takayuki; Funaki, Masaya; Yamane, Daisuke; Murakami, Seishi; Lemon, Stanley M.; Kaneko, Shuichi

2014-04-01

Clinical studies suggest that the oral acyclic retinoid Peretinoin may reduce the recurrence of hepatocellular carcinoma (HCC) following surgical ablation of primary tumours. Since hepatitis C virus (HCV) infection is a major cause of HCC, we assessed whether Peretinoin and other retinoids have any effect on HCV infection. For this purpose, we measured the effects of several retinoids on the replication of genotype 1a, 1b, and 2a HCV in vitro. Peretinoin inhibited RNA replication for all genotypes and showed the strongest antiviral effect among the retinoids tested. Furthermore, it reduced infectious virus release by 80-90% without affecting virus assembly. These effects could be due to reduced signalling from lipid droplets, triglyceride abundance, and the expression of mature sterol regulatory element-binding protein 1c and fatty acid synthase. These negative effects of Peretinoin on HCV infection may be beneficial in addition to its potential for HCC chemoprevention in HCV-infected patients.

The interphotoreceptor retinoid binding protein gene in therian mammals: implications for higher level relationships and evidence for loss of function in the marsupial mole.

PubMed

Springer, M S; Burk, A; Kavanagh, J R; Waddell, V G; Stanhope, M J

1997-12-09

The subclass Theria of Mammalia includes marsupials (infraclass Metatheria) and placentals (infraclass Eutheria). Within each group, interordinal relationships remain unclear. One limitation of many studies is incomplete ordinal representation. Here, we analyze DNA sequences for part of exon 1 of the interphotoreceptor retinoid binding protein gene, including 10 that are newly reported, for representatives of all therian orders. Among placentals, the most robust clades are Cetartiodactyla, Paenungulata, and an expanded African clade that includes paenungulates, tubulidentates, and macroscelideans. Anagalida, Archonta, Altungulata, Hyracoidea + Perissodactyla, Ungulata, and the "flying primate" hypothesis are rejected by statistical tests. Among marsupials, the most robust clade includes all orders except Didelphimorphia. The phylogenetic placement of the monito del monte and the marsupial mole remains unclear. However, the marsupial mole sequence contains three frameshift indels and numerous stop codons in all three reading frames. Given that the interphotoreceptor retinoid binding protein gene is a single-copy gene that functions in the visual cycle and that the marsupial mole is blind with degenerate eyes, this finding suggests that phenotypic degeneration of the eyes is accompanied by parallel changes at the molecular level as a result of relaxed selective constraints.

Exploring (novel) gene expression during retinoid-induced maturation and cell death of acute promyelocytic leukemia.

PubMed

Benoit, G R; Tong, J H; Balajthy, Z; Lanotte, M

2001-01-01

During recent years, reports have shown that biological responses of acute promyelocytic leukemia (APL) cells to retinoids are more complex than initially envisioned. PML-RARalpha chimeric protein disturbs various biological processes such as cell proliferation, differentiation, and apoptosis. The distinct biological programs that regulate these processes stem from specific transcriptional activation of distinct (but overlapping) sets of genes. These programs are sometimes mutually exclusive and depend on whether the signals are delivered by RAR or RXR agonists. Furthermore, evidence that retinoid nuclear signaling by retinoid, on its own, is not enough to trigger these cellular responses is rapidly accumulating. Indeed, work with NB4 cells show that the fate of APL cells treated by retinoid depends on complex signaling cross-talk. Elucidation of the sequence of events and cascades of transcriptional regulation necessary for APL cell maturation will be an additional tool with which to further improve therapy by retinoids. In this task, the classical techniques used to analyze gene expression have proved time consuming, and their yield has been limited. Global analyses of the APL cell transcriptome are needed. We review the technical approaches currently available (differential display, complementary DNA microarrays), to identify novel genes involved in the determination of cell fate.

Vitamin A and Retinoids as Mitochondrial Toxicants

PubMed Central

de Oliveira, Marcos Roberto

2015-01-01

Vitamin A and its derivatives, the retinoids, are micronutrient necessary for the human diet in order to maintain several cellular functions from human development to adulthood and also through aging. Furthermore, vitamin A and retinoids are utilized pharmacologically in the treatment of some diseases, as, for instance, dermatological disturbances and some types of cancer. In spite of being an essential micronutrient with clinical application, vitamin A exerts several toxic effects regarding redox environment and mitochondrial function. Moreover, decreased life quality and increased mortality rates among vitamin A supplements users have been reported. However, the exact mechanism by which vitamin A elicits its deleterious effects is not clear yet. In this review, the role of mitochondrial dysfunction in the mechanism of vitamin A-induced toxicity is discussed. PMID:26078802

Synergistic Activation of Steroidogenic Acute Regulatory Protein Expression and Steroid Biosynthesis by Retinoids: Involvement of cAMP/PKA Signaling

PubMed Central

Manna, Pulak R.; Slominski, Andrzej T.; King, Steven R.; Stetson, Cloyce L.

2014-01-01

Both retinoic acid receptors (RARs) and retinoid X receptors (RXRs) mediate the action of retinoids that play important roles in reproductive development and function, as well as steroidogenesis. Regulation of steroid biosynthesis is principally mediated by the steroidogenic acute regulatory protein (StAR); however, the modes of action of retinoids in the regulation of steroidogenesis remain obscure. In this study we demonstrate that all-trans retinoic acid (atRA) enhances StAR expression, but not its phosphorylation (P-StAR), and progesterone production in MA-10 mouse Leydig cells. Activation of the protein kinase A (PKA) cascade, by dibutyrl-cAMP or type I/II PKA analogs, markedly increased retinoid-responsive StAR, P-StAR, and steroid levels. Targeted silencing of endogenous RARα and RXRα, with small interfering RNAs, resulted in decreases in 9-cis RA-stimulated StAR and progesterone levels. Truncation of and mutational alterations in the 5′-flanking region of the StAR gene demonstrated the importance of the −254/−1-bp region in retinoid responsiveness. An oligonucleotide probe encompassing an RXR/liver X receptor recognition motif, located within the −254/−1-bp region, specifically bound MA-10 nuclear proteins and in vitro transcribed/translated RXRα and RARα in EMSAs. Transcription of the StAR gene in response to atRA and dibutyrl-cAMP was influenced by several factors, its up-regulation being dependent on phosphorylation of cAMP response-element binding protein (CREB). Chromatin immunoprecipitation studies revealed the association of phosphorylation of CREB, CREB binding protein, RXRα, and RARα to the StAR promoter. Further studies elucidated that hormone-sensitive lipase plays an important role in atRA-mediated regulation of the steroidogenic response that involves liver X receptor signaling. These findings delineate the molecular events by which retinoids influence cAMP/PKA signaling and provide additional and novel insight into the regulation of StAR expression and steroidogenesis in mouse Leydig cells. PMID:24265455

Identification of a Novel Non-retinoid Pan Inverse Agonist of the Retinoic Acid Receptors

PubMed Central

Busby, Scott A.; Kumar, Naresh; Kuruvilla, Dana S.; Istrate, Monica A.; Conkright, Juliana J.; Wang, Yongjun; Kamenecka, Theodore M.; Cameron, Michael D.; Roush, William R.; Burris, Thomas P.; Griffin, Patrick R.

2011-01-01

Retinoids are potent forms of vitamin A and are involved in a broad range of physiological processes and the pharmacological effects of retinoids are primarily mediated by the retinoic acid receptors (RARs) and the retinoid X receptors (RXRs). Several natural and synthetic RAR modulators have proven to be clinically useful for a number of therapeutic indications including cancer, psoriasis, and diabetes. Unfortunately, these agents lead to a number of significant side effects. Most synthetic retinoid ligands are based on the retinoid scaffold and thus have similarities to the natural ligand with all previously disclosed RAR ligands having a carboxylic acid that makes a critical ionic bridge within the ligand binding domain of the receptors. The potential therapeutic value offered from RAR modulation provides the impetus to identify novel ligands based on unique scaffolds that may offer improved toxicity and pharmacokinetic profiles. Here we describe the identification of an atypical RAR inverse agonist that represents the first non-acid, non-retinoid direct modulator of RAR receptor subfamily. SR-0065 functions as a pan-RAR inverse agonist suppressing the basal activity of RARα, RARβ, and RARγ as well as inhibiting agonist induced RAR activity. SR-0065 treatment enhanced receptor interaction with a peptide representative of the corepressor SMRT and in cells SR-0065 enhances recruitment of SMRT to RARγ. The acid form of SR-0065, SR-1758, was inactive in all assays. Thus, SR-0065 represents a new class of non-acid, non-retinoid RAR modulator that may be used as a point to initiate development of improved RAR-targeted drugs. PMID:21381756

The interphotoreceptor retinoid binding protein gene in therian mammals: Implications for higher level relationships and evidence for loss of function in the marsupial mole

PubMed Central

Springer, Mark S.; Burk, Angela; Kavanagh, John R.; Waddell, Victor G.; Stanhope, Michael J.

1997-01-01

The subclass Theria of Mammalia includes marsupials (infraclass Metatheria) and placentals (infraclass Eutheria). Within each group, interordinal relationships remain unclear. One limitation of many studies is incomplete ordinal representation. Here, we analyze DNA sequences for part of exon 1 of the interphotoreceptor retinoid binding protein gene, including 10 that are newly reported, for representatives of all therian orders. Among placentals, the most robust clades are Cetartiodactyla, Paenungulata, and an expanded African clade that includes paenungulates, tubulidentates, and macroscelideans. Anagalida, Archonta, Altungulata, Hyracoidea + Perissodactyla, Ungulata, and the “flying primate” hypothesis are rejected by statistical tests. Among marsupials, the most robust clade includes all orders except Didelphimorphia. The phylogenetic placement of the monito del monte and the marsupial mole remains unclear. However, the marsupial mole sequence contains three frameshift indels and numerous stop codons in all three reading frames. Given that the interphotoreceptor retinoid binding protein gene is a single-copy gene that functions in the visual cycle and that the marsupial mole is blind with degenerate eyes, this finding suggests that phenotypic degeneration of the eyes is accompanied by parallel changes at the molecular level as a result of relaxed selective constraints. PMID:9391099

Activation of the CRABPII/RAR pathway by curcumin induces retinoic acid mediated apoptosis in retinoic acid resistant breast cancer cells

PubMed Central

Thulasiraman, Padmamalini; Garriga, Galen; Danthuluri, Veena; McAndrews, Daniel J.; Mohiuddin, Imran Q.

2017-01-01

Due to the anti-proliferative and anti-apoptotic effects of retinoic acid (RA), this hormone has emerged as a target for several diseases, including cancer. However, development of retinoid resistance is a critical issue and efforts to understand the retinoid signaling pathway may identify useful biomarkers for future clinical trials. Apoptotic responses of RA are exhibited through the cellular RA-binding protein II (CRABPII)/retinoic acid receptor (RAR) signaling cascade. Delivery of RA to RAR by CRABPII enhances the transcriptional activity of genes involved in cell death and cell cycle arrest. The purpose of this study was to investigate the role of curcumin in sensitizing RA-resistant triple-negative breast cancer (TNBC) cells to RA-mediated apoptosis. We provide evidence that curcumin upregulates the expression of CRABPII, RARβ and RARγ in two different TNBC cell lines. Co-treatment of the cells with curcumin and RA results in increased apoptosis as demonstrated by elevated cleavage of poly(ADP-ribose) polymerase and cleaved caspase-9. Additionally, silencing CRABPII reverses curcumin sensitization of TNBC cells to the apoptotic inducing effects of RA. These findings provide mechanistic insights into sensitizing TNBC cells to RA-mediated cell death by curcumin-induced upregulation of the CRABPII/RAR pathway. PMID:28350049

Folding propensity of intrinsically disordered proteins by osmotic stress

DOE PAGES

Mansouri, Amanda L.; Grese, Laura N.; Rowe, Erica L.; ...

2016-10-11

Proteins imparted with intrinsic disorder conduct a range of essential cellular functions. To better understand the folding and hydration properties of intrinsically disordered proteins (IDPs), we used osmotic stress to induce conformational changes in nuclear co-activator binding domain (NCBD) and activator for thyroid hormone and retinoid receptor (ACTR). Osmotic stress was applied by the addition of small and polymeric osmolytes, where we discovered that water contributions to NCBD folding always exceeded those for ACTR. Both NCBD and ACTR were found to gain a-helical structure with increasing osmotic stress, consistent with their folding upon NCBD/ACTR complex formation. Using small-angle neutron scatteringmore » (SANS), we further characterized NCBD structural changes with the osmolyte ethylene glycol. Here a large reduction in overall size initially occurred before substantial secondary structural change. In conclusion, by focusing on folding propensity, and linked hydration changes, we uncover new insights that may be important for how IDP folding contributes to binding.« less

Folding propensity of intrinsically disordered proteins by osmotic stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mansouri, Amanda L.; Grese, Laura N.; Rowe, Erica L.

Proteins imparted with intrinsic disorder conduct a range of essential cellular functions. To better understand the folding and hydration properties of intrinsically disordered proteins (IDPs), we used osmotic stress to induce conformational changes in nuclear co-activator binding domain (NCBD) and activator for thyroid hormone and retinoid receptor (ACTR). Osmotic stress was applied by the addition of small and polymeric osmolytes, where we discovered that water contributions to NCBD folding always exceeded those for ACTR. Both NCBD and ACTR were found to gain a-helical structure with increasing osmotic stress, consistent with their folding upon NCBD/ACTR complex formation. Using small-angle neutron scatteringmore » (SANS), we further characterized NCBD structural changes with the osmolyte ethylene glycol. Here a large reduction in overall size initially occurred before substantial secondary structural change. In conclusion, by focusing on folding propensity, and linked hydration changes, we uncover new insights that may be important for how IDP folding contributes to binding.« less

The action of a dietary retinoid on gene expression and cancer induction in electron-irradiated rat skin

NASA Technical Reports Server (NTRS)

Burns, Fredric J.; Chen, Shuaili; Xu, Guijuan; Wu, Feng; Tang, Moon-Shong

2002-01-01

Current models of radiation carcinogenesis generally assume that the DNA is damaged in a variety of ways by the radiation and that subsequent cell divisions contribute to the conversion of the damage to heritable mutations. Cancer may seem complex and intractable, but its complexity provides multiple opportunities for preventive interventions. Mitotic inhibitors are among the strongest cancer preventive agents, not only slowing the growth rate of preneoplasias but also increasing the fidelity of DNA repair processes. Ionizing radiation, including electrons, is a strong inducer of cancer in rat skin, and dietary retinoids have shown potent cancer preventive activity in the same system. A non-toxic dietary dose of retinyl acetate altered gene expression levels 24 hours after electron irradiation of rat skin. Of the 8740 genes on an Affymetrix rat expression array, the radiation significantly (5 fold or higher) altered 188, while the retinoid altered 231, including 16 radiation-altered genes that were reversely altered. While radiation strongly affected the expression of stress response, immune/inflammation and nucleic acid metabolism genes, the retinoid most strongly affected proliferation-related genes, including some significant reversals, such as, keratin 14, retinol binding protein, and calcium binding proteins. These results point to reversal of proliferation-relevant genes as a likely basis for the anti-radiogenic effects of dietary retinyl acetate.

RXR function requires binding to an endogenous terpenoid ligand

USDA-ARS?s Scientific Manuscript database

The issue of whether the nuclear receptor RXR must bind to an endogenous, nanomolar affinity ligand in order to perform its natural function is still unsettled (1). On the basis of our previous studies establishing that the Drosophilamelanogaster ortholog of the retinoid X receptor ("ultraspiracle,"...

Cone outer segment and Müller microvilli pericellular matrices provide binding domains for interphotoreceptor retinoid-binding protein (IRBP).

PubMed

Garlipp, Mary Alice; Gonzalez-Fernandez, Federico

2013-08-01

The close packing of vertebrate photoreceptors presents a challenge to the exchange of molecules between the outer segments, retinal pigmented epithelium (RPE), and Müller glia. An extracellular hyaluronan scaffold separates these cells while soluble interphotoreceptor matrix (IPM) proteins traffic visual cycle retinoids, fatty acids, and other molecules between them. In the IPM, retinoids and fatty acids are carried by interphotoreceptor retinoid-binding protein (IRBP). The fact that much of the retina's IRBP can be extracted by saline wash has led to the notion that IRBP does not bind to the retina, but freely distributes itself within the subretinal space. In this study, we challenge this idea by asking if there are specialized IPM domains that bind IRBP, perhaps facilitating its ability to target delivery/uptake of its ligands. Xenopus is an ideal animal model to study the role of the IPM in RPE-photoreceptor interactions. Here, we took advantage of the large size of its photoreceptors, ability to detach the retina in light, sustainability of the retina in short term organ culture, and the availability of recombinant full-length Xenopus IRBP and antisera directed against Xenopus IRBP. We compared the distribution of wash resistant native IRBP, and that of IRBP-Alexa 647 binding in Xenopus retina. IRBP and cone opsin were localized using anti-Xenopus IRBP serum, and monoclonal COS-1 respectively. Cone matrix sheath proteoglycans were localized with wheat germ agglutinin (WGA), and diffuse IPM proteoglycans with peanut agglutinin (PNA). Wholemounts and frozen sections were compared by immunofluorescence from retinas detached under Ringer's followed by additional washes, or detached directly under 4% paraformaldehyde without Ringer's wash. Undetached Lowicryl embedded retinas were subjected to IRBP immunogold electron microscopy (EM). Immunogold labeled a diffuse network of filamentous structures, and a separate distinct flocculant material directly coating the outer segments, filling the rod periciliary ridge, and associated with Müller microvilli. By immunofluorescence, Ringer's wash removed most of the diffuse IRBP, but not that coating the outer segments. IRBP-Alexa 647 bound to the cone outer segments and Müller villi region, and comparably less to rod outer segments. Co-incubation with unlabeled IRBP markedly reduced this binding; ovalbumin-Alexa 647 and Alexa 647 dye alone showed no binding. Our data suggest that the pericellular matrix of the cone outer segments and Müller microvilli provide specialized domains that facilitate IRBP's functions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Singlet Oxygen and Free Radical Reactions of Retinoids and Carotenoids—A Review

PubMed Central

Truscott, T. George

2018-01-01

We report on studies of reactions of singlet oxygen with carotenoids and retinoids and a range of free radical studies on carotenoids and retinoids with emphasis on recent work, dietary carotenoids and the role of oxygen in biological processes. Many previous reviews are cited and updated together with new data not previously reviewed. The review does not deal with computational studies but the emphasis is on laboratory-based results. We contrast the ease of study of both singlet oxygen and polyene radical cations compared to neutral radicals. Of particular interest is the switch from anti- to pro-oxidant behavior of a carotenoid with change of oxygen concentration: results for lycopene in a cellular model system show total protection of the human cells studied at zero oxygen concentration, but zero protection at 100% oxygen concentration. PMID:29301252

Retinoids and Retinal Diseases

PubMed Central

Kiser, Philip D.; Palczewski, Krzysztof

2016-01-01

Recent progress in molecular understanding of the retinoid cycle in mammalian retina stems from painstaking biochemical reconstitution studies supported by natural or engineered animal models with known genetic lesions and studies of humans with specific genetic blinding diseases. Structural and membrane biology have been used to detect critical retinal enzymes and proteins and their substrates and ligands, placing them in a cellular context. These studies have been supplemented by analytical chemistry methods that have identified small molecules by their spectral characteristics, often in conjunction with the evaluation of models of animal retinal disease. It is from this background that rational therapeutic interventions to correct genetic defects or environmental insults are identified. Thus, most presently accepted modulators of the retinoid cycle already have demonstrated promising results in animal models of retinal degeneration. These encouraging signs indicate that some human blinding diseases can be alleviated by pharmacological interventions. PMID:27917399

Differentiation of human SH-SY5Y neuroblastoma cells by all-trans retinoic acid activates the interleukin-18 system.

PubMed

Sallmon, Hannes; Hoene, Victoria; Weber, Sven C; Dame, Christof

2010-02-01

The clinical prognosis of children with high-stage neuroblastoma is still poor. Therapeutic approaches include surgery and cellular differentiation by retinoic acid, but also experimental interleukin-based immune modulation. However, the molecular mechanisms of all-trans retinoic acid (ATRA)-induced differentiation of neuroblastoma cells are incompletely understood. Herein, we examined the effect of ATRA on the activity of the interleukin-18 (IL-18) system in human SH-SY5Y neuroblastoma cells. It is shown that SH-SY5Y cells express IL-18 receptor (IL-18R) and the secreted antagonist IL-18-binding protein (IL-18BP), but no IL-18. SH-SY5Y cells are highly sensitive to ATRA treatment and react by cellular differentiation from a neuroblastic toward a more neuronal phenotype. This was associated with induction of IL-18 and reduction of IL-18BP expression, while IL-18R expression remained stable. Thereby, we identified the IL-18 system as a novel target of ATRA in neuroblastoma cells that might contribute to the therapeutic properties of retinoids in treatment of neuroblastoma.

Retinoid quantification by HPLC/MS(n)

NASA Technical Reports Server (NTRS)

McCaffery, Peter; Evans, James; Koul, Omanand; Volpert, Amy; Reid, Kevin; Ullman, M. David

2002-01-01

Retinoic acid (RA) mediates most of the biological effects of vitamin A that are essential for vertebrate survival. It acts through binding to receptors that belong to the nuclear receptor transcription factor superfamily (Mangelsdorf et al. 1994). It is also a highly potent vertebrate teratogen. To determine the function and effects of endogenous and exogenous RA, it is important to have a highly specific, sensitive, accurate, and precise analytical procedure. Current analyses of RA and other retinoids are labor intensive, of poor sensitivity, have limited specificity, or require compatibility with RA reporter cell lines (Chen et al. 1995. BIOCHEM: Pharmacol. 50: 1257-1264; Creech Kraft et al. 1994. BIOCHEM: J. 301: 111-119; Lanvers et al. 1996. J. Chromatogr. B Biomed. Appl. 685: 233-240; Maden et al. 1998. DEVELOPMENT: 125: 4133-4144; Wagner et al. 1992. DEVELOPMENT: 116: 55-66). This paper describes an HPLC/mass spectrometry/mass spectrometry product ion scan (HPLC/MS(n)) procedure for the analysis of retinoids that employs atmospheric pressure chemical ionization MS. The retinoids are separated by normal-phase column chromatography with a linear hexane-isopropanol-dioxane gradient. Each retinoid is detected by a unique series of MS(n) functions set at optimal collision-induced dissociation energy (30% to 32%) for all MS(n) steps. The scan events are divided into three segments, based on HPLC elution order, to maximize the mass spectrometer duty cycle. The all-trans, 9-cis, and 13-cis RA isomers are separated, if desired, by an isocratic hexane-dioxane-isopropanol mobile phase. This paper describes an HPLC/MS(n) procedure possessing high sensitivity and specificity for retinoids.

Retinoid Receptors in Bone and Their Role in Bone Remodeling

PubMed Central

Henning, Petra; Conaway, H. Herschel; Lerner, Ulf H.

2015-01-01

Vitamin A (retinol) is a necessary and important constituent of the body which is provided by food intake of retinyl esters and carotenoids. Vitamin A is known best for being important for vision, but in addition to the eye, vitamin A is necessary in numerous other organs in the body, including the skeleton. Vitamin A is converted to an active compound, all-trans-retinoic acid (ATRA), which is responsible for most of its biological actions. ATRA binds to intracellular nuclear receptors called retinoic acid receptors (RARα, RARβ, RARγ). RARs and closely related retinoid X receptors (RXRα, RXRβ, RXRγ) form heterodimers which bind to DNA and function as ligand-activated transcription factors. It has been known for many years that hypervitaminosis A promotes skeleton fragility by increasing osteoclast formation and decreasing cortical bone mass. Some epidemiological studies have suggested that increased intake of vitamin A and increased serum levels of retinoids may decrease bone mineral density and increase fracture rate, but the literature on this is not conclusive. The current review summarizes how vitamin A is taken up by the intestine, metabolized, stored in the liver, and processed to ATRA. ATRA’s effects on formation and activity of osteoclasts and osteoblasts are outlined, and a summary of clinical data pertaining to vitamin A and bone is presented. PMID:25814978

The Retinoid X Receptors and Their Ligands

PubMed Central

Dawson, Marcia I.; Xia, Zebin

2014-01-01

This chapter presents an overview of the current status of studies on the structural and molecular biology of the retinoid X receptor subtypes α, β, and γ (RXRs, NR2B1–3), their nuclear and cytoplasmic functions, post-transcriptional processing, and recently reported ligands. Points of interest are the different changes in the ligand-binding pocket induced by variously shaped agonists, the communication of the ligand–bound pocket with the coactivator binding surface and the heterodimerization interface, and recently identified ligands that are natural products, those that function as environmental toxins or drugs that had been originally designed to interact with other targets, as well as those that were deliberately designed as RXR-selective transcriptional agonists, synergists, or antagonists. Of these synthetic ligands, the general trend in design appears to be away from fully aromatic rigid structures to those containing partial elements of the flexible tetraene side chain of 9-cis-retinoic acid. PMID:22020178

Determination of highly protein bound drugs in plasma using high-performance liquid chromatography and column switching, exemplified by the retinoids.

PubMed

Wyss, R; Bucheli, F

1988-12-02

During method development for the determination of either isotretinoin, tretinoin and their 4-oxo-metabolites, or etretinate, acitretin and 13-cis-acitretin in plasma using high-performance liquid chromatography and column switching, recovery problems arose, when undiluted plasma samples were injected directly onto the precolumn. These recovery problems may be due to the strong binding of the retinoids to different plasma proteins. Measures to overcome this strong protein binding, such as variation of the injection solution composition and the purge mobile phase, were systematically investigated. Best recoveries were obtained by diluting of plasma with 9 mM sodium hydroxide-acetonitrile (8:2, v/v) and protein precipitation with ethanol for the isotretinoin and etretinate series, respectively, in combination with the use of a purge mobile phase containing ammonium acetate and 10-20% acetonitrile. Less effective was the use of a longer precolumn or heating of the precolumn.

Vitamin D receptor–retinoid X receptor heterodimer signaling regulates oligodendrocyte progenitor cell differentiation

PubMed Central

de la Fuente, Alerie Guzman; Errea, Oihana; van Wijngaarden, Peter; Gonzalez, Ginez A.; Kerninon, Christophe; Jarjour, Andrew A.; Lewis, Hilary J.; Jones, Clare A.; Nait-Oumesmar, Brahim; Zhao, Chao; Huang, Jeffrey K.; ffrench-Constant, Charles

2015-01-01

The mechanisms regulating differentiation of oligodendrocyte (OLG) progenitor cells (OPCs) into mature OLGs are key to understanding myelination and remyelination. Signaling via the retinoid X receptor γ (RXR-γ) has been shown to be a positive regulator of OPC differentiation. However, the nuclear receptor (NR) binding partner of RXR-γ has not been established. In this study we show that RXR-γ binds to several NRs in OPCs and OLGs, one of which is vitamin D receptor (VDR). Using pharmacological and knockdown approaches we show that RXR–VDR signaling induces OPC differentiation and that VDR agonist vitamin D enhances OPC differentiation. We also show expression of VDR in OLG lineage cells in multiple sclerosis. Our data reveal a role for vitamin D in the regenerative component of demyelinating disease and identify a new target for remyelination medicines. PMID:26644513

Enzymology of retinoic acid biosynthesis and degradation

PubMed Central

Kedishvili, Natalia Y.

2013-01-01

All-trans-retinoic acid is a biologically active derivative of vitamin A that regulates numerous physiological processes. The concentration of retinoic acid in the cells is tightly regulated, but the exact mechanisms responsible for this regulation are not completely understood, largely because the enzymes involved in the biosynthesis of retinoic acid have not been fully defined. Recent studies using in vitro and in vivo models suggest that several members of the short-chain dehydrogenase/reductase superfamily of proteins are essential for retinoic acid biosynthesis and the maintenance of retinoic acid homeostasis. However, the exact roles of some of these recently identified enzymes are yet to be characterized. The properties of the known contributors to retinoid metabolism have now been better defined and allow for more detailed understanding of their interactions with retinoid-binding proteins and other retinoid enzymes. At the same time, further studies are needed to clarify the interactions between the cytoplasmic and membrane-bound proteins involved in the processing of hydrophobic retinoid metabolites. This review summarizes current knowledge about the roles of various biosynthetic and catabolic enzymes in the regulation of retinoic acid homeostasis and outlines the remaining questions in the field. PMID:23630397

Increased frequency of anti-retina antibodies in asymptomatic patients with chronic t. gondii infection

PubMed Central

Cursino, Sylvia Regina Temer; da Costa, Thaís Boccia; Yamamoto, Joyce Hisae; Meireles, Luciana Regina; Silva, Maria Antonieta Longo Galvão; de Andrade Junior, Heitor Franco

2010-01-01

PURPOSE: To search for anti-retina antibodies that serve as markers for eye disease in uveitis. MATERIALS AND METHODS: Stored sera from patients with uveitis, ocular toxoplasmosis (n = 30) and non-infectious, immune-mediated uveitis (n = 50) and from asymptomatic individuals who were positive (n = 250) and negative (n = 250) for anti-Toxoplasma antibodies were tested. Serum anti-retina IgG was detected by an optimized ELISA using a solid-phase whole human retina extract, bovine S-antigen or interphotoreceptor retinoid-binding protein. RESULTS: Uveitis patients showed a higher mean reactivity to whole human retina extract, interphotoreceptor retinoid-binding protein and S-antigen in comparison to the asymptomatic population. These findings were independent of the uveitis origin and allowed the determination of the lower anti-retina antibody cut-off for the three antigens. Asymptomatic anti-Toxoplasma serum-positive individuals showed a higher frequency of anti-human whole retina extract antibodies in comparison to asymptomatic anti-Toxoplasma serum-negative patients. The bovine S-antigen and interphotoreceptor retinoid-binding protein ELISAs also showed a higher mean reactivity in the uveitis groups compared to the asymptomatic group, but the observed reactivities were lower and overlapped without discrimination. CONCLUSION: We detected higher levels of anti-retina antibodies in uveitis patients and in a small fraction of asymptomatic patients with chronic toxoplasmosis. The presence of anti-retina antibodies in sera might be a marker of eye disease in asymptomatic patients, especially when whole human retina extract is used in a solid-phase ELISA. PMID:21120306

Comparison of the ligand binding properties of two homologous rat apocellular retinol-binding proteins expressed in Escherichia coli.

PubMed

Levin, M S; Locke, B; Yang, N C; Li, E; Gordon, J I

1988-11-25

Cellular retinol-binding protein (CRBP) and cellular retinol-binding protein II (CRBP II) are 132-residue cytosolic proteins which have 56% amino acid sequence identity and bind all-trans-retinol as their endogenous ligand. They belong to a family of cytoplasmic proteins which have evolved to bind distinct hydrophobic ligands. Their patterns of tissue-specific and developmental regulation are distinct. We have compared the ligand binding properties of rat apo-CRBP and apo-CRBP II that have been expressed in Escherichia coli. Several observations indicate that the E. coli-derived apoproteins are structurally similar to the native rat proteins: they co-migrate on isoelectric focusing gels; and when complexed with all-trans-retinol, their absorption and excitation/emission spectra are nearly identical to those of the authentic rat holoproteins. Comparative lifetime and acrylamide quenching studies suggest that there are differences in the conformations of apo-CRBP and apo-CRBP II. The interaction of E. coli-derived apo-CRBP and apo-CRBP II with a variety of retinoids was analyzed using spectroscopic techniques. Both apoproteins formed high affinity complexes with all-trans-retinol (K'd approximately 10 nM). In direct binding assays, all-trans-retinal bound to both apoproteins (K'd approximately 50 nM for CRBP; K'd approximately 90 nM for CRBP II). However, all-trans-retinal could displace all-trans-retinol bound to CRBP II but not to CRBP. These observations suggests that there is a specific yet distinct interaction between these two proteins and all-trans-retinal. Apo-CRBP and apo-CRBP II did not demonstrate significant binding to either retinoic acid or methyl retinoate, an uncharged derivative of all-trans-retinoic acid. This indicates that the carboxymethyl group of methyl retinoate cannot be sterically accommodated in their binding pockets and that failure to bind retinoic acid probably is not simply due to the negative charge of its C-15 carboxylate group. Finally, neither all-trans-retinol nor retinoic acid bound to E. coli-derived rat intestinal fatty acid-binding protein, a homologous protein whose tertiary structure is known. Together, the data suggest that these three family members have acquired unique functional capabilities.

PREDICTING RETINOID RECEPTOR BINDING AFFINITY: COREPA-M APPLICATION

EPA Science Inventory

Retinoic acid and associated vitamin A derivatives comprise a class of endogenous hormones that activate different retinoic acid receptors RARs). Transcriptional events subsequent to this activation are key to controlling several aspects of vertebrate development. As such, identi...

Teratogenicity of isotretinoin revisited: species variation and the role of all-trans-retinoic acid.

PubMed

Nau, H

2001-11-01

This paper reviews the teratogenicity of isotretinoin in regard to aspects of species variation, toxicokinetics, and metabolism. Particular emphasis is given to the hypothesis that most effects of isotretinoin (13-cis-retinoic acid) are mediated by isomerization to the all-trans-retinoic acid. This mechanism of action would provide a basis for the understanding of species differences and the extrapolation of experimental results to the human situation and thus improve drug development. The insensitive species (rat, mouse) eliminate the drug rapidly through detoxification to the beta-glucuronide; also, placental transfer is limited in these species. On the other hand, in sensitive species (primates), the drug is predominantly metabolized to the active 13-cis-4-oxo-retinoic acid; placental transfer is more extensive here. The beta-glucuronides showed limited placental transfer in all species examined; these metabolites exhibited very low, if any, measurable concentrations in the human. The 13-cis-retinoic acid is not appreciably bound to cellular retinoid-binding proteins or nuclear receptors and exhibits low tissue distribution and placental transfer. Its access to the nucleus may be extensive. Because of the long half life of 13-cis-retinoic acid, continuous isomerization results in significant area under the concentration-time curve levels of all-trans-retinoic acid in the mouse, monkey and the human; the all-trans-retinoic acid formed is extensively distributed across the placenta and may be an important factor that contributes to the teratogenic potency of 13-cis-retinoic acid. Isomerization cannot explain the teratogenic effects of 13-cis-retinoic acid in the rat and rabbit. It is concluded that the high teratogenic activity of isotretinoin in sensitive species (human, monkey) is related to slow elimination of the 13-cis-isomer, to metabolism to the 4-oxo-derivative, to increased placental transfer, to continuous isomerization and significant exposure of the target tissue to all-trans-retinoic acid; and to lack of binding to cytoplasmic retinoid binding proteins that could possibly result in ready access to the nucleus.

Uptake of Dietary Retinoids at the Maternal-Fetal Barrier

PubMed Central

Wassef, Lesley; Quadro, Loredana

2011-01-01

Dietary retinoids (vitamin A and its derivatives) contribute to normal embryonic development. However, the mechanism(s) involved in the transfer of recently ingested vitamin A from mother to embryo is not fully understood. We investigated in vivo whether lipoprotein lipase (LPL) facilitates the placental uptake of dietary retinyl ester incorporated in chylomicrons and their remnants and its transfer to the embryo. We examined the effects of both genetic ablation (MCK-L0 mice) and pharmacological inhibition (P-407) of LPL by maintaining wild type and MCK-L0 mice on diets with different vitamin A content or administering them an oral gavage dose of [3H]retinol with or without P-407 treatment. We showed that LPL expressed in placenta facilitates uptake of retinoids by this organ and their transfer to the embryo, mainly through its catalytic activity. In addition, through its “bridging function,” LPL can mediate the acquisition of nascent chylomicrons by the placenta, although less efficiently. Quantitative real-time PCR and Western blot analysis showed that placental LPL acts in concert with LDL receptor and LRP1. Finally, by knocking out the retinol-binding protein (RBP) gene in the MCK-L0 background (MCK-L0-RBP−/− mice) we demonstrated that the placenta acquires dietary retinoids also via the maternal circulating RBP-retinol complex. RBP expressed in the placenta facilitate the transfer of postprandial retinoids across the placental layers toward the embryo. PMID:21795711

High level transactivation by a modified Bombyx ecdysone receptor in mammalian cells without exogenous retinoid X receptor

PubMed Central

Suhr, Steven T.; Gil, Elad B.; Senut, Marie-Claude; Gage, Fred H.

1998-01-01

Our studies of the Bombyx mori ecdysone receptor (BE) revealed that, unlike the Drosophila melanogaster ecdysone receptor (DE), treatment of BE with the ecdysone agonist tebufenozide stimulated high level transactivation in mammalian cells without adding an exogenous heterodimer partner. Gel mobility shift and transfection assays with both the ultraspiracle gene product (Usp) and retinoid X receptor heterodimer partners indicated that this property of BE stems from significantly augmented heterodimer complex formation and concomitant DNA binding. We have mapped this “gain of function” to determinants within the D and E domains of BE and demonstrated that, although the D domain determinant is sufficient for high affinity heterodimerization with Usp, both determinants are necessary for high affinity interaction with retinoid X receptor. Modified BE receptors alone used as replication-defective retroviruses potently stimulated separate “reporter” viruses in all cell types examined, suggesting that BE has potentially broad utility in the modulation of transgene expression in mammalian cells. PMID:9653129

Retinoid hyposignaling contributes to aging-related decline in hippocampal function in short-term/working memory organization and long-term declarative memory encoding in mice.

PubMed

Mingaud, Frédérique; Mormede, Cécile; Etchamendy, Nicole; Mons, Nicole; Niedergang, Betty; Wietrzych, Marta; Pallet, Véronique; Jaffard, Robert; Krezel, Wojciech; Higueret, Paul; Marighetto, Aline

2008-01-02

An increasing body of evidence indicates that the vitamin A metabolite retinoic acid (RA) plays a role in adult brain plasticity by activating gene transcription through nuclear receptors. Our previous studies in mice have shown that a moderate downregulation of retinoid-mediated transcription contributed to aging-related deficits in hippocampal long-term potentiation and long-term declarative memory (LTDM). Here, knock-out, pharmacological, and nutritional approaches were used in a series of radial-arm maze experiments with mice to further assess the hypothesis that retinoid-mediated nuclear events are causally involved in preferential degradation of hippocampal function in aging. Molecular and behavioral findings confirmed our hypothesis. First, a lifelong vitamin A supplementation, like short-term RA administration, was shown to counteract the aging-related hippocampal (but not striatal) hypoexpression of a plasticity-related retinoid target-gene, GAP43 (reverse transcription-PCR analyses, experiment 1), as well as short-term/working memory (STWM) deterioration seen particularly in organization demanding trials (STWM task, experiment 2). Second, using a two-stage paradigm of LTDM, we demonstrated that the vitamin A supplementation normalized memory encoding-induced recruitment of (hippocampo-prefrontal) declarative memory circuits, without affecting (striatal) procedural memory system activity in aged mice (Fos neuroimaging, experiment 3A) and alleviated their LTDM impairment (experiment 3B). Finally, we showed that (knock-out, experiment 4) RA receptor beta and retinoid X receptor gamma, known to be involved in STWM (Wietrzych et al., 2005), are also required for LTDM. Hence, aging-related retinoid signaling hypoexpression disrupts hippocampal cellular properties critically required for STWM organization and LTDM formation, and nutritional vitamin A supplementation represents a preventive strategy. These findings are discussed within current neurobiological perspectives questioning the historical consensus on STWM and LTDM system partition.

Clearance of PML/RARA-bound promoters suffice to initiate APL differentiation.

PubMed

Vitaliano-Prunier, Adeline; Halftermeyer, Juliane; Ablain, Julien; de Reynies, Aurélien; Peres, Laurent; Le Bras, Morgane; Metzger, Daniel; de Thé, Hugues

2014-12-11

PML/RARA, a potent transcriptional inhibitor of nuclear receptor signaling, represses myeloid differentiation genes and drives acute promyelocytic leukemia (APL). Association of the retinoid X receptor-α (RXRA) coreceptor to PML/RARA is required for transformation, with RXRA promoting its efficient DNA binding. APL is exquisitely sensitive to retinoic acid (RA) and arsenic trioxide (arsenic), which both trigger cell differentiation in vivo. Whereas RA elicits transcriptional activation of PML/RARA targets, how arsenic triggers differentiation remains unclear. Here we demonstrate that extinction of PML/RARA triggers terminal differentiation in vivo. Similarly, ablation of retinoid X receptors loosens PML/RARA DNA binding, inducing terminal differentiation of APL cells ex vivo or in vivo. RXRA sumoylation directly contributes to PML/RARA-dependent transformation ex vivo, presumably by enhancing transcriptional repression. Thus, APL differentiation is a default program triggered by clearance of PML/RARA-bound promoters, rather than obligatory active transcriptional activation, explaining how arsenic elicits APL maturation through PML/RARA degradation. © 2014 by The American Society of Hematology.

Effect of Lipid Peroxidation Products on the Activity of Human Retinol Dehydrogenase 12 (RDH12) and Retinoid Metabolism

PubMed Central

Lee, Seung-Ah; Belyaeva, Olga V.; Kedishvili, Natalia Y.

2008-01-01

SUMMARY Mutations in human Retinol Dehydrogenase 12 (RDH12) are known to cause photoreceptor cell death but the physiological function of RDH12 in photoreceptors remains poorly understood. In vitro, RDH12 recognizes both retinoids and medium-chain aldehydes as substrates. Our previous study suggested that RDH12 protects cells against toxic levels of retinaldehyde and retinoic acid [Lee et al., J. Biol. Chem. 282 (2007) 35621–35628]. Here, we investigated whether RDH12 can also protect cells against highly reactive medium-chain aldehydes. Analysis of cell survival demonstrated that RDH12 was protective against nonanal but not against 4-hydroxynonenal. At high concentrations, nonanal inhibited the activity of RDH12 towards retinaldehyde, suggesting that nonanal was metabolized by RDH12. 4-Hydroxynonenal did not inhibit the RDH12 retinaldehyde reductase activity, but it strongly inhibited the activities of lecithin:retinol acyl transferase and aldehyde dehydrogenase, resulting in decreased levels of retinyl esters and retinoic acid and accumulation of unesterified retinol. Thus, the results of this study showed that RDH12 is more effective in protection against retinaldehyde than against medium-chain aldehydes, and that medium-chain aldehydes, especially 4-hydroxynonenal, severely disrupt cellular retinoid homeostasis. Together, these findings provide a new insight into the effects of lipid peroxidation products and the impact of oxidative stress on retinoid metabolism. PMID:18396173

Retinoic Acid Isomers Up-Regulate ATP Binding Cassette A1 and G1 and Cholesterol Efflux in Rat Astrocytes: Implications for Their Therapeutic and Teratogenic Effects

PubMed Central

Chen, Jing; Costa, Lucio G.

2011-01-01

Recent studies suggest that retinoids may be effective in the treatment of Alzheimer's disease, although exposure to an excess of retinoids during gestation causes teratogenesis. Cholesterol is essential for brain development, but high levels of cholesterol have been associated with Alzheimer's disease. We hypothesized that retinoic acid may affect cholesterol homeostasis in rat astrocytes, which regulate cholesterol distribution in the brain, through the up-regulation of cholesterol transporters ATP binding cassette (Abc)a1 and Abcg1. Tretinoin, 13-cis retinoic acid (13-cis-RA), 9-cis-RA, and the selective retinoid X receptor (RXR) agonist methoprene significantly increased cholesterol efflux induced by cholesterol acceptors and protein levels of Abca1 by 2.3- (±0.25), 3.6- (±0.42), 4.1- (±0.5), and 1.75- (±0.43) fold, respectively, and Abcg1 by 2.1- (±0.26), 2.2- (±0.33), 2.5- (±0.23), and 2.2- (±0.21) fold, respectively. 13-cis-RA and 9-cis-RA also significantly increased mRNA levels of Abca1 (maximal induction 7.3 ± 0.42 and 2.7 ± 0.17, respectively) and Abcg1 (maximal induction 2.0 ± 0.18 and 1.8 ± 0.09, respectively), and the levels of membrane-bound Abca1 (2.5 ± 0.3 and 2.5 ± 0.40-fold increase, respectively), whereas they significantly decreased intracellular cholesterol content without affecting cholesterol synthesis. The effect of 9-cis-RA on cholesterol homeostasis in astrocytes can be ascribed to the activation of RXR, whereas the effects of 13-cis-RA and tretinoin were independent of either RXRs or retinoic acid receptors. These findings suggest that retinoids affect cholesterol homeostasis in astrocytes and that this effect may be involved in both their therapeutic and teratogenic actions. PMID:21628419

EFFECTS OF METHOPRENE DERIVATIVES ON THE EXPRESSION OF RETINOIC ACID SENSITIVE GENES AND PROTEINS IN CULTURED CELLS

EPA Science Inventory

The insect juvenile hormone analog methoprene has been suggested as a possible cause of malformations in frogs and other amphibians. Methoprene has structural similarities to the ubiquitous development regulator, retinoic acid, and thus, may bind to retinoid receptors and consequ...

Oral Vitamin A and Retinoic Acid Supplementation Stimulates Antibody Production and Splenic Stra6 Expression in Tetanus Toxoid–Immunized Mice12

PubMed Central

Tan, Libo; Wray, Amanda E.; Ross, A. Catharine

2012-01-01

Coadministration of retinoic acid (RA) and polyinosinic acid:polycytidylic acid (PIC) has been shown to cooperatively enhance the anti–tetanus toxoid (anti-TT) vaccine response in adult mice. Germinal center formation in the spleen is critical for a normal antibody response. Recent studies have identified Stimulated by Retinoic Acid-6 (Stra6) as the cell membrane receptor for retinol-binding protein (RBP) in many organs, including spleen. The objectives of the present studies were to test whether orally administered vitamin A (VA) itself, either alone or combined with RA, and/or treatment with PIC regulates Stra6 gene expression in mouse spleen and, concomitantly, antibody production. Eight-week-old C57BL/6 mice were immunized with TT. In an initial kinetic study, oral VA (6 mg/kg) increased anti-TT IgM and IgG production as well as splenic Stra6 mRNA expression. In treatment studies that were analyzed 9 d postimmunization, retinoids including VA, RA, VA and RA combined, and PIC significantly increased plasma anti-TT IgM and IgG (P < 0.05) and splenic Stra6 mRNA (P < 0.05). Treatments that included PIC elevated plasma anti-TT IgM and IgG concentrations >20-fold (P < 0.01). Immunohistochemistry of STRA6 protein in mouse spleen confirmed its increase after immunization and retinoid treatment. In conclusion, retinoid treatments that included VA, RA, VA and RA combined, and the combination of retinoid and PIC stimulated the expression of Stra6 in spleen, which potentially could increase the local uptake of retinol. Concomitantly, these treatments increased the systemic antigen-specific antibody response. The ability of oral retinoids to stimulate systemic immunity has implications for public health and therapeutic use of VA. PMID:22739370

Gestational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters retinoid homeostasis in maternal and perinatal tissues of the Holtzman rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kransler, Kevin M.; Tonucci, David A.; McGarrigle, Barbara P.

2007-10-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), one of the most widely studied environmental contaminants, causes a variety of adverse health effects including teratogenesis and altered development which may be related to disruptions in retinoid homeostasis. The purpose of this study was to determine the effect that gestational administration of TCDD has on retinoid homeostasis in both pregnant Holtzman rats and developing fetuses and neonates. A single oral dose of TCDD (0, 1.5, 3, or 6 {mu}g/kg) was administered to pregnant rats on gestation day 10, with fetuses analyzed on gestation days 17 and 20, and neonates analyzed on post natal day 7. Exposure tomore » TCDD generally produced decreases in the concentrations of retinyl esters, such as retinyl palmitate, and retinol in maternal and perinatal liver and lung, while increasing levels in the maternal kidney. Additionally, perinatal hepatic retinol binding protein 1-dependent retinyl ester hydrolysis was also decrease by TCDD. Sensitivity of the developing perinates to TCDD appeared to have an age-related component demonstrated by an increased rate of mortality and significant alterations to body weight and length on post natal day 7 relative to that observed at gestation day 20. A unique observation made in this study was a significant decrease in lung weight observed in the perinates exposed to TCDD. Taken together, these data demonstrate that TCDD significantly alters retinoid homeostasis in tissues of the developing fetus and neonate, suggesting that their unique sensitivity to TCDD may at least be in part the result of altered retinoid homeostasis.« less

The role of retinoic acid receptors and their cognate ligands in reproduction in a context of triorganotin based endocrine disrupting chemicals.

PubMed

Macejova, Dana; Toporova, L; Brtko, J

2016-07-01

Retinoic acid (RA), an active form of vitamin A, regulates the embryonic development, male and female reproduction and induces important effects on the cell development, proliferation, and differentiation. These effects are mediated by the retinoid (RAR) and rexinoid nuclear receptors (RXR), which are considered to be a ligand-activated, DNA-binding, trans-acting, and transcription-modulating proteins, involved in a general molecular mechanism responsible for the transcriptional responses in target genes. Organotin compounds are typical environmental contaminants and suspected endocrine disrupting substances. They may affect processes of reproductive system in mammals, predominantly via nuclear receptor signaling pathways. Triorganotins, such as tributyltin chloride (TBTCl) and triphenyltin chloride (TPTCl), are capable to bind to RXR molecules, and thus represent potent agonists of RXR subtypes of nuclear receptors not sharing any structural characteristics with endogenous ligands of nuclear receptors. Th is article summarizes selected effects of biologically active retinoids and rexinoids on both male and female reproduction and also deals with the effects of organotin compounds evoking endocrine disrupting actions in reproduction.

Retinoid-Related Orphan Receptor β and Transcriptional Control of Neuronal Differentiation.

PubMed

Liu, Hong; Aramaki, Michihiko; Fu, Yulong; Forrest, Douglas

2017-01-01

The ability to generate neuronal diversity is central to the function of the nervous system. Here we discuss the key neurodevelopmental roles of retinoid-related orphan receptor β (RORβ) encoded by the Rorb (Nr1f2) gene. Recent studies have reported loss of function of the human RORB gene in cases of familial epilepsy and intellectual disability. Principal sites of expression of the Rorb gene in model species include sensory organs, the spinal cord, and brain regions that process sensory and circadian information. Genetic analyses in mice have indicated functions in circadian behavior, vision, and, at the cellular level, the differentiation of specific neuronal cell types. Studies in the retina and sensory areas of the cerebral cortex suggest that this orphan nuclear receptor acts at decisive steps in transcriptional hierarchies that determine neuronal diversity. 2017 Published by Elsevier Inc.

Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

PubMed

Keller, H; Givel, F; Perroud, M; Wahli, W

1995-07-01

Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

Involvement of all-trans-retinal in acute light-induced retinopathy of mice.

PubMed

Maeda, Akiko; Maeda, Tadao; Golczak, Marcin; Chou, Steven; Desai, Amar; Hoppel, Charles L; Matsuyama, Shigemi; Palczewski, Krzysztof

2009-05-29

Exposure to bright light can cause visual dysfunction and retinal photoreceptor damage in humans and experimental animals, but the mechanism(s) remain unclear. We investigated whether the retinoid cycle (i.e. the series of biochemical reactions required for vision through continuous generation of 11-cis-retinal and clearance of all-trans-retinal, respectively) might be involved. Previously, we reported that mice lacking two enzymes responsible for clearing all-trans-retinal, namely photoreceptor-specific ABCA4 (ATP-binding cassette transporter 4) and RDH8 (retinol dehydrogenase 8), manifested retinal abnormalities exacerbated by light and associated with accumulation of diretinoid-pyridinium-ethanolamine (A2E), a condensation product of all-trans-retinal and a surrogate marker for toxic retinoids. Now we show that these mice develop an acute, light-induced retinopathy. However, cross-breeding these animals with lecithin:retinol acyltransferase knock-out mice lacking retinoids within the eye produced progeny that did not exhibit such light-induced retinopathy until gavaged with the artificial chromophore, 9-cis-retinal. No significant ocular accumulation of A2E occurred under these conditions. These results indicate that this acute light-induced retinopathy requires the presence of free all-trans-retinal and not, as generally believed, A2E or other retinoid condensation products. Evidence is presented that the mechanism of toxicity may include plasma membrane permeability and mitochondrial poisoning that lead to caspase activation and mitochondria-associated cell death. These findings further understanding of the mechanisms involved in light-induced retinal degeneration.

Inhibition of estrogen-responsive gene activation by the retinoid X receptor beta: evidence for multiple inhibitory pathways.

PubMed

Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K

1993-04-01

The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Novel mutations in the cellular retinaldehyde-binding protein gene (RLBP1) associated with retinitis punctata albescens: evidence of interfamilial genetic heterogeneity and fundus changes in heterozygotes.

PubMed

Fishman, Gerald A; Roberts, Mary Flynn; Derlacki, Deborah J; Grimsby, Jonna L; Yamamoto, Hiroyuki; Sharon, Dror; Nishiguchi, Koji M; Dryja, Thaddeus P

2004-01-01

To evaluate the molecular genetic defects associated with retinitis punctata albescens (RPA) in 5 patients from 3 families with this disease. We examined 3 probands and 2 clinically affected relatives with RPA. Clinical examinations included best-corrected visual acuity, visual field testing, electroretinography, dilated fundus examination, and fundus photography. Leukocyte DNA was analyzed for mutations in the exons of the genes encoding cellular retinaldehyde-binding protein 1 (RLBP1), 11-cis-retinol dehydrogenase (RDH5), interphotoreceptor retinoid-binding protein (RBP3), and photoreceptor all-trans-retinol dehydrogenase (RDH8). Not all patients were evaluated for mutations in each gene. The exons were individually amplified and screened for mutations by single-stranded conformational polymorphism analysis or direct genomic sequencing. The 3 probands had similar clinical findings, including a history of poor night vision, the presence of punctate white deposits in the retina, and substantially reduced or absent rod responses on electroretinogram testing. One of the probands (patient 2:III:2) had 2 novel mutations in the RLBP1 gene (Arg151Trp and Gly31[2-base pair deletion], [GGA-->G-]). Segregation analysis showed that the 2 mutations were allelic and that the patient was a compound heterozygote. Both parents of the proband manifested round white deposits in the retina. The other 2 probands had no detected pathogenic mutations in RLBP1 or in the other 3 genes evaluated. The identification of novel RLBP1 mutations in 1 of our 3 probands, all with RPA, is further evidence of genetic (nonallelic) heterogeneity in this disease. The presence of round white deposits in the retina may be observed in those heterozygous for RLBP1. Clinical Relevance Patients with a clinical presentation of RPA can have genetically different mutations. Drusen-like lesions may be observed in heterozygotes in families with this disease and a mutation in RLBP1.

Simultaneous analysis of retinol, all-trans- and 13-cis-retinoic acid and 13-cis-4-oxoretinoic acid in plasma by liquid chromatography using on-column concentration after single-phase fluid extraction.

PubMed

Teerlink, T; Copper, M P; Klaassen, I; Braakhuis, B J

1997-06-20

A reversed-phase high-performance liquid chromatographic method for the simultaneous analysis of retinol, all-trans-retinoic acid, 13-cis-retinoic acid and 13-cis-4-oxoretinoic acid in human plasma and cell culture medium is described. Sample preparation involves precipitation of proteins and extraction of retinoids with 60% acetonitrile. After centrifugation, the acetonitrile content of the supernatant is reduced to 45%, allowing on-column concentration of analytes. Injection volumes up to 2.0 ml (equivalent to 0.525 ml of sample) can be used without compromising chromatographic resolution of all-trans-retinoic acid and 13-cis-retinoic acid. Retinoids were stable in this extract and showed no isomerization when stored in the dark in a cooled autosampler, allowing automated analysis of large series of samples. Recoveries from spiked plasma samples were between 95 and 103%. Although no internal standard was used, the inter-assay precision for all retinoids was better than 6% and 4% at concentrations of 30 nM and 100 nM, respectively. The method is a valuable tool for the study of cellular metabolism of all-trans-retinoic acid, as polar metabolites of this compound can be detected with high sensitivity in cell culture media.

A non-retinoid antagonist of Retinol-Binding Protein 4 rescues phenotype in a model of Stargardt disease without inhibiting the visual cycle.

PubMed

Racz, Boglarka; Varadi, Andras; Kong, Jian; Allikmets, Rando; Pearson, Paul G; Johnson, Graham; Cioffi, Christopher L; Petrukhin, Konstantin

2018-06-05

A primary pathological defect in the heritable eye disorder Stargardt disease is excessive accumulation of cytotoxic lipofuscin bisretinoids in the retina. Age-dependent accumulation of lipofuscin in the retinal pigment epithelium (RPE) matches the age-dependent increase in the incidence of the atrophic (dry) form of age-related macular degeneration (AMD) and therefore may be one of several pathogenic factors contributing to AMD progression. Lipofuscin bisretinoid synthesis in the retina depends on the influx of serum retinol from the circulation into the RPE. Formation of the tertiary retinol-binding protein 4 (RBP4)-transthyretin-retinol complex in the serum is required for this influx. Herein, we report the pharmacological effects of the non-retinoid RBP4 antagonist, BPN-14136. BPN-14136 dosing in the Abca4-/- mouse model of increased lipofuscinogenesis significantly reduced serum RBP4 levels and inhibited bisretinoid synthesis, and this inhibition correlated with a partial reduction in visual cycle retinoids such as retinaldehydes serving as bisretinoid precursors. BPN-14136 administration at doses inducing maximal serum RBP4 reduction did not produce changes in the rate of the visual cycle, consistent with minimal changes in dark adaptation. Abca4-/- mice exhibited dysregulation of the complement system in the retina, and BPN-14136 administration normalized the retinal levels of proinflammatory complement cascade components such as complement factors D and H, C-reactive protein, and C3. We conclude that BPN-14136 has several beneficial characteristics, combining inhibition of bisretinoid synthesis and reduction in retinaldehydes with normalization of the retinal complement system. BPN-14136, or a similar compound, may be a promising drug candidate to manage Stargardt disease and dry AMD. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Uptake and esterification of vitamin A by RCS rat retinal pigment epithelial cells in primary culture.

PubMed

Cia, David; Bonhomme, Brigitte; Azaïs-Braesco, Véronique; Cluzel, Jacques; Doly, Michel

2004-02-01

We investigated the capacity of Royal College of Surgeons (RCS) rat retinal pigment epithelial (RPE) cells to take up all-trans-retinol (ROL) (vitamin A) and to metabolize it into retinyl esters (RE). Cultures of RPE cells were established from RCS and control newborn rats. All-trans-ROL was delivered to the apical surface of the RPE monolayer. Retinoids were analyzed by high-performance liquid chromatography. The cellular retinol-binding protein type I (CRBP-I) was assessed by Western blotting. Before supplementation with ROL, RE were lower in RCS rats. After ROL supplementation, esters increased and reached values that were similar in the two strains, but the increase, expressed relative to the initial value, was higher in RCS rats. The uptake of ROL and the level of CRBP-I were greater in RCS rats. Our results provide evidence of a functional retinol esterifying enzyme in cultured RCS RPE cells and suggest that CRBP-I could play a role in the uptake and esterification of ROL in the RPE cells.

Methyl farnesoate action, and morphogenetic signaling through the ligand binding pocket of the ortholog of the retinoid X receptor, in higher dipter

USDA-ARS?s Scientific Manuscript database

Most attention on metamorphic signaling by small terpenoids has focused action by juvenile hormone (JH) through bHLH-PAS proteins (e.g., MET and GCE), especially as that signaling axis intersects with ecdysteroid action through the receptor EcR. However, a long-standing series of endocrine and pharm...

[Experiences with an isolation method for retinal S-antigen and interphotoreceptor retinoid-binding protein].

PubMed

Sych, F J; Strobel, J

1996-12-01

S-antigen (AgS) and interphotoreceptor retinoid-binding protein (IRBP) are two highly potent uveitopathogenic autoantigens of the retina frequently used to trigger autoimmune uveitis in animal trials. The aim of this study was the simultaneous isolation of both proteins from bovine retina, additionally avoiding time-consuming dialysis and employing prepacked, commercially available cartridges. Retina extract, obtained in the usual manner, was precipitated with ammonium sulfate. Both the desalting and the buffer exchange of dissolved precipitate were carried out using a Bio-Gel P6 column. Subsequent separation with Econo-Pac Q gave prepurified AgS and IRBP fractions. Further purification was realized predominantly with Econo-Pac Q, -HTP and -HIC (5-ml cartridges). AgS and IRBP were isolated in high purity (sodium dodecylsulfate polyacrylamide gel electrophoresis, silver stain) from bovine retina using prepacked cartridges with yields of approximately 0.25 (for AgS) and 0.15 (for IRBP) mg/g retina, respectively. The application of ready-to-use cartridges allows simultaneous isolation of AgS and IRBP in milligram amounts under simplified conditions. This approach might be of particular interest for small samples of retina.

Modeling, Synthesis and Biological Evaluation of Potential Retinoid-X-Receptor (RXR) Selective Agonists: Novel Halogenated Analogs of 4-[1-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)ethynyl]benzoic Acid (Bexarotene)

PubMed Central

Furmick, Julie K.; Kaneko, Ichiro; Walsh, Angela N.; Yang, Joanna; Bhogal, Jaskaran S.; Gray, Geoffrey M.; Baso, Juan C.; Browder, Drew O.; Prentice, Jessica L.S.; Montano, Luis A.; Huynh, Chanh C.; Marcus, Lisa M.; Tsosie, Dorian G.; Kwon, Jungeun S.; Quezada, Alexis; Reyes, Nicole M.; Lemming, Brittney; Saini, Puneet; van der Vaart, Arjan; Groy, Thomas L.; Marshall, Pamela A.; Jurutka, Peter W.; Wagner, Carl E.

2012-01-01

The synthesis of halogenated analogs of 4-[1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)ethynyl]benzoic acid (1), known commonly as bexarotene, and their evaluation for retinoid-X-receptor (RXR)-specific agonist performance is described. Compound 1 is FDA approved to treat cutaneous T-cell lymphoma (CTCL); however, bexarotene treatment can induce hypothyroidism and elevated triglyceride levels, presumably by disrupting RXR heterodimer pathways for other nuclear receptors. The novel halogenated analogs in this study were modeled and assessed for their ability to bind to RXR and stimulate RXR homodimerization in an RXRE-mediated transcriptional assay as well as an RXR mammalian-2-hybrid assay. In an array of 8 novel compounds, 4 analogs were discovered to promote RXR-mediated transcription with comparable EC50 values as 1 and are selective RXR agonists. Our approach also uncovered a periodic trend of increased binding and homodimerization of RXR when substituting a halogen atom for a proton ortho to the carboxylic acid on 1. PMID:22927238

Pre-Clinical Evaluation of a Novel RXR Agonist for the Treatment of Neuroblastoma

PubMed Central

Waters, Alicia M.; Stewart, Jerry E.; Atigadda, Venkatram R.; Mroczek-Musulman, Elizabeth; Muccio, Donald D.; Grubbs, Clinton J.; Beierle, Elizabeth A.

2015-01-01

Neuroblastoma remains a common cause of pediatric cancer deaths, especially for children who present with advanced stage or recurrent disease. Currently, retinoic acid therapy is used as maintenance treatment to induce differentiation and reduce tumor recurrence following induction therapy for neuroblastoma, but unavoidable side effects are seen. A novel retinoid, UAB30, has been shown to generate negligible toxicities. In the current study, we hypothesized that UAB30 would have a significant impact on multiple neuroblastoma cell lines in vitro and in vivo. Cellular survival, cell cycle analysis, migration, and invasion were studied using alamarBlue® assays, FACS, and Transwell® assays, respectively, in multiple cell lines following treatment with UAB30. In addition, an in vivo murine model of human neuroblastoma was utilized to study the effects of UAB30 upon tumor xenograft growth and animal survival. We successfully demonstrated decreased cellular survival, invasion and migration, cell cycle arrest and increased apoptosis after treatment with UAB30. Furthermore, inhibition of tumor growth and increased survival was observed in a murine neuroblastoma xenograft model. The results of these in vitro and in vivo studies suggest a potential therapeutic role for the low toxicity synthetic retinoid X receptor selective agonist, UAB30, in neuroblastoma treatment. PMID:25944918

Interphotoreceptor matrix components in retinal cell transplants.

PubMed

Juliusson, B; Mieziewska, K; Bergström, A; Wilke, K; Van Veen, T; Ehinger, B

1994-05-01

To further investigate the functional potential of retinal transplants we have used immunocytochemistry to study the distribution of four different interphotoreceptor matrix (IPM)-specific components in rabbit retinal transplants. The different components were: interphotoreceptor retinoid-binding protein (IRBP), chondroitin-6-sulfate, F22 antigen and peanut agglutinin (PNA) binding structures. IRBP acts as a retinoid-transport protein between the neural retina and the retinal pigment epithelium. Chondroitin-6-sulfate is a glycosaminoglycan and a part of the insoluble IPM skeleton. The identity and role of the F22 antigen is not known. However, it is a 250 kDa protein localized to specific extracellular compartments such as teh IPM. PNA is a lectin with a high binding affinity for D-galactose-beta (1-3) N-acetyl-D-galactosamine disaccharide linkages and binds to IPM domains surrounding cones, but not rods. The transplants (15-day-old embryonic rabbit retina) were placed between the neural retina and retinal pigment epithelium in adult hosts. The transplants developed the typical rosette formations with photoreceptors toward the center. IRBP labeling was distinct in the IPM in the host retina. However, no IRBP labeling could be detected in the transplants. The chondroitin-6-sulfate and F22 antibodies strongly labeled the IPM in the host retina and corresponding structures in the center of rosettes. A cone-specific labeling with PNA could be seen in the host retina. In the transplants, however, PNA labeling appeared in association with many more photoreceptors than in the host retina. There is no previous study available on the IPM in retinal cell transplants.(ABSTRACT TRUNCATED AT 250 WORDS)

The neurobehavioral teratology of retinoids: a 50-year history.

PubMed

Adams, Jane

2010-10-01

This review of the central nervous system (CNS) and behavioral teratology of the retinoids over the last 50 years is a commemorative retrospective organized by decade to show the prominent research focus within each period and the most salient findings. In the 1960s, research focused on the gross CNS malformations associated with exposure and the delineation of dose-response and stage-specific responses in rodent models. Relevant scientific events before and during the 1960s are also discussed to provide the zeitgeist in which the field of neurobehavioral teratology emerged in the 1970s. During this period, studies demonstrated that adverse effects on postnatal behavior could be produced in animals exposed to doses of vitamin A lower than those that were teratogenic or impacted growth. Work during the 1980s showed an overrepresentation of behavioral studies focused on the reliability of screening methods, while the marked effects of human exposure were illustrated in children born to women treated with isotretinoin during pregnancy. The human catastrophe invigorated research during the 1990s, a period when technological advances allowed more elegant examinations of the developing CNS, of biochemical, cellular, and molecular developmental events and regulatory actions, and of the effects of direct genetic manipulations. Likewise, research in the 1990s reflected a reinvigoration of research in neurobehavioral teratology evinced in studies that used animal models to try to better understand human vulnerability. These foci continued in the 2000-2010 period while examinations of the role of retinoids in brain development and lifelong functioning became increasingly sophisticated and broader in scope. This review of the work on retinoids also provides a lens on the more general ontogeny of the field of neurobehavioral teratology. Birth Defects Research (Part A), 2010. © 2010 Wiley-Liss, Inc.

Prenatal Exposure to the Environmental Obesogen Tributyltin Predisposes Multipotent Stem Cells to Become Adipocytes

PubMed Central

Kirchner, Séverine; Kieu, Tiffany; Chow, Connie; Casey, Stephanie; Blumberg, Bruce

2010-01-01

The environmental obesogen hypothesis proposes that pre- and postnatal exposure to environmental chemicals contributes to adipogenesis and the development of obesity. Tributyltin (TBT) is an agonist of both retinoid X receptor (RXR) and peroxisome proliferator-activated receptor γ (PPARγ). Activation of these receptors can elevate adipose mass in adult mice exposed to the chemical in utero. Here we show that TBT sensitizes human and mouse multipotent stromal stem cells derived from white adipose tissue [adipose-derived stromal stem cells (ADSCs)] to undergo adipogenesis. In vitro exposure to TBT, or the PPARγ activator rosiglitazone increases adipogenesis, cellular lipid content, and expression of adipogenic genes. The adipogenic effects of TBT and rosiglitazone were blocked by the addition of PPARγ antagonists, suggesting that activation of PPARγ mediates the effect of both compounds on adipogenesis. ADSCs from mice exposed to TBT in utero showed increased adipogenic capacity and reduced osteogenic capacity with enhanced lipid accumulation in response to adipogenic induction. ADSCs retrieved from animals exposed to TBT in utero showed increased expression of PPARγ target genes such as the early adipogenic differentiation gene marker fatty acid-binding protein 4 and hypomethylation of the promoter/enhancer region of the fatty acid-binding protein 4 locus. Hence, TBT alters the stem cell compartment by sensitizing multipotent stromal stem cells to differentiate into adipocytes, an effect that could likely increase adipose mass over time. PMID:20160124

Prenatal exposure to the environmental obesogen tributyltin predisposes multipotent stem cells to become adipocytes.

PubMed

Kirchner, Séverine; Kieu, Tiffany; Chow, Connie; Casey, Stephanie; Blumberg, Bruce

2010-03-01

The environmental obesogen hypothesis proposes that pre- and postnatal exposure to environmental chemicals contributes to adipogenesis and the development of obesity. Tributyltin (TBT) is an agonist of both retinoid X receptor (RXR) and peroxisome proliferator-activated receptor gamma (PPARgamma). Activation of these receptors can elevate adipose mass in adult mice exposed to the chemical in utero. Here we show that TBT sensitizes human and mouse multipotent stromal stem cells derived from white adipose tissue [adipose-derived stromal stem cells (ADSCs)] to undergo adipogenesis. In vitro exposure to TBT, or the PPARgamma activator rosiglitazone increases adipogenesis, cellular lipid content, and expression of adipogenic genes. The adipogenic effects of TBT and rosiglitazone were blocked by the addition of PPARgamma antagonists, suggesting that activation of PPARgamma mediates the effect of both compounds on adipogenesis. ADSCs from mice exposed to TBT in utero showed increased adipogenic capacity and reduced osteogenic capacity with enhanced lipid accumulation in response to adipogenic induction. ADSCs retrieved from animals exposed to TBT in utero showed increased expression of PPARgamma target genes such as the early adipogenic differentiation gene marker fatty acid-binding protein 4 and hypomethylation of the promoter/enhancer region of the fatty acid-binding protein 4 locus. Hence, TBT alters the stem cell compartment by sensitizing multipotent stromal stem cells to differentiate into adipocytes, an effect that could likely increase adipose mass over time.

High-throughput screening (HTS) and modeling of the retinoid ...

EPA Pesticide Factsheets

Presentation at the Retinoids Review 2nd workshop in Brussels, Belgium on the application of high throughput screening and model to the retinoid system Presentation at the Retinoids Review 2nd workshop in Brussels, Belgium on the application of high throughput screening and model to the retinoid system

Fingerprint Stimulated Raman Scattering Imaging Reveals Retinoid Coupling Lipid Metabolism and Survival.

PubMed

Chen, Andy Jing; Li, Junjie; Jannasch, Amber; Ozseker, Sena; Wang, Meng C; Cheng, Ji-Xin

2018-06-17

Retinoids play critical roles in development, immunity and lipid metabolism, and their deficiency leads to various human disorders. Yet, tools for sensing retinoids in vivo are lacking, which limits the understanding of retinoid distribution, dynamics and functions in living organisms. Here, using hyperspectral stimulated Raman scattering microscopy, we discover a previously unknown cytoplasmic store of retinoids in Caenorahbditis elegans. Following the temporal dynamics of retinoids, we reveal that their levels are positively correlated with fat storage, and their supplementation slows down fat loss during dauer starvation. We also discover that retinoids promote fat unsaturation in response to high-glucose stress, and improve organism survival. Together, our studies report a new method for tracking the spatiotemporal dynamics of retinoids in living organisms, and suggest the crucial roles of retinoids in maintaining metabolic homeostasis and enhancing organism fitness upon developmental and dietary stresses. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photodecomposition and Phototoxicity of Natural Retinoids

PubMed Central

Tolleson, William H.; Cherng, Shui-Hui; Xia, Qingsu; Boudreau, Mary; Yin, Jun Jie; Wamer, Wayne G.; Howard, Paul C.; Yu, Hongtao; Fu, Peter P.

2005-01-01

Sunlight is a known human carcinogen. Many cosmetics contain retinoid-based compounds, such as retinyl palmitate (RP), either to protect the skin or to stimulate skin responses that will correct skin damaged by sunlight. However, little is known about the photodecomposition of some retinoids and the toxicity of these retinoids and their sunlight-induced photodecomposition products on skin. Thus, studies are required to test whether topical application of retinoids enhances the phototoxicity and photocarcinogenicity of sunlight and UV light. Mechanistic studies are needed to provide insight into the disposition of retinoids in vitro and on the skin, and to test thoroughly whether genotoxic damage by UV-induced radicals may participate in any toxicity of topically applied retinoids in the presence of UV light. This paper reports the update information and our experimental results on photostability, photoreactions, and phototoxicity of the natural retinoids including retinol (ROH), retinal, retinoid acid (RA), retinyl acetate, and RP (Figure 1). PMID:16705812

Is tretinoin still a key agent for photoaging management?

PubMed

Ascenso, Andreia; Ribeiro, Helena; Marques, Helena C; Oliveira, Helena; Santos, Conceicao; Simões, Sandra

2014-01-01

BACKGROUND & SCOPE OF THE REVIEW: This review focuses on the UV radiation effects on skin, emphasizing the photoaging process, and the photoprotection conferred by tretinoin (all-trans retinoic acid or ATRA). Tretinoin is still the best tested retinoid to reverse photoaged skin. Tretinoin can be used for photoaging treatment or combined treatment by different mechanisms. It binds to and activates retinoic acid receptors, inducing changes in gene expression that leads to cell differentiation, decreased cell proliferation, and inhibition of tumourigenesis. It has been demonstrated that photoaging resulting from UV-B radiation can be treated by retinoid formulations. Pretreatment of human skin with tretinoin blocks dermal matrix degradation followed by sun exposure, inhibiting the induction of the activated protein-1 (AP-1) transcription factor and AP-1 regulated matrix-degrading metalloproteinases. GENERAL SIGNIFICANCE AND INTEREST: Tretinoin should be considered as a key factor as it is the most potent and best-studied retinoid. In addition, the development of advanced drug delivery systems, especially novel nanoformulations, has contributed to overpass some technical drawbacks besides the skin irritation potential. The triple combination of tretinoin, hydroquinone and corticosteroids is still considered the gold standard for melasma. Although there are other novel therapeutic approaches, more high-quality clinical trials are still needed.

The efficacy of 9-cis retinoic acid in experimental models of cancer.

PubMed

Gottardis, M M; Lamph, W W; Shalinsky, D R; Wellstein, A; Heyman, R A

1996-01-01

9-cis retinoic acid (9-cis RA) is a retinoid receptor pan-agonist that binds with high affinity to both retinoic acid receptors (RARs) and retinoid X receptors (RXRs). Using a variety of in vivo and in vitro cancer models, we present experimental data that 9-cis RA has activity as a potential chemotherapeutic agent. Treatment of the human promyelocytic leukemia cell line HL-60 with 9-cis RA decreases cell proliferation, increases cell differentiation, and increases apoptosis. Induction of apoptosis correlates with an increase in tissue transglutaminase (type II) activity. In vivo, 9-cis RA induces complete tumor regression of an early passage human lip squamous cell carcinoma xenograft. Finally, 9-cis RA inhibits the anchorage-independent growth of the human breast cancer cell lines MCF-7 and LY2 (an antiestrogen-resistant MCF-7 variant). Transient co-transfection assays indicate that 9-cis RA inhibits estrogen receptor transcription of an ERE-tk-LUC reporter through RAR or RXR receptors. These data suggest that retinoid receptors can antagonize estrogen-dependent transcription and provides one possible mechanism for the inhibition of cell growth by 9-cis RA in breast cancer cell lines. In summary, these findings present evidence that 9-cis RA has a wide range of activities in human cancer models.

Increasing human Th17 differentiation through activation of orphan nuclear receptor retinoid acid-related orphan receptor γ (RORγ) by a class of aryl amide compounds.

PubMed

Zhang, Wei; Zhang, Jing; Fang, Leiping; Zhou, Ling; Wang, Shuai; Xiang, Zhijun; Li, Yuan; Wisely, Bruce; Zhang, Guifeng; An, Gang; Wang, Yonghui; Leung, Stewart; Zhong, Zhong

2012-10-01

In a screen for small-molecule inhibitors of retinoid acid-related orphan receptor γ (RORγ), we fortuitously discovered that a class of aryl amide compounds behaved as functional activators of the interleukin 17 (IL-17) reporter in Jurkat cells. Three of these compounds were selected for further analysis and found to activate the IL-17 reporter with potencies of ∼0.1 μM measured by EC₅₀. These compounds were shown to directly bind to RORγ by circular dichroism-based thermal stability experiments. Furthermore, they can enhance an in vitro Th17 differentiation process in human primary T cells. As RORγ remains an orphan nuclear receptor, discovery of these aryl amide compounds as functional agonists will now provide pharmacological tools for us to dissect functions of RORγ and facilitate drug discovery efforts for immune-modulating therapies.

Retinoid-xenobiotic interactions: the Ying and the Yang

PubMed Central

2015-01-01

The literature provides compelling evidence pointing to tight metabolic interactions between retinoids and xenobiotics. These are extensive and important for understanding xenobiotic actions in the body. Within the body, retinoids affect xenobiotic metabolism and actions and conversely, xenobiotics affect retinoid metabolism and actions. This article summarizes data that establish the importance of retinoid-dependent metabolic pathways for sustaining the body’s responses to xenobiotic exposure, including the roles of all-trans- and 9-cis-retinoic acid for protecting mammals from harmful xenobiotic effects and for ensuring xenobiotic elimination from the body. This review will also consider molecular mechanisms underlying xenobiotic toxicity focusing on how this may contribute to retinoid deficiency and disruption of normal retinoid homeostasis. Special attention is paid to xenobiotic molecular targets (nuclear receptors, regulatory proteins, enzymes, and transporters) which affect retinoid metabolism and signaling. PMID:26311625

The neurobiology of retinoic acid in affective disorders.

PubMed

Bremner, J Douglas; McCaffery, Peter

2008-02-15

Current models of affective disorders implicate alterations in norepinephrine, serotonin, dopamine, and CRF/cortisol; however treatments targeted at these neurotransmitters or hormones have led to imperfect resolution of symptoms, suggesting that the neurobiology of affective disorders is incompletely understood. Until now retinoids have not been considered as possible contributors to affective disorders. Retinoids represent a family of compounds derived from vitamin A that perform a large number of functions, many via the vitamin A product, retinoic acid. This signaling molecule binds to specific retinoic acid receptors in the brain which, like the glucocorticoid and thyroid hormone receptors, are part of the nuclear receptor superfamily and regulate gene transcription. Research in the field of retinoic acid in the CNS has focused on the developing brain, in part stimulated by the observation that isotretinoin (13-cis retinoic acid), an isomer of retinoic acid used in the treatment of acne, is highly teratogenic for the CNS. More recent work has suggested that retinoic acid may influence the adult brain; animal studies indicated that the administration of isotretinoin is associated with alterations in behavior as well as inhibition of neurogenesis in the hippocampus. Clinical evidence for an association between retinoids and depression includes case reports in the literature, studies of health care databases, and other sources. A preliminary PET study in human subjects showed that isotretinoin was associated with a decrease in orbitofrontal metabolism. Several studies have shown that the molecular components required for retinoic acid signaling are expressed in the adult brain; the overlap of brain areas implicated in retinoic acid function and stress and depression suggest that retinoids could play a role in affective disorders. This report reviews the evidence in this area and describes several systems that may be targets of retinoic acid and which contribute to the pathophysiology of depression.

The Neurobiology of Retinoic Acid in Affective Disorders

PubMed Central

Bremner, J Douglas; McCaffery, Peter

2009-01-01

Current models of affective disorders implicate alterations in norepinephrine, serotonin, dopamine, and CRF/cortisol; however treatments targeted at these neurotransmitters or hormones have led to imperfect resolution of symptoms, suggesting that the neurobiology of affective disorders is incompletely understood. Until now retinoids have not been considered as possible contributors to affective disorders. Retinoids represent a family of compounds derived from Vitamin A that perform a large number of functions, many via the vitamin A product, retinoic acid. This signaling molecule binds to specific retinoic acid receptors in the brain which, like the glucocorticoid and thyroid hormone receptors, are part of the nuclear receptor superfamily and regulate gene transcription. Research in the field of retinoic acid in the CNS has focused on the developing brain, in part stimulated by the observation that isotretinoin (13-cis retinoic acid), an isomer of retinoic acid used in the treatment of acne, is highly teratogenic for the CNS. More recent work has suggested that retinoic acid may influence the adult brain; animal studies indicated that the administration of isotretinoin is associated with alterations in behavior as well as inhibition of neurogenesis in the hippocampus. Clinical evidence for an association between retinoids and depression includes case reports in the literature, studies of health care databases, and other sources. A preliminary PET study in human subjects showed that isotretinoin was associated with a decrease in orbitofrontal metabolism. Several studies have shown that the molecular components required for retinoic acid signaling are expressed in the adult brain ; the overlap of brain areas implicated in retinoic acid function and stress and depression suggest that retinoids could play a role in affective disorders. This report reviews the evidence in this area and describes several systems that may be targets of retinoic acid and which contribute to the pathophysiology of depression. PMID:17707566

Consequences of metal exposure on retinoid metabolism in vertebrates: a review.

PubMed

Defo, M A; Spear, P A; Couture, P

2014-02-10

What we generally refer to as 'vitamin A' is a group of naturally-occurring molecules structurally similar to retinol that are capable of exerting biological activity. These retinoids are essential to diverse physiological functions including vision, immune response, bone mineralization, reproduction, cell differentiation, and growth. As well, some retinoids have antioxidant properties. Independent studies published over the last few decades have revealed that many fish and wildlife populations living in highly polluted environments have altered retinoid status possibly associated with retinoid metabolic or homeostatic mechanisms. Substantial evidence links organic contaminant exposure with changes in retinoid status in animal populations, but only a few detailed studies have been published implicating inorganic contaminants such as metals. This mini-review selectively deals with field and laboratory studies reporting associations between environmental contaminants, especially trace metals, and alterations in retinoid status. Both essential and non-essential trace metals have been reported to affect retinoid status. This review focuses on metabolic imbalances of retinoids in relation to metal contamination and illustrates possible modes of action. The role of retinoids as antioxidants and their potential as biomarkers of metal contamination are discussed. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Phosphorylation of a conserved serine in the deoxyribonucleic acid binding domain of nuclear receptors alters intracellular localization.

PubMed

Sun, Kai; Montana, Vedrana; Chellappa, Karthikeyani; Brelivet, Yann; Moras, Dino; Maeda, Yutaka; Parpura, Vladimir; Paschal, Bryce M; Sladek, Frances M

2007-06-01

Nuclear receptors (NRs) are a superfamily of transcription factors whose genomic functions are known to be activated by lipophilic ligands, but little is known about how to deactivate them or how to turn on their nongenomic functions. One obvious mechanism is to alter the nuclear localization of the receptors. Here, we show that protein kinase C (PKC) phosphorylates a highly conserved serine (Ser) between the two zinc fingers of the DNA binding domain of orphan receptor hepatocyte nuclear factor 4alpha (HNF4alpha). This Ser (S78) is adjacent to several positively charged residues (Arg or Lys), which we show here are involved in nuclear localization of HNF4alpha and are conserved in nearly all other NRs, along with the Ser/threonine (Thr). A phosphomimetic mutant of HNF4alpha (S78D) reduced DNA binding, transactivation ability, and protein stability. It also impaired nuclear localization, an effect that was greatly enhanced in the MODY1 mutant Q268X. Treatment of the hepatocellular carcinoma cell line HepG2 with PKC activator phorbol 12-myristate 13-acetate also resulted in increased cytoplasmic localization of HNF4alpha as well as decreased endogenous HNF4alpha protein levels in a proteasome-dependent fashion. We also show that PKC phosphorylates the DNA binding domain of other NRs (retinoic acid receptor alpha, retinoid X receptor alpha, and thyroid hormone receptor beta) and that phosphomimetic mutants of the same Ser/Thr result in cytoplasmic localization of retinoid X receptor alpha and peroxisome proliferator-activated receptor alpha. Thus, phosphorylation of this conserved Ser between the two zinc fingers may be a common mechanism for regulating the function of NRs.

Potential role of retinoids in ovarian physiology and pathogenesis of polycystic ovary syndrome.

PubMed

Jiang, Yanwen; Li, Chunjin; Chen, Lu; Wang, Fengge; Zhou, Xu

2017-06-01

Retinoids (retinol and its derivatives) are required for maintaining vision, immunity, barrier function, reproduction, embryogenesis, cell proliferation and differentiation. Furthermore, retinoid signaling plays a key role in initiating meiosis of germ cells of the mammalian fetal ovary. Recently, studies indicated that precise retinoid level regulation in the ovary provides a molecular control of ovarian development, steroidogenesis and oocyte maturation. Besides, abnormal retinoid signaling may be involved in the pathogenesis of polycystic ovary syndrome (PCOS), one of the most common ovarian endocrinopathies in reproductive-aged women worldwide. This review primarily summarizes recent advancements made in investigating the action of retinoid signaling in ovarian physiology as well as the abnormal retinoid signaling in PCOS. Copyright © 2017. Published by Elsevier B.V.

Uveitis in horses induced by interphotoreceptor retinoid-binding protein is similar to the spontaneous disease.

PubMed

Deeg, Cornelia A; Thurau, Stephan R; Gerhards, Hartmut; Ehrenhofer, Marion; Wildner, Gerhild; Kaspers, Bernd

2002-09-01

Equine recurrent uveitis (ERU) is an inflammatory eye disease with high similarity to uveitis in man. It is the only spontaneous animal model for uveitis and the most frequent eye disease in horses affecting up to 10% of the population. To further investigate the pathophysiology of ERU we now report the establishment of an inducible uveitis model in horses. An ERU-like disease was elicited in seven out of seven horses by injection of interphotoreceptor retinoid-binding protein (IRBP) in complete Freund's adjuvant. Control horses did not develop uveitis. The disease model is characterized by a highly reproducible disease course and recurrent episodes with an identical time course elicited in all horses by repeated IRBP injections. The histology revealed the formation of lymphoid follicle-like structures in the eyes and an intraocular infiltration dominated by CD3(+) lymphocytes, morphological patterns typical for the spontaneous disease. Antigen-specific T cell proliferation of PBL was monitored prior to clinical uveitis and during disease episodes. An initial T cell response to IRBP-derived peptides was followed by epitope spreading to S-antigen-derived peptides in response to subsequent immunizations. Thus, horse experimental uveitis represents a valuable disease model for comparative studies with the spontaneous disease and the investigation of immunomodulatory therapeutic approaches after onset of the disease.

Hyperspectral imaging of endogenous fluorescent metabolic molecules to identify pain states in central nervous system tissue

NASA Astrophysics Data System (ADS)

Staikopoulos, Vasiliki; Gosnell, Martin E.; Anwer, Ayad G.; Mustafa, Sanam; Hutchinson, Mark R.; Goldys, Ewa M.

2016-12-01

Fluorescence-based bio-imaging methods have been extensively used to identify molecular changes occurring in biological samples in various pathological adaptations. Auto-fluorescence generated by endogenous fluorescent molecules within these samples can interfere with signal to background noise making positive antibody based fluorescent staining difficult to resolve. Hyperspectral imaging uses spectral and spatial imaging information for target detection and classification, and can be used to resolve changes in endogenous fluorescent molecules such as flavins, bound and free NADH and retinoids that are involved in cell metabolism. Hyperspectral auto-fluorescence imaging of spinal cord slices was used in this study to detect metabolic differences within pain processing regions of non-pain versus sciatic chronic constriction injury (CCI) animals, an established animal model of peripheral neuropathy. By using an endogenous source of contrast, subtle metabolic variations were detected between tissue samples, making it possible to distinguish between animals from non-injured and injured groups. Tissue maps of native fluorophores, flavins, bound and free NADH and retinoids unveiled subtle metabolic signatures and helped uncover significant tissue regions with compromised mitochondrial function. Taken together, our results demonstrate that hyperspectral imaging provides a new non-invasive method to investigate central changes of peripheral neuropathic injury and other neurodegenerative disease models, and paves the way for novel cellular characterisation in health, disease and during treatment, with proper account of intrinsic cellular heterogeneity.

Comparison of the in vitro and in vivo effects of retinoids either alone or in combination with cisplatin and 5-fluorouracil on tumor development and metastasis of melanoma.

PubMed

Liu, Xin; Chan, Sui Yung; Ho, Paul Chi-Lui

2008-12-01

Retinoids have previously been reported to inhibit proliferation of melanoma cell lines in vitro. However, the relative antimetastatic efficacy of various retinoids on melanoma in vivo is unknown. Therefore, we investigated the effects of different retinoids on the invasion and metastasis of murine melanoma B16-F10 cells in vitro and in vivo. Based on the findings, the antitumor effects of a selected retinoid either alone or in combination with cisplatin were also investigated in a preclinical mouse melanoma model. Cell proliferation and invasion analyses of murine melanoma B16-F10 cells were assessed in the presence of different retinoids, either alone or in combination with cisplatin (CDDP) or 5-fluorouracil (5-FU). Experimental lung metastasis assay was performed in this study to investigate the antimetastatic efficacy of retinoids. Additionally, a mouse melanoma model was used to assess the antitumor efficacy of a selected retinoid in combination with cisplatin. Retinoids showed significant antiproliferation and anti-invasion effects on murine melanoma B16-F10 cells. Pretreatment with retinoids increased the sensitivity to CDDP but not to 5-FU in in-vitro. Moreover, the number of metastatic colonies formed in the lungs of mice injected intravenously with B16-F10 cells was significantly reduced by injecting the respective retinoid once a day for 10 days. Treatment with a combination of cisplatin and 13-cis-retinoic acid resulted in a significant reduction in primary tumor size and the number of lung metastatic nodules in melanoma-bearing mice. These results suggest that retinoids not only exhibit antimetastatic effect, but also enhance the antitumor activity of cisplatin in vivo.

Increased uptake of dietary retinoids at the maternal-fetal barrier in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Kutasy, Balazs; Friedmacher, Florian; Pes, Lara; Paradisi, Francesca; Puri, Prem

2014-06-01

The retinol signaling pathway is disrupted in congenital diaphragmatic hernia (CDH). Since there is no fetal retinol synthesis, maternal retinol has to cross the placenta. Nitrofen interferes with the retinol-binding protein (RBP) transfer pathway in CDH. However, in RBP knockout mice, retinol has been shown to be present. In this model, increased uptake of maternal dietary retinyl ester (RE) bounded in low-dense-lipoprotein (LDL) through low-density-lipoprotein-receptor 1 (LRP1) and increased activity of RE hydrolysis by lipoprotein-lipase (LPL) have been found. The aim of this study was to investigate the RE transfer pathway in the nitrofen CDH model. Pregnant rats were treated with nitrofen or vehicle on gestational day (D9) and sacrificed on D21. Immunohistochemistry was performed to evaluate LRP1 and LPL protein expression. Serum LDL levels were measured by ELISA. Pulmonary and serum retinoid levels were measured using HPLC. Markedly increased trophoblastic and pulmonary LRP1 and LPL immunoreactivity were observed in CDH compared to controls. Significantly increased serum LDL and RE levels were observed in CDH compared to controls. The increased uptake of dietary retinoids at the maternal-fetal barrier in the nitrofen CDH model suggests that the RE transfer pathway may be the main source of retinol in this model. Copyright © 2014 Elsevier Inc. All rights reserved.

Arginine methylation of HSP70 regulates retinoid acid-mediated RARβ2 gene activation

PubMed Central

Gao, Wei-wei; Xiao, Rong-quan; Peng, Bing-ling; Xu, Huan-teng; Shen, Hai-feng; Huang, Ming-feng; Shi, Tao-tao; Yi, Jia; Zhang, Wen-juan; Wu, Xiao-nan; Gao, Xiang; Lin, Xiang-zhi; Dorrestein, Pieter C.; Rosenfeld, Michael G.; Liu, Wen

2015-01-01

Although “histone” methyltransferases and demethylases are well established to regulate transcriptional programs and to use nonhistone proteins as substrates, their possible roles in regulation of heat-shock proteins in the nucleus have not been investigated. Here, we report that a highly conserved arginine residue, R469, in HSP70 (heat-shock protein of 70 kDa) proteins, an evolutionarily conserved protein family of ATP-dependent molecular chaperone, was monomethylated (me1), at least partially, by coactivator-associated arginine methyltransferase 1/protein arginine methyltransferase 4 (CARM1/PRMT4) and demethylated by jumonji-domain–containing 6 (JMJD6), both in vitro and in cultured cells. Functional studies revealed that HSP70 could directly regulate retinoid acid (RA)-induced retinoid acid receptor β2 (RARβ2) gene transcription through its binding to chromatin, with R469me1 being essential in this process. HSP70’s function in gene transcriptional regulation appears to be distinct from its protein chaperon activity. R469me1 was shown to mediate the interaction between HSP70 and TFIIH, which involves in RNA polymerase II phosphorylation and thus transcriptional initiation. Our findings expand the repertoire of nonhistone substrates targeted by PRMT4 and JMJD6, and reveal a new function of HSP70 proteins in gene transcription at the chromatin level aside from its classic role in protein folding and quality control. PMID:26080448

Nuclear actions of insulin-like growth factor binding protein-3.

PubMed

Baxter, Robert C

2015-09-10

In addition to its actions outside the cell, cellular uptake and nuclear import of insulin-like growth factor binding protein-3 (IGFBP-3) has been recognized for almost two decades, but knowledge of its nuclear actions has been slow to emerge. IGFBP-3 has a functional nuclear localization signal and interacts with the nuclear transport protein importin-β. Within the nucleus IGFBP-3 appears to have a role in transcriptional regulation. It can bind to the nuclear receptor, retinoid X receptor-α and several of its dimerization partners, including retinoic acid receptor, vitamin D receptor (VDR), and peroxisome proliferator-activated receptor-γ (PPARγ). These interactions modulate the functions of these receptors, for example inhibiting VDR-dependent transcription in osteoblasts and PPARγ-dependent transcription in adipocytes. Nuclear IGFBP-3 can be detected by immunohistochemistry in cancer and other tissues, and its presence in the nucleus has been shown in many cell culture studies to be necessary for its pro-apoptotic effect, which may also involve interaction with the nuclear receptor Nur77, and export from the nucleus. IGFBP-3 is p53-inducible and in response to DNA damage, forms a complex with the epidermal growth factor receptor (EGFR), translocating to the nucleus to interact with DNA-dependent protein kinase. Inhibition of EGFR kinase activity or downregulation of IGFBP-3 can inhibit DNA double strand-break repair by nonhomologous end joining. IGFBP-3 thus has the ability to influence many cell functions through its interactions with intranuclear pathways, but the importance of these interactions in vivo, and their potential to be targeted for therapeutic benefit, require further investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

Stimulation of Phospholipid Scrambling of the Erythrocyte Membrane by 9-Cis-Retinoic Acid.

PubMed

Abed, Majed; Alzoubi, Kousi; Lang, Florian; Al Mamun Bhuayn, Abdulla

2017-01-01

The endogenous retinoid 9-cis-retinoic acid has previously been shown to trigger apoptosis in a wide variety of cells including several tumor cells and has thus been suggested for the treatment of malignancy. Similar to apoptosis of nucleated cells, erythrocytes may enter suicidal erythrocyte death or eryptosis, which is characterized by cell shrinkage and cell membrane scrambling with phosphatidylserine translocation to the erythrocyte surface. Cellular mechanisms participating in the accomplishment of eryptosis include increase of cytosolic Ca2+ activity ([Ca2+]i) and formation of ceramide. The present study explored, whether 9-cis-retinoic acid induces eryptosis and whether the effect involves Ca2+ and/or ceramide. Flow cytometry was employed to estimate erythrocyte volume from forward scatter, phosphatidylserine exposure at the cell surface from annexin-V-binding, [Ca2+]i from Fluo3-fluorescence, and ceramide abundance utilizing specific antibodies. Hemolysis was quantified from hemoglobin concentration in the supernatant. A 48 hours exposure of human erythrocytes to 9-cis-retinoic acid (≥ 0.5 µg/ml) significantly increased the percentage of annexin-V-binding cells and significantly decreased forward scatter. Exposure to 9-cis-retinoic acid (≥ 0.5 µg/ml) significantly increased Fluo3-fluorescence, and the effect of 9-cis-retinoic acid on annexin-V-binding was significantly blunted by removal of extracellular Ca2+. Exposure to 9-cis-retinoic acid (1 µg/ml) further significantly increased the ceramide abundance at the erythrocyte surface and significantly increased hemolysis. 9-cis-retinoic acid triggers phospholipid scrambling of the erythrocyte cell membrane, an effect at least in part downstream of Ca2+ and ceramide. © 2017 The Author(s)Published by S. Karger AG, Basel.

Miscellaneous vitreous-derived IgM antibodies target numerous retinal proteins in equine recurrent uveitis.

PubMed

Zipplies, Johanna K; Hauck, Stefanie M; Eberhardt, Christina; Hirmer, Sieglinde; Amann, Barbara; Stangassinger, Manfred; Ueffing, Marius; Deeg, Cornelia A

2012-09-01

In equine recurrent uveitis (ERU), immune reactions are directed toward known antigens like S-antigen, interphotoreceptor retinoid-binding protein, and cellular retinalaldehyde-binding protein, and anti-retinal antibodies were detected in vitreous samples. The aim of this study was the investigation of intraocular immunoglobulin M (IgM) reactivities to retinal proteome. Retina was separated by one- and two-dimensional gel electrophoresis and blotted semidry on PVDF membranes. To identify intraocular IgM antibody responses to retinal tissue, blots were incubated with vitreous samples of ERU-diseased horses (n = 50) and healthy controls (n = 30), followed by an HRP-labeled secondary antibody specific for equine IgM. Noticeable 2D western blot signals were aligned on a 2D gel of retinal proteome, excised, and subsequently identified by tandem mass spectrometry. Interestingly, frequent and very miscellaneous IgM response patterns to the retinal proteome in 68% of ERU vitreous samples were detected. Binding of IgM antibodies was localized at 17 different molecular weights. The most frequently detected signal, in 21 of the 50 samples, was located at 49 kDa. Comparing the samples interindividually between one and up to nine different signals in one sample could be observed. All healthy vitreous samples were devoid of IgM antibodies. Analysis of targeted spots with mass spectrometry led to the clear identification of 11 different proteins (corresponding to 16 different spots). One candidate could not be discovered so far. The considerable IgM response to retinal proteins demonstrates an ongoing immune response, which might contribute to the remitting relapsing character of ERU. Novel identified target proteins point to a diverse response pattern of individual ERU cases. © 2012 American College of Veterinary Ophthalmologists.

Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

PubMed Central

Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

2006-01-01

The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

Spatial distribution of endogenous retinoids in the murine embryonic mandible.

PubMed

Kronmiller, J E; Beeman, C S

1994-12-01

Retinoids play an important part in pattern formation during embryonic development. Exogenous retinoids alter the pattern of skeletal, neural and odontogenic tissues. Endogenous retinoids have been demonstrated previously in the murine embryonic mandible, reaching a concentration peak during the initiation of odontogenesis. It was now found that endogenous retinoids are present in a concentration gradient in the embryonic mouse mandible at the time of the initiation of the dental lamina. All-trans-retinoic acid was more concentrated in the incisor region and retinol in the molar region. These results, and the fact that exogenous retinoids produce supernumerary incisors and missing molars, suggest that all-trans-retinoic acid may instruct incisor morphology.

Vitamin A Metabolism: An Update

PubMed Central

D’Ambrosio, Diana N.; Clugston, Robin D.; Blaner, William S.

2011-01-01

Retinoids are required for maintaining many essential physiological processes in the body, including normal growth and development, normal vision, a healthy immune system, normal reproduction, and healthy skin and barrier functions. In excess of 500 genes are thought to be regulated by retinoic acid. 11-cis-retinal serves as the visual chromophore in vision. The body must acquire retinoid from the diet in order to maintain these essential physiological processes. Retinoid metabolism is complex and involves many different retinoid forms, including retinyl esters, retinol, retinal, retinoic acid and oxidized and conjugated metabolites of both retinol and retinoic acid. In addition, retinoid metabolism involves many carrier proteins and enzymes that are specific to retinoid metabolism, as well as other proteins which may be involved in mediating also triglyceride and/or cholesterol metabolism. This review will focus on recent advances for understanding retinoid metabolism that have taken place in the last ten to fifteen years. PMID:21350678

Retinoids in the treatment of skin aging: an overview of clinical efficacy and safety

PubMed Central

Mukherjee, Siddharth; Date, Abhijit; Patravale, Vandana; Korting, Hans Christian; Roeder, Alexander; Weindl, Günther

2006-01-01

Aging of skin is an intricate biological process consisting of two types. While intrinsic or chronological aging is an inevitable process, photoaging involves the premature aging of skin occurring due to cumulative exposure to ultraviolet radiation. Chronological and photoaging both have clinically differentiable manifestations. Various natural and synthetic retinoids have been explored for the treatment of aging and many of them have shown histological and clinical improvement, but most of the studies have been carried out in patients presenting with photoaged skin. Amongst the retinoids, tretinoin possibly is the most potent and certainly the most widely investigated retinoid for photoaging therapy. Although retinoids show promise in the treatment of skin aging, irritant reactions such as burning, scaling or dermatitis associated with retinoid therapy limit their acceptance by patients. This problem is more prominent with tretinoin and tazarotene whereas other retinoids mainly represented by retinaldehyde and retinol are considerably less irritating. In order to minimize these side effects, various novel drug delivery systems have been developed. In particular, nanoparticles have shown a good potential in improving the stability, tolerability and efficacy of retinoids like tretinoin and retinol. However, more elaborate clinical studies are required to confirm their advantage in the delivery of topical retinoids. PMID:18046911

Anti-tumor effects of retinoids combined with trastuzumab or tamoxifen in breast cancer cells: induction of apoptosis by retinoid/trastuzumab combinations.

PubMed

Koay, Debbie C; Zerillo, Cynthia; Narayan, Murli; Harris, Lyndsay N; DiGiovanna, Michael P

2010-01-01

HER2 and estrogen receptor (ER) are important in breast cancer and are therapeutic targets of trastuzumab (Herceptin) and tamoxifen, respectively. Retinoids inhibit breast cancer growth, and modulate signaling by HER2 and ER. We hypothesized that treatment with retinoids and simultaneous targeting of HER2 and/or ER may have enhanced anti-tumor effects. The effects of retinoids combined with trastuzumab or tamoxifen were examined in two human breast cancer cell lines in culture, BT474 and SKBR3. Assays of proliferation, apoptosis, differentiation, cell cycle distribution, and receptor signaling were performed. In HER2-overexpressing/ER-positive BT474 cells, combining all-trans retinoic acid (atRA) with tamoxifen or trastuzumab synergistically inhibited cell growth, and altered cell differentiation and cell cycle. Only atRA/trastuzumab-containing combinations induced apoptosis. BT474 and HER2-overexpressing/ER-negative SKBR3 cells were treated with a panel of retinoids (atRA, 9-cis-retinoic acid, 13-cis-retinoic acid, or N-(4-hydroxyphenyl) retinamide (fenretinide) (4-HPR)) combined with trastuzumab. In BT474 cells, none of the single agents except 4-HPR induced apoptosis, but again combinations of each retinoid with trastuzumab did induce apoptosis. In contrast, the single retinoid agents did cause apoptosis in SKBR3 cells; this was only modestly enhanced by addition of trastuzumab. The retinoid drug combinations altered signaling by HER2 and ER. Retinoids were inactive in trastuzumab-resistant BT474 cells. Combining retinoids with trastuzumab maximally inhibits cell growth and induces apoptosis in trastuzumab-sensitive cells. Treatment with such combinations may have benefit for breast cancer patients.

Recent Progress in the Design and Discovery of RXR Modulators Targeting Alternate Binding Sites of the Receptor.

PubMed

Su, Ying; Zeng, Zhiping; Chen, Ziwen; Xu, Dan; Zhang, Weidong; Zhang, Xiao-Kun

2017-01-01

Retinoid X receptors (RXRs) occupy a central position within the nuclear receptor superfamily. They not only function as important transcriptional factors but also exhibit diverse nongenomic biological activities. The pleiotropic actions of RXRs under both physiological and pathophysiological conditions confer RXRs important drug targets for the treatment of cancer, and metabolic and neurodegenerative diseases. RXR modulators have been studied for the purpose of developing both drug molecules and chemical tools for biological investigation of RXR. Development of RXR modulators has focused on small molecules targeting the canonical ligand-binding pocket. However, accumulating results have demonstrated that there are other binding mechanisms by which small molecules interact with RXR to act as RXR modulators. This review discusses the recent development in the design and discovery of RXR modulators with a focus on those targeting novel binding sites on RXR.

Comparison of extraction phases for a two-phase culture of a recombinant E. coli producing retinoids.

PubMed

Jang, Hui-Jeong; Ha, Bo-Kyung; Kim, Jin-Woong; Jung, Kyung-Hwa; Ahn, Jiyoon; Yoon, Sang-Hwal; Kim, Seon-Won

2014-03-01

To prevent degradation of intracellular retinoids through in situ extraction from the cells, a two-phase culture system was performed. Several organic solvents, including n-alkanes, mineral oils and cosmetic raw materials, were applied as the extraction phase. Of the n-alkanes, n-decane had the highest retinoid production as 134 mg/l after 72 h. For mineral oil, light and heavy mineral oil gave retinoid productions of 158 and 174 mg/l after 96 h, respectively. Of other materials, isopropyl myristate gave the highest retinoid production of 181 mg/l. These results indicate that many types of oils can be applied for retinoid production, and optimization of the in situ extraction process will lead to further improve of economical production for the industrial purpose.

Hypervitaminosis A is prevalent in children with CKD and contributes to hypercalcemia.

PubMed

Manickavasagar, Baheerathi; McArdle, Andrew J; Yadav, Pallavi; Shaw, Vanessa; Dixon, Marjorie; Blomhoff, Rune; Connor, Graeme O'; Rees, Lesley; Ledermann, Sarah; Van't Hoff, William; Shroff, Rukshana

2015-02-01

Vitamin A accumulates in renal failure, but the prevalence of hypervitaminosis A in children with predialysis chronic kidney disease (CKD) is not known. Hypervitaminosis A has been associated with hypercalcemia. In this study we compared dietary vitamin A intake with serum retinoid levels and their associations with hypercalcemia. We studied the relationship between vitamin A intake, serum retinoid levels, and serum calcium in 105 children with CKD stages 2-5 on dialysis and posttransplant. Serum retinoid measures included retinol (ROH), its active retinoic acid (RA) metabolites [all-trans RA (at-RA) and 13-cis RA] and carrier proteins [retinol-binding protein-4 (RBP4) and transthyretin (TTR)]. Dietary vitamin A intake was assessed using a food diary. Twenty-five children were in CKD 2-3, 35 in CKD 4-5, 23 on dialysis and 22 posttransplant; 53 % had vitamin A intake above the Reference Nutrient Intake (RNI) value. Children receiving supplemental feeds compared with diet alone had higher vitamin A intake (p = 0.02) and higher serum ROH (p < 0.001). Notably, increased ROH was seen as early as CKD stage 2. For every 10 ml/min/1.73 m(2) fall in estimated glomerular filtration rate (eGFR), there was a 13 % increase in ROH. RBP4 levels were increased in CKD 3-5 and dialysis patients. The lowest ratios of ROH:RBP4 were seen in dialysis compared with CKD 2-3 (p = 0.03), suggesting a relative increase in circulating RBP4. Serum ROH, RBP4 and at-RA were associated with serum calcium. On multivariable analysis RBP4 levels and alfacalcidol dose were significant predictors of serum calcium (model R (2) 32 %) in dialysis patients. Hypervitaminosis A is seen in early CKD, with highest levels in children on supplemental feeds compared with diet alone. Serum retinoid levels significantly predict hypercalcemia.

Immunolocalization of peroxisome proliferator-activated receptors and retinoid X receptors in the adult rat CNS.

PubMed

Moreno, S; Farioli-Vecchioli, S; Cerù, M P

2004-01-01

Peroxisome proliferator-activated and retinoid X receptors (PPARs and RXRs) are transcription factors belonging to the steroid hormone receptor superfamily. Upon activation by their ligands, PPARs and RXRs bind to their target genes as heterodimers. Ligands of these receptors include lipophylic molecules, such as retinoids, fatty acids and eicosanoids, the importance of which in the metabolism and functioning of the nervous tissue is well documented. The immunohistochemical distribution of PPARs and RXRs in the CNS of the adult rat was studied by means of a sensitive biotinyl-tyramide method. All PPAR (alpha, beta/delta and gamma) and RXR (alpha, beta and gamma) isotypes were detected and found to exhibit specific patterns of localization in the different areas of the brain and spinal cord. The presence of the nuclear receptors was observed in both neuronal and glial cells. While PPAR beta/delta and RXR beta showed a widespread distribution, alpha and gamma isotypes exhibited a more restricted pattern of expression. The frontal cortex, basal ganglia, reticular formation, some cranial nerve nuclei, deep cerebellar nuclei, and cerebellar Golgi cells appeared rather rich in all studied receptors. Based on our data, we suggest that in the adult CNS, PPARs and RXRs, besides playing roles common to many other tissues, may have specific functions in regulating the expression of genes involved in neurotransmission, and therefore play roles in complex processes, such as aging, neurodegeneration, learning and memory.

Simultaneous quantification of various retinoids by high performance liquid chromatography: its relevance to alcohol research.

PubMed

Yokoyama, H; Matsumoto, M; Shiraishi, H; Ishii, H

2000-04-01

We established a high performance liquid chromatography system that allowed simultaneous quantification of various retinoids. We applied the retinoids to a high performance liquid chromatography system with a silica gel absorption column. Samples were separated by the system with a binary multistep gradient with two kinds of solvent that contained n-Hexan, 2-propanol, and glacial acetic acid in different ratios. Each retinoid was detected at a wavelength of 350 nm. This condition allowed separation of 13-cis-retinoic acid, 9-cis-retinoic acid, all-trans-retinoic acid, 13-cis-retinol, all-trans-retinol, all-trans-4-oxo-retinoic acid, and 13-cis-4-oxo-retinoic acid as distinct single peaks. Each retinoid was also analyzed separately and its retention time determined. To ascertain the reliability of this system for retinoid quantification, retinoids at various concentrations were applied to the system. We observed the linearities between the concentration and area under the curve of the peak for each retinoid by linear least-squares regression analysis up to 2.5 ng/ml for all retinoic acids and up to 5 ng/ml for all retinols. There was no significant scattering in tests of within-day reproducibility or day-to-day reproducibility. Using this system, we examined effects of light exposure on isomerization of retinoids. When retinoids were exposed to room light for 2 hr, the amounts of all but 13-cis-retinol changed significantly. In particular, the amounts of all-trans-retinoic acid and 9-cis-retinoic acid were reduced by 40% and 60%, respectively. The HPLC system established in this study should be useful for studying the oxidation pathway of retinol to retinoic acid. A light-shielded condition is required when particular retinoic acids are analyzed.

MEK blockade converts AML differentiating response to retinoids into extensive apoptosis.

PubMed

Milella, Michele; Konopleva, Marina; Precupanu, Cristina M; Tabe, Yoko; Ricciardi, Maria Rosaria; Gregorj, Chiara; Collins, Steven J; Carter, Bing Z; D'Angelo, Carmen; Petrucci, Maria Teresa; Foà, Robin; Cognetti, Francesco; Tafuri, Agostino; Andreeff, Michael

2007-03-01

The aberrant function of transcription factors and/or kinase-based signaling pathways that regulate the ability of hematopoietic cells to proliferate, differentiate, and escape apoptosis accounts for the leukemic transformation of myeloid progenitors. Here, we demonstrate that simultaneous retinoid receptor ligation and blockade of the MEK/ERK signaling module, using the small-molecule inhibitor CI-1040, result in a strikingly synergistic induction of apoptosis in both acute myeloid leukemia (AML) and acute promyelocytic leukemia (APL) cells with constitutive ERK activation. This proapoptotic synergism requires functional RAR and RXR retinoid receptors, as demonstrated using RAR- and RXR-selective ligands and RAR-defective cells. In the presence of MEK inhibitors, however, retinoid-induced chromatin remodeling, target-gene transcription, and granulocytic differentiation are strikingly inhibited and apoptosis induction becomes independent of death-inducing ligand/receptor pairs; this suggests that apoptosis induction by combined retinoids and MEK inhibitors is entirely distinct from the classical "postmaturation" apoptosis induced by retinoids alone. Finally, we identify disruption of Bcl-2-dependent mitochondrial homeostasis as a possible point of convergence for the proapoptotic synergism observed with retinoids and MEK inhibitors. Taken together, these results indicate that combined retinoid treatment and MEK blockade exert powerful antileukemic effects and could be developed into a novel therapeutic strategy for both AML and APL.

ITE, a novel endogenous nontoxic aryl hydrocarbon receptor ligand, efficiently suppresses EAU and T-cell-mediated immunity.

PubMed

Nugent, Lindsey F; Shi, Guangpu; Vistica, Barbara P; Ogbeifun, Osato; Hinshaw, Samuel J H; Gery, Igal

2013-11-13

Ligands for aryl hydrocarbon receptor (AHR), such as dioxins, are highly toxic. One such ligand, TCDD, was found to exert potent immunosuppressive capacities in mice developing pathogenic autoimmune processes, including EAU, but its toxicity makes it unusable for humans. A recently identified endogenous AHR ligand, ITE, is also immunosuppressive, but is nontoxic and could therefore be useful for therapy in humans. Here, we tested ITE for its capacity to inhibit EAU and related immune responses. EAU was induced in B10.A mice by immunization with interphotoreceptor retinoid-binding protein (IRBP; 40 μg) in CFA. Treatment with ITE was by daily intraperitoneal injection of 0.2 mg. Disease severity was assessed by both fundoscopy and histological examination. Draining lymph node cells were tested for proliferation by thymidine uptake and for cytokine production and release by ELISA. In addition, the intracellular expression of cytokines and Foxp3 was determined by flow cytometry. Serum antibodies were measured by ELISA. Treatment with ITE efficiently inhibited the development of EAU in mice, as well as the cellular immune responses against IRBP and PPD. ITE treatment inhibited the expansion of both Th1 and Th17 subpopulations, as well as their release of the signature cytokines, IFN-gamma and IL-17. The treatment moderately increased, however, the proportion of Foxp3 expressing T-regulatory cells. Antibody production was not affected by the treatment. ITE, an endogenous AHR ligand, efficiently inhibits EAU development and related cellular immune responses. Being nontoxic, ITE may be considered for treatment of pathogenic immunity in humans.

ITE, A Novel Endogenous Nontoxic Aryl Hydrocarbon Receptor Ligand, Efficiently Suppresses EAU and T-Cell–Mediated Immunity

PubMed Central

Nugent, Lindsey F.; Shi, Guangpu; Vistica, Barbara P.; Ogbeifun, Osato; Hinshaw, Samuel J. H.; Gery, Igal

2013-01-01

Purpose. Ligands for aryl hydrocarbon receptor (AHR), such as dioxins, are highly toxic. One such ligand, TCDD, was found to exert potent immunosuppressive capacities in mice developing pathogenic autoimmune processes, including EAU, but its toxicity makes it unusable for humans. A recently identified endogenous AHR ligand, ITE, is also immunosuppressive, but is nontoxic and could therefore be useful for therapy in humans. Here, we tested ITE for its capacity to inhibit EAU and related immune responses. Methods. EAU was induced in B10.A mice by immunization with interphotoreceptor retinoid-binding protein (IRBP; 40 μg) in CFA. Treatment with ITE was by daily intraperitoneal injection of 0.2 mg. Disease severity was assessed by both fundoscopy and histological examination. Draining lymph node cells were tested for proliferation by thymidine uptake and for cytokine production and release by ELISA. In addition, the intracellular expression of cytokines and Foxp3 was determined by flow cytometry. Serum antibodies were measured by ELISA. Results. Treatment with ITE efficiently inhibited the development of EAU in mice, as well as the cellular immune responses against IRBP and PPD. ITE treatment inhibited the expansion of both Th1 and Th17 subpopulations, as well as their release of the signature cytokines, IFN-gamma and IL-17. The treatment moderately increased, however, the proportion of Foxp3 expressing T-regulatory cells. Antibody production was not affected by the treatment. Conclusions. ITE, an endogenous AHR ligand, efficiently inhibits EAU development and related cellular immune responses. Being nontoxic, ITE may be considered for treatment of pathogenic immunity in humans. PMID:24150760

Retinoid Binding Properties of Nucleotide Binding Domain 1 of the Stargardt Disease-associated ATP Binding Cassette (ABC) Transporter, ABCA4*

PubMed Central

Biswas-Fiss, Esther E.; Affet, Stephanie; Ha, Malissa; Biswas, Subhasis B.

2012-01-01

The retina-specific ATP binding cassette transporter, ABCA4 protein, is associated with a broad range of inherited macular degenerations, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. In order to understand its role in retinal transport in rod out segment discs, we have investigated the interactions of the soluble domains of ABCA4 with both 11-cis- and all-trans-retinal. Using fluorescence anisotropy-based binding analysis and recombinant polypeptides derived from the amino acid sequences of the four soluble domains of ABCA4, we demonstrated that the nucleotide binding domain 1 (NBD1) specifically bound 11-cis-retinal. Its affinity for all-trans-retinal was markedly reduced. Stargardt disease-associated mutations in this domain resulted in attenuation of 11-cis-retinal binding. Significant differences in 11-cis-retinal binding affinities were observed between NBD1 and other cytoplasmic and lumenal domains of ABCA4. The results suggest a possible role of ABCA4 and, in particular, the NBD1 domain in 11-cis-retinal binding. These results also correlate well with a recent report on the in vivo role of ABCA4 in 11-cis-retinal transport. PMID:23144455

Retinoids for prevention and treatment of actinic keratosis*

PubMed Central

Ianhez, Mayra; Fleury, Luiz Fernando Fróes; Miot, Hélio Amante; Bagatin, Edileia

2013-01-01

Actinic keratosis is a common cause of dermatological consultations and it presents a strong association with squamous cell carcinoma. Many substances are used for treatment and prevention, such as retinoids. Nevertheless, many studies on retinoids emphasize their application in treating and preventing non melanoma skin cancers. In this article, we reviewed studies about systemic and topical retinoids used with immunocompetent patients and organ transplant recipients with actinic keratosis, as primary or secondary outcomes. The majority of these papers pointed to a reduction in actinic keratosis count after treatment with retinoids. However, studies need to be better-defined in order to address the lack of a standardized dose, the absence of control groups, the low number of patients and short follow-up periods. Blind, randomized and controlled clinical trials with adequate sample sizes, specifically focused on actinic keratosis, are needed to clarify the real benefit of topical and/or oral retinoids. Comparison of efficacy and safety between oral and topical retinoids in the prevention and treatment of non-melanoma skin cancers and actinic keratosis is an essential pre requisite to establish new strategies to control these conditions. PMID:24068130

Are retinoids a promise for Alzheimer's disease management?

PubMed

Carratù, M R; Marasco, C; Signorile, A; Scuderi, C; Steardo, L

2012-01-01

Retinoids regulate several physiological and pathological processes through the interaction with nuclear receptors. Retinoid-associated signaling which plays an essential role in neurodevelopment appears to remain active in the adult central nervous system (CNS), thus assuming a high significance in the context of neurodegeneration, and indeed retinoid analogs are thought to be promising therapeutic agents for the treatment of neurodegenerative disorders. The ability of retinoids to exert antioxidant effects, inhibit amyloid-β (Aβ) deposits and likely Aβ-induced mitochondrial dysfunction, tau hyperphosphorylation, Aβ-induced IL6 production and neuroinflammation, increase survival in hippocampal neurons, and reverse cognitive deficits in animal models of Alzheimer's disease (AD) is discussed. Although retinoids with their multi-target activity are revealing to be promising for management of AD which is a multifaceted biochemical phenomenon, timing as well as appropriate dosage and safety remain, however, a challenge. The end-stage lesions, namely senile plaques and neurofibrillary tangles, are, at present, considered an adaptive response to oxidative stress underlying AD, thus paradoxically late administration of retinoids could even suppress a protective mechanism by inhibiting Aβ deposits.

Epigenetic Plasticity Drives Adipogenic and Osteogenic Differentiation of Marrow-derived Mesenchymal Stem Cells*

PubMed Central

Meyer, Mark B.; Benkusky, Nancy A.; Sen, Buer; Rubin, Janet; Pike, J. Wesley

2016-01-01

Terminal differentiation of multipotent stem cells is achieved through a coordinated cascade of activated transcription factors and epigenetic modifications that drive gene transcription responsible for unique cell fate. Within the mesenchymal lineage, factors such as RUNX2 and PPARγ are indispensable for osteogenesis and adipogenesis, respectively. We therefore investigated genomic binding of transcription factors and accompanying epigenetic modifications that occur during osteogenic and adipogenic differentiation of mouse bone marrow-derived mesenchymal stem cells (MSCs). As assessed by ChIP-sequencing and RNA-sequencing analyses, we found that genes vital for osteogenic identity were linked to RUNX2, C/EBPβ, retinoid X receptor, and vitamin D receptor binding sites, whereas adipocyte differentiation favored PPARγ, retinoid X receptor, C/EBPα, and C/EBPβ binding sites. Epigenetic marks were clear predictors of active differentiation loci as well as enhancer activities and selective gene expression. These marrow-derived MSCs displayed an epigenetic pattern that suggested a default preference for the osteogenic pathway; however, these patterns were rapidly altered near the Adipoq, Cidec, Fabp4, Lipe, Plin1, Pparg, and Cebpa genes during adipogenic differentiation. Surprisingly, we found that these cells also exhibited an epigenetic plasticity that enabled them to trans-differentiate from adipocytes to osteoblasts (and vice versa) after commitment, as assessed by staining, gene expression, and ChIP-quantitative PCR analysis. The osteogenic default pathway may be subverted during pathological conditions, leading to skeletal fragility and increased marrow adiposity during aging, estrogen deficiency, and skeletal unloading. Taken together, our data provide an increased mechanistic understanding of the epigenetic programs necessary for multipotent differentiation of MSCs that may prove beneficial in the development of therapeutic strategies. PMID:27402842

Retinoid production using metabolically engineered Escherichia coli with a two-phase culture system.

PubMed

Jang, Hui-Jeong; Yoon, Sang-Hwal; Ryu, Hee-Kyung; Kim, Jung-Hun; Wang, Chong-Long; Kim, Jae-Yean; Oh, Deok-Kun; Kim, Seon-Won

2011-07-29

Retinoids are lipophilic isoprenoids composed of a cyclic group and a linear chain with a hydrophilic end group. These compounds include retinol, retinal, retinoic acid, retinyl esters, and various derivatives of these structures. Retinoids are used as cosmetic agents and effective pharmaceuticals for skin diseases. Retinal, an immediate precursor of retinoids, is derived by β-carotene 15,15'-mono(di)oxygenase (BCM(D)O) from β-carotene, which is synthesized from the isoprenoid building blocks isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Retinoids are chemically unstable and biologically degraded via retinoic acid. Although extensive studies have been performed on the microbial production of carotenoids, retinoid production using microbial metabolic engineering has not been reported. Here, we report retinoid production using engineered Escherichia coli that express exogenous BCM(D)O and the mevalonate (MVA) pathway for the building blocks synthesis in combination with a two-phase culture system using a dodecane overlay. Among the BCM(D)O tested in E. coli, the synthetic retinoid synthesis protein (SR), based on bacteriorhodopsin-related protein-like homolog (Blh) of the uncultured marine bacteria 66A03, showed the highest β-carotene cleavage activity with no residual intracellular β-carotene. By introducing the exogenous MVA pathway, 8.7 mg/L of retinal was produced, which is 4-fold higher production than that of augmenting the MEP pathway (dxs overexpression). There was a large gap between retinal production and β-carotene consumption using the exogenous MVA pathway; therefore, the retinal derivatives were analyzed. The derivatives, except for retinoic acid, that formed were identified, and the levels of retinal, retinol, and retinyl acetate were measured. Amounts as high as 95 mg/L retinoids were obtained from engineered E. coli DH5α harboring the synthetic SR gene and the exogenous MVA pathway in addition to dxs overexpression, which were cultured at 29°C for 72 hours with 2YT medium containing 2.0% (w/v) glycerol as the main carbon source. However, a significant level of intracellular degradation of the retinoids was also observed in the culture. To prevent degradation of the intracellular retinoids through in situ extraction from the cells, a two-phase culture system with dodecane was used. The highest level of retinoid production (136 mg/L) was obtained after 72 hours with 5 mL of dodecane overlaid on a 5 mL culture. In this study, we successfully produced 136 mg/L retinoids, which were composed of 67 mg/L retinal, 54 mg/L retinol, and 15 mg/L retinyl acetate, using a two-phase culture system with dodecane, which produced 68-fold more retinoids than the initial level of production (2.2 mg/L). Our results demonstrate the potential use of E. coli as a promising microbial cell factory for retinoid production.

Temporal distribution of endogenous retinoids in the embryonic mouse mandible.

PubMed

Beeman, C S; Kronmiller, J E

1994-09-01

Retinoids play an important part in embryonic pattern formation. They are necessary for normal differentiation of odontogenic tissues and, in excess, disrupt the pattern of tooth formation. Excess retinoids produce supernumerary buds of the dental lamina in the diastema region of the mouse embryonic mandible where teeth do not normally form. This effect is coincident with an increase in epithelial proliferation and an alteration in epidermal growth factor mRNA expression (a gene product necessary for tooth formation). It was found by high-performance liquid chromatography that endogenous retinoids are present in the developing murine mandible and that concentrations of some retinoids reach a peak at the time of the initiation of odontogenesis (dental lamina formation).

Skincare science: update on topical retinoids.

PubMed

Boswell, C B

2006-01-01

According to the author, the single most effective component in a skincare regimen for reversal of photoaging is the use of retinoids. Here is a guide to the mechanism and application of various formulations of retinoids, and a comprehensive skin regimen incorporating tretinoin.

A forward chemical screen in zebrafish identifies a retinoic acid derivative with receptor specificity.

PubMed

Das, Bhaskar C; McCartin, Kellie; Liu, Ting-Chun; Peterson, Randall T; Evans, Todd

2010-04-02

Retinoids regulate key developmental pathways throughout life, and have potential uses for differentiation therapy. It should be possible to identify novel retinoids by coupling new chemical reactions with screens using the zebrafish embryonic model. We synthesized novel retinoid analogues and derivatives by amide coupling, obtaining 80-92% yields. A small library of these compounds was screened for bioactivity in living zebrafish embryos. We found that several structurally related compounds significantly affect development. Distinct phenotypes are generated depending on time of exposure, and we characterize one compound (BT10) that produces specific cardiovascular defects when added 1 day post fertilization. When compared to retinoic acid (ATRA), BT10 shows similar but not identical changes in the expression pattern of embryonic genes that are known targets of the retinoid pathway. Reporter assays determined that BT10 interacts with all three RAR receptor sub-types, but has no activity for RXR receptors, at all concentrations tested. Our screen has identified a novel retinoid with specificity for retinoid receptors. This lead compound may be useful for manipulating components of retinoid signaling networks, and may be further derivatized for enhanced activity.

Mefloquine use, psychosis, and violence: a retinoid toxicity hypothesis.

PubMed

Mawson, Anthony

2013-07-15

Mefloquine use has been linked to severe gastrointestinal and neuropsychiatric adverse effects, including cognitive disturbances, anxiety, depression, psychosis, and violence. The adverse effects of the drug are thought to result from the secondary consequences of hepatocellular injury; in fact, mefloquine is known to cause a transient, anicteric chemical hepatitis. However, the mechanism of mefloquine-associated liver damage and the associated neuropsychiatric and behavioral effects of the drug are not well understood. Mefloquine and other 8-amino-quinolines are the only antimalarial drugs that target the liver-stage malaria parasites, which selectively absorb vitamin A from the host. Vitamin A is also stored mainly in the liver, in potentially poisonous concentrations. These observations suggest that both the therapeutic effectiveness of mefloquine and its adverse effects are related to the ability of the 8-aminoquinolines to alter the metabolism of retinoids (vitamin A and its congeners). Several lines of evidence support the hypothesis that mefloquine neurotoxicity and other adverse effects reflect an endogenous form of hypervitaminosis A due to a process involving: mefloquine-induced dehydrogenase inhibition; the accumulation of retinoids in the liver; retinoid-induced hepatocellular damage; the spillage of stored retinoids into the circulation; and the transport of these compounds to the gut and brain in toxic concentrations. The retinoid hypothesis could be tested clinically by comparing cases of mefloquine toxicity and untreated controls in terms of retinoid profiles (retinol, retinyl esters, percent retinyl esters, and retinoic acid). Subject to such tests, retinoid profiling could provide an indicator for assessing mefloquine-associated adverse effects.

A molecular mechanism of optic nerve regeneration in fish: the retinoid signaling pathway.

PubMed

Kato, Satoru; Matsukawa, Toru; Koriyama, Yoshiki; Sugitani, Kayo; Ogai, Kazuhiro

2013-11-01

The fish optic nerve regeneration process takes more than 100 days after axotomy and comprises four stages: neurite sprouting (1-4 days), axonal elongation (5-30 days), synaptic refinement (35-80 days) and functional recovery (100-120 days). We screened genes specifically upregulated in each stage from axotomized fish retina. The mRNAs for heat shock protein 70 and insulin-like growth factor-1 rapidly increased in the retinal ganglion cells soon after axotomy and function as cell-survival factors. Purpurin mRNA rapidly and transiently increased in the photoreceptors and purpurin protein diffusely increased in all nuclear layers at 1-4 days after injury. The purpurin gene has an active retinol-binding site and a signal peptide. Purpurin with retinol functions as a sprouting factor for thin neurites. This neurite-sprouting effect was closely mimicked by retinoic acid and blocked by its inhibitor. We propose that purpurin works as a retinol transporter to supply retinoic acid to damaged RGCs which in turn activates target genes. We also searched for genes involved in the second stage of regeneration. The mRNA of retinoid-signaling molecules increased in retinal ganglion cells at 7-14 days after injury and tissue transglutaminase and neuronal nitric oxide synthase mRNAs, RA-target genes, increased in retinal ganglion cells at 10-30 days after injury. They function as factors for the outgrowth of thick, long neurites. Here we present a retinoid-signaling hypothesis to explain molecular events during the early stages of optic nerve regeneration in fish. Copyright © 2013 Elsevier Ltd. All rights reserved.

PNPLA3 has retinyl-palmitate lipase activity in human hepatic stellate cells

PubMed Central

Pirazzi, Carlo; Valenti, Luca; Motta, Benedetta Maria; Pingitore, Piero; Hedfalk, Kristina; Mancina, Rosellina Margherita; Burza, Maria Antonella; Indiveri, Cesare; Ferro, Yvelise; Montalcini, Tiziana; Maglio, Cristina; Dongiovanni, Paola; Fargion, Silvia; Rametta, Raffaela; Pujia, Arturo; Andersson, Linda; Ghosal, Saswati; Levin, Malin; Wiklund, Olov; Iacovino, Michelina; Borén, Jan; Romeo, Stefano

2014-01-01

Retinoids are micronutrients that are stored as retinyl esters in the retina and hepatic stellate cells (HSCs). HSCs are key players in fibrogenesis in chronic liver diseases. The enzyme responsible for hydrolysis and release of retinyl esters from HSCs is unknown and the relationship between retinoid metabolism and liver disease remains unclear. We hypothesize that the patatin-like phospholipase domain-containing 3 (PNPLA3) protein is involved in retinol metabolism in HSCs. We tested our hypothesis both in primary human HSCs and in a human cohort of subjects with non-alcoholic fatty liver disease (N = 146). Here we show that PNPLA3 is highly expressed in human HSCs. Its expression is regulated by retinol availability and insulin, and increased PNPLA3 expression results in reduced lipid droplet content. PNPLA3 promotes extracellular release of retinol from HSCs in response to insulin. We also show that purified wild-type PNPLA3 hydrolyzes retinyl palmitate into retinol and palmitic acid. Conversely, this enzymatic activity is markedly reduced with purified PNPLA3 148M, a common mutation robustly associated with liver fibrosis and hepatocellular carcinoma development. We also find the PNPLA3 I148M genotype to be an independent (P = 0.009 in a multivariate analysis) determinant of circulating retinol-binding protein 4, a reliable proxy for retinol levels in humans. This study identifies PNPLA3 as a lipase responsible for retinyl-palmitate hydrolysis in HSCs in humans. Importantly, this indicates a potential novel link between HSCs, retinoid metabolism and PNPLA3 in determining the susceptibility to chronic liver disease. PMID:24670599

PNPLA3 has retinyl-palmitate lipase activity in human hepatic stellate cells.

PubMed

Pirazzi, Carlo; Valenti, Luca; Motta, Benedetta Maria; Pingitore, Piero; Hedfalk, Kristina; Mancina, Rosellina Margherita; Burza, Maria Antonella; Indiveri, Cesare; Ferro, Yvelise; Montalcini, Tiziana; Maglio, Cristina; Dongiovanni, Paola; Fargion, Silvia; Rametta, Raffaela; Pujia, Arturo; Andersson, Linda; Ghosal, Saswati; Levin, Malin; Wiklund, Olov; Iacovino, Michelina; Borén, Jan; Romeo, Stefano

2014-08-01

Retinoids are micronutrients that are stored as retinyl esters in the retina and hepatic stellate cells (HSCs). HSCs are key players in fibrogenesis in chronic liver diseases. The enzyme responsible for hydrolysis and release of retinyl esters from HSCs is unknown and the relationship between retinoid metabolism and liver disease remains unclear. We hypothesize that the patatin-like phospholipase domain-containing 3 (PNPLA3) protein is involved in retinol metabolism in HSCs. We tested our hypothesis both in primary human HSCs and in a human cohort of subjects with non-alcoholic fatty liver disease (N = 146). Here we show that PNPLA3 is highly expressed in human HSCs. Its expression is regulated by retinol availability and insulin, and increased PNPLA3 expression results in reduced lipid droplet content. PNPLA3 promotes extracellular release of retinol from HSCs in response to insulin. We also show that purified wild-type PNPLA3 hydrolyzes retinyl palmitate into retinol and palmitic acid. Conversely, this enzymatic activity is markedly reduced with purified PNPLA3 148M, a common mutation robustly associated with liver fibrosis and hepatocellular carcinoma development. We also find the PNPLA3 I148M genotype to be an independent (P = 0.009 in a multivariate analysis) determinant of circulating retinol-binding protein 4, a reliable proxy for retinol levels in humans. This study identifies PNPLA3 as a lipase responsible for retinyl-palmitate hydrolysis in HSCs in humans. Importantly, this indicates a potential novel link between HSCs, retinoid metabolism and PNPLA3 in determining the susceptibility to chronic liver disease. © The Author 2014. Published by Oxford University Press.

Placental transfer and developmental effects of 9-cis retinoic acid in mice.

PubMed

Kochhar, D M; Jiang, H; Penner, J D; Heyman, R A

1995-04-01

9-cis retinoic acid (RA) is a naturally occurring isomer of all-trans RA. While both isomers can bind with high affinity and activate RA receptors, only 9-cis RA is the specific ligand for the retinoid X receptors. 9-cis RA has also been shown to be much more potent than all-trans RA in inducing digit duplication in the chick embryo wing bud. To gain further insight into its mechanisms, here we investigated the teratogenic activity in pregnant mice of 9-cis RA and compared it with those of all-trans RA and 13-cis RA. Using frequency and severity of limb reduction defects as well as palatal clefts in the resultant fetuses as indicators, we found that orally administered 9-cis RA was one-half as potent a teratogen as all-trans RA. That 9-cis RA was intrinsically less active than all-trans RA was deduced by comparing the inhibitory activities of the two retinoids in the limb bud mesenchymal cell micromass cultures using chondrogenesis as an end-point. Since placental transfer of cis isomers of RA is generally poor, we monitored the identities and amounts of retinoids in the embryo after administration of 9-cis RA to the mother. We found that 9-cis RA undergoes extensive metabolism and isomerization during absorption resulting in a number of metabolites in the maternal circulation within 30 min after administration. Although some of these metabolites remain to be identified, the most abundant RA isomers in the plasma coeluted with 13-cis RA.(ABSTRACT TRUNCATED AT 250 WORDS)

Evidence for metabolic imbalance of vitamin A2 in wild fish chronically exposed to metals.

PubMed

Defo, Michel A; Pierron, Fabien; Spear, Philip A; Bernatchez, Louis; Campbell, Peter G C; Couture, Patrice

2012-11-01

In a recent study on indigenous yellow perch chronically exposed to metals, we reported a negative correlation between liver metal concentration and liver transcription levels of genes encoding for enzymes involved in the metabolism of retinoids. We therefore speculated that metals, and especially the non-essential metal Cd, could alter the metabolism of retinoids in wild fish. Thus the present field study investigates the impact of in situ metal exposure on retinoid storage. A total of 55 yellow perch (Perca flavescens) were sampled in six lakes representing a metal contamination gradient (8≤N≤10 per lake). Our results show that yellow perch from Cd-contaminated lakes had significantly higher concentrations of liver dehydroretinol and dehydroretinyl esters than did fish from reference lakes. However, the increase in retinyl ester stores with increasing Cd concentrations was quantitatively much more important than the increase in free dehydroretinol. As a result, a significant decrease in the percentage of hepatic free dehydroretinol with increasing renal Cd concentrations was observed. These results suggest that the enzymes and the binding proteins involved in vitamin A homeostasis are inhibited by the presence of Cd. Alternatively, the increase in tissue vitamin A (antioxidant) levels could serve to better counteract the oxidative stress engendered by Cd exposure. Overall our findings illustrate that vitamin A(2) homeostasis can be altered as a consequence of chronic exposure to low Cd concentrations. Thus, in the context of environmental risk assessment, the percentage of liver free dehydroretinol can be considered as a biomarker of for in situ Cd exposure. Copyright © 2012 Elsevier Inc. All rights reserved.

Key enzymes of the retinoid (visual) cycle in vertebrate retina

PubMed Central

Kiser, Philip D.; Golczak, Marcin; Maeda, Akiko; Palczewski, Krzysztof

2011-01-01

A major goal in vision research over the past few decades has been to understand the molecular details of retinoid processing within the retinoid (visual) cycle. This includes the consequences of side reactions that result from delayed all-trans-retinal clearance and condensation with phospholipids that characterize a variety of serious retinal diseases. Knowledge of the basic retinoid biochemistry involved in these diseases is essential for development of effective therapeutics. Photoisomerization of the 11-cis-retinal chromophore of rhodopsin triggers a complex set of metabolic transformations collectively termed phototransduction that ultimately lead to light perception. Continuity of vision depends on continuous conversion of all-trans-retinal back to the 11-cis-retinal isomer. This process takes place in a series of reactions known as the retinoid cycle, which occur in photoreceptor and RPE cells. All-trans-retinal, the initial substrate of this cycle, is a chemically reactive aldehyde that can form toxic conjugates with proteins and lipids. Therefore, much experimental effort has been devoted to elucidate molecular mechanisms of the retinoid cycle and all-trans-retinal-mediated retinal degeneration, resulting in delineation of many key steps involved in regenerating 11-cis-retinal. Three particularly important reactions are catalyzed by enzymes broadly classified as acyltransferases, short-chain dehydrogenases/reductases and carotenoid/retinoid isomerases/oxygenases. PMID:21447403

Activation of RXR–PPAR heterodimers by organotin environmental endocrine disruptors

PubMed Central

le Maire, Albane; Grimaldi, Marina; Roecklin, Dominique; Dagnino, Sonia; Vivat-Hannah, Valérie; Balaguer, Patrick; Bourguet, William

2009-01-01

The nuclear receptor retinoid X receptor-α (RXR-α)–peroxisome proliferator-activated receptor-γ (PPAR-γ) heterodimer was recently reported to have a crucial function in mediating the deleterious effects of organotin compounds, which are ubiquitous environmental contaminants. However, because organotins are unrelated to known RXR-α and PPAR-γ ligands, the mechanism by which these compounds bind to and activate the RXR-α–PPAR-γ heterodimer at nanomolar concentrations has remained elusive. Here, we show that tributyltin (TBT) activates all three RXR–PPAR-α, -γ, -δ heterodimers, primarily through its interaction with RXR. In addition, the 1.9 Å resolution structure of the RXR-α ligand-binding domain in complex with TBT shows a covalent bond between the tin atom and residue Cys 432 of helix H11. This interaction largely accounts for the high binding affinity of TBT, which only partly occupies the RXR-α ligand-binding pocket. Our data allow an understanding of the binding and activation properties of the various organotins and suggest a mechanism by which these tin compounds could affect other nuclear receptor signalling pathways. PMID:19270714

Endocrine, teratogenic and neurotoxic effects of cyanobacteria detected by cellular in vitro and zebrafish embryos assays.

PubMed

Jonas, Adam; Scholz, Stefan; Fetter, Eva; Sychrova, Eliska; Novakova, Katerina; Ortmann, Julia; Benisek, Martin; Adamovsky, Ondrej; Giesy, John P; Hilscherova, Klara

2015-02-01

Cyanobacteria contain various types of bioactive compounds, which could cause adverse effects on organisms. They are released into surface waters during cyanobacterial blooms, but there is little information on their potential relevance for effects in vivo. In this study presence of bioactive compounds was characterized in cyanobacteria Microcystis aeruginosa (Chroococcales), Planktothrix agardhii (Oscillatoriales) and Aphanizomenon gracile (Nostocales) with selected in vitro assays. The in vivo relevance of detected bioactivities was analysed using transgenic zebrafish embryos tg(cyp19a1b-GFP). Teratogenic potency was assessed by analysis of developmental disorders and effects on functions of the neuromuscular system by video tracking of locomotion. Estrogenicity in vitro corresponded to 0.95-54.6 ng estradiol equivalent(g dry weight (dw))(-1). In zebrafish embryos, estrogenic effects could not be detected potentially because they were masked by high toxicity. There was no detectable (anti)androgenic/glucocorticoid activity in any sample. Retinoid-like activity was determined at 1-1.3 μg all-trans-retinoic acid equivalent(g dw)(-1). Corresponding to the retinoid-like activity A. gracile extract also caused teratogenic effects in zebrafish embryos. Furthermore, exposure to biomass extracts at 0.3 gd wL(-1) caused increase of body length in embryos. There were minor effects on locomotion caused by 0.3 gd wL(-1)M. aeruginosa and P. agardhii extracts. The traditionally measured cyanotoxins microcystins did not seem to play significant role in observed effects. This indicates importance of other cyanobacterial compounds at least towards some species or their developmental phases. More attention should be paid to activity of retinoids, estrogens and other bioactive substances in phytoplankton using in vitro and in vivo bioassays. Copyright © 2014 Elsevier Ltd. All rights reserved.

Modulation of 3-methylcholanthrene toxicity in cultured neoplastic keratinocytes by glucocorticoids and retinoids is not accounted for by macromolecular adduct formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rubin, A.L.; Rice, R.H.

3-Methylcholanthrene (3-MC) greatly inhibits the growth of two lines of human squamous carcinoma cells, SCC-9 and SCC-12B{sub 2}. The degree of 3-MC-mediated inhibition, however, was markedly alleviated by inclusion of retinoic acid and hydrocortisone or dexamethasone in the culture medium. These physiological effectors, which are known to have opposing actions on keratinocyte character in SCC cells, did not significantly alter either aryl hydrocarbon hydroxylase activity or macromolecular adduct formation. Further analysis of the cellular responses indicated that hydrocortisone and, in some experiments, retinoids increased the growth rate in 3-MC-exposed cultures, while 3-MC increased the saturation density in retinoic acid-exposed cultures,more » an example of interference with a physiological response of the cells. These results indicate that alteration of the differentiated state, regardless of the direction of the change, can alter the sensitivity of these cells to toxic stimuli. Further investigation of the bases of such toxic responses and their modulation by the microenvironment may enhance our understanding of the target cell specificity of polycyclic aromatic hydrocarbons.« less

Mefloquine use, psychosis, and violence: A retinoid toxicity hypothesis

PubMed Central

Mawson, Anthony R.

2013-01-01

Mefloquine use has been linked to severe gastrointestinal and neuropsychiatric adverse effects, including cognitive disturbances, anxiety, depression, psychosis, and violence. The adverse effects of the drug are thought to result from the secondary consequences of hepatocellular injury; in fact, mefloquine is known to cause a transient, anicteric chemical hepatitis. However, the mechanism of mefloquine-associated liver damage and the associated neuropsychiatric and behavioral effects of the drug are not well understood. Mefloquine and other 8-amino-quinolines are the only antimalarial drugs that target the liver-stage malaria parasites, which selectively absorb vitamin A from the host. Vitamin A is also stored mainly in the liver, in potentially poisonous concentrations. These observations suggest that both the therapeutic effectiveness of mefloquine and its adverse effects are related to the ability of the 8-aminoquinolines to alter the metabolism of retinoids (vitamin A and its congeners). Several lines of evidence support the hypothesis that mefloquine neurotoxicity and other adverse effects reflect an endogenous form of hypervitaminosis A due to a process involving: mefloquine-induced dehydrogenase inhibition; the accumulation of retinoids in the liver; retinoid-induced hepatocellular damage; the spillage of stored retinoids into the circulation; and the transport of these compounds to the gut and brain in toxic concentrations. The retinoid hypothesis could be tested clinically by comparing cases of mefloquine toxicity and untreated controls in terms of retinoid profiles (retinol, retinyl esters, percent retinyl esters, and retinoic acid). Subject to such tests, retinoid profiling could provide an indicator for assessing mefloquine-associated adverse effects. PMID:23852388

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

Chromosomal locations and modes of action of genes of the retinoid (vitamin A) system support their involvement in the etiology of schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodman, A.B.

1995-08-14

Vitamin A (retinoid), an essential nutrient for fetal and subsequent mammalian development, is involved in gene expression, cell differentiation, proliferation, migration, and death. Retinoic acid (RA) the morphogenic derivative of vitamin A is highly teratogenic. In humans retinoid excess or deficit can result in brain anomalies and psychosis. This review discusses chromosomal loci of genes that control the retinoid cascade in relation to some candidate genes in schizophrenia. The paper relates the knowledge about the transport, delivery, and action of retinoids to what is presently known about the pathology of schizophrenia, with particular reference to the dopamine hypothesis, neurotransmitters, themore » glutamate hypothesis, neurotransmitters, the glutamate hypothesis, retinitis pigmentosa, dermatologic disorders, and craniofacial anomalies. 201 refs., 1 tab.« less

ATP7A is a novel target of retinoic acid receptor β2 in neuroblastoma cells

PubMed Central

Bohlken, A; Cheung, B B; Bell, J L; Koach, J; Smith, S; Sekyere, E; Thomas, W; Norris, M; Haber, M; Lovejoy, D B; Richardson, D R; Marshall, G M

2009-01-01

Increased retinoic acid receptor β (RARβ2) gene expression is a hallmark of cancer cell responsiveness to retinoid anticancer effects. Moreover, low basal or induced RARβ2 expression is a common feature of many human cancers, suggesting that RARβ2 may act as a tumour suppressor gene in the absence of supplemented retinoid. We have previously shown that low RARβ2 expression is a feature of advanced neuroblastoma. Here, we demonstrate that the ABC domain of the RARβ2 protein alone was sufficient for the growth inhibitory effects of RARβ2 on neuroblastoma cells. ATP7A, the copper efflux pump, is a retinoid-responsive gene, was upregulated by ectopic overexpression of RARβ2. The ectopic overexpression of the RARβ2 ABC domain was sufficient to induce ATP7A expression, whereas, RARβ2 siRNA blocked the induction of ATP7A expression in retinoid-treated neuroblastoma cells. Forced downregulation of ATP7A reduced copper efflux and increased viability of retinoid-treated neuroblastoma cells. Copper supplementation enhanced cell growth and reduced retinoid-responsiveness, whereas copper chelation reduced the viability and proliferative capacity. Taken together, our data demonstrates ATP7A expression is regulated by retinoic acid receptor β and it has effects on intracellular copper levels, revealing a link between the anticancer action of retinoids and copper metabolism. PMID:19127267

Human Blue Cone Opsin Regeneration Involves Secondary Retinal Binding with Analog Specificity.

PubMed

Srinivasan, Sundaramoorthy; Fernández-Sampedro, Miguel A; Morillo, Margarita; Ramon, Eva; Jiménez-Rosés, Mireia; Cordomí, Arnau; Garriga, Pere

2018-03-27

Human color vision is mediated by the red, green, and blue cone visual pigments. Cone opsins are G-protein-coupled receptors consisting of an opsin apoprotein covalently linked to the 11-cis-retinal chromophore. All visual pigments share a common evolutionary origin, and red and green cone opsins exhibit a higher homology, whereas blue cone opsin shows more resemblance to the dim light receptor rhodopsin. Here we show that chromophore regeneration in photoactivated blue cone opsin exhibits intermediate transient conformations and a secondary retinoid binding event with slower binding kinetics. We also detected a fine-tuning of the conformational change in the photoactivated blue cone opsin binding site that alters the retinal isomer binding specificity. Furthermore, the molecular models of active and inactive blue cone opsins show specific molecular interactions in the retinal binding site that are not present in other opsins. These findings highlight the differential conformational versatility of human cone opsin pigments in the chromophore regeneration process, particularly compared to rhodopsin, and point to relevant functional, unexpected roles other than spectral tuning for the cone visual pigments. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells.

PubMed

Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

2017-12-14

Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations.

Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells

PubMed Central

Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

2017-01-01

Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations. PMID:28846104

Evolution of Retinoid and Steroid Signaling: Vertebrate Diversification from an Amphioxus Perspective

PubMed Central

Albalat, Ricard; Brunet, Frédéric; Laudet, Vincent; Schubert, Michael

2011-01-01

Although the physiological relevance of retinoids and steroids in vertebrates is very well established, the origin and evolution of the genetic machineries implicated in their metabolic pathways is still very poorly understood. We investigated the evolution of these genetic networks by conducting an exhaustive survey of components of the retinoid and steroid pathways in the genome of the invertebrate chordate amphioxus (Branchiostoma floridae). Due to its phylogenetic position at the base of chordates, amphioxus is a very useful model to identify and study chordate versus vertebrate innovations, both on a morphological and a genomic level. We have characterized more than 220 amphioxus genes evolutionarily related to vertebrate components of the retinoid and steroid pathways and found that, globally, amphioxus has orthologs of most of the vertebrate components of these two pathways, with some very important exceptions. For example, we failed to identify a vertebrate-like machinery for retinoid storage, transport, and delivery in amphioxus and were also unable to characterize components of the adrenal steroid pathway in this invertebrate chordate. The absence of these genes from the amphioxus genome suggests that both an elaboration and a refinement of the retinoid and steroid pathways took place at the base of the vertebrate lineage. In stark contrast, we also identified massive amplifications in some amphioxus gene families, most extensively in the short-chain dehydrogenase/reductase superfamily, which, based on phylogenetic and genomic linkage analyses, were likely the result of duplications specific to the amphioxus lineage. In sum, this detailed characterization of genes implicated in retinoid and steroid signaling in amphioxus allows us not only to reconstruct an outline of these pathways in the ancestral chordate but also to discuss functional innovations in retinoid homeostasis and steroid-dependent regulation in both cephalochordate and vertebrate evolution. PMID:21856648

13-cis Retinoic Acid Inhibits Development and Progression of Chronic Allograft Nephropathy

PubMed Central

Adams, Judith; Kiss, Eva; Arroyo, Ana B.V.; Bonrouhi, Mahnaz; Sun, Qiang; Li, Zhen; Gretz, Norbert; Schnitger, Anna; Zouboulis, Christos C.; Wiesel, Manfred; Wagner, Jürgen; Nelson, Peter J.; Gröne, Hermann-Josef

2005-01-01

Chronic allograft nephropathy is characterized by chronic inflammation and fibrosis. Because retinoids exhibit anti-proliferative, anti-inflammatory, and anti-fibrotic functions, the effects of low and high doses of 13-cis-retinoic acid (13cRA) were studied in a chronic Fisher344→Lewis transplantation model. In 13cRA animals, independent of dose (2 or 20 mg/kg body weight/day) and start (0 or 14 days after transplantation) of 13cRA administration, serum creatinine was significantly lower and chronic rejection damage was dramatically reduced, including subendothelial fibrosis of preglomerular vessels and chronic tubulointerstitial damage. The number of infiltrating mononuclear cells and their proliferative activity were significantly diminished. The mRNA expression of chemokines (MCP-1/CCL2, MIP-1α/CCL3, IP-10/CXCL10, RANTES/CCL5) and proteins associated with fibrosis (plasminogen activator inhibitor-1, transforming growth factor-β1, and collagens I and III) were strikingly lower in treated allografts. In vitro, activated peritoneal macrophages of 13cRA-treated rats showed a pronounced decrease in protein secretion of inflammatory cytokines (eg, tumor necrosis factor-α, interleukin-6). The suppression of the proinflammatory chemokine RANTES/CCL5 × 13cRA in fibroblasts could be mapped to a promoter module comprising IRF-1 and nuclear factor-κB binding elements, but direct binding of retinoid receptors to promoter elements could be excluded. In summary, 13cRA acted as a potent immunosuppressive and anti-fibrotic agent able to prevent and inhibit progression of chronic allograft nephropathy. PMID:15972972

Retinoids and azelaic acid to treat acne and hyperpigmentation in skin of color.

PubMed

Woolery-Lloyd, Heather C; Keri, Jonette; Doig, Stefan

2013-04-01

In this review, we examine published data reporting the efficacy of pharmaceutical agents to treat associated postinflammatory hyperpigmentation commonly seen in skin of color. Retinoids and azelaic acid have been widely used to treat acne. Now there are increasing data describing their use in skin of color for the treatment of both acne and the subsequent postinflammatory hyperpigmentation. Historically, some dermatologists have been hesitant to use retinoids in skin of color because of perceived hypersensitivity in this patient population. However, recent data support the use of retinoids and azelaic acid in skin of color as both safe and beneficial.

9-Cis-Retinoic Acid Induces Growth Inhibition in Retinoid-Sensitive Breast Cancer and Sea Urchin Embryonic Cells via Retinoid X Receptor α and Replication Factor C3

PubMed Central

Maeng, Sejung; Kim, Gil Jung; Choi, Eun Ju; Yang, Hyun Ok; Lee, Dong-Sup

2012-01-01

There is widespread interest in defining factors and mechanisms that suppress the proliferation of cancer cells. Retinoic acid (RA) is a potent suppressor of mammary cancer and developmental embryonic cell proliferation. However, the molecular mechanisms by which 9-cis-RA signaling induces growth inhibition in RA-sensitive breast cancer and embryonic cells are not apparent. Here, we provide evidence that the inhibitory effect of 9-cis-RA on cell proliferation depends on 9-cis-RA-dependent interaction of retinoid X receptor α (RXRα) with replication factor C3 (RFC3), which is a subunit of the RFC heteropentamer that opens and closes the circular proliferating cell nuclear antigen (PCNA) clamp on DNA. An RFC3 ortholog in a sea urchin cDNA library was isolated by using the ligand-binding domain of RXRα as bait in a yeast two-hybrid screening. The interaction of RFC3 with RXRα depends on 9-cis-RA and bexarotene, but not on all-trans-RA or an RA receptor (RAR)-selective ligand. Truncation and mutagenesis experiments demonstrated that the C-terminal LXXLL motifs in both human and sea urchin RFC3 are critical for the interaction with RXRα. The transient interaction between 9-cis-RA-activated RXRα and RFC3 resulted in reconfiguration of the PCNA-RFC complex. Furthermore, we found that knockdown of RXRα or overexpression of RFC3 impairs the ability of 9-cis-RA to inhibit proliferation of MCF-7 breast cancer cells and sea urchin embryogenesis. Our results indicate that 9-cis-RA-activated RXRα suppresses the growth of RA-sensitive breast cancer and embryonic cells through RFC3. PMID:22949521

Nuclear retinoid receptors and pregnancy: placental transfer, functions, and pharmacological aspects.

PubMed

Comptour, Aurélie; Rouzaire, Marion; Belville, Corinne; Bouvier, Damien; Gallot, Denis; Blanchon, Loïc; Sapin, Vincent

2016-10-01

Animal models of vitamin A (retinol) deficiency have highlighted its crucial role in reproduction and placentation, whereas an excess of retinoids (structurally or functionally related entities) can cause toxic and teratogenic effects in the embryo and foetus, especially in the first trimester of human pregnancy. Knock-out experimental strategies-targeting retinoid nuclear receptors RARs and RXRs have confirmed that the effects of vitamin A are mediated by retinoic acid (especially all-trans retinoic acid) and that this vitamin is essential for the developmental process. All these data show that the vitamin A pathway and metabolism are as important for the well-being of the foetus, as they are for that of the adult. Accordingly, during this last decade, extensive research on retinoid metabolism has yielded detailed knowledge on all the actors in this pathway, spurring the development of antagonists and agonists for therapeutic and research applications. Natural and synthetic retinoids are currently used in clinical practice, most often on the skin for the treatment of acne, and as anti-oncogenic agents in acute promyelocytic leukaemia. However, because of the toxicity and teratogenicity of retinoids during pregnancy, their pharmacological use needs a sound knowledge of their metabolism, molecular aspects, placental transfer, and action.

Insights into the pathogenesis of dominant retinitis pigmentosa associated with a D477G mutation in RPE65.

PubMed

Choi, Elliot H; Suh, Susie; Sander, Christopher L; Hernandez, Christian J Ortiz; Bulman, Elizabeth R; Khadka, Nimesh; Dong, Zhiqian; Shi, Wuxian; Palczewski, Krzysztof; Kiser, Philip D

2018-04-12

RPE65 is the essential trans-cis isomerase of the classical retinoid (visual) cycle. Mutations in RPE65 give rise to severe retinal dystrophies, most of which are associated with loss of protein function and recessive inheritance. The only known exception is a c.1430G>A (D477G) mutation that gives rise to dominant retinitis pigmentosa with delayed onset and choroidal and macular involvement. Position 477 is distant from functionally critical regions of RPE65. Hence, the mechanism of D477G pathogenicity remains unclear, although protein misfolding and aggregation mechanisms have been suggested. We characterized a D477G knock-in mouse model which exhibited mild age-dependent changes in retinal structure and function. Immunoblot analysis of protein extracts from the eyes of the knock-in mice demonstrated the presence of ubiquitinated RPE65 and reduced RPE65 expression. We observed an accumulation of retinyl esters in the knock-in mice as well as a delay in rhodopsin regeneration kinetics and diminished electroretinography responses, indicative of RPE65 functional impairment induced by the D477G mutation in vivo. However, a cell line expressing D477G RPE65 revealed protein expression levels, cellular localization, and retinoid isomerase activity comparable to cells expressing wild-type protein. Structural analysis of an RPE65 chimera suggested that the D477G mutation does not perturb protein folding or tertiary structure. Instead, the mutation generates an aggregation-prone surface that could induce cellular toxicity through abnormal complex formation as suggested by crystal packing analysis. These results indicate that a toxic gain-of-function induced by the D477G RPE65 substitution may play a role in the pathogenesis of this form of dominant retinitis pigmentosa.

Breastfeeding, retinoids, and postpartum depression: a new theory.

PubMed

Mawson, Anthony R; Xueyuan, Wang

2013-09-25

Postpartum depression (PPD) is an international public health problem affecting at least 1 in 8 mothers. Known risk factors include: giving birth to a preterm or low birth weight infant, babies with greater symptoms of illness at age 4-6 weeks, formula feeding, younger maternal age, smoking, and fatigue. Prolonged breastfeeding is associated with a reduced risk of PPD but the mechanisms are not well understood. Interventions for PPD focusing on psychosocial risk factors have been largely unsuccessful, suggesting that the condition has a mainly biological basis. The hypothesis proposed for consideration is that breastfeeding protects against PPD by maintaining endogenous retinoids (vitamin A-related compounds) below a threshold concentration. In fact, breast milk is rich in retinoids; pregnant women accumulate retinoids in liver and breast in preparation for lactation; there is increasing evidence that retinoids in higher concentration are associated with cognitive disturbances and mood disorders, including depression and suicide; and prolonged lactation reduces maternal stores of retinoids. Consistent with this hypothesis, it is estimated that an amount of vitamin A is transferred from mother to infant during the first six months of exclusive breastfeeding equivalent to 76% of a dose known to cause acute vitamin A poisoning in an adult. Breastfeeding may thus have evolutionary-adaptive functions for both mother and infant, transferring vital nutrients to an infant unable to feed itself, yet at the same time providing a natural means of reducing potentially toxic concentrations of retinoids in the mother. © 2013 Elsevier B.V. All rights reserved.

Molecular characterization and functions of fatty acid and retinoid binding protein gene (Ab-far-1) in Aphelenchoides besseyi.

PubMed

Cheng, Xi; Xiang, Yu; Xie, Hui; Xu, Chun-Ling; Xie, Teng-Fei; Zhang, Chao; Li, Yu

2013-01-01

Rice white tip nematode, Aphelenchoides besseyi, is a kind of plant parasitic nematodes that cause serious losses in rice and many other crops. Fatty acid and retinoid binding protein (FAR) is a specific protein in nematodes and is related to development, reproduction, infection to the host, and disruption of plant defense reactions, so the inhibition of FAR function is the potential approach to control A. besseyi. The full-length of Ab-far-1 cDNA is 805 bp, including 546 bp of ORF that encodes 181 amino acids. Software analysis revealed that the Ab-FAR-1 was rich in α-helix structure, contained a predicted consensus casein kinase II phosphorylation site and a hydrophobic secretory signal peptide, but did not have glycosylation sites. The Ab-FAR-1 had 52% homology to Gp-FAR-1 protein. The Ab-FAR-1 and Gp-FAR-1 were grouped in the same branch according to the phylogenetic tree. Fluorescence-based ligand binding analysis confirmed that the recombinant Ab-FAR-1 (rAb-FAR-1) bound with the fluorescent analogues 11-((5-dimethylaminonaphthalene-1-sulfonyl) amino) undecannoic acid (DAUDA), cis-parinaric acid and retinol, but the oleic acid would compete with the binding site. Quantitative PCR (qPCR) was used to assess the expression level of Ab-far-1 at different development stages of A. besseyi, the highest expression was found in the females, followed by eggs, juveniles and males. Using in situ hybridization technique, Ab-far-1 mRNA was present in the hypodermis of juveniles and adults, the ovaries of females and the testes of males. When A. besseyi was treated with Ab-far-1 dsRNA for 48 h, the silencing efficiency of Ab-far-1 was the best and the number of nematodes on the carrot was the least. Thus FAR plays important roles in the development and reproduction of nematodes. This study is useful and helpful to figure out a new way to control the plant parasitic nematodes.

Synergistic growth inhibition in HL-60 cells by the combination of acyclic retinoid and vitamin K2.

PubMed

Kitagawa, Junichi; Hara, Takeshi; Tsurumi, Hisashi; Ninomiya, Soranobu; Ogawa, Kengo; Adachi, Seiji; Kanemura, Nobuhiro; Kasahara, Senji; Shimizu, Masahito; Moriwaki, Hisataka

2011-05-01

The aim of this study was to assess the effects of acyclic retinoid (ACR) and vitamin K(2) (VK(2)) in HL-60 cells. We used HL-60 cells, and the Trypan Blue dye exclusion method was used for cell proliferation assays. For detection of apoptosis, the Annexin V-binding capacity of treated cells was examined by flow cytometry. To evaluate the cell cycle, we used a FITC BrdU Flow KIT and flow cytometry. Total extracted and equivalent amounts of protein were examined by Western blotting using specific antibodies. ACR and VK(2) dose dependently inhibited the proliferation of HL-60 cells. These two agents in combination synergistically inhibited cell growth and induced apoptosis. VK(2) inhibited activation of the Ras/MAPK signaling pathway, and ACR plus VK(2) cooperatively inhibited phosphorylation of RXRα and the growth of HL-60 cells. Moreover, ACR and VK(2) induced increases in G0/G1 phase HL-60 cells, alone and synergistically in combination. The synergistic effects of ACR and VK(2) on HL-60 cells may provide a novel strategy for treating leukemia.

Chromatin Accessibility Mapping Identifies Mediators of Basal Transcription and Retinoid-Induced Repression of OTX2 in Medulloblastoma

PubMed Central

Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping

2014-01-01

Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066

SIGNALLING THROUGH RETINOIC ACID RECEPTORS IN CARDIAC DEVELOPMENT: DOING THE RIGHT THINGS AT THE RIGHT TIMES

PubMed Central

Xavier-Neto, José; Costa, Ângela M. Sousa; Figueira, Ana Carolina M.; Caiaffa, Carlo Donato; do Amaral, Fabio Neves; Peres, Lara Maldanis Cerqueira; da Silva, Bárbara Santos Pires; Santos, Luana Nunes; Moise, Alexander R.; Castillo, Hozana Andrade

2015-01-01

Retinoic acid (RA) is a terpenoid that is synthesized from Vitamin A/retinol (ROL) and binds to the nuclear receptors retinoic acid receptor (RAR)/retinoid X receptor (RXR) to control multiple developmental processes in vertebrates. The available clinic and experimental data provide uncontested evidence for the pleiotropic roles of RA signalling in development of multiple embryonic structures and organs such eyes, central nervous system, gonads, lungs and heart. The development of any of these above-mentioned embryonic organ systems can be effectively utilized to showcase the many strategies utilized by RA signalling. However, it is very likely that the strategies employed to transfer RA signals during cardiac development comprise the majority of the relevant and sophisticated ways through which retinoid signals can be conveyed in a complex biological system. Here, we provide the reader with arguments indicating that RA signalling is exquisitely regulated according to specific phases of cardiac development and that RA signalling itself is one of the major regulators of the timing of cardiac morphogenesis and differentiation. We will focus on the role of signalling by RA receptors (RARs) in early phases of heart development. PMID:25134739

Antagonist-perturbation mechanism for activation function-2 fixed motifs: active conformation and docking mode of retinoid X receptor antagonists

NASA Astrophysics Data System (ADS)

Tsuji, Motonori

2017-06-01

HX531, which contains a dibenzodiazepine skeleton, is one of the first retinoid X receptor (RXR) antagonists. Functioning via RXR-PPARγ heterodimer, this compound is receiving a lot of attention as a therapeutic drug candidate for diabetic disease controlling differentiation of adipose tissue. However, the active conformation of HX531 for RXRs is not well established. In the present study, quantum mechanics calculations and molecular mechanical docking simulations were carried out to precisely study the docking mode of HX531 with the human RXRα ligand-binding domain, as well as to provide a new approach to drug design using a structure-based perspective. It was suggested that HX531, which has the R configuration for the bent dibenzodiazepine plane together with the equatorial configuration for the N-methyl group attached to the nitrogen atom in the seven-membered diazepine ring, is a typical activation function-2 (AF-2) fixed motif perturbation type antagonist, which destabilizes the formation of AF-2 fixed motifs. On the other hand, the docking simulations supported the experimental result that LG100754 is an RXR homodimer antagonist and an RXR heterodimer agonist.

RETINOIC ACID SYNTHESIS AND DEGRADATION

PubMed Central

Kedishvili, Natalia Y.

2017-01-01

Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503

RORα, a Potential Tumor Suppressor and Therapeutic Target of Breast Cancer

PubMed Central

Du, Jun; Xu, Ren

2012-01-01

The function of the nuclear receptor (NR) in breast cancer progression has been investigated for decades. The majority of the nuclear receptors have well characterized natural ligands, but a few of them are orphan receptors for which no ligand has been identified. RORα, one member of the retinoid orphan nuclear receptor (ROR) subfamily of orphan receptors, regulates various cellular and pathological activities. RORα is commonly down-regulated and/or hypoactivated in breast cancer compared to normal mammary tissue. Expression of RORα suppresses malignant phenotypes in breast cancer cells, in vitro and in vivo. Activity of RORα can be categorized into the canonical and non-canonical nuclear receptor pathways, which in turn regulate various breast cancer cellular function, including cell proliferation, apoptosis and invasion. This information suggests that RORα is a potent tumor suppressor and a potential therapeutic target for breast cancer. PMID:23443091

Vitamin D receptor displays DNA binding and transactivation as a heterodimer with the retinoid X receptor, but not with the thyroid hormone receptor.

PubMed

Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R

1999-12-01

The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.

Structural and functional evidences for the interactions between nuclear hormone receptors and endocrine disruptors at low doses.

PubMed

Balaguer, Patrick; Delfosse, Vanessa; Grimaldi, Marina; Bourguet, William

Endocrine-disrupting chemicals (EDCs) represent a broad class of exogenous substances that cause adverse effects in the endocrine system mainly by interacting with nuclear hormone receptors (NRs). Humans are generally exposed to low doses of pollutants, and current researches aim at deciphering the mechanisms accounting for the health impact of EDCs at environmental concentrations. Our correlative analysis of structural, interaction and cell-based data has revealed a variety of, sometimes unexpected, binding modes, reflecting a wide range of EDC affinities and specificities. Here, we present a few representative examples to illustrate various means by which EDCs achieve high-affinity binding to NRs. These examples include the binding of the mycoestrogen α-zearalanol to estrogen receptors, the covalent interaction of organotins with the retinoid X- and peroxisome proliferator-activated receptors, and the cooperative binding of two chemicals to the pregnane X receptor. We also discuss some hypotheses that could further explain low-concentration effects of EDCs with weaker affinity towards NRs. Copyright © 2017. Published by Elsevier Masson SAS.

Nuclear receptors and pathogenesis of pancreatic cancer

PubMed Central

Polvani, Simone; Tarocchi, Mirko; Tempesti, Sara; Galli, Andrea

2014-01-01

Pancreatic ductal adenocarcinoma (PDAC) is a devastating disease with a median overall survival time of 5 mo and the five years survival less than 5%, a rate essentially unchanged over the course of the years. A well defined progression model of accumulation of genetic alterations ranging from single point mutations to gross chromosomal abnormalities has been introduced to describe the origin of this disease. However, due to the its subtle nature and concurring events PDAC cure remains elusive. Nuclear receptors (NR) are members of a large superfamily of evolutionarily conserved ligand-regulated DNA-binding transcription factors functionally involved in important cellular functions ranging from regulation of metabolism, to growth and development. Given the nature of their ligands, NR are very tempting drug targets and their pharmacological modulation has been widely exploited for the treatment of metabolic and inflammatory diseases. There are now clear evidences that both classical ligand-activated and orphan NR are involved in the pathogenesis of PDAC from its very early stages; nonetheless many aspects of their role are not fully understood. The purpose of this review is to highlight the striking connections that link peroxisome proliferator activated receptors, retinoic acid receptors, retinoid X receptor, androgen receptor, estrogen receptors and the orphan NR Nur, chicken ovalbumin upstream promoter transcription factor II and the liver receptor homologue-1 receptor to PDAC development, connections that could lead to the identification of novel therapies for this disease. PMID:25232244

Activation of Peroxisome Proliferator-activated Receptor α Induces Lysosomal Biogenesis in Brain Cells

PubMed Central

Ghosh, Arunava; Jana, Malabendu; Modi, Khushbu; Gonzalez, Frank J.; Sims, Katherine B.; Berry-Kravis, Elizabeth; Pahan, Kalipada

2015-01-01

Lysosomes are ubiquitous membrane-enclosed organelles filled with an acidic interior and are central to the autophagic, endocytic, or phagocytic pathway. In contrast to its classical function as the waste management machinery, lysosomes are now considered to be an integral part of various cellular signaling processes. The diverse functionality of this single organelle requires a very complex and coordinated regulation of its activity with transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, at its core. However, mechanisms by which TFEB is regulated are poorly understood. This study demonstrates that gemfibrozil, an agonist of peroxisome proliferator-activated receptor (PPAR) α, alone and in conjunction with all-trans-retinoic acid is capable of enhancing TFEB in brain cells. We also observed that PPARα, but not PPARβ and PPARγ, is involved in gemfibrozil-mediated up-regulation of TFEB. Reporter assay and chromatin immunoprecipitation studies confirmed the recruitment of retinoid X receptor α, PPARα, and PGC1α on the PPAR-binding site on the Tfeb promoter as well. Subsequently, the drug-mediated induction of TFEB caused an increase in lysosomal protein and the lysosomal abundance in cell. Collectively, this study reinforces the link between lysosomal biogenesis and lipid metabolism with TFEB at the crossroads. Furthermore, gemfibrozil may be of therapeutic value in the treatment of lysosomal storage disorders in which autophagy-lysosome pathway plays an important role. PMID:25750174

[RXR, a key member of the oncogenic complex in acute promyelocytic leukemia].

PubMed

Halftermeyer, Juliane; Le Bras, Morgane; De Thé, Hugues

2011-11-01

Acute promyelocytic leukaemia (APL) is induced by fusion proteins always implying the retinoic acid receptor RARa. Although PML-RARa and other fusion oncoproteins are able to bind DNA as homodimers, in vivo they are always found in association with the nuclear receptor RXRa (Retinoid X Receptor). Thus, RXRa is an essential cofactor of the fusion protein for the transformation. Actually, RXRa contributes to several aspects of in vivo -transformation: RARa fusion:RXRa hetero-oligomeric complexes bind DNA with a much greater affinity than RARa fusion homodimers. Besides, PML-RARa:RXRa recognizes an enlarged repertoire of DNA binding sites. Thus the association between fusion proteins and RXRa regulates more genes than the homodimer alone. Titration of RXRa by the fusion protein may also play a role in the transformation process, as well as post-translational modifications of RXRa in the complex. Finally, RXRa is required for rexinoid-induced APL differentiation. Thus, RXRa is a key member of the oncogenic complex. © 2011 médecine/sciences – Inserm / SRMS.

The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong

2015-11-30

Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibitsmore » constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.« less

Antiproliferative effect of retinoid compounds on Kaposi's sarcoma cells.

PubMed Central

Corbeil, J; Rapaport, E; Richman, D D; Looney, D J

1994-01-01

A panel of retinoid compounds (tretinoin, isotretinoin, acitretin, and RO13-1470) were tested for inhibitory activity against Kaposi's sarcoma cell (KSC) cultures in vitro. Tretinoin was found to be the most effective retinoid tested, inhibiting the growth of KSC in vitro while having no effect on the expression of interleukin-6 and basic fibroblast growth factor, two important cytokines involved in KSC growth. Tretinoin also did not appear to downregulate the expression of receptors for these two cytokines. At low concentrations (10(-9) M), acitretin and tretinoin selectively inhibited growth of early passage KSC. At higher concentrations (10(-6)-10(-5) M), retinoid treatment induced a pattern of DNA degradation and morphological changes in KSC characteristic of apoptosis (programmed cell death). The inhibitory activity of tretinoin on KSC growth was decreased if human serum (but not fetal calf serum) was present in the growth medium, and partially restored by removal of serum lipids. These data suggest that retinoids possess potential as therapeutic agents in Kaposi's sarcoma. Images PMID:8182129

Topical retinoids in acne vulgaris: update on efficacy and safety.

PubMed

Thielitz, Anja; Gollnick, Harald

2008-01-01

Topical retinoids represent a mainstay of acne treatment because they expel mature comedones, reduce microcomedone formation, and exert anti-inflammatory effects. The first-generation retinoid tretinoin (all-trans retinoic acid) and the synthetic third-generation polyaromatics adapalene and tazarotene are approved for acne treatment by the US FDA, whereas topical tretinoin, isotretinoin (13-cis retinoic acid), and adapalene are accredited in Canada and Europe. Topical retinoids have a favorable safety profile distinct from the toxicity of their systemic counterparts. Local adverse effects, including erythema, dryness, itching, and stinging, occur frequently during the early treatment phase. Their impact varies with the vehicle formation, skin type, frequency and mode of application, use of moisturizers, and environmental factors such as sun exposure or temperature. The broad anti-acne activity and safety profile of topical retinoids justifies their use as first-line treatment in most types of non-inflammatory and inflammatory acne. They are also suitable as long-term medications, with no risk of inducing bacterial resistance, for maintenance of remission after cessation of initial combination therapy.

Action mechanisms of Liver X Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabbi, Chiara; Warner, Margaret; Gustafsson, Jan-Åke, E-mail: jgustafs@central.uh.edu

2014-04-11

Highlights: • LXRα and LXRβ are ligand-activated nuclear receptors. • They share oxysterol ligands and the same heterodimerization partner, RXR. • LXRs regulate lipid and glucose metabolism, CNS and immune functions, and water transport. - Abstract: The two Liver X Receptors, LXRα and LXRβ, are nuclear receptors belonging to the superfamily of ligand-activated transcription factors. They share more than 78% homology in amino acid sequence, a common profile of oxysterol ligands and the same heterodimerization partner, Retinoid X Receptor. LXRs play crucial roles in several metabolic pathways: lipid metabolism, in particular in preventing cellular cholesterol accumulation; glucose homeostasis; inflammation; centralmore » nervous system functions and water transport. As with all nuclear receptors, the transcriptional activity of LXR is the result of an orchestration of numerous cellular factors including ligand bioavailability, presence of corepressors and coactivators and cellular context i.e., what other pathways are activated in the cell at the time the receptor recognizes its ligand. In this mini-review we summarize the factors regulating the transcriptional activity and the mechanisms of action of these two receptors.« less

BMY 30047: A novel topically active retinoid with low local and systemic toxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nair, X.; Quigley, J.; Tramposch, K.M.

In the treatment of various dermatological disorders, topically applied retinoids have potential therapeutic use with the advantage of improved localized activity and lower toxicity over systemically administered retinoids. However, most retinoids cause a significant degree of local irritation. In the present study, the ability to produce local activity with low local irritation potential was evaluated with a novel retinoic acid derivative. BMY 30047 (11-cis, 13-cis-12-hydroxymethylretinoic acid delta-lactone) is one of a series of retinoic acid derivatives in which the carboxyl function of the polar end was modified with the aim of achieving reduced local irritation and systemic toxicity while retainingmore » the local therapeutic effect. BMY 30047 was evaluated and compared with all-trans retinoic acid for topical retinoid activity in several preclinical assay systems, including the utricle reduction assay in rhino mice, 12-o-tetradecanoylphorbol 13-acetate ester-stimulated ornithine decarboxylase induction in hairless mice and the UV light-induced photodamaged skin model in hairless mice. BMY 30047 was assessed for retinoid-type side effects by evaluating the skin irritation potential in rabbits after repeated topical application, and hypervitaminosis A-inducing potential in mice after i.p. injection. BMY 30047 demonstrated significant topical retinoid activity in several in vivo models with less skin irritation potential relative to the most used clinical concentrations of all-trans retinoic acid. BMY 30047 also showed very little systemic activity and did not produce any evidence of hypervitaminosis A syndrome at systemic doses 20 times greater than the no-effect dose of all-trans retinoic acid.« less

Reduced retinoids and retinoid receptors' expression in pancreatic cancer: A link to patient survival.

PubMed

Bleul, Tim; Rühl, Ralph; Bulashevska, Svetlana; Karakhanova, Svetlana; Werner, Jens; Bazhin, Alexandr V

2015-09-01

Pancreatic ductal adenocarcinoma (PDAC) represents one of the deadliest cancers in the world. All-trans retinoic acid (ATRA) is the major physiologically active form of vitamin A, regulating expression of many genes. Disturbances of vitamin A metabolism are prevalent in some cancer cells. The main aim of this work was to investigate deeply the components of retinoid signaling in PDAC compared to in the normal pancreas and to prove the clinical importance of retinoid receptor expression. For the study, human tumor tissues obtained from PDAC patients and murine tumors from the orthotopic Panc02 model were used for the analysis of retinoids, using high performance liquid chromatography mass spectrometry and real-time RT-PCR gene expression analysis. Survival probabilities in univariate analysis were estimated using the Kaplan-Meier method and the Cox proportional hazards model was used for the multivariate analysis. In this work, we showed for the first time that the ATRA and all-trans retinol concentration is reduced in PDAC tissue compared to their normal counterparts. The expression of RARα and β as well as RXRα and β are down-regulated in PDAC tissue. This reduced expression of retinoid receptors correlates with the expression of some markers of differentiation and epithelial-to-mesenchymal transition as well as of cancer stem cell markers. Importantly, the expression of RARα and RXRβ is associated with better overall survival of PDAC patients. Thus, reduction of retinoids and their receptors is an important feature of PDAC and is associated with worse patient survival outcomes. © 2014 Wiley Periodicals, Inc.

Esterase 22 and beta-glucuronidase hydrolyze retinoids in mouse liver

PubMed Central

Schreiber, Renate; Taschler, Ulrike; Wolinski, Heimo; Seper, Andrea; Tamegger, Stefanie N.; Graf, Maria; Kohlwein, Sepp D.; Haemmerle, Guenter; Zimmermann, Robert; Zechner, Rudolf; Lass, Achim

2009-01-01

Excess dietary vitamin A is esterified with fatty acids and stored in the form of retinyl ester (RE) predominantly in the liver. According to the requirements of the body, liver RE stores are hydrolyzed and retinol is delivered to peripheral tissues. The controlled mobilization of retinol ensures a constant supply of the body with the vitamin. Currently, the enzymes catalyzing liver RE hydrolysis are unknown. In this study, we identified mouse esterase 22 (Es22) as potent RE hydrolase highly expressed in the liver, particularly in hepatocytes. The enzyme is located exclusively at the endoplasmic reticulum (ER), implying that it is not involved in the mobilization of RE present in cytosolic lipid droplets. Nevertheless, cell culture experiments revealed that overexpression of Es22 attenuated the formation of cellular RE stores, presumably by counteracting retinol esterification at the ER. Es22 was previously shown to form a complex with β-glucuronidase (Gus). Our studies revealed that Gus colocalizes with Es22 at the ER but does not affect its RE hydrolase activity. Interestingly, however, Gus was capable of hydrolyzing the naturally occurring vitamin A metabolite retinoyl β-glucuronide. In conclusion, our observations implicate that both Es22 and Gus play a role in liver retinoid metabolism. PMID:19723663

Comparative Analysis of Vitamin A (Retinol) Regulated Genes in African-American and Caucasian Prostate Cancer Patients

DTIC Science & Technology

2007-03-01

chemoprevention strategies and to the development of novel therapies for this disease. 14. SUBJECT TERMS 15. NUMBER OF PAGES 13Retinoids, Vitamin A...the TRAMP model will ultimately lead to improved chemoprevention strategies and to the development of novel therapies for prostate cancer...Selective retinoids and rexinoids in cancer therapy and chemoprevention. Drug Discov Today, 7: 1165-1174, 2002. 5. Wei, L. N. Retinoid receptors and

Retinoids induce differentiation and downregulate telomerase activity and N-Myc to increase sensitivity to flavonoids for apoptosis in human malignant neuroblastoma SH-SY5Y cells.

PubMed

Das, Arabinda; Banik, Naren L; Ray, Swapan K

2009-03-01

Human malignant neuroblastoma is characterized by poor differentiation and uncontrolled proliferation of immature neuroblasts. Retinoids such as all-trans-retinoic acid (ATRA), 13-cis-retinoic acid (13-CRA), and N-(4-hydroxyphenyl) retinamide (4-HPR) at low doses are capable of inducing differentiation, while flavonoids such as (-)-epigallocatechin-3-gallate (EGCG) and genistein (GST) at relatively high dose can induce apoptosis. We used combination of retinoid and flavonoid for controlling growth of malignant neuroblastoma SH-SY5Y cells. Cells were treated with a retinoid (1 microM ATRA, 1 microM 13-CRA, or 0.5 microM 4-HPR) for 7 days and then with a flavonoid (25 microM EGCG or 25 microM GST) for 24 h. Treatment of cells with a low dose of a retinoid for 7 days induced neuronal differentiation with downregulation of telomerase activity and N-Myc but overexpression of neurofilament protein (NFP) and subsequent treatment with a relatively high dose of a flavonoid for 24 h increased apoptosis in the differentiated cells. Besides, retinoids reduced the levels of inflammatory and angiogenic factors. Apoptosis was associated with increases in intracellular free [Ca2+], Bax expression, cytochrome c release from mitochondria and activities of calpain and caspases. Decreases in expression of calpastatin (endogenous calpain inhibitor) and baculovirus inhibitor-of-apoptosis repeat containing (BIRC) proteins (endogenous caspase inhibitors) favored apoptosis. Treatment of SH-SY5Y cells with EGCG activated caspase-8, indicating induction of the receptor-mediated pathway of apoptosis. Based on our observation, we conclude that combination of a retinoid and a flavonoid worked synergistically for controlling the malignant growth of human neuroblastoma cells.

Synergistic growth inhibition by acyclic retinoid and vitamin K2 in human hepatocellular carcinoma cells.

PubMed

Kanamori, Toh; Shimizu, Masahito; Okuno, Masataka; Matsushima-Nishiwaki, Rie; Tsurumi, Hisashi; Kojima, Soichi; Moriwaki, Hisataka

2007-03-01

Hepatocellular carcinoma (HCC) is one of the most prevalent cancers worldwide. However, effective chemopreventive and chemotherapeutic agents for this cancer have not yet been developed. In clinical trials acyclic retinoid (ACR) and vitamin K(2) (VK(2)) decreased the recurrence rate of HCC. In the present study we examined the possible combined effects of ACR or another retinoid 9-cis retinoic acid (9cRA) plus VK(2) in the HuH7 human HCC cell line. We found that the combination of 1.0 microM ACR or 1.0 microM 9cRA plus 10 microM VK(2) synergistically inhibited the growth of HuH7 cells without affecting the growth of Hc normal human hepatocytes. The combined treatment with ACR plus VK(2) also acted synergistically to induce apoptosis in HuH7 cells. Treatment with VK(2) alone inhibited phosphorylation of the retinoid X receptor (RXR)alpha protein, which is regarded as a critical factor for liver carcinogenesis, through inhibition of Ras activation and extracellular signal-regulated kinase phosphorylation. Moreover, the inhibition of RXRalpha phosphorylation by VK(2) was enhanced when the cells were cotreated with ACR. The combination of retinoids plus VK(2) markedly increased both the retinoic acid receptor responsive element and retinoid X receptor responsive element promoter activities in HuH7 cells. Our results suggest that retinoids (especially ACR) and VK(2) cooperatively inhibit activation of the Ras/MAPK signaling pathway, subsequently inhibiting the phosphorylation of RXRalpha and the growth of HCC cells. This combination might therefore be effective for the chemoprevention and chemotherapy of HCC.

Pharmaceutical and nutraceutical approaches for preventing liver carcinogenesis: chemoprevention of hepatocellular carcinoma using acyclic retinoid and branched-chain amino acids.

PubMed

Shimizu, Masahito; Shirakami, Yohei; Hanai, Tatsunori; Imai, Kenji; Suetsugu, Atsushi; Takai, Koji; Shiraki, Makoto; Moriwaki, Hisataka

2014-01-01

The poor prognosis for patients with hepatocellular carcinoma (HCC) is associated with its high rate of recurrence in the cirrhotic liver. Therefore, more effective strategies need to be urgently developed for the chemoprevention of this malignancy. The malfunction of retinoid X receptor α, a retinoid receptor, due to phosphorylation by Ras/mitogen-activated protein kinase is closely associated with liver carcinogenesis and may be a promising target for HCC chemoprevention. Acyclic retinoid (ACR), a synthetic retinoid, can prevent HCC development by inhibiting retinoid X receptor α phosphorylation and improve the prognosis for this malignancy. Supplementation with branched-chain amino acids (BCAA), which are used to improve protein malnutrition in patients with liver cirrhosis, can also reduce the risk of HCC in obese cirrhotic patients. In experimental studies, both ACR and BCAA exert suppressive effects on HCC development and the growth of HCC cells. In particular, combined treatment with ACR and BCAA cooperatively inhibits the growth of HCC cells. Furthermore, ACR and BCAA inhibit liver tumorigenesis associated with obesity and diabetes, both of which are critical risk factors for HCC development. These findings suggest that pharmaceutical and nutraceutical approaches using ACR and BCAA may be promising strategies for preventing HCC and improving the prognosis of this malignancy. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis and stability study of retinoids in pharmaceuticals by LC with fluorescence detection.

PubMed

Gatti, R; Gioia, M G; Cavrini, V

2000-08-01

Liquid chromatographic (HPLC) methods with fluorescence detection at different wavelengths were developed for measurements of retinoic acids (13-cis and all-trans) in pharmaceutical dosage forms and components of 'retinoid solution' (all-trans retinoic acid, vitamin A palmitate and beta-carotene), a galenical of 'Di Bella therapy', using reversed phase columns under isocratic conditions. The stability of all-trans retinoic acid in cream and all-trans retinoic acid and vitamin A palmitate in 'retinoid solution' was investigated. Solid-phase extraction (SPE), using C18 sorbent was applied to the analysis of retinoic acids (9-cis, 13-cis and all-trans) in the 'retinoid solution' to obtain a practical and reliable sample clean-up. The results showed that these preparations (cream and solution) can be conveniently stored in the dark (t.a. or 2-8 degrees C): under these conditions about 86-87% of the all-trans retinoic acid initial concentration in both formulations and about 73-78% of vitamin A palmitate in the 'retinoid solution' remained after 90 days, while under sunlight exposure rapid degradation of the drugs was observed.

Synthetic 9-cis-beta-carotene inhibits photoreceptor degeneration in cultures of eye cups from rpe65rd12 mouse model of retinoid cycle defect.

PubMed

Sher, Ifat; Tzameret, Adi; Peri-Chen, Sara; Edelshtain, Victoria; Ioffe, Michael; Sayer, Alon; Buzhansky, Ludmila; Gazit, Ehud; Rotenstreich, Ygal

2018-04-17

The retinoid cycle enzymes regenerate the visual chromophore 11-cis retinal to enable vision. Mutations in the genes encoding the proteins of the retinoid cycle are the leading cause for recessively inherited retinal dystrophies such as retinitis pigmentosa, Leber congenital amaurosis, congenital cone-rod dystrophy and fundus albipunctatus. Currently there is no treatment for these blinding diseases. In previous studies we demonstrated that oral treatment with the 9-cis-β-carotene rich Dunaliella Bardawil algae powder significantly improved visual and retinal functions in patients with retinitis pigmentosa and fundus albipunctatus. Here we developed a convenient and economical synthetic route for biologically active 9-cis-β-carotene from inexpensive building materials and demonstrated that the molecule is stable for at least one month. Synthetic 9-cis-β-carotene rescued cone photoreceptors from degeneration in eye cup cultures of mice with a retinoid cycle genetic defect. This study suggests that synthetic 9-cis-β-carotene may serve as an effective treatment for retinal dystrophies involving the retinoid cycle.

All-trans-retinoic acid enhances apoptosis induction by tyrosine kinase inhibitors in the eosinophilic leukemia-derived EoL-1 cell line.

PubMed

Robert, Carine; Apàti, Agota; Chomienne, Christine; Papp, Béla

2008-02-01

Imatinib and retinoids induce apoptosis in FIP1L1/PDGFRalpha-positive EoL-1 leukemia cells. Although imatinib induces complete remission in most FIP1L1/PDGFRalpha-positive patients, response to imatinib is sometimes suboptimal. In order to enhance the potency of the molecularly targeted therapy of eosinophilic leukemia, we investigated the effect of retinoids combined with tyrosine kinase inhibitors on EoL-1 cells. We demonstrate that retinoids combined with tyrosine kinase inhibitors lead to enhanced apoptosis induction in EoL-1 cells. Our results suggest that tyrosine kinase inhibitors combined with retinoids may constitute a valuable therapeutic approach for sensitive neoplasias that may display enhanced anti-leukemic potency when compared to single drug treatments.

Allosteric Pathways in the PPARγ-RXRα nuclear receptor complex

NASA Astrophysics Data System (ADS)

Ricci, Clarisse G.; Silveira, Rodrigo L.; Rivalta, Ivan; Batista, Victor S.; Skaf, Munir S.

2016-01-01

Understanding the nature of allostery in DNA-nuclear receptor (NR) complexes is of fundamental importance for drug development since NRs regulate the transcription of a myriad of genes in humans and other metazoans. Here, we investigate allostery in the peroxisome proliferator-activated/retinoid X receptor heterodimer. This important NR complex is a target for antidiabetic drugs since it binds to DNA and functions as a transcription factor essential for insulin sensitization and lipid metabolism. We find evidence of interdependent motions of Ω-loops and PPARγ-DNA binding domain with contacts susceptible to conformational changes and mutations, critical for regulating transcriptional functions in response to sequence-dependent DNA dynamics. Statistical network analysis of the correlated motions, observed in molecular dynamics simulations, shows preferential allosteric pathways with convergence centers comprised of polar amino acid residues. These findings are particularly relevant for the design of allosteric modulators of ligand-dependent transcription factors.

Retinoid X receptor suppresses a metastasis-promoting transcriptional program in myeloid cells via a ligand-insensitive mechanism

PubMed Central

Kiss, Mate; Czimmerer, Zsolt; Nagy, Gergely; Bieniasz-Krzywiec, Pawel; Ehling, Manuel; Pap, Attila; Poliska, Szilard; Boto, Pal; Tzerpos, Petros; Horvath, Attila; Kolostyak, Zsuzsanna; Daniel, Bence; Szatmari, Istvan; Mazzone, Massimiliano; Nagy, Laszlo

2017-01-01

Retinoid X receptor (RXR) regulates several key functions in myeloid cells, including inflammatory responses, phagocytosis, chemokine secretion, and proangiogenic activity. Its importance, however, in tumor-associated myeloid cells is unknown. In this study, we demonstrate that deletion of RXR in myeloid cells enhances lung metastasis formation while not affecting primary tumor growth. We show that RXR deficiency leads to transcriptomic changes in the lung myeloid compartment characterized by increased expression of prometastatic genes, including important determinants of premetastatic niche formation. Accordingly, RXR-deficient myeloid cells are more efficient in promoting cancer cell migration and invasion. Our results suggest that the repressive activity of RXR on prometastatic genes is mediated primarily through direct DNA binding of the receptor along with nuclear receptor corepressor (NCoR) and silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) corepressors and is largely unresponsive to ligand activation. In addition, we found that expression and transcriptional activity of RXRα is down-modulated in peripheral blood mononuclear cells of patients with lung cancer, particularly in advanced and metastatic disease. Overall, our results identify RXR as a regulator in the myeloid cell-assisted metastatic process and establish lipid-sensing nuclear receptors in the microenvironmental regulation of tumor progression. PMID:28923935

Assessment of the efficacy and safety of a combination of 2 topical retinoids (RetinSphere) in maintaining post-treatment response of acne to oral isotretinoin.

PubMed

Truchuelo, M T; Jiménez, N; Mavura, D; Jaén, P

2015-03-01

The high rate of relapse of acne lesions following oral isotretinoin treatment is a common problem which remains unsolved. To avoid or minimize relapses, topical retinoids have been used for many years as maintenance treatment. However, adverse effects frequently occur. To determine the efficacy and safety of a new retinoid combination (Retinsphere technology) in maintaining post-treatment response to oral isotretinoin. Prospective, randomized, double-blind and vehicle-controlled study of 30 patients with acne previously treated with isotretinoin. Treatment with the retinoid combination was applied to one side of the face and vehicle was applied to the other, once daily, for 3 months. Standardized photographs were taken using RBX technology at baseline, 1.5 months and 3 months. The primary efficacy endpoint was the appearance of relapse on the treated side compared to the vehicle-treated side. Other endpoints included lesion count, investigator-reported improvement, patient-reported improvement, impact on quality-of-life, and side effects. Although the majority of patients did not reach the total target dose of oral isotretinoin, the relapse rate was significantly lower on the retinoid-treated side compared to the vehicle-treated side. Likewise, improved lesion count and excellent tolerance were observed. This new retinoid combination (Retinsphere technology) were effective and safe as maintenance therapy after post-treatment response to oral isotretinoin in patients with acne. Copyright © 2014 Elsevier España, S.L.U. and AEDV. All rights reserved.

Retinoic acid stability in stem cell cultures.

PubMed

Sharow, Kyle A; Temkin, Boris; Asson-Batres, Mary Ann

2012-01-01

It has been reported that retinoids, such as retinoic acid (RA) and retinol (ROL), dissolved in aqueous solutions are susceptible to oxidative damage when exposed to light, air, and relatively high temperatures, conditions that are normal for culturing stem cells. Thus, questions arise regarding the interpretation of results obtained from studies of mouse embryonic stem cells exposed to retinoids because their isomerization state, their stability in culture conditions, and their interactions with other potential differentiation factors in growth media could influence developmental processes under study. Media samples were supplemented with retinoids and exposed to cell culture conditions with and without mouse embryonic stem cells (mESC), and retinoids were extracted and analyzed using HPLC. To determine whether retinoids are stable in media supplemented with fetal bovine serum (FBS) or in chemically-defined, serum-free media, mESC adapted to each type of growth media were investigated. Studies reported here indicate there was little loss or isomerization of at-RA, 9-cis-RA, 13-cis-RA, or ROL in cell cultures grown in serum-supplemented media when cell cultures were maintained in the dark and manipulated and observed under yellow light. In contrast, the stability of both at-RA and ROL were determined to be greatly reduced in serum-free media as compared with serum-supplemented media. Addition of 6 mg/ml bovine serum albumin was found to stabilize retinoids in serum-free media. It was also determined that ROL is less stable than RA in cell culture conditions.

Retinoic acid receptor alpha drives cell cycle progression and is associated with increased sensitivity to retinoids in T-cell lymphoma.

PubMed

Wang, Xueju; Dasari, Surendra; Nowakowski, Grzegorz S; Lazaridis, Konstantinos N; Wieben, Eric D; Kadin, Marshall E; Feldman, Andrew L; Boddicker, Rebecca L

2017-04-18

Peripheral T-cell lymphomas (PTCLs) are aggressive non-Hodgkin lymphomas with generally poor outcomes following standard therapy. Few candidate therapeutic targets have been identified to date. Retinoic acid receptor alpha (RARA) is a transcription factor that modulates cell growth and differentiation in response to retinoids. While retinoids have been used to treat some cutaneous T-cell lymphomas (CTCLs), their mechanism of action and the role of RARA in CTCL and other mature T-cell lymphomas remain poorly understood. After identifying a PTCL with a RARAR394Q mutation, we sought to characterize the role of RARA in T-cell lymphoma cells. Overexpressing wild-type RARA or RARAR394Q significantly increased cell growth in RARAlow cell lines, while RARA knockdown induced G1 arrest and decreased expression of cyclin-dependent kinases CDK2/4/6 in RARAhigh cells. The retinoids, AM80 (tamibarotene) and all-trans retinoic acid, caused dose-dependent growth inhibition, G1 arrest, and CDK2/4/6 down-regulation. Genes down-regulated in transcriptome data were enriched for cell cycle and G1-S transition. Finally, RARA overexpression augmented chemosensitivity to retinoids. In conclusion, RARA drives cyclin-dependent kinase expression, G1-S transition, and cell growth in T-cell lymphoma. Synthetic retinoids inhibit these functions in a dose-dependent fashion and are most effective in cells with high RARA expression, indicating RARA may represent a therapeutic target in some PTCLs.

Linked magnolol dimer as a selective PPARγ agonist - Structure-based rational design, synthesis, and bioactivity evaluation.

PubMed

Dreier, Dominik; Latkolik, Simone; Rycek, Lukas; Schnürch, Michael; Dymáková, Andrea; Atanasov, Atanas G; Ladurner, Angela; Heiss, Elke H; Stuppner, Hermann; Schuster, Daniela; Mihovilovic, Marko D; Dirsch, Verena M

2017-10-20

The nuclear receptors peroxisome proliferator-activated receptor γ (PPARγ) and its hetero-dimerization partner retinoid X receptor α (RXRα) are considered as drug targets in the treatment of diseases like the metabolic syndrome and diabetes mellitus type 2. Effort has been made to develop new agonists for PPARγ to obtain ligands with more favorable properties than currently used drugs. Magnolol was previously described as dual agonist of PPARγ and RXRα. Here we show the structure-based rational design of a linked magnolol dimer within the ligand binding domain of PPARγ and its synthesis. Furthermore, we evaluated its binding properties and functionality as a PPARγ agonist in vitro with the purified PPARγ ligand binding domain (LBD) and in a cell-based nuclear receptor transactivation model in HEK293 cells. We determined the synthesized magnolol dimer to bind with much higher affinity to the purified PPARγ ligand binding domain than magnolol (K i values of 5.03 and 64.42 nM, respectively). Regarding their potency to transactivate a PPARγ-dependent luciferase gene both compounds were equally effective. This is likely due to the PPARγ specificity of the newly designed magnolol dimer and lack of RXRα-driven transactivation activity by this dimeric compound.

Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward

2010-01-12

The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less

Psychiatric disorders, acne and systemic retinoids: comparison of risks.

PubMed

Le Moigne, M; Bulteau, S; Grall-Bronnec, Marie; Gerardin, M; Fournier, Jean-Pascal; Jonville-Bera, A P; Jolliet, Pascale; Dreno, Brigitte; Victorri-Vigneau, C

2017-09-01

The link between isotretinoin, treatment of a severe form of acne, and psychiatric disorders remains controversial, as acne itself could explain the occurrence of psychiatric disorders. This study aims at assessing the disproportionality of psychiatric adverse events reported with isotretinoin in the French National PharmacoVigilance Database, compared with other systemic acne treatments and systemic retinoids. Data were extracted from the French National PharmacoVigilance Database for systemic acne treatments, systemic retinoids and drugs used as comparators. Each report was subjected to double-blind analysis by two psychiatric experts. A disproportionality analysis was performed, calculating the number of psychiatric ADRs divided by the total number of notifications for each drug of interest. Concerning acne systemic treatments: all 71 reports of severe psychiatric disorders involved isotretinoin, the highest proportion of mild/moderate psychiatric adverse events was reported with isotretinoin (14.1%). Among systemic retinoids, the highest proportion of severe and mild/moderate psychiatric events occurred with isotretinoin and alitretinoin. Our study raises the hypothesis that psychiatric disorders associated with isotretinoin are related to a class effect of retinoids, as a signal emerges for alitretinoin. Complementary studies are necessary to estimate the risk and further determine at-risk populations.

Small-molecule RORγt antagonists inhibit T helper 17 cell transcriptional network by divergent mechanisms.

PubMed

Xiao, Sheng; Yosef, Nir; Yang, Jianfei; Wang, Yonghui; Zhou, Ling; Zhu, Chen; Wu, Chuan; Baloglu, Erkan; Schmidt, Darby; Ramesh, Radha; Lobera, Mercedes; Sundrud, Mark S; Tsai, Pei-Yun; Xiang, Zhijun; Wang, Jinsong; Xu, Yan; Lin, Xichen; Kretschmer, Karsten; Rahl, Peter B; Young, Richard A; Zhong, Zhong; Hafler, David A; Regev, Aviv; Ghosh, Shomir; Marson, Alexander; Kuchroo, Vijay K

2014-04-17

We identified three retinoid-related orphan receptor gamma t (RORγt)-specific inhibitors that suppress T helper 17 (Th17) cell responses, including Th17-cell-mediated autoimmune disease. We systemically characterized RORγt binding in the presence and absence of drugs with corresponding whole-genome transcriptome sequencing. RORγt acts as a direct activator of Th17 cell signature genes and a direct repressor of signature genes from other T cell lineages; its strongest transcriptional effects are on cis-regulatory sites containing the RORα binding motif. RORγt is central in a densely interconnected regulatory network that shapes the balance of T cell differentiation. Here, the three inhibitors modulated the RORγt-dependent transcriptional network to varying extents and through distinct mechanisms. Whereas one inhibitor displaced RORγt from its target loci, the other two inhibitors affected transcription predominantly without removing DNA binding. Our work illustrates the power of a system-scale analysis of transcriptional regulation to characterize potential therapeutic compounds that inhibit pathogenic Th17 cells and suppress autoimmunity. Copyright © 2014 Elsevier Inc. All rights reserved.

A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

PubMed

Lee, M O; Liu, Y; Zhang, X K

1995-08-01

The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene expression.

Both retinoic-acid-receptor- and retinoid-X-receptor-dependent signalling pathways mediate the induction of the brown-adipose-tissue-uncoupling-protein-1 gene by retinoids.

PubMed Central

Alvarez, R; Checa, M; Brun, S; Viñas, O; Mampel, T; Iglesias, R; Giralt, M; Villarroya, F

2000-01-01

The intracellular pathways and receptors mediating the effects of retinoic acid (RA) on the brown-fat-uncoupling-protein-1 gene (ucp-1) have been analysed. RA activates transcription of ucp-1 and the RA receptor (RAR) is known to be involved in this effect. However, co-transfection of an expression vector for retinoid-X receptor (RXR) increases the action of 9-cis RA but not the effects of all-trans RA on the ucp-1 promoter in brown adipocytes. Either RAR-specific ¿p-[(E)-2-(5,6,7,8,-tetrahydro-5,5,8, 8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid¿ or RXR-specific [isopropyl-(E,E)-(R,S)-11-methoxy-3,7, 11-trimethyldodeca-2,4-dienoate, or methoprene] synthetic compounds increase the expression of UCP-1 mRNA and the activity of chloramphenicol acetyltransferase expression vectors driven by the ucp-1 promoter. The RXR-mediated action of 9-cis RA requires the upstream enhancer region at -2469/-2318 in ucp-1. During brown-adipocyte differentiation RXRalpha and RXRgamma mRNA expression is induced in parallel with UCP-1 mRNA, whereas the mRNA for the three RAR subtypes, alpha, beta and gamma, decreases. Co-transfection of murine expression vectors for the different RAR and RXR subtypes indicates that RARalpha and RARbeta as well as RXRalpha are the major retinoid-receptor subtypes capable of mediating the responsiveness of ucp-1 to retinoids. It is concluded that the effects of retinoids on ucp-1 transcription involve both RAR- and RXR-dependent signalling pathways. The responsiveness of brown adipose tissue to retinoids in vivo relies on a complex combination of the capacity of RAR and RXR subtypes to mediate ucp-1 induction and their distinct expression in the differentiated brown adipocyte. PMID:10600643

Hepatic retinoid levels in seven fish species (teleosts) from a tropical coastal lagoon receiving effluents from iron-ore mining and processing.

PubMed

Pereira, Adriana A; van Hattum, Bert; Brouwer, Abraham

2012-02-01

The present study was undertaken to investigate the possible effects of Fe and trace element exposure on hepatic levels of retinoids in seven fish species. Concentrations of retinoids were measured in fish collected from a coastal lagoon in Brazil that receives effluents from an iron-ore mining and processing plant. Fish from nearby coastal lagoons were also included to assess possible differences related to chemical exposure. Results indicated considerable differences in hepatic retinoid composition among the various species investigated. The most striking differences were in retinol and derivative-specific profiles and in didehydro retinol and derivative-specific profiles. The Perciformes species Geophagus brasiliensis, Tilapia rendalli, Mugil liza, and Cichla ocellaris and the Characiforme Hoplias malabaricus were characterized as retinol and derivative-specific, while the Siluriformes species Hoplosternum littorale and Rhamdia quelen were didehydro retinol and derivative-specific fish species. A negative association was observed between Al, Pb, As, and Cd and hepatic didehydro retinoid levels. Fish with higher levels of hepatic Fe, Cu, and Zn showed unexpectedly significant positive correlations with increased hepatic retinol levels. This finding, associated with the positive relationships between retinol and retinyl palmitate with lipid peroxidation, may suggest that vitamin A is mobilized from other tissues to increase hepatic antioxidant levels for protection against oxidative damage. These data show significant but dissimilar associations between trace element exposure and hepatic retinoid levels in fish species exposed to iron-ore mining and processing effluents, without apparent major impacts on fish health and condition. Copyright © 2011 SETAC.

Receptor-selective retinoids implicate retinoic acid receptor alpha and gamma in the regulation of bmp-2 and bmp-4 in F9 embryonal carcinoma cells.

PubMed

Rogers, M B

1996-01-01

The effect of retinoids on malignant cells and embryos indicates that retinoids influence the expression of growth factors or alter the response of cells to growth factors. The bone morphogenetic proteins, Bmp-2 and Bmp-4, are candidates for such growth factors because retinoic acid (RA) treatment of F9 embryonal carcinoma cells induced Bmp-2 mRNA, while simultaneously repressing Bmp-4 levels. Also, recombinant Bmp-2 affected the growth and differentiation of these cells. Regulation of each gene was concentration dependent and required continuous RA treatment. The short half-lives of the Bmp-2 (75 +/- 11 min) and Bmp-4 (70 +/- 4 min) mRNAs suggest that their abundance is primarily controlled at the transcriptional level. To determine which RA receptor (RAR) controls bmp-2 and bmp-4 expression, F9 cells were exposed to various receptor-selective retinoids. RAR alpha- and gamma-selective retinoids induced Bmp-2 and repressed Bmp-4 equally as well as all-trans RA. In contrast, a RAR beta-selective retinoid had little effect on Bmp-2 induction but repressed Bmp-4. A RAR alpha-selective antagonist inhibited all-trans RA stimulation of Bmp-2, although not as dramatically as a RAR beta gamma-selective antagonist. No differences were observed between Bmp levels in all-trans RA and 9-cis RA-treated cells, indicating that the RXRs play little part in controlling these genes. The results are consistent with RAR alpha and gamma-controlled Bmp-2 and Bmp-4 regulation.

A simple and robust quantitative analysis of retinol and retinyl palmitate using a liquid chromatographic isocratic method.

PubMed

Yokota, Satoshi; Oshio, Shigeru

2018-04-01

Vitamin A is a vital nutritional substances that regulates biological activities including development, but is also associated with disease onset. The extent of vitamin A intake influences the retinoid content in the liver, the most important organ for the storage of vitamin A. Measurement of endogenous retinoid in biological samples is important to understand retinoid homeostasis. Here we present a reliable, highly sensitive, and robust method for the quantification of retinol and retinyl palmitate using a reverse-phase HPLC/UV isocratic method. We determined the impact of chronic dietary vitamin A on retinoid levels in livers of mice fed an AIN-93G semi-purified diet (4 IU/g) compared with an excess vitamin A diet (1000 IU/g) over a period from birth to 10 weeks of age. Coefficients of variation for intra-assays for both retinoids were less than 5%, suggesting a higher reproducibility than any other HPLC/UV gradient method. Limits of detection and quantification for retinol were 0.08 pmol, and 0.27 pmol, respectively, which are remarkably higher than previous results. Supplementation with higher doses of vitamin A over the study period significantly increased liver retinol and retinyl palmitate concentrations in adult mice. The assays described here provide a sensitive and rigorous quantification of endogenous retinol and retinyl palmitate, which can be used to help determine retinoid homeostasis in disease states, such as toxic hepatitis and liver cancer. Copyright © 2017. Published by Elsevier B.V.

Analysis of follicular fluid retinoids in women undergoing in vitro fertilization: retinoic acid influences embryo quality and is reduced in women with endometriosis.

PubMed

Pauli, Samuel A; Session, Donna R; Shang, Weirong; Easley, Kirk; Wieser, Friedrich; Taylor, Robert N; Pierzchalski, Keely; Napoli, Joseph L; Kane, Maureen A; Sidell, Neil

2013-09-01

Retinol (ROL) and its biologically active metabolite, all-trans retinoic acid (ATRA), are essential for a number of reproductive processes. However, there is a paucity of information regarding their roles in ovarian folliculogenesis, oocyte maturation, and early embryogenesis. The objectives of this study were to quantify and compare peripheral plasma (PP) and follicular fluid (FF) retinoid levels, including ATRA in women undergoing in vitro fertilization (IVF) and to investigate the relationship between retinoid levels and embryo quality. Retinoid levels were evaluated in PP and FF from 79 women undergoing IVF at the time of oocyte retrieval and corresponding embryo quality assessed on a daily basis after retrieval for 3 days until uterine transfer. Analysis compared the retinoid levels with day 3 embryo grades and between endometriosis versus control patients. Results demonstrated distinctive levels of retinoid metabolites and isomers in FF versus PP. There was a significantly larger percentage of high-quality grade I embryos derived from the largest versus smallest follicles. An increase in follicle size also correlated with a >50% increase in FF ROL and ATRA concentrations. Independent of follicle size, FF yielding grade I versus nongrade I embryos showed higher mean levels of ATRA but not ROL. In a nested case-control analysis, control participants had 50% higher mean levels of ATRA in their FF and PP than women with endometriosis. These findings strongly support the proposition that ATRA plays a fundamental role in oocyte development and quality, and that reduced ATRA synthesis may contribute to decreased fecundity of participants with endometriosis.

Retinoids, race and the pathogenesis of dengue hemorrhagic fever.

PubMed

Mawson, Anthony R

2013-12-01

Dengue hemorrhagic fever (DHF) is the most significant mosquito-borne viral disease worldwide in terms of illness, mortality and economic cost, but the pathogenesis of DHF is not well understood and there is no specific treatment or vaccine. Based on evidence of liver involvement, it is proposed that dengue virus and retinoids interact to cause cholestatic liver damage, resulting in the spillage of stored retinoids into the circulation and in an endogenous form of hypervitaminosisis A manifested by the signs and symptoms of the disease, including: fever, severe joint and bone pain, capillary leakage, thrombocytopenia, headache, and gastrointestinal symptoms. While retinoids in low concentration are essential for numerous biological functions, they are prooxidant, cytotoxic, mutagenic and teratogenic in higher concentration, especially when unbound to protein, and an endogenous form of vitamin A intoxication is recognized in cholestasis. The model tentatively explains the observations that 1) repeat infections are more severe than initial dengue virus infections; 2) the incidence of denue has increased dramatically worldwide in recent decades; 3) DHF is less prevalent in people of African ancestry than those of other racial backgrounds; and 4) infants are protected from dengue. The retinoid toxicity hypothesis of DHF predicts the co-existence of low serum concentrations of retinol coupled with high concentrations of retinoic acid and an increased percentage of retinyl esters to total vitamin A. Subject to such tests, it may be possible to treat DHF effectively using drugs that target the metabolism and expression of retinoids. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

South-East Asia study alliance guidelines on the management of acne vulgaris in South-East Asian patients.

PubMed

Goh, Chee Leok; Abad-Casintahan, Flordeliz; Aw, Derrick Chen Wee; Baba, Roshidah; Chan, Lee Chin; Hung, Nguyen Thanh; Kulthanan, Kanokvalai; Leong, Hoe Nam; Medina-Oblepias, Marie Socouer; Noppakun, Nopadon; Sitohang, Irma Bernadette; Sugito, Titi Lestari; Wong, Su-Ni

2015-10-01

The management of acne in South-East Asia is unique, as Asian skin and local variables require a clinical approach unlike that utilized in other parts of the world. There are different treatment guidelines per country in the region, and a group of leading dermatologists from these countries convened to review these guidelines, discuss current practices and recent advances, and formulate consensus guidelines to harmonize the management of acne vulgaris in the region. Emphasis has been placed on formulating recommendations to impede the development of antibiotic resistance in Propionibacterium acnes. The group adopted the Acne Consensus Conference system for grading acne severity. The group recommends that patients may be treated with topical medications including retinoids, benzoyl peroxide (BPO), salicylic acid, a combination of retinoid and BPO, or a combination of retinoids and BPO with or without antibiotics for mild acne; topical retinoid with topical BPO and a oral antibiotic for moderate acne; and oral isotretinoin if the patient fails first-line treatment (a 6- or 8-week trial of combined oral antibiotics and topical retinoids with BPO) for severe acne. Maintenance acne treatment using topical retinoids with or without BPO is recommended. To prevent the development of antibiotic resistance, topical antibiotics should not be used as monotherapy or used simultaneously with oral antibiotics. Skin care, comprised of cleansing, moisturizing and sun protection, is likewise recommended. Patient education and good communication is recommended to improve adherence, and advice should be given about the characteristics of the skin care products patients should use. © 2015 Japanese Dermatological Association.

Synchronizing Pharmacotherapy in Acne with Review of Clinical Care

PubMed Central

Sacchidanand, Sarvajnamurthy Aradhya; Lahiri, Koushik; Godse, Kiran; Patwardhan, Narendra Gajanan; Ganjoo, Anil; Kharkar, Rajendra; Narayanan, Varsha; Borade, Dhammraj; D’souza, Lyndon

2017-01-01

Acne is a chronic inflammatory skin disease that involves the pathogenesis of four major factors, such as androgen-induced increased sebum secretion, altered keratinization, colonization of Propionibacterium acnes, and inflammation. Several acne mono-treatment and combination treatment regimens are available and prescribed in the Indian market, ranging from retinoids, benzoyl peroxide (BPO), anti-infectives, and other miscellaneous agents. Although standard guidelines and recommendations overview the management of mild, moderate, and severe acne, relevance and positioning of each category of pharmacotherapy available in Indian market are still unexplained. The present article discusses the available topical and oral acne therapies and the challenges associated with the overall management of acne in India and suggestions and recommendations by the Indian dermatologists. The experts opined that among topical therapies, the combination therapies are preferred over monotherapy due to associated lower efficacy, poor tolerability, safety issues, adverse effects, and emerging bacterial resistance. Retinoids are preferred in comedonal acne and as maintenance therapy. In case of poor response, combination therapies BPO-retinoid or retinoid-antibacterials in papulopustular acne and retinoid-BPO or BPO-antibacterials in pustular-nodular acne are recommended. Oral agents are generally recommended for severe acne. Low-dose retinoids are economical and have better patient acceptance. Antibiotics should be prescribed till the inflammation is clinically visible. Antiandrogen therapy should be given to women with high androgen levels and are added to regimen to regularize the menstrual cycle. In late-onset hyperandrogenism, oral corticosteroids should be used. The experts recommended that an early initiation of therapy is directly proportional to effective therapeutic outcomes and prevent complications. PMID:28794543

Analysis of Follicular Fluid Retinoids in Women Undergoing In Vitro Fertilization

PubMed Central

Pauli, Samuel A.; Session, Donna R.; Shang, Weirong; Easley, Kirk; Wieser, Friedrich; Taylor, Robert N.; Pierzchalski, Keely; Napoli, Joseph L.; Kane, Maureen A.

2013-01-01

Retinol (ROL) and its biologically active metabolite, all-trans retinoic acid (ATRA), are essential for a number of reproductive processes. However, there is a paucity of information regarding their roles in ovarian folliculogenesis, oocyte maturation, and early embryogenesis. The objectives of this study were to quantify and compare peripheral plasma (PP) and follicular fluid (FF) retinoid levels, including ATRA in women undergoing in vitro fertilization (IVF) and to investigate the relationship between retinoid levels and embryo quality. Retinoid levels were evaluated in PP and FF from 79 women undergoing IVF at the time of oocyte retrieval and corresponding embryo quality assessed on a daily basis after retrieval for 3 days until uterine transfer. Analysis compared the retinoid levels with day 3 embryo grades and between endometriosis versus control patients. Results demonstrated distinctive levels of retinoid metabolites and isomers in FF versus PP. There was a significantly larger percentage of high-quality grade I embryos derived from the largest versus smallest follicles. An increase in follicle size also correlated with a >50% increase in FF ROL and ATRA concentrations. Independent of follicle size, FF yielding grade I versus nongrade I embryos showed higher mean levels of ATRA but not ROL. In a nested case–control analysis, control participants had 50% higher mean levels of ATRA in their FF and PP than women with endometriosis. These findings strongly support the proposition that ATRA plays a fundamental role in oocyte development and quality, and that reduced ATRA synthesis may contribute to decreased fecundity of participants with endometriosis. PMID:23427183

Ribavirin suppresses hepatic lipogenesis through inosine monophosphate dehydrogenase inhibition: Involvement of adenosine monophosphate-activated protein kinase-related kinases and retinoid X receptor α.

PubMed

Satoh, Shinya; Mori, Kyoko; Onomura, Daichi; Ueda, Youki; Dansako, Hiromichi; Honda, Masao; Kaneko, Shuichi; Ikeda, Masanori; Kato, Nobuyuki

2017-08-01

Ribavirin (RBV) has been widely used as an antiviral reagent, specifically for patients with chronic hepatitis C. We previously demonstrated that adenosine kinase, which monophosphorylates RBV into the metabolically active form, is a key determinant for RBV sensitivity against hepatitis C virus RNA replication. However, the precise mechanism of RBV action and whether RBV affects cellular metabolism remain unclear. Analysis of liver gene expression profiles obtained from patients with advanced chronic hepatitis C treated with the combination of pegylated interferon and RBV showed that the adenosine kinase expression level tends to be lower in patients who are overweight and significantly decreases with progression to advanced fibrosis stages. In our effort to investigate whether RBV affects cellular metabolism, we found that RBV treatment under clinically achievable concentrations suppressed lipogenesis in hepatic cells. In this process, guanosine triphosphate depletion through inosine monophosphate dehydrogenase inhibition by RBV and adenosine monophosphate-activated protein kinase-related kinases, especially microtubule affinity regulating kinase 4, were required. In addition, RBV treatment led to the down-regulation of retinoid X receptor α (RXRα), a key nuclear receptor in various metabolic processes, including lipogenesis. Moreover, we found that guanosine triphosphate depletion in cells induced the down-regulation of RXRα, which was mediated by microtubule affinity regulating kinase 4. Overexpression of RXRα attenuated the RBV action for suppression of lipogenic genes and intracellular neutral lipids, suggesting that down-regulation of RXRα was required for the suppression of lipogenesis in RBV action. Conclusion : We provide novel insights about RBV action in lipogenesis and its mechanisms involving inosine monophosphate dehydrogenase inhibition, adenosine monophosphate-activated protein kinase-related kinases, and down-regulation of RXRα. RBV may be a potential reagent for anticancer therapy against the active lipogenesis involved in hepatocarcinogenesis. ( Hepatology Communications 2017;1:550-563).

α-Synuclein and huntingtin exon 1 amyloid fibrils bind laterally to the cellular membrane.

PubMed

Monsellier, Elodie; Bousset, Luc; Melki, Ronald

2016-01-13

Fibrillar aggregates involved in neurodegenerative diseases have the ability to spread from one cell to another in a prion-like manner. The underlying molecular mechanisms, in particular the binding mode of the fibrils to cell membranes, are poorly understood. In this work we decipher the modality by which aggregates bind to the cellular membrane, one of the obligatory steps of the propagation cycle. By characterizing the binding properties of aggregates made of α-synuclein or huntingtin exon 1 protein displaying similar composition and structure but different lengths to mammalian cells we demonstrate that in both cases aggregates bind laterally to the cellular membrane, with aggregates extremities displaying little or no role in membrane binding. Lateral binding to artificial liposomes was also observed by transmission electron microscopy. In addition we show that although α-synuclein and huntingtin exon 1 fibrils bind both laterally to the cellular membrane, their mechanisms of interaction differ. Our findings have important implications for the development of future therapeutic tools that aim to block protein aggregates propagation in the brain.

α-Synuclein and huntingtin exon 1 amyloid fibrils bind laterally to the cellular membrane

PubMed Central

Monsellier, Elodie; Bousset, Luc; Melki, Ronald

2016-01-01

Fibrillar aggregates involved in neurodegenerative diseases have the ability to spread from one cell to another in a prion-like manner. The underlying molecular mechanisms, in particular the binding mode of the fibrils to cell membranes, are poorly understood. In this work we decipher the modality by which aggregates bind to the cellular membrane, one of the obligatory steps of the propagation cycle. By characterizing the binding properties of aggregates made of α-synuclein or huntingtin exon 1 protein displaying similar composition and structure but different lengths to mammalian cells we demonstrate that in both cases aggregates bind laterally to the cellular membrane, with aggregates extremities displaying little or no role in membrane binding. Lateral binding to artificial liposomes was also observed by transmission electron microscopy. In addition we show that although α-synuclein and huntingtin exon 1 fibrils bind both laterally to the cellular membrane, their mechanisms of interaction differ. Our findings have important implications for the development of future therapeutic tools that aim to block protein aggregates propagation in the brain. PMID:26757959

Systemic and topical drugs for aging skin.

PubMed

Kockaert, Michael; Neumann, Martino

2003-08-01

The rejuvenation of aging skin is a common desire for our patients, and several options are available. Although there are some systemic methods, the most commonly used treatments for rejuvenation of the skin are applied topically. The most frequently used topical drugs include retinoids, alpha hydroxy acids (AHAs), vitamin C, beta hydroxy acids, anti-oxidants, and tocopherol. Combination therapy is frequently used; particularly common is the combination of retinoids and AHAs. Systemic therapies available include oral retinoids and vitamin C. Other available therapies such as chemical peels, face-lifts, collagen, and botulinum toxin injections are not discussed in this article.

Histogenesis of retinal dysplasia in trisomy 13

PubMed Central

Chan, Ada; Lakshminrusimha, Satyan; Heffner, Reid; Gonzalez-Fernandez, Federico

2007-01-01

Background Although often associated with holoprosencephaly, little detail of the histopathology of cyclopia is available. Here, we describe the ocular findings in a case of trisomy 13 to better understand the histogenesis of the rosettes, or tubules, characteristic of the retinal dysplasia associated with this condition. Methods A full pediatric autopsy was performed of a near term infant who died shortly after birth from multiple congenital anomalies including fused facial-midline structures. A detailed histopathological study of the ocular structures was performed. The expression of interphotoreceptor retinoid-binding protein (IRBP), cellular retinal-binding protein (CRALBP), rod opsin, and Sonic Hedgehog (Shh) were studied by immunohistochemistry. Results Holoprosencephaly, and a spectrum of anatomical findings characteristic of Patau's syndrome, were found. Cytogenetic studies demonstrated trisomy 13 [47, XY, +13]. The eyes were fused but contained two developed separate lenses. In contrast, the cornea, and angle structures were hypoplastic, and the anterior chamber had failed to form. The retina showed areas of normally laminated neural retina, whereas in other areas it was replaced by numerous neuronal rosettes. Histological and immunohistochemical studies revealed that the rosettes were composed of differentiated retinal neurons and Müller cell glia. In normally laminated retina, Shh expression was restricted to retinal-ganglion cells, and to a population of neurons in the inner zone of the outer nuclear layer. In contrast, Shh could not be detected in the dysplastic rosettes. Conclusion The histopathology of cyclopia appears to be more complex than what may have been previously appreciated. In fact, the terms "cyclopia" and "synophthalmia" are misnomers as the underlying mechanism is a failure of the eyes to form separately during development. The rosettes found in the dysplastic retina are fundamentally different than those of retinoblastoma, being composed of a variety of differentiated cell types. The dysplastic rosettes are essentially laminated retina failing to establish a polarized orientation, resulting in the formation of tubules. Finally, our findings suggest that defective ganglion cell Shh expression may contribute to the ocular pathology of cyclopia. PMID:18088410

Towards Building an AOP-based Prenatal Developmental Toxicity Ontology (SOT)

EPA Science Inventory

Retinoid signaling plays an important role in embryo-fetal development and its disruption is broadly teratogenic. The retinoic acid (RA) pathway includes elements in retinoid metabolism and nuclear receptor (RAR, RXR) activation and thus serves as an excellent prototype for adver...

Use of topical tretinoin and the development of noncutaneous adverse events: evidence from a systematic review of the literature.

PubMed

Shapiro, Stanley; Heremans, Annie; Mays, David A; Martin, Amber L; Hernandez-Medina, Marisol; Lanes, Stephan

2011-12-01

Topical retinoids have been in clinical use for the treatment of chronic skin conditions, including acne, photodamage, and psoriasis, for 30 years. A systematic literature review was conducted to assess the incidence of noncutaneous adverse events (AE) among patients treated with topical retinoids with a focus on topical tretinoin studies reported before the Veterans Affairs Topical Tretinoin Chemoprevention trial. Electronic literature searches were conducted in Embase and MEDLINE for literature reporting development of nonteratogenic, noncutaneous AE among patients treated with topical retinoids published through September 2008. The search yielded 2778 citations, of which 20 studies met inclusion criteria. Tretinoin was used in 14 of the studies. Other retinoids assessed included isotretinoin, adapalene, alitretinoin, and tazarotene. Within patients receiving topical tretinoin, 27.9% reported the occurrence of at least one noncutaneous AE. The majority of noncutaneous AE were transient and judged not to be related to tretinoin treatment. The conclusions of this study apply largely to tretinoin compared with other topical retinoids. Many of the included trials were designed to evaluate the efficacy of topical treatment and reporting of safety events concentrated on incidence of localized AE, rather than systemic or noncutaneous events. We found no clear evidence of a relationship between the use of topical tretinoin and the development of noncutaneous AE before a recent report of excess mortality in a clinical trial. The majority of noncutaneous AE reported by patients receiving topical retinoids consisted of nonsevere, nonspecific symptoms that were judged not to be related to treatment. Copyright © 2010 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Transcriptome sequencing reveals e-cigarette vapor and mainstream-smoke from tobacco cigarettes activate different gene expression profiles in human bronchial epithelial cells

PubMed Central

Shen, Yifei; Wolkowicz, Michael J.; Kotova, Tatyana; Fan, Lonjiang; Timko, Michael P.

2016-01-01

Electronic cigarettes (e-cigarettes) generate an aerosol vapor (e-vapor) thought to represent a less risky alternative to main stream smoke (MSS) of conventional tobacco cigarettes. RNA-seq analysis was used to examine the transcriptomes of differentiated human bronchial epithelial (HBE) cells exposed to air, MSS from 1R5F tobacco reference cigarettes, and e-vapor with and without added nicotine in an in vitro air-liquid interface model for cellular exposure. Our results indicate that while e-vapor does not elicit many of the cell toxicity responses observed in MSS-exposed HBE cells, e-vapor exposure is not benign, but elicits discrete transcriptomic signatures with and without added nicotine. Among the cellular pathways with the most significantly enriched gene expression following e-vapor exposure are the phospholipid and fatty acid triacylglycerol metabolism pathways. Our data suggest that alterations in cellular glycerophopholipid biosynthesis are an important consequences of e-vapor exposure. Moreover, the presence of nicotine in e-vapor elicits a cellular response distinct from e-vapor alone including alterations of cytochrome P450 function, retinoid metabolism, and nicotine catabolism. These studies establish a baseline for future analysis of e-vapor and e-vapor additives that will better inform the FDA and other governmental bodies in discussions of the risks and future regulation of these products. PMID:27041137

The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses.

PubMed

Haigh, Cathryn L; Tumpach, Carolin; Drew, Simon C; Collins, Steven J

2015-01-01

Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response.

The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses

PubMed Central

Haigh, Cathryn L.; Tumpach, Carolin; Drew, Simon C.; Collins, Steven J.

2015-01-01

Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response. PMID:26252007

Evolution of the genetic machinery of the visual cycle: a novelty of the vertebrate eye?

PubMed

Albalat, Ricard

2012-05-01

The discovery in invertebrates of ciliary photoreceptor cells and ciliary (c)-opsins established that at least two of the three elements that characterize the vertebrate photoreceptor system were already present before vertebrate evolution. However, the origin of the third element, a series of biochemical reactions known as the "retinoid cycle," remained uncertain. To understand the evolution of the retinoid cycle, I have searched for the genetic machinery of the cycle in invertebrate genomes, with special emphasis on the cephalochordate amphioxus. Amphioxus is closely related to vertebrates, has a fairly prototypical genome, and possesses ciliary photoreceptor cells and c-opsins. Phylogenetic and structural analyses of the amphioxus sequences related with the vertebrate machinery do not support a function of amphioxus proteins in chromophore regeneration but suggest that the genetic machinery of the retinoid cycle arose in vertebrates due to duplications of ancestral nonvisual genes. These results favor the hypothesis that the retinoid cycle machinery was a functional innovation of the primitive vertebrate eye.

Retinoids: Literature Review and Suggested Algorithm for Use Prior to Facial Resurfacing Procedures

PubMed Central

Buchanan, Patrick J; Gilman, Robert H

2016-01-01

Vitamin A-containing products have been used topically since the early 1940s to treat various skin conditions. To date, there are four generations of retinoids, a family of Vitamin A-containing compounds. Tretinoin, all-trans-retinoic acid, is a first-generation, naturally occurring, retinoid. It is available, commercially, as a gel or cream. The authors conducted a complete review of all studies, clinical- and basic science-based studies, within the literature involving tretinoin treatment recommendations for impending facial procedures. The literature currently lacks definitive recommendations for the use of tretinoin-containing products prior to undergoing facial procedures. Tretinoin pretreatment regimens vary greatly in terms of the strength of retinoid used, the length of the pre-procedure treatment, and the ideal time to stop treatment before the procedure. Based on the current literature and personal experience, the authors set forth a set of guidelines for the use of tretinoin prior to various facial procedures. PMID:27761082

Effects of retinoids on ultraviolet-induced carcinogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, J.H.

The evidence for effects of the retinoids on UV-induced carcinogenesis is sparse. Clinical observations indicate that topical RA can cause significant regression of premalignant actinic keratoses. Also there is some evidence that this agent can cause dissolution of some basal cell epitheliomas. However this latter effect does not appear to be of therapeutic value. Systemic retinoids are of little value in the treatment of premalignant and malignant cutaneous lesions though 13-cis-retinoic acid might be of use in the basal cell nevus syndrome. Examination of the influence of the retinoids on photocarcinogenesis essentially has been confined to RA and animal experimentation.more » RA in nontoxic concentrations can both stimulate and inhibit photocarcinogenesis depending upon the circumstances of the study. The mechanisms of these responses are not clear. Influences on DNA synthesis directly and/or indirectly or on immune responses may be involved in both effects. Preliminary studies with oral 13-cis-retinoic acid have not demonstrated any effects to date on UV-induced skin cancer formation.« less

Alteration of gene expression in the colon of colorectal cancer model rat by dietary sodium gluconate.

PubMed

Kameue, Chiyoko; Tsukahara, Takamitsu; Ushida, Kazunari

2006-03-01

Butyrate induces apoptosis of various cancer cell lines in a p53-independent manner and inhibits the proliferation of cancer cells. In a previous report, we reported a significant reduction in tumor incidence in rat colon as a result of dietary sodium gluconate (GNA). The stimulation of apoptosis through enhanced butyrate production in the large intestine was involved in the antitumorigenic effect of GNA. In the present study, a cDNA microarray analysis was performed to investigate the particular mechanism involved in the antitumorigenic effect of GNA. Some up-regulated genes suggested by microarray analysis were further evaluated using real-time PCR. A microarray revealed that GNA regulates the expression of retinoic acid receptor (RAR) and retinoid X receptor (RXR), and several genes known as the target of retinoids in cancer cells. In other words, the antitumorigenic effect of GNA may involve the regulation of the retinoid signaling pathway by butyrate in a retinoid-independent manner.

Beneficial effect of a moisturizing cream as adjunctive treatment to oral isotretinoin or topical tretinoin in the management of acne.

PubMed

Laquieze, Sabine; Czernielewski, Janusz; Rueda, Marie-José

2006-01-01

Despite their beneficial effects on the treatment of acne vulgaris, topical and oral retinoids may cause severe local irritation (retinoid dermatitis) due to their mechanism of action, thereby jeopardizing patient adherence, and thus compromising treatment efficacy. Alleviating dryness and improving skin comfort by using a moisturizer concomitantly to retinoids could enhance efficacy. In the present study, 30 subjects receiving either oral isotretinoin for at least 2 months or topical tretinoin for at least one month applied a moisturizing cream (Cetaphil Moisturizing Cream) twice daily for 15 days on one half of the face while the other side remained untreated. Clinical assessments, confirmed by biophysical measurements, showed that the moisturizer provided a significant improvement in skin dryness, roughness, and desquamation. Skin properties and skin discomfort were also greatly improved and subjects were very satisfied with the product. Retinoid-induced skin irritation can be relieved by the regular use of a gentle moisturizing cream as an adjunctive treatment.

Pathogenesis of Zika Virus-Associated Embryopathy.

PubMed

Mawson, Anthony R

2016-01-01

A strong causal association has become evident between Zika virus (ZIKV) infection during pregnancy and the occurrence of fetal growth restriction, microcephaly and eye defects. Circumstantial evidence is presented in this paper in support of the hypothesis that these effects, as well as the Guillain-Barré syndrome, are due to an endogenous form of hypervitaminosis A resulting from ZIKV infection-induced damage to the liver and the spillage of stored vitamin A compounds ("retinoids") into the maternal and fetal circulation in toxic concentrations. Retinoids are mainly stored in the liver (about 80%) and are essential for numerous biological functions. In higher concentration, retinoids are potentially cytotoxic, pro-oxidant, mutagenic and teratogenic, especially if sudden shifts occur in their bodily distribution. Although liver involvement has not been mentioned specifically in recent reports, conventional liver enzyme tests underestimate the true extent of liver dysfunction. The proposed model could be tested by comparing retinoid concentration and expression profiles in microcephalic newborns of ZIKV-infected mothers and nonmicrocephalic newborn controls, and by correlating these profiles with measures of clinical severity.

Unique spatial and cellular expression patterns of Hoxa5, Hoxb4 and Hoxb6 proteins in normal developing murine lung are modified in pulmonary hypoplasia

PubMed Central

Volpe, MaryAnn Vitoria; Wang, Karen Ting Wai; Nielsen, Heber Carl; Chinoy, Mala Romeshchandra

2009-01-01

Background Hox transcription factors modulate signaling pathways controlling organ morphogenesis and maintain cell fate and differentiation in adults. Retinoid signaling, key in regulating Hox expression, is altered in pulmonary hypoplasia. Information on pattern-specific expression of Hox proteins in normal lung development and in pulmonary hypoplasia is minimal. Our objective was to determine how pulmonary hypoplasia alters temporal, spatial and cellular expression of Hoxa5, Hoxb4 and Hoxb6 proteins compared to normal lung development. Methods Temporal, spatial and cellular Hoxa5, Hoxb4 and Hoxb6 expression was studied in normal (untreated) and nitrofen-induced hypoplastic (NT-PH) lungs from gestational day 13.5, 16, 19 fetuses and neonates using western blot and immunohistochemistry. Results Modification of protein levels and spatial and cellular Hox expression patterns in NT-PH lungs was consistent with delayed lung development. Distinct protein isoforms were detected for each Hox protein. Expression levels of the Hoxa5 and Hoxb6 isoforms changed with development and further in NT-PH lungs. Compared to normal lungs, Gd19 and neonatal NT-PH lungs had decreased Hoxb6 and increased Hoxa5 and Hoxb4. Hoxa5 cellular localization changed from mesenchyme to epithelia earlier in normal lungs. Hoxb4 was expressed in mesenchyme and epithelial cells throughout development. Hoxb6 remained mainly in mesenchymal cells around distal airways. Conclusions Unique spatial and cellular expression of Hoxa5, Hoxb4 and Hoxb6 participates in branching morphogenesis and terminal sac formation. Altered Hox protein temporal and cellular balance of expression either contributes to pulmonary hypoplasia or functions as a compensatory mechanism attempting to correct abnormal lung development and maturation in this condition. PMID:18553509

SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.

PubMed

Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan

2013-04-30

The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.

Physiological and Microfluorometric Studies of Reduction and Clearance of Retinal in Bleached Rod Photoreceptors

PubMed Central

Tsina, Efthymia; Chen, Chunhe; Koutalos, Yiannis; Ala-Laurila, Petri; Tsacopoulos, Marco; Wiggert, Barbara; Crouch, Rosalie K.; Cornwall, M. Carter

2004-01-01

The visual cycle comprises a sequence of reactions that regenerate the visual pigment in photoreceptors during dark adaptation, starting with the reduction of all-trans retinal to all-trans retinol and its clearance from photoreceptors. We have followed the reduction of retinal and clearance of retinol within bleached outer segments of red rods isolated from salamander retina by measuring its intrinsic fluorescence. Following exposure to a bright light (bleach), increasing fluorescence intensity was observed to propagate along the outer segments in a direction from the proximal region adjacent to the inner segment toward the distal tip. Peak retinol fluorescence was achieved after ∼30 min, after which it declined very slowly. Clearance of retinol fluorescence is considerably accelerated by the presence of the exogenous lipophilic substances IRBP (interphotoreceptor retinoid binding protein) and serum albumin. We have used simultaneous fluorometric and electrophysiological measurements to compare the rate of reduction of all-trans retinal to all-trans retinol to the rate of recovery of flash response amplitude in these cells in the presence and absence of IRBP. We find that flash response recovery in rods is modestly accelerated in the presence of extracellular IRBP. These results suggest such substances may participate in the clearance of retinoids from rod photoreceptors, and that this clearance, at least in rods, may facilitate dark adaptation by accelerating the clearance of photoproducts of bleaching. PMID:15452202

Retinoblastoma-binding Protein 4-regulated Classical Nuclear Transport Is Involved in Cellular Senescence*

PubMed Central

Tsujii, Akira; Miyamoto, Yoichi; Moriyama, Tetsuji; Tsuchiya, Yuko; Obuse, Chikashi; Mizuguchi, Kenji; Oka, Masahiro; Yoneda, Yoshihiro

2015-01-01

Nucleocytoplasmic trafficking is a fundamental cellular process in eukaryotic cells. Here, we demonstrated that retinoblastoma-binding protein 4 (RBBP4) functions as a novel regulatory factor to increase the efficiency of importin α/β-mediated nuclear import. RBBP4 accelerates the release of importin β1 from importin α via competitive binding to the importin β-binding domain of importin α in the presence of RanGTP. Therefore, it facilitates importin α/β-mediated nuclear import. We showed that the importin α/β pathway is down-regulated in replicative senescent cells, concomitant with a decrease in RBBP4 level. Knockdown of RBBP4 caused both suppression of nuclear transport and induction of cellular senescence. This is the first report to identify a factor that competes with importin β1 to bind to importin α, and it demonstrates that the loss of this factor can trigger cellular senescence. PMID:26491019

A New Family of Nuclear Receptor Coregulators That Integrate Nuclear Receptor Signaling through CREB-Binding Protein

PubMed Central

Mahajan, Muktar A.; Samuels, Herbert H.

2000-01-01

We describe the cloning and characterization of a new family of nuclear receptor coregulators (NRCs) which modulate the function of nuclear hormone receptors in a ligand-dependent manner. NRCs are expressed as alternatively spliced isoforms which may exhibit different intrinsic activities and receptor specificities. The NRCs are organized into several modular structures and contain a single functional LXXLL motif which associates with members of the steroid hormone and thyroid hormone/retinoid receptor subfamilies with high affinity. Human NRC (hNRC) harbors a potent N-terminal activation domain (AD1), which is as active as the herpesvirus VP16 activation domain, and a second activation domain (AD2) which overlaps with the receptor-interacting LXXLL region. The C-terminal region of hNRC appears to function as an inhibitory domain which influences the overall transcriptional activity of the protein. Our results suggest that NRC binds to liganded receptors as a dimer and this association leads to a structural change in NRC resulting in activation. hNRC binds CREB-binding protein (CBP) with high affinity in vivo, suggesting that hNRC may be an important functional component of a CBP complex involved in mediating the transcriptional effects of nuclear hormone receptors. PMID:10866662

Literature Mining Methods for Toxicology and Construction of ...

EPA Pesticide Factsheets

Webinar Presentation on text-mining methodologies in use at NCCT and how they can be used to assist with the OECD Retinoid project. Presentation to 1st Workshop/Scientific Expert Group meeting on the OECD Retinoid Project - April 26, 2016 –Brussels, Presented remotely via web.

STORED RETINOIDS IN POPULATIONS OF AN ESTUARINE FISH, FUNDULUS HETERCLITUS, INDIGENOUS TO PCB-CONTAMINATED AND REFERENCE SITES

EPA Science Inventory

Concentrations of retinoids, derivatives of vitamin A, were measured in populations of the nonmigratory estuarine fish Fundulus heteroclitus, indigenous to a reference site and a site highly contaminated with polychlorinated biphenyls (PCBs) to address the hypothesis that contami...

CASTING A BROAD NETWORK: FISHING FOR MECHANISMS OF RETINOID TERATOGENICITY

EPA Science Inventory

This is a short essay that serves to introduce a featured paper for an issue of Toxicological Sciences. The paper being introduced describes a study of mechanisms of retinoid induced abnormal limb development in mice. The paper was notable because the authors used gene expressi...

Duration of oral tetracycline-class antibiotic therapy and use of topical retinoids for the treatment of acne among general practitioners (GP): A retrospective cohort study.

PubMed

Barbieri, John S; Hoffstad, Ole; Margolis, David J

2016-12-01

Guidelines recommend limiting the duration of oral antibiotic therapy in acne to 3 to 6 months and prescribing concomitant topical retinoids for all patients. We sought to evaluate the duration of therapy with oral tetracyclines and the use of topical retinoids among patients with acne treated primarily by general practitioners in the United Kingdom. We conducted a retrospective cohort study using the Health Improvement Network database. The mean duration of therapy was 175.1 days. Of antibiotic courses, 62% were not associated with a topical retinoid; 29% exceeded 6 months in duration. If all regions were to achieve uses similar to the region with the shortest mean duration of therapy, approximately 3.3 million antibiotic days per year could be avoided in the United Kingdom. The Health Improvement Network does not include information on acne severity and clinical outcomes. Prescribing behavior for oral antibiotics in the treatment of acne among general practitioners is not aligned with current guideline recommendations. Increasing the use of topical retinoids and considering alternative agents to oral antibiotics when appropriate represent opportunities to reduce antibiotic exposure and associated complications such as antibiotic resistance and to improve outcomes in patients treated for acne. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Plasma retinoids concentration in Leptodactylus chaquensis (Amphibia: Leptodactylidae) from rice agroecosystems, Santa Fe province, Argentina.

PubMed

Teglia, Carla M; Attademo, Andrés M; Peltzer, Paola M; Goicoechea, Héctor C; Lajmanovich, Rafael C

2015-09-01

Retinoids are known to regulate important processes such as differentiation, development, and embryogenesis of vertebrates: Alteration in endogenous retinoids concentration is linked with teratogenic effects. Retinol (ROH), retinoid acid (RA), and isoform 13-Cis-retinoic acid (13-Cis-RA), in plasma of a native adults frog, Leptodactylus chaquensis from a rice field (RF) and a forest (reference site; RS) were measured. ROH did not vary between treatment sites. RA and 13-Cis-RA activities were higher (93.7±8.6 μg mL(-1) and 131.7±11.4 μg mL(-1), respectively) in individuals collected from RF than in those from RS (65.5±8.6 μg mL(-1) and 92.2±10.2 μg mL(-1), respectively). The ratios retinoic acid-retinol (RA/ROH) and 13-Cis-RA/ROH revealed significantly higher values in RF than in RS. RA and 13-Cis-RA concentrations in plasma on wild amphibian's species such as L. chaquensis would be suitable biomarkers of pesticide exposure in field monitoring. Finally, the mechanism of alteration in retinoid metabolites alteration should be further explored both in larvae and adult, considering that the potential exposition and uptake contaminants vary between the double lives of these vertebrates. Copyright © 2015 Elsevier Ltd. All rights reserved.

BXR, an embryonic orphan nuclear receptor activated by a novel class of endogenous benzoate metabolites

PubMed Central

Blumberg, Bruce; Kang, Heonjoong; Bolado, Jack; Chen, Hongwu; Craig, A. Grey; Moreno, Tanya A.; Umesono, Kazuhiko; Perlmann, Thomas; De Robertis, Eddy M.; Evans, Ronald M.

1998-01-01

Nuclear receptors are ligand-modulated transcription factors that respond to steroids, retinoids, and thyroid hormones to control development and body physiology. Orphan nuclear receptors, which lack identified ligands, provide a unique, and largely untapped, resource to discover new principles of physiologic homeostasis. We describe the isolation and characterization of the vertebrate orphan receptor, BXR, which heterodimerizes with RXR and binds high-affinity DNA sites composed of a variant thyroid hormone response element. A bioactivity-guided screen of embryonic extracts revealed that BXR is activatable by low-molecular-weight molecules with spectral patterns distinct from known nuclear receptor ligands. Mass spectrometry and 1H NMR analysis identified alkyl esters of amino and hydroxy benzoic acids as potent, stereoselective activators. In vitro cofactor association studies, along with competable binding of radiolabeled compounds, establish these molecules as bona fide ligands. Benzoates comprise a new molecular class of nuclear receptor ligand and their activity suggests that BXR may control a previously unsuspected vertebrate signaling pathway. PMID:9573044

UPTAKE AND METABOLISM OF ALL-TRANS RETINOIC ACID BY THREE NATIVE NORTH AMERICAN RANIDS

EPA Science Inventory

Retinoids, which are Vvitamin A derivatives, are important signaling molecules that regulate processes critical for development in all vertebrates. The objective of our study was to examine uptake and metabolism of the model retinoid, all-trans retinoic acid (all-trans RA), by th...

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

In Silico Molecular Interaction of Bisphenol Analogues with Human Nuclear Receptors Reveals their Stronger Affinity vs. Classical Bisphenol A.

PubMed

Sharma, Shikha; Ahmad, Shahzad; Faraz Khan, Mohemmed; Parvez, Suhel; Raisuddin, Sheikh

2018-06-21

Bisphenol A (BPA) is known for endocrine disrupting activity. In order to replace BPA a number of bisphenol analogues have been designed. However, their activity profile is poorly described and little information exists about their endocrine disrupting potential and interactions with nuclear receptors. An understanding of such interaction may unravel mechanism of their molecular action and provide valuable inputs for risk assessment. BPA binds and activates peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) which act as transcription factors and regulate genes involved in glucose, lipid, and cholesterol metabolism and adipogenesis. We studied binding efficiency of 18 bisphenol analogues and BPA with human PPARs and RXRs. Using Maestro Schrodinger 9.4, docking scores of bisphenols were compared with the known endogenous and exogenous ligands of hPPARs and hRXRs. BPA showed good binding efficiency. Several analogues also showed higher binding efficiency than BPA. BPPH which has high tendency to be absorbed in tissues showed the strongest binding with hPPARα, hPPARβ, hPPARγ and hRXRα whereas two of the most toxic bisphenols, BPM and BPAF showed strongest binding with hRXRβ and hRXRγ. Some of the bisphenol analogues showed a stronger binding affinity with PPAR and RXR compared to BPA implying that BPA substitutes may not be fully safe and chemico-biological interactions indicate their toxic potential. These results may also serve to plan further studies for determining safety profile of bisphenol analogues and be helpful in risk characterization.

Cellular Binding of Anionic Nanoparticles is Inhibited by Serum Proteins Independent of Nanoparticle Composition.

PubMed

Fleischer, Candace C; Kumar, Umesh; Payne, Christine K

2013-09-01

Nanoparticles used in biological applications encounter a complex mixture of extracellular proteins. Adsorption of these proteins on the nanoparticle surface results in the formation of a "protein corona," which can dominate the interaction of the nanoparticle with the cellular environment. The goal of this research was to determine how nanoparticle composition and surface modification affect the cellular binding of protein-nanoparticle complexes. We examined the cellular binding of a collection of commonly used anionic nanoparticles: quantum dots, colloidal gold nanoparticles, and low-density lipoprotein particles, in the presence and absence of extracellular proteins. These experiments have the advantage of comparing different nanoparticles under identical conditions. Using a combination of fluorescence and dark field microscopy, flow cytometry, and spectroscopy, we find that cellular binding of these anionic nanoparticles is inhibited by serum proteins independent of nanoparticle composition or surface modification. We expect these results will aid in the design of nanoparticles for in vivo applications.

Toxcast Chemical and Bioactivity Profiles for In Vitro Targets in the Retinoid Signaling System (SOT)

EPA Science Inventory

A predictive model for prenatal developmental toxicity using ToxCast Phase I showed the RAR assay set to be the strongest weighting factor (Sipes et al. 2011). Retinoid signaling mediates growth and differentiation of the embryo. ToxCast has 6 reporter assays for trans-activation...

Topical retinoids in the management of photodamaged skin: from theory to evidence-based practical approach.

PubMed

Darlenski, R; Surber, C; Fluhr, J W

2010-12-01

Skin, being exposed directly to the environment, represents a unique model for demonstrating the synergistic effects of intrinsic and extrinsic factors on the ageing process. Ultraviolet radiation (UVR) is the major factor among exogenous stressors responsible for premature skin ageing. The problem of skin ageing has captured public attention and has an important social impact. Different therapeutic approaches have been developed to treat cutaneous ageing and to diminish or prevent the negative effects of UVR. Topical retinoids represent an important and powerful class of molecules in the dermatologist's hands for the treatment of photodamaged skin. Since their introduction more than 20 years ago, topical retinoids have shown beneficial efficacy and good safety profiles in the management of photodamaged skin, and as therapeutic anti-ageing agents. This review provides a brief retrospective of the development of topical retinoids in the treatment of photodamaged skin, elucidates their mechanism of action, delineates their use and addresses clinical, pharmaceutical and regulatory issues in connection with their intended use. © 2010 The Authors. BJD © 2010 British Association of Dermatologists.

Correlations between conceptal concentrations of all-trans-retinoic acid and dysmorphogenesis after microinjections of all-trans-retinoic acid, 13-cis-retinoic acid, all-trans-retinoyl-beta-glucuronide, or retinol in cultured whole rat embryos.

PubMed

Kraft, J C; Juchau, M R

1992-01-01

Retinol (4,000 ng/ml), all-trans-retinoyl-beta-glucuronide (4,000 ng/ml), and 13-cis-retinoic acid (1,500 ng/ml) each produced dysmorphogenic effects qualitatively similar to those elicited by 250 ng/ml of all-trans-retinoic acid after microinjections of the respective individual retinoids into the amniotic cavities of cultured whole rat embryos. Subsequent HPLC analyses of the cultured whole conceptuses, embryos proper, yolk sacs, and culture media (24 hr after microinjections) indicated that conceptal biotransformation of each of the retinoids had occurred during the culture period. All-trans-retinoic acid was present in the embryos proper at quantitatively similar concentrations (20-100 nM) after microinjections of the selected quantities of each of the microinjected retinoids: retinol, all-trans-retinoyl-beta-glucuronide, 13-cis-retinoic acid, or all-trans-retinoic acid. The results suggested that all-trans-retinoic acid acted as an ultimate dysmorphogen for the retinoids tested with respect to the anomalies monitored in the embryo culture system.

A human induced pluripotent stem cell-based in vitro assay predicts developmental toxicity through a retinoic acid receptor-mediated pathway for a series of related retinoid analogues.

PubMed

Palmer, Jessica A; Smith, Alan M; Egnash, Laura A; Colwell, Michael R; Donley, Elizabeth L R; Kirchner, Fred R; Burrier, Robert E

2017-10-01

The relative developmental toxicity potency of a series of retinoid analogues was evaluated using a human induced pluripotent stem (iPS) cell assay that measures changes in the biomarkers ornithine and cystine. Analogue potency was predicted, based on the assay endpoint of the ornithine/cystine (o/c) ratio, to be all-trans-retinoic acid>TTNPB>13-cis-retinoic acid≈9-cis-retinoic acid>acitretin>etretinate>retinol. These rankings correlate with in vivo data and demonstrate successful application of the assay to rank a series of related toxic and non-toxic compounds. The retinoic acid receptor α (RARα)-selective antagonist Ro 41-5253 inhibited the cystine perturbation caused by all-trans-retinoic acid, TTNPB, 13-cis-retinoic acid, 9-cis-retinoic acid, and acitretin. Ornithine was altered independent of RARα in all retinoids except acitretin. These results suggest a role for an RARα-mediated mechanism in retinoid-induced developmental toxicity through altered cystine metabolism. Copyright © 2017 Elsevier Inc. All rights reserved.

The expression of Apoc3 mRNA is regulated by HNF4α and COUP-TFII, but not acute retinoid treatments, in primary rat hepatocytes and hepatoma cells.

PubMed

Howell, Meredith; Li, Rui; Zhang, Rui; Li, Yang; Chen, Wei; Chen, Guoxun

2014-02-01

Vitamin A status regulates obesity development, hyperlipidemia, and hepatic lipogenic gene expression in Zucker fatty (ZF) rats. The development of hyperlipidemia in acne patients treated with retinoic acid (RA) has been attributed to the induction of apolipoprotein C-III expression. To understand the role of retinoids in the development of hyperlipidemia in ZF rats, the expression levels of several selected RA-responsive genes in the liver and isolated hepatocytes from Zucker lean (ZL) and ZF rats were compared using real-time PCR. The Rarb and Srebp-1c mRNA levels are higher in the liver and isolated hepatocytes from ZF than ZL rats. The Apoc3 mRNA level is only higher in the isolated hepatocytes from ZF than ZL rats. To determine whether dynamic RA production acutely regulates Apoc3 expression, its mRNA levels in response to retinoid treatments or adenovirus-mediated overexpression of hepatocyte nuclear factor 4 alpha (HNF4α) and chicken ovalbumin upstream-transcription factor II (COUP-TFII) were analyzed. Retinoid treatments for 2-6 h did not induce the expression of Apoc3 mRNA. The overexpression of HNF4α or COUP-TFII induced or inhibited Apoc3 expression, respectively. We conclude that short-term retinoid treatments could not induce Apoc3 mRNA expression, which is regulated by HNF4α and COUP-TFII in hepatocytes.

In Vivo Two-Photon Fluorescence Kinetics of Primate Rods and Cones

PubMed Central

Sharma, Robin; Schwarz, Christina; Williams, David R.; Palczewska, Grazyna; Palczewski, Krzysztof; Hunter, Jennifer J.

2016-01-01

Purpose The retinoid cycle maintains vision by regenerating bleached visual pigment through metabolic events, the kinetics of which have been difficult to characterize in vivo. Two-photon fluorescence excitation has been used previously to track autofluorescence directly from retinoids and pyridines in the visual cycle in mouse and frog retinas, but the mechanisms of the retinoid cycle are not well understood in primates. Methods We developed a two-photon fluorescence adaptive optics scanning light ophthalmoscope dedicated to in vivo imaging in anesthetized macaques. Using pulsed light at 730 nm, two-photon fluorescence was captured from rods and cones during light and dark adaptation through the eye's pupil. Results The fluorescence from rods and cones increased with light exposure but at different rates. During dark adaptation, autofluorescence declined, with cone autofluorescence decreasing approximately 4 times faster than from rods. Rates of autofluorescence decrease in rods and cones were approximately 4 times faster than their respective rates of photopigment regeneration. Also, subsets of sparsely distributed cones were less fluorescent than their neighbors immediately following bleach at 565 nm and they were comparable with the S cone mosaic in density and distribution. Conclusions Although other molecules could be contributing, we posit that these fluorescence changes are mediated by products of the retinoid cycle. In vivo two-photon ophthalmoscopy provides a way to monitor noninvasively stages of the retinoid cycle that were previously inaccessible in the living primate eye. This can be used to assess objectively photoreceptor function in normal and diseased retinas. PMID:26903225

Reversible upregulation of tropomyosin-related kinase receptor B by geranylgeranoic acid in human neuroblastoma SH-SY5Y cells.

PubMed

Sakane, Chiharu; Shidoji, Yoshihiro

2011-09-01

All-trans retinoic acid (ATRA) plays crucial roles in cell survival and differentiation of neuroblastoma cells. In the present study, we investigated the effects of geranylgeranoic acid (GGA), an acyclic retinoid, on differentiation and tropomyosin-related kinase receptor B (TrkB) gene expression in SH-SY5Y human neuroblastoma cells in comparison with ATRA. GGA induced growth suppression and neural differentiation to the same extent as ATRA. Two variants (145 and 95 kD) of the TrkB protein were dramatically increased by GGA treatment, comparable to the effect of ATRA. Following 6- to 8-day GGA treatment, the effect of GGA on TrkB was reversed after 2-4 days of its removal, whereas the effect of ATRA was irreversible under the same conditions. Both GGA and ATRA upregulated the cellular levels of three major TrkB messenger RNA splice variants in a time-dependent manner. Time-dependent induction of cell cycle-related genes, such as cyclin D1 and retinoblastoma protein, and amplification of the neural progenitor cell marker, brain lipid binding protein, were suppressed by GGA treatment and were completely abolished by ATRA. ATRA and GGA induced retinoic acid receptor β (RARβ) expression, whereas the time-dependent expression of both RARα and RARγ was abolished by ATRA, but not by GGA. Our results suggest that GGA may be able to restore neuronal properties of SH-SY5Y human neuroblastoma cells in a similar but not identical way to ATRA.

Adaptive responses induced by 24S-hydroxycholesterol through liver X receptor pathway reduce 7-ketocholesterol-caused neuronal cell death☆

PubMed Central

Okabe, Akishi; Urano, Yasuomi; Itoh, Sayoko; Suda, Naoto; Kotani, Rina; Nishimura, Yuki; Saito, Yoshiro; Noguchi, Noriko

2013-01-01

Lipid peroxidation products have been known to induce cellular adaptive responses and enhance tolerance against subsequent oxidative stress through up-regulation of antioxidant compounds and enzymes. 24S-hydroxycholesterol (24SOHC) which is endogenously produced oxysterol in the brain plays an important role in maintaining brain cholesterol homeostasis. In this study, we evaluated adaptive responses induced by brain-specific oxysterol 24SOHC in human neuroblastoma SH-SY5Y cells. Cells treated with 24SOHC at sub-lethal concentrations showed significant reduction in cell death induced by subsequent treatment with 7-ketocholesterol (7KC) in both undifferentiated and retinoic acid-differentiated SH-SY5Y cells. These adaptive responses were also induced by other oxysterols such as 25-hydroxycholesterol and 27-hydroxycholesterol which are known to be ligands of liver X receptor (LXR). Co-treatment of 24SOHC with 9-cis retinoic acid, a retinoid X receptor ligand, enhanced the adaptive responses. Knockdown of LXRβ by siRNA diminished the adaptive responses induced by 24SOHC almost completely. The treatment with 24SOHC induced the expression of LXR target genes, such as ATP-binding cassette transporter A1 (ABCA1) and G1 (ABCG1). The 24SOHC-induced adaptive responses were significantly attenuated by siRNA for ABCG1 but not by siRNA for ABCA1. Taken together, these results strongly suggest that 24SOHC at sub-lethal concentrations induces adaptive responses via transcriptional activation of LXR signaling pathway, thereby protecting neuronal cells from subsequent 7KC-induced cytotoxicity. PMID:24371802

Immune responses to retinal autoantigens and peptides in equine recurrent uveitis.

PubMed

Deeg, C A; Kaspers, B; Gerhards, H; Thurau, S R; Wollanke, B; Wildner, G

2001-02-01

To test the hypothesis that autoimmune mechanisms are involved in horses in which equine recurrent uveitis (ERU) develops spontaneously. Material obtained from horses treated for spontaneous disease by therapeutic routine vitrectomy was analyzed for total IgG content and IgG specific for S-Antigen (S-Ag) and interphotoreceptor retinoid-binding protein (IRBP). The cellular infiltrate of the vitreous was analyzed by differential counts of cytospin preparations and flow cytometry using equine lymphocyte-specific antibodies. Antigen-specific proliferation assays were performed comparing peripheral blood lymphocytes (PBLs) with vitreal lymphocytes by stimulation with S-Ag and several S-Ag- and IRBP-derived peptides. The total IgG content of specimens from horses with ERU was very high with great variability among the investigated samples (11.5 +/- 8.0 mg). Autoantibodies to S-Ag or IRBP or both were found in 72% of vitreous specimens from horses with uveitis. The leukocyte infiltrates (up to 2 x 10(8) cells per sample) were dominated by lymphocytes (>90%) in most cases (22/32). Flow cytometry showed that more than 50% of these cells were CD4(+) T cells. In vitro stimulation of vitreal lymphocytes, but not of PBL, showed a strong proliferative response to peptides derived from S-Ag or IRBP in 9 of 12 patients. In the eyes of horses with ERU, IgG antibodies and autoreactive T cells specific for retinal antigens were detected. These results strongly support the hypothesis that ERU is an autoimmune-mediated disease and is highly similar to recurrent uveitis in humans in both clinical and immunologic parameters.

Retinoids in the treatment of glioma: a new perspective.

PubMed

Mawson, Anthony R

2012-01-01

Primary brain tumors are among the top ten causes of cancer-related deaths in the US. Malignant gliomas account for approximately 70% of the 22,500 new cases of malignant primary brain tumors diagnosed in adults each year and are associated with high morbidity and mortality. Despite optimal treatment, the prognosis for patients with gliomas remains poor. The use of retinoids (vitamin A and its congeners) in the treatment of certain tumors was originally based on the assumption that these conditions were associated with an underlying deficiency of vitamin A and that supplementation with pharmacological doses would correct the deficiency. Yet the results of retinoid treatment have been only modestly beneficial and usually short-lived. Studies also indicate that vitamin A excess and supplementation have pro-oxidant effects and are associated with increased risks of mortality from cancer and other diseases. The therapeutic role of vitamin A in cancer thus remains uncertain and a new perspective on the facts is needed. The modest and temporary benefits of retinoid treatment could result from a process of feedback inhibition, whereby exogenous retinoid temporarily inhibits the endogenous synthesis of these compounds. In fact, repeated and/or excessive exposure of the tissues to endogenous retinoic acid may contribute to carcinogenesis. Gliomas, in particular, may result from an imbalance in retinoid receptor expression initiated by environmental factors that increase the endogenous production of retinoic acid in glia. At the receptor level, it is proposed that this imbalance is characterized by excessive expression of retinoic acid receptor-α (RARα) and reduced expression of retinoic acid receptor-β (RARβ). This suggests a potential new treatment strategy for gliomas, possibly even at a late stage of the disease, ie, to combine the use of a RARα antagonist and a RARβ agonist. According to this hypothesis, the RARα antagonist would be expected to inhibit RARα-induced gliomas, while the RARβ agonist would suppress tumor growth and possibly contribute to the regeneration of normal glia.

Activation of RAS/ERK alone is insufficient to inhibit RXRα function and deplete retinoic acid in hepatocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Ai-Guo, E-mail: wangaiguotl@hotmail.com; Song, Ya-Nan; Chen, Jun

2014-09-26

Highlights: • The activation of RAS/ERK is insufficient to inhibit RXRα function and deplete RA. • The retinoid metabolism-related genes are down-regulated by ras oncogene. • The atRA has no effect on preventing hepatic tumorigenesis or curing the developed hepatic nodules. - Abstract: Activation of RAS/ERK signaling pathway, depletion of retinoid, and phosphorylation of retinoid X receptor alpha (RXRα) are frequent events found in liver tumors and thought to play important roles in hepatic tumorigenesis. However, the relationships among them still remained to be elucidated. By exploring the transgenic mouse model of hepatic tumorigenesis induced by liver-specific expression of H-ras12Vmore » oncogene, the activation of RAS/ERK, the mRNA expression levels of retinoid metabolism-related genes, the contents of retinoid metabolites, and phosphorylation of RXRα were determined. RAS/ERK signaling pathway was gradually and significantly activated in hepatic tumor adjacent normal liver tissues (P) and hepatic tumor tissues (T) of H-ras12V transgenic mice compared with normal liver tissues (Wt) of wild type mice. On the contrary, the mRNA expression levels of retinoid metabolism-related genes were significantly reduced in P and T compared with Wt. Interestingly, the retinoid metabolites 9-cis-retinoic acid (9cRA) and all-trans-retinoic acid (atRA), the well known ligands for nuclear transcription factor RXR and retinoic acid receptor (RAR), were significantly decreased only in T compared with Wt and P, although the oxidized polar metabolite of atRA, 4-keto-all-trans-retinoic-acid (4-keto-RA) was significantly decreased in both P and T compared with Wt. To our surprise, the functions of RXRα were significantly blocked only in T compared with Wt and P. Namely, the total protein levels of RXRα were significantly reduced and the phosphorylation levels of RXRα were significantly increased only in T compared with Wt and P. Treatment of H-ras12V transgenic mice at 5-week-old or 5-month-old with atRA had no effect on the prevention of tumorigenesis or cure of developed nodules in liver. These events imply that the depletion of 9cRA and atRA and the inhibition of RXRα function in hepatic tumors involve more complex mechanisms besides the activation of RAS/ERK pathway.« less

A Possible Link Between Pyriproxyfen and Microcephaly

PubMed Central

Parens, Raphael; Nijhout, H. Frederik; Morales, Alfredo; Xavier Costa, Felipe; Bar-Yam, Yaneer

2017-01-01

The Zika virus has been the primary suspect in the large increase in incidence of microcephaly in 2015-6 in Brazil. While evidence for Zika being the cause of some of the cases is strong, its role as the primary cause of the large number of cases in Brazil has not been confirmed. Recently, the disparity between the incidences in different geographic locations has led to questions about the virus's role. Here we consider the alternative possibility that the use of the insecticide pyriproxyfen for control of mosquito populations in Brazilian drinking water is the primary cause. Pyriproxifen is a juvenile hormone analog which has been shown to correspond in mammals to a number of fat soluble regulatory molecules including retinoic acid, a metabolite of vitamin A, with which it has cross-reactivity and whose application during development has been shown to cause microcephaly. Methoprene, another juvenile hormone analog that was approved as an insecticide based upon tests performed in the 1970s, has metabolites that bind to the mammalian retinoid X receptor, and has been shown to cause developmental disorders in mammals. Isotretinoin is another example of a retinoid causing microcephaly in human babies via maternal exposure and activation of the retinoid X receptor in developing fetuses. Moreover, tests of pyriproxyfen by the manufacturer, Sumitomo, widely quoted as giving no evidence for developmental toxicity, actually found some evidence for such an effect, including low brain mass and arhinencephaly—incomplete formation of the anterior cerebral hemispheres—in exposed rat pups. Finally, the pyriproxyfen use in Brazil is unprecedented—it has never before been applied to a water supply on such a scale. Claims that it is not being used in Recife, the epicenter of microcephaly cases, do not distinguish the metropolitan area of Recife, where it is widely used, and the municipality, and have not been adequately confirmed. Given this combination of information about molecular mechanisms and toxicological evidence, we strongly recommend that the use of pyriproxyfen in Brazil be suspended until the potential causal link to microcephaly is investigated further. PMID:29362686

Nanoparticles engineered to bind cellular motors for efficient delivery.

PubMed

Dalmau-Mena, Inmaculada; Del Pino, Pablo; Pelaz, Beatriz; Cuesta-Geijo, Miguel Ángel; Galindo, Inmaculada; Moros, María; de la Fuente, Jesús M; Alonso, Covadonga

2018-03-30

Dynein is a cytoskeletal molecular motor protein that transports cellular cargoes along microtubules. Biomimetic synthetic peptides designed to bind dynein have been shown to acquire dynamic properties such as cell accumulation and active intra- and inter-cellular motion through cell-to-cell contacts and projections to distant cells. On the basis of these properties dynein-binding peptides could be used to functionalize nanoparticles for drug delivery applications. Here, we show that gold nanoparticles modified with dynein-binding delivery sequences become mobile, powered by molecular motor proteins. Modified nanoparticles showed dynamic properties, such as travelling the cytosol, crossing intracellular barriers and shuttling the nuclear membrane. Furthermore, nanoparticles were transported from one cell to another through cell-to-cell contacts and quickly spread to distant cells through cell projections. The capacity of these motor-bound nanoparticles to spread to many cells and increasing cellular retention, thus avoiding losses and allowing lower dosage, could make them candidate carriers for drug delivery.

Evidence of Early Childhood Defects Due to Prenatal Over-Exposure to Vitamin A: A Case Study

ERIC Educational Resources Information Center

Naude, H.; Marx, J.; Pretorius, E.; Hislop-Esterhuyzen, N.

2007-01-01

One of the important nutrients during pregnancy is vitamin A or related compounds called retinoids. Although it is well-known that vitamin A deficiency may be detrimental to foetal development, overdosage of retinoids might cause developmental defects, particularly affecting the central nervous system development of the foetus, causing hindbrain…

Efficacy of steroidal vs non-steroidal agents in oral lichen planus: a randomised, open-label study.

PubMed

Singh, A R; Rai, A; Aftab, M; Jain, S; Singh, M

2017-01-01

This study compared the therapeutic efficacy of steroidal and non-steroidal agents for treating oral lichen planus. Forty patients with clinical and/or histologically proven oral lichen planus were randomly placed into four groups and treated with topical triamcinolone, oral dapsone, topical tacrolimus or topical retinoid for three months. Pre- and post-treatment symptoms and signs were scored for each patient. Patients in all treatment groups showed significant clinical improvement after three months (p 0.05) and for topical retinoid vs topical tacrolimus (p > 0.05). Non-steroidal drugs such as dapsone, tacrolimus and retinoid are as efficacious as steroidal drugs for treating oral lichen planus, and avoid the side effects associated with steroids.

Downregulation of insulin-like growth factor binding protein 3 and 5 in nitrofen-induced pulmonary hypoplasia.

PubMed

Ruttenstock, Elke; Doi, Takashi; Dingemann, Jens; Puri, Prem

2010-01-01

The high mortality in congenital diaphragmatic hernia (CDH) is mainly attributed to pulmonary hypoplasia. Recent studies suggest that retinoid signaling pathway (RSP) is inhibited in the nitrofen-induced hypoplastic lung. The insulin-like growth factor (IGF) system plays a crucial role in fetal lung development by interaction of IGFBP-3 and IGFBP-5 with RSP. We hypothesized that pulmonary IGFBP-3 and IGFBP-5 gene expression levels are downregulated in the nitrofen-induced pulmonary hypoplasia. Pregnant rats were exposed to either olive oil or 100 mg nitrofen on day 9.5 (D9.5) of gestation. Fetal lungs were harvested on D18 and D21 and divided into control and nitrofen groups. IGFBP-3 and IGFBP-5 pulmonary gene and protein expression were determined using real-time RT-PCR and immunohistochemistry. Relative levels of IGFBP-3 mRNA were significantly decreased in the nitrofen group (8.00 +/- 14.44) in D21 compared to controls (14.81 +/- 16.11; p < 0.05). Expression levels of IGFBP-5 mRNA were also significantly decreased in nitrofen group (10.66 +/- 4.83) on D18 compared to controls (17.92 +/- 4.77). Immunohistochemistry showed decreased IGFBP-3 expression on D21 and decreased IGFBP-5 immunoreactivity on D18 in hypoplastic lungs compared to controls. Downregulation of IGFBP-3 and IGFBP-5 gene expression may cause pulmonary hypoplasia in the nitrofen-induced CDH model by interfering with retinoid signaling pathway.

Low-dose retinoic acid enhances in vitro invasiveness of human oral squamous-cell-carcinoma cell lines

PubMed Central

Uchida, D; Kawamata, H; Nakashiro, K; Omotehara, F; Hino, S; Hoque, M O; Begum, N-M; Yoshida, H; Sato, M; Fujimori, T

2001-01-01

Retinoids inhibit the proliferation of several types of tumour cells, and are used for patients with several malignant tumours. In this study, we examined the effect of retinoic acids (RAs) on the invasive potentials of the oral squamous cell carcinoma (SCC) cells, BHY and HNt. BHY cells expressed all of retinoid nuclear receptors (RARα, β, γ, and RXRα) and cytoplasmic retinoic acid binding proteins (CRABP1 and CRABP2). HNt cells lacked the expression of RARβ, but expressed other nuclear receptors and CRABPs. All-trans retinoic acid (ATRA) and 13-cis retinoic acid (13-cisRA) (10−6and 10−7M) inhibited the growth of the cells, but low-dose ATRA and 13-cisRA (10−8M) marginally affected the growth of the cells. Surprisingly, low-dose RAs enhanced the activity of tissue-type plasminogen activator (tPA), and activated pro-matrix metalloproteinases (proMMP2 and proMMP9). Activation of proMMP2 and proMMP9 was inhibited by aprotinin, a serine-proteinase, tPA inhibitor. Furthermore, low-dose RAs enhanced the in vitro invasiveness of BHY cells. These results indicate that low-dose RAs enhances the in vitro invasiveness of oral SCC cells via an activation of proMMP2 and proMMP9 probably mediated by the induction of tPA. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11437413

Genomic characterization and regulation of CYP3a13: role of xenobiotics and nuclear receptors.

PubMed

Anakk, Sayeepriyadarshini; Kalsotra, Auinash; Shen, Qi; Vu, Mary T; Staudinger, Jeffrey L; Davies, Peter J A; Strobel, Henry W

2003-09-01

We report that CYP3a13 gene, located on mouse chromosome 5, spans 27.5 Kb and contains 13 exons. The transcription start site is 35 bp upstream of the coding region and results in a 109 bp 5' untranslated region. CYP3a13 promoter shows putative binding sites for retinoid X receptor, pregnane X receptor, and estrogen receptor. CYP3a13 shows a broad tissue distribution with predominant expression in liver. Although CYP3a13 shares 92% nucleotide identity with the female-specific rat CYP3A9, its expression does not exhibit sexual dimorphism. Ligand activation of peroxisomal proliferator-activated receptor-gamma and retinoid X receptor inhibit expression of CYP3a13 at the transcription level in a tissue-specific manner. Another novel finding is hepatic induction of CYP3a13 by dexamethasone occurring only in pregnane X receptor null mice. We also report that pregnane X receptor is essential to maintain robust in vivo basal levels of CYP3a13 in contrast to CYP3a11. CYP3a13 protein expressed in vitro can metabolize clinically active drugs ethylmorphine and erythromycin, as well as benzphetamine. We conclude that CYP3a13 is regulated differentially by various nuclear receptors. In humans this may lead to altered drug metabolism, as many of the newly synthesized ligands/drugs targeted toward these nuclear receptors could influence CYP3A gene expression.

Detection of angiotensin II binding to single adrenal zona glomerulosa cells by confocal Raman microspectroscopy

NASA Astrophysics Data System (ADS)

McCoy, Michael J.; Habermann, Timothy J.; Hanke, Craig J.; Adar, Fran; Campbell, William B.; Nithipatikom, Kasem

1999-04-01

We developed a confocal Raman microspectroscopic technique to study ligand-receptor bindings in single cells using Raman-labeled ligands and surface-enhanced Raman scattering (SERS). The adrenal zona glomerulosa (ZG) cells were used as a model in this study. ZG cells have a high density of angiotensin II (AII) receptors on the cellular membrane. There are two identified subtypes of AII receptors,namely AT1 and AT2 receptors. AII is a peptidic hormone, which upon binding to its receptors, stimulates the release of aldosterone from ZG cells. The cellular localization of these receptors subtypes was detected in single ZG cells by using immunocomplexation of receptors with specific antibodies and confocal Raman microspectroscopy. In the binding study, we used biotin-labeled AII to bind to its receptors in ZG cells. Then, avidin and Raman-labeled AII. The binding was measure directly on the single ZG cells. The results showed that the binding was displaced with unlabeled AII and specific AII antagonists. This is a rapid and sensitive technique for detection of cellular ligand bindings as well as antagonists screening in drug discovery.

SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

PubMed

Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

2016-04-07

The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

Selective binding of the fluorescent dye 1-anilinonaphthalene-8-sulfonic acid to peroxisome proliferator-activated receptor gamma allows ligand identification and characterization.

PubMed

Zorrilla, Silvia; Garzón, Beatriz; Pérez-Sala, Dolores

2010-04-01

Peroxisome proliferator-activated receptor gamma (PPARgamma) is a member of the nuclear receptor superfamily involved in insulin sensitization, atherosclerosis, inflammation, and carcinogenesis. PPARgamma transcriptional activity is modulated by specific ligands that promote conformational changes allowing interaction with coactivators. Here we show that the fluorophore 1-anilinonaphthalene-8-sulfonic acid (ANS) binds to PPARgamma-LBD (ligand binding domain), displaying negligible interaction with other nuclear receptors such as PPARalpha and retinoid X receptor alpha (RXRalpha). ANS binding is competed by PPARgamma agonists such as rosiglitazone, 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)), and 9,10-dihydro-15-deoxy-Delta(12,14)-prostaglandin J(2) (CAY10410). Moreover, the affinity of PPARgamma for these ligands, determined through ANS competition titrations, is within the range of that reported previously, thereby suggesting that ANS competition could be useful in the screening and characterization of novel PPARgamma agonists. In contrast, gel-based competition assays showed limited performance with noncovalently bound ligands. We applied the ANS binding assay to characterize a biotinylated analog of 15d-PGJ(2) that does not activate PPAR in cells. We found that although this compound bound to PPARgamma with low affinity, it failed to promote PPARgamma interaction with a fluorescent SRC-1 peptide, indicating a lack of receptor activation. Therefore, combined approaches using ANS and fluorescent coactivator peptides to monitor PPARgamma binding and interactions may provide valuable strategies to fully understand the role of PPARgamma ligands. Copyright 2009 Elsevier Inc. All rights reserved.

Diethylnitrosamine-induced hepatocarcinogenesis is suppressed in lecithin:retinol acyltransferase-deficient mice primarily through retinoid actions immediately after carcinogen administration.

PubMed

Shirakami, Yohei; Gottesman, Max E; Blaner, William S

2012-02-01

Loss of retinoid-containing lipid droplets upon hepatic stellate cell (HSC) activation is one of the first events in the development of liver disease leading to hepatocellular carcinoma. Although retinoid stores are progressively lost from HSCs during the development of hepatic disease, how this affects hepatocarcinogenesis is unclear. To investigate this, we used diethylnitrosamine (DEN) to induce hepatic tumorigenesis in matched wild-type (WT) and lecithin:retinol acyltransferase (LRAT) knockout (KO) mice, which lack stored retinoid and HSC lipid droplets. Male 15-day-old WT or Lrat KO mice were given intraperitoneal injections of DEN (25 mg/kg body wt). Eight months later, Lrat KO mice showed significantly less liver tumor development compared with WT mice, characterized by less liver tumor incidence and smaller tumor size. Two days after DEN injection, lower serum levels of alanine aminotransferase and decreased hepatic levels of cyclin D1 were observed in Lrat KO mice. Lrat KO mice also exhibited increased levels of retinoic acid-responsive genes, including p21, lower levels of cytochrome P450 enzymes required for DEN bioactivation and higher levels of the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT), both before and after DEN treatment. Our results indicate that Lrat KO mice are less susceptible to DEN-induced hepatocarcinogenesis due to increased retinoid signaling and higher expression of p21, which is accompanied by altered hepatic levels of DEN-activating enzymes and MGMT in Lrat KO mice also contribute to decreased cancer initiation and suppressed liver tumor development.

UVA is the major contributor to the photodegradation of tretinoin and isotretinoin: implications for development of improved pharmaceutical formulations

PubMed Central

Tashtoush, Bassam M.; Jacobson, Elaine L.; Jacobson, Myron K.

2008-01-01

The chemical stability of tretinoin (RA) and isotretinoin (13RA) in ethanol and dermatological cream preparations exposed to solar simulated light (SSL), UVA, and visible light has been studied. Photostability was monitored by an HPLC method that allowed simultaneous analysis of RA and 13RA, thus allowing photodegradation due to isomerization to other retinoids and photolysis to non-retinoid products to be monitored. Both retinoids undergo both isomerization and photolysis following SSL, UVA and visible light exposure but RA is more sensitive to photodegradation than 13RA. Degradation of both retinoids by photolysis is considerably greater in cream formulations than in ethanol and the photodegradation follows second order kinetics. Rate constants and half-lives for degradation of RA and 13RA in ethanol solution and cream preparations subjected to different light sources are reported. The UVA component of SSL is the major contributor to photodegradation. Since UVA penetrates deeply into skin, our results suggest that photodegradation of RA may contribute to the photosensitivity associated with RA therapy. Our studies suggest that development of improved formulations and the use of effective UVA sunscreens may reduce the side effects of RA therapy. PMID:18093761

UVA is the major contributor to the photodegradation of tretinoin and isotretinoin: Implications for development of improved pharmaceutical formulations.

PubMed

Tashtoush, Bassam M; Jacobson, Elaine L; Jacobson, Myron K

2008-03-20

The chemical stability of tretinoin (RA) and isotretinoin (13RA) in ethanol and dermatological cream preparations exposed to solar simulated light (SSL), UVA, and visible light has been studied. Photostability was monitored by an HPLC method that allowed simultaneous analysis of RA and 13RA, thus allowing photodegradation due to isomerization to other retinoids and photolysis to non-retinoid products to be monitored. Both retinoids undergo both isomerization and photolysis following SSL, UVA and visible light exposure but RA is more sensitive to photodegradation than 13RA. Degradation of both retinoids by photolysis is considerably greater in cream formulations than in ethanol and the photodegradation follows second order kinetics. Rate constants and half-lives for degradation of RA and 13RA in ethanol solution and cream preparations subjected to different light sources are reported. The UVA component of SSL is the major contributor to photodegradation. Since UVA penetrates deeply into skin, our results suggest that photodegradation of RA may contribute to the photosensitivity associated with RA therapy. Our studies suggest that development of improved formulations and the use of effective UVA sunscreens may reduce the side effects of RA therapy.

Synthetic retinoids in dermatology

PubMed Central

Heller, Elizabeth H.; Shiffman, Norman J.

1985-01-01

The potential of vitamin A, or retinol, in the treatment of a variety of skin diseases has long been recognized, but because of serious toxic effects this substance generally could not be used. The recent development and marketing of two relatively nontoxic synthetic analogues, which are known as retinoids, has made it possible to treat some of the diseases that are resistant to standard forms of therapy. Isotretinoin is very effective in cystic and conglobate acne, while etretinate is especially useful in the more severe forms of psoriasis. Good results have also been obtained in other disorders of keratinization. Vitamin A and its derivatives apparently have an antineoplastic effect as well and may come to be used in both the prevention and the treatment of epithelial cancer. In many of these diseases the retinoids act by enhancing the normal differentiation and proliferation of epidermal tissues, but the exact mechanisms are not well understood. Their influence on the intracellular polyamines that control the synthesis of nucleic acids and proteins may be an important factor. Although the retinoids have few serious systemic effects, they are teratogenic, and because they persist in the body their use in women of childbearing potential is limited. ImagesFig. 3 PMID:3158386

Space, self, and the theater of consciousness.

PubMed

Trehub, Arnold

2007-06-01

Over a decade ago, I introduced a large-scale theory of the cognitive brain which explained for the first time how the human brain is able to create internal models of its intimate world and invent models of a wider universe. An essential part of the theoretical model is an organization of neuronal mechanisms which I have named the Retinoid Model [Trehub, A. (1977). Neuronal models for cognitive processes: Networks for learning, perception and imagination. Journal of Theoretical Biology, 65, 141-169; Trehub, A. (1991). The Cognitive Brain: MIT Press]. This hypothesized brain system has structural and dynamic properties enabling it to register and appropriately integrate disparate foveal stimuli into a perspectival, egocentric representation of an extended 3D world scene including a neuronally tokened locus of the self which, in this theory, is the neuronal origin of retinoid space. As an integral part of the larger neuro-cognitive model, the retinoid system is able to perform many other useful perceptual and higher cognitive functions. In this paper, I draw on the hypothesized properties of this system to argue that neuronal activity within the retinoid structure constitutes the phenomenal content of consciousness and the unique sense of self that each of us experiences.

Evaluation of vitamin A and carotenoid data in food composition tables.

PubMed

Beecher, G R; Khachik, F

1984-12-01

Vitamin A and carotenoid data in food composition tables have been generated with the use of the Association of Official Analytical Chemists procedures. These procedures fractionate complex mixtures of retinoids and carotenoids into only three fractions, e.g., retinoids, carotenes, and xanthophylls. Food tables lack uniformity in the presentation of vitamin A and carotenoid data. For example, the revisions of Agriculture Handbook, No. 8 (Washington, D.C.: U.S. Govt Print Off, 1963), report both international units and retinol equivalents of vitamin A in foods. Food tables published in the United Kingdom (Paul AA, Southgate DA. McCance and Widdowson's: The composition of foods. Amsterdam: Elsevier/North-Holland, 1978) report preformed vitamin A as retinol and carotenoids as carotene on a weight basis (micrograms/100 g food). The vitamin A and carotenoid data currently available in food composition tables allow only the intake of total vitamin A activity to be estimated. Information about the intake of specific species of retinoids or carotenoids is not available and could not be calculated from existing food tables. Limited applications of new separation techniques and chemical instrumentation have demonstrated the potential for generating detailed analytic information in regard to the retinoid and carotenoid contents of foods.

Uncoupling RARA transcriptional activation and degradation clarifies the bases for APL response to therapies.

PubMed

Ablain, Julien; Leiva, Magdalena; Peres, Laurent; Fonsart, Julien; Anthony, Elodie; de Thé, Hugues

2013-04-08

In PML/RARA-driven acute promyelocytic leukemia (APL), retinoic acid (RA) induces leukemia cell differentiation and transiently clears the disease. Molecularly, RA activates PML/RARA-dependent transcription and also initiates its proteasome-mediated degradation. In contrast, arsenic, the other potent anti-APL therapy, only induces PML/RARA degradation by specifically targeting its PML moiety. The respective contributions of RA-triggered transcriptional activation and proteolysis to clinical response remain disputed. Here, we identify synthetic retinoids that potently activate RARA- or PML/RARA-dependent transcription, but fail to down-regulate RARA or PML/RARA protein levels. Similar to RA, these uncoupled retinoids elicit terminal differentiation, but unexpectedly fail to impair leukemia-initiating activity of PML/RARA-transformed cells ex vivo or in vivo. Accordingly, the survival benefit conferred by uncoupled retinoids in APL mice is dramatically lower than the one provided by RA. Differentiated APL blasts sorted from uncoupled retinoid-treated mice retain PML/RARA expression and reinitiate APL in secondary transplants. Thus, differentiation is insufficient for APL eradication, whereas PML/RARA loss is essential. These observations unify the modes of action of RA and arsenic and shed light on the potency of their combination in mice or patients.

Nuclear hormone retinoid X receptor (RXR) negatively regulates the glucose-stimulated insulin secretion of pancreatic ß-cells.

PubMed

Miyazaki, Satsuki; Taniguchi, Hidenori; Moritoh, Yusuke; Tashiro, Fumi; Yamamoto, Tsunehiko; Yamato, Eiji; Ikegami, Hiroshi; Ozato, Keiko; Miyazaki, Jun-ichi

2010-11-01

Retinoid X receptors (RXRs) are members of the nuclear hormone receptor superfamily and are thought to be key regulators in differentiation, cellular growth, and gene expression. Although several experiments using pancreatic β-cell lines have shown that the ligands of nuclear hormone receptors modulate insulin secretion, it is not clear whether RXRs have any role in insulin secretion. To elucidate the function of RXRs in pancreatic β-cells, we generated a double-transgenic mouse in which a dominant-negative form of RXRβ was inducibly expressed in pancreatic β-cells using the Tet-On system. We also established a pancreatic β-cell line from an insulinoma caused by the β-cell-specific expression of simian virus 40 T antigen in the above transgenic mouse. In the transgenic mouse, expression of the dominant-negative RXR enhanced the insulin secretion with high glucose stimulation. In the pancreatic β-cell line, the suppression of RXRs also enhanced glucose-stimulated insulin secretion at a high glucose concentration, while 9-cis-retinoic acid, an RXR agonist, repressed it. High-density oligonucleotide microarray analysis showed that expression of the dominant-negative RXR affected the expression levels of a number of genes, some of which have been implicated in the function and/or differentiation of β-cells. These results suggest that endogenous RXR negatively regulates the glucose-stimulated insulin secretion. Given these findings, we propose that the modulation of endogenous RXR in β-cells may be a new therapeutic approach for improving impaired insulin secretion in type 2 diabetes.

A cellular reporter to evaluate CRM1 nuclear export activity: functional analysis of the cancer-related mutant E571K.

PubMed

García-Santisteban, Iraia; Arregi, Igor; Alonso-Mariño, Marián; Urbaneja, María A; Garcia-Vallejo, Juan J; Bañuelos, Sonia; Rodríguez, Jose A

2016-12-01

The exportin CRM1 binds nuclear export signals (NESs), and mediates active transport of NES-bearing proteins from the nucleus to the cytoplasm. Structural and biochemical analyses have uncovered the molecular mechanisms underlying CRM1/NES interaction. CRM1 binds NESs through a hydrophobic cleft, whose open or closed conformation facilitates NES binding and release. Several cofactors allosterically modulate the conformation of the NES-binding cleft through intramolecular interactions involving an acidic loop and a C-terminal helix in CRM1. This current model of CRM1-mediated nuclear export has not yet been evaluated in a cellular setting. Here, we describe SRV100, a cellular reporter to interrogate CRM1 nuclear export activity. Using this novel tool, we provide evidence further validating the model of NES binding and release by CRM1. Furthermore, using both SRV100-based cellular assays and in vitro biochemical analyses, we investigate the functional consequences of a recurrent cancer-related mutation, which targets a residue near CRM1 NES-binding cleft. Our data indicate that this mutation does not necessarily abrogate the nuclear export activity of CRM1, but may increase its affinity for NES sequences bearing a more negatively charged C-terminal end.

A tandem regression-outlier analysis of a ligand cellular system for key structural modifications around ligand binding.

PubMed

Lin, Ying-Ting

2013-04-30

A tandem technique of hard equipment is often used for the chemical analysis of a single cell to first isolate and then detect the wanted identities. The first part is the separation of wanted chemicals from the bulk of a cell; the second part is the actual detection of the important identities. To identify the key structural modifications around ligand binding, the present study aims to develop a counterpart of tandem technique for cheminformatics. A statistical regression and its outliers act as a computational technique for separation. A PPARγ (peroxisome proliferator-activated receptor gamma) agonist cellular system was subjected to such an investigation. Results show that this tandem regression-outlier analysis, or the prioritization of the context equations tagged with features of the outliers, is an effective regression technique of cheminformatics to detect key structural modifications, as well as their tendency of impact to ligand binding. The key structural modifications around ligand binding are effectively extracted or characterized out of cellular reactions. This is because molecular binding is the paramount factor in such ligand cellular system and key structural modifications around ligand binding are expected to create outliers. Therefore, such outliers can be captured by this tandem regression-outlier analysis.

The Molecular Chaperone TRiC/CCT Binds to the Trp-Asp 40 (WD40) Repeat Protein WDR68 and Promotes Its Folding, Protein Kinase DYRK1A Binding, and Nuclear Accumulation*

PubMed Central

Miyata, Yoshihiko; Shibata, Takeshi; Aoshima, Masato; Tsubata, Takuichi; Nishida, Eisuke

2014-01-01

Trp-Asp (WD) repeat protein 68 (WDR68) is an evolutionarily conserved WD40 repeat protein that binds to several proteins, including dual specificity tyrosine phosphorylation-regulated protein kinase (DYRK1A), MAPK/ERK kinase kinase 1 (MEKK1), and Cullin4-damage-specific DNA-binding protein 1 (CUL4-DDB1). WDR68 affects multiple and diverse physiological functions, such as controlling anthocyanin synthesis in plants, tissue growth in insects, and craniofacial development in vertebrates. However, the biochemical basis and the regulatory mechanism of WDR68 activity remain largely unknown. To better understand the cellular function of WDR68, here we have isolated and identified cellular WDR68 binding partners using a phosphoproteomic approach. More than 200 cellular proteins with wide varieties of biochemical functions were identified as WDR68-binding protein candidates. Eight T-complex protein 1 (TCP1) subunits comprising the molecular chaperone TCP1 ring complex/chaperonin-containing TCP1 (TRiC/CCT) were identified as major WDR68-binding proteins, and phosphorylation sites in both WDR68 and TRiC/CCT were identified. Co-immunoprecipitation experiments confirmed the binding between TRiC/CCT and WDR68. Computer-aided structural analysis suggested that WDR68 forms a seven-bladed β-propeller ring. Experiments with a series of deletion mutants in combination with the structural modeling showed that three of the seven β-propeller blades of WDR68 are essential and sufficient for TRiC/CCT binding. Knockdown of cellular TRiC/CCT by siRNA caused an abnormal WDR68 structure and led to reduction of its DYRK1A-binding activity. Concomitantly, nuclear accumulation of WDR68 was suppressed by the knockdown of TRiC/CCT, and WDR68 formed cellular aggregates when overexpressed in the TRiC/CCT-deficient cells. Altogether, our results demonstrate that the molecular chaperone TRiC/CCT is essential for correct protein folding, DYRK1A binding, and nuclear accumulation of WDR68. PMID:25342745

Lipocalin 2, a Regulator of Retinoid Homeostasis and Retinoid-mediated Thermogenic Activation in Adipose Tissue*

PubMed Central

Guo, Hong; Foncea, Rocio; O'Byrne, Sheila M.; Jiang, Hongfeng; Zhang, Yuanyuan; Deis, Jessica A.; Blaner, William S.; Bernlohr, David A.; Chen, Xiaoli

2016-01-01

We have recently characterized the role of lipocalin 2 (Lcn2) as a new adipose-derived cytokine in the regulation of adaptive thermogenesis via a non-adrenergic pathway. Herein, we explored a potential non-adrenergic mechanism by which Lcn2 regulates thermogenesis and lipid metabolism. We found that Lcn2 is a retinoic acid target gene, and retinoic acid concurrently stimulated UCP1 and Lcn2 expression in adipocytes. Lcn2 KO mice exhibited a blunted effect of all-trans-retinoic acid (ATRA) on body weight and fat mass, lipid metabolism, and retinoic acid signaling pathway activation in adipose tissue under the high fat diet-induced obese condition. We further demonstrated that Lcn2 is required for the full action of ATRA on the induction of UCP1 and PGC-1α expression in brown adipocytes and the restoration of cold intolerance in Lcn2 KO mice. Interestingly, we discovered that Lcn2 KO mice have decreased levels of retinoic acid and retinol in adipose tissue. The protein levels of STRA6 responsible for retinol uptake were significantly decreased in adipose tissue. The retinol transporter RBP4 was increased in adipose tissue but decreased in the circulation, suggesting the impairment of RBP4 secretion in Lcn2 KO adipose tissue. Moreover, Lcn2 deficiency abolished the ATRA effect on RBP4 expression in adipocytes. All the data suggest that the decreased retinoid level and action are associated with impaired retinol transport and storage in adipose tissue in Lcn2 KO mice. We conclude that Lcn2 plays a critical role in regulating metabolic homeostasis of retinoids and retinoid-mediated thermogenesis in adipose tissue. PMID:27008859

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Cellular anomalies underlying retinoid-induced phocomelia.

PubMed

Zhou, Jian; Kochhar, Devendra M

2004-11-01

The question of how alterations in cell behavior produced by retinoic acid (RA) influenced the development of skeletogenic mesenchyme of the limb bud was examined in this study. Our established model was employed, which involves treatment of pregnant mice with a teratogenic dose of RA (100 mg/kg) on 11 days postcoitum (dpc) resulting in a severe truncation of all long bones of the forelimbs in virtually every exposed fetus. It is shown that RA, administered at a stage to induce phocomelia in virtually all exposed embryos, resulted in immediate appearance of enhanced cell death within the mesenchyme in the central core of the limb bud, an area destined for chondrogenesis. The central core mesenchyme, which in the untreated limb buds experiences a sharp decline in cell proliferation heralding the onset of chondrogenesis, demonstrated a reversal of the process; this mesenchyme maintained a higher rate of cell proliferation upon RA exposure. These events resulted in a truncation and disorganization of the chondrogenic anlage, more pronounced in zeugopodal mesenchyme than in the autopod. We conclude that an inhibition of chondrogenesis was secondary to a disruption in cellular behavior caused by RA, a likely consequence of misregulation in the growth factor signaling cascade.

Retinoids, 585-nm laser, and carbon dioxide laser: a numeric comparison of neocollagen formation in photoaged hairless mouse skin.

PubMed

Lee, C J; Park, J H; Ciesielski, T E; Thomson, J G; Persing, J A

2008-11-01

A variety of new methods for treating photoaging have been recently introduced. There has been increasing interest in comparing the relative efficacy of multiple methods for photoaging. However, the efficacy of a single method is difficult to assess from the data reported in the literature. Photoaged hairless mice were randomly divided into seven treatment groups: control, retinoids (tretinoin and adapalene), lasers (585 nm and CO(2)), and combination groups (585 nm + adapalene and CO(2 )+ adapalene). Biopsies were taken from the treated regions, and the results were analyzed based on the repair zone. The repair zones of the various methods for photoaging were compared. Retinoids produced a wider repair zone than the control condition. The 585-nm and CO(2) laser resurfacing produced a result equivalent to that of the control condition. A combination of these lasers with adapalene produced a wider repair zone than the lasers alone, but the combination produced a result equivalent to that of adapalene alone. Retinoids are potent stimuli for neocollagen formation. The 585-nm or CO(2) laser alone did not induce more neocollagen than the control condition. In addition, no synergistic effect was observed with the combination treatments. The repair zone of the combination treatment is mainly attributable to adapalene.

A new class of synthetic retinoid antibiotics effective against bacterial persisters.

PubMed

Kim, Wooseong; Zhu, Wenpeng; Hendricks, Gabriel Lambert; Van Tyne, Daria; Steele, Andrew D; Keohane, Colleen E; Fricke, Nico; Conery, Annie L; Shen, Steven; Pan, Wen; Lee, Kiho; Rajamuthiah, Rajmohan; Fuchs, Beth Burgwyn; Vlahovska, Petia M; Wuest, William M; Gilmore, Michael S; Gao, Huajian; Ausubel, Frederick M; Mylonakis, Eleftherios

2018-04-05

A challenge in the treatment of Staphylococcus aureus infections is the high prevalence of methicillin-resistant S. aureus (MRSA) strains and the formation of non-growing, dormant 'persister' subpopulations that exhibit high levels of tolerance to antibiotics and have a role in chronic or recurrent infections. As conventional antibiotics are not effective in the treatment of infections caused by such bacteria, novel antibacterial therapeutics are urgently required. Here we used a Caenorhabditis elegans-MRSA infection screen to identify two synthetic retinoids, CD437 and CD1530, which kill both growing and persister MRSA cells by disrupting lipid bilayers. CD437 and CD1530 exhibit high killing rates, synergism with gentamicin, and a low probability of resistance selection. All-atom molecular dynamics simulations demonstrated that the ability of retinoids to penetrate and embed in lipid bilayers correlates with their bactericidal ability. An analogue of CD437 was found to retain anti-persister activity and show an improved cytotoxicity profile. Both CD437 and this analogue, alone or in combination with gentamicin, exhibit considerable efficacy in a mouse model of chronic MRSA infection. With further development and optimization, synthetic retinoids have the potential to become a new class of antimicrobials for the treatment of Gram-positive bacterial infections that are currently difficult to cure.

A new class of synthetic retinoid antibiotics effective against bacterial persisters

NASA Astrophysics Data System (ADS)

Kim, Wooseong; Zhu, Wenpeng; Hendricks, Gabriel Lambert; van Tyne, Daria; Steele, Andrew D.; Keohane, Colleen E.; Fricke, Nico; Conery, Annie L.; Shen, Steven; Pan, Wen; Lee, Kiho; Rajamuthiah, Rajmohan; Fuchs, Beth Burgwyn; Vlahovska, Petia M.; Wuest, William M.; Gilmore, Michael S.; Gao, Huajian; Ausubel, Frederick M.; Mylonakis, Eleftherios

2018-04-01

A challenge in the treatment of Staphylococcus aureus infections is the high prevalence of methicillin-resistant S. aureus (MRSA) strains and the formation of non-growing, dormant ‘persister’ subpopulations that exhibit high levels of tolerance to antibiotics and have a role in chronic or recurrent infections. As conventional antibiotics are not effective in the treatment of infections caused by such bacteria, novel antibacterial therapeutics are urgently required. Here we used a Caenorhabditis elegans–MRSA infection screen to identify two synthetic retinoids, CD437 and CD1530, which kill both growing and persister MRSA cells by disrupting lipid bilayers. CD437 and CD1530 exhibit high killing rates, synergism with gentamicin, and a low probability of resistance selection. All-atom molecular dynamics simulations demonstrated that the ability of retinoids to penetrate and embed in lipid bilayers correlates with their bactericidal ability. An analogue of CD437 was found to retain anti-persister activity and show an improved cytotoxicity profile. Both CD437 and this analogue, alone or in combination with gentamicin, exhibit considerable efficacy in a mouse model of chronic MRSA infection. With further development and optimization, synthetic retinoids have the potential to become a new class of antimicrobials for the treatment of Gram-positive bacterial infections that are currently difficult to cure.

Surface properties of adipocyte lipid-binding protein: Response to lipid binding, and comparison with homologous proteins.

PubMed

LiCata, V J; Bernlohr, D A

1998-12-01

Adipocyte lipid-binding protein (ALBP) is one of a family of intracellular lipid-binding proteins (iLBPs) that bind fatty acids, retinoids, and other hydrophobic ligands. The different members of this family exhibit a highly conserved three-dimensional structure; and where structures have been determined both with (holo) and without (apo) bound lipid, observed conformational changes are extremely small (Banaszak, et al., 1994, Adv. Prot. Chem. 45, 89; Bernlohr, et al., 1997, Annu. Rev. Nutr. 17, 277). We have examined the electrostatic, hydrophobic, and water accessible surfaces of ALBP in the apo form and of holo forms with a variety of bound ligands. These calculations reveal a number of previously unrecognized changes between apo and holo ALBP, including: 1) an increase in the overall protein surface area when ligand binds, 2) expansion of the binding cavity when ligand is bound, 3) clustering of individual residue exposure increases in the area surrounding the proposed ligand entry portal, and 4) ligand-binding dependent variation in the topology of the electrostatic potential in the area surrounding the ligand entry portal. These focused analyses of the crystallographic structures thus reveal a number of subtle but consistent conformational and surface changes that might serve as markers for differential targeting of protein-lipid complexes within the cell. Most changes are consistent from ligand to ligand, however there are some ligand-specific changes. Comparable calculations with intestinal fatty-acid-binding protein and other vertebrate iLBPs show differences in the electrostatic topology, hydrophobic topology, and in localized changes in solvent exposure near the ligand entry portal. These results provide a basis toward understanding the functional and mechanistic differences among these highly structurally homologous proteins. Further, they suggest that iLBPs from different tissues exhibit one of two predominant end-state structural distributions of the ligand entry portal.

Viral and Cellular Determinants of the Hepatitis C Virus Envelope-Heparan Sulfate Interaction▿

PubMed Central

Barth, Heidi; Schnober, Eva K.; Zhang, Fuming; Linhardt, Robert J.; Depla, Erik; Boson, Bertrand; Cosset, Francois-Loic; Patel, Arvind H.; Blum, Hubert E.; Baumert, Thomas F.

2006-01-01

Cellular binding and entry of hepatitis C virus (HCV) are the first steps of viral infection and represent a major target for antiviral antibodies and novel therapeutic strategies. We have recently demonstrated that heparan sulfate (HS) plays a key role in the binding of HCV envelope glycoprotein E2 to target cells (Barth et al., J. Biol. Chem. 278:41003-41012, 2003). In this study, we characterized the HCV-HS interaction and analyzed its inhibition by antiviral host immune responses. Using recombinant envelope glycoproteins, virus-like particles, and HCV pseudoparticles as model systems for the early steps of viral infection, we mapped viral and cellular determinants of HCV-HS interaction. HCV-HS binding required a specific HS structure that included N-sulfo groups and a minimum of 10 to 14 saccharide subunits. HCV envelope binding to HS was mediated by four viral epitopes overlapping the E2 hypervariable region 1 and E2-CD81 binding domains. In functional studies using HCV pseudoparticles, we demonstrate that HCV binding and entry are specifically inhibited by highly sulfated HS. Finally, HCV-HS binding was markedly inhibited by antiviral antibodies derived from HCV-infected individuals. In conclusion, our results demonstrate that binding of the viral envelope to a specific HS configuration represents an important step for the initiation of viral infection and is a target of antiviral host immune responses in vivo. Mapping of viral and cellular determinants of HCV-HS interaction sets the stage for the development of novel HS-based antiviral strategies targeting viral attachment and entry. PMID:16928753

RNA-Binding Protein FXR1 Regulates p21 and TERC RNA to Bypass p53-Mediated Cellular Senescence in OSCC

PubMed Central

Majumder, Mrinmoyee; House, Reniqua; Palanisamy, Nallasivam; Qie, Shuo; Day, Terrence A.; Neskey, David; Diehl, J. Alan

2016-01-01

RNA-binding proteins (RBP) regulate numerous aspects of co- and post-transcriptional gene expression in cancer cells. Here, we demonstrate that RBP, fragile X-related protein 1 (FXR1), plays an essential role in cellular senescence by utilizing mRNA turnover pathway. We report that overexpressed FXR1 in head and neck squamous cell carcinoma targets (G-quadruplex (G4) RNA structure within) both mRNA encoding p21 (Cyclin-Dependent Kinase Inhibitor 1A (CDKN1A, Cip1) and the non-coding RNA Telomerase RNA Component (TERC), and regulates their turnover to avoid senescence. Silencing of FXR1 in cancer cells triggers the activation of Cyclin-Dependent Kinase Inhibitors, p53, increases DNA damage, and ultimately, cellular senescence. Overexpressed FXR1 binds and destabilizes p21 mRNA, subsequently reduces p21 protein expression in oral cancer cells. In addition, FXR1 also binds and stabilizes TERC RNA and suppresses the cellular senescence possibly through telomerase activity. Finally, we report that FXR1-regulated senescence is irreversible and FXR1-depleted cells fail to form colonies to re-enter cellular proliferation. Collectively, FXR1 displays a novel mechanism of controlling the expression of p21 through p53-dependent manner to bypass cellular senescence in oral cancer cells. PMID:27606879

Nitrofen interferes with trophoblastic expression of retinol-binding protein and transthyretin during lung morphogenesis in the nitrofen-induced congenital diaphragmatic hernia model.

PubMed

Kutasy, Balazs; Gosemann, Jan H; Doi, Takashi; Fujiwara, Naho; Friedmacher, Florian; Puri, Prem

2012-02-01

Retinoids play a key role in lung development. Retinoid signaling pathway has been shown to be disrupted in the nitrofen model of congenital diaphragmatic hernia (CDH) but the exact mechanism is not clearly understood. Retinol-binding protein (RBP) and transthyretin (TTR) are transport proteins for delivery of retinol to the tissues via circulation. Previous studies have shown that pulmonary retinol levels are decreased during lung morphogenesis in the nitrofen CDH model. In human newborns with CDH, both retinol and RBP levels are decreased. It has been reported that maternal RBP does not cross the placenta and the fetus produces its own RBP by trophoblast. RBP and TTR synthesized in the fetus are essential for retinol transport to the developing organs including lung morphogenesis. We hypothesized that nitrofen interferes with the trophoblastic expression of RBP and TTR during lung morphogenesis and designed this study to examine the trophoblastic expression of RBP and TTR, and the total level of RBP and TTR in the lung in the nitrofen model of CDH. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal lungs and placenta harvested on D21 and divided into two groups: control (n = 8) and nitrofen with CDH (n = 8). Total lung RBP and TTR levels using protein extraction were compared with enzyme linked immunoassay (ELISA). Immunohistochemistry was performed to evaluate trophoblastic RBP and TTR expression. Total protein levels of lung RBP and TTR were significantly lower in CDH (0.26 ± 0.003 and 6.4 ± 0.5 μg/mL) compared with controls (0.4 ± 0.001 and 9.9 ± 1.6 μg/mL, p < 0.05). In the control group, immunohistochemical staining showed strong immunoreactivity of RBP and TTR in the trophoblast compared to CDH group. Decreased trophoblast expression of retinol transport proteins suggest that nitrofen may interfere with the fetal retinol transport resulting in reduced pulmonary RBP and TTR levels and causing pulmonary hypoplasia in CDH.

Radiolabeling and initial biological evaluation of [18F]KBM-1 for imaging RAR-α receptors in neuroblastoma.

PubMed

Solingapuram Sai, Kiran Kumar; Das, Bhaskar C; Sattiraju, Anirudh; Almaguel, Frankis G; Craft, Suzanne; Mintz, Akiva

2017-03-15

Retinoic acid receptor alpha (RAR-α) plays a significant role in a number of diseases, including neuroblastoma. Children diagnosed with high-risk neuroblastoma are treated13-cis-retinoic acid, which reduces risk of cancer recurrence. Neuroblastoma cell death is mediated via RAR-α, and expression of RAR-α is upregulated after treatment. A molecular imaging probe that binds RAR-α will help clinicians to diagnose and stratify risk for patients with neuroblastoma, who could benefit from retinoid-based therapy. In this study, we report the radiolabeling, and initial in vivo evaluation of [ 18 F]KBM-1, a novel RAR-α agonist. The radiochemical synthesis of [ 18 F]KBM-1 was carried out through KHF 2 assisted substitution of [ 18 F] - from aryl-substituted pinacolatoesters-based retinoid precursor. In vitro cell uptake assay in human neuroblastoma cell line showed that the uptake of [ 18 F]KBM-1 was significantly inhibited by all three blocking agents (KBM-1, ATRA, BD4) at all the selected incubation times. Standard biodistribution in mice bearing neuroblastoma tumors demonstrated increased tumor uptake from 5min to 60min post radiotracer injection and the uptake ratios for target to non-target (tumor: muscle) increased 2.2-fold to 3.7-fold from 30min to 60min post injection. Tumor uptake in subset of 30min blocking group was 1.7-fold lower than unblocked. These results demonstrate the potential utility of [ 18 F]KBM-1 as a RAR-α imaging agent. Copyright © 2017 Elsevier Ltd. All rights reserved.

The effect of phosphorylation on arrestin-rhodopsin interaction in the squid visual system.

PubMed

Robinson, Kelly A; Ou, Wei-Lin; Guan, Xinyu; Sugamori, Kim S; Bandyopadhyay, Abhishek; Ernst, Oliver P; Mitchell, Jane

2015-12-01

Invertebrate visual opsins are G protein-coupled receptors coupled to retinoid chromophores that isomerize reversibly between inactive rhodopsin and active metarhodopsin upon absorption of photons of light. The squid visual system has an arrestin protein that binds to metarhodopsin to block signaling to Gq and activation of phospholipase C. Squid rhodopsin kinase (SQRK) can phosphorylate both metarhodopsin and arrestin, a dual role that is unique among the G protein-coupled receptor kinases. The sites and role of arrestin phosphorylation by SQRK were investigated here using recombinant proteins. Arrestin was phosphorylated on serine 392 and serine 397 in the C-terminus. Unphosphorylated arrestin bound to metarhodopsin and phosphorylated metarhodopsin with similar high affinities (Kd 33 and 21 nM respectively), while phosphorylation of arrestin reduced the affinity 3- to 5-fold (Kd 104 nM). Phosphorylation of metarhodopsin slightly increased the dissociation of arrestin observed during a 1 hour incubation. Together these studies suggest a unique role for SQRK in phosphorylating both receptor and arrestin and inhibiting the binding of these two proteins in the squid visual system. Invertebrate visual systems are inactivated by arrestin binding to metarhodopsin that does not require receptor phosphorylation. Here we show that squid rhodopsin kinase phosphorylates arrestin on two serines (S392,S397) in the C-terminus and phosphorylation decreases the affinity of arrestin for squid metarhodopsin. Metarhodopsin phosphorylation has very little effect on arrestin binding but does increase arrestin dissociation. © 2015 International Society for Neurochemistry.

Retinoid and Histone Deacetylase Inhibitors in the Treatment of Prostate Cancer

DTIC Science & Technology

2004-12-01

prostate cancer therapy (2). BODY Task 1. To determine the mechanism by which concomitant administration of retinoids and various histone deacetylase...cell proliferation assays to determine if we observed increased growth inhibition using combination therapy with ATRA plus a low dose of a variety of...cancer therapy trials (3-8). We also added the drug 5-aza-deoxycytidine to our growth inhibition studies because of much recent data that in combination

1 ALPHA-Hydroxyvitamin D5 as a Chemotherapeutic and Possibly Chemopreventive Agent

DTIC Science & Technology

2004-09-01

with differential, platelets, PT, and PTT. 7.1.4 Serum chemistries : glucose, electrolytes (Na+, K+, Cl-, C0 2), BUN, creatinine, total protein... chemistries : glucose, electrolytes (Na+, K+, Cl-, and C02), BUN, creatinine, total protein, albumin, bilirubin, alkaline phosphatase, LDH, SGOT, SGPT, calcium...Roberts AB, Goodman DS (eds) The Retinoids: Biology, Chemistry , and Medicine. New York: Raven, 1994, pp. 573-596. 3. Hong WK, Itri LM. Retinoids and human

Tretinoin for the treatment of photodamaged skin.

PubMed

Ting, William

2010-07-01

Interest in and interventions for photodamaged skin have dramatically increased over the last few years. Although a number of topical therapies have been used for the treatment of photodamaged skin, many therapies remain unproven in efficacy, unapproved, or only supported with limited clinical evidence. Topical retinoids, particularly tretinoin, are the most extensively studied. They have been shown to attenuate and reverse the signs of photodamage, such as coarse wrinkling. In addition, the clinical changes achieved with tretinoin are accompanied by histologic evidence of benefit. The main drawbacks to retinoid use are local irritation and erythema that can limit utility in some patients. New retinoids and formulations specifically optimized to improve cutaneous tolerability have been introduced. Two case reports of patients using low-concentration tretinoin gel 0.05% for the treatment of photodamaged skin are discussed. Over a relatively short treatment period of 4 weeks, tretinoin gel 0.05% was shown to provide both chemoprevention and reversal of photodamage.

SAOS-2 osteosarcoma cells bind fibroblasts via ICAM-1 and this is increased by tumour necrosis factor-α.

PubMed

David, Manu S; Kelly, Elizabeth; Cheung, Ivan; Xaymardan, Munira; Moore, Malcolm A S; Zoellner, Hans

2014-01-01

We recently reported exchange of membrane and cytoplasmic markers between SAOS-2 osteosarcoma cells and human gingival fibroblasts (h-GF) without comparable exchange of nuclear markers, while similar h-GF exchange was seen for melanoma and ovarian carcinoma cells. This process of "cellular sipping" changes phenotype such that cells sharing markers of both SAOS-2 and h-GF have morphology intermediate to that of either cell population cultured alone, evidencing increased tumour cell diversity without genetic change. TNF-α increases cellular sipping between h-GF and SAOS-2, and we here study binding of SAOS-2 to TNF-α treated h-GF to determine if increased cellular sipping can be accounted for by cytokine stimulated SAOS-2 binding. More SAOS-2 bound h-GF pe-seeded wells than culture plastic alone (p<0.001), and this was increased by h-GF pre-treatment with TNF-α (p<0.001). TNF-α stimulated binding was dose dependent and maximal at 1.16 nM (p<0.05) with no activity below 0.006 nM. SAOS-2 binding to h-GF was independent of serum, while the lipopolysaccharide antagonist Polymyxin B did not affect results, and TNF-α activity was lost on boiling. h-GF binding of SAOS-2 started to increase after 30min TNF-α stimulation and was maximal by 1.5 hr pre-treatment (p<0.001). h-GF retained maximal binding up to 6 hrs after TNF-α stimulation, but this was lost by 18 hrs (p<0.001). FACS analysis demonstrated increased ICAM-1 consistent with the time course of SAOS-2 binding, while antibody against ICAM-1 inhibited SAOS-2 adhesion (p<0.04). Pre-treating SAOS-2 with TNF-α reduced h-GF binding to background levels (p<0.003), and this opposite effect to h-GF cytokine stimulation suggests that the history of cytokine exposure of malignant cells migrating across different microenvironments can influence subsequent interactions with fibroblasts. Since cytokine stimulated binding was comparable in magnitude to earlier reported TNF-α stimulated cellular sipping, we conclude that TNF-α stimulated cellular sipping likely reflects increased SAOS-2 binding as opposed to enhanced exchange mechanisms.

Effects of retinoids and thiazolidinediones on proliferation, insulin release, insulin mRNA, GLUT 2 transporter protein and mRNA of INS-1 cells.

PubMed

Blumentrath, J; Neye, H; Verspohl, E J

2001-09-01

Both 9-cis-retinoic acid (9cRA) and all-trans-retinoic acid (ATRA) are active metabolites of vitamin A (retinol). There exists an interaction between retinoid receptors and peroxisome proliferator-activated receptors (PPARgamma). To define their functions in an insulin secreting system the effects of ATRA, 9cRA and the PPARgamma agonist rosiglitazone on cell proliferation, insulin release and glucose transporter (GLUT) 2 of INS-1 cells were tested. Retinoic acid receptor (RAR-alpha and -gamma) and retinoid X receptor (RXR-alpha and -beta) proteins are present (immunoblots). Both 9cRA and ATRA inhibit INS-1 cell proliferation ([3H]-thymidine assay) in a concentration dependent manner. Both 9cRA and ATRA increased insulin release, but only ATRA ralsed the GLUT 2 mRNA in a bell-shaped concentration response curve after 48 h. The insulinotropic effect of one compound is not significantly superimposed by the other indicating that the same binding sites are used by 9cRA and ATRA. The acute and chronic effects of the PPARgamma agonist rosiglitazone on insulin release were additionally determined since glitazones act as transcription factors together with RXR agonists. At high concentrations (100 microM) rosiglitazone inhibited glucose (8.3 mM) stimulated insulin secretion (acute experiment over 60 min). Insulin secretion, however, was increased during a 24 h treatment at a concentration of 10 microM and again inhibited at 100 microM. Changes in preproinsulin mRNA expression were not observed. Rosiglitazone (100 microM) increased GLUT 2 mRNA paralleled by an increase of GLUT 2 protein, but only after 24 h of treatment. This data indicate that RAR and RXR mediate insulin release. The changes in GLUT 2 have no direct impact on insulin release; the inhibition seen at high concentrations of either compound is possibly the result of the observed inhibition of cell proliferation. Effects of rosiglitazone on preproinsulin mRNA and GLUT 2 (mRNA and protein) do not play a role in modulating insulin secretion. With the presence of an RXR receptor agonist the effect of rosiglitazone on insulin release becomes stimulatory. Thus the effects of RAR-, RXR agonists and rosiglitazone depend on their concentrations, the duration of their presence and are due to specific interactions. Copyright 2001 John Wiley & Sons, Ltd.

Retinoic Acid Isomers Facilitate Apolipoprotein E Production and Lipidation in Astrocytes through the Retinoid X Receptor/Retinoic Acid Receptor Pathway*

PubMed Central

Zhao, Jing; Fu, Yuan; Liu, Chia-Chen; Shinohara, Mitsuru; Nielsen, Henrietta M.; Dong, Qiang; Kanekiyo, Takahisa; Bu, Guojun

2014-01-01

Apolipoprotein E (apoE) is the major cholesterol transport protein in the brain. Among the three human APOE alleles (APOE2, APOE3, and APOE4), APOE4 is the strongest genetic risk factor for late-onset Alzheimer disease (AD). The accumulation of amyloid-β (Aβ) is a central event in AD pathogenesis. Increasing evidence demonstrates that apoE isoforms differentially regulate AD-related pathways through both Aβ-dependent and -independent mechanisms; therefore, modulating apoE secretion, lipidation, and function might be an attractive approach for AD therapy. We performed a drug screen for compounds that modulate apoE production in immortalized astrocytes derived from apoE3-targeted replacement mice. Here, we report that retinoic acid (RA) isomers, including all-trans-RA, 9-cis-RA, and 13-cis-RA, significantly increase apoE secretion to ∼4-fold of control through retinoid X receptor (RXR) and RA receptor. These effects on modulating apoE are comparable with the effects recently reported for the RXR agonist bexarotene. Furthermore, all of these compounds increased the expression of the cholesterol transporter ABCA1 and ABCG1 levels and decreased cellular uptake of Aβ in an apoE-dependent manner. Both bexarotene and 9-cis-RA promote the lipidation status of apoE, in which 9-cis-RA promotes a stronger effect and exhibits less cytotoxicity compared with bexarotene. Importantly, we showed that oral administration of bexarotene and 9-cis-RA significantly increases apoE, ABCA1, and ABCG1 levels in mouse brains. Taken together, our results demonstrate that RXR/RA receptor agonists, including several RA isomers, are effective modulators of apoE secretion and lipidation and may be explored as potential drugs for AD therapy. PMID:24599963

Noninvasive two-photon fluorescence microscopy imaging of mouse retina and RPE through the pupil of the eye

PubMed Central

Palczewska, Grazyna; Dong, Zhiqian; Golczak, Marcin; Hunter, Jennifer J.; Williams, David R.; Alexander, Nathan S.; Palczewski, Krzysztof

2014-01-01

Two-photon excitation microscopy (TPM) can image retinal molecular processes in vivo. Intrinsically fluorescent retinyl esters in sub-cellular structures called retinosomes are an integral part of the visual chromophore regeneration pathway. Fluorescent condensation products of all–trans–retinal accumulate in the eye with age and are also associated with age-related macular degeneration (AMD). Here we report repetitive, dynamic imaging of these compounds in live mice, through the pupil of the eye. Leveraging advanced adaptive optics we developed a data acquisition algorithm that permitted the identification of retinosomes and condensation products in the retinal pigment epithelium (RPE) by their characteristic localization, spectral properties, and absence in genetically modified or drug-treated mice. This imaging approach has the potential to detect early molecular changes in retinoid metabolism that trigger light and AMD-induced retinal defects and to assess the effectiveness of treatments for these conditions. PMID:24952647

[The reaction of the neuroblastoma cells in the culture on the influence of tretionine and neurotoxine].

PubMed

Magakian, Iu A; Karalian, Z A; Karalova, E M; Abroian, L O; Akopian, L A; Avetisian, A C; Semerdzhian, Z B

2011-01-01

Effect of the tretionine (retinoid) and aluminum chloride (neurotoxin) on the growth and differentiation of neuroblastoma cells in culture after their introduction into the medium separately and in combination was studied. The introduction of these substances creates a new information field in the medium, which becomes apparent by the reactions of neuroblastoma found on the populational and cellular levels of its organization. The presence of tretionine stimulates proliferation and induces differentiation of the cells into astrocytes. Aluminum chloride inhibits cell proliferation and enhances the process of their destruction in the monolayer. The variety of the reactions of neuroblastoma cells to the presence of these substances in the medium indicates the existence and functioning of a mechanism that selects from the information introduced only the portion which may contribute to adaptation of neuroblastoma cells to the changed culture conditions.

The import of the transcription factor STAT3 into mitochondria depends on GRIM-19, a component of the electron transport chain.

PubMed

Tammineni, Prasad; Anugula, Chandrashekhar; Mohammed, Fareed; Anjaneyulu, Murari; Larner, Andrew C; Sepuri, Naresh Babu Venkata

2013-02-15

The signal transducer and activator of transcription 3 (STAT3), a nuclear transcription factor, is also present in mitochondria and regulates cellular respiration in a transcriptional-independent manner. The mechanism of STAT3 import into mitochondria remains obscure. In this report we show that mitochondrial-localized STAT3 resides in the inner mitochondrial membrane. In vitro import studies show that the gene associated with retinoid interferon induced cell mortality 19 (GRIM-19), a complex I subunit that acts as a chaperone to recruit STAT3 into mitochondria. In addition, GRIM-19 enhances the integration of STAT3 into complex I. A S727A mutation in STAT3 reduces its import and assembly even in the presence of GRIM-19. Together, our studies unveil a novel chaperone function for GRIM-19 in the recruitment of STAT3 into mitochondria.

The cytostatic effect of 9-cis-retinoic acid, tretinoin, and isotretinoin on three different human bladder cancer cell lines in vitro.

PubMed

Laaksovirta, S; Rajala, P; Nurmi, M; Tammela, T L; Laato, M

1999-01-01

Retinoids have been shown to have activity in both preclinical and clinical bladder cancer studies but their exact role in its treatment and prevention remains obscure. In this study cytostatic activity of a novel 9-cis-retinoic acid (9-cis-RA) was compared with two other retinoids: tretinoin and isotretinoin, in three different bladder cancer cell lines: RT4 (well differentiated), 5637 (moderately differentiated) and T24 (poorly differentiated). The three retinoids were incubated at concentrations of 0.3, 3 and 30 microg/ml with bladder cancer cells in microtitre plates for 3 and 6 days. The cytostatic effect was estimated by using luminometric measuring of ATP activity of viable cells in suspension. Compared with the older retinoids, tretinoin and isotretinoin, the highest concentration of 9-cis-RA had a cytostatic efficacy in all three bladder cancer cell lines tested. A clear dose response relationship was observed in isotretinoin-treated cultures after 6 days and in all 9-cis-RA-treated cultures. Tretinoin was either ineffective or had a stimulating effect on poorly differentiated tumour cells. To conclude, isotretinoin and 9-cis-RA had a cytostatic effect on human bladder cancer cells in vitro. However, the possibility of stimulating cancer growth at small doses, at least with tretinoin, and toxicity at high doses must be considered when planning clinical trials.

Cumulative irritation potential of topical retinoid formulations.

PubMed

Leyden, James J; Grossman, Rachel; Nighland, Marge

2008-08-01

Localized irritation can limit treatment success with topical retinoids such as tretinoin and adapalene. The factors that influence irritant reactions have been shown to include individual skin sensitivity, the particular retinoid and concentration used, and the vehicle formulation. To compare the cutaneous tolerability of tretinoin 0.04% microsphere gel (TMG) with that of adapalene 0.3% gel and a standard tretinoin 0.025% cream. The results of 2 randomized, investigator-blinded studies of 2 to 3 weeks' duration, which utilized a split-face method to compare cumulative irritation scores induced by topical retinoids in subjects with healthy skin, were combined. Study 1 compared TMG 0.04% with adapalene 0.3% gel over 2 weeks, while study 2 compared TMG 0.04% with tretinoin 0.025% cream over 3 weeks. In study 1, TMG 0.04% was associated with significantly lower cumulative scores for erythema, dryness, and burning/stinging than adapalene 0.3% gel. However, in study 2, there were no significant differences in cumulative irritation scores between TMG 0.04% and tretinoin 0.025% cream. Measurements of erythema by a chromameter showed no significant differences between the test formulations in either study. Cutaneous tolerance of TMG 0.04% on the face was superior to that of adapalene 0.3% gel and similar to that of a standard tretinoin cream containing a lower concentration of the drug (0.025%).

Running increases neurogenesis without retinoic acid receptor activation in the adult mouse dentate gyrus.

PubMed

Aberg, Elin; Perlmann, Thomas; Olson, Lars; Brené, Stefan

2008-01-01

Both vitamin A deficiency and high doses of retinoids can result in learning and memory impairments, depression as well as decreases in cell proliferation, neurogenesis and cell survival. Physical activity enhances hippocampal neurogenesis and can also exert an antidepressant effect. Here we elucidate a putative link between running, retinoid signaling, and neurogenesis in hippocampus. Adult transgenic reporter mice designed to detect ligand-activated retinoic acid receptors (RAR) or retinoid X receptors (RXR) were used to localize the distribution of activated RAR or RXR at the single-cell level in the brain. Two months of voluntary wheel-running induced an increase in hippocampal neurogenesis as indicated by an almost two-fold increase in doublecortin-immunoreactive cells. Running activity was correlated with neurogenesis. Under basal conditions a distinct pattern of RAR-activated cells was detected in the granule cell layer of the dentate gyrus (DG), thalamus, and cerebral cortex layers 3-4 and to a lesser extent in hippocampal pyramidal cell layers CA1-CA3. Running did not change the number of RAR-activated cells in the DG. There was no correlation between running and RAR activation or between RAR activation and neurogenesis in the DG of hippocampus. Only a few scattered activated retinoid X receptors were found in the DG under basal conditions and after wheel-running, but RXR was detected in other areas such as in the hilus region of hippocampus and in layer VI of cortex cerebri. RAR agonists affect mood in humans and reduce neurogenesis, learning and memory in animal models. In our study, long-term running increased neurogenesis but did not alter RAR ligand activation in the DG in individually housed mice. Thus, our data suggest that the effects of exercise on neurogenesis and other plasticity changes in the hippocampal formation are mediated by mechanisms that do not involve retinoid receptor activation. (c) 2008 Wiley-Liss, Inc.

Liver X Receptors Balance Lipid Stores in Hepatic Stellate Cells via Rab18, a Retinoid Responsive Lipid Droplet Protein

PubMed Central

O’Mahony, Fiona; Wroblewski, Kevin; O’Byrne, Sheila M.; Jiang, Hongfeng; Clerkin, Kara; Benhammou, Jihane; Blaner, William S.; Beaven, Simon W.

2014-01-01

Liver X receptors (LXRs) are determinants of hepatic stellate cell (HSC) activation and liver fibrosis. Freshly isolated HSCs from Lxrαβ−/− mice have increased lipid droplet (LD) size but the functional consequences of this are unknown. Our aim was to determine whether LXRs link cholesterol to retinoid storage in HSCs and how this impacts activation. Primary HSCs from Lxrαβ−/− and wild-type (WT) mice were profiled by gene array during in vitro activation. Lipid content was quantified by HPLC and mass spectroscopy. Primary HSCs were treated with nuclear receptor ligands, transfected with siRNA and plasmid constructs, and analyzed by immunocytochemistry. Lxrαβ−/− HSCs have increased cholesterol and retinyl esters (CEs & REs). The retinoid increase drives intrinsic retinoic acid receptor (RAR) signaling and activation occurs more rapidly in Lxrαβ−/− HSCs. We identify Rab18 as a novel retinoic acid responsive, lipid droplet associated protein that helps mediate stellate cell activation. Rab18 mRNA, protein, and membrane insertion increase during activation. Both Rab18 GTPase activity and isoprenylation are required for stellate cell lipid droplet loss and induction of activation markers. These phenomena are accelerated in the Lxrαβ−/− HSCs, where there is greater retinoic acid flux. Conversely, Rab18 knockdown retards lipid droplet loss in culture and blocks activation, just like the functional mutants. Rab18 is also induced with acute liver injury in vivo. Conclusion Retinoid and cholesterol metabolism are linked in stellate cells by the LD associated protein, Rab18. Retinoid overload helps explain the pro-fibrotic phenotype of Lxrαβ−/− mice and we establish a pivotal role for Rab18 GTPase activity and membrane insertion in wild-type stellate cell activation. Interference with Rab18 may have significant therapeutic benefit in ameliorating liver fibrosis. PMID:25482505

Liver X receptors balance lipid stores in hepatic stellate cells through Rab18, a retinoid responsive lipid droplet protein.

PubMed

O'Mahony, Fiona; Wroblewski, Kevin; O'Byrne, Sheila M; Jiang, Hongfeng; Clerkin, Kara; Benhammou, Jihane; Blaner, William S; Beaven, Simon W

2015-08-01

Liver X receptors (LXRs) are determinants of hepatic stellate cell (HSC) activation and liver fibrosis. Freshly isolated HSCs from Lxrαβ(-/-) mice have increased lipid droplet (LD) size, but the functional consequences of this are unknown. Our aim was to determine whether LXRs link cholesterol to retinoid storage in HSCs and how this impacts activation. Primary HSCs from Lxrαβ(-/-) and wild-type mice were profiled by gene array during in vitro activation. Lipid content was quantified by high-performance liquid chromatography and mass spectroscopy. Primary HSCs were treated with nuclear receptor ligands, transfected with small interfering RNA and plasmid constructs, and analyzed by immunocytochemistry. Lxrαβ(-/-) HSCs have increased cholesterol and retinyl esters. The retinoid increase drives intrinsic retinoic acid receptor signaling, and activation occurs more rapidly in Lxrαβ(-/-) HSCs. We identify Rab18 as a novel retinoic acid-responsive, LD-associated protein that helps mediate stellate cell activation. Rab18 mRNA, protein, and membrane insertion increase during activation. Both Rab18 guanosine triphosphatase activity and isoprenylation are required for stellate cell LD loss and induction of activation markers. These phenomena are accelerated in Lxrαβ(-/-) HSCs, where there is greater retinoic acid flux. Conversely, Rab18 knockdown retards LD loss in culture and blocks activation, just like the functional mutants. Rab18 is also induced with acute liver injury in vivo. Retinoid and cholesterol metabolism are linked in stellate cells by the LD-associated protein Rab18. Retinoid overload helps explain the profibrotic phenotype of Lxrαβ(-/-) mice, and we establish a pivotal role for Rab18 GTPase activity and membrane insertion in wild-type stellate cell activation. Interference with Rab18 may have significant therapeutic benefit in ameliorating liver fibrosis. © 2015 by the American Association for the Study of Liver Diseases.

Retinoids, retinoid analogs, and lactoferrin interact and differentially affect cell viability of 2 bovine mammary cell types in vitro.

PubMed

Wang, Y; Baumrucker, C R

2010-07-01

Two bovine mammary cell types (BME-UV1 and MeBo cells) were used to evaluate the effect of natural retinoids, retinoid analogs, and bovine lactoferrin (bLf) on cell viability in vitro. Experiments with Alamar Blue showed a linear relationship between fluorescence and cell viability index. The BME-UV1 cells exhibited twice the metabolic activity but required half the doubling time of the MeBo cells. The BME-UV1 cells were very sensitive to all-trans retinoic acid (atRA) inhibition of cell viability (P<0.05) and exhibited a dose-dependent inhibition with 9-cisRA (9cRA; P<0.05). The MeBo cells exhibited some inhibition with these natural ligands (P<0.05), but they were not as sensitive. The addition of bLf had similar inhibitory effects (P<0.05) on cell viability of the 2 mammary cell types. Applications of RA receptor (RAR) agonist indicated that the stimulation of the RAR in both mammary cell types was highly effective in inhibition of cell viability (P<0.05), whereas the application of an RAR antagonist stimulated MeBo cell viability (P<0.05) and inhibited BME-UV1 cell viability (P<0.05). Finally, the use of the RAR antagonist in conjunction with bLf indicated a rescue of the bLf effect in the MeBo cells, suggesting that bLf is acting through the RAR receptor. Conversely, bLf reverted inhibition of cell viability by 9cRA in the BME-UV1 cell type (P<0.05). We conclude that RAR interaction in bovine mammary cell types regulates cell viability in vitro; we hypothesize that the natural ligands mediate regulation of bovine mammary cell viability in vivo and that bLf can either enhance or reverse the retinoid-induced inhibition of cell viability, depending on the type of bovine mammary cell studied.

Low aqueous solubility of 11-cis-retinal limits the rate of pigment formation and dark adaptation in salamander rods.

PubMed

Frederiksen, Rikard; Boyer, Nicholas P; Nickle, Benjamin; Chakrabarti, Kalyan S; Koutalos, Yiannis; Crouch, Rosalie K; Oprian, Daniel; Cornwall, M Carter

2012-06-01

We report experiments designed to test the hypothesis that the aqueous solubility of 11-cis-retinoids plays a significant role in the rate of visual pigment regeneration. Therefore, we have compared the aqueous solubility and the partition coefficients in photoreceptor membranes of native 11-cis-retinal and an analogue retinoid, 11-cis 4-OH retinal, which has a significantly higher solubility in aqueous medium. We have then correlated these parameters with the rates of pigment regeneration and sensitivity recovery that are observed when bleached intact salamander rod photoreceptors are treated with physiological solutions containing these retinoids. We report the following results: (a) 11-cis 4-OH retinal is more soluble in aqueous buffer than 11-cis-retinal. (b) Both 11-cis-retinal and 11-cis 4-OH retinal have extremely high partition coefficients in photoreceptor membranes, though the partition coefficient of 11-cis-retinal is roughly 50-fold greater than that of 11-cis 4-OH retinal. (c) Intact bleached isolated rods treated with solutions containing equimolar amounts of 11-cis-retinal or 11-cis 4-OH retinal form functional visual pigments that promote full recovery of dark current, sensitivity, and response kinetics. However, rods treated with 11-cis 4-OH retinal regenerated on average fivefold faster than rods treated with 11-cis-retinal. (d) Pigment regeneration from recombinant and wild-type opsin in solution is slower when treated with 11-cis 4-OH retinal than with 11-cis-retinal. Based on these observations, we propose a model in which aqueous solubility of cis-retinoids within the photoreceptor cytosol can place a limit on the rate of visual pigment regeneration in vertebrate photoreceptors. We conclude that the cytosolic gap between the plasma membrane and the disk membranes presents a bottleneck for retinoid flux that results in slowed pigment regeneration and dark adaptation in rod photoreceptors.

Identification and Characterization of Strychnine-Binding Peptides Using Phage-Display Screening.

PubMed

Zhang, Fang; Wang, Min; Qiu, Zheng; Wang, Xiao-Meng; Xu, Chun-Lei; Zhang, Xia

2017-01-01

In drug development, phage display is a high-throughput method for identifying the specific cellular targets of drugs. However, insoluble small chemicals remain intractable to this technique because of the difficulty of presenting molecules to phages without occupying or destroying the limited functional groups. In the present study, we selected Strychnine (Stry) as a model compounda and sought to develope an alternative in vitro biopanning strategy against insoluble suspension. A phage library displaying random sequences of fifteen peptides was employed to screen for interactions between Stry and its cellular selective binding peptides, which are of great value to have a complete understanding of the mechanism of Stry for its antitumor activity. After four rounds of biopanning, a selection of 100 binding clones was randomly picked and subjected to modified proliferation and diffusion assays to evaluate the binding affinity of the clones. Finally, eleven clones were identified as positive binders. The corresponding peptides were synthesized and detected for their binding activities using surface plasmon resonance imaging (SPRi). Our study provides a feasible scheme for confirming the interaction of chemical compounds and cellular binding peptides. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Retinoic acids and trichostatin A (TSA), a histone deacetylase inhibitor, induce human pyruvate dehydrogenase kinase 4 (PDK4) gene expression.

PubMed

Kwon, Hye-Sook; Huang, Boli; Ho Jeoung, Nam; Wu, Pengfei; Steussy, Calvin N; Harris, Robert A

2006-01-01

Induction of pyruvate dehydrogenase kinase 4 (PDK4) conserves glucose and substrates for gluconeogenesis and thereby helps regulate blood glucose levels during starvation. We report here that retinoic acids (RA) as well as Trichostatin A (TSA), an inhibitor of histone deacetylase (HDAC), regulate PDK4 gene expression. Two retinoic acid response elements (RAREs) to which retinoid X receptor alpha (RXRalpha) and retinoic acid receptor alpha (RARalpha) bind and activate transcription are present in the human PDK4 (hPDK4) proximal promoter. Sp1 and CCAAT box binding factor (CBF) bind to the region between two RAREs. Mutation of either the Sp1 or the CBF site significantly decreases basal expression, transactivation by RXRalpha/RARalpha/RA, and the ability of TSA to stimulate hPDK4 gene transcription. By the chromatin immunoprecipitation assay, RA and TSA increase acetylation of histones bound to the proximal promoter as well as occupancy of CBP and Sp1. Interaction of p300/CBP with E1A completely prevented hPDK4 gene activation by RXRalpha/RARalpha/RA and TSA. The p300/CBP may enhance acetylation of histones bound to the hPDK4 promoter and cooperate with Sp1 and CBF to stimulate transcription of the hPDK4 gene in response to RA and TSA.

Severe hepatotoxic reaction with progression to cirrhosis after use of a novel retinoid (acitretin).

PubMed

van Ditzhuijsen, T J; van Haelst, U J; van Dooren-Greebe, R J; van de Kerkhof, P C; Yap, S H

1990-09-01

We report the case of a 50-year-old female who suffered from severe palmar and plantar pustulosis. During treatment with acitretin, a novel oral retinoid, which is the main derivative of etretinate, the patient developed a severe hepatotoxic reaction. Subsequent histological studies strongly suggested the development of liver cirrhosis. Reversible elevation of serum aminotransferase values during treatment with acitretin has been reported. However, the present observation indicates that severe hepatotoxic injury may also follow treatment with this agent.

Two distinct cellular proteins interact with the EIa-responsive element of an adenovirus early promoter.

PubMed Central

Jansen-Durr, P; Wintzerith, M; Reimund, B; Hauss, C; Kédinger, C

1990-01-01

EIa-dependent transactivation of the adenovirus EIIa early (EIIaE) promoter is correlated with the activation of the cellular transcription factor E2F. In this study we identified a cellular protein, C alpha, that is distinct from E2F and that binds two sites in the EIIaE promoter, one of which overlaps with the proximal E2F binding site of the EIIaE promoter. The possible involvement of C alpha in the EIa responsiveness of this promoter is discussed. Images PMID:2139142

Curcuminoid Binding to Embryonal Carcinoma Cells: Reductive Metabolism, Induction of Apoptosis, Senescence, and Inhibition of Cell Proliferation

PubMed Central

Quitschke, Wolfgang W.

2012-01-01

Curcumin preparations typically contain a mixture of polyphenols, collectively referred to as curcuminoids. In addition to the primary component curcumin, they also contain smaller amounts of the co-extracted derivatives demethoxycurcumin and bisdemethoxycurcumin. Curcuminoids can be differentially solubilized in serum, which allows for the systematic analysis of concentration-dependent cellular binding, biological effects, and metabolism. Technical grade curcumin was solubilized in fetal calf serum by two alternative methods yielding saturated preparations containing either predominantly curcumin (60%) or bisdemethoxycurcumin (55%). Continual exposure of NT2/D1 cells for 4–6 days to either preparation in cell culture media reduced cell division (1–5 µM), induced senescence (6–7 µM) or comprehensive cell death (8–10 µM) in a concentration-dependent manner. Some of these effects could also be elicited in cells transiently exposed to higher concentrations of curcuminoids (47 µM) for 0.5–4 h. Curcuminoids induced apoptosis by generalized activation of caspases but without nucleosomal fragmentation. The equilibrium binding of serum-solubilized curcuminoids to NT2/D1 cells incubated with increasing amounts of curcuminoid-saturated serum occurred with apparent overall dissociation constants in the 6–10 µM range. However, the presence of excess free serum decreased cellular binding in a hyperbolic manner. Cellular binding was overwhelmingly associated with membrane fractions and bound curcuminoids were metabolized in NT2/D1 cells via a previously unidentified reduction pathway. Both the binding affinities for curcuminoids and their reductive metabolic pathways varied in other cell lines. These results suggest that curcuminoids interact with cellular binding sites, thereby activating signal transduction pathways that initiate a variety of biological responses. The dose-dependent effects of these responses further imply that distinct cellular pathways are sequentially activated and that this activation is dependent on the affinity of curcuminoids for the respective binding sites. Defined serum-solubilized curcuminoids used in cell culture media are thus suitable for further investigating the differential activation of signal transduction pathways. PMID:22768090

Celastrol reverses palmitic acid (PA)-caused TLR4-MD2 activation-dependent insulin resistance via disrupting MD2-related cellular binding to PA.

PubMed

Zhang, Xue; Wang, Ying; Ge, Hui-Ya; Gu, Yi-Jun; Cao, Fan-Fan; Yang, Chun-Xin; Uzan, Georges; Peng, Bin; Zhang, Deng-Hai

2018-04-18

Elevated plasma statured fatty acids (FFAs) cause TLR4/MD2 activation-dependent inflammation and insulin tolerance, which account for the occurrence and development of obesity. It has been confirmed that statured palmitic acid (PA) (the most abundant FFA) could bind MD2 to cause cellular inflammation. The natural compound celastrol could improve obesity, which is suggested via inhibiting inflammation, yet the detailed mechanism for celastrol is still unclear. As celastrol is reported to directly target MD2, we thought disrupting the binding between FFAs and MD2 might be one of the ways for celastrol to inhibit FFAs-caused inflammation and insulin resistance. In this study, we found evidence to support our hypothesis: celastrol could reverse PA-caused TLR4/MD2 activation-dependent insulin resistance, as determined by glucose-lowering ability, cellular glucose uptake, insulin action-related proteins and TLR4/MD2/NF-κB activation. Bioinformatics and cellular experiments showed that both celastrol and PA could bind MD2, and that celastrol could expel PA from cells. Finally, celastrol could reverse high fat diet caused hyperglycemia and obesity, and liver NF-kB activations. Taking together, we proved that celastrol could reverses PA-caused TLR4-MD2 activation-dependent insulin resistance via disrupting PA binding to MD2. © 2018 Wiley Periodicals, Inc.

The identification of cellular targets of 17β estradiol using a lytic (T7) cDNA phage display approach.

PubMed

Van Dorst, Bieke; Mehta, Jaytry; Rouah-Martin, Elsa; De Coen, Wim; Blust, Ronny; Robbens, Johan

2011-02-01

To unravel the mechanism of action of chemical compounds, it is crucial to know their cellular targets. A novel in vitro tool that can be used as a fast, simple and cost effective alternative is cDNA phage display. This tool is used in our study to select cellular targets of 17β estradiol (E2). It was possible to select two potential cellular targets of E2 out of the T7 Select™ Human Breast cDNA phage library. The selected cellular targets, autophagy/beclin-1 regulator 1 (beclin 1) and ATP synthase F(0) subunit 6 (ATP6) have so far been unknown as binding proteins of E2. To confirm the E2 binding properties of these selected proteins, surface plasmon resonance (SPR) was used. With SPR the K(d) values were determined to be 0.178±0.031 and 0.401±0.142 nM for the ATP6 phage and beclin 1 phage, respectively. These K(d) values in the low nM range verify that the selected cellular proteins are indeed binding proteins for E2. The selection and identification of these two potential cellular targets of E2, can enhance our current understanding of its mechanism of action. This illustrates the potential of lytic (T7) cDNA phage display in toxicology, to provide important information about cellular targets of chemical compounds. Copyright © 2010 Elsevier Ltd. All rights reserved.

Maternal-fetal transfer and metabolism of vitamin A and its precursor β-carotene in the developing tissues.

PubMed

Spiegler, Elizabeth; Kim, Youn-Kyung; Wassef, Lesley; Shete, Varsha; Quadro, Loredana

2012-01-01

The requirement of the developing mammalian embryo for retinoic acid is well established. Retinoic acid, the active form of vitamin A, can be generated from retinol and retinyl ester obtained from food of animal origin, and from carotenoids, mainly β-carotene, from vegetables and fruits. The mammalian embryo relies on retinol, retinyl ester and β-carotene circulating in the maternal bloodstream for its supply of vitamin A. The maternal-fetal transfer of retinoids and carotenoids, as well as the metabolism of these compounds in the developing tissues are still poorly understood. The existing knowledge in this field has been summarized in this review in reference to our basic understanding of the transport and metabolism of retinoids and carotenoids in adult tissues. The need for future research on the metabolism of these essential lipophilic nutrients during development is highlighted. This article is part of a Special Issue entitled: Retinoid and Lipid Metabolism. © 2011 Elsevier B.V. All rights reserved.

Proteomic analysis of the gamma human papillomavirus type 197 E6 and E7 associated cellular proteins

PubMed Central

Grace, Miranda; Munger, Karl

2016-01-01

Gamma HPV197 was the most frequently identified HPV when human skin cancer specimens were analyzed by deep sequencing. To gain insight into the biological activities of HPV197, we investigated the cellular interactomes of HPV197 E6 and E7. HPV197 E6 protein interacts with a broad spectrum of cellular LXXLL domain proteins, including UBE3A and MAML1. HPV197 E6 also binds and inhibits the TP53 tumor suppressor and interacts with the CCR4-NOT ubiquitin ligase and deadenylation complex. Despite lacking a canonical retinoblastoma (RB1) tumor suppressor binding site, HPV197 E7 binds RB1 and activates E2F transcription. Hence, HPV197 E6 and E7 proteins interact with a similar set of cellular proteins as E6 and E7 proteins encoded by HPVs that have been linked to human carcinogenesis and/or have transforming activities in vitro. PMID:27771561

Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis

PubMed Central

2010-01-01

Background Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped virus, bearing severe economic consequences to the swine industry worldwide. Previous studies on enveloped viruses have shown that many incorporated cellular proteins associated with the virion's membranes that might play important roles in viral infectivity. In this study, we sought to proteomically profile the cellular proteins incorporated into or associated with the virions of a highly virulent PRRSV strain GDBY1, and to provide foundation for further investigations on the roles of incorporated/associated cellular proteins on PRRSV's infectivity. Results In our experiment, sixty one cellular proteins were identified in highly purified PRRSV virions by two-dimensional gel electrophoresis coupled with mass spectrometric approaches. The identified cellular proteins could be grouped into eight functional categories including cytoskeletal proteins, chaperones, macromolecular biosynthesis proteins, metabolism-associated proteins, calcium-dependent membrane-binding proteins and other functional proteins. Among the identified proteins, four have not yet been reported in other studied envelope viruses, namely, guanine nucleotide-binding proteins, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase, peroxiredoxin 1 and galectin-1 protein. The presence of five selected cellular proteins (i.e., β-actin, Tubulin, Annexin A2, heat shock protein Hsp27, and calcium binding proteins S100) in the highly purified PRRSV virions was validated by Western blot and immunogold labeling assays. Conclusions Taken together, the present study has demonstrated the incorporation of cellular proteins in PRRSV virions, which provides valuable information for the further investigations for the effects of individual cellular proteins on the viral replication, assembly, and pathogenesis. PMID:20849641

Nitrofen increases total retinol levels in placenta during lung morphogenesis in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Kutasy, Balazs; Pes, Lara; Friedmacher, Florian; Paradisi, Francesca; Puri, Prem

2014-10-01

It has been shown that pulmonary retinol level is decreased during lung morphogenesis in the nitrofen-induced PH in congenital diaphragmatic hernia (CDH). Placenta has a major role in the retinol homeostasis in fetal life. Since there is no fetal retinol synthesis, maternal retinol has to cross the placenta. Placenta is the main fetal retinol store where retinol is stored in retinyl-ester formation. Trophoblasts have to produce its own retinol-binding protein (RBP) for retinol transport from placenta to fetus. Recently, we demonstrated that trophoblastic RBP expression is decreased in the nitrofen model of CDH. The aim of this study was to investigate the retinol transfer from mother to the placenta in nitrofen model of CDH. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal placenta harvested on D21 and divided into two groups: control (n = 11) and nitrofen with CDH (n = 11). Retinoid levels in placenta were measured using HPLC. Immunohistochemistry was performed to evaluate trophoblastic expression of main RSP genes. Total retinol levels in the placenta were significantly increased in CDH placenta compared to control placenta. The retinyl-ester levels were significantly increased in CDH placenta compared to control placenta. Markedly, decreased immunoreactivity of retinoid signaling pathway was observed in trophoblast cells in CDH compared to control placenta. Increased placental retinol levels show that retinol is transferred from mother to placenta and stored in the placenta in nitrofen model of CDH during lung morphogenesis. Nitrofen may disturb the mobilization of retinol from placenta to fetal circulation causing PH in CDH.

Bexarotene via CBP/p300 induces suppression of NF-κB-dependent cell growth and invasion in thyroid cancer.

PubMed

Cras, Audrey; Politis, Béatrice; Balitrand, Nicole; Darsin-Bettinger, Diane; Boelle, Pierre Yves; Cassinat, Bruno; Toubert, Marie-Elisabeth; Chomienne, Christine

2012-01-15

Retinoic acid (RA) treatment has been used for redifferentiation of metastatic thyroid cancer with loss of radioiodine uptake. The aim of this study was to improve the understanding of RA resistance and investigate the role of bexarotene in thyroid cancer cells. A model of thyroid cancer cell lines with differential response to RA was used to evaluate the biological effects of retinoid and rexinoid and to correlate this with RA receptor levels. Subsequently, thyroid cancer patients were treated with 13-cis RA and bexarotene and response evaluated on radioiodine uptake reinduction on posttherapy scan and conventional imaging. In thyroid cancer patients, 13-cis RA resistance can be bypassed in some tumors by bexarotene. A decreased tumor growth without differentiation was observed confirming our in vitro data. Indeed, we show that ligands of RARs or RXRs exert different effects in thyroid cancer cell lines through either differentiation or inhibition of cell growth and invasion. These effects are associated with restoration of RARβ and RXRγ levels and downregulation of NF-κB targets genes. We show that bexarotene inhibits the transactivation potential of NF-κB in an RXR-dependent manner through decreased promoter permissiveness without interfering with NF-κB nuclear translocation and binding to its responsive elements. Inhibition of transcription results from the release of p300 coactivator from NF-κB target gene promoters and subsequent histone deacetylation. This study highlights dual mechanisms by which retinoids and rexinoids may target cell tumorigenicity, not only via RARs and RXRs, as expected, but also via NF-κB pathway. ©2011 AACR.

A novel RPE65 inhibitor CU239 suppresses visual cycle and prevents retinal degeneration.

PubMed

Shin, Younghwa; Moiseyev, Gennadiy; Petrukhin, Konstantin; Cioffi, Christopher L; Muthuraman, Parthasarathy; Takahashi, Yusuke; Ma, Jian-Xing

2018-07-01

The retinoid visual cycle is an ocular retinoid metabolism specifically dedicated to support vertebrate vision. The visual cycle serves not only to generate light-sensitive visual chromophore 11-cis-retinal, but also to clear toxic byproducts of normal visual cycle (i.e. all-trans-retinal and its condensation products) from the retina, ensuring both the visual function and the retinal health. Unfortunately, various conditions including genetic predisposition, environment and aging may attribute to a functional decline of the all-trans-retinal clearance. To combat all-trans-retinal mediated retinal degeneration, we sought to slow down the retinoid influx from the RPE by inhibiting the visual cycle with a small molecule. The present study describes identification of CU239, a novel non-retinoid inhibitor of RPE65, a key enzyme in the visual cycle. Our data demonstrated that CU239 selectively inhibited isomerase activity of RPE65, with IC 50 of 6 μM. Further, our results indicated that CU239 inhibited RPE65 via competition with its substrate all-trans-retinyl ester. Mice with systemic injection of CU239 exhibited delayed chromophore regeneration after light bleach, and conferred a partial protection of the retina against injury from high intensity light. Taken together, CU239 is a potent visual cycle modulator and may have a therapeutic potential for retinal degeneration. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

Metabolism of oral 9-cis-retinoic acid in the human. Identification of 9-cis-retinoyl-beta-glucuronide and 9-cis-4-oxo-retinoyl-beta-glucuronide as urinary metabolites.

PubMed

Sass, J O; Masgrau, E; Saurat, J H; Nau, H

1995-09-01

Data from a number of investigators suggest that the 9-cis-isomer of RA1 (9-cis-RA) may be a promising agent in chemoprevention and treatment of certain types of cancer. Therefore, clinical studies on this retinoid have been initiated. However, up to now, no information has been published on the metabolism of 9-cis-RA in the human. Herein, we report the first data on retinoid metabolism after multiple administration of 9-cis-RA (20 mg/day po) to human volunteers. After 2 and 12-13 hr, plasma concentrations of 9-cis-RA and its metabolites 9,13-dicis-RA, 13-cis-RA, and all-trans-RA were low. In contrast, dosing with 13-cis-RA yielded much higher plasma retinoid levels. Effects on plasma retinol concentrations did not become obvious after any drug treatment. Several retinoid metabolites were found in the urine of 9-cis-RA-treated individuals, and 9-cis-RAG, as well as 9-cis-4-oxo-RAG, could be identified. After treatment with 9-cis-RA, high concentrations of the administered drug were found in the feces, along with comparably low concentrations of 13-cis-RA, 9,13-dicis-RA, and all-trans-RA. Our report indicates that 9-cis-RA is either eliminated much more rapidly than 13-cis-RA, or it is poorly absorbed, and presents the characterization of two urinary glucuronides.

Antagonism of hypervitaminosis A-induced anterior neural tube closure defects with a methyl-donor deficiency in murine whole-embryo culture.

PubMed

Santos-Guzmán, Jesús; Arnhold, Thomas; Nau, Heinz; Wagner, Conrad; Fahr, Sharon H; Mao, Gloria E; Caudill, Marie A; Wang, Jennie C; Henning, Susanne M; Swendseid, Marian E; Collins, Michael D

2003-11-01

The interaction of a dietary excess of vitamin A (retinoid) and deficiency of methyl-donor compounds was examined in murine early-organogenesis embryonic development. Female mice were fed one of six diets from the time of vaginal plug detection until gestational d 8.0, when embryos were removed and grown in whole embryo culture for 46 h, using serum from rats fed the same diet for 36 d as the culture medium. The six diets were either methyl-donor deficient (designated -FCM: devoid of folic acid, choline and supplemental L-methionine, but having methionine as a component of the protein portion of the diet) or methyl-donor sufficient (designated +FCM: containing folic acid, choline and L-methionine supplementation), in combination with one of three concentrations of retinyl palmitate (0.016, 0.416 or 4.016 g/kg diet). The high dose of retinyl palmitate induced a failure of anterior neuropore closure and hypoplasia of the visceral arches, both of which were significantly ameliorated by simultaneous administration of the methyl-donor-deficient diet. The primary acidic retinoid detected in the rat serum was 9,13-di-cis-retinoic acid, although we hypothesize that teratogenic retinoids were formed by embryonic biotransformation of the retinyl esters to toxic metabolites. Biochemical measurements of metabolites in relevant pathways were performed. We propose that the amelioration of these malformations may be used to determine biochemical pathways critical for retinoid teratogenesis.

Malaria, Epstein-Barr virus infection and the pathogenesis of Burkitt's lymphoma.

PubMed

Mawson, Anthony R; Majumdar, Suvankar

2017-11-01

A geographical and causal connection has long been recognized between malaria, Epstein-Barr virus (EBV) infection and Burkitt's lymphoma (BL), but the underlying mechanisms remain obscure. Potential clues are that the malaria parasite Plasmodium falciparum selectively absorbs vitamin A from the host and depends on it for its biological activities; secondly, alterations in vitamin A (retinoid) metabolism have been implicated in many forms of cancer, including BL. The first author has proposed that the merozoite-stage malaria parasite, emerging from the liver, uses its absorbed vitamin A as a cell membrane destabilizer to invade the red blood cells, causing anemia and other signs and symptoms of the disease as manifestations of an endogenous form of hypervitaminosis A (Mawson AR, Path Global Health 2013;107(3):122-9). Repeated episodes of malaria would therefore be expected to expose the tissues of affected individuals to potentially toxic doses of vitamin A. It is proposed that such episodes activate latent EBV infection, which in turn activates retinoid-responsive genes. Expression of these genes enhances viral replication and induces germinal center (GC) B cell expansion, activation-induced cytidine deaminase (AID) expression, and c-myc translocation, which in turn predisposes to BL. Thus, an endogenous form of retinoid toxicity related to malaria infection may be the common factor linking frequent malaria, EBV infection and BL, whereby prolonged exposure of lymphatic tissues to high concentrations of retinoids may combine to induce B-cell translocation and increase the risk of Burkitt's lymphoma. © 2017 UICC.

Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis (SJS/TEN): Could Retinoids Play a Causative Role?

PubMed Central

Mawson, Anthony R.; Eriator, Ike; Karre, Sridhar

2015-01-01

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1–4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression. PMID:25579087

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN): could retinoids play a causative role?

PubMed

Mawson, Anthony R; Eriator, Ike; Karre, Sridhar

2015-01-12

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.

RBFOX2 protein domains and cellular activities.

PubMed

Arya, Anurada D; Wilson, David I; Baralle, Diana; Raponi, Michaela

2014-08-01

RBFOX2 (RNA-binding protein, Fox-1 homologue 2)/RBM9 (RNA-binding-motif protein 9)/RTA (repressor of tamoxifen action)/HNRBP2 (hexaribonucleotide-binding protein 2) encodes an RNA-binding protein involved in tissue specific alternative splicing regulation and steroid receptors transcriptional activity. Its ability to regulate specific splicing profiles depending on context has been related to different expression levels of the RBFOX2 protein itself and that of other splicing regulatory proteins involved in the shared modulation of specific genes splicing. However, this cannot be the sole explanation as to why RBFOX2 plays a widespread role in numerous cellular mechanisms from development to cell survival dependent on cell/tissue type. RBFOX2 isoforms with altered protein domains exist. In the present article, we describe the main RBFOX2 protein domains, their importance in the context of splicing and transcriptional regulation and we propose that RBFOX2 isoform distribution may play a fundamental role in RBFOX2-specific cellular effects.

A Major Binding Protein for Leukemia Inhibitory Factor in Normal Mouse Serum: Identification as a Soluble Form of the Cellular Receptor

NASA Astrophysics Data System (ADS)

Layton, Meredith J.; Cross, Bronwyn A.; Metcalf, Donald; Ward, Larry D.; Simpson, Richard J.; Nicola, Nicos A.

1992-09-01

A protein that specifically binds leukemia inhibitory factor (LIF) has been isolated from normal mouse serum by using four successive fractionation steps: chromatography on a LIF affinity matrix, anion-exchange chromatography, size-exclusion chromatography, and preparative native gel electrophoresis. The purified LIF-binding protein (LBP) is a glycoprotein with an apparent molecular mass of 90 kDa that specifically binds 125I-labeled murine LIF with an affinity comparable to that of the low-affinity cellular LIF receptor (K_d = 600 pM). N-terminal sequencing has identified this protein as a soluble truncated form of the α chain of the cellular LIF receptor. LBP is present in normal mouse serum at high levels (1 μg/ml) and these levels are elevated in pregnant mice and reduced in neonatal mice. Since normal serum concentrations of LBP can block the biological actions of LIF in culture, LBP may serve as an inhibitor of the systemic effects of locally produced LIF.

The epidermal growth factor receptor (EGFR) promotes uptake of influenza A viruses (IAV) into host cells.

PubMed

Eierhoff, Thorsten; Hrincius, Eike R; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

2010-09-09

Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake.

The Epidermal Growth Factor Receptor (EGFR) Promotes Uptake of Influenza A Viruses (IAV) into Host Cells

PubMed Central

Eierhoff, Thorsten; Hrincius, Eike R.; Rescher, Ursula; Ludwig, Stephan; Ehrhardt, Christina

2010-01-01

Influenza A viruses (IAV) bind to sialic-acids at cellular surfaces and enter cells by using endocytotic routes. There is evidence that this process does not occur constitutively but requires induction of specific cellular signals, including activation of PI3K that promotes virus internalization. This implies engagement of cellular signaling receptors during viral entry. Here, we present first indications for an interplay of IAV with receptor tyrosine kinases (RTKs). As representative RTK family-members the epidermal growth factor receptor (EGFR) and the c-Met receptor were studied. Modulation of expression or activity of both RTKs resulted in altered uptake of IAV, showing that these receptors transmit entry relevant signals upon virus binding. More detailed studies on EGFR function revealed that virus binding lead to clustering of lipid-rafts, suggesting that multivalent binding of IAV to cells induces a signaling platform leading to activation of EGFR and other RTKs that in turn facilitates IAV uptake. PMID:20844577

Autonomous rexinoid death signaling is suppressed by converging signaling pathways in immature leukemia cells.

PubMed

Benoit, G R; Flexor, M; Besançon, F; Altucci, L; Rossin, A; Hillion, J; Balajthy, Z; Legres, L; Ségal-Bendirdjian, E; Gronemeyer, H; Lanotte, M

2001-07-01

On their own, retinoid X receptor (RXR)-selective ligands (rexinoids) are silent in retinoic acid receptor (RAR)-RXR heterodimers, and no selective rexinoid program has been described as yet in cellular systems. We report here on the rexinoid signaling capacity that triggers apoptosis of immature promyelocytic NB4 cells as a default pathway in the absence of survival factors. Rexinoid-induced apoptosis displays all features of bona fide programmed cell death and is inhibited by RXR, but not RAR antagonists. Several types of survival signals block rexinoid-induced apoptosis. RARalpha agonists switch the cellular response toward differentiation and induce the expression of antiapoptosis factors. Activation of the protein kinase A pathway in the presence of rexinoid agonists induces maturation and blocks immature cell apoptosis. Addition of nonretinoid serum factors also blocks cell death but does not induce cell differentiation. Rexinoid-induced apoptosis is linked to neither the presence nor stability of the promyelocytic leukemia-RARalpha fusion protein and operates also in non-acute promyelocytic leukemia cells. Together our results support a model according to which rexinoids activate in certain leukemia cells a default death pathway onto which several other signaling paradigms converge. This pathway is entirely distinct from that triggered by RAR agonists, which control cell maturation and postmaturation apoptosis.

Cytotoxic effect induced by retinoic acid loaded into galactosyl-sphingosine containing liposomes on human hepatoma cell lines.

PubMed

Díaz, Cecilia; Vargas, Ernesto; Gätjens-Boniche, Omar

2006-11-15

Two retinoids, ATRA and 13cisRA, were incorporated into liposomes of different composition and charge and added to two hepatoma cell lines with different degree of transformation to measure cytotoxicity by MTT assay. Retinoid-free cationic liposomes were more toxic than the other kinds (anionic and made only of PC) but were also the best delivery system for retinoic acid to induce specific cytotoxic effects on these tumor hepatoma cell lines. Galactosyl-sphingosine containing cationic liposomes increased the cytotoxic effect induced by ATRA on Hep3B cells when compared to glucosyl-sphingosine cationic liposomes, but did not improve the effect induced by free retinoid or ATRA loaded into liposomes without glycolipids. This suggests that in this cell line, ATRA is being incorporated by a mechanism mediated by the asialoglycoprotein receptor, but at the same time, non-specific sugar-independent capture is also taking place as well as free diffusion of ATRA directly through the membrane. Galactose-specific effect was not observed in HepG2 cells treated with ATRA or both cell lines treated with 13cisRA. In fact, treatment of HepG2 cells with retinoids entrapped into liposomes likely induces proliferation instead of cytotoxicity, a result that interferes with the measurement of cell death by MTT. Compared to the specific effect of ATRA entrapped into cationic liposomes, vesicles made only by PC, did not mediate a specific mechanism, since differences between ATRA in galactosyl- and glucosyl-shpingosine PC-liposomes were not statistically significant. The specific mechanism was not present in the myoblastic cell line C2C12, where ATRA incorporated into galactosyl- and glucosyl-sphingosine containing cationic and PC-liposomes, was able to induce cytotoxicity at the same extent. Micelles containing ATRA and galactosyl-sphingosine had a significantly more toxic effect than the retinoid administered together with glucosyl-sphingosine, in Hep3B cells. Also, micelles containing ATRA were more toxic than glycolipid-containing liposomes with ATRA, for both kinds of sphingosines. The same effect was not observed in C2C12 cells, where glycolipid-containing liposomes worked better than micelles, and a sugar-specific mechanism was not seen. This suggests that, even though galactose-containing cationic liposomes could be a promising approach, a galactose-specific emulsion system could be the best strategy to specifically deliver retinoic acid to liver tumor cells, since it shows tissue specificity (perhaps induced by ASGPR-mediated internalization) and a stronger cytotoxic effect than the retinoid incorporated into liposomes.

The cellular RNA-binding protein EAP recognizes a conserved stem-loop in the Epstein-Barr virus small RNA EBER 1.

PubMed Central

Toczyski, D P; Steitz, J A

1993-01-01

EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232

Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

PubMed

Pessler, Frank; Hernandez, Nouria

2003-08-01

POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

Radiocesium accumulation in mosses from highlands of Serbia and Montenegro: chemical and physiological aspects.

PubMed

Dragović, S; Nedić, O; Stanković, S; Bacić, G

2004-01-01

The aim of this work was (i) to determine the activity levels of 137Cs in mosses from highland ecosystems of Serbia and Montenegro, (ii) to find out if radiocesium is associated with essential biomacromolecules, and (iii) to investigate 137Cs distribution among intracellular compartments. It was found that biomolecules of mosses do not bind significant amounts of radiocesium (2.3-3.3% of the absorbed 137Cs), a behavior that was independent of the moss species. Cellular fractionation of mosses showed that membranes are the primary 137Cs-binding sites at the cellular level. They contained 26.1-43.1% of the initial radiocesium activity. It seems that 137Cs-binding molecules in different mosses are of similar chemical nature, and their distribution between various cellular compartments is not species specific.

Schools of pharmacology: retinoid update.

PubMed

Scheinfeld, Noah

2006-10-01

The most widely used retinoids include topical tretinoin (Retin-A), adapalene (Differin), topical tazarotene (Tazorac), isotretinoin (Accutane), and acitretin (Soriatane). This article will review new uses and developments in tazarotene (its failure to secure FDA approval in oral form for psoriasis), adapalene (its new 0.3% gel form and use in rosacea), alitretinoin (its use in photoaging), bexarotene (its use for psoriasis and chronic hand dermatitis), isotretinoin (the IPledge program, its use for neuroblastoma and branded formulation pharmacological superiority to generics), and retinoic acid metabolism-blocking agents (RAMBAs) (liarazole use for ichthyosis and psoriasis).

CD2v Interacts with Adaptor Protein AP-1 during African Swine Fever Infection

PubMed Central

Pérez-Núñez, Daniel; García-Urdiales, Eduardo; Martínez-Bonet, Marta; Nogal, María L.; Barroso, Susana; Revilla, Yolanda; Madrid, Ricardo

2015-01-01

African swine fever virus (ASFV) CD2v protein is believed to be involved in virulence enhancement, viral hemadsorption, and pathogenesis, although the molecular mechanisms of the function of this viral protein are still not fully understood. Here we describe that CD2v localized around viral factories during ASFV infection, suggesting a role in the generation and/or dynamics of these viral structures and hence in disturbing cellular traffic. We show that CD2v targeted the regulatory trans-Golgi network (TGN) protein complex AP-1, a key element in cellular traffic. This interaction was disrupted by brefeldin A even though the location of CD2v around the viral factory remained unchanged. CD2v-AP-1 binding was independent of CD2v glycosylation and occurred on the carboxy-terminal part of CD2v, where a canonical di-Leu motif previously reported to mediate AP-1 binding in eukaryotic cells, was identified. This motif was shown to be functionally interchangeable with the di-Leu motif present in HIV-Nef protein in an AP-1 binding assay. However, we demonstrated that it was not involved either in CD2v cellular distribution or in CD2v-AP-1 binding. Taken together, these findings shed light on CD2v function during ASFV infection by identifying AP-1 as a cellular factor targeted by CD2v and hence elucidate the cellular pathways used by the virus to enhance infectivity. PMID:25915900

CD2v Interacts with Adaptor Protein AP-1 during African Swine Fever Infection.

PubMed

Pérez-Núñez, Daniel; García-Urdiales, Eduardo; Martínez-Bonet, Marta; Nogal, María L; Barroso, Susana; Revilla, Yolanda; Madrid, Ricardo

2015-01-01

African swine fever virus (ASFV) CD2v protein is believed to be involved in virulence enhancement, viral hemadsorption, and pathogenesis, although the molecular mechanisms of the function of this viral protein are still not fully understood. Here we describe that CD2v localized around viral factories during ASFV infection, suggesting a role in the generation and/or dynamics of these viral structures and hence in disturbing cellular traffic. We show that CD2v targeted the regulatory trans-Golgi network (TGN) protein complex AP-1, a key element in cellular traffic. This interaction was disrupted by brefeldin A even though the location of CD2v around the viral factory remained unchanged. CD2v-AP-1 binding was independent of CD2v glycosylation and occurred on the carboxy-terminal part of CD2v, where a canonical di-Leu motif previously reported to mediate AP-1 binding in eukaryotic cells, was identified. This motif was shown to be functionally interchangeable with the di-Leu motif present in HIV-Nef protein in an AP-1 binding assay. However, we demonstrated that it was not involved either in CD2v cellular distribution or in CD2v-AP-1 binding. Taken together, these findings shed light on CD2v function during ASFV infection by identifying AP-1 as a cellular factor targeted by CD2v and hence elucidate the cellular pathways used by the virus to enhance infectivity.

Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

PubMed Central

McClellan, Michael J.; Wood, C. David; Ojeniyi, Opeoluwa; Cooper, Tim J.; Kanhere, Aditi; Arvey, Aaron; Webb, Helen M.; Palermo, Richard D.; Harth-Hertle, Marie L.; Kempkes, Bettina; Jenner, Richard G.; West, Michelle J.

2013-01-01

Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors, we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular basis for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of enhancer-promoter interactions by viral transcription factors. PMID:24068937

Specific RNP capture with antisense LNA/DNA mixmers

PubMed Central

Rogell, Birgit; Fischer, Bernd; Rettel, Mandy; Krijgsveld, Jeroen; Castello, Alfredo; Hentze, Matthias W.

2017-01-01

RNA-binding proteins (RBPs) play essential roles in RNA biology, responding to cellular and environmental stimuli to regulate gene expression. Important advances have helped to determine the (near) complete repertoires of cellular RBPs. However, identification of RBPs associated with specific transcripts remains a challenge. Here, we describe “specific ribonucleoprotein (RNP) capture,” a versatile method for the determination of the proteins bound to specific transcripts in vitro and in cellular systems. Specific RNP capture uses UV irradiation to covalently stabilize protein–RNA interactions taking place at “zero distance.” Proteins bound to the target RNA are captured by hybridization with antisense locked nucleic acid (LNA)/DNA oligonucleotides covalently coupled to a magnetic resin. After stringent washing, interacting proteins are identified by quantitative mass spectrometry. Applied to in vitro extracts, specific RNP capture identifies the RBPs bound to a reporter mRNA containing the Sex-lethal (Sxl) binding motifs, revealing that the Sxl homolog sister of Sex lethal (Ssx) displays similar binding preferences. This method also revealed the repertoire of RBPs binding to 18S or 28S rRNAs in HeLa cells, including previously unknown rRNA-binding proteins. PMID:28476952

Specific RNP capture with antisense LNA/DNA mixmers.

PubMed

Rogell, Birgit; Fischer, Bernd; Rettel, Mandy; Krijgsveld, Jeroen; Castello, Alfredo; Hentze, Matthias W

2017-08-01

RNA-binding proteins (RBPs) play essential roles in RNA biology, responding to cellular and environmental stimuli to regulate gene expression. Important advances have helped to determine the (near) complete repertoires of cellular RBPs. However, identification of RBPs associated with specific transcripts remains a challenge. Here, we describe "specific ribonucleoprotein (RNP) capture," a versatile method for the determination of the proteins bound to specific transcripts in vitro and in cellular systems. Specific RNP capture uses UV irradiation to covalently stabilize protein-RNA interactions taking place at "zero distance." Proteins bound to the target RNA are captured by hybridization with antisense locked nucleic acid (LNA)/DNA oligonucleotides covalently coupled to a magnetic resin. After stringent washing, interacting proteins are identified by quantitative mass spectrometry. Applied to in vitro extracts, specific RNP capture identifies the RBPs bound to a reporter mRNA containing the Sex-lethal (Sxl) binding motifs, revealing that the Sxl homolog sister of Sex lethal (Ssx) displays similar binding preferences. This method also revealed the repertoire of RBPs binding to 18S or 28S rRNAs in HeLa cells, including previously unknown rRNA-binding proteins. © 2017 Rogell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Modulation of telomere binding proteins: a future area of research for skin protection and anti-aging target.

PubMed

Imbert, Isabelle; Botto, Jean-Marie; Farra, Claude D; Domloge, Nouha

2012-06-01

Telomere shortening is considered as one of the main characteristics of cellular aging by limiting cellular division. Besides the fundamental advances through the discoveries of telomere and telomerase, which were recognized by a Nobel Prize, telomere protection remains an essential area of research. Recently, it was evidenced that studying the cross-talks between the proteins associated with telomere should provide a better understanding of the mechanistic basis for telomere-associated aging phenotypes. In this review, we discuss the current knowledge on telomere shortening, telomerase activity, and the essential role of telomere binding proteins in telomere stabilization and telomere-end protection. This review highlights the capacity of telomere binding proteins to limit cellular senescence and to maintain skin tissue homeostasis, which is of key importance to reduce accelerated tissue aging. Future studies addressing telomere protection and limitation of DNA damage response in human skin should include investigations on telomere binding proteins. As little is known about the expression of telomere binding proteins in human skin and modulation of their expression with aging, it remains an interesting field of skin research and a key area for future skin protection and anti-aging developments. © 2012 Wiley Periodicals, Inc.

Discovery of small molecules binding to the normal conformation of prion by combining virtual screening and multiple biological activity evaluation methods

NASA Astrophysics Data System (ADS)

Li, Lanlan; Wei, Wei; Jia, Wen-Juan; Zhu, Yongchang; Zhang, Yan; Chen, Jiang-Huai; Tian, Jiaqi; Liu, Huanxiang; He, Yong-Xing; Yao, Xiaojun

2017-12-01

Conformational conversion of the normal cellular prion protein, PrPC, into the misfolded isoform, PrPSc, is considered to be a central event in the development of fatal neurodegenerative diseases. Stabilization of prion protein at the normal cellular form (PrPC) with small molecules is a rational and efficient strategy for treatment of prion related diseases. However, few compounds have been identified as potent prion inhibitors by binding to the normal conformation of prion. In this work, to rational screening of inhibitors capable of stabilizing cellular form of prion protein, multiple approaches combining docking-based virtual screening, steady-state fluorescence quenching, surface plasmon resonance and thioflavin T fluorescence assay were used to discover new compounds interrupting PrPC to PrPSc conversion. Compound 3253-0207 that can bind to PrPC with micromolar affinity and inhibit prion fibrillation was identified from small molecule databases. Molecular dynamics simulation indicated that compound 3253-0207 can bind to the hotspot residues in the binding pocket composed by β1, β2 and α2, which are significant structure moieties in conversion from PrPC to PrPSc.

Efficient delivery of cell impermeable phosphopeptides by a cyclic peptide amphiphile containing tryptophan and arginine.

PubMed

Nasrolahi Shirazi, Amir; Tiwari, Rakesh Kumar; Oh, Donghoon; Banerjee, Antara; Yadav, Arpita; Parang, Keykavous

2013-05-06

Phosphopeptides are valuable reagent probes for studying protein-protein and protein-ligand interactions. The cellular delivery of phosphopeptides is challenging because of the presence of the negatively charged phosphate group. The cellular uptake of a number of fluorescent-labeled phosphopeptides, including F'-GpYLPQTV, F'-NEpYTARQ, F'-AEEEIYGEFEAKKKK, F'-PEpYLGLD, F'-pYVNVQN-NH2, and F'-GpYEEI (F' = fluorescein), was evaluated in the presence or absence of a [WR]4, a cyclic peptide containing alternative arginine (R) and tryptophan (W) residues, in human leukemia cells (CCRF-CEM) after 2 h incubation using flow cytometry. [WR]4 improved significantly the cellular uptake of all phosphopeptides. PEpYLGLD is a sequence that mimics the pTyr1246 of ErbB2 that is responsible for binding to the Chk SH2 domain. The cellular uptake of F'-PEpYLGLD was enhanced dramatically by 27-fold in the presence of [WR]4 and was found to be time-dependent. Confocal microscopy of a mixture of F'-PEpYLGLD and [WR]4 in live cells exhibited intracellular localization and significantly higher cellular uptake compared to that of F'-PEpYLGLD alone. Transmission electron microscopy (TEM) and isothermal calorimetry (ITC) were used to study the interaction of PEpYLGLD and [WR]4. TEM results showed that the mixture of PEpYLGLD and [WR]4 formed noncircular nanosized structures with width and height of 125 and 60 nm, respectively. ITC binding studies confirmed the interaction between [WR]4 and PEpYLGLD. The binding isotherm curves, derived from sequential binding models, showed an exothermic interaction driven by entropy. These studies suggest that amphiphilic peptide [WR]4 can be used as a cellular delivery tool of cell-impermeable negatively charged phosphopeptides.

A core viral protein binds host nucleosomes to sequester immune danger signals

PubMed Central

Avgousti, Daphne C.; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J.; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C.; Blumenthal, Daniel; Paris, Andrew J.; Reyes, Emigdio D.; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H.; Worthen, G. Scott; Black, Ben E.; Garcia, Benjamin A.; Weitzman, Matthew D.

2016-01-01

Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses1. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important role in innate immune responses2. Viral encoded core basic proteins compact viral genomes but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones3. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles4,5, it is unknown whether protein VII impacts cellular chromatin. Our observation that protein VII alters cellular chromatin led us to hypothesize that this impacts antiviral responses during adenovirus infection. We found that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in chromatin of members of the high-mobility group protein B family (HMGB1, HMGB2, and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses6,7. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling. PMID:27362237

Effect of arginine methylation on the RNA recognition and cellular uptake of Tat-derived peptides.

PubMed

Li, Jhe-Hao; Chiu, Wen-Chieh; Yao, Yun-Chiao; Cheng, Richard P

2015-05-01

Arginine (Arg) methylation is a common post-translational modification that regulates gene expression and viral infection. The HIV-1 Tat protein is an essential regulatory protein for HIV proliferation, and is methylated in the cell. The basic region (residues 47-57) of the Tat protein contains six Arg residues, and is responsible for two biological functions: RNA recognition and cellular uptake. In this study, we explore the effect of three different methylation states at each Arg residue in Tat-derived peptides on the two biological functions. The Tat-derived peptides were synthesized by solid phase peptide synthesis. TAR RNA binding of the peptides was assessed by electrophoresis mobility shift assays. The cellular uptake of the peptides into Jurkat cells was determined by flow cytometry. Our results showed that RNA recognition was affected by both methylation state and position. In particular, asymmetric dimethylation at position 53 decreased TAR RNA binding affinity significantly, but unexpectedly less so upon asymmetric dimethylation at position 52. The RNA binding affinity even slightly increased upon methylation at some of the flanking Arg residues. Upon Arg methylation, the cellular uptake of Tat-derived peptides mostly decreased. Interestingly, cellular uptake of Tat-derived peptides with a single asymmetrically dimethylated Arg residue was similar to the native all Arg peptide (at 120 μM). Based on our results, TAR RNA binding apparently required both guanidinium terminal NH groups on Arg53, whereas cellular uptake apparently required guanidinium terminal NH₂ groups instead. These results should provide insight into how nature uses arginine methylation to regulate different biological functions, and should be useful for the development of functional molecules with methylated arginines. Copyright © 2015. Published by Elsevier Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alimirah, Fatouma; Peng, Xinjian; Yuan, Liang

Heterodimerization and cross-talk between nuclear hormone receptors often occurs. For example, estrogen receptor alpha (ER{alpha}) physically binds to peroxisome proliferator-activated receptor gamma (PPAR{gamma}) and inhibits its transcriptional activity. The interaction between PPAR{gamma} and the vitamin D receptor (VDR) however, is unknown. Here, we elucidate the molecular mechanisms linking PPAR{gamma} and VDR signaling, and for the first time we show that PPAR{gamma} physically associates with VDR in human breast cancer cells. We found that overexpression of PPAR{gamma} decreased 1{alpha},25-dihydroxyvitamin D{sub 3} (1,25D{sub 3}) mediated transcriptional activity of the vitamin D target gene, CYP24A1, by 49% and the activity of VDRE-luc, amore » vitamin D responsive reporter, by 75% in T47D human breast cancer cells. Deletion mutation experiments illustrated that helices 1 and 4 of PPAR{gamma}'s hinge and ligand binding domains, respectively, governed this suppressive function. Additionally, abrogation of PPAR{gamma}'s AF2 domain attenuated its repressive action on 1,25D{sub 3} transactivation, indicating that this domain is integral in inhibiting VDR signaling. PPAR{gamma} was also found to compete with VDR for their binding partner retinoid X receptor alpha (RXR{alpha}). Overexpression of RXR{alpha} blocked PPAR{gamma}'s suppressive effect on 1,25D{sub 3} action, enhancing VDR signaling. In conclusion, these observations uncover molecular mechanisms connecting the PPAR{gamma} and VDR pathways. -- Highlights: PPAR{gamma}'s role on 1{alpha},25-dihydroxyvitamin D{sub 3} transcriptional activity is examined. Black-Right-Pointing-Pointer PPAR{gamma} physically binds to VDR and inhibits 1{alpha},25-dihydroxyvitamin D{sub 3} action. Black-Right-Pointing-Pointer PPAR{gamma}'s hinge and ligand binding domains are important for this inhibitory effect. Black-Right-Pointing-Pointer PPAR{gamma} competes with VDR for the availability of their binding partner, RXR{alpha}.« less

Differential patterns of induction of NGFI-B, Nor1 and c-fos mRNAs in striatal subregions by haloperidol and clozapine.

PubMed

Werme, M; Ringholm, A; Olson, L; Brené, S

2000-04-28

Disturbances of retinoid activated transcription mechanisms have recently been implicated as risk factors for schizophrenia. In this study we have compared the regulation of mRNAs for the nuclear orphan receptor NGFI-B, which forms a functional heterodimer with the retinoid x receptor and the related orphan nuclear receptor Nor1 with c-fos mRNA after acute and chronic treatments with haloperidol and clozapine. The antipsychotic drugs haloperidol and clozapine have different clinical profiles. Haloperidol is a typical neuroleptic giving extrapyramidal side effects (EPS), whereas the atypical compound clozapine does not. Acute haloperidol treatment increased NGFI-B, Nor1 and c-fos mRNAs in nucleus accumbens shell and core as well as medial and lateral caudate putamen. In contrast, clozapine lead to an increase of NGFI-B, Nor1 and c-fos only in the accumbens shell. No haloperidol or clozapine effect on these mRNAs was detected in cingulate, sensory or motor cortex. Chronic haloperidol lead to an increase of NGFI-B mRNA in the accumbens core. Acutely, it is possible that the increased levels of NGFI-B, Nor1 and c-fos mRNA levels in striatum and accumbens might indicate a neural activation which possibly can be used when screening for drugs that do not produce EPS. Also, the increased levels of NGFI-B, which is an important component in retinoid signaling, both after acute and chronic treatments of haloperidol suggests altered sensitivity to retinoids which could be an important component for the beneficial antipsychotic effect.

Cross-linked matrix rigidity and soluble retinoids synergize in nuclear lamina regulation of stem cell differentiation.

PubMed

Ivanovska, Irena L; Swift, Joe; Spinler, Kyle; Dingal, Dave; Cho, Sangkyun; Discher, Dennis E

2017-07-07

Synergistic cues from extracellular matrix and soluble factors are often obscure in differentiation. Here the rigidity of cross-linked collagen synergizes with retinoids in the osteogenesis of human marrow mesenchymal stem cells (MSCs). Collagen nanofilms serve as a model matrix that MSCs can easily deform unless the film is enzymatically cross-linked, which promotes the spreading of cells and the stiffening of nuclei as both actomyosin assembly and nucleoskeletal lamin-A increase. Expression of lamin-A is known to be controlled by retinoic acid receptor (RAR) transcription factors, but soft matrix prevents any response to any retinoids. Rigid matrix is needed to induce rapid nuclear accumulation of the RARG isoform and for RARG-specific antagonist to increase or maintain expression of lamin-A as well as for RARG-agonist to repress expression. A progerin allele of lamin-A is regulated in the same manner in iPSC-derived MSCs. Rigid matrices are further required for eventual expression of osteogenic markers, and RARG-antagonist strongly drives lamin-A-dependent osteogenesis on rigid substrates, with pretreated xenografts calcifying in vivo to a similar extent as native bone. Proteomics-detected targets of mechanosensitive lamin-A and retinoids underscore the convergent synergy of insoluble and soluble cues in differentiation. © 2017 Ivanovska et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

A Microparticle/Hydrogel Combination Drug-Delivery System for Sustained Release of Retinoids

PubMed Central

Gao, Song-Qi; Maeda, Tadao; Okano, Kiichiro; Palczewski, Krzysztof

2012-01-01

Purpose. To design and develop a drug-delivery system containing a combination of poly(d,l-lactide-co-glycolide) (PLGA) microparticles and alginate hydrogel for sustained release of retinoids to treat retinal blinding diseases that result from an inadequate supply of retinol and generation of 11-cis-retinal. Methods. To study drug release in vivo, either the drug-loaded microparticle–hydrogel combination was injected subcutaneously or drug-loaded microparticles were injected intravitreally into Lrat−/− mice. Orally administered 9-cis-retinoids were used for comparison and drug concentrations in plasma were determined by HPLC. Electroretinography (ERG) and both chemical and histologic analyses were used to evaluate drug effects on visual function and morphology. Results. Lrat−/− mice demonstrated sustained drug release from the microparticle/hydrogel combination that lasted 4 weeks after subcutaneous injection. Drug concentrations in plasma of the control group treated with the same oral dose rose to higher levels for 6−7 hours but then dropped markedly by 24 hours. Significantly increased ERG responses and a markedly improved retinal pigmented epithelium (RPE)–rod outer segment (ROS) interface were observed after subcutaneous injection of the drug-loaded delivery combination. Intravitreal injection of just 2% of the systemic dose of drug-loaded microparticles provided comparable therapeutic efficacy. Conclusions. Sustained release of therapeutic levels of 9-cis-retinoids was achieved in Lrat−/− mice by subcutaneous injection in a microparticle/hydrogel drug-delivery system. Both subcutaneous and intravitreal injections of drug-loaded microparticles into Lrat−/− mice improved visual function and retinal structure. PMID:22918645

Feasibility of retinoids for the treatment of emphysema study.

PubMed

Roth, Michael D; Connett, John E; D'Armiento, Jeanine M; Foronjy, Robert F; Friedman, Paul J; Goldin, Jonathan G; Louis, Thomas A; Mao, Jenny T; Muindi, Josephia R; O'Connor, George T; Ramsdell, Joe W; Ries, Andrew L; Scharf, Steven M; Schluger, Neil W; Sciurba, Frank C; Skeans, Melissa A; Walter, Robert E; Wendt, Christine H; Wise, Robert A

2006-11-01

Retinoids promote alveolar septation in the developing lung and stimulate alveolar repair in some animal models of emphysema. One hundred forty-eight subjects with moderate-to-severe COPD and a primary component of emphysema, defined by diffusing capacity of the lung for carbon monoxide (Dlco) [37.1 +/- 12.0% of predicted] and CT density mask (38.5 +/- 12.8% of voxels <- 910 Hounsfield units) [mean +/- SD] were enrolled into a randomized, double-blind, feasibility study at five university hospitals. Participants received all-trans retinoic acid (ATRA) at either a low dose (LD) [1 mg/kg/d] or high dose (HD) [2 mg/kg/d], 13-cis retinoic acid (13-cRA) [1 mg/kg/d], or placebo for 6 months followed by a 3-month crossover period. No treatment was associated with an overall improvement in pulmonary function, CT density mask score, or health-related quality of life (QOL) at the end of 6 months. However, time-dependent changes in Dlco (initial decrease with delayed recovery) and St. George Respiratory Questionnaire (delayed improvement) were observed in the HD-ATRA cohort and correlated with plasma drug levels. In addition, 5 of 25 participants in the HD-ATRA group had delayed improvements in their CT scores that also related to ATRA levels. Retinoid-related side effects were common but generally mild. No definitive clinical benefits related to the administration of retinoids were observed in this feasibility study. However, time- and dose-dependent changes in Dlco, CT density mask score, and health-related QOL were observed in subjects treated with ATRA, suggesting the possibility of exposure-related biological activity that warrants further investigation.

UV-induced isomerization of oral retinoids in vitro and in vivo in hairless mice.

PubMed

Berne, B; Rollman, O; Vahlquist, A

1990-08-01

Ultraviolet (UV) irradiation causes isomerization and destruction of many vitamin A analogues (retinoids). Using high-performance liquid chromatography (HPLC), we investigated in vitro and in vivo the effects of UV irradiation on 2 all-trans aromatic retinoids (etretinate and acitretin) and on 13-cis retinoic acid (isotretinoin). When etretinate and acitretin dissolved in ethanol were irradiated with UVB (280-320 nm; 10-336 mJ/cm2) or UVA (320-400 nm; 1-5 J/cm2), extensive and reproducible cis-isomerizations occurred at the 13-position (cis/trans ratio approximately 1.6 in all experiments) but there was no progressive photodegradation of the molecules. Irradiation of isotretinoin produced only moderate trans-isomerization but the sum of HPLC peak heights fell with increasing UV doses, being 72% of the original value after 336 mJ/cm2 of UVB. Hairless mice were given etretinate (50 mg/kg bw), acitretin (200 mg/kg) or isotretinoin (50 mg/kg) on days 1, 4 and 7 and were irradiated daily for 8 d with 13 mJ/cm2 UVB plus 1 J/cm2 UVA. Samples of serum, dorsal skin and liver were collected and retinoids analyzed by HPLC. In the etretinate and acitretin-treated, irradiated animals the serum concentrations of the 13-cis isomers were 2-6 times higher than in nonirradiated controls. Irradiated epidermis also contained significantly higher concentrations of 13-cis etretinate and 13-cis acitretin than did control epidermis. The serum and epidermal concentrations of all-trans etretinate and acitretin were unchanged or even increased after irradiation.(ABSTRACT TRUNCATED AT 250 WORDS)

Genome-wide localization and expression profiling establish Sp2 as a sequence-specific transcription factor regulating vitally important genes

PubMed Central

Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram

2012-01-01

The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502

Binding affinity of amyloid oligomers to cellular membranes is a generic indicator of cellular dysfunction in protein misfolding diseases

PubMed Central

Evangelisti, Elisa; Cascella, Roberta; Becatti, Matteo; Marrazza, Giovanna; Dobson, Christopher M.; Chiti, Fabrizio; Stefani, Massimo; Cecchi, Cristina

2016-01-01

The conversion of peptides or proteins from their soluble native states into intractable amyloid deposits is associated with a wide range of human disorders. Misfolded protein oligomers formed during the process of aggregation have been identified as the primary pathogenic agents in many such conditions. Here, we show the existence of a quantitative relationship between the degree of binding to neuronal cells of different types of oligomers formed from a model protein, HypF-N, and the GM1 content of the plasma membranes. In addition, remarkably similar behavior is observed for oligomers of the Aβ42 peptide associated with Alzheimer’s disease. Further analysis has revealed the existence of a linear correlation between the level of the influx of Ca2+ across neuronal membranes that triggers cellular damage, and the fraction of oligomeric species bound to the membrane. Our findings indicate that the susceptibility of neuronal cells to different types of misfolded oligomeric assemblies is directly related to the extent of binding of such oligomers to the cellular membrane. PMID:27619987

Effects of different transferrin forms on transferrin receptor expression, iron uptake, and cellular proliferation of human leukemic HL60 cells. Mechanisms responsible for the specific cytotoxicity of transferrin-gallium.

PubMed Central

Chitambar, C R; Seligman, P A

1986-01-01

We have previously shown that human leukemic cells proliferate normally in serum-free media containing various transferrin forms, but the addition of transferrin-gallium leads to inhibition of cellular proliferation. Because gallium has therapeutic potential, the effects of transferrin-gallium on leukemic cell proliferation, transferrin receptor expression, and cellular iron utilization were studied. The cytotoxicity of gallium is considerably enhanced by its binding to transferrin and cytotoxicity can be reversed by transferrin-iron but not by other transferrin forms. Exposure to transferrin-gallium leads to a marked increase in cell surface transferrin binding sites, but despite this, cellular 59Fe incorporation is inappropriately low. Although shunting of transferrin-gallium to another cellular compartment has not been ruled out, other studies suggest that transferrin-gallium impairs intracellular release of 59Fe from transferrin by interfering with processes responsible for intracellular acidification. These studies, taken together, demonstrate that inhibition of cellular iron incorporation by transferrin-gallium is a prerequisite for inhibition of cellular proliferation. PMID:3465751

Human adenovirus serotypes 3 and 5 bind to two different cellular receptors via the fiber head domain.

PubMed Central

Stevenson, S C; Rollence, M; White, B; Weaver, L; McClelland, A

1995-01-01

The adenovirus fiber protein is responsible for attachment of the virion to cell surface receptors. The identity of the cellular receptor which mediates binding is unknown, although there is evidence suggesting that two distinct adenovirus receptors interact with the group C (adenovirus type 5 [Ad5]) and the group B (Ad3) adenoviruses. In order to define the determinants of adenovirus receptor specificity, we have carried out a series of competition binding experiments using recombinant native fiber polypeptides from Ad5 and Ad3 and chimeric fiber proteins in which the head domains of Ad5 and Ad3 were exchanged. Specific binding of fiber to HeLa cell receptors was assessed with radiolabeled protein synthesized in vitro, and by competition analysis with baculovirus-expressed fiber protein. Fiber produced in vitro was found as both monomer and trimer, but only the assembled trimers had receptor binding activity. Competition data support the conclusion that Ad5 and Ad3 interact with different cellular receptors. The Ad5 receptor distribution on several cell lines was assessed with a fiber binding flow cytometric assay. HeLa cells were found to express high levels of receptor, while CHO and human diploid fibroblasts did not. A chimeric fiber containing the Ad5 fiber head domain blocked the binding of Ad5 fiber but not Ad3 fiber. Similarly, a chimeric fiber containing the Ad3 fiber head blocked the binding of labeled Ad3 fiber but not Ad5 fiber. In addition, the isolated Ad3 fiber head domain competed effectively with labeled Ad3 fiber for binding to HeLa cell receptors. These results demonstrate that the determinants of receptor binding are located in the head domain of the fiber and that the isolated head domain is capable of trimerization and binding to cellular receptors. Our results also show that it is possible to change the receptor specificity of the fiber protein by manipulation of sequences contained in the head domain. Modification or replacement of the fiber head domain with novel ligands may permit adenovirus vectors with new receptor specificities which could be useful for targeted gene delivery in vivo to be engineered. PMID:7707507

Role of the histone deacetylase complex in acute promyelocytic leukaemia.

PubMed

Lin, R J; Nagy, L; Inoue, S; Shao, W; Miller, W H; Evans, R M

1998-02-19

Non-liganded retinoic acid receptors (RARs) repress transcription of target genes by recruiting the histone deacetylase complex through a class of silencing mediators termed SMRT or N-CoR. Mutant forms of RARalpha, created by chromosomal translocations with either the PML (for promyelocytic leukaemia) or the PLZF (for promyelocytic leukaemia zinc finger) locus, are oncogenic and result in human acute promyelocytic leukaemia (APL). PML-RARalpha APL patients achieve complete remission following treatments with pharmacological doses of retinoic acids (RA); in contrast, PLZF-RARalpha patients respond very poorly, if at all. Here we report that the association of these two chimaeric receptors with the histone deacetylase (HDAC) complex helps to determine both the development of APL and the ability of patients to respond to retinoids. Consistent with these observations, inhibitors of histone deacetylase dramatically potentiate retinoid-induced differentiation of RA-sensitive, and restore retinoid responses of RA-resistant, APL cell lines. Our findings suggest that oncogenic RARs mediate leukaemogenesis through aberrant chromatin acetylation, and that pharmacological manipulation of nuclear receptor co-factors may be a useful approach in the treatment of human disease.

The negligible systemic availability of retinoids with multiple and excessive topical application of isotretinoin 0.05% gel (Isotrex) in patients with acne vulgaris.

PubMed

Jensen, B K; McGann, L A; Kachevsky, V; Franz, T J

1991-03-01

The potential systemic availability of retinoids from topically applied isotretinoin was assessed in 12 men with acne vulgaris. Isotretinoin 0.05% gel was applied to patients at a daily dose of 20 gm (equivalent to 10 mg of isotretinoin) over a 1900 cm2 surface area of skin on the face, back, and chest for 30 days. Blood samples were collected throughout the study and up to 48 hours after the last topical application; they were assayed for isotretinoin, tretinoin, and 4-oxo-isotretinoin by specific high-performance liquid chromatography. Plasma concentrations of isotretinoin, tretinoin, and 4-oxo-isotretinoin were not measurable (less than 20 ng/ml) at any time. Most adverse experiences were cutaneous; a few systemic adverse experiences were judged to be remotely related to topical drug administration. The lack of measurable plasma concentrations of isotretinoin, tretinoin, or 4-oxo-isotretinoin and systemic adverse experiences indicates negligible systemic availability of retinoids even after multiple application of isotretinoin 0.05% gel at doses approximately 12 times greater than normal daily use.

Pathogenesis of Zika Virus-Associated Embryopathy

PubMed Central

Mawson, Anthony R.

2016-01-01

Abstract A strong causal association has become evident between Zika virus (ZIKV) infection during pregnancy and the occurrence of fetal growth restriction, microcephaly and eye defects. Circumstantial evidence is presented in this paper in support of the hypothesis that these effects, as well as the Guillain-Barré syndrome, are due to an endogenous form of hypervitaminosis A resulting from ZIKV infection-induced damage to the liver and the spillage of stored vitamin A compounds (“retinoids”) into the maternal and fetal circulation in toxic concentrations. Retinoids are mainly stored in the liver (about 80%) and are essential for numerous biological functions. In higher concentration, retinoids are potentially cytotoxic, pro-oxidant, mutagenic and teratogenic, especially if sudden shifts occur in their bodily distribution. Although liver involvement has not been mentioned specifically in recent reports, conventional liver enzyme tests underestimate the true extent of liver dysfunction. The proposed model could be tested by comparing retinoid concentration and expression profiles in microcephalic newborns of ZIKV-infected mothers and nonmicrocephalic newborn controls, and by correlating these profiles with measures of clinical severity. PMID:27403405

NR4A orphan nuclear receptors influence retinoic acid and docosahexaenoic acid signaling via up-regulation of fatty acid binding protein 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volakakis, Nikolaos; Joodmardi, Eliza; Perlmann, Thomas, E-mail: thomas.perlmann@licr.ki.se

2009-12-25

The orphan nuclear receptor (NR) Nurr1 is expressed in the developing and adult nervous system and is also induced as an immediate early gene in a variety of cell types. In silico analysis of human promoters identified fatty acid binding protein 5 (FABP5), a protein shown to enhance retinoic acid-mediated PPAR{beta}/{delta} signaling, as a potential Nurr1 target gene. Nurr1 has previously been implicated in retinoid signaling via its heterodimerization partner RXR. Since NRs are commonly involved in cross-regulatory control we decided to further investigate the regulatory relationship between Nurr1 and FABP5. FABP5 expression was up-regulated by Nurr1 and other NR4Amore » NRs in HEK293 cells, and Nurr1 was shown to activate and bind to the FABP5 promoter, supporting that FABP5 is a direct downstream target of NR4A NRs. We also show that the RXR ligand docosahexaenoic acid (DHA) can induce nuclear translocation of FABP5. Moreover, via up-regulation of FABP5 Nurr1 can enhance retinoic acid-induced signaling of PPAR{beta}/{delta} and DHA-induced activation of RXR. We also found that other members of the NR4A orphan NRs can up-regulate FABP5. Thus, our findings suggest that NR4A orphan NRs can influence signaling events of other NRs via control of FABP5 expression levels.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Wenfei; Wang, Ying; Wang, Nianshuang

Middle East respiratory syndrome coronavirus (MERS-CoV) infects host cells through binding the receptor binding domain (RBD) on its spike glycoprotein to human receptor dipeptidyl peptidase 4 (hDPP4). Here, we report identification of critical residues on hDPP4 for RBD binding and virus entry through analysis of a panel of hDPP4 mutants. Based on the RBD–hDPP4 crystal structure we reported, the mutated residues were located at the interface between RBD and hDPP4, which potentially changed the polarity, hydrophobic or hydrophilic properties of hDPP4, thereby interfering or disrupting their interaction with RBD. Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay,more » we showed that several residues in hDPP4–RBD binding interface were important on hDPP4–RBD binding and viral entry. These results provide atomic insights into the features of interactions between hDPP4 and MERS-CoV RBD, and also provide potential explanation for cellular and species tropism of MERS-CoV infection. - Highlights: • It has been demonstrated that MERS-CoV infects host cells through binding its envelope spike (S) glycoprotein to the host cellular receptor dipeptidyl peptidase 4 (DPP4). • To identify the critical residues on hDPP4 for RBD binding and virus entry, we constructed a panel of hDPP4 mutants based on structure-guided mutagenesis. • Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay, we showed that several residues on hDPP4 had significant impacts on virus/receptor interactions and viral entry. • Our study has provided new insights into the features of interactions between hDPP4 and MERS-CoV RBD, and provides potential explanation for cellular and species tropism of MERS-CoV infection.« less

The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity

PubMed Central

Shewell, Lucy K.; Harvey, Richard M.; Higgins, Melanie A.; Day, Christopher J.; Hartley-Tassell, Lauren E.; Chen, Austen Y.; Gillen, Christine M.; James, David B. A.; Alonzo, Francis; Torres, Victor J.; Walker, Mark J.; Paton, Adrienne W.; Paton, James C.; Jennings, Michael P.

2014-01-01

The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a Kd of 1.88 × 10−5 M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism. PMID:25422425

The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity.

PubMed

Shewell, Lucy K; Harvey, Richard M; Higgins, Melanie A; Day, Christopher J; Hartley-Tassell, Lauren E; Chen, Austen Y; Gillen, Christine M; James, David B A; Alonzo, Francis; Torres, Victor J; Walker, Mark J; Paton, Adrienne W; Paton, James C; Jennings, Michael P

2014-12-09

The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a K(d) of 1.88 × 10(-5) M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism.

Insulin-Like Growth Factor Binding Proteins Increase Intracellular Calcium Levels in Two Different Cell Lines

PubMed Central

Seurin, Danielle; Lombet, Alain; Babajko, Sylvie; Godeau, François; Ricort, Jean-Marc

2013-01-01

Background Insulin-like growth factor binding proteins (IGFBPs) are six related secreted proteins that share IGF-dependent and -independent functions. If the former functions begin to be well described, the latter are somewhat more difficult to investigate and to characterize. At the cellular level, IGFBPs were shown to modulate numerous processes including cell growth, differentiation and apoptosis. However, the molecular mechanisms implicated remain largely unknown. We previously demonstrated that IGFBP-3, but not IGFBP-1 or IGFBP-5, increase intracellular calcium concentration in MCF-7 cells (Ricort J-M et al. (2002) FEBS lett 527: 293–297). Methodology/Principal Findings We perform a global analysis in which we studied, by two different approaches, the binding of each IGFBP isoform (i.e., IGFBP-1 to -6) to the surface of two different cellular models, MCF-7 breast adenocarcinoma cells and C2 myoblast proliferative cells, as well as the IGFBP-induced increase of intracellular calcium concentration. Using both confocal fluorescence microscopy and flow cytometry analysis, we showed that all IGFBPs bind to MCF-7 cell surface. By contrast, only four IGFBPs can bind to C2 cell surface since neither IGFBP-2 nor IGFBP-4 were detected. Among the six IGFBPs tested, only IGFBP-1 did not increased intracellular calcium concentration whatever the cellular model studied. By contrast, IGFBP-2, -3, -4 and -6, in MCF-7 cells, and IGFBP-3, -5 and -6, in C2 proliferative cells, induce a rapid and transient increase in intracellular free calcium concentration. Moreover, IGFBP-2 and -3 (in MCF-7 cells) and IGFBP-5 (in C2 cells) increase intracellular free calcium concentration by a pertussis toxin sensitive signaling pathway. Conclusions Our results demonstrate that IGFBPs are able to bind to cell surface and increase intracellular calcium concentration. By characterizing the IGFBPs-induced cell responses and intracellular couplings, we highlight the cellular specificity and complexity of the IGF-independent actions of these IGF binding proteins. PMID:23527161

Computational membrane biophysics: From ion channel interactions with drugs to cellular function.

PubMed

Miranda, Williams E; Ngo, Van A; Perissinotti, Laura L; Noskov, Sergei Yu

2017-11-01

The rapid development of experimental and computational techniques has changed fundamentally our understanding of cellular-membrane transport. The advent of powerful computers and refined force-fields for proteins, ions, and lipids has expanded the applicability of Molecular Dynamics (MD) simulations. A myriad of cellular responses is modulated through the binding of endogenous and exogenous ligands (e.g. neurotransmitters and drugs, respectively) to ion channels. Deciphering the thermodynamics and kinetics of the ligand binding processes to these membrane proteins is at the heart of modern drug development. The ever-increasing computational power has already provided insightful data on the thermodynamics and kinetics of drug-target interactions, free energies of solvation, and partitioning into lipid bilayers for drugs. This review aims to provide a brief summary about modeling approaches to map out crucial binding pathways with intermediate conformations and free-energy surfaces for drug-ion channel binding mechanisms that are responsible for multiple effects on cellular functions. We will discuss post-processing analysis of simulation-generated data, which are then transformed to kinetic models to better understand the molecular underpinning of the experimental observables under the influence of drugs or mutations in ion channels. This review highlights crucial mathematical frameworks and perspectives on bridging different well-established computational techniques to connect the dynamics and timescales from all-atom MD and free energy simulations of ion channels to the physiology of action potentials in cellular models. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

In Silico Prediction and In Vitro Characterization of Multifunctional Human RNase3

PubMed Central

Kuo, Ping-Hsueh; Chen, Chien-Jung; Chang, Hsiu-Hui; Fang, Shun-lung; Wu, Wei-Shuo; Lai, Yiu-Kay; Pai, Tun-Wen; Chang, Margaret Dah-Tsyr

2013-01-01

Human ribonucleases A (hRNaseA) superfamily consists of thirteen members with high-structure similarities but exhibits divergent physiological functions other than RNase activity. Evolution of hRNaseA superfamily has gained novel functions which may be preserved in a unique region or domain to account for additional molecular interactions. hRNase3 has multiple functions including ribonucleolytic, heparan sulfate (HS) binding, cellular binding, endocytic, lipid destabilization, cytotoxic, and antimicrobial activities. In this study, three putative multifunctional regions, 34RWRCK38 (HBR1), 75RSRFR79 (HBR2), and 101RPGRR105 (HBR3), of hRNase3 have been identified employing in silico sequence analysis and validated employing in vitro activity assays. A heparin binding peptide containing HBR1 is characterized to act as a key element associated with HS binding, cellular binding, and lipid binding activities. In this study, we provide novel insights to identify functional regions of hRNase3 that may have implications for all hRNaseA superfamily members. PMID:23484086

FK506-Binding Proteins and Their Diverse Functions.

PubMed

Tong, Mingming; Jiang, Yu

2015-01-01

FK506 binding proteins (FKBPs) are a family of highly conserved proteins in eukaryotes. The prototype of this protein family, FKBP12, is the binding partner for immunosuppressive drugs FK506 and rapamycin. FKBP12 functions as a cis/trans peptidyl prolyl isomerase (PPIase) that catalyzes interconversion between prolyl cis/trans conformations. Members of the FKBP family contain one or several PPIase domains, which do not always exhibit PPIase activity yet are all essential for their function. FKBPs are involved in diverse cellular functions including protein folding, cellular signaling, apoptosis and transcription. They elicit their function through direct binding and altering conformation of their target proteins, hence acting as molecular switches. In this review, we provide a general summary for the structures and diverse functions of FKBPs found in mammalian cells.

Noninvasive multi–photon fluorescence microscopy resolves retinol and retinal–condensation products in mouse eyes

PubMed Central

Palczewska, Grazyna; Maeda, Tadao; Imanishi, Yoshikazu; Sun, Wenyu; Chen, Yu; Williams, David R.; Piston, David; Maeda, Akiko; Palczewski, Krzysztof

2010-01-01

Multi–photon excitation fluorescence microscopy (MPM) can image certain molecular processes in vivo. In the eye, fluorescent retinyl esters in sub–cellular structures called retinosomes mediate regeneration of the visual chromophore, 11–cis–retinal, by the visual cycle. But harmful fluorescent condensation products were also identified previously. We report that in wild type mice, excitation with λ ~730 nm identified retinosomes in the retinal pigment epithelium, whereas excitation with λ ~910 nm revealed at least one additional retinal fluorophore. The latter fluorescence was absent in eyes of genetically modified mice lacking a functional visual cycle, but accentuated in eyes of older WT mice and mice with defective clearance of all–trans–retinal, an intermediate in the visual cycle. MPM, a noninvasive imaging modality that facilitates concurrent monitoring of retinosomes along with potentially harmful products in aging eyes, has the potential to detect early molecular changes due to age–related macular degeneration and other defects in retinoid metabolism. PMID:21076393

Biochemical, histological and behavioural aspects of visual function during early development of rainbow trout

USGS Publications Warehouse

Carvalho, Paulo S. M.; Noltie, Douglas B.; Tillitt, D.E.

2004-01-01

Retinal structure and concentration of retinoids involved in phototransduction changed during early development of rainbow trout Oncorhynchus mykiss, correlating with improvements in visual function. A test chamber was used to evaluate the presence of optokinetic or optomotor responses and to assess the functionality of the integrated cellular, physiological and biochemical components of the visual system. The results indicated that in rainbow trout optomotor responses start at 10 days post-hatch, and demonstrated for the first time that increases in acuity, sensitivity to low light as well as in motion detection abilities occur from this stage until exogenous feeding starts. The structure of retinal cells such as cone ellipsoids increased in length as photopic visual acuity improved, and rod densities increased concurrently with improvements in scotopic thresholds (2.2 log10 units). An increase in the concentrations of the chromophore all-trans-retinal correlated with improvements of all behavioural measures of visual function during the same developmental phase. ?? 2004 The Fisheries Society of the British Isles.

Involvement of SREBPs in 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced disruption of lipid metabolism in male guinea pig

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishiumi, Shin; Yabushita, Yoshiyuki; Furuyashiki, Takashi

2008-06-15

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has multiple toxic effects causing a wasting syndrome characterized by a loss of body weight accompanied by a decrease in adipose tissue weight. To elucidate the mechanism behind this syndrome, we investigated the changes in lipid metabolism 7 and 21 days after a single intraperitoneal injection of TCDD at 1 {mu}g/kg body weight to male guinea pigs. TCDD caused the symptoms of the syndrome, body weight loss with a decrease in adipose tissue weight, while it increased the levels of triacylglycerols, total cholesterols, and free fatty acids in plasma. On day 7, TCDD decreased the levels of CCAAT/enhancermore » binding protein (C/EBP) {alpha}, peroxisome proliferator activated receptor {gamma}, and glucose transporter 4, adipogenesis-related factors, in adipose tissue, whereas the levels of retinoid X receptor {alpha}, C/EBP{beta}, C/EBP{delta}, and c-Myc remained unchanged. TCDD also reduced the levels of both p125 precursor and p68 active forms of sterol regulatory element binding protein (SREBP)-1 and -2, the lypogenesis-related factors, and downregulated their DNA binding activity in adipose tissue, while it raised the levels of their p68 active forms and increased their DNA binding activity in the liver. TCDD decreased mRNA and protein levels of acetyl-CoA carboxylase and HMG-CoA synthase in the liver and adipose tissue. Similar results were obtained on day 21. These results suggest that TCDD disrupts lipid metabolism through changes in the expression levels of the adipogenesis-related and lipogenesis-related proteins in the liver and adipose tissue, and SREBPs would be involved in the development of the wasting syndrome.« less

Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity[S

PubMed Central

Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C.; MacPherson, Laura; Ruan, Hai-Bin; Wu, Jing; Pedersen, Thomas Å.; Steffensen, Knut R.; Yang, Xiaoyong; Matthews, Jason; Mandrup, Susanne; Nebb, Hilde I.; Grønning-Wang, Line M.

2015-01-01

Liver X receptor (LXR)α and LXRβ play key roles in hepatic de novo lipogenesis through their regulation of lipogenic genes, including sterol regulatory element-binding protein (SREBP)-1c and carbohydrate responsive element-binding protein (ChREBP). LXRs activate lipogenic gene transcription in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin-independent effects of feeding on LXR-mediated lipogenic gene expression in vivo, we subjected control and streptozotocin-treated LXRα/β+/+ and LXRα/β−/− mice to a fasting-refeeding regime. We show that under hyperglycemic and hypoinsulinemic conditions, LXRs maintain their ability to upregulate the expression of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose metabolic sensors upstream of ChREBP by modulating GK expression, nuclear O-GlcNAc signaling, and ChREBP expression and activity. PMID:25724563

Regulatory RNA binding proteins contribute to the transcriptome-wide splicing alterations in human cellular senescence.

PubMed

Dong, Qiongye; Wei, Lei; Zhang, Michael Q; Wang, Xiaowo

2018-06-24

Dysregulation of mRNA splicing has been observed in certain cellular senescence process. However, the common splicing alterations on the whole transcriptome shared by various types of senescence are poorly understood. In order to systematically identify senescence-associated transcriptomic changes in genome-wide scale, we collected RNA sequencing datasets of different human cell types with a variety of senescence-inducing methods from public databases and performed meta-analysis. First, we discovered that a group of RNA binding proteins were consistently down-regulated in diverse senescent samples and identified 406 senescence-associated common differential splicing events. Then, eight differentially expressed RNA binding proteins were predicted to regulate these senescence-associated splicing alterations through an enrichment analysis of their RNA binding information, including motif scanning and enhanced cross-linking immunoprecipitation data. In addition, we constructed the splicing regulatory modules that might contribute to senescence-associated biological processes. Finally, it was confirmed that knockdown of the predicted senescence-associated potential splicing regulators through shRNAs in HepG2 cell line could result in senescence-like splicing changes. Taken together, our work demonstrated a broad range of common changes in mRNA splicing switches and detected their central regulatory RNA binding proteins during senescence. These findings would help to better understand the coordinating splicing alterations in cellular senescence.

From receptor binding kinetics to signal transduction; a missing link in predicting in vivo drug-action.

PubMed

Nederpelt, Indira; Kuzikov, Maria; de Witte, Wilbert E A; Schnider, Patrick; Tuijt, Bruno; Gul, Sheraz; IJzerman, Adriaan P; de Lange, Elizabeth C M; Heitman, Laura H

2017-10-26

An important question in drug discovery is how to overcome the significant challenge of high drug attrition rates due to lack of efficacy and safety. A missing link in the understanding of determinants for drug efficacy is the relation between drug-target binding kinetics and signal transduction, particularly in the physiological context of (multiple) endogenous ligands. We hypothesized that the kinetic binding parameters of both drug and endogenous ligand play a crucial role in determining cellular responses, using the NK1 receptor as a model system. We demonstrated that the binding kinetics of both antagonists (DFA and aprepitant) and endogenous agonists (NKA and SP) have significantly different effects on signal transduction profiles, i.e. potency values, in vitro efficacy values and onset rate of signal transduction. The antagonistic effects were most efficacious with slowly dissociating aprepitant and slowly associating NKA while the combination of rapidly dissociating DFA and rapidly associating SP had less significant effects on the signal transduction profiles. These results were consistent throughout different kinetic assays and cellular backgrounds. We conclude that knowledge of the relationship between in vitro drug-target binding kinetics and cellular responses is important to ultimately improve the understanding of drug efficacy in vivo.

High vascular delivery of EGF, but low receptor binding rate is observed in AsPC-1 tumors as compared to normal pancreas.

PubMed

Samkoe, Kimberley S; Sexton, Kristian; Tichauer, Kenneth M; Hextrum, Shannon K; Pardesi, Omar; Davis, Scott C; O'Hara, Julia A; Hoopes, P Jack; Hasan, Tayyaba; Pogue, Brian W

2012-08-01

Cellular receptor targeted imaging agents present the potential to target extracellular molecular expression in cancerous lesions; however, the image contrast in vivo does not reflect the magnitude of overexpression expected from in vitro data. Here, the in vivo delivery and binding kinetics of epidermal growth factor receptor (EGFR) was determined for normal pancreas and AsPC-1 orthotopic pancreatic tumors known to overexpress EGFR. EGFR in orthotopic xenograft AsPC-1 tumors was targeted with epidermal growth factor (EGF) conjugated with IRDye800CW. The transfer rate constants (k(e), K₁₂, k₂₁, k₂₃, and k₃₂) associated with a three-compartment model describing the vascular delivery, leakage rate and binding of targeted agents were determined experimentally. The plasma excretion rate, k (e), was determined from extracted blood plasma samples. K₁₂, k₂₁, and k₃₂ were determined from ex vivo tissue washing studies at time points ≥ 24 h. The measured in vivo uptake of IRDye800CW-EGF and a non-targeted tracer dye, IRDye700DX-carboxylate, injected simultaneously was used to determined k₂₃. The vascular exchange of IRDye800CW-EGF in the orthotopic tumor (K₁₂ and k₂₁) was higher than in the AsPC-1 tumor as compared to normal pancreas, suggesting that more targeted agent can be taken up in tumor tissue. However, the cellular associated (binding) rate constant (k₂₃) was slightly lower for AsPC-1 pancreatic tumor (4.1 × 10(-4) s(-1)) than the normal pancreas (5.5 × 10(-4) s(-1)), implying that less binding is occurring. Higher vascular delivery but low cellular association in the AsPC-1 tumor compared to the normal pancreas may be indicative of low receptor density due to low cellular content. This attribute of the AsPC-1 tumor may indicate one contributing cause of the difficulty in treating pancreatic tumors with cellular targeted agents.

Clindamycin phosphate 1.2% / tretinoin 0.025%: a novel fixed-dose combination treatment for acne vulgaris.

PubMed

Ochsendorf, F

2015-06-01

The Global Alliance to Improve Outcomes in Acne Group recommends retinoid-based combination therapy as first-line therapy and the preferred treatment approach for almost all acne patients except those with the most severe disease. Clindamycin 1% (as clindamycin phosphate 1.2%)/tretinoin 0.025% (Clin-RA) is a new fixed-dose retinoid-based combination therapy. The aqueous-based gel formulation of Clin-RA was designed to minimize skin irritation and optimize adherence with the therapy. It contains both solubilized and crystalline tretinoin which allows the retinoid to be slowly released onto the skin surface and decreases the potential for cutaneous irritation. A pooled analysis of three pivotal studies involving 4550 acne patients showed that Clin-RA is well tolerated and effective at treating both inflammatory and non-inflammatory acne lesions. The onset of action of Clin-RA is rapid occurring within 2 weeks of treatment initiation. It is not associated with acne flaring or an increase in clindamycin-resistant Propionibacterium acnes counts. Clin-RA is considered as effective as adapalene 0.1%/benzoyl peroxide (BPO) 2.5%, whereas Clin-RA has a more favourable tolerability profile. Clin-RA may be more effective than clindamycin 1%/BPO 5% at treating non-inflammatory acne lesions since the latter does not contain a retinoid to target comedones. Clin-RA is also easy for patients to handle and apply, and has the advantage of not containing BPO which can bleach hair and fabrics. Taken together, the profile of Clin-RA suggests Clin-RA to be a first-line treatment for patients with facial acne. © 2015 European Academy of Dermatology and Venereology.

Combination therapy with retinaldehyde (0.1%) glycolic acid (6%) and efectiose (0.1%) in mild to moderate acne vulgaris during the period of sun exposure--efficacy and skin tolerability.

PubMed

Masini, F; Ricci, F; Fossati, B; Frascione, P; Capizzi, R; De Waure, C; Guerriero, C

2014-08-01

Acne vulgaris is the most common disease of the adolescence age (70-94%). Main topical treatments for acne vulgaris are retinoids, benzoyl peroxide and antibiotics in mono or combination therapy. Topical retinoids, some antibiotics and antiseptics although effective on acne lesions, can due photosensitivity or make the skin more sensitive to the sun. Our study is aimed to evaluate the efficacy and tolerability of a combination therapy with Retinaldheyde (0.1%), Glycolic acid (6%) and Efectiose (0.1%) (RGE) cream in patients affected by acne vulgaris, during the lasting period of sun exposure. We retrospectively observed 30 patients of Central Italy with mild or moderate acne between April and September. All the patients selected underwent only therapy with RGE cream once a day in the evening for 8 weeks, while in the morning they just applied SPF 50 sunscreen. We evaluate the efficacy at 30 and 60 days with the "Global Evaluation Scale" (GES) and the tolerability with a 0-3 qualitative scale. The mean GES value showed a statistically significant reduction: 1.83 (SD 0.83) at baseline 1.57 (SD 0.77) and 0.90 (SD 0.76) respectively at 30 and 60 days (p < 0.01). Side effects were very uncommon. Topical treatments with retinoids, antibiotics and antiseptics can be associated with an increased occurrence of facial dryness and erythema restricting their use in sun exposure period. RGE cream has shown a good skin tolerability and efficacy, so it can be considerate an effective maintaining therapy to treat mild to moderate acne during the sun exposure period in which retinoids, antibiotics or antiseptic treatments are not recommended.

Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics

PubMed Central

Cideciyan, Artur V.; Aleman, Tomas S.; Boye, Sanford L.; Schwartz, Sharon B.; Kaushal, Shalesh; Roman, Alejandro J.; Pang, Ji-jing; Sumaroka, Alexander; Windsor, Elizabeth A. M.; Wilson, James M.; Flotte, Terence R.; Fishman, Gerald A.; Heon, Elise; Stone, Edwin M.; Byrne, Barry J.; Jacobson, Samuel G.; Hauswirth, William W.

2008-01-01

The RPE65 gene encodes the isomerase of the retinoid cycle, the enzymatic pathway that underlies mammalian vision. Mutations in RPE65 disrupt the retinoid cycle and cause a congenital human blindness known as Leber congenital amaurosis (LCA). We used adeno-associated virus-2-based RPE65 gene replacement therapy to treat three young adults with RPE65-LCA and measured their vision before and up to 90 days after the intervention. All three patients showed a statistically significant increase in visual sensitivity at 30 days after treatment localized to retinal areas that had received the vector. There were no changes in the effect between 30 and 90 days. Both cone- and rod-photoreceptor-based vision could be demonstrated in treated areas. For cones, there were increases of up to 1.7 log units (i.e., 50 fold); and for rods, there were gains of up to 4.8 log units (i.e., 63,000 fold). To assess what fraction of full vision potential was restored by gene therapy, we related the degree of light sensitivity to the level of remaining photoreceptors within the treatment area. We found that the intervention could overcome nearly all of the loss of light sensitivity resulting from the biochemical blockade. However, this reconstituted retinoid cycle was not completely normal. Resensitization kinetics of the newly treated rods were remarkably slow and required 8 h or more for the attainment of full sensitivity, compared with <1 h in normal eyes. Cone-sensitivity recovery time was rapid. These results demonstrate dramatic, albeit imperfect, recovery of rod- and cone-photoreceptor-based vision after RPE65 gene therapy. PMID:18809924

Retinoid agonist isotretinoin ameliorates obstructive renal injury.

PubMed

Schaier, Matthias; Jocks, Thomas; Grone, Hermann-Josef; Ritz, Eberhard; Wagner, Juergen

2003-10-01

Interstitial fibrosis is a major cause of end stage renal failure. Retinoids, which are involved in tissue repair and fibrosis, inhibit inflammatory and proliferative pathways. Therefore, we studied the dose dependent effects of the retinoid receptor agonist isotretinoin 13-cis retinoic acid in the unilateral ureteral obstruction model (UUO). Sham operated control rats were compared with UUO rats treated with vehicle (UUO-Veh), or low (5 mg/kg body weight (UUO-LD) or high (25 mg/kg) (UUO-HD) dose isotretinoin. Kidneys were evaluated using reverse transcriptase-polymerase chain reaction and immunohistology 7 days after UUO. Renal injury and fibrosis were quantified by immunostaining and expression measurements of the genes involved in renal fibrosis. In UUO-Veh kidneys the interstitial area was expanded 5-fold but only 3-fold in UUO-HD and 3.5-fold in UUO-LD rats. Interstitial cell counts were 3-fold higher in UUO-Veh rats but significantly less in UUO-HD or UUO-LD animals. Tubular and interstitial cell proliferation was significantly higher in UUO-Veh rats compared with sham operated control plus vehicle animals but less so in UUO-LD and UUO-HD rats. In UUO-Veh rats interstitial infiltration by monocytes/macrophages was higher compared with unobstructed controls. It was significantly less after isotretinoin treatment. In UUO-Veh rats mRNA for procollagen I, and transforming growth factor-beta1 and II receptor was significantly increased. It was significantly less after treatment with isotretinoin. Fibronectin and collagen I immunostaining was also decreased by isotretinoin. Since isotretinoin limits proliferation, inflammation and fibrosis after UUO, retinoids should be further investigated as potentially promising therapeutic agents for renal disease.

The Visual Cycle in the Inner Retina of Chicken and the Involvement of Retinal G-Protein-Coupled Receptor (RGR).

PubMed

Díaz, Nicolás M; Morera, Luis P; Tempesti, Tomas; Guido, Mario E

2017-05-01

The vertebrate retina contains typical photoreceptor (PR) cones and rods responsible for day/night vision, respectively, and intrinsically photosensitive retinal ganglion cells (ipRGCs) involved in the regulation of non-image-forming tasks. Rhodopsin/cone opsin photopigments in visual PRs or melanopsin (Opn4) in ipRGCs utilizes retinaldehyde as a chromophore. The retinoid regeneration process denominated as "visual cycle" involves the retinal pigment epithelium (RPE) or Müller glial cells. Opn4, on the contrary, has been characterized as a bi/tristable photopigment, in which a photon of one wavelength isomerizes 11-cis to all-trans retinal (Ral), with a second photon re-isomerizing it back. However, it is unknown how the chromophore is further metabolized in the inner retina. Nor is it yet clear whether an alternative secondary cycle occurs involving players such as the retinal G-protein-coupled receptor (RGR), a putative photoisomerase of unidentified inner retinal activity. Here, we investigated the role of RGR in retinoid photoisomerization in Opn4x (Xenopus ortholog) (+) RGC primary cultures free of RPE and other cells from chicken embryonic retinas. Opn4x (+) RGCs display significant photic responses by calcium fluorescent imaging and photoisomerize exogenous all-trans to 11-cis Ral and other retinoids. RGR was found to be expressed in developing retina and in primary cultures; when its expression was knocked down, the levels of 11-cis, all-trans Ral, and all-trans retinol in cultures exposed to light were significantly higher and those in all-trans retinyl esters lower than in dark controls. The results support a novel role for RGR in ipRGCs to modulate retinaldehyde levels in light, keeping the balance of inner retinal retinoid pools.

Cell- and virus-mediated regulation of the barrier-to-autointegration factor's phosphorylation state controls its DNA binding, dimerization, subcellular localization, and antipoxviral activity.

PubMed

Jamin, Augusta; Wicklund, April; Wiebe, Matthew S

2014-05-01

Barrier-to-autointegration factor (BAF) is a DNA binding protein with multiple cellular functions, including the ability to act as a potent defense against vaccinia virus infection. This antiviral function involves BAF's ability to condense double-stranded DNA and subsequently prevent viral DNA replication. In recent years, it has become increasingly evident that dynamic phosphorylation involving the vaccinia virus B1 kinase and cellular enzymes is likely a key regulator of multiple BAF functions; however, the precise mechanisms are poorly understood. Here we analyzed how phosphorylation impacts BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity through the characterization of BAF phosphomimetic and unphosphorylatable mutants. Our studies demonstrate that increased phosphorylation enhances BAF's mobilization from the nucleus to the cytosol, while dephosphorylation restricts BAF to the nucleus. Phosphorylation also impairs both BAF's dimerization and its DNA binding activity. Furthermore, our studies of BAF's antiviral activity revealed that hyperphosphorylated BAF is unable to suppress viral DNA replication or virus production. Interestingly, the unphosphorylatable BAF mutant, which is capable of binding DNA but localizes predominantly to the nucleus, was also incapable of suppressing viral replication. Thus, both DNA binding and localization are important determinants of BAF's antiviral function. Finally, our examination of how phosphatases are involved in regulating BAF revealed that PP2A dephosphorylates BAF during vaccinia infection, thus counterbalancing the activity of the B1 kinase. Altogether, these data demonstrate that phosphoregulation of BAF by viral and cellular enzymes modulates this protein at multiple molecular levels, thus determining its effectiveness as an antiviral factor and likely other functions as well. The barrier-to-autointegration factor (BAF) contributes to cellular genomic integrity in multiple ways, the best characterized of which are as a host defense against cytoplasmic DNA and as a regulator of mitotic nuclear reassembly. Although dynamic phosphorylation involving both viral and cellular enzymes is likely a key regulator of multiple BAF functions, the precise mechanisms involved are poorly understood. Here we demonstrate that phosphorylation coordinately regulates BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity. Overall, our findings provide new insights into how phosphoregulation of BAF modulates this protein at multiple levels and governs its effectiveness as an antiviral factor against foreign DNA.

Metabolic activation and nucleic acid binding of acetaminophen and related arylamine substrates by the respiratory burst of human granulocytes.

PubMed

Corbett, M D; Corbett, B R; Hannothiaux, M H; Quintana, S J

1989-01-01

Following stimulation with phorbol myristate acetate, human granulocytes were found to incorporate acetaminophen, p-phenetidine, p-aminophenol, and p-chloroaniline into cellular DNA and RNA. Phenacetin was not incorporated into nucleic acid or metabolized by such activated granulocytes. None of the substrates gave nucleic acid binding if the granulocyte cultures were not induced to undergo the respiratory burst. Additional studies on the binding of acetaminophen to DNA and RNA were made by use of both ring-14C-labeled and carbonyl-14C-labeled forms of this substrate. The finding that equivalent amounts of these two labeled acetaminophen substrates were bound to cellular DNA demonstrated that the intact acetaminophen molecule was incorporated into DNA. On the other hand, the finding that excess ring-14C-labeled acetaminophen was incorporated into cellular RNA implies partial hydrolysis of the acetaminophen substrate prior to RNA binding. Evidence was presented which strongly indicates that the nucleic acid binding of the substrates was covalent in nature. The inability of the respiratory burst to result in the binding of phenacetin to nucleic acid suggests that arylamides are not normally activated or metabolized by activated granulocytes. Acetaminophen is an exception to the recalcitrance of arylamides to such bioactivation processes because it also possesses the phenolic functional group, which, like the arylamine group, is oxidized by certain reactive oxygen species. Myeloperoxidase appears to be much more important in the binding of acetaminophen to DNA than it is in the DNA binding of arylamines in general. The role of the respiratory burst in causing the bioactivation of certain arylamines, which are not normally genotoxic via the more usual microsomal activation pathways, was extended to include certain amide substrates such as acetaminophen.

Modulating factors in the expression of radiation-induced oncogenic transformation.

PubMed Central

Hall, E J; Hei, T K

1990-01-01

Many assays for oncogenic transformation have been developed ranging from those in established rodent cell lines where morphological alteration is scored, to those in human cells growing in nude mice where tumor invasiveness is scored. In general, systems that are most quantitative are also the least relevant in terms of human carcinogenesis and human risk estimation. The development of cell culture systems has made it possible to assess at the cellular level the oncogenic potential of a variety of chemical, physical and viral agents. Cell culture systems afford the opportunity to identify factors and conditions that may prevent or enhance cellular transformation by radiation and chemicals. Permissive and protective factors in radiation-induced transformation include thyroid hormone and the tumor promoter TPA that increase the transformation incidence for a given dose of radiation, and retinoids, selenium, vitamin E, and 5-aminobenzamide that inhibit the expression of transformation. Densely ionizing alpha-particles, similar to those emitted by radon daughters, are highly effective in inducing transformations and appear to interact in a supra-additive fashion with asbestos fibers. The activation of a known dominant oncogene has not yet been demonstrated in radiation-induced oncogenic transformation. The most likely mechanism for radiation activation of an oncogene would be via the production of a chromosomal translocation. Radiation also efficiently induces deletions and may thus lead to the loss of a suppressor gene. Images FIGURE 4. PMID:2272310

Cow's milk increases the activities of human nuclear receptors peroxisome proliferator-activated receptors alpha and delta and retinoid X receptor alpha involved in the regulation of energy homeostasis, obesity, and inflammation.

PubMed

Suhara, W; Koide, H; Okuzawa, T; Hayashi, D; Hashimoto, T; Kojo, H

2009-09-01

The nuclear peroxisome proliferator-activated receptors (PPAR) have been shown to play crucial roles in regulating energy homeostasis including lipid and carbohydrate metabolism, inflammatory responses, and cell proliferation, differentiation, and survival. Because PPAR agonists have the potential to prevent or ameliorate diseases such as hyperlipidemia, diabetes, atherosclerosis, and obesity, we have explored new natural agonists for PPAR. For this purpose, cow's milk was tested for agonistic activity toward human PPAR subtypes using a reporter gene assay. Milk increased human PPARalpha activity in a dose-dependent manner with a 3.2-fold increase at 0.5% (vol/vol). It also enhanced human PPARdelta activity in a dose-dependent manner with an 11.5-fold increase at 0.5%. However, it only slightly affected human PPARgamma activity. Ice cream, butter, and yogurt also increased the activities of PPARalpha and PPARdelta, whereas vegetable cream affected activity of PPARdelta but not PPARalpha. Skim milk enhanced the activity of PPAR to a lesser degree than regular milk. Milk and fresh cream increased the activity of human retinoid X receptor (RXR)alpha as well as PPARalpha and PPARdelta, whereas neither affected vitamin D3 receptor, estrogen receptors alpha and beta, or thyroid receptors alpha and beta. Both milk and fresh cream were shown by quantitative real-time PCR to increase the quantity of mRNA for uncoupling protein 2 (UCP2), an energy expenditure gene, in a dose-dependent manner. The increase in UCP2 mRNA was found to be reduced by treatment with PPARdelta-short interfering (si)RNA. This study unambiguously clarified at the cellular level that cow's milk increased the activities of human PPARalpha, PPARdelta, and RXRalpha. The possible role in enhancing the activities of PPARalpha, PPARdelta, and RXRalpha, and the health benefits of cow's milk were discussed.

Composite alginate gels for tunable cellular microenvironment mechanics

NASA Astrophysics Data System (ADS)

Khavari, Adele; Nydén, Magnus; Weitz, David A.; Ehrlicher, Allen J.

2016-08-01

The mechanics of the cellular microenvironment can be as critical as biochemistry in directing cell behavior. Many commonly utilized materials derived from extra-cellular-matrix create excellent scaffolds for cell growth, however, evaluating the relative mechanical and biochemical effects independently in 3D environments has been difficult in frequently used biopolymer matrices. Here we present 3D sodium alginate hydrogel microenvironments over a physiological range of stiffness (E = 1.85 to 5.29 kPa), with and without RGD binding sites or collagen fibers. We use confocal microscopy to measure the growth of multi-cellular aggregates (MCAs), of increasing metastatic potential in different elastic moduli of hydrogels, with and without binding factors. We find that the hydrogel stiffness regulates the growth and morphology of these cell clusters; MCAs grow larger and faster in the more rigid environments similar to cancerous breast tissue (E = 4-12 kPa) as compared to healthy tissue (E = 0.4-2 kpa). Adding binding factors from collagen and RGD peptides increases growth rates, and change maximum MCA sizes. These findings demonstrate the utility of these independently tunable mechanical/biochemistry gels, and that mechanical confinement in stiffer microenvironments may increase cell proliferation.

Cell Surface Changes Associated with Cellular Immune Reactions in Drosophila

NASA Astrophysics Data System (ADS)

Nappi, Anthony J.; Silvers, Michael

1984-09-01

In Drosophila melanogaster a temperature-induced change in immune competence accompanies cell surface alterations that cause its blood cells to adhere and to encapsulate a parasite. At 29 degrees C the blood cells of the tumorous-lethal (Tuml) mutant show a high degree of immune competence and encapsulate the eggs of the parasitic wasp Leptopilina heterotoma. At 21 degrees C the blood cells are essentially immune incompetent. High percentages of lectin binding cells were found under conditions which potentiated cellular encapsulation responses. Some immune reactive blood cells did not bind lectin. The low percentages of lectin binding cells in susceptible hosts suggest that developing parasites alter the cell surface of the blood cells of immune reactive hosts.

In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2

PubMed Central

Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R

2018-01-01

Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V1) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys8]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg8]-vasopressin (AVP) at V1 and vasopressin-2 (V2) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V1 and V2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [3H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V1) and cyclic adenosine monophosphate (V2). Binding potency at V1 and V2 was AVP>LVP>>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V1 than for V2. Cellular activity potency was also AVP>LVP>>terlipressin. Terlipressin was a partial agonist at V1 and a full agonist at V2; LVP was a full agonist at both V1 and V2. The in vivo response to terlipressin is likely due to the partial V1 agonist activity of terlipressin and full V1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors. PMID:29302194

In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2.

PubMed

Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R

2018-01-01

Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V 1 ) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys 8 ]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg 8 ]-vasopressin (AVP) at V 1 and vasopressin-2 (V 2 ) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V 1 and V 2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [ 3 H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V 1 ) and cyclic adenosine monophosphate (V 2 ). Binding potency at V 1 and V 2 was AVP>LVP>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V 1 than for V 2 . Cellular activity potency was also AVP>LVP>terlipressin. Terlipressin was a partial agonist at V 1 and a full agonist at V 2 ; LVP was a full agonist at both V 1 and V 2 . The in vivo response to terlipressin is likely due to the partial V 1 agonist activity of terlipressin and full V 1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giuliani, Sarah E; Frank, Ashley M; Corgliano, Danielle M

Abstract Background: Transporter proteins are one of an organism s primary interfaces with the environment. The expressed set of transporters mediates cellular metabolic capabilities and influences signal transduction pathways and regulatory networks. The functional annotation of most transporters is currently limited to general classification into families. The development of capabilities to map ligands with specific transporters would improve our knowledge of the function of these proteins, improve the annotation of related genomes, and facilitate predictions for their role in cellular responses to environmental changes. Results: To improve the utility of the functional annotation for ABC transporters, we expressed and purifiedmore » the set of solute binding proteins from Rhodopseudomonas palustris and characterized their ligand-binding specificity. Our approach utilized ligand libraries consisting of environmental and cellular metabolic compounds, and fluorescence thermal shift based high throughput ligand binding screens. This process resulted in the identification of specific binding ligands for approximately 64% of the purified and screened proteins. The collection of binding ligands is representative of common functionalities associated with many bacterial organisms as well as specific capabilities linked to the ecological niche occupied by R. palustris. Conclusion: The functional screen identified specific ligands that bound to ABC transporter periplasmic binding subunits from R. palustris. These assignments provide unique insight for the metabolic capabilities of this organism and are consistent with the ecological niche of strain isolation. This functional insight can be used to improve the annotation of related organisms and provides a route to evaluate the evolution of this important and diverse group of transporter proteins.« less

Structure of the Shroom-Rho Kinase Complex Reveals a Binding Interface with Monomeric Shroom That Regulates Cell Morphology and Stimulates Kinase Activity

DOE PAGES

Zalewski, Jenna K.; Mo, Joshua H.; Heber, Simone; ...

2016-10-10

Shroom-mediated remodeling of the actomyosin cytoskeleton is a critical driver of cellular shape and tissue morphology that underlies the development of many tissues including the neural tube, eye, intestines, and vasculature. Shroom uses a conserved SD2 domain to direct the subcellular localization of Rho-associated kinase (Rock), which in turn drives changes in the cytoskeleton and cellular morphology through its ability to phosphorylate and activate non-muscle myosin II. Here in this paper, we present the structure of the human Shroom-Rock binding module, revealing an unexpected stoichiometry for Shroom in which two Shroom SD2 domains bind independent surfaces on Rock. Mutation ofmore » interfacial residues impaired Shroom-Rock binding in vitro and resulted in altered remodeling of the cytoskeleton and loss of Shroom-mediated changes in cellular morphology. In addition, we provide the first direct evidence that Shroom can function as a Rock activator. These data provide molecular insight into the Shroom-Rock interface and demonstrate that Shroom directly participates in regulating cytoskeletal dynamics, adding to its known role in Rock localization.« less

Steap4 Plays a Critical Role in Osteoclastogenesis in Vitro by Regulating Cellular Iron/Reactive Oxygen Species (ROS) Levels and cAMP Response Element-binding Protein (CREB) Activation*

PubMed Central

Zhou, Jian; Ye, Shiqiao; Fujiwara, Toshifumi; Manolagas, Stavros C.; Zhao, Haibo

2013-01-01

Iron is essential for osteoclast differentiation, and iron overload in a variety of hematologic diseases is associated with excessive bone resorption. Iron uptake by osteoclast precursors via the transferrin cycle increases mitochondrial biogenesis, reactive oxygen species production, and activation of cAMP response element-binding protein, a critical transcription factor downstream of receptor activator of NF-κB-ligand-induced calcium signaling. These changes are required for the differentiation of osteoclast precursors to mature bone-resorbing osteoclasts. However, the molecular mechanisms regulating cellular iron metabolism in osteoclasts remain largely unknown. In this report, we provide evidence that Steap4, a member of the six-transmembrane epithelial antigen of prostate (Steap) family proteins, is an endosomal ferrireductase with a critical role in cellular iron utilization in osteoclasts. Specifically, we show that Steap4 is the only Steap family protein that is up-regulated during osteoclast differentiation. Knocking down Steap4 expression in vitro by lentivirus-mediated short hairpin RNAs inhibits osteoclast formation and decreases cellular ferrous iron, reactive oxygen species, and the activation of cAMP response element-binding protein. These results demonstrate that Steap4 is a critical enzyme for cellular iron uptake and utilization in osteoclasts and, thus, indispensable for osteoclast development and function. PMID:23990467

An Expanding Range of Functions for the Copper Chaperone/Antioxidant Protein Atox1

PubMed Central

Hatori, Yuta

2013-01-01

Abstract Significance: Antioxidant protein 1 (Atox1 in human cells) is a copper chaperone for the copper export pathway with an essential role in cellular copper distribution. In vitro, Atox1 binds and transfers copper to the copper-transporting ATPases, stimulating their catalytic activity. Inactivation of Atox1 in cells inhibits maturation of secreted cuproenzymes as well as copper export from cells. Recent Advances: Accumulating data suggest that cellular functions of Atox1 are not limited to its copper-trafficking role and may include storage of labile copper, modulation of transcription, and antioxidant defense. The conserved metal binding site of Atox1, CxGC, differs from the metal-binding sites of copper-transporting ATPases and has a physiologically relevant redox potential that equilibrates with the GSH:GSSG pair. Critical Issues: Tight relationship appears to exist between intracellular copper levels and glutathione (GSH) homeostasis. The biochemical properties of Atox1 place it at the intersection of cellular networks that regulate copper distribution and cellular redox balance. Mechanisms through which Atox1 facilitates copper export and contributes to oxidative defense are not fully understood. Future Directions: The current picture of cellular redox homeostasis and copper physiology will be enhanced by further mechanistic studies of functional interactions between the GSH:GSSG pair and copper-trafficking machinery. Antioxid. Redox Signal. 19, 945–957. PMID:23249252

Nuclear Receptors, RXR, and the Big Bang.

PubMed

Evans, Ronald M; Mangelsdorf, David J

2014-03-27

Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

Oral treatment with retinoic acid decreases bone mass in rats.

PubMed

Hotchkiss, Charlotte E; Latendresse, John; Ferguson, Sherry A

2006-12-01

13-cis-retinoic acid (13-cis-RA, isotretinoin) is used to treat severe recalcitrant acne. Other retinoids have adverse effects on bone. Recent studies of human patients treated with 13-cis-RA have had varying results, perhaps because of variability among patients and the lack of control groups. The effects of retinoids have been studied in rodents, but little information is available regarding the effects of clinically relevant retinoid doses as evaluated by use of bone densitometric techniques. We treated rats for 15 or 20 wk with 13-cis-RA, all-trans-RA, or soybean oil (control) by gavage. We used dual-energy X-ray absorptiometry, histomorphometry, and histologic evaluation to evaluate effects on bone. Spontaneous long bone fractures occurred in some rats treated with 15 mg/kg all-trans-RA daily. Bone mineral density, bone mineral content, bone diameter, and cortical thickness of the femur were reduced in rats treated daily with 10 or 15 mg/kg all-trans-RA or 30 mg/kg 13-cis-RA. The lumbar spine was not affected. Although the effects of 13-cis-RA were not as dramatic as those of all-trans-RA, further study of the effects of 13-cis-RA on long bones is warranted.

Lipid peroxide, alpha-tocopherol and retinoid levels in plasma and liver of rats fed diets containing beta-carotene and 13-cis-retinoic acid.

PubMed

Alam, S Q; Alam, B S

1983-12-01

The effect of feeding large amounts of beta-carotene and 13-cis-retinoic acid (RA) on plasma and liver levels of alpha-tocopherol, lipid peroxides and retinoids was studied. Groups of young male rats were fed semipurified diets supplemented with 0, 100 mg/kg beta-carotene, 20 and 100 mg/kg 13-cis-RA. After feeding the various diets for 11 weeks, rats were killed and the concentrations of lipid peroxides, alpha-tocopherol, and retinoids were measured in blood plasma and liver. Peroxide levels were increased and alpha-tocopherol levels were decreased in plasma as well as liver of rats fed diets containing 13-cis-RA; this effect seems to be dose dependent, beta-Carotene had no significant effect on either of the above parameters. There was a decrease in the liver and plasma concentrations of retinol in rats fed 13-cis-RA; the levels of RA were generally higher in these two groups. The results suggest that the mechanism whereby 13-cis-RA increases the tissue peroxide levels may be related to its ability to decrease alpha-tocopherol levels.

Uncoupling RARA transcriptional activation and degradation clarifies the bases for APL response to therapies

PubMed Central

Ablain, Julien; Leiva, Magdalena; Peres, Laurent; Fonsart, Julien; Anthony, Elodie

2013-01-01

In PML/RARA-driven acute promyelocytic leukemia (APL), retinoic acid (RA) induces leukemia cell differentiation and transiently clears the disease. Molecularly, RA activates PML/RARA-dependent transcription and also initiates its proteasome-mediated degradation. In contrast, arsenic, the other potent anti-APL therapy, only induces PML/RARA degradation by specifically targeting its PML moiety. The respective contributions of RA-triggered transcriptional activation and proteolysis to clinical response remain disputed. Here, we identify synthetic retinoids that potently activate RARA- or PML/RARA-dependent transcription, but fail to down-regulate RARA or PML/RARA protein levels. Similar to RA, these uncoupled retinoids elicit terminal differentiation, but unexpectedly fail to impair leukemia-initiating activity of PML/RARA-transformed cells ex vivo or in vivo. Accordingly, the survival benefit conferred by uncoupled retinoids in APL mice is dramatically lower than the one provided by RA. Differentiated APL blasts sorted from uncoupled retinoid–treated mice retain PML/RARA expression and reinitiate APL in secondary transplants. Thus, differentiation is insufficient for APL eradication, whereas PML/RARA loss is essential. These observations unify the modes of action of RA and arsenic and shed light on the potency of their combination in mice or patients. PMID:23509325

Hydroperoxide-dependent cooxidation of 13-cis-retinoic acid by prostaglandin H synthase.

PubMed

Samokyszyn, V M; Marnett, L J

1987-10-15

Reverse phase high pressure liquid chromatography was employed to separate the major products resulting from the hydroperoxide-dependent cooxidation of 13-cis-retinoic acid by microsomal and purified prostaglandin H (PGH) synthase. Several major oxygenated metabolites including 4-hydroxy-, 5,6-epoxy-, and 5,8-oxy-13-cis-retinoic acid were unambiguously identified on the basis of cochromatography with authentic standards, uv spectra, and mass spectral analysis. Identical product profiles were generated regardless of the type of oxidizing substrate employed, and heat-denatured microsomes or enzyme did not support oxidation. In addition, several geometric isomers including all trans-retinoic acid were identified. Isomerization to all trans-retinoic acid in microsomes occurred in the absence of exogenous hydroperoxide, was insensitive to inhibition by antioxidant, and was eliminated when heat-denatured preparations were substituted for intact microsomes. Conversely, isomerization to at least one other isomer required the addition of hydroperoxide and was sensitive to antioxidant inhibition. Addition of antioxidant to microsomal incubation mixtures inhibited the hydroperoxide-dependent generation of 5,6-epoxy- and 5,8-oxy-13-cis-retinoic acid and other oxygenated metabolites but stimulated the formation of 4-hydroxy-13-cis-retinoic acid. Under standard conditions, 77% of the original retinoid was metabolized resulting in products containing 1.25 oxygen atoms/oxygenated metabolite, and two dioxygen molecules were consumed per hydroperoxide reduced. Purified PGH synthase also supported O2 uptake during cooxidation of 13-cis-retinoic acid by H2O2 or 5-phenyl-4-pentenyl-1-hydroperoxide, and the initial velocities of O2 uptake were directly proportional to enzyme concentration. 13-cis-Retinoic acid effectively inhibited peroxidase-dependent cooxidation of guaiacol indicating a direct interaction of retinoid with peroxidase iron-oxo intermediates, and EPR spin trapping studies demonstrated the formation of retinoid-derived free radical intermediates. Incubating H2O2 with microsomal PGH synthase resulted in the initiation of lipid peroxidation, detected via measurement of malondialdehyde generation, that was inhibited by retinoid and suggests some limited involvement of lipid peroxidation in retinoid oxidation. Incubation of 13-cis-retinoic acid with hematin and 15-hydroperoxy-5,8,11,13-eicosatetraenoic acid in the presence of detergent, a system that generates high yields of peroxyl radicals, resulted in high yields of 5,6-epoxide; 4-hydroxy-13-cis-retinoic acid was not detected.(ABSTRACT TRUNCATED AT 400 WORDS)

Control of retinoic acid synthesis and FGF expression in the nasal pit is required to pattern the craniofacial skeleton.

PubMed

Song, Y; Hui, J N; Fu, K K; Richman, J M

2004-12-15

Endogenous retinoids are important for patterning many aspects of the embryo including the branchial arches and frontonasal region of the embryonic face. The nasal placodes express retinaldehyde dehydrogenase-3 (RALDH3) and thus retinoids from the placode are a potential patterning influence on the developing face. We have carried out experiments that have used Citral, a RALDH antagonist, to address the function of retinoid signaling from the nasal pit in a whole embryo model. When Citral-soaked beads were implanted into the nasal pit of stage 20 chicken embryos, the result was a specific loss of derivatives from the lateral nasal prominences. Providing exogenous retinoic acid residue development of the beak demonstrating that most Citral-induced defects were produced by the specific blocking of RA synthesis. The mechanism of Citral effects was a specific increase in programmed cell death on the lateral (lateral nasal prominence) but not the medial side (frontonasal mass) of the nasal pit. Gene expression studies were focused on the Bone Morphogenetic Protein (BMP) pathway, which has a well-established role in programmed cell death. Unexpectedly, blocking RA synthesis decreased rather than increased Msx1, Msx2, and Bmp4 expression. We also examined cell survival genes, the most relevant of which was Fgf8, which is expressed around the nasal pit and in the frontonasal mass. We found that Fgf8 was not initially expressed along the lateral side of the nasal pit at the start of our experiments, whereas it was expressed on the medial side. Citral prevented upregulation of Fgf8 along the lateral edge and this may have contributed to the specific increase in programmed cell death in the lateral nasal prominence. Consistent with this idea, exogenous FGF8 was able to prevent cell death, rescue most of the morphological defects and was able to prevent a decrease in retinoic acid receptorbeta (Rarbeta) expression caused by Citral. Together, our results demonstrate that endogenous retinoids act upstream of FGF8 and the balance of these two factors is critical for regulating programmed cell death and morphogenesis in the face. In addition, our data suggest a novel role for endogenous retinoids from the nasal pit in controlling the precise downregulation of FGF in the center of the frontonasal mass observed during normal vertebrate development.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zalewski, Jenna K.; Mo, Joshua H.; Heber, Simone

Shroom-mediated remodeling of the actomyosin cytoskeleton is a critical driver of cellular shape and tissue morphology that underlies the development of many tissues including the neural tube, eye, intestines, and vasculature. Shroom uses a conserved SD2 domain to direct the subcellular localization of Rho-associated kinase (Rock), which in turn drives changes in the cytoskeleton and cellular morphology through its ability to phosphorylate and activate non-muscle myosin II. Here in this paper, we present the structure of the human Shroom-Rock binding module, revealing an unexpected stoichiometry for Shroom in which two Shroom SD2 domains bind independent surfaces on Rock. Mutation ofmore » interfacial residues impaired Shroom-Rock binding in vitro and resulted in altered remodeling of the cytoskeleton and loss of Shroom-mediated changes in cellular morphology. In addition, we provide the first direct evidence that Shroom can function as a Rock activator. These data provide molecular insight into the Shroom-Rock interface and demonstrate that Shroom directly participates in regulating cytoskeletal dynamics, adding to its known role in Rock localization.« less

No evidence for a local renin-angiotensin system in liver mitochondria

PubMed Central

Astin, Ronan; Bentham, Robert; Djafarzadeh, Siamak; Horscroft, James A.; Kuc, Rhoda E.; Leung, Po Sing; Skipworth, James R. A.; Vicencio, Jose M.; Davenport, Anthony P.; Murray, Andrew J.; Takala, Jukka; Jakob, Stephan M.; Montgomery, Hugh; Szabadkai, Gyorgy

2013-01-01

The circulating, endocrine renin-angiotensin system (RAS) is important to circulatory homeostasis, while ubiquitous tissue and cellular RAS play diverse roles, including metabolic regulation. Indeed, inhibition of RAS is associated with improved cellular oxidative capacity. Recently it has been suggested that an intra-mitochondrial RAS directly impacts on metabolism. Here we sought to rigorously explore this hypothesis. Radiolabelled ligand-binding and unbiased proteomic approaches were applied to purified mitochondrial sub-fractions from rat liver, and the impact of AngII on mitochondrial function assessed. Whilst high-affinity AngII binding sites were found in the mitochondria-associated membrane (MAM) fraction, no RAS components could be detected in purified mitochondria. Moreover, AngII had no effect on the function of isolated mitochondria at physiologically relevant concentrations. We thus found no evidence of endogenous mitochondrial AngII production, and conclude that the effects of AngII on cellular energy metabolism are not mediated through its direct binding to mitochondrial targets. PMID:23959064

Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roman, Corina; Fuior, Elena V.; Trusca, Violeta G.

Apolipoprotein E (apoE), a protein mainly involved in lipid metabolism, is associated with several neurodegenerative disorders including Alzheimer's disease. Despite numerous attempts to elucidate apoE gene regulation in the brain, the exact mechanism is still uncovered. The mechanism of apoE gene regulation in the brain involves the proximal promoter and multienhancers ME.1 and ME.2, which evolved by gene duplication. Herein we questioned whether thyroid hormones and their nuclear receptors have a role in apoE gene regulation in astrocytes. Our data showed that thyroid hormones increase apoE gene expression in HTB14 astrocytes in a dose-dependent manner. This effect can be intermediatedmore » by the thyroid receptor β (TRβ) which is expressed in these cells. In the presence of triiodothyronine (T3) and 9-cis retinoic acid, in astrocytes transfected to overexpress TRβ and retinoid X receptor α (RXRα), apoE promoter was indirectly activated through the interaction with ME.2. To determine the location of TRβ/RXRα binding site on ME.2, we performed DNA pull down assays and found that TRβ/RXRα complex bound to the region 341–488 of ME.2. This result was confirmed by transient transfection experiments in which a series of 5′- and 3′-deletion mutants of ME.2 were used. These data support the existence of a biologically active TRβ binding site starting at 409 in ME.2. In conclusion, our data revealed that ligand-activated TRβ/RXRα heterodimers bind with high efficiency on tissue-specific distal regulatory element ME.2 and thus modulate apoE gene expression in the brain. - Highlights: • T3 induce a dose-dependent increase of apoE expression in astrocytes. • Thyroid hormones activate apoE promoter in a cell specific manner. • Ligand activated TRβ/RXRα bind on the distal regulatory element ME.2 to modulate apoE. • The binding site of TRβ/RXRα heterodimer is located at 409 bp on ME.2.« less

Mechanical Unfolding Studies on Single-Domain SUMO and Multi-Domain Periplasmic Binding Proteins

NASA Astrophysics Data System (ADS)

Kotamarthi, Hema Chandra; Ainavarapu, Sri Rama Koti

Protein mechanics is a key component of many cellular and sub-cellular processes. The current review focuses on recent studies from our laboratory that probe the effect of sequence on the mechanical stability of structurally similar proteins and the unfolding mechanisms of multi-domain periplasmic binding proteins. Ubiquitin and small ubiquitin-related modifiers (SUMOs) are structurally similar and possess different mechanical stabilities, ubiquitin being stronger than SUMOs as revealed from their unfolding forces. These differences are plausibly due to the variation in number of inter-residue contacts. The unfolding potential widths determined from the pulling speed-dependent studies revealed that SUMOs are mechanically more flexible than ubiquitin. This flexibility of SUMOs plays a role in ligand binding and our single-molecule studies on SUMO interaction with SUMO binding motifs (SBMs) have shown that ligand binding decreases the SUMO flexibility and increases its mechanical stability. Studies on multi-domain periplasmic binding proteins have revealed that the unfolding energy landscape of these proteins is complex and they follow kinetic partitioning between two-state and multiple three-state pathways.

The increasing diversity of functions attributed to the SAFB family of RNA-/DNA-binding proteins.

PubMed

Norman, Michael; Rivers, Caroline; Lee, Youn-Bok; Idris, Jalilah; Uney, James

2016-12-01

RNA-binding proteins play a central role in cellular metabolism by orchestrating the complex interactions of coding, structural and regulatory RNA species. The SAFB (scaffold attachment factor B) proteins (SAFB1, SAFB2 and SAFB-like transcriptional modulator, SLTM), which are highly conserved evolutionarily, were first identified on the basis of their ability to bind scaffold attachment region DNA elements, but attention has subsequently shifted to their RNA-binding and protein-protein interactions. Initial studies identified the involvement of these proteins in the cellular stress response and other aspects of gene regulation. More recently, the multifunctional capabilities of SAFB proteins have shown that they play crucial roles in DNA repair, processing of mRNA and regulatory RNA, as well as in interaction with chromatin-modifying complexes. With the advent of new techniques for identifying RNA-binding sites, enumeration of individual RNA targets has now begun. This review aims to summarise what is currently known about the functions of SAFB proteins. © 2016 The Author(s).

Binding of phosphatidic acid to 14-3-3 proteins hampers their ability to activate the plant plasma membrane H+-ATPase.

PubMed

Camoni, Lorenzo; Di Lucente, Cristina; Pallucca, Roberta; Visconti, Sabina; Aducci, Patrizia

2012-08-01

Phosphatidic acid is a phospholipid second messenger implicated in various cellular processes in eukaryotes. In plants, production of phosphatidic acid is triggered in response to a number of biotic and abiotic stresses. Here, we show that phosphatidic acid binds to 14-3-3 proteins, a family of regulatory proteins which bind client proteins in a phosphorylation-dependent manner. Binding of phosphatidic acid involves the same 14-3-3 region engaged in protein target binding. Consequently, micromolar phosphatidic acid concentrations significantly hamper the interaction of 14-3-3 proteins with the plasma membrane H(+)-ATPase, a well characterized plant 14-3-3 target, thus inhibiting the phosphohydrolitic enzyme activity. Moreover, the proton pump is inhibited when endogenous PA production is triggered by phospholipase D and the G protein agonist mastoparan-7. Hence, our data propose a possible mechanism involving PA that regulates 14-3-3-mediated cellular processes in response to stress. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

Multi-scale continuum modeling of biological processes: from molecular electro-diffusion to sub-cellular signaling transduction

NASA Astrophysics Data System (ADS)

Cheng, Y.; Kekenes-Huskey, P.; Hake, J. E.; Holst, M. J.; McCammon, J. A.; Michailova, A. P.

2012-01-01

This paper presents a brief review of multi-scale modeling at the molecular to cellular scale, with new results for heart muscle cells. A finite element-based simulation package (SMOL) was used to investigate the signaling transduction at molecular and sub-cellular scales (http://mccammon.ucsd.edu/smol/, http://FETK.org) by numerical solution of the time-dependent Smoluchowski equations and a reaction-diffusion system. At the molecular scale, SMOL has yielded experimentally validated estimates of the diffusion-limited association rates for the binding of acetylcholine to mouse acetylcholinesterase using crystallographic structural data. The predicted rate constants exhibit increasingly delayed steady-state times, with increasing ionic strength, and demonstrate the role of an enzyme's electrostatic potential in influencing ligand binding. At the sub-cellular scale, an extension of SMOL solves a nonlinear, reaction-diffusion system describing Ca2+ ligand buffering and diffusion in experimentally derived rodent ventricular myocyte geometries. Results reveal the important role of mobile and stationary Ca2+ buffers, including Ca2+ indicator dye. We found that alterations in Ca2+-binding and dissociation rates of troponin C (TnC) and total TnC concentration modulate sub-cellular Ca2+ signals. The model predicts that reduced off-rate in the whole troponin complex (TnC, TnI, TnT) versus reconstructed thin filaments (Tn, Tm, actin) alters cytosolic Ca2+ dynamics under control conditions or in disease-linked TnC mutations. The ultimate goal of these studies is to develop scalable methods and theories for the integration of molecular-scale information into simulations of cellular-scale systems.

Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

PubMed Central

Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

2013-01-01

Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

Fatty acids and hypolipidemic drugs regulate peroxisome proliferator-activated receptors alpha - and gamma-mediated gene expression via liver fatty acid binding protein: a signaling path to the nucleus.

PubMed

Wolfrum, C; Borrmann, C M; Borchers, T; Spener, F

2001-02-27

Peroxisome proliferator-activated receptor alpha (PPARalpha) is a key regulator of lipid homeostasis in hepatocytes and target for fatty acids and hypolipidemic drugs. How these signaling molecules reach the nuclear receptor is not known; however, similarities in ligand specificity suggest the liver fatty acid binding protein (L-FABP) as a possible candidate. In localization studies using laser-scanning microscopy, we show that L-FABP and PPARalpha colocalize in the nucleus of mouse primary hepatocytes. Furthermore, we demonstrate by pull-down assay and immunocoprecipitation that L-FABP interacts directly with PPARalpha. In a cell biological approach with the aid of a mammalian two-hybrid system, we provide evidence that L-FABP interacts with PPARalpha and PPARgamma but not with PPARbeta and retinoid X receptor-alpha by protein-protein contacts. In addition, we demonstrate that the observed interaction of both proteins is independent of ligand binding. Final and quantitative proof for L-FABP mediation was obtained in transactivation assays upon incubation of transiently and stably transfected HepG2 cells with saturated, monounsaturated, and polyunsaturated fatty acids as well as with hypolipidemic drugs. With all ligands applied, we observed strict correlation of PPARalpha and PPARgamma transactivation with intracellular concentrations of L-FABP. This correlation constitutes a nucleus-directed signaling by fatty acids and hypolipidemic drugs where L-FABP acts as a cytosolic gateway for these PPARalpha and PPARgamma agonists. Thus, L-FABP and the respective PPARs could serve as targets for nutrients and drugs to affect expression of PPAR-sensitive genes.

Adenovirus E1A functions as a cofactor for retinoic acid receptor beta (RAR beta) through direct interaction with RAR beta.

PubMed

Folkers, G E; van der Saag, P T

1995-11-01

Transcription regulation by DNA-bound activators is thought to be mediated by a direct interaction between these proteins and TATA-binding protein (TBP), TFIIB, or TBP-associated factors, although occasionally cofactors or adapters are required. For ligand-induced activation by the retinoic acid receptor-retinoid X receptor (RAR-RXR) heterodimer, the RAR beta 2 promoter is dependent on the presence of E1A or E1A-like activity, since this promoter is activated by retinoic acid only in cells expressing such proteins. The mechanism underlying this E1A requirement is largely unknown. We now show that direct interaction between RAR and E1A is a requirement for retinoic acid-induced RAR beta 2 activation. The activity of the hormone-dependent activation function 2 (AF-2) of RAR beta is upregulated by E1A, and an interaction between this region and E1A was observed, but not with AF-1 or AF-2 of RXR alpha. This interaction is dependent on conserved region III (CRIII), the 13S mRNA-specific region of E1A. Deletion analysis within this region indicated that the complete CRIII is needed for activation. The putative zinc finger region is crucial, probably as a consequence of interaction with TBP. Furthermore, the region surrounding amino acid 178, partially overlapping with the TBP binding region, is involved in both binding to and activation by AF-2. We propose that E1A functions as a cofactor by interacting with both TBP and RAR, thereby stabilizing the preinitiation complex.

Sterol Carrier Protein-2: Binding Protein for Endocannabinoids

PubMed Central

Liedhegner, Elizabeth Sabens; Vogt, Caleb D.; Sem, Daniel S.; Cunningham, Christopher W.

2015-01-01

The endocannabinoid (eCB) system, consisting of eCB ligands and the type 1 cannabinoid receptor (CB1R), subserves retrograde, activity-dependent synaptic plasticity in the brain. eCB signaling occurs “on-demand,” thus the processes regulating synthesis, mobilization and degradation of eCBs are also primary mechanisms for the regulation of CB1R activity. The eCBs, N-arachidonylethanolamine (AEA) and 2-arachidonoylglycerol (2-AG), are poorly soluble in water. We hypothesize that their aqueous solubility, and, therefore, their intracellular and transcellular distribution, are facilitated by protein binding. Using in silico docking studies, we have identified the nonspecific lipid binding protein, sterol carrier protein 2 (SCP-2), as a potential AEA binding protein. The docking studies predict that AEA and AM404 associate with SCP-2 at a putative cholesterol binding pocket with ΔG values of −3.6 and −4.6 kcal/mol, respectively. These values are considerably higher than cholesterol (−6.62 kcal/mol) but consistent with a favorable binding interaction. In support of the docking studies, SCP-2-mediated transfer of cholesterol in vitro is inhibited by micromolar concentrations of AEA; and heterologous expression of SCP-2 in HEK 293 cells increases time-related accumulation of AEA in a temperature-dependent fashion. These results suggest that SCP-2 facilitates cellular uptake of AEA. However, there is no effect of SCP-2 transfection on the cellular accumulation of AEA determined at equilibrium or the IC50 values for AEA, AM404 or 2-AG to inhibit steady state accumulation of radiolabelled AEA. We conclude that SCP-2 is a low affinity binding protein for AEA that can facilitate its cellular uptake but does not contribute significantly to intracellular sequestration of AEA. PMID:24510313

Implementation of meiosis prophase I programme requires a conserved retinoid-independent stabilizer of meiotic transcripts

PubMed Central

Abby, Emilie; Tourpin, Sophie; Ribeiro, Jonathan; Daniel, Katrin; Messiaen, Sébastien; Moison, Delphine; Guerquin, Justine; Gaillard, Jean-Charles; Armengaud, Jean; Langa, Francina; Toth, Attila; Martini, Emmanuelle; Livera, Gabriel

2016-01-01

Sexual reproduction is crucially dependent on meiosis, a conserved, specialized cell division programme that is essential for the production of haploid gametes. Here we demonstrate that fertility and the implementation of the meiotic programme require a previously uncharacterized meiosis-specific protein, MEIOC. Meioc invalidation in mice induces early and pleiotropic meiotic defects in males and females. MEIOC prevents meiotic transcript degradation and interacts with an RNA helicase that binds numerous meiotic mRNAs. Our results indicate that proper engagement into meiosis necessitates the specific stabilization of meiotic transcripts, a previously little-appreciated feature in mammals. Remarkably, the upregulation of MEIOC at the onset of meiosis does not require retinoic acid and STRA8 signalling. Thus, we propose that the complete induction of the meiotic programme requires both retinoic acid-dependent and -independent mechanisms. The latter process involving post-transcriptional regulation likely represents an ancestral mechanism, given that MEIOC homologues are conserved throughout multicellular animals. PMID:26742488

The Ubiquitin-associated Domain of Cellular Inhibitor of Apoptosis Proteins Facilitates Ubiquitylation*

PubMed Central

Budhidarmo, Rhesa; Day, Catherine L.

2014-01-01

The cellular inhibitor of apoptosis (cIAP) proteins are essential RING E3 ubiquitin ligases that regulate apoptosis and inflammatory responses. cIAPs contain a ubiquitin-associated (UBA) domain that binds ubiquitin and is implicated in the regulation of cell survival and proteasomal degradation. Here we show that mutation of the MGF and LL motifs in the UBA domain of cIAP1 caused unfolding and increased cIAP1 multimonoubiquitylation. By developing a UBA mutant that disrupted ubiquitin binding but not the structure of the UBA domain, we found that the UBA domain enhances cIAP1 and cIAP2 ubiquitylation. We demonstrate that the UBA domain binds to the UbcH5b∼Ub conjugate, and this promotes RING domain-dependent monoubiquitylation. This study establishes ubiquitin-binding modules, such as the UBA domain, as important regulatory modules that can fine tune the activity of E3 ligases. PMID:25065467

Poly(A)-binding proteins and mRNA localization: who rules the roost?

PubMed

Gray, Nicola K; Hrabálková, Lenka; Scanlon, Jessica P; Smith, Richard W P

2015-12-01

RNA-binding proteins are often multifunctional, interact with a variety of protein partners and display complex localizations within cells. Mammalian cytoplasmic poly(A)-binding proteins (PABPs) are multifunctional RNA-binding proteins that regulate multiple aspects of mRNA translation and stability. Although predominantly diffusely cytoplasmic at steady state, they shuttle through the nucleus and can be localized to a variety of cytoplasmic foci, including those associated with mRNA storage and localized translation. Intriguingly, PABP sub-cellular distribution can alter dramatically in response to cellular stress or viral infection, becoming predominantly nuclear and/or being enriched in induced cytoplasmic foci. However, relatively little is known about the mechanisms that govern this distribution/relocalization and in many cases PABP functions within specific sites remain unclear. Here we discuss the emerging evidence with respect to these questions in mammals. © 2015 Authors; published by Portland Press Limited.

Studies on the cellular localization of spinal cord substance P receptors.

PubMed

Helke, C J; Charlton, C G; Wiley, R G

1986-10-01

Substance P-immunoreactivity and specific substance P binding sites are present in the spinal cord. Receptor autoradiography showed the discrete localization of substance P binding sites in both sensory and motor regions of the spinal cord and functional studies suggested an important role for substance P receptor activation in autonomic outflow, nociception, respiration and somatic motor function. In the current studies, we investigated the cellular localization of substance P binding sites in rat spinal cord using light microscopic autoradiography combined with several lesioning techniques. Unilateral injections of the suicide transport agent, ricin, into the superior cervical ganglion reduced substance P binding and cholinesterase-stained preganglionic sympathetic neurons in the intermediolateral cell column. However, unilateral electrolytic lesions of ventral medullary substance P neurons which project to the intermediolateral cell column did not alter the density of substance P binding in the intermediolateral cell column. Likewise, 6-hydroxydopamine and 5,7-dihydroxytryptamine, which destroy noradrenergic and serotonergic nerve terminals, did not reduce the substance P binding in the intermediolateral cell column. It appears, therefore, that the substance P binding sites are located postsynaptically on preganglionic sympathetic neurons rather than presynaptically on substance P-immunoreactive processes (i.e. as autoreceptors) or on monoamine nerve terminals. Unilateral injections of ricin into the phrenic nerve resulted in the unilateral destruction of phrenic motor neurons in the cervical spinal cord and caused a marked reduction in the substance P binding in the nucleus. Likewise, sciatic nerve injections of ricin caused a loss of associated motor neurons in the lateral portion of the ventral horn of the lumbar spinal cord and a reduction in the substance P binding. Sciatic nerve injections of ricin also destroyed afferent nerves of the associated dorsal root ganglia and increased the density of substance P binding in the dorsal horn. Capsaicin, which destroys small diameter primary sensory neurons, similarly increased the substance P binding in the dorsal horn. These studies show that the cellular localization of substance P binding sites can be determined by analysis of changes in substance P binding to discrete regions of spinal cord after selective lesions of specific groups of neurons. The data show the presence of substance P binding sites on preganglionic sympathetic neurons in the intermediolateral cell column and on somatic motor neurons in the ventral horn, including the phrenic motor nucleus.(ABSTRACT TRUNCATED AT 400 WORDS)

Addition of lysophospholipids with large head groups to cells inhibits Shiga toxin binding.

PubMed

Ailte, Ieva; Lingelem, Anne Berit Dyve; Kavaliauskiene, Simona; Bergan, Jonas; Kvalvaag, Audun Sverre; Myrann, Anne-Grethe; Skotland, Tore; Sandvig, Kirsten

2016-07-26

Shiga toxin (Stx), an AB5 toxin, binds specifically to the neutral glycosphingolipid Gb3 at the cell surface before being transported into cells. We here demonstrate that addition of conical lysophospholipids (LPLs) with large head groups inhibit Stx binding to cells whereas LPLs with small head groups do not. Lysophosphatidylinositol (LPI 18:0), the most efficient LPL with the largest head group, was selected for in-depth investigations to study how the binding of Stx is regulated. We show that the inhibition of Stx binding by LPI is reversible and possibly regulated by cholesterol since addition of methyl-β-cyclodextrin (mβCD) reversed the ability of LPI to inhibit binding. LPI-induced inhibition of Stx binding is independent of signalling and membrane turnover as it occurs in fixed cells as well as after depletion of cellular ATP. Furthermore, data obtained with fluorescent membrane dyes suggest that LPI treatment has a direct effect on plasma membrane lipid packing with shift towards a liquid disordered phase in the outer leaflet, while lysophosphoethanolamine (LPE), which has a small head group, does not. In conclusion, our data show that cellular treatment with conical LPLs with large head groups changes intrinsic properties of the plasma membrane and modulates Stx binding to Gb3.

RNA Helicases at work: binding and rearranging

PubMed Central

Jankowsky, Eckhard

2010-01-01

RNA helicases are ubiquitous, highly conserved enzymes that participate in nearly all aspects of RNA metabolism. These proteins bind or remodel RNA or RNA–protein complexes in an ATP-dependent fashion. How RNA helicases physically perform their cellular tasks has been a longstanding question, but in recent years, intriguing models have started to link structure, mechanism and biological function for some RNA helicases. This review outlines our current view on major structural and mechanistic themes of RNA helicase function, and on emerging physical models for cellular roles of these enzymes. PMID:20813532

The retinoid X receptor agonist, 9-cis UAB30, inhibits cutaneous T-cell lymphoma proliferation through the SKP2-p27kip1 axis.

PubMed

Chou, Chu-Fang; Hsieh, Yu-Hua; Grubbs, Clinton J; Atigadda, Venkatram R; Mobley, James A; Dummer, Reinhard; Muccio, Donald D; Eto, Isao; Elmets, Craig A; Garvey, W Timothy; Chang, Pi-Ling

2018-06-01

Bexarotene (Targretin ® ) is currently the only FDA approved retinoid X receptor (RXR) -selective agonist for the treatment of cutaneous T-cell lymphomas (CTCLs). The main side effects of bexarotene are hypothyroidism and elevation of serum triglycerides (TGs). The novel RXR ligand, 9-cis UAB30 (UAB30) does not elevate serum TGs or induce hypothyroidism in normal subjects. To assess preclinical efficacy and mechanism of action of UAB30 in the treatment of CTCLs and compare its action with bexarotene. With patient-derived CTCL cell lines, we evaluated UAB30 function in regulating growth, apoptosis, cell cycle check points, and cell cycle-related markers. Compared to bexarotene, UAB30 had lower half maximal inhibitory concentration (IC 50 ) values and was more effective in inhibiting the G1 cell cycle checkpoint. Both rexinoids increased the stability of the cell cycle inhibitor, p27kip1 protein, in part, through targeting components involved in the ubiquitination-proteasome system: 1) decreasing SKP2, a F-box protein that binds and targets p27kip1 for degradation by 26S proteasome and 2) suppressing 20S proteasome activity (cell line-dependent) through downregulation of PSMA7, a component of the 20S proteolytic complex in 26S proteasome. UAB30 and bexarotene induce both early cell apoptosis and suppress cell proliferation. Inhibition of the G1 to S cell cycle transition by rexinoids is mediated, in part, through downregulation of SKP2 and/or 20S proteasome activity, leading to increased p27kip1 protein stability. Because UAB30 has minimal effect in elevating serum TGs and inducing hypothyroidism, it is potentially a better alternative to bexarotene for the treatment of CTCLs. Copyright © 2018 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

Peretinoin, an acyclic retinoid, suppresses steatohepatitis and tumorigenesis by activating autophagy in mice fed an atherogenic high-fat diet

PubMed Central

Honda, Masao; Takegoshi, Kai; Yamashita, Taro; Nakamura, Mikiko; Shirasaki, Takayoshi; Sakai, Yoshio; Shimakami, Tetsuro; Nagata, Naoto; Takamura, Toshinari; Tanaka, Takuji; Kaneko, Shuichi

2017-01-01

The pathogenesis of non-alcoholic steatohepatitis (NASH) is still unclear and the prevention of the development of hepatocellular carcinoma (HCC) has not been established. We established an atherogenic and high-fat diet mouse model that develops hepatic steatosis, inflammation, fibrosis, and liver tumors at a high frequency. Using two NASH-HCC mouse models, we showed that peretinoin, an acyclic retinoid, significantly improved liver histology and reduced the incidence of liver tumors. Interestingly, we found that peretinoin induced autophagy in the liver of mice, which was characterized by the increased co-localized expression of microtubule-associated protein light chain 3B-II and lysosome-associated membrane protein 2, and increased autophagosome formation and autophagy flux in the liver. These findings were confirmed using primary mouse hepatocytes. Among representative autophagy pathways, the autophagy related (Atg) 5-Atg12-Atg16L1 pathway was impaired; especially, Atg16L1 was repressed at both the mRNA and protein level. Decreased Atg16L1 mRNA expression was also found in the liver of patients with NASH according to disease progression. Promoter analysis revealed that peretinoin activated the promoter of Atg16L1 by increasing the expression of CCAAT/enhancer-binding-protein-alpha. Interestingly, Atg16L1 overexpression in HepG2 cells inhibited palmitate-induced NF-kB activation and interleukin-6-induced STAT3 activation. We showed that Atg16L1 induced the de-phosphorylation of Gp130, a receptor subunit of interleukin-6 family cytokines, which subsequently repressed phosphorylated-STAT3 (Tyr705) levels, and this process might be independent of autophagy function. Thus, peretinoin prevents the progression of NASH and the development of HCC through activating the autophagy pathway by increased Atg16L1 expression, which is an essential regulator of autophagy and anti-inflammatory proteins. PMID:28591717

Retinoic acid‐induced glandular differentiation of the oesophagus

PubMed Central

Chang, Chih‐Long; Lao‐Sirieix, Pierre; Save, Vicki; De La Cueva Mendez, Guillermo; Laskey, Ron; Fitzgerald, Rebecca C

2007-01-01

Background Retinoic acid (RA) is a powerful differentiation agent. Barrett's oesophagus occurs when duodeno‐gastro‐oesophageal reflux causes squamous epithelium (SE) tissue to become columnar epithelium tissue by an unknown mechanism. The bile acid lithocholic acid (LCA) competes for the retinoid X receptor retinoid binding site. Hence, RA pathways may be implicated in Barrett's oesophagus. Methods RA activity in tissues and cell lines treated with all‐trans retinoic acid (ATRA) with or without LCA was assessed using a reporter. Expression of p21 was determined by real‐time PCR in Barrett's oesophagus cell lines with or without LCA. SE and Barrett's oesophagus biopsy specimens were exposed to 100 μM of ATRA or 20 mM of a RA inhibitor, citral, in organ culture for >72 h. Characteristics of treated specimens, compared with untreated controls, were analysed by immunohistochemical analysis (cytokeratins (CKs), vimentin) and RT‐PCR (CKs). Confocal microscopy assessed temporal changes in co‐localisation of CK8/18 and vimentin. Cell proliferation was assessed by bromo‐deoxyuridine incorporation and immunohistochemical analysis for Ki67 and p21. Results RA biosynthesis was increased in Barrett's oesophagus compared with SE (p<0.001). LCA and ATRA caused a synergistic increase in RA signalling as shown by increased p21 (p<0.01). Morphological and molecular analysis of SE exposed to ATRA showed columnar differentiation independent of proliferation. Metaplasia could be induced from the stromal compartment alone and vimentin expression co‐localised with CK8/18 at 24 h, which separated into CK8/18‐positive glands and vimentin‐positive stroma by 48 h. Citral‐treated Barrett's oesophagus led to phenotypic and immunohistochemical characteristics of SE, which was independent of proliferation. Conclusion RA activity is increased in Barrett's oesophagus and is induced by LCA. Under conditions of altered RA activity and an intact stroma, the oesophageal phenotype can be altered independent of proliferation. PMID:17185354

Suppressive effects of RXR agonist PA024 on adrenal CYP11B2 expression, aldosterone secretion and blood pressure.

PubMed

Suzuki, Dai; Saito-Hakoda, Akiko; Ito, Ryo; Shimizu, Kyoko; Parvin, Rehana; Shimada, Hiroki; Noro, Erika; Suzuki, Susumu; Fujiwara, Ikuma; Kagechika, Hiroyuki; Rainey, William E; Kure, Shigeo; Ito, Sadayoshi; Yokoyama, Atsushi; Sugawara, Akira

2017-01-01

The effects of retinoids on adrenal aldosterone synthase gene (CYP11B2) expression and aldosterone secretion are still unknown. We therefore examined the effects of nuclear retinoid X receptor (RXR) pan-agonist PA024 on CYP11B2 expression, aldosterone secretion and blood pressure, to elucidate its potential as a novel anti-hypertensive drug. We demonstrated that PA024 significantly suppressed angiotensin II (Ang II)-induced CYP11B2 mRNA expression, promoter activity and aldosterone secretion in human adrenocortical H295R cells. Human CYP11B2 promoter functional analyses using its deletion and point mutants indicated that the suppression of CYP11B2 promoter activity by PA024 was in the region from -1521 (full length) to -106 including the NBRE-1 and the Ad5 elements, and the Ad5 element may be mainly involved in the PA024-mediated suppression. PA024 also significantly suppressed the Ang II-induced mRNA expression of transcription factors NURR1 and NGFIB that bind to and activate the Ad5 element. NURR1 overexpression demonstrated that the decrease of NURR1 expression may contribute to the PA024-mediated suppression of CYP11B2 transcription. PA024 also suppressed the Ang II-induced mRNA expression of StAR, HSD3β2 and CYP21A2, a steroidogenic enzyme group involved in aldosterone biosynthesis. Additionally, the PA024-mediated CYP11B2 transcription suppression was shown to be exerted via RXRα. Moreover, the combination of PPARγ agonist pioglitazone and PA024 caused synergistic suppressive effects on CYP11B2 mRNA expression. Finally, PA024 treatment significantly lowered both the systolic and diastolic blood pressure in Tsukuba hypertensive mice (hRN8-12 x hAG2-5). Thus, RXR pan-agonist PA024 may be a candidate anti-hypertensive drugs that acts via the suppression of aldosterone synthesis and secretion.

The retinoid X receptor in a marine invertebrate chordate: evolutionary insights from urochordates.

PubMed

Maeng, Sejung; Lee, Jung Hwan; Choi, Sung-Chang; Kim, Mi Ae; Shin, Yun Kyung; Sohn, Young Chang

2012-09-01

Retinoid X receptors (RXRs) are highly conserved members of the nuclear hormone receptor family that mediate various physiological processes in vertebrates and invertebrates. We examined the expression patterns of RXR in the ascidian Halocynthia roretzi across a wide range of tissues and stages of embryo development, as well as the regulation of gene transcription by the ascidian RXR. H. roretzi RXR cDNA (HrRXR) was cloned from 64-cell stage embryos. The overall amino acid sequence of HrRXR showed high sequence identity with a urochordate Ciona intestinalis RXR (58%), but the ligand-binding domain of HrRXR was more similar to vertebrate orthologs than to those of invertebrate RXRs. Based on a phylogenetic analysis, HrRXR belongs to a group of urochordates that are separate from vertebrate RXRs, showing a clear evolutionary history. Real-time quantitative polymerase chain reaction and whole-mount in situ hybridization analyses revealed that the HrRXR mRNA is of maternal origin during embryogenesis, and in the examined adult tissues it is expressed in the muscles, gills, gonads, and the hepatopancreas. Immunofluorescence and immunohistochemical staining demonstrated that HrRXR is localized to the nucleus and highly expressed in the gills and hepatopancreas. Unlike human RXRα, HrRXR did not show 9-cis retinoic acid- and bexarotene (LGD1069)-dependent transactivation. While a synthetic ligand for farnesoid X receptor (FXR), GW4064, did not increase the transcriptional activation in HrRXR- or HrRXR/HrFXR-transfected HEK-293 cells, the ligand showed weak but significant activity for a single amino acid mutant of HrRXR ((Phe)231(Cys)) and HrFXR cotransfected cells. The present study suggests that the marine invertebrate chordate RXR may possess endogenous ligands that are different than vertebrate RXR ligands and which function during early embryonic stages. Copyright © 2012 Elsevier Inc. All rights reserved.

Imposex induction is mediated through the Retinoid X Receptor signalling pathway in the neogastropod Nucella lapillus.

PubMed

Castro, L Filipe C; Lima, D; Machado, A; Melo, C; Hiromori, Y; Nishikawa, J; Nakanishi, T; Reis-Henriques, M A; Santos, M M

2007-11-15

The imposex phenomenon in female prosobranch gastropods provides one of the best documented examples of endocrine disruption in wildlife. While many field studies have demonstrated the negative impact of tributyltin (TBT) upon female gastropods, the mechanism(s) underlying imposex development has not yet been fully clarified. Over the years several hypotheses have been raised to determine the biochemical and molecular determinants of this process. Nevertheless, the interplay between the different suggested pathways (neuroendocrine, steroid and retinoid) is still unknown. Hence, through a combination of exposure experiments, we show that the 9-cis-retinoic acid (9cisRA), the proposed natural ligand of the retinoic X receptor (RXR), induces imposex in females of Nucella lapillus to the same degree as tributyltin, when administered at similar concentrations (1 microg/g body weight). Methoprene acid, a selective ligand for RXR, also induces imposex, albeit to a lower degree than that of the positive control. In contrast, testosterone significantly induced imposex, but had no effect on female penis induction, while the neuropeptide APGWamide had no effect on imposex development. These results clearly demonstrate that imposex induction in N. lapillus is mediated through the modulation of the RXR signalling pathways. In addition to the effects reported in female dogwhelks, both TBT and RA significantly increased male penis length, thus suggesting that TBT may also impact male secondary sex organs through the RXR signalling pathways. As a step for future studies, we have cloned the orthologue of N. lapillus RXR and provide experimental evidence that it binds 9cisRA. Finally, the basal expression level of RXR in several tissues of N. lapillus was determined through real-time PCR, thus showing that RXR is ubiquitously expressed in mollusc tissues, with the highest expression levels being recorded in female and male gonads. The mechanistic impacts of the overall findings to the imposex process are discussed.

Melanin targeting for intracellular drug delivery: Quantification of bound and free drug in retinal pigment epithelial cells.

PubMed

Rimpelä, Anna-Kaisa; Hagström, Marja; Kidron, Heidi; Urtti, Arto

2018-05-31

Melanin binding affects drug distribution and retention in pigmented ocular tissues, thereby affecting drug response, duration of activity and toxicity. Therefore, it is a promising possibility for drug targeting and controlled release in the pigmented cells and tissues. Intracellular unbound drug concentrations determine pharmacological and toxicological actions, but analyses of unbound vs. total drug concentrations in pigmented cells are lacking. We studied intracellular binding and cellular drug uptake in pigmented retinal pigment epithelial cells and in non-pigmented ARPE-19 cells with five model drugs (chloroquine, propranolol, timolol, diclofenac, methotrexate). The unbound drug fractions in pigmented cells were 0.00016-0.73 and in non-pigmented cells 0.017-1.0. Cellular uptake (i.e. distribution ratio Kp), ranged from 1.3 to 6300 in pigmented cells and from 1.0 to 25 in non-pigmented cells. Values for intracellular bioavailability, F ic , were similar in both cells types (although larger variation in pigmented cells). In vitro melanin binding parameters were used to predict intracellular unbound drug fraction and cell uptake. Comparison of predictions with experimental data indicates that other factors (e.g. ion-trapping, lipophilicity-related binding to other cell components) also play a role. Melanin binding is a major factor that leads to cellular uptake and unbound drug fractions of a range of 3-4 orders of magnitude indicating that large reservoirs of melanin bound drug can be generated in the cells. Understanding melanin binding has important implications on retinal drug targeting, efficacy and toxicity. Copyright © 2017. Published by Elsevier B.V.

Selecting the correct cellular model for assessing of the biological response of collagen-based biomaterials.

PubMed

Davidenko, Natalia; Hamaia, Samir; Bax, Daniel V; Malcor, Jean-Daniel; Schuster, Carlos F; Gullberg, Donald; Farndale, Richard W; Best, Serena M; Cameron, Ruth E

2018-01-01

Accurate evaluation of the biological performance of biomaterials requires the correct assessment of their native-like cell ligation properties. However, cell attachment studies often overlook the details of the substrate-cell binding mechanisms, be they integrin-mediated or non-specific, and ignore the class- and species-specificities of the cell adhesion receptor involved. In this work we have used different collagen (Col) substrates (fibrillar collagens I, II and III and network-forming Col IV), containing different affinity cell-recognition motifs, to establish the influence of the receptor identity and species-specificity on collagen-cell interactive properties. Receptor expression was varied by using cells of different origin, or transfecting collagen-binding integrins into integrin-null cells. These include mouse C2C12 myoblasts transfected with human α1, α2, α10 or α11; human fibrosarcoma HT1080 cells which constitutively express only human α2β1, and rat glioma Rugli cells, with only rat α1β1. Using these lines, the nature of integrin binding sites was studied in order to delineate the bioactivity of different collagen substrates. Integrin ligation was studied on collagen coatings alongside synthetic (GFOGER/GLOGEN) and Toolkit (Col II-28/Col III-7) triple-helical peptides to evaluate (1) their affinity towards different integrins and (2) to confirm the activity of the inserted integrin in the transfected cells. Thin films of dermal and tendon Col I were used to evaluate the influence of the carbodiimide (EDC)-based treatment on the cellular response on Col of different origin. The results showed that the binding properties of transfected C2C12 cells to collagens depend on the identity of inserted integrin. Similar ligation characteristics were observed using α1+ and α10+ cells, but these were distinct from the similar binding features of α2+ and α11+ cells. Recombinant human and rat-α1 I domain binding to collagens and peptides correlated with the cell adhesion results, showing receptor class- and species-specificities. The understanding of the physiologically relevant cell anchorage characteristics of bio-constructs may assist in the selection of (1) the optimum collagen source for cellular supports and (2) the correct cellular model for their biological assessment. This, in turn, may allow reliable prediction of the biological performance of bio-scaffolds in vivo for specific TE applications. Integrins play a vital role in cellular responses to environmental cues during early-stage cell-substrate interaction. We describe physiologically relevant cell anchorage to collagen substrates that present different affinity cell-recognition motifs, to provide experimental tools to assist in understanding integrin binding. Using different cell types and recombinant integrin α1-I-domains, we found that cellular response was highly dependent on collagen type, origin and EDC-crosslinking status, as well as on the integrin class and species of origin. This comprehensive study establishes selectivity amongst the four collagen-binding integrins and species-specific properties that together may influence choice of cell type and receptor in different experimental settings. This work offers key guidance in selecting of the correct cellular model for the biological testing of collagen-based biomaterials. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Loss of selenium-binding protein 1 decreases sensitivity to clastogens and intracellular selenium content in HeLa cells

USDA-ARS?s Scientific Manuscript database

Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesized that loss of SBP1 modulates cellular selenium content and the response of ...

A unique hinge binder of extremely selective aminopyridine-based Mps1 (TTK) kinase inhibitors with cellular activity.

PubMed

Kusakabe, Ken-ichi; Ide, Nobuyuki; Daigo, Yataro; Itoh, Takeshi; Yamamoto, Takahiko; Kojima, Eiichi; Mitsuoka, Yasunori; Tadano, Genta; Tagashira, Sachie; Higashino, Kenichi; Okano, Yousuke; Sato, Yuji; Inoue, Makiko; Iguchi, Motofumi; Kanazawa, Takayuki; Ishioka, Yukichi; Dohi, Keiji; Kido, Yasuto; Sakamoto, Shingo; Ando, Shigeru; Maeda, Masahiro; Higaki, Masayo; Yoshizawa, Hidenori; Murai, Hitoshi; Nakamura, Yusuke

2015-05-01

Mps1, also known as TTK, is a dual-specificity kinase that regulates the spindle assembly check point. Increased expression levels of Mps1 are observed in cancer cells, and the expression levels correlate well with tumor grade. Such evidence points to selective inhibition of Mps1 as an attractive strategy for cancer therapeutics. Starting from an aminopyridine-based lead 3a that binds to a flipped-peptide conformation at the hinge region in Mps1, elaboration of the aminopyridine scaffold at the 2- and 6-positions led to the discovery of 19c that exhibited no significant inhibition for 287 kinases as well as improved cellular Mps1 and antiproliferative activities in A549 lung carcinoma cells (cellular Mps1 IC₅₀=5.3 nM, A549 IC₅₀=26 nM). A clear correlation between cellular Mps1 and antiproliferative IC₅₀ values indicated that the antiproliferative activity observed in A549 cells would be responsible for the cellular inhibition of Mps1. The X-ray structure of 19c in complex with Mps1 revealed that this compound retains the ability to bind to the peptide flip conformation. Finally, comparative analysis of the X-ray structures of 19c, a deamino analogue 33, and a known Mps1 inhibitor bound to Mps1 provided insights into the unique binding mode at the hinge region. Copyright © 2015 Elsevier Ltd. All rights reserved.

Regulation of calreticulin–major histocompatibility complex (MHC) class I interactions by ATP

PubMed Central

Wijeyesakere, Sanjeeva Joseph; Gagnon, Jessica K.; Arora, Karunesh; Brooks, Charles L.; Raghavan, Malini

2015-01-01

The MHC class I peptide loading complex (PLC) facilitates the assembly of MHC class I molecules with peptides, but factors that regulate the stability and dynamics of the assembly complex are largely uncharacterized. Based on initial findings that ATP, in addition to MHC class I-specific peptide, is able to induce MHC class I dissociation from the PLC, we investigated the interaction of ATP with the chaperone calreticulin, an endoplasmic reticulum (ER) luminal, calcium-binding component of the PLC that is known to bind ATP. We combined computational and experimental measurements to identify residues within the globular domain of calreticulin, in proximity to the high-affinity calcium-binding site, that are important for high-affinity ATP binding and for ATPase activity. High-affinity calcium binding by calreticulin is required for optimal nucleotide binding, but both ATP and ADP destabilize enthalpy-driven high-affinity calcium binding to calreticulin. ATP also selectively destabilizes the interaction of calreticulin with cellular substrates, including MHC class I molecules. Calreticulin mutants that affect ATP or high-affinity calcium binding display prolonged associations with monoglucosylated forms of cellular MHC class I, delaying MHC class I dissociation from the PLC and their transit through the secretory pathway. These studies reveal central roles for ATP and calcium binding as regulators of calreticulin–substrate interactions and as key determinants of PLC dynamics. PMID:26420867

Inhibition of Catalase by Tea Catechins in Free and Cellular State: A Biophysical Approach

PubMed Central

Pal, Sandip; Dey, Subrata Kumar; Saha, Chabita

2014-01-01

Tea flavonoids bind to variety of enzymes and inhibit their activities. In the present study, binding and inhibition of catalase activity by catechins with respect to their structure-affinity relationship has been elucidated. Fluorimetrically determined binding constants for (−)-epigallocatechin gallate (EGCG) and (−)-epicatechin gallate (ECG) with catalase were observed to be 2.27×106 M−1 and 1.66×106 M−1, respectively. Thermodynamic parameters evidence exothermic and spontaneous interaction between catechins and catalase. Major forces of interaction are suggested to be through hydrogen bonding along with electrostatic contributions and conformational changes. Distinct loss of α-helical structure of catalase by interaction with EGCG was captured in circular dichroism (CD) spectra. Gallated catechins demonstrated higher binding constants and inhibition efficacy than non-gallated catechins. EGCG exhibited maximum inhibition of pure catalase. It also inhibited cellular catalase in K562 cancer cells with significant increase in cellular ROS and suppression of cell viability (IC50 54.5 µM). These results decipher the molecular mechanism by which tea catechins interact with catalase and highlight the potential of gallated catechin like EGCG as an anticancer drug. EGCG may have other non-specific targets in the cell, but its anticancer property is mainly defined by ROS accumulation due to catalase inhibition. PMID:25025898

Cross-neutralizing human anti-poliovirus antibodies bind the recognition site for cellular receptor

PubMed Central

Chen, Zhaochun; Fischer, Elizabeth R.; Kouiavskaia, Diana; Hansen, Bryan T.; Ludtke, Steven J.; Bidzhieva, Bella; Makiya, Michelle; Agulto, Liane; Purcell, Robert H.; Chumakov, Konstantin

2013-01-01

Most structural information about poliovirus interaction with neutralizing antibodies was obtained in the 1980s in studies of mouse monoclonal antibodies. Recently we have isolated a number of human/chimpanzee anti-poliovirus antibodies and demonstrated that one of them, MAb A12, could neutralize polioviruses of both serotypes 1 and 2. This communication presents data on isolation of an additional cross-neutralizing antibody (F12) and identification of a previously unknown epitope on the surface of poliovirus virions. Epitope mapping was performed by sequencing of antibody-resistant mutants and by cryo-EM of complexes of virions with Fab fragments. The results have demonstrated that both cross-neutralizing antibodies bind the site located at the bottom of the canyon surrounding the fivefold axis of symmetry that was previously shown to interact with cellular poliovirus receptor CD155. However, the same antibody binds to serotypes 1 and 2 through different specific interactions. It was also shown to interact with type 3 poliovirus, albeit with about 10-fold lower affinity, insufficient for effective neutralization. Antibody interaction with the binding site of the cellular receptor may explain its broad reactivity and suggest that further screening or antibody engineering could lead to a universal antibody capable of neutralizing all three serotypes of poliovirus. PMID:24277851

The conserved regulation of mitochondrial uncoupling proteins: From unicellular eukaryotes to mammals.

PubMed

Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

2017-01-01

Uncoupling proteins (UCPs) belong to the mitochondrial anion carrier protein family and mediate regulated proton leak across the inner mitochondrial membrane. Free fatty acids, aldehydes such as hydroxynonenal, and retinoids activate UCPs. However, there are some controversies about the effective action of retinoids and aldehydes alone; thus, only free fatty acids are commonly accepted positive effectors of UCPs. Purine nucleotides such as GTP inhibit UCP-mediated mitochondrial proton leak. In turn, membranous coenzyme Q may play a role as a redox state-dependent metabolic sensor that modulates the complete activation/inhibition of UCPs. Such regulation has been observed for UCPs in microorganisms, plant and animal UCP1 homologues, and UCP1 in mammalian brown adipose tissue. The origin of UCPs is still under debate, but UCP homologues have been identified in all systematic groups of eukaryotes. Despite the differing levels of amino acid/DNA sequence similarities, functional studies in unicellular and multicellular organisms, from amoebae to mammals, suggest that the mechanistic regulation of UCP activity is evolutionarily well conserved. This review focuses on the regulatory feedback loops of UCPs involving free fatty acids, aldehydes, retinoids, purine nucleotides, and coenzyme Q (particularly its reduction level), which may derive from the early stages of evolution as UCP first emerged. Copyright © 2016 Elsevier B.V. All rights reserved.

Cell-type-specific regulation of the retinoic acid receptor mediated by the orphan nuclear receptor TLX.

PubMed

Kobayashi, M; Yu, R T; Yasuda, K; Umesono, K

2000-12-01

Malformations in the eye can be caused by either an excess or deficiency of retinoids. An early target gene of the retinoid metabolite, retinoic acid (RA), is that encoding one of its own receptors, the retinoic acid receptor beta (RARbeta). To better understand the mechanisms underlying this autologous regulation, we characterized the chick RARbeta2 promoter. The region surrounding the transcription start site of the avian RARbeta2 promoter is over 90% conserved with the corresponding region in mammals and confers strong RA-dependent transactivation in primary cultured embryonic retina cells. This response is selective for RAR but not retinoid X receptor-specific agonists, demonstrating a principal role for RAR(s) in retina cells. Retina cells exhibit a far higher sensitivity to RA than do fibroblasts or osteoblasts, a property we found likely due to expression of the orphan nuclear receptor TLX. Ectopic expression of TLX in fibroblasts resulted in increased sensitivity to RA induction, an effect that is conserved between chick and mammals. We have identified a cis element, the silencing element relieved by TLX (SET), within the RARbeta2 promoter region which confers TLX- and RA-dependent transactivation. These results indicate an important role for TLX in autologous regulation of the RARbeta gene in the eye.

Cell-Type-Specific Regulation of the Retinoic Acid Receptor Mediated by the Orphan Nuclear Receptor TLX†

PubMed Central

Kobayashi, Mime; Yu, Ruth T.; Yasuda, Kunio; Umesono, Kazuhiko

2000-01-01

Malformations in the eye can be caused by either an excess or deficiency of retinoids. An early target gene of the retinoid metabolite, retinoic acid (RA), is that encoding one of its own receptors, the retinoic acid receptor β (RARβ). To better understand the mechanisms underlying this autologous regulation, we characterized the chick RARβ2 promoter. The region surrounding the transcription start site of the avian RARβ2 promoter is over 90% conserved with the corresponding region in mammals and confers strong RA-dependent transactivation in primary cultured embryonic retina cells. This response is selective for RAR but not retinoid X receptor-specific agonists, demonstrating a principal role for RAR(s) in retina cells. Retina cells exhibit a far higher sensitivity to RA than do fibroblasts or osteoblasts, a property we found likely due to expression of the orphan nuclear receptor TLX. Ectopic expression of TLX in fibroblasts resulted in increased sensitivity to RA induction, an effect that is conserved between chick and mammals. We have identified a cis element, the silencing element relieved by TLX (SET), within the RARβ2 promoter region which confers TLX- and RA-dependent transactivation. These results indicate an important role for TLX in autologous regulation of the RARβ gene in the eye. PMID:11073974

9-cis-Retinoic Acid Promotes Cell Adhesion Through Integrin Dependent and Independent Mechanisms Across Immune Lineages

PubMed Central

Whelan, Jarrett T.; Chen, Jianming; Miller, Jabin; Morrow, Rebekah L.; Lingo, Joshuah D.; Merrell, Kaitlin; Shaikh, Saame Raza; Bridges, Lance C.

2012-01-01

Retinoids are essential in the proper establishment and maintenance of immunity. Although retinoids are implicated in immune related processes, their role in immune cell adhesion has not been well established. In this study, the effect of 9-cis-retinoic acid (9-cis-RA) on human hematopoietic cell adhesion was investigated. 9-cis-RA treatment specifically induced cell adhesion of the human immune cell lines HuT-78, NB4, RPMI 8866, and U937. Due to the prominent role of integrin receptors in mediating immune cell adhesion, we sought to evaluate if cell adhesion was integrin-dependent. By employing a variety of integrin antagonist including function-blocking antibodies and EDTA, we establish that 9-cis-RA prompts immune cell adhesion through established integrin receptors in addition to a novel integrin-independent process. The novel integrin-independent adhesion required the presence of retinoid and was attenuated by treatment with synthetic corticosteroids. Finally, we demonstrate that 9-cis-RA treatment of primary murine B-cells induces ex vivo adhesion that persists in the absence of integrin function. Our study is the first to demonstrate that 9-cis-retinoic acid influences immune cell adhesion through at least two functionally distinct mechanisms. PMID:22925918

Focal epithelial hyperplasia by human papillomavirus (HPV)-32 misdiagnosed as HPV-16 and treated with combination of retinoids, imiquimod and quadrivalent HPV vaccine.

PubMed

Gemigniani, Franco; Hernández-Losa, Javier; Ferrer, Berta; García-Patos, Vicente

2015-12-01

Focal epithelial hyperplasia (FEH) or Heck's disease is a rare, benign and asymptomatic mucosal proliferation associated with human papillomavirus (HPV) infection, mainly with genotypes 13 and 32. We report a florid case of FEH in an 11-year-old Haitian girl with systemic lupus erythematosus receiving immunosuppressive therapy. Cryotherapy was previously performed on numerous occasions with no results. We decided to prescribe a non-invasive and more comfortable treatment. A combination of topical retinoid and imiquimod cream was well tolerated and led to an important improvement. The evidence of infection by HPV-16 detected by polymerase chain reaction (PCR) technique, prompted us to prescribe the quadrivalent HPV vaccine (types 6, 11,16 and 18). Subsequent PCR sequencing with generic primers GP5-GP6 and further BLAST comparative analysis confirmed that genomic viral sequence in our case truly corresponded with HPV-32. This molecular misdiagnosis can be explained by the similarity between genomic sequences of both HPV-16 and -32 genotypes. At the 1-year follow up, we observed total clinical improvement and no recurrences of the disease. Complete healing in this case may correspond to a potential action of topical retinoid, imiquimod and the cross-protection mechanism of the quadrivalent HPV vaccine. © 2015 Japanese Dermatological Association.

Maternal retinoids control type 3 innate lymphoid cells and set the offspring immunity

NASA Astrophysics Data System (ADS)

van de Pavert, Serge A.; Ferreira, Manuela; Domingues, Rita G.; Ribeiro, Hélder; Molenaar, Rosalie; Moreira-Santos, Lara; Almeida, Francisca F.; Ibiza, Sales; Barbosa, Inês; Goverse, Gera; Labão-Almeida, Carlos; Godinho-Silva, Cristina; Konijn, Tanja; Schooneman, Dennis; O'Toole, Tom; Mizee, Mark R.; Habani, Yasmin; Haak, Esther; Santori, Fabio R.; Littman, Dan R.; Schulte-Merker, Stefan; Dzierzak, Elaine; Simas, J. Pedro; Mebius, Reina E.; Veiga-Fernandes, Henrique

2014-04-01

The impact of nutritional status during fetal life on the overall health of adults has been recognized; however, dietary effects on the developing immune system are largely unknown. Development of secondary lymphoid organs occurs during embryogenesis and is considered to be developmentally programmed. Secondary lymphoid organ formation depends on a subset of type 3 innate lymphoid cells (ILC3) named lymphoid tissue inducer (LTi) cells. Here we show that mouse fetal ILC3s are controlled by cell-autonomous retinoic acid (RA) signalling in utero, which pre-sets the immune fitness in adulthood. We found that embryonic lymphoid organs contain ILC progenitors that differentiate locally into mature LTi cells. Local LTi cell differentiation was controlled by maternal retinoid intake and fetal RA signalling acting in a haematopoietic cell-autonomous manner. RA controlled LTi cell maturation upstream of the transcription factor RORγt. Accordingly, enforced expression of Rorgt restored maturation of LTi cells with impaired RA signalling, whereas RA receptors directly regulated the Rorgt locus. Finally, we established that maternal levels of dietary retinoids control the size of secondary lymphoid organs and the efficiency of immune responses in the adult offspring. Our results reveal a molecular link between maternal nutrients and the formation of immune structures required for resistance to infection in the offspring.

Maternal retinoids control type 3 innate lymphoid cells and set the offspring immunity.

PubMed

van de Pavert, Serge A; Ferreira, Manuela; Domingues, Rita G; Ribeiro, Hélder; Molenaar, Rosalie; Moreira-Santos, Lara; Almeida, Francisca F; Ibiza, Sales; Barbosa, Inês; Goverse, Gera; Labão-Almeida, Carlos; Godinho-Silva, Cristina; Konijn, Tanja; Schooneman, Dennis; O'Toole, Tom; Mizee, Mark R; Habani, Yasmin; Haak, Esther; Santori, Fabio R; Littman, Dan R; Schulte-Merker, Stefan; Dzierzak, Elaine; Simas, J Pedro; Mebius, Reina E; Veiga-Fernandes, Henrique

2014-04-03

The impact of nutritional status during fetal life on the overall health of adults has been recognized; however, dietary effects on the developing immune system are largely unknown. Development of secondary lymphoid organs occurs during embryogenesis and is considered to be developmentally programmed. Secondary lymphoid organ formation depends on a subset of type 3 innate lymphoid cells (ILC3) named lymphoid tissue inducer (LTi) cells. Here we show that mouse fetal ILC3s are controlled by cell-autonomous retinoic acid (RA) signalling in utero, which pre-sets the immune fitness in adulthood. We found that embryonic lymphoid organs contain ILC progenitors that differentiate locally into mature LTi cells. Local LTi cell differentiation was controlled by maternal retinoid intake and fetal RA signalling acting in a haematopoietic cell-autonomous manner. RA controlled LTi cell maturation upstream of the transcription factor RORγt. Accordingly, enforced expression of Rorgt restored maturation of LTi cells with impaired RA signalling, whereas RA receptors directly regulated the Rorgt locus. Finally, we established that maternal levels of dietary retinoids control the size of secondary lymphoid organs and the efficiency of immune responses in the adult offspring. Our results reveal a molecular link between maternal nutrients and the formation of immune structures required for resistance to infection in the offspring.

Hyperlipidemia secondary to acitretin therapy for lamellar ichthyosis associated with a NIPAL4 mutation improves on a plant-based diet and relapses on a standard Western diet.

PubMed

Lin, Jonathan C; Massera, Daniele; Ghalib, Mohammad; Marion, Robert; Graf, Lauren; Cohen, Steven R; Ostfeld, Robert J

2018-04-01

Oral retinoids are commonly prescribed for many dermatological conditions and may induce hyperlipidemia. We document the case of a 35-year-old man taking acitretin for congenital lamellar ichthyosis associated with a homozygous deleterious mutation in NIPAL4 who developed retinoid-induced hyperlipidemia that responded dramatically to a whole-food plant-based (WFPB) diet. On presentation, his diet consisted of chicken, fish, low fat meats and dairy, grains, and some fruits and vegetables. He then adopted a WFPB diet without making changes to his medications. His serum lipid levels dropped and his exercise capacity improved. Five months later, after discontinuing the plant-based diet and returning to his baseline diet, his hyperlipidemia returned and persisted despite adjustments to his medications. After a year and a half, the patient again adopted a plant-based diet and his lipid levels fell sharply again. A WFPB diet helped improve and control serum lipid levels in a patient with retinoid-induced hyperlipidemia. Future interventions should focus on ways to help patients successfully adopt and maintain a WFPB diet, as increased adherence to a healthy lifestyle is associated with greater health benefits. Copyright © 2018 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

Molecular characterization and gene expression patterns of retinoid receptors, in normal and regenerating tissues of the sea cucumber, Holothuria glaberrima.

PubMed

Viera-Vera, Jorge; García-Arrarás, José E

2018-05-15

Retinoic acid receptors (RAR) and retinoid X receptors (RXR) are ligand-mediated transcription factors that synchronize intricate signaling networks in metazoans. Dimer formation between these two nuclear receptors mediates the recruitment of co-regulatory complexes coordinating the progression of signaling cascades during developmental and regenerative events. In the present study we identified and characterized the receptors for retinoic acid in the sea cucumber Holothuria glaberrima; a model system capable of regenerative organogenesis during adulthood. Molecular characterizations revealed the presence of three isoforms of RAR and two of RXR as a consequence of alternative splicing events. Various analyses including: primary structure sequencing, phylogenetic analysis, protein domain prediction, and multiple sequence alignment further confirmed their identity. Semiquantitative reverse transcription PCR analysis of each receptor isoform herein identified showed that the retinoid receptors are expressed in all tissues sampled: the mesenteries, respiratory trees, muscles, gonads, and the digestive tract. During regenerative organogenesis two of the receptors (RAR-L and RXR-T) showed differential expression in the posterior segment while RAR-S is differentially expressed in the anterior segment of the intestine. This work presents the first description of the components relaying the signaling for retinoic acid within this model system. Copyright © 2018 Elsevier B.V. All rights reserved.

Mesodermal and neuronal retinoids regulate the induction and maintenance of limb innervating spinal motor neurons.

PubMed

Ji, Sheng-Jian; Zhuang, BinQuan; Falco, Crystal; Schneider, André; Schuster-Gossler, Karin; Gossler, Achim; Sockanathan, Shanthini

2006-09-01

During embryonic development, the generation, diversification and maintenance of spinal motor neurons depend upon extrinsic signals that are tightly regulated. Retinoic acid (RA) is necessary for specifying the fates of forelimb-innervating motor neurons of the Lateral Motor Column (LMC), and the specification of LMC neurons into medial and lateral subtypes. Previous studies implicate motor neurons as the relevant source of RA for specifying lateral LMC fates at forelimb levels. However, at the time of LMC diversification, a significant amount of retinoids in the spinal cord originates from the adjacent paraxial mesoderm. Here we employ mouse genetics to show that RA derived from the paraxial mesoderm is required for lateral LMC induction at forelimb and hindlimb levels, demonstrating that mesodermally synthesized RA functions as a second source of signals to specify lateral LMC identity. Furthermore, reduced RA levels in postmitotic motor neurons result in a decrease of medial and lateral LMC neurons, and abnormal axonal projections in the limb; invoking additional roles for neuronally synthesized RA in motor neuron maintenance and survival. These findings suggest that during embryogenesis, mesodermal and neuronal retinoids act coordinately to establish and maintain appropriate cohorts of spinal motor neurons that innervate target muscles in the limb.

Stress- and Rho-activated ZO-1–associated nucleic acid binding protein binding to p21 mRNA mediates stabilization, translation, and cell survival

PubMed Central

Nie, Mei; Balda, Maria S.; Matter, Karl

2012-01-01

A central component of the cellular stress response is p21WAF1/CIP1, which regulates cell proliferation, survival, and differentiation. Inflammation and cell stress often up-regulate p21 posttranscriptionally by regulatory mechanisms that are poorly understood. ZO-1–associated nucleic acid binding protein (ZONAB)/DbpA is a Y-box transcription factor that is regulated by components of intercellular junctions that are affected by cytokines and tissue damage. We therefore asked whether ZONAB activation is part of the cellular stress response. Here, we demonstrate that ZONAB promotes cell survival in response to proinflammatory, hyperosmotic, and cytotoxic stress and that stress-induced ZONAB activation involves the Rho regulator GEF-H1. Unexpectedly, stress-induced ZONAB activation does not stimulate ZONAB’s activity as a transcription factor but leads to the posttranscriptional up-regulation of p21 protein and mRNA. Up-regulation is mediated by ZONAB binding to specific sites in the 3′-untranslated region of the p21 mRNA, resulting in mRNA stabilization and enhanced translation. Binding of ZONAB to mRNA is activated by GEF-H1 via Rho stimulation and also mediates Ras-induced p21 expression. We thus identify a unique type of stress and Rho signaling activated pathway that drives mRNA stabilization and translation and links the cellular stress response to p21 expression and cell survival. PMID:22711822

Retinoids Modulate Expression of the Endocytic Partners Megalin, Cubilin, and Disabled-2 and Uptake of Vitamin D-Binding Protein in Human Mammary Cells12

PubMed Central

Chlon, Timothy M.; Taffany, David A.; Welsh, JoEllen; Rowling, Matthew J.

2008-01-01

The major circulating form of vitamin D, 25-hydroxycholecalciferol (25D3), circulates bound to vitamin D-binding protein (DBP). Prior to activation to 1,25-dihydroxycholecalciferol in the kidney, the 25D3-DBP complex is internalized via receptor-mediated endocytosis, which is absolutely dependent on the membrane receptors megalin and cubilin and the adaptor protein disabled-2 (Dab2). We recently reported that mammary epithelial cells (T-47D) expressing megalin, cubilin, and Dab2 rapidly internalize DBP via endocytosis, whereas cells that do not express all 3 proteins (MCF-7) do not. The objectives of this study were to characterize megalin, cubilin, and Dab2 expression and transport of DBP in human mammary epithelial cells. Using immunoblotting and real-time PCR, we found that megalin, cubilin, and Dab2 were expressed and dose dependently induced by all-trans-retinoic acid (RA) in T-47D human breast cancer cells and that RA-treated T-47D cells exhibited enhanced DBP internalization. These are the first studies to our knowledge to demonstrate that mammary epithelial cells express megalin, cubilin, and Dab2, which are enhanced during differentiation and may explain, at least in part, our finding that receptor-mediated endocytosis of DBP is upregulated in differentiated mammary epithelial cells. PMID:18567755

Stat1-Vitamin D Receptor Interactions Antagonize 1,25-Dihydroxyvitamin D Transcriptional Activity and Enhance Stat1-Mediated Transcription

PubMed Central

Vidal, Marcos; Ramana, Chilakamarti V.; Dusso, Adriana S.

2002-01-01

The cytokine gamma interferon (IFN-γ) and the calcitropic steroid hormone 1,25-dihydroxyvitamin D (1,25D) are activators of macrophage immune function. In sarcoidosis, tuberculosis, and several granulomatoses, IFN-γ induces 1,25D synthesis by macrophages and inhibits 1,25D induction of 24-hydroxylase, a key enzyme in 1,25D inactivation, causing high levels of 1,25D in serum and hypercalcemia. This study delineates IFN-γ-1,25D cross talk in human monocytes-macrophages. Nuclear accumulation of Stat1 and vitamin D receptor (VDR) by IFN-γ and 1,25D promotes protein-protein interactions between Stat1 and the DNA binding domain of the VDR. This prevents VDR-retinoid X receptor (RXR) binding to the vitamin D-responsive element, thus diverting the VDR from its normal genomic target on the 24-hydroxylase promoter and antagonizing 1,25D-VDR transactivation of this gene. In contrast, 1,25D enhances IFN-γ action. Stat1-VDR interactions, by preventing Stat1 deactivation by tyrosine dephosphorylation, cooperate with IFN-γ/Stat1-induced transcription. This novel 1,25D-IFN-γ cross talk explains the pathogenesis of abnormal 1,25D homeostasis in granulomatous processes and provides new insights into 1,25D immunomodulatory properties. PMID:11909970

Antenatal retinoic acid administration increases trophoblastic retinol-binding protein dependent retinol transport in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Kutasy, Balazs; Friedmacher, Florian; Pes, Lara; Coyle, David; Doi, Takashi; Paradisi, Francesca; Puri, Prem

2016-04-01

Low pulmonary retinol levels and disrupted retinoid signaling pathway (RSP) have been implicated in the pathogenesis of congenital diaphragmatic hernia (CDH) and associated pulmonary hypoplasia (PH). It has been demonstrated that nitrofen disturbs the main retinol-binding protein (RBP)-dependent trophoblastic retinol transport. Several studies have demonstrated that prenatal treatment with retinoic acid (RA) can reverse PH in the nitrofen-induced CDH model. We hypothesized that maternal administration of RA can increase trophoblastic RBP-dependent retinol transport in a nitrofen model of CDH. Pregnant rats were treated with nitrofen or vehicle on gestational day 9 (D9) and sacrificed on D21. RA was given i.p. on D18, D19, and D20. Retinol and RA levels were measured using high-performance liquid chromatography. Immunohistochemistry was performed to evaluate trophoblastic expression of RBP. Expression levels of the primary RSP genes were determined using quantitative real-time PCR and immunohistochemistry. Markedly increased trophoblastic RBP immunoreactivity was observed in CDH+RA compared to CDH. Significantly increased serum and pulmonary retinol and RA levels were detected in CDH+RA compared to CDH. Pulmonary expression of RSP genes and proteins were increased in CDH+RA compared to CDH. Increased trophoblastic RBP expression and retinol transport after antenatal administration of RA suggest that retinol-triggered RSP activation may attenuate CDH-associated PH by elevating serum and pulmonary retinol levels.

Interaction of AIM with insulin-like growth factor-binding protein-4.

PubMed

You, Qiang; Wu, Yan; Yao, Nannan; Shen, Guannan; Zhang, Ying; Xu, Liangguo; Li, Guiying; Ju, Cynthia

2015-09-01

Apoptosis inhibitor of macrophages (AIM/cluster of differentiation 5 antigen-like/soluble protein α) has been shown to inhibit cellular apoptosis; however, the underlying molecular mechanism has not been elucidated. Using yeast two‑hybrid screening, the present study uncovered that AIM binds to insulin‑like growth factor binding protein‑4 (IGFBP‑4). AIM interaction with IGFBP‑4, as well as IGFBP‑2 and ‑3, but not with IGFBP‑1, ‑5 and ‑6, was further confirmed by co‑immunoprecipitation (co‑IP) using 293 cells. The binding activity and affinity between AIM and IGFBP‑4 in vitro were analyzed by co‑IP and biolayer interferometry. Serum depletion‑induced cellular apoptosis was attenuated by insulin‑like growth factor‑I (IGF‑I), and this effect was abrogated by IGFBP‑4. Of note, in the presence of AIM, the inhibitory effect of IGFBP‑4 on the anti‑apoptosis function of IGF‑I was attenuated, possibly through binding of AIM with IGFBP‑4. In conclusion, to the best of our knowledge, the present study provides the first evidence that AIM binds to IGFBP‑2, ‑3 and ‑4. The data suggest that this interaction may contribute to the mechanism of AIM-mediated anti-apoptosis function.

Interaction of AIM with insulin-like growth factor-binding protein-4

PubMed Central

YOU, QIANG; WU, YAN; YAO, NANNAN; SHEN, GUANNAN; ZHANG, YING; XU, LIANGGUO; LI, GUIYING; JU, CYNTHIA

2015-01-01

Apoptosis inhibitor of macrophages (AIM/cluster of differentiation 5 antigen-like/soluble protein α) has been shown to inhibit cellular apoptosis; however, the underlying molecular mechanism has not been elucidated. Using yeast two-hybrid screening, the present study uncovered that AIM binds to insulin-like growth factor binding protein-4 (IGFBP-4). AIM interaction with IGFBP-4, as well as IGFBP-2 and -3, but not with IGFBP-1, -5 and -6, was further confirmed by co-immunoprecipitation (co-IP) using 293 cells. The binding activity and affinity between AIM and IGFBP-4 in vitro were analyzed by co-IP and biolayer interferometry. Serum depletion-induced cellular apoptosis was attenuated by insulin-like growth factor-I (IGF-I), and this effect was abrogated by IGFBP-4. Of note, in the presence of AIM, the inhibitory effect of IGFBP-4 on the anti-apoptosis function of IGF-I was attenuated, possibly through binding of AIM with IGFBP-4. In conclusion, to the best of our knowledge, the present study provides the first evidence that AIM binds to IGFBP-2, -3 and -4. The data suggest that this interaction may contribute to the mechanism of AIM-mediated anti-apoptosis function. PMID:26135353

A role for retinoids in human oocyte fertilization: regulation of connexin 43 by retinoic acid in cumulus granulosa cells

PubMed Central

Best, Monica W.; Wu, Juanjuan; Pauli, Samuel A.; Kane, Maureen A.; Pierzchalski, Keely; Session, Donna R.; Woods, Dori C.; Shang, Weirong; Taylor, Robert N.; Sidell, Neil

2015-01-01

Retinoids are essential for ovarian steroid production and oocyte maturation in mammals. Oocyte competency is known to positively correlate with efficient gap junction intercellular communication (GJIC) among granulosa cells in the cumulus-oocyte complex. Connexin 43 (Cx43) is the main subunit of gap junction channels in human cumulus granulosa cells (CGC) and is regulated by all-trans retinoic acid (ATRA) in other hormone responsive cell types. The objectives of this study were to quantify retinoid levels in human CGC obtained during IVF oocyte retrievals, to investigate the potential relationship between CGC ATRA levels and successful oocyte fertilization, and to determine the effects of ATRA on Cx43 protein expression in CGC. Results showed that CGC cultures actively metabolize retinol to produce ATRA. Grouped according to fertilization rate tertiles, mean ATRA levels were 2-fold higher in pooled CGC from women in the highest versus the lowest tertile (P < 0.05). ATRA induced a rapid dephosphorylation of Cx43 in CGC and granulosa cell line (KGN) cultures resulting in a >2-fold increase in the expression of the functional non-phosphorylated (P0) species (P < 0.02). Similar enhancement of P0 by ATRA was shown in CGC and KGN cultures co-treated with LH or hCG which, by themselves, enhanced the protein levels of Cx43 without altering its phosphorylation profile. Correspondingly, the combination of ATRA+hCG treatment of KGN caused a significant increase in GJIC compared with single agent treatments (P < 0.025) and a doubling of GJIC from that seen in untreated cells (P < 0.01). These findings indicate that CGC are a primary site of retinoid uptake and ATRA biosynthesis. Regulation of Cx43 by ATRA may serve an important role in folliculogenesis, development of oocyte competency, and successful fertilization by increasing GJIC in CGC. PMID:25877907

All-trans-retinoic Acid Modulates the Plasticity and Inhibits the Motility of Breast Cancer Cells: ROLE OF NOTCH1 AND TRANSFORMING GROWTH FACTOR (TGFβ).

PubMed

Zanetti, Adriana; Affatato, Roberta; Centritto, Floriana; Fratelli, Maddalena; Kurosaki, Mami; Barzago, Maria Monica; Bolis, Marco; Terao, Mineko; Garattini, Enrico; Paroni, Gabriela

2015-07-17

All-trans-retinoic acid (ATRA) is a natural compound proposed for the treatment/chemoprevention of breast cancer. Increasing evidence indicates that aberrant regulation of epithelial-to-mesenchymal transition (EMT) is a determinant of the cancer cell invasive and metastatic behavior. The effects of ATRA on EMT are largely unknown. In HER2-positive SKBR3 and UACC812 cells, showing co-amplification of the ERBB2 and RARA genes, ATRA activates a RARα-dependent epithelial differentiation program. In SKBR3 cells, this causes the formation/reorganization of adherens and tight junctions. Epithelial differentiation and augmented cell-cell contacts underlie the anti-migratory action exerted by the retinoid in cells exposed to the EMT-inducing factors EGF and heregulin-β1. Down-regulation of NOTCH1, an emerging EMT modulator, is involved in the inhibition of motility by ATRA. Indeed, the retinoid blocks NOTCH1 up-regulation by EGF and/or heregulin-β1. Pharmacological inhibition of γ-secretase and NOTCH1 processing also abrogates SKBR3 cell migration. Stimulation of TGFβ contributes to the anti-migratory effect of ATRA. The retinoid switches TGFβ from an EMT-inducing and pro-migratory determinant to an anti-migratory mediator. Inhibition of the NOTCH1 pathway not only plays a role in the anti-migratory action of ATRA; it is relevant also for the anti-proliferative activity of the retinoid in HCC1599 breast cancer cells, which are addicted to NOTCH1 for growth/viability. This effect is enhanced by the combination of ATRA and the γ-secretase inhibitor N-(N-(3,5-difluorophenacetyl)-l-alanyl)-S-phenylglycine t-butyl ester, supporting the concept that the two compounds act at the transcriptional and post-translational levels along the NOTCH1 pathway. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Retinoids in pediatric onco-hematology: the model of acute promyelocytic leukemia and neuroblastoma.

PubMed

Masetti, Riccardo; Biagi, Carlotta; Zama, Daniele; Vendemini, Francesca; Martoni, Anna; Morello, William; Gasperini, Pietro; Pession, Andrea

2012-09-01

Retinoids are lipophilic compounds derived from vitamin A, which have been extensively studied in cancer prevention and therapy. In pediatric oncology, they are successfully used for the treatment of acute promyelocytic leukemia (APL) and high-risk neuroblastoma (HR-NBL). APL is a subtype of acute myeloid leukemia (AML) clinically characterized by a severe bleeding tendency with a highrisk of fatal hemorrhage. The molecular hallmark of this disease is the presence of the promyelocytic leukemia (PML)-retinoic acid receptor-α (RAR α) gene fusion that plays a critical role in promyelocytic leukemogenesis and represents the target of retinoid therapy. The introduction in the late 1980s of all-trans retinoic acid (ATRA) into the therapy of APL radically changed the management and the outcome of this disease. Presently, the standard front-line therapeutic approach for pediatric APL includes anthracycline-based chemotherapy and ATRA, leading to a complete remission in almost 90% of the patients. Neuroblastoma (NBL) is an aggressive childhood tumor derived from the peripheral neural crest. More than half of patients have a high-risk disease, with a poor outcome despite intensive multimodal treatment. Although the exact mechanism of action remains unclear, the introduction of 13-cis-retinoic acid (13-cis-RA) in the therapy of NBL has improved the prognosis of this disease. Currently, the standard treatment for HR-NBL consists of myeloablative therapy followed by autologous hematopoietic stem cell transplantation (HSCT) and maintenance with 13-cis-RA for the treatment of minimal residual disease, leading to a 3-year disease-free survival rate (DFS) of about 50%. In this paper the authors provide a review of the peer-reviewed literature on the role of retinoids in the treatment of pediatric APL and HR-NBL, summarizing the most relevant clinical trial results of the last decades, analyzing the ongoing trials, and investigating future therapeutic perspectives of children affected by these diseases.

Comparative teratology and transplacental pharmacokinetics of all-trans-retinoic acid, 13-cis-retinoic acid, and retinyl palmitate following daily administrations in rats.

PubMed

Collins, M D; Tzimas, G; Hummler, H; Bürgin, H; Nau, H

1994-07-01

The retinoids are teratogenic in a wide variety of species. In the rat, 13-cis-retinoic acid and retinyl palmitate are significantly less potent teratogens than all-trans-retinoic acid. This investigation questioned whether differing teratogenic potencies of these moieties can be correlated with the concentrations of these drugs and/or metabolites in the embryonic compartment. Approximately equipotent teratogenic doses of these three retinoids were administered and the pharmacokinetics in maternal plasma and embryo of the most prevalent vitamin A metabolites were measured. The glucuronides of the respective retinoids were the predominant metabolites in the maternal plasma, but were not detected in the embryo. Also, the transport of 13-cis-retinoic acid across the placenta occurred to a much lesser extent than the transport of all-trans-retinoic acid. Administration of either all-trans- or 13-cis-retinoic acid causes a depression in the endogenous retinol concentration. This depression is more pronounced in the maternal plasma than in the embryo. The depression of the retinol level in both plasma and embryo after 13-cis-retinoic acid administration (75 mg/kg/day) was greater than the depression after all-trans-retinoic acid (6 mg/kg/day), corroborating the inferential teratological data that the 13-cis-retinoic acid dose was more embryotoxic than the all-trans-retinoic acid dose. Although the dose of all-trans-retinoic acid was less embryotoxic than that of either 13-cis-retinoic acid or retinyl palmitate, the embryonic exposure to all-trans-retinoic acid was considerably larger, as determined by maximum concentration or area under the concentration-versus-time curve, after administration of all-trans-retinoic acid than after either retinyl palmitate or 13-cis-retinoic acid application. These results suggest that embryonic retinoids other than all-trans-retinoic acid--including the administered substances themselves--are important in the teratogenic process induced by 13-cis-retinoic acid and retinyl palmitate.

Free-Energy-Based Protein Design: Re-Engineering Cellular Retinoic Acid Binding Protein II Assisted by the Moveable-Type Approach.

PubMed

Zhong, Haizhen A; Santos, Elizabeth M; Vasileiou, Chrysoula; Zheng, Zheng; Geiger, James H; Borhan, Babak; Merz, Kenneth M

2018-03-14

How to fine-tune the binding free energy of a small-molecule to a receptor site by altering the amino acid residue composition is a key question in protein engineering. Indeed, the ultimate solution to this problem, to chemical accuracy (±1 kcal/mol), will result in profound and wide-ranging applications in protein design. Numerous tools have been developed to address this question using knowledge-based models to more computationally intensive molecular dynamics simulations-based free energy calculations, but while some success has been achieved there remains room for improvement in terms of overall accuracy and in the speed of the methodology. Here we report a fast, knowledge-based movable-type (MT)-based approach to estimate the absolute and relative free energy of binding as influenced by mutations in a small-molecule binding site in a protein. We retrospectively validate our approach using mutagenesis data for retinoic acid binding to the Cellular Retinoic Acid Binding Protein II (CRABPII) system and then make prospective predictions that are borne out experimentally. The overall performance of our approach is supported by its success in identifying mutants that show high or even sub-nano-molar binding affinities of retinoic acid to the CRABPII system.

Pheromone induction of agglutination in Saccharomyces cerevisiae a cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Terrance, K.; Lipke, P.N.

1987-10-01

a-Agglutinin, the cell surface sexual agglutinin of yeast a cells, was assayed by its ability to bind its complementary agglutinin, ..cap alpha..-agglutinin. The specific binding of /sup 125/I-..cap alpha..-agglutinin to a cells treated with the sex pheromone ..cap alpha..-factor was 2 to 2.5 times that of binding to a cells not treated with ..cap alpha..-factor. Competition with unlabeled ..cap alpha..-agglutinin revealed that the increased binding was due to increased cell surface expression of a-agglutinin, with no apparent change in the binding constant. The increase in site number was similar to the increase in cellular agglutinability. Increased expression of a-agglutinin followedmore » the same kinetics as the increase in cellular agglutinability, with a 10-min lag followed by a 15- to 20-min response time. Induction kinetics were similar in cells in phases G1 and G2 of the cell cycle. Maximal expression levels were similar in cells treated with excess pheromone and in cells exposed to pheromone after destruction of constitutively expressed a-agglutinin.« less

Functional diversification and specialization of cytosolic 70-kDa heat shock proteins.

PubMed

McCallister, Chelsea; Siracusa, Matthew C; Shirazi, Farzaneh; Chalkia, Dimitra; Nikolaidis, Nikolas

2015-03-20

A fundamental question in molecular evolution is how protein functional differentiation alters the ability of cells and organisms to cope with stress and survive. To answer this question we used two paralogous Hsp70s from mouse and explored whether these highly similar cytosolic molecular chaperones, which apart their temporal expression have been considered functionally interchangeable, are differentiated with respect to their lipid-binding function. We demonstrate that the two proteins bind to diverse lipids with different affinities and therefore are functionally specialized. The observed lipid-binding patterns may be related with the ability of both Hsp70s to induce cell death by binding to a particular plasma-membrane lipid, and the potential of only one of them to promote cell survival by binding to a specific lysosomal-membrane lipid. These observations reveal that two seemingly identical proteins differentially modulate cellular adaptation and survival by having acquired specialized functions via sequence divergence. Therefore, this study provides an evolutionary paradigm, where promiscuity, specificity, sub- and neo-functionalization orchestrate one of the most conserved systems in nature, the cellular stress-response.

Murine Hyperglycemic Vasculopathy and Cardiomyopathy: Whole-Genome Gene Expression Analysis Predicts Cellular Targets and Regulatory Networks Influenced by Mannose Binding Lectin

PubMed Central

Zou, Chenhui; La Bonte, Laura R.; Pavlov, Vasile I.; Stahl, Gregory L.

2012-01-01

Hyperglycemia, in the absence of type 1 or 2 diabetes, is an independent risk factor for cardiovascular disease. We have previously demonstrated a central role for mannose binding lectin (MBL)-mediated cardiac dysfunction in acute hyperglycemic mice. In this study, we applied whole-genome microarray data analysis to investigate MBL’s role in systematic gene expression changes. The data predict possible intracellular events taking place in multiple cellular compartments such as enhanced insulin signaling pathway sensitivity, promoted mitochondrial respiratory function, improved cellular energy expenditure and protein quality control, improved cytoskeleton structure, and facilitated intracellular trafficking, all of which may contribute to the organismal health of MBL null mice against acute hyperglycemia. Our data show a tight association between gene expression profile and tissue function which might be a very useful tool in predicting cellular targets and regulatory networks connected with in vivo observations, providing clues for further mechanistic studies. PMID:22375142

KDM5 Interacts with Foxo to Modulate Cellular Levels of Oxidative Stress

PubMed Central

Liu, Xingyin; Greer, Christina; Secombe, Julie

2014-01-01

Increased cellular levels of oxidative stress are implicated in a large number of human diseases. Here we describe the transcription co-factor KDM5 (also known as Lid) as a new critical regulator of cellular redox state. Moreover, this occurs through a novel KDM5 activity whereby it alters the ability of the transcription factor Foxo to bind to DNA. Our microarray analyses of kdm5 mutants revealed a striking enrichment for genes required to regulate cellular levels of oxidative stress. Consistent with this, loss of kdm5 results in increased sensitivity to treatment with oxidizers, elevated levels of oxidized proteins, and increased mutation load. KDM5 activates oxidative stress resistance genes by interacting with Foxo to facilitate its recruitment to KDM5-Foxo co-regulated genes. Significantly, this occurs independently of KDM5's well-characterized demethylase activity. Instead, KDM5 interacts with the lysine deacetylase HDAC4 to promote Foxo deacetylation, which affects Foxo DNA binding. PMID:25329053

Tretinoin peel: a critical view*

PubMed Central

Sumita, Juliana Mayumi; Leonardi, Gislaine Ricci; Bagatin, Ediléia

2017-01-01

The tretinoin peel, also known as retinoic acid peel, is a superficial peeling often performed in dermatological clinics in Brazil. The first study on this was published in 2001, by Cuce et al., as a treatment option for melasma. Since then, other studies have reported its applicability with reasonable methodology, although without a consistent scientific background and consensus. Topical tretinoin is used for the treatment of various dermatoses such as acne, melasma, scars, skin aging and non-melanoma skin cancer. The identification of retinoids cellular receptors was reported in 1987, but a direct cause-effect relation has not been established. This article reviews studies evaluating the use of topical tretinoin as agent for superficial chemical peel. Most of them have shown benefits in the treatment of melasma and skin aging. A better quality methodology in the study design, considering indication and intervention is indispensable regarding concentration, vehicle and treatment regimen (interval and number of applications). Additionally, more controlled and randomized studies comparing the treatment with tretinoin cream versus its use as a peeling agent, mainly for melasma and photoaging, are necessary. PMID:29186249

Tretinoin peel: a critical view.

PubMed

Sumita, Juliana Mayumi; Leonardi, Gislaine Ricci; Bagatin, Ediléia

2017-01-01

The tretinoin peel, also known as retinoic acid peel, is a superficial peeling often performed in dermatological clinics in Brazil. The first study on this was published in 2001, by Cuce et al., as a treatment option for melasma. Since then, other studies have reported its applicability with reasonable methodology, although without a consistent scientific background and consensus. Topical tretinoin is used for the treatment of various dermatoses such as acne, melasma, scars, skin aging and non-melanoma skin cancer. The identification of retinoids cellular receptors was reported in 1987, but a direct cause-effect relation has not been established. This article reviews studies evaluating the use of topical tretinoin as agent for superficial chemical peel. Most of them have shown benefits in the treatment of melasma and skin aging. A better quality methodology in the study design, considering indication and intervention is indispensable regarding concentration, vehicle and treatment regimen (interval and number of applications). Additionally, more controlled and randomized studies comparing the treatment with tretinoin cream versus its use as a peeling agent, mainly for melasma and photoaging, are necessary.

c-di-AMP: An Essential Molecule in the Signaling Pathways that Regulate the Viability and Virulence of Gram-Positive Bacteria

PubMed Central

Fahmi, Tazin; Port, Gary C.

2017-01-01

Signal transduction pathways enable organisms to monitor their external environment and adjust gene regulation to appropriately modify their cellular processes. Second messenger nucleotides including cyclic adenosine monophosphate (c-AMP), cyclic guanosine monophosphate (c-GMP), cyclic di-guanosine monophosphate (c-di-GMP), and cyclic di-adenosine monophosphate (c-di-AMP) play key roles in many signal transduction pathways used by prokaryotes and/or eukaryotes. Among the various second messenger nucleotides molecules, c-di-AMP was discovered recently and has since been shown to be involved in cell growth, survival, and regulation of virulence, primarily within Gram-positive bacteria. The cellular level of c-di-AMP is maintained by a family of c-di-AMP synthesizing enzymes, diadenylate cyclases (DACs), and degradation enzymes, phosphodiesterases (PDEs). Genetic manipulation of DACs and PDEs have demonstrated that alteration of c-di-AMP levels impacts both growth and virulence of microorganisms. Unlike other second messenger molecules, c-di-AMP is essential for growth in several bacterial species as many basic cellular functions are regulated by c-di-AMP including cell wall maintenance, potassium ion homeostasis, DNA damage repair, etc. c-di-AMP follows a typical second messenger signaling pathway, beginning with binding to receptor molecules to subsequent regulation of downstream cellular processes. While c-di-AMP binds to specific proteins that regulate pathways in bacterial cells, c-di-AMP also binds to regulatory RNA molecules that control potassium ion channel expression in Bacillus subtilis. c-di-AMP signaling also occurs in eukaryotes, as bacterially produced c-di-AMP stimulates host immune responses during infection through binding of innate immune surveillance proteins. Due to its existence in diverse microorganisms, its involvement in crucial cellular activities, and its stimulating activity in host immune responses, c-di-AMP signaling pathway has become an attractive antimicrobial drug target and therefore has been the focus of intensive study in several important pathogens. PMID:28783096

The mannose 6-phosphate-binding sites of M6P/IGF2R determine its capacity to suppress matrix invasion by squamous cell carcinoma cells

PubMed Central

Probst, Olivia C.; Karayel, Evren; Schida, Nicole; Nimmerfall, Elisabeth; Hehenberger, Elisabeth; Puxbaum, Verena; Mach, Lukas

2013-01-01

The M6P (mannose 6-phosphate)/IGF2R (insulin-like growth factor II receptor) interacts with a variety of factors that impinge on tumour invasion and metastasis. It has been shown that expression of wild-type M6P/IGF2R reduces the tumorigenic and invasive properties of receptor-deficient SCC-VII squamous cell carcinoma cells. We have now used mutant forms of M6P/IGF2R to assess the relevance of the different ligand-binding sites of the receptor for its biological activities in this cellular system. The results of the present study demonstrate that M6P/IGF2R does not require a functional binding site for insulin-like growth factor II for inhibition of anchorage-independent growth and matrix invasion by SCC-VII cells. In contrast, the simultaneous mutation of both M6P-binding sites is sufficient to impair all cellular functions of the receptor tested. These findings highlight that the interaction between M6P/IGF2R and M6P-modified ligands is not only important for intracellular accumulation of lysosomal enzymes and formation of dense lysosomes, but is also crucial for the ability of the receptor to suppress SCC-VII growth and invasion. The present study also shows that some of the biological activities of M6P/IGF2R in SCC-VII cells strongly depend on a functional M6P-binding site within domain 3, thus providing further evidence for the non-redundant cellular functions of the individual carbohydrate-binding domains of the receptor. PMID:23347038

CELLULAR BIOAVAILABILITY OF NATURAL HORMONES AND ENVIRONMENTAL CONTAMINANTS AS A FUNCTION OF SERUM AND CYTOSOLIC BINDING FACTORS

EPA Science Inventory

Environmental contaminants have been reported to function as hormone mimics in various wildlife species. To investigate a potential mechanism for the interaction of contaminants with the endocrine system, we evaluated the cellular bioavailability of numerous chemicals. Hormone bi...

Differences in primary cellular factors influencing the metabolism and distribution of 3,5,3′-L-triiodothyronine and L-thyroxine

PubMed Central

Oppenheimer, Jack H.; Schwartz, Harold L.; Shapiro, Harvey C.; Bernstein, Gerald; Surks, Martin I.

1970-01-01

Administration of phenobarbital, which acts exclusively on cellular sites, results in an augmentation of the liver/plasma concentration ratio of L-thyroxine (T4) in rats but no change in the liver/plasma concentration ratio of L-triiodothyronine (T3). Whereas phenobarbital stimulates the fecal clearance rate both of T3 and T4, it increases the deiodinative clearance rate of T4 only. These findings suggest basic differences in the cellular metabolism of T3 and T4. Further evidence pointing to cellular differences was obtained from a comparison of the distribution and metabolism of these hormones with appropriate corrections for the effect of differential plasma binding. The percentage of total exchangeable cellular T4 within the liver (28.5) is significantly greater than the corresponding percentage of exchangeable cellular T3 within this organ (12.3). Extrahepatic tissues bind T3 twice as firmly as T4. The cellular metabolic clearance rate (= free hormone clearance rate) of T3 exceeds that of T4 by a factor 1.8 in the rat. The corresponding ratio in man, 2.4, was determined by noncompartmental analysis of turnover studies in four individuals after the simultaneous injection of T4-125I and T3-131I. The greater cellular metabolic clearance rate of T3 both in rat and man may be related to the higher specific hormonal potency of this iodothyronine. PMID:5441537

Investigation of the Causes of Breast Cancer at the Cellular Level: Isolation of In Vivo Binding Sites of the Human Origin Recognition Complex

DTIC Science & Technology

2000-08-01

The coordination between cellular DNA replication and mitosis is critical to ensure controlled cell proliferation and accurate transmission of the...proteins involved in the initiation of DNA replication . Preliminary results are presented....genetic information as cells divide -two aspects of cellular life tipically lost in cancer. In order to unravel the molecular mechanisms of human DNA

Design of selective nuclear receptor modulators: RAR and RXR as a case study.

PubMed

de Lera, Angel R; Bourguet, William; Altucci, Lucia; Gronemeyer, Hinrich

2007-10-01

Retinoic acid receptors (RARs) and retinoid X receptors (RXRs) are members of the nuclear receptor superfamily whose effects on cell growth and survival can be modulated therapeutically by small-molecule ligands. Although compounds that target these receptors are powerful anticancer drugs, their use is limited by toxicity. An improved understanding of the structural biology of RXRs and RARs and recent advances in the chemical synthesis of modified retinoid and rexinoid ligands should enable the rational design of more selective agents that might overcome such problems. Here, we review structural data for RXRs and RARs, discuss strategies in the design of selective RXR and RAR modulators, and consider lessons that can be learned for the design of selective nuclear-receptor modulators in general.

Reversal of skin aging with topical retinoids.

PubMed

Hubbard, Bradley A; Unger, Jacob G; Rohrich, Rod J

2014-04-01

Topical skin care and its place in plastic surgery today are often overlooked by clinicians formulating a plan for facial rejuvenation. Not only is it important to consider topical skin care as part of comprehensive care, but clinicians should also be educated with the data available in today's literature. This review aims to familiarize the reader with the biological processes of skin aging and evidence-based clinical outcomes afforded by various topical therapies. Furthermore, this review will focus on solar damage, the value of retinoids, and how they can be used in conjunction with forms of treatment such as chemical peel, dermabrasion, and lasers. Finally, guidelines will be provided to help the physician administer appropriate skin care based on the data presented.

[Treatment of acne with consequences -- pseudotumor cerebri due to hypervitaminosis A].

PubMed

Meyer-Heim, A; Landau, K; Boltshauser, E

2002-01-09

Pseudotumor cerebri (PTC) is an entity characterized by elevated intracranial pressure of probably multifactoral origin, but most cases remain idiopathic. We report a 15-year-old girl with PTC due to prolonged consumption of Arovit (Vitamin A) for treatment of acne. The diagnosis was established by measuring raised cerebrospinal fluid pressure after an intracranial mass lesion and dural venous sinsus thrombosis were excluded. The increased level of vitamin A confirmed the diagnosis of hypervitaminosis A as the causative pathogen. The patient was treated with lumbar punctures and acetazolamide (Diamox). PTC due to hypervitaminosis A is a serious complication, which can cause permanent visual impairment. Patients treated with retinoids require proper surveillance. The elevated serum level of retinoids after withdrawal may persist for weeks.

Recurrent Glioblastoma Multiforme (grade IV - WHO 2007): a case of complete objective response - concomitant administration of Somatostatin / Octreotide, Retinoids, Vit E, Vit D3, Vit C, Melatonin, D2 R agonists (Di Bella Method.

PubMed

Di Bella, Giuseppe; Leci, Jovan; Ricchi, Alessandro; Toscano, Rosilde

2015-01-01

In a 41 year old man, with Glioblastoma Multiforme (Grade IV - WHO 2007) and loco-regional recurrence, treated conventionally with surgery, radio-therapy and Temolozomide, a complete objective response was subsequently achieved by means of the well-tolerated concomitant administration of Somatostatin + slow-release Octreotide, Melatonin, Retinoids solubilized in Vitamin E, Vit D3, Vit C, D2 R agonists, and Temolozomide. In addition to the positive and previously unreported therapeutic finding, this result allowed the patient to avoid further surgical trauma and the correlated risks, achieving an excellent quality of life and working capacity.

RAR/RXR and PPAR/RXR Signaling in Spinal Cord Injury

PubMed Central

van Neerven, Sabien; Mey, Jörg

2007-01-01

The retinoid acid receptors (RAR) and peroxisome proliferator-activated receptors (PPAR) have been implicated in the regulation of inflammatory reactions. Both receptor families contain ligand-activated transcription factors which form heterodimers with retinoid X receptors (RXR). We review data that imply RAR/RXR and PPAR/RXR pathways in physiological reactions after spinal cord injury. Experiments show how RAR signaling may improve axonal regeneration and modulate reactions of glia cells. While anti-inflammatory properties of PPAR are well documented in the periphery, their possible roles in the central nervous system have only recently become evident. Due to its anti-inflammatory function this transcription factor family promises to be a useful target after spinal cord or brain lesions. PMID:18060014

Molecular Mechanism of Wide Photoabsorption Spectral Shifts of Color Variants of Human Cellular Retinol Binding Protein II.

PubMed

Cheng, Cheng; Kamiya, Motoshi; Uchida, Yoshihiro; Hayashi, Shigehiko

2015-10-21

Color variants of human cellular retinol binding protein II (hCRBPII) created by protein engineering were recently shown to exhibit anomalously wide photoabsorption spectral shifts over ∼200 nm across the visible region. The remarkable phenomenon provides a unique opportunity to gain insight into the molecular basis of the color tuning of retinal binding proteins for understanding of color vision as well as for engineering of novel color variants of retinal binding photoreceptor proteins employed in optogenetics. Here, we report a theoretical investigation of the molecular mechanism underlying the anomalously wide spectral shifts of the color variants of hCRBPII. Computational modeling of the color variants with hybrid molecular simulations of free energy geometry optimization succeeded in reproducing the experimentally observed wide spectral shifts, and revealed that protein flexibility, through which the active site structure of the protein and bound water molecules is altered by remote mutations, plays a significant role in inducing the large spectral shifts.

Identification of a molecular recognition feature in the E1A oncoprotein that binds the SUMO conjugase UBC9 and likely interferes with polySUMOylation.

PubMed

Yousef, A F; Fonseca, G J; Pelka, P; Ablack, J N G; Walsh, C; Dick, F A; Bazett-Jones, D P; Shaw, G S; Mymryk, J S

2010-08-19

Hub proteins have central roles in regulating cellular processes. By targeting a single cellular hub, a viral oncogene may gain control over an entire module in the cellular interaction network that is potentially comprised of hundreds of proteins. The adenovirus E1A oncoprotein is a viral hub that interacts with many cellular hub proteins by short linear motifs/molecular recognition features (MoRFs). These interactions transform the architecture of the cellular protein interaction network and virtually reprogram the cell. To identify additional MoRFs within E1A, we screened portions of E1A for their ability to activate yeast pseudohyphal growth or differentiation. This identified a novel functional region within E1A conserved region 2 comprised of the sequence EVIDLT. This MoRF is necessary and sufficient to bind the N-terminal region of the SUMO conjugase UBC9, which also interacts with SUMO noncovalently and is involved in polySUMOylation. Our results suggest that E1A interferes with polySUMOylation, but not with monoSUMOylation. These data provide the first insight into the consequences of the interaction of E1A with UBC9, which was initially described in 1996. We further demonstrate that polySUMOylation regulates pseudohyphal growth and promyelocytic leukemia body reorganization by E1A. In conclusion, the interaction of the E1A oncogene with UBC9 mimics the normal binding between SUMO and UBC9 and represents a novel mechanism to modulate polySUMOylation.

Cellular Retinoic Acid Binding Proteins: Genomic and Non-genomic Functions and their Regulation.

PubMed

Wei, Li-Na

Cellular retinoic acid binding proteins (CRABPs) are high-affinity retinoic acid (RA) binding proteins that mainly reside in the cytoplasm. In mammals, this family has two members, CRABPI and II, both highly conserved during evolution. The two proteins share a very similar structure that is characteristic of a "β-clam" motif built up from10-strands. The proteins are encoded by two different genes that share a very similar genomic structure. CRABPI is widely distributed and CRABPII has restricted expression in only certain tissues. The CrabpI gene is driven by a housekeeping promoter, but can be regulated by numerous factors, including thyroid hormones and RA, which engage a specific chromatin-remodeling complex containing either TRAP220 or RIP140 as coactivator and corepressor, respectively. The chromatin-remodeling complex binds the DR4 element in the CrabpI gene promoter to activate or repress this gene in different cellular backgrounds. The CrabpII gene promoter contains a TATA-box and is rapidly activated by RA through an RA response element. Biochemical and cell culture studies carried out in vitro show the two proteins have distinct biological functions. CRABPII mainly functions to deliver RA to the nuclear RA receptors for gene regulation, although recent studies suggest that CRABPII may also be involved in other cellular events, such as RNA stability. In contrast, biochemical and cell culture studies suggest that CRABPI functions mainly in the cytoplasm to modulate intracellular RA availability/concentration and to engage other signaling components such as ERK activity. However, these functional studies remain inconclusive because knocking out one or both genes in mice does not produce definitive phenotypes. Further studies are needed to unambiguously decipher the exact physiological activities of these two proteins.

Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin.

PubMed

Donohue, Elizabeth; Balgi, Aruna D; Komatsu, Masaaki; Roberge, Michel

2014-01-01

Autophagy is a cellular catabolic process responsible for the degradation of cytoplasmic constituents, including organelles and long-lived proteins, that helps maintain cellular homeostasis and protect against various cellular stresses. Verteporfin is a benzoporphyrin derivative used clinically in photodynamic therapy to treat macular degeneration. Verteporfin was recently found to inhibit autophagosome formation by an unknown mechanism that does not require exposure to light. We report that verteporfin directly targets and modifies p62, a scaffold and adaptor protein that binds both polyubiquitinated proteins destined for degradation and LC3 on autophagosomal membranes. Western blotting experiments revealed that exposure of cells or purified p62 to verteporfin causes the formation of covalently crosslinked p62 oligomers by a mechanism involving low-level singlet oxygen production. Rose bengal, a singlet oxygen producer structurally unrelated to verteporfin, also produced crosslinked p62 oligomers and inhibited autophagosome formation. Co-immunoprecipitation experiments demonstrated that crosslinked p62 oligomers retain their ability to bind to LC3 but show defective binding to polyubiquitinated proteins. Mutations in the p62 PB1 domain that abolish self-oligomerization also abolished crosslinked oligomer formation. Interestingly, small amounts of crosslinked p62 oligomers were detected in untreated cells, and other groups noted the accumulation of p62 forms with reduced SDS-PAGE mobility in cellular and animal models of oxidative stress and aging. These data indicate that p62 is particularly susceptible to oxidative crosslinking and lead us to propose a model whereby oxidized crosslinked p62 oligomers generated rapidly by drugs like verteporfin or over time during the aging process interfere with autophagy.

Interdependence of free zinc changes and protein complex assembly - insights into zinc signal regulation.

PubMed

Kocyła, Anna; Adamczyk, Justyna; Krężel, Artur

2018-01-24

Cellular zinc (Zn(ii)) is bound with proteins that are part of the proteomes of all domains of life. It is mostly utilized as a catalytic or structural protein cofactor, which results in a vast number of binding architectures. The Zn(ii) ion is also important for the formation of transient protein complexes with a Zn(ii)-dependent quaternary structure that is formed upon cellular zinc signals. The mechanisms by which proteins associate with and dissociate from Zn(ii) and the connection with cellular Zn(ii) changes remain incompletely understood. In this study, we aimed to examine how zinc protein domains with various Zn(ii)-binding architectures are formed under free Zn(ii) concentration changes and how formation of the Zn(ii)-dependent assemblies is related to the protein concentration and reactivity. To accomplish these goals we chose four zinc domains with different Zn(ii)-to-protein binding stoichiometries: classical zinc finger (ZnP), LIM domain (Zn 2 P), zinc hook (ZnP 2 ) and zinc clasp (ZnP 1 P 2 ) folds. Our research demonstrated a lack of changes in the saturation level of intraprotein zinc binding sites, despite various peptide concentrations, while homo- and heterodimers indicated a concentration-dependent tendency. In other words, at a certain free Zn(ii) concentration, the fraction of a formed dimeric complex increases or decreases with subunit concentration changes. Secondly, even small or local changes in free Zn(ii) may significantly affect protein saturation depending on its architecture, function and subcellular concentration. In our paper, we indicate the importance of interdependence of free Zn(ii) availability and protein subunit concentrations for cellular zinc signal regulation.

Identification of novel putative-binding proteins for cellular prion protein and a specific interaction with the STIP1 homology and U-Box-containing protein 1

PubMed Central

Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich

2015-01-01

ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451

Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin

PubMed Central

Donohue, Elizabeth; Balgi, Aruna D.; Komatsu, Masaaki; Roberge, Michel

2014-01-01

Autophagy is a cellular catabolic process responsible for the degradation of cytoplasmic constituents, including organelles and long-lived proteins, that helps maintain cellular homeostasis and protect against various cellular stresses. Verteporfin is a benzoporphyrin derivative used clinically in photodynamic therapy to treat macular degeneration. Verteporfin was recently found to inhibit autophagosome formation by an unknown mechanism that does not require exposure to light. We report that verteporfin directly targets and modifies p62, a scaffold and adaptor protein that binds both polyubiquitinated proteins destined for degradation and LC3 on autophagosomal membranes. Western blotting experiments revealed that exposure of cells or purified p62 to verteporfin causes the formation of covalently crosslinked p62 oligomers by a mechanism involving low-level singlet oxygen production. Rose bengal, a singlet oxygen producer structurally unrelated to verteporfin, also produced crosslinked p62 oligomers and inhibited autophagosome formation. Co-immunoprecipitation experiments demonstrated that crosslinked p62 oligomers retain their ability to bind to LC3 but show defective binding to polyubiquitinated proteins. Mutations in the p62 PB1 domain that abolish self-oligomerization also abolished crosslinked oligomer formation. Interestingly, small amounts of crosslinked p62 oligomers were detected in untreated cells, and other groups noted the accumulation of p62 forms with reduced SDS-PAGE mobility in cellular and animal models of oxidative stress and aging. These data indicate that p62 is particularly susceptible to oxidative crosslinking and lead us to propose a model whereby oxidized crosslinked p62 oligomers generated rapidly by drugs like verteporfin or over time during the aging process interfere with autophagy. PMID:25494214

On the Selective Packaging of Genomic RNA by HIV-1.

PubMed

Comas-Garcia, Mauricio; Davis, Sean R; Rein, Alan

2016-09-12

Like other retroviruses, human immunodeficiency virus type 1 (HIV-1) selectively packages genomic RNA (gRNA) during virus assembly. However, in the absence of the gRNA, cellular messenger RNAs (mRNAs) are packaged. While the gRNA is selected because of its cis-acting packaging signal, the mechanism of this selection is not understood. The affinity of Gag (the viral structural protein) for cellular RNAs at physiological ionic strength is not much higher than that for the gRNA. However, binding to the gRNA is more salt-resistant, implying that it has a higher non-electrostatic component. We have previously studied the spacer 1 (SP1) region of Gag and showed that it can undergo a concentration-dependent conformational transition. We proposed that this transition represents the first step in assembly, i.e., the conversion of Gag to an assembly-ready state. To explain selective packaging of gRNA, we suggest here that binding of Gag to gRNA, with its high non-electrostatic component, triggers this conversion more readily than binding to other RNAs; thus we predict that a Gag-gRNA complex will nucleate particle assembly more efficiently than other Gag-RNA complexes. New data shows that among cellular mRNAs, those with long 3'-untranslated regions (UTR) are selectively packaged. It seems plausible that the 3'-UTR, a stretch of RNA not occupied by ribosomes, offers a favorable binding site for Gag.

C-type lectins do not act as functional receptors for filovirus entry into cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuno, Keita; Nakayama, Eri; Noyori, Osamu

2010-12-03

Research highlights: {yields} Filovirus glycoprotein (GP) having a deficient receptor binding region were generated. {yields} Mutant GPs mediated virus entry less efficiently than wild-type GP. {yields} Mutant GPs bound to C-type lectins but not mediated entire steps of cellular entry. {yields} C-type lectins do not independently mediate filovirus entry into cells. {yields} Other molecule(s) are required for C-type lectin-mediated entry of filoviruses. -- Abstract: Cellular C-type lectins have been reported to facilitate filovirus infection by binding to glycans on filovirus glycoprotein (GP). However, it is not clearly known whether interaction between C-type lectins and GP mediates all the steps ofmore » virus entry (i.e., attachment, internalization, and membrane fusion). In this study, we generated vesicular stomatitis viruses pseudotyped with mutant GPs that have impaired structures of the putative receptor binding regions and thus reduced ability to infect the monkey kidney cells that are routinely used for virus propagation. We found that infectivities of viruses with the mutant GPs dropped in C-type lectin-expressing cells, parallel with those in the monkey kidney cells, whereas binding activities of these GPs to the C-type lectins were not correlated with the reduced infectivities. These results suggest that C-type lectin-mediated entry of filoviruses requires other cellular molecule(s) that may be involved in virion internalization or membrane fusion.« less

Therapeutic Potential of Shark Anti-ICOSL VNAR Domains is Exemplified in a Murine Model of Autoimmune Non-Infectious Uveitis.

PubMed

Kovaleva, Marina; Johnson, Katherine; Steven, John; Barelle, Caroline J; Porter, Andrew

2017-01-01

Induced costimulatory ligand (ICOSL) plays an important role in the activation of T cells through its interaction with the inducible costimulator, ICOS. Suppression of full T cell activation can be achieved by blocking this interaction and has been shown to be an effective means of ameliorating disease in models of autoimmunity and inflammation. In this study, we demonstrated the ability of a novel class of anti-ICOSL antigen-binding single domains derived from sharks (VNARs) to effectively reduce inflammation in a murine model of non-infectious uveitis. In initial selections, specific VNARs that recognized human ICOSL were isolated from an immunized nurse shark phage display library and lead domains were identified following their performance in a series of antigen selectivity and in vitro bioassay screens. High potency in cell-based blocking assays suggested their potential as novel binders suitable for further therapeutic development. To test this hypothesis, surrogate anti-mouse ICOSL VNAR domains were isolated from the same phage display library and the lead VNAR clone selected via screening in binding and ICOS/ICOSL blocking experiments. The VNAR domain with the highest potency in cell-based blocking of ICOS/ICOSL interaction was fused to the Fc portion of human IgG1 and was tested in vivo in a mouse model of interphotoreceptor retinoid-binding protein-induced uveitis. The anti-mICOSL VNAR Fc, injected systemically, resulted in a marked reduction of inflammation in treated mice when compared with untreated control animals. This approach inhibited disease progression to an equivalent extent to that seen for the positive corticosteroid control, cyclosporin A, reducing both clinical and histopathological scores. These results represent the first demonstration of efficacy of a VNAR binding domain in a relevant clinical model of disease and highlight the potential of VNARs for the treatment of auto-inflammatory conditions.

Effect of 11-Cis 13-Demethylretinal on Phototransduction in Bleach-Adapted Rod and Cone Photoreceptors

PubMed Central

Corson, D.Wesley; Kefalov, Vladimir J.; Cornwall, M. Carter; Crouch, Rosalie K.

2000-01-01

We used 11-cis 13-demethylretinal to examine the physiological consequences of retinal's noncovalent interaction with opsin in intact rod and cone photoreceptors during visual pigment regeneration. 11-Cis 13-demethylretinal is an analog of 11-cis retinal in which the 13 position methyl group has been removed. Biochemical experiments have shown that it is capable of binding in the chromophore pocket of opsin, forming a Schiff-base linkage with the protein to produce a pigment, but at a much slower rate than the native 11-cis retinal (Nelson, R., J. Kim deReil, and A. Kropf. 1970. Proc. Nat. Acad. Sci. USA. 66:531–538). Experimentally, this slow rate of pigment formation should allow separate physiological examination of the effects of the initial binding of retinal in the pocket and the subsequent formation of the protonated Schiff-base linkage. Currents from solitary rods and cones from the tiger salamander were recorded in darkness before and after bleaching and then after exposure to 11-cis 13-demethylretinal. In bleach-adapted rods, 11-cis 13-demethylretinal caused transient activation of phototransduction, as evidenced by a decrease of the dark current and sensitivity, acceleration of the dim flash responses, and activation of cGMP phosphodiesterase and guanylyl cyclase. The steady state of phototransduction activity was still higher than that of the bleach-adapted rod. In contrast, exposure of bleach-adapted cones to 11-cis 13-demethylretinal resulted in an immediate deactivation of transduction as measured by the same parameters. These results extend the validity of a model for the effects of the noncovalent binding of a retinoid in the chromophore pockets of rod and cone opsins to analogs capable of forming a Schiff-base and imply that the noncovalent binding by itself may play a role for the dark adaptation of photoreceptors. PMID:10919871

Molecular Evolution of Ultraspiracle Protein (USP/RXR) in Insects

PubMed Central

Hult, Ekaterina F.; Tobe, Stephen S.; Chang, Belinda S. W.

2011-01-01

Ultraspiracle protein/retinoid X receptor (USP/RXR) is a nuclear receptor and transcription factor which is an essential component of a heterodimeric receptor complex with the ecdysone receptor (EcR). In insects this complex binds ecdysteroids and plays an important role in the regulation of growth, development, metamorphosis and reproduction. In some holometabolous insects, including Lepidoptera and Diptera, USP/RXR is thought to have experienced several important shifts in function. These include the acquisition of novel ligand-binding properties and an expanded dimerization interface with EcR. In light of these recent hypotheses, we implemented codon-based likelihood methods to investigate if the proposed shifts in function are reflected in changes in site-specific evolutionary rates across functional and structural motifs in insect USP/RXR sequences, and if there is any evidence for positive selection at functionally important sites. Our results reveal evidence of positive selection acting on sites within the loop connecting helices H1 and H3, the ligand-binding pocket, and the dimer interface in the holometabolous lineage leading to the Lepidoptera/Diptera/Trichoptera. Similar analyses conducted using EcR sequences did not indicate positive selection. However, analyses allowing for variation across sites demonstrated elevated non-synonymous/synonymous rate ratios (d N/d S), suggesting relaxed constraint, within the dimerization interface of both USP/RXR and EcR as well as within the coactivator binding groove and helix H12 of USP/RXR. Since the above methods are based on the assumption that d S is constant among sites, we also used more recent models which relax this assumption and obtained results consistent with traditional random-sites models. Overall our findings support the evolution of novel function in USP/RXR of more derived holometabolous insects, and are consistent with shifts in structure and function which may have increased USP/RXR reliance on EcR for cofactor recruitment. Moreover, these findings raise important questions regarding hypotheses which suggest the independent activation of USP/RXR by its own ligand. PMID:21901121

Association of papillomavirus E6 proteins with either MAML1 or E6AP clusters E6 proteins by structure, function, and evolutionary relatedness

PubMed Central

Brimer, Nicole

2017-01-01

Papillomavirus E6 proteins bind to LXXLL peptide motifs displayed on targeted cellular proteins. Alpha genus HPV E6 proteins associate with the cellular ubiquitin ligase E6AP (UBE3A), by binding to an LXXLL peptide (ELTLQELLGEE) displayed by E6AP, thereby stimulating E6AP ubiquitin ligase activity. Beta, Gamma, and Delta genera E6 proteins bind a similar LXXLL peptide (WMSDLDDLLGS) on the cellular transcriptional co-activator MAML1 and thereby repress Notch signaling. We expressed 45 different animal and human E6 proteins from diverse papillomavirus genera to ascertain the overall preference of E6 proteins for E6AP or MAML1. E6 proteins from all HPV genera except Alpha preferentially interacted with MAML1 over E6AP. Among animal papillomaviruses, E6 proteins from certain ungulate (SsPV1 from pigs) and cetacean (porpoises and dolphins) hosts functionally resembled Alpha genus HPV by binding and targeting the degradation of E6AP. Beta genus HPV E6 proteins functionally clustered with Delta, Pi, Tau, Gamma, Chi, Mu, Lambda, Iota, Dyokappa, Rho, and Dyolambda E6 proteins to bind and repress MAML1. None of the tested E6 proteins physically and functionally interacted with both MAML1 and E6AP, indicating an evolutionary split. Further, interaction of an E6 protein was insufficient to activate degradation of E6AP, indicating that E6 proteins that target E6AP co-evolved to separately acquire both binding and triggering of ubiquitin ligase activation. E6 proteins with similar biological function clustered together in phylogenetic trees and shared structural features. This suggests that the divergence of E6 proteins from either MAML1 or E6AP binding preference is a major event in papillomavirus evolution. PMID:29281732

Src binds cortactin through an SH2 domain cystine-mediated linkage.

PubMed

Evans, Jason V; Ammer, Amanda G; Jett, John E; Bolcato, Chris A; Breaux, Jason C; Martin, Karen H; Culp, Mark V; Gannett, Peter M; Weed, Scott A

2012-12-15

Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions.

Src binds cortactin through an SH2 domain cystine-mediated linkage

PubMed Central

Evans, Jason V.; Ammer, Amanda G.; Jett, John E.; Bolcato, Chris A.; Breaux, Jason C.; Martin, Karen H.; Culp, Mark V.; Gannett, Peter M.; Weed, Scott A.

2012-01-01

Summary Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions. PMID:23097045

Dephosphorylation of HuR Protein during Alphavirus Infection Is Associated with HuR Relocalization to the Cytoplasm*

PubMed Central

Dickson, Alexa M.; Anderson, John R.; Barnhart, Michael D.; Sokoloski, Kevin J.; Oko, Lauren; Opyrchal, Mateusz; Galanis, Evanthia; Wilusz, Carol J.; Morrison, Thomas E.; Wilusz, Jeffrey

2012-01-01

We have demonstrated previously that the cellular HuR protein binds U-rich elements in the 3′ untranslated region (UTR) of Sindbis virus RNA and relocalizes from the nucleus to the cytoplasm upon Sindbis virus infection in 293T cells. In this study, we show that two alphaviruses, Ross River virus and Chikungunya virus, lack the conserved high-affinity U-rich HuR binding element in their 3′ UTRs but still maintain the ability to interact with HuR with nanomolar affinities through alternative binding elements. The relocalization of HuR protein occurs during Sindbis infection of multiple mammalian cell types as well as during infections with three other alphaviruses. Interestingly, the relocalization of HuR is not a general cellular reaction to viral infection, as HuR protein remained largely nuclear during infections with dengue and measles virus. Relocalization of HuR in a Sindbis infection required viral gene expression, was independent of the presence of a high-affinity U-rich HuR binding site in the 3′ UTR of the virus, and was associated with an alteration in the phosphorylation state of HuR. Sindbis virus-induced HuR relocalization was mechanistically distinct from the movement of HuR observed during a cellular stress response, as there was no accumulation of caspase-mediated HuR cleavage products. Collectively, these data indicate that virus-induced HuR relocalization to the cytoplasm is specific to alphavirus infections and is associated with distinct posttranslational modifications of this RNA-binding protein. PMID:22915590

Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee Jialing; Klase, Zachary; Gao Xiaoqi

An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J.more » Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein and a repressor of the UL127 promoter, while SATB1 has no effect on UL127 expression. Since CDP is known as a transcription repressor and a nuclear matrix-associated region binding protein, CDP may have a role in the regulation of human CMV transcription.« less

Carotenoids and Retinoids: Nomenclature, Chemistry, and Analysis.

PubMed

Harrison, Earl H; Curley, Robert W

Carotenoids are polyenes synthesized in plants and certain microorganisms and are pigments used by plants and animals in various physiological processes. Some of the over 600 known carotenoids are capable of metabolic conversion to the essential nutrient vitamin A (retinol) in higher animals. Vitamin A also gives rise to a number of other metabolites which, along with their analogs, are known as retinoids. To facilitate discussion about these important molecules, a nomenclature is required to identify specific substances. The generally accepted rules for naming these important molecules have been agreed to by various Commissions of the International Union of Pure and Applied Chemistry and International Union of Biochemistry. These naming conventions are explained along with comparisons to more systematic naming rules that apply for these organic chemicals. Identification of the carotenoids and retinoids has been advanced by their chemical syntheses, and here, both classical and modern methods for synthesis of these molecules, as well as their analogs, are described. Because of their importance in biological systems, sensitive methods for the detection and quantification of these compounds from various sources have been essential. Early analyses that relied on liquid adsorption and partition chromatography have given way to high-performance liquid chromatography (HPLC) coupled with various detection methods. The development of HPLC coupled to mass spectrometry, particularly LC/MS-MS with Multiple Reaction Monitoring, has resulted in the greatest sensitivity and specificity in these analyses.

Selective ligand activity at Nur/retinoid X receptor complexes revealed by dimer-specific bioluminescence resonance energy transfer-based sensors

PubMed Central

Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel

2017-01-01

Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973

Allergen-induced dermatitis causes alterations in cutaneous retinoid-mediated signaling in mice.

PubMed

Gericke, Janine; Ittensohn, Jan; Mihály, Johanna; Dubrac, Sandrine; Rühl, Ralph

2013-01-01

Nuclear receptor-mediated signaling via RARs and PPARδ is involved in the regulation of skin homeostasis. Moreover, activation of both RAR and PPARδ was shown to alter skin inflammation. Endogenous all-trans retinoic acid (ATRA) can activate both receptors depending on specific transport proteins: Fabp5 initiates PPARδ signaling whereas Crabp2 promotes RAR signaling. Repetitive topical applications of ovalbumin (OVA) in combination with intraperitoneal injections of OVA or only intraperitoneal OVA applications were used to induce allergic dermatitis. In our mouse model, expression of IL-4, and Hbegf increased whereas expression of involucrin, Abca12 and Spink5 decreased in inflamed skin, demonstrating altered immune response and epidermal barrier homeostasis. Comprehensive gene expression analysis showed alterations of the cutaneous retinoid metabolism and retinoid-mediated signaling in allergic skin immune response. Notably, ATRA synthesis was increased as indicated by the elevated expression of retinaldehyde dehydrogenases and increased levels of ATRA. Consequently, the expression pattern of genes downstream to RAR was altered. Furthermore, the increased ratio of Fabp5 vs. Crabp2 may indicate an up-regulation of the PPARδ pathway in allergen-induced dermatitis in addition to the altered RAR signaling. Thus, our findings suggest that ATRA levels, RAR-mediated signaling and signaling involved in PPARδ pathways are mainly increased in allergen-induced dermatitis and may contribute to the development and/or maintenance of allergic skin diseases.

Age-related change in the retinoid X receptor beta gene expression in peripheral blood mononuclear cells of healthy volunteers: effect of 13-cis retinoic acid supplementation.

PubMed

Brtko, J; Rock, E; Nezbedova, P; Krizanova, O; Dvorcakova, M; Minet-Quinard, R; Farges, M-C; Ribalta, J; Winklhofer-Roob, B M; Vasson, M-P; Macejova, D

2007-01-01

The regulation of cell growth and differentiation and also expression of a number of genes by retinoids are mediated by nuclear retinoid receptors (RARs and/or RXRs). In this study we investigated age-related alteration in both RAR and RXR receptor subtypes gene expression and tissue transglutaminase (tTG) activity before and after supplementation with 13-cis retinoic acid (13cRA) in human peripheral blood mononuclear cells (PBMCs). Healthy men (40) were divided in two groups according to their age (young group: 26.1+/-4.1 years and old group: 65.4+/-3.8 years). Each volunteer received 13cRA (Curacné), 0.5mg/(kgday)) during a period of 4 weeks. We have shown that RXRbeta expression was decreased significantly (p=0.0108) in PBMCs of elderly men when compared to that of young volunteers. Distribution of retinoic acid receptor subtype expression in PBMCs was found in the order: RXRbeta>RARgamma>RXRalpha>RARalpha. The tTG activity in PBMCs reflected a trend to be enhanced after 13-cis retinoic acid supplementation. In conclusion, we demonstrate a significant decrease in the expression of RXRbeta subtype of rexinoid receptors in PBMCs of healthy elderly men. Our data suggest that in healthy elderly men reduction of RXRbeta expression in PBMCs might be a common feature of physiological senescence.

Persistent behavioral effects following early life exposure to retinoic acid or valproic acid in zebrafish

PubMed Central

Bailey, Jordan M.; Oliveri, Anthony N.; Karbhari, Nishika; Brooks, Roy A.J.; De La Rocha, Amberlene J.; Janardhan, Sheila; Levin, Edward D.

2015-01-01

BACKGROUND Moderate to severe dysregulation in retinoid signaling during early development is associated with a constellation of physical malformations and/or neural tube defects, including spina bifida. It is thought that more subtle dysregulation of this system, which might be achievable via dietary (i.e. hypervitaminosis A) or pharmacological (i.e. valproic acid) exposure in humans, will manifest on behavioral domains including sociability, without overt physical abnormalities. METHODS During early life, zebrafish were exposed to low doses of two chemicals that disrupt retinoid signaling. From 0-5 dpf, larvae were reared in aqueous solutions containing retinoic acid (0, 0.02, 0.2 or 2 nM) or valproic acid (0, 0.5, 5.0 or 50 uM). One cohort of zebrafish was assessed using a locomotor activity screen at 6-dpf; another was reared to adulthood and assessed using a neurobehavioral test battery (startle habituation, novel tank exploration, shoaling, and predator escape/avoidance). RESULTS There was no significant increase in the incidence of physical malformation among exposed fish compared to controls. Both retinoic acid and valproic acid exposures during development disrupted larval activity with persisting behavioral alterations later in life, primarily manifesting as decreased social affiliation. CONCLUSIONS Social behavior and some aspects of motor function were altered in exposed fish; the importance of examining emotional or psychological consequences of early life exposure to retinoid acting chemicals is discussed. PMID:26439099

A Case of AML Characterized by a Novel t(4;15)(q31;q22) Translocation That Confers a Growth-Stimulatory Response to Retinoid-Based Therapy

PubMed Central

Watts, Justin M.; Pereira, Lutecia; Fan, Yao-Shan; Brown, Geoffrey; Vega, Francisco; Swords, Ronan T.; Zelent, Arthur

2017-01-01

Here we report the case of a 30-year-old woman with relapsed acute myeloid leukemia (AML) who was treated with all-trans retinoic acid (ATRA) as part of investigational therapy (NCT02273102). The patient died from rapid disease progression following eight days of continuous treatment with ATRA. Karyotype analysis and RNA-Seq revealed the presence of a novel t(4;15)(q31;q22) reciprocal translocation involving the TMEM154 and RASGRF1 genes. Analysis of primary cells from the patient revealed the expression of TMEM154-RASGRF1 mRNA and the resulting fusion protein, but no expression of the reciprocal RASGRF1-TMEM154 fusion. Consistent with the response of the patient to ATRA therapy, we observed a rapid proliferation of t(4;15) primary cells following ATRA treatment ex vivo. Preliminary characterization of the retinoid response of t(4;15) AML revealed that in stark contrast to non-t(4;15) AML, these cells proliferate in response to specific agonists of RARα and RARγ. Furthermore, we observed an increase in the levels of nuclear RARγ upon ATRA treatment. In summary, the identification of the novel t(4;15)(q31;q22) reciprocal translocation opens new avenues in the study of retinoid resistance and provides potential for a new biomarker for therapy of AML. PMID:28696354

Allergen-Induced Dermatitis Causes Alterations in Cutaneous Retinoid-Mediated Signaling in Mice

PubMed Central

Gericke, Janine; Ittensohn, Jan; Mihály, Johanna; Dubrac, Sandrine; Rühl, Ralph

2013-01-01

Nuclear receptor-mediated signaling via RARs and PPARδ is involved in the regulation of skin homeostasis. Moreover, activation of both RAR and PPARδ was shown to alter skin inflammation. Endogenous all-trans retinoic acid (ATRA) can activate both receptors depending on specific transport proteins: Fabp5 initiates PPARδ signaling whereas Crabp2 promotes RAR signaling. Repetitive topical applications of ovalbumin (OVA) in combination with intraperitoneal injections of OVA or only intraperitoneal OVA applications were used to induce allergic dermatitis. In our mouse model, expression of IL-4, and Hbegf increased whereas expression of involucrin, Abca12 and Spink5 decreased in inflamed skin, demonstrating altered immune response and epidermal barrier homeostasis. Comprehensive gene expression analysis showed alterations of the cutaneous retinoid metabolism and retinoid-mediated signaling in allergic skin immune response. Notably, ATRA synthesis was increased as indicated by the elevated expression of retinaldehyde dehydrogenases and increased levels of ATRA. Consequently, the expression pattern of genes downstream to RAR was altered. Furthermore, the increased ratio of Fabp5 vs. Crabp2 may indicate an up-regulation of the PPARδ pathway in allergen-induced dermatitis in addition to the altered RAR signaling. Thus, our findings suggest that ATRA levels, RAR-mediated signaling and signaling involved in PPARδ pathways are mainly increased in allergen-induced dermatitis and may contribute to the development and/or maintenance of allergic skin diseases. PMID:23977003

Effects of Tributyltin and Other Retinoid Receptor Agonists in Reproductive-Related Endpoints in the Zebrafish (Danio rerio).

PubMed

Lima, Daniela; Castro, L Filipe C; Coelho, Inês; Lacerda, Ricardo; Gesto, Manuel; Soares, Joana; André, Ana; Capela, Ricardo; Torres, Tiago; Carvalho, António Paulo; Santos, Miguel M

2015-01-01

Both field and experimental data examined the influence of exposure to environmental contaminant tributyltin (TBT) on marine organisms. Although most attention focused on the imposex phenomenon in gastropods, adverse effects were also observed in other taxonomic groups. It has been shown that imposex induction involves modulation of retinoid signaling in gastropods. Whether TBT influences similar pathways in fish is yet to be addressed. In this study, larvae of the model teleost Danio rerio were exposed to natural retinoids, all-trans-retinoic acid, 9-cis-retinoic acid, and all-trans-retinol, as well as to the RXR synthetic pan-agonist methoprene acid (MA) and to TBT. Larvae were exposed to TBT from 5 days post fertilization (dpf) to adulthood, and reproductive capacity was assessed and correlated with mode of action. TBT significantly decreased fecundity at environmentally relevant levels at 1 μg TBT Sn/g in diet. Interestingly, in contrast to previous reports, TBT altered zebrafish sex ratio toward females, whereas MA exposure biased sex toward males. Since fecundity was significantly altered in the TBT-exposed group with up to 62% decrease, the potentially affected pathways were investigated. Significant downregulation was observed in brain mRNA levels of aromatase b (CYP19a1b) in females and peroxisome proliferator activated receptor gamma (PPARg) in both males and females, suggesting an involvement of these pathways in reproductive impairment associated with TBT.

Umbrella Sampling and X-ray Crystallographic Analysis Unveil an Arg-Asp Gate Facilitating Inhibitor Binding Inside Phosphopantetheine Adenylyltransferase Allosteric Cleft.

PubMed

Mondal, A; Chatterjee, R; Datta, S

2018-02-08

Phosphopantetheine adenylyltransferase (PPAT) is a rate-limiting enzyme essential for biosynthesis of coenzyme A (CoA), which in turn is responsible to regulate the secretion of exotoxins via type III secretion system in Pseudomonas aeruginosa, causing severe health concerns ranging from nosocomial infections to respiratory failure. Acetyl coenzyme A (AcCoA) is a newly reported inhibitor of PPAT, believed to regulate the cellular levels of CoA and thereby the pathogenesis. Very little is known so far regarding the mechanistic details of AcCoA binding inside PPAT-binding cleft. Herein, we have used extensive umbrella sampling simulations to decipher mechanistic insight into the inhibitor accommodation inside the binding cavity. We found that R90 and D94 residues act like a gate near the binding cavity to accommodate and stabilize the incoming ligand. Mutational models concerning these residues also show considerable difference in AcCoA-binding thermodynamics. To substantiate our findings, we have solved the first crystal structure of apo-PPAT from P. aeruginosa, which also found to agree with the simulation results. Collectively, these results describe the mechanistic details of accommodation of inhibitor molecule inside PPAT-binding cavity and also offer valuable insight into regulating cellular levels of CoA/AcCoA and thus controlling the pathogenicity.

Stimulation of translation by human Unr requires cold shock domains 2 and 4, and correlates with poly(A) binding protein interaction.

PubMed

Ray, Swagat; Anderson, Emma C

2016-03-03

The RNA binding protein Unr, which contains five cold shock domains, has several specific roles in post-transcriptional control of gene expression. It can act as an activator or inhibitor of translation initiation, promote mRNA turnover, or stabilise mRNA. Its role depends on the mRNA and other proteins to which it binds, which includes cytoplasmic poly(A) binding protein 1 (PABP1). Since PABP1 binds to all polyadenylated mRNAs, and is involved in translation initiation by interaction with eukaryotic translation initiation factor 4G (eIF4G), we investigated whether Unr has a general role in translational control. We found that Unr strongly stimulates translation in vitro, and mutation of cold shock domains 2 or 4 inhibited its translation activity. The ability of Unr and its mutants to stimulate translation correlated with its ability to bind RNA, and to interact with PABP1. We found that Unr stimulated the binding of PABP1 to mRNA, and that Unr was required for the stable interaction of PABP1 and eIF4G in cells. siRNA-mediated knockdown of Unr reduced the overall level of cellular translation in cells, as well as that of cap-dependent and IRES-dependent reporters. These data describe a novel role for Unr in regulating cellular gene expression.

Characterization of Novel Calmodulin Binding Domains within IQ Motifs of IQGAP1

PubMed Central

Jang, Deok-Jin; Ban, Byungkwan; Lee, Jin-A

2011-01-01

IQ motif-containing GTPase-activating protein 1 (IQGAP1), which is a well-known calmodulin (CaM) binding protein, is involved in a wide range of cellular processes including cell proliferation, tumorigenesis, adhesion, and migration. Interaction of IQGAP1 with CaM is important for its cellular functions. Although each IQ domain of IQGAP1 for CaM binding has been characterized in a Ca2+-dependent or -independent manner, it was not clear which IQ motifs are physiologically relevant for CaM binding in the cells. In this study, we performed immunoprecipitation using 3xFLAGhCaM in mammalian cell lines to characterize the domains of IQGAP1 that are key for CaM binding under physiological conditions. Interestingly, using this method, we identified two novel domains, IQ(2.7-3) and IQ(3.5-4.4), within IQGAP1 that were involved in Ca2+-independent or -dependent CaM binding, respectively. Mutant analysis clearly showed that the hydrophobic regions within IQ(2.7-3) were mainly involved in apoCaM binding, while the basic amino acids and hydrophobic region of IQ(3.5-4.4) were required for Ca2+/CaM binding. Finally, we showed that IQ(2.7-3) was the main apoCaM binding domain and both IQ(2.7-3) and IQ(3.5-4.4) were required for Ca2+/CaM binding within IQ(1- 2-3-4). Thus, we identified and characterized novel direct CaM binding motifs essential for IQGAP1. This finding indicates that IQGAP1 plays a dynamic role via direct interactions with CaM in a Ca2+-dependent or -independent manner. PMID:22080369