Cellular structure of lean hydrogen flames in microgravity

NASA Technical Reports Server (NTRS)

Patnaik, G.; Kailasanath, K.

1990-01-01

Detailed, time-dependent, two-dimensional numerical simulations of premixed laminar flames have been used to study the initiation and subsequent development of cellular structures in lean hydrogen-air flames. The model includes detailed hydrogen-oxygen combustion with 24 elementary reactions of eight reactive species and a nitrogen diluent, molecular diffusion of all species, thermal conduction, viscosity, and convection. This model has been used to study the nonlinear evolution of cellular flame structure and shows that cell splitting, as observed in experiments, can be predicted numerically for sufficiently reactive mixtures. The structures that evolved also resembled the cellular structures observed in experiments. The present study shows that the 'cell-split limit' postulated from experimental observations is an intrinsic property of the mixture and that external factors such as heat losses are not necessary to cause this limit.

Stereological estimation of cell wall density of DR12 tomato mutant using three-dimensional confocal imaging

PubMed Central

Legland, David; Guillon, Fabienne; Kiêu, Kiên; Bouchet, Brigitte; Devaux, Marie-Françoise

2010-01-01

Background and Aims The cellular structure of fleshy fruits is of interest to study fruit shape, size, mechanical behaviour or sensory texture. The cellular structure is usually not observed in the whole fruit but, instead, in a sample of limited size and volume. It is therefore difficult to extend measurements to the whole fruit and/or to a specific genotype, or to describe the cellular structure heterogeneity within the fruit. Methods An integrated method is presented to describe the cellular structure of the whole fruit from partial three-dimensional (3D) observations, involving the following steps: (1) fruit sampling, (2) 3D image acquisition and processing and (3) measurement and estimation of relevant 3D morphological parameters. This method was applied to characterize DR12 mutant and wild-type tomatoes (Solanum lycopersicum). Key Results The cellular structure was described using the total volume of the pericarp, the surface area of the cell walls and the ratio of cell-wall surface area to pericarp volume, referred to as the cell-wall surface density. The heterogeneity of cellular structure within the fruit was investigated by estimating variations in the cell-wall surface density with distance to the epidermis. Conclusions The DR12 mutant presents a greater pericarp volume and an increase of cell-wall surface density under the epidermis. PMID:19952012

Sub-cellular force microscopy in single normal and cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Babahosseini, H.; Carmichael, B.; Strobl, J.S.

2015-08-07

This work investigates the biomechanical properties of sub-cellular structures of breast cells using atomic force microscopy (AFM). The cells are modeled as a triple-layered structure where the Generalized Maxwell model is applied to experimental data from AFM stress-relaxation tests to extract the elastic modulus, the apparent viscosity, and the relaxation time of sub-cellular structures. The triple-layered modeling results allow for determination and comparison of the biomechanical properties of the three major sub-cellular structures between normal and cancerous cells: the up plasma membrane/actin cortex, the mid cytoplasm/nucleus, and the low nuclear/integrin sub-domains. The results reveal that the sub-domains become stiffer andmore » significantly more viscous with depth, regardless of cell type. In addition, there is a decreasing trend in the average elastic modulus and apparent viscosity of the all corresponding sub-cellular structures from normal to cancerous cells, which becomes most remarkable in the deeper sub-domain. The presented modeling in this work constitutes a unique AFM-based experimental framework to study the biomechanics of sub-cellular structures. - Highlights: • The cells are modeled as a triple-layered structure using Generalized Maxwell model. • The sub-domains include membrane/cortex, cytoplasm/nucleus, and nuclear/integrin. • Biomechanics of corresponding sub-domains are compared among normal and cancer cells. • Viscoelasticity of sub-domains show a decreasing trend from normal to cancer cells. • The decreasing trend becomes most significant in the deeper sub-domain.« less

Magnetization reversal process in (Sm, Dy, Gd) (Co, Fe, Cu, Zr)z magnets with different cellular structures

NASA Astrophysics Data System (ADS)

Liu, Lei; Liu, Zhuang; Zhang, Xin; Feng, Yanping; Wang, Chunxiao; Sun, Yingli; Lee, Don; Yan, Aru; Wu, Qiong

2017-05-01

Magnetization reversal mechanism is found to vary with cellular structures by a comparative study of the magnetization processes of three (Sm, Dy, Gd) (Co, Fe, Cu, Zr)z magnets with different cellular structures. Analysis of domain walls, initial magnetization curves and recoil loops indicates that the morphology of cellular structure has a significant effect on the magnetization process, besides the obvious connection to the difference of domain energy density between cell boundary phase (CBP) and main phase. The magnetization of Sample 2 (with a moderate cell size and uniformly continuous CBPs) behaves as a strong coherence domain-wall pinning effect to the domain wall and lead to a highest coercivity in the magnet. The magnetization of Sample 1 (with thin and discontinuous CBPs) shows an inconsistent pinning effect to the domain wall while that of Sample 3 (with thick and aggregate CBPs) exhibits a two-phase separation magnetization. Both the two cases lead to lower coercivities. A simplified model is given as well to describe the relationships among cellular structure and magnetization behavior.

Lactose-modified DNA tile nanostructures as drug carriers.

PubMed

Akkus Sut, Pinar; Tunc, Cansu Umran; Culha, Mustafa

2016-09-01

DNA hybridization allows the preparation of nanoscale DNA structures with desired shape and size. DNA structures using simple base pairing can be used for the delivery of drug molecules into the cells. Since DNA carries multiple negative charges, their cellular uptake efficiency is low. Thus, the modification of the DNA structures with molecules that may enhance the cellular internalization may be an option. The objective of this study is to construct DNA-based nanocarrier system and to investigate the cellular uptake of DNA tile with/without lactose modification. Doxorubicin was intercalated to DNA tile and cellular uptake of drug-loaded DNA-based carrier with/without lactose modification was investigated in vitro. HeLa, BT-474, and MDA-MB-231 cancer cells were used for cellular uptake studies and cytotoxicity assays. Using fluorescence spectroscopy, flow cytometry, and confocal microscopy, cellular uptake behavior of DNA tile was investigated. The cytotoxicity of DNA tile structures was determined with WST-1 assay. The results show that modification with lactose effectively increases the intracellular uptake of doxorubicin loaded DNA tile structure by cancer cells compared with the unmodified DNA tile. The findings of this study suggest that DNA-based nanostructures modified with carbohydrates can be used as suitable multifunctional nanocarriers with simple chemical modifications.

Innovative cellular distance structures from polymeric and metallic threads

NASA Astrophysics Data System (ADS)

Wieczorek, F.; Trümper, W.; Cherif, C.

2017-10-01

Knitting allows a high individual adaptability of the geometry and properties of flat-knitted spacer fabrics. This offers advantages for the specific adjustment of the mechanical properties of innovative composites based on highly viscous matrix systems such as bone cement, elastomer or foam and cellular reinforcing structures made from e. g. polymeric monofilaments or metallic wires. The prerequisite is the availability of binding solutions for highly productive production of functional, cellular, self-stabilized spacer flat knitted fabrics as supporting and functionalized structures.

Complex Ordered Patterns in Mechanical Instability Induced Geometrically Frustrated Triangular Cellular Structures

NASA Astrophysics Data System (ADS)

Kang, Sung Hoon; Shan, Sicong; Košmrlj, Andrej; Noorduin, Wim L.; Shian, Samuel; Weaver, James C.; Clarke, David R.; Bertoldi, Katia

2014-03-01

Geometrical frustration arises when a local order cannot propagate throughout the space because of geometrical constraints. This phenomenon plays a major role in many systems leading to disordered ground-state configurations. Here, we report a theoretical and experimental study on the behavior of buckling-induced geometrically frustrated triangular cellular structures. To our surprise, we find that buckling induces complex ordered patterns which can be tuned by controlling the porosity of the structures. Our analysis reveals that the connected geometry of the cellular structure plays a crucial role in the generation of ordered states in this frustrated system.

Visualizing Viral Protein Structures in Cells Using Genetic Probes for Correlated Light and Electron Microscopy

PubMed Central

Ou, Horng D.; Deerinck, Thomas J.; Bushong, Eric; Ellisman, Mark H.; O’Shea, Clodagh C.

2015-01-01

Structural studies of viral proteins most often use high-resolution techniques such as X-ray crystallography, nuclear magnetic resonance, single particle negative stain, or cryo-electron microscopy (EM) to reveal atomic interactions of soluble, homogeneous viral proteins or viral protein complexes. Once viral proteins or complexes are separated from their host’s cellular environment, their natural in-situ structure and details of how they interact with other cellular components may be lost. EM has been an invaluable tool in virology since its introduction in the late 1940’s and subsequent application to cells in the 1950’s. EM studies have expanded our knowledge of viral entry, viral replication, alteration of cellular components, and viral lysis. Most of these early studies were focused on conspicuous morphological cellular changes, because classic EM metal stains were designed to highlight classes of cellular structures rather than specific molecular structures. Much later, to identify viral proteins inducing specific structural configurations at the cellular level, immunostaining with a primary antibody followed by colloidal gold secondary antibody was employed to mark the location of specific viral proteins. This technique can suffer from artifacts in cellular ultrastructure due to compromises required to provide access to the immuno-reagents. Immunolocalization methods also require the generation of highly specific antibodies, which may not be available for every viral protein. Here we discuss new methods to visualize viral proteins and structures at high resolutions in-situ using correlated light and electron microscopy (CLEM). We discuss the use of genetically encoded protein fusions that oxidize diaminobenzidine (DAB) into an osmiophilic polymer that can be visualized by EM. Detailed protocols for applying the genetically encoded photo-oxidizing protein MiniSOG to a viral protein, photo-oxidation of the fusion protein to yield DAB polymer staining, and preparation of photo-oxidized samples for TEM and serial block-face scanning EM (SBEM) for large-scale volume EM data acquisition are also presented. As an example, we discuss the recent multi-scale analysis of Adenoviral protein E4-ORF3 that reveals a new type of multi-functional polymer that disrupts multiple cellular proteins. This new capability to visualize unambiguously specific viral protein structures at high resolutions in the native cellular environment is revealing new insights into how they usurp host proteins and functions to drive pathological viral replication. PMID:26066760

Visualizing viral protein structures in cells using genetic probes for correlated light and electron microscopy.

PubMed

Ou, Horng D; Deerinck, Thomas J; Bushong, Eric; Ellisman, Mark H; O'Shea, Clodagh C

2015-11-15

Structural studies of viral proteins most often use high-resolution techniques such as X-ray crystallography, nuclear magnetic resonance, single particle negative stain, or cryo-electron microscopy (EM) to reveal atomic interactions of soluble, homogeneous viral proteins or viral protein complexes. Once viral proteins or complexes are separated from their host's cellular environment, their natural in situ structure and details of how they interact with other cellular components may be lost. EM has been an invaluable tool in virology since its introduction in the late 1940's and subsequent application to cells in the 1950's. EM studies have expanded our knowledge of viral entry, viral replication, alteration of cellular components, and viral lysis. Most of these early studies were focused on conspicuous morphological cellular changes, because classic EM metal stains were designed to highlight classes of cellular structures rather than specific molecular structures. Much later, to identify viral proteins inducing specific structural configurations at the cellular level, immunostaining with a primary antibody followed by colloidal gold secondary antibody was employed to mark the location of specific viral proteins. This technique can suffer from artifacts in cellular ultrastructure due to compromises required to provide access to the immuno-reagents. Immunolocalization methods also require the generation of highly specific antibodies, which may not be available for every viral protein. Here we discuss new methods to visualize viral proteins and structures at high resolutions in situ using correlated light and electron microscopy (CLEM). We discuss the use of genetically encoded protein fusions that oxidize diaminobenzidine (DAB) into an osmiophilic polymer that can be visualized by EM. Detailed protocols for applying the genetically encoded photo-oxidizing protein MiniSOG to a viral protein, photo-oxidation of the fusion protein to yield DAB polymer staining, and preparation of photo-oxidized samples for TEM and serial block-face scanning EM (SBEM) for large-scale volume EM data acquisition are also presented. As an example, we discuss the recent multi-scale analysis of Adenoviral protein E4-ORF3 that reveals a new type of multi-functional polymer that disrupts multiple cellular proteins. This new capability to visualize unambiguously specific viral protein structures at high resolutions in the native cellular environment is revealing new insights into how they usurp host proteins and functions to drive pathological viral replication. Copyright © 2015 Elsevier Inc. All rights reserved.

The auxetic behavior of an expanded periodic cellular structure

NASA Astrophysics Data System (ADS)

Ciolan, Mihaela A.; Lache, Simona; Velea, Marian N.

2018-02-01

Within nowadays research, when it comes to lightweight sandwich panels, periodic cellular structures are considered real trendsetters. One of the most used type of core in producing sandwich panels is the honeycomb. However, due to its relatively high manufacturing cost, this structure has limited applications; therefore, research has been carried out in order to develop alternative solutions. An example in this sense is the ExpaAsym cellular structure, developed at the Transilvania University of Braşov; it represents a periodic cellular structure manufactured through a mechanically expansion process of a previously cut and perforated sheet material. The relative density of the structure was proven to be significantly lower than the one of the honeycomb. This gives a great advantage to the structure, due to the fact that when the internal angle A of the unit cell is 60°, after the mechanical expansion it results a hexagonal structure. The main objective of this paper is to estimate the in-plane Poisson ratios of the structure, in terms of its geometrical parameters. It is therefore analytically shown that for certain values of the geometric parameters, the in-plane Poisson ratios have negative values when the internal angle exceeds 90°, which determines its auxetic behavior.

Development of 3D woven cellular structures for adaptive composites based on thermoplastic hybrid yarns

NASA Astrophysics Data System (ADS)

Sennewald, C.; Vorhof, M.; Schegner, P.; Hoffmann, G.; Cherif, C.; Boblenz, J.; Sinapius, M.; Hühne, C.

2018-05-01

Flexible cellular 3D structures with structure-inherent compliance made of fiber-reinforced composites have repeatedly aroused the interest of international research groups. Such structures offer the possibility to meet the increasing demand for flexible and adaptive structures. The aim of this paper is the development of cellular 3D structures based on weaving technology. Considering the desired geometry of the 3D structure, algorithms are developed for the formation of geometry through tissue sub-areas. Subsequently, these sub-areas are unwound into the weaving level and appropriate weave patterns are developed. A particular challenge is the realization of compliant mechanisms in the woven fabric. This can be achieved either by combining different materials or, in particular, by implementing large stiffness gradients by means of varying the woven fabrics thickness, whereas differences in wall thickness have to be realized with a factor of 1:10. A manufacturing technology based on the weaving process is developed for the realization of the developed 3D cellular structures. To this end, solutions for the processing of hybrid thermoplastic materials (e.g. tapes), solutions for the integration of inlays in the weaving process (thickening of partial areas), and solutions for tissue retraction, as well as for the fabric pull-off (linear pull-off system) are being developed. In this way, woven cellular 3D structures with woven outer layers and woven joint areas (compliance) can be realized in a single process step and are subsequently characterized.

Dynamic behavior of cellular materials and cellular structures: Experiments and modeling

NASA Astrophysics Data System (ADS)

Gao, Ziyang

Cellular solids, including cellular materials and cellular structures (CMS), have attracted people's great interests because of their low densities and novel physical, mechanical, thermal, electrical and acoustic properties. They offer potential for lightweight structures, energy absorption, thermal management, etc. Therefore, the studies of cellular solids have become one of the hottest research fields nowadays. From energy absorption point of view, any plastically deformed structures can be divided into two types (called type I and type II), and the basic cells of the CMS may take the configurations of these two types of structures. Accordingly, separated discussions are presented in this thesis. First, a modified 1-D model is proposed and numerically solved for a typical type II structure. Good agreement is achieved with the previous experimental data, hence is used to simulate the dynamic behavior of a type II chain. Resulted from different load speeds, interesting collapse modes are observed, and the parameters which govern the cell's post-collapse behavior are identified through a comprehensive non-dimensional analysis on general cellular chains. Secondly, the MHS specimens are chosen as an example of type I foam materials because of their good uniformity of the cell geometry. An extensive experimental study was carried out, where more attention was paid to their responses to dynamic loadings. Great enhancement of the stress-strain curve was observed in dynamic cases, and the energy absorption capacity is found to be several times higher than that of the commercial metal foams. Based on the experimental study, finite elemental simulations and theoretical modeling are also conducted, achieving good agreements and demonstrating the validities of those models. It is believed that the experimental, numerical and analytical results obtained in the present study will certainly deepen the understanding of the unsolved fundamental issues on the mechanical behavior of cellular solids and make substantial contributions to the theoretical advance of impact dynamics.

The Virtual Cell Animation Collection: Tools for Teaching Molecular and Cellular Biology

PubMed Central

Reindl, Katie M.; White, Alan R.; Johnson, Christina; Vender, Bradley; Slator, Brian M.; McClean, Phillip

2015-01-01

A cell is a minifactory in which structures and molecules are assembled, rearranged, disassembled, packaged, sorted, and transported. Because cellular structures and molecules are invisible to the human eye, students often have difficulty conceptualizing the dynamic nature of cells that function at multiple scales across time and space. To represent these dynamic cellular processes, the Virtual Cell Productions team at North Dakota State University develops freely available multimedia materials to support molecular and cellular biology learning inside and outside the high school and university classroom. PMID:25856580

3D visualization of subcellular structures of Schizosaccharomyces pombe by hard X-ray tomography.

PubMed

Yang, Y; Li, W; Liu, G; Zhang, X; Chen, J; Wu, W; Guan, Y; Xiong, Y; Tian, Y; Wu, Z

2010-10-01

Cellular structures of the fission yeast, Schizosaccharomyces pombe, were examined by using hard X-ray tomography. Since cells are nearly transparent to hard X-rays, Zernike phase contrast and heavy metal staining were introduced to improve image contrast. Through using such methods, images taken at 8 keV displayed sufficient contrast for observing cellular structures. The cell wall, the intracellular organelles and the entire structural organization of the whole cells were visualized in three-dimensional at a resolution better than 100 nm. Comparison between phase contrast and absorption contrast was also made, indicating the obvious advantage of phase contrast for cellular imaging at this energy. Our results demonstrate that hard X-ray tomography with Zernike phase contrast is suitable for cellular imaging. Its unique abilities make it have potential to become a useful tool for revealing structural information from cells, especially thick eukaryotic cells. © 2010 The Authors Journal compilation © 2010 The Royal Microscopical Society.

Cellular complexity captured in durable silica biocomposites

PubMed Central

Kaehr, Bryan; Townson, Jason L.; Kalinich, Robin M.; Awad, Yasmine H.; Swartzentruber, B. S.; Dunphy, Darren R.; Brinker, C. Jeffrey

2012-01-01

Tissue-derived cultured cells exhibit a remarkable range of morphological features in vitro, depending on phenotypic expression and environmental interactions. Translation of these cellular architectures into inorganic materials would provide routes to generate hierarchical nanomaterials with stabilized structures and functions. Here, we describe the fabrication of cell/silica composites (CSCs) and their conversion to silica replicas using mammalian cells as scaffolds to direct complex structure formation. Under mildly acidic solution conditions, silica deposition is restricted to the molecularly crowded cellular template. Inter- and intracellular heterogeneity from the nano- to macroscale is captured and dimensionally preserved in CSCs following drying and subjection to extreme temperatures allowing, for instance, size and shape preserving pyrolysis of cellular architectures to form conductive carbon replicas. The structural and behavioral malleability of the starting material (cultured cells) provides opportunities to develop robust and economical biocomposites with programmed structures and functions. PMID:23045634

The concept of self-organization in cellular architecture

PubMed Central

Misteli, Tom

2001-01-01

In vivo microscopy has recently revealed the dynamic nature of many cellular organelles. The dynamic properties of several cellular structures are consistent with a role for self-organization in their formation, maintenance, and function; therefore, self-organization might be a general principle in cellular organization. PMID:11604416

Around the macrolide - Impact of 3D structure of macrocycles on lipophilicity and cellular accumulation.

PubMed

Koštrun, Sanja; Munic Kos, Vesna; Matanović Škugor, Maja; Palej Jakopović, Ivana; Malnar, Ivica; Dragojević, Snježana; Ralić, Jovica; Alihodžić, Sulejman

2017-06-16

The aim of this study was to investigate lipophilicity and cellular accumulation of rationally designed azithromycin and clarithromycin derivatives at the molecular level. The effect of substitution site and substituent properties on a global physico-chemical profile and cellular accumulation of investigated compounds was studied using calculated structural parameters as well as experimentally determined lipophilicity. In silico models based on the 3D structure of molecules were generated to investigate conformational effect on studied properties and to enable prediction of lipophilicity and cellular accumulation for this class of molecules based on non-empirical parameters. The applicability of developed models was explored on a validation and test sets and compared with previously developed empirical models. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Challenges in structural approaches to cell modeling

PubMed Central

Im, Wonpil; Liang, Jie; Olson, Arthur; Zhou, Huan-Xiang; Vajda, Sandor; Vakser, Ilya A.

2016-01-01

Computational modeling is essential for structural characterization of biomolecular mechanisms across the broad spectrum of scales. Adequate understanding of biomolecular mechanisms inherently involves our ability to model them. Structural modeling of individual biomolecules and their interactions has been rapidly progressing. However, in terms of the broader picture, the focus is shifting toward larger systems, up to the level of a cell. Such modeling involves a more dynamic and realistic representation of the interactomes in vivo, in a crowded cellular environment, as well as membranes and membrane proteins, and other cellular components. Structural modeling of a cell complements computational approaches to cellular mechanisms based on differential equations, graph models, and other techniques to model biological networks, imaging data, etc. Structural modeling along with other computational and experimental approaches will provide a fundamental understanding of life at the molecular level and lead to important applications to biology and medicine. A cross section of diverse approaches presented in this review illustrates the developing shift from the structural modeling of individual molecules to that of cell biology. Studies in several related areas are covered: biological networks; automated construction of three-dimensional cell models using experimental data; modeling of protein complexes; prediction of non-specific and transient protein interactions; thermodynamic and kinetic effects of crowding; cellular membrane modeling; and modeling of chromosomes. The review presents an expert opinion on the current state-of-the-art in these various aspects of structural modeling in cellular biology, and the prospects of future developments in this emerging field. PMID:27255863

Imaging deep skeletal muscle structure using a high-sensitivity ultrathin side-viewing optical coherence tomography needle probe

PubMed Central

Yang, Xiaojie; Lorenser, Dirk; McLaughlin, Robert A.; Kirk, Rodney W.; Edmond, Matthew; Simpson, M. Cather; Grounds, Miranda D.; Sampson, David D.

2013-01-01

We have developed an extremely miniaturized optical coherence tomography (OCT) needle probe (outer diameter 310 µm) with high sensitivity (108 dB) to enable minimally invasive imaging of cellular structure deep within skeletal muscle. Three-dimensional volumetric images were acquired from ex vivo mouse tissue, examining both healthy and pathological dystrophic muscle. Individual myofibers were visualized as striations in the images. Degradation of cellular structure in necrotic regions was seen as a loss of these striations. Tendon and connective tissue were also visualized. The observed structures were validated against co-registered hematoxylin and eosin (H&E) histology sections. These images of internal cellular structure of skeletal muscle acquired with an OCT needle probe demonstrate the potential of this technique to visualize structure at the microscopic level deep in biological tissue in situ. PMID:24466482

Differential growth of wrinkled biofilms

NASA Astrophysics Data System (ADS)

Espeso, D. R.; Carpio, A.; Einarsson, B.

2015-02-01

Biofilms are antibiotic-resistant bacterial aggregates that grow on moist surfaces and can trigger hospital-acquired infections. They provide a classical example in biology where the dynamics of cellular communities may be observed and studied. Gene expression regulates cell division and differentiation, which affect the biofilm architecture. Mechanical and chemical processes shape the resulting structure. We gain insight into the interplay between cellular and mechanical processes during biofilm development on air-agar interfaces by means of a hybrid model. Cellular behavior is governed by stochastic rules informed by a cascade of concentration fields for nutrients, waste, and autoinducers. Cellular differentiation and death alter the structure and the mechanical properties of the biofilm, which is deformed according to Föppl-Von Kármán equations informed by cellular processes and the interaction with the substratum. Stiffness gradients due to growth and swelling produce wrinkle branching. We are able to reproduce wrinkled structures often formed by biofilms on air-agar interfaces, as well as spatial distributions of differentiated cells commonly observed with B. subtilis.

Distinction of broken cellular wall Ganoderma lucidum spores and G. lucidum spores using FTIR microspectroscopy

NASA Astrophysics Data System (ADS)

Chen, Xianliang; Liu, Xingcun; Sheng, Daping; Huang, Dake; Li, Weizu; Wang, Xin

2012-11-01

In this paper, FTIR microspectroscopy was used to identify broken cellular wall Ganoderma lucidum spores and G. lucidum spores. For IR spectra, broken cellular wall G. lucidum spores and G. lucidum spores were mainly different in the regions of 3000-2800, 1660-1600, 1400-1200 and 1100-1000 cm-1. For curve fitting, the results showed the differences in the protein secondary structures and the polysaccharide structures/content between broken cellular wall G. lucidum spores and G. lucidum spores. Moreover, the value of A1078/A1741 might be a potentially useful factor to distinguish broken cellular wall G. lucidum spores from G. lucidum spores. Additionally, FTIR microspectroscopy could identify broken cellular wall G. lucidum spores and G. lucidum spores accurately when it was combined with hierarchical cluster analysis. The result suggests FTIR microspectroscopy is very simple and efficient for distinction of broken cellular wall G. lucidum spores and G. lucidum spores. The result also indicates FTIR microspectroscopy may be useful for TCM identification.

High-strength cellular ceramic composites with 3D microarchitecture.

PubMed

Bauer, Jens; Hengsbach, Stefan; Tesari, Iwiza; Schwaiger, Ruth; Kraft, Oliver

2014-02-18

To enhance the strength-to-weight ratio of a material, one may try to either improve the strength or lower the density, or both. The lightest solid materials have a density in the range of 1,000 kg/m(3); only cellular materials, such as technical foams, can reach considerably lower values. However, compared with corresponding bulk materials, their specific strength generally is significantly lower. Cellular topologies may be divided into bending- and stretching-dominated ones. Technical foams are structured randomly and behave in a bending-dominated way, which is less weight efficient, with respect to strength, than stretching-dominated behavior, such as in regular braced frameworks. Cancellous bone and other natural cellular solids have an optimized architecture. Their basic material is structured hierarchically and consists of nanometer-size elements, providing a benefit from size effects in the material strength. Designing cellular materials with a specific microarchitecture would allow one to exploit the structural advantages of stretching-dominated constructions as well as size-dependent strengthening effects. In this paper, we demonstrate that such materials may be fabricated. Applying 3D laser lithography, we produced and characterized micro-truss and -shell structures made from alumina-polymer composite. Size-dependent strengthening of alumina shells has been observed, particularly when applied with a characteristic thickness below 100 nm. The presented artificial cellular materials reach compressive strengths up to 280 MPa with densities well below 1,000 kg/m(3).

Fabrication and characterisation of a fully auxetic 3D lattice structure via selective electron beam melting

NASA Astrophysics Data System (ADS)

Warmuth, Franziska; Osmanlic, Fuad; Adler, Lucas; Lodes, Matthias A.; Körner, Carolin

2017-02-01

A three-dimensional fully auxetic cellular structure with negative Poisson’s ratio is presented. Samples are fabricated from Ti6Al4V powder via selective electron beam melting. The influence of the strut thickness and the amplitude of the strut on the mechanical properties and the deformation behaviour of cellular structures is studied.

Interplay between self-assembled structure of bone morphogenetic protein-2 (BMP-2) and osteoblast functions in three-dimensional titanium alloy scaffolds: Stimulation of osteogenic activity.

PubMed

Nune, K C; Kumar, A; Murr, L E; Misra, R D K

2016-02-01

Three-dimensional cellular scaffolds are receiving significant attention in bone tissue engineering to treat segmental bone defects. However, there are indications of lack of significant osteoinductive ability of three-dimensional cellular scaffolds. In this regard, the objective of the study is to elucidate the interplay between bone morphogenetic protein (BMP-2) and osteoblast functions on 3D mesh structures with different porosities and pore size that were fabricated by electron beam melting. Self-assembled dendritic microstructure with interconnected cellular-type morphology of BMP-2 on 3D scaffolds stimulated osteoblast functions including adhesion, proliferation, and mineralization, with prominent effect on 2-mm mesh. Furthermore, immunofluorescence studies demonstrated higher density and viability of osteoblasts on lower porosity mesh structure (2 mm) as compared to 3- and 4-mm mesh structures. Enhanced filopodia cellular extensions with extensive cell spreading was observed on BMP-2 treated mesh structures, a behavior that is attributed to the unique self-assembled structure of BMP-2 that effectively communicates with the cells. The study underscores the potential of BMP-2 in imparting osteoinductive capability to the 3D printed scaffolds. © 2015 Wiley Periodicals, Inc.

Wavefront cellular learning automata.

PubMed

Moradabadi, Behnaz; Meybodi, Mohammad Reza

2018-02-01

This paper proposes a new cellular learning automaton, called a wavefront cellular learning automaton (WCLA). The proposed WCLA has a set of learning automata mapped to a connected structure and uses this structure to propagate the state changes of the learning automata over the structure using waves. In the WCLA, after one learning automaton chooses its action, if this chosen action is different from the previous action, it can send a wave to its neighbors and activate them. Each neighbor receiving the wave is activated and must choose a new action. This structure for the WCLA is necessary in many dynamic areas such as social networks, computer networks, grid computing, and web mining. In this paper, we introduce the WCLA framework as an optimization tool with diffusion capability, study its behavior over time using ordinary differential equation solutions, and present its accuracy using expediency analysis. To show the superiority of the proposed WCLA, we compare the proposed method with some other types of cellular learning automata using two benchmark problems.

Wavefront cellular learning automata

NASA Astrophysics Data System (ADS)

Moradabadi, Behnaz; Meybodi, Mohammad Reza

2018-02-01

This paper proposes a new cellular learning automaton, called a wavefront cellular learning automaton (WCLA). The proposed WCLA has a set of learning automata mapped to a connected structure and uses this structure to propagate the state changes of the learning automata over the structure using waves. In the WCLA, after one learning automaton chooses its action, if this chosen action is different from the previous action, it can send a wave to its neighbors and activate them. Each neighbor receiving the wave is activated and must choose a new action. This structure for the WCLA is necessary in many dynamic areas such as social networks, computer networks, grid computing, and web mining. In this paper, we introduce the WCLA framework as an optimization tool with diffusion capability, study its behavior over time using ordinary differential equation solutions, and present its accuracy using expediency analysis. To show the superiority of the proposed WCLA, we compare the proposed method with some other types of cellular learning automata using two benchmark problems.

Advances in high-resolution imaging--techniques for three-dimensional imaging of cellular structures.

PubMed

Lidke, Diane S; Lidke, Keith A

2012-06-01

A fundamental goal in biology is to determine how cellular organization is coupled to function. To achieve this goal, a better understanding of organelle composition and structure is needed. Although visualization of cellular organelles using fluorescence or electron microscopy (EM) has become a common tool for the cell biologist, recent advances are providing a clearer picture of the cell than ever before. In particular, advanced light-microscopy techniques are achieving resolutions below the diffraction limit and EM tomography provides high-resolution three-dimensional (3D) images of cellular structures. The ability to perform both fluorescence and electron microscopy on the same sample (correlative light and electron microscopy, CLEM) makes it possible to identify where a fluorescently labeled protein is located with respect to organelle structures visualized by EM. Here, we review the current state of the art in 3D biological imaging techniques with a focus on recent advances in electron microscopy and fluorescence super-resolution techniques.

Dynamic Finite Element Predictions for Mars Sample Return Cellular Impact Test #4

NASA Technical Reports Server (NTRS)

Fasanella, Edwin L.; Billings, Marcus D.

2001-01-01

The nonlinear finite element program MSC.Dytran was used to predict the impact pulse for (he drop test of an energy absorbing cellular structure. This pre-test simulation was performed to aid in the design of an energy absorbing concept for a highly reliable passive Earth Entry Vehicle (EEV) that will directly impact the Earth without a parachute. In addition, a goal of the simulation was to bound the acceleration pulse produced and delivered to the simulated space cargo container. EEV's are designed to return materials from asteroids, comets, or planets for laboratory analysis on Earth. The EEV concept uses an energy absorbing cellular structure designed to contain and limit the acceleration of space exploration samples during Earth impact. The spherical shaped cellular structure is composed of solid hexagonal and pentagonal foam-filled cells with hybrid graphite-epoxy/Kevlar cell walls. Space samples fit inside a smaller sphere at the enter of the EEV's cellular structure. The material models and failure criteria were varied to determine their effect on the resulting acceleration pulse. Pre-test analytical predictions using MSC.Dytran were compared with the test results obtained from impact test #4 using bungee accelerator located at the NASA Langley Research Center Impact Dynamics Research Facility. The material model used to represent the foam and the proper failure criteria for the cell walls were critical in predicting the impact loads of the cellular structure. It was determined that a FOAMI model for the foam and a 20% failure strain criteria for the cell walls gave an accurate prediction of the acceleration pulse for drop test #4.

Challenges in structural approaches to cell modeling.

PubMed

Im, Wonpil; Liang, Jie; Olson, Arthur; Zhou, Huan-Xiang; Vajda, Sandor; Vakser, Ilya A

2016-07-31

Computational modeling is essential for structural characterization of biomolecular mechanisms across the broad spectrum of scales. Adequate understanding of biomolecular mechanisms inherently involves our ability to model them. Structural modeling of individual biomolecules and their interactions has been rapidly progressing. However, in terms of the broader picture, the focus is shifting toward larger systems, up to the level of a cell. Such modeling involves a more dynamic and realistic representation of the interactomes in vivo, in a crowded cellular environment, as well as membranes and membrane proteins, and other cellular components. Structural modeling of a cell complements computational approaches to cellular mechanisms based on differential equations, graph models, and other techniques to model biological networks, imaging data, etc. Structural modeling along with other computational and experimental approaches will provide a fundamental understanding of life at the molecular level and lead to important applications to biology and medicine. A cross section of diverse approaches presented in this review illustrates the developing shift from the structural modeling of individual molecules to that of cell biology. Studies in several related areas are covered: biological networks; automated construction of three-dimensional cell models using experimental data; modeling of protein complexes; prediction of non-specific and transient protein interactions; thermodynamic and kinetic effects of crowding; cellular membrane modeling; and modeling of chromosomes. The review presents an expert opinion on the current state-of-the-art in these various aspects of structural modeling in cellular biology, and the prospects of future developments in this emerging field. Copyright © 2016 Elsevier Ltd. All rights reserved.

Manufacturing and Characterization of 18Ni Marage 300 Lattice Components by Selective Laser Melting.

PubMed

Contuzzi, Nicola; Campanelli, Sabina L; Casavola, Caterina; Lamberti, Luciano

2013-08-13

The spreading use of cellular structures brings the need to speed up manufacturing processes without deteriorating mechanical properties. By using Selective Laser Melting (SLM) to produce cellular structures, the designer has total freedom in defining part geometry and manufacturing is simplified. The paper investigates the suitability of Selective Laser Melting for manufacturing steel cellular lattice structures with characteristic dimensions in the micrometer range. Alternative lattice topologies including reinforcing bars in the vertical direction also are considered. The selected lattice structure topology is shown to be superior over other lattice structure designs considered in literature. Compression tests are carried out in order to evaluate mechanical strength of lattice strut specimens made via SLM. Compressive behavior of samples also is simulated by finite element analysis and numerical results are compared with experimental data in order to assess the constitutive behavior of the lattice structure designs considered in this study. Experimental data show that it is possible to build samples of relative density in the 0.2456-0.4367 range. Compressive strength changes almost linearly with respect to relative density, which in turns depends linearly on the number of vertical reinforces. Specific strength increases with cell and strut edge size. Numerical simulations confirm the plastic nature of the instability phenomena that leads the cellular structures to collapse under compression loading.

Design of Improved Arithmetic Logic Unit in Quantum-Dot Cellular Automata

NASA Astrophysics Data System (ADS)

Heikalabad, Saeed Rasouli; Gadim, Mahya Rahimpour

2018-06-01

The quantum-dot cellular automata (QCA) can be replaced to overcome the limitation of CMOS technology. An arithmetic logic unit (ALU) is a basic structure of any computer devices. In this paper, design of improved single-bit arithmetic logic unit in quantum dot cellular automata is presented. The proposed structure for ALU has AND, OR, XOR and ADD operations. A unique 2:1 multiplexer, an ultra-efficient two-input XOR and a low complexity full adder are used in the proposed structure. Also, an extended design of this structure is provided for two-bit ALU in this paper. The proposed structure of ALU is simulated by QCADesigner and simulation result is evaluated. Evaluation results show that the proposed design has best performance in terms of area, complexity and delay compared to the previous designs.

Design of Improved Arithmetic Logic Unit in Quantum-Dot Cellular Automata

NASA Astrophysics Data System (ADS)

Heikalabad, Saeed Rasouli; Gadim, Mahya Rahimpour

2018-03-01

The quantum-dot cellular automata (QCA) can be replaced to overcome the limitation of CMOS technology. An arithmetic logic unit (ALU) is a basic structure of any computer devices. In this paper, design of improved single-bit arithmetic logic unit in quantum dot cellular automata is presented. The proposed structure for ALU has AND, OR, XOR and ADD operations. A unique 2:1 multiplexer, an ultra-efficient two-input XOR and a low complexity full adder are used in the proposed structure. Also, an extended design of this structure is provided for two-bit ALU in this paper. The proposed structure of ALU is simulated by QCADesigner and simulation result is evaluated. Evaluation results show that the proposed design has best performance in terms of area, complexity and delay compared to the previous designs.

Viral and cellular subnuclear structures in human cytomegalovirus-infected cells.

PubMed

Strang, Blair L

2015-02-01

In human cytomegalovirus (HCMV)-infected cells, a dramatic remodelling of the nuclear architecture is linked to the creation, utilization and manipulation of subnuclear structures. This review outlines the involvement of several viral and cellular subnuclear structures in areas of HCMV replication and virus-host interaction that include viral transcription, viral DNA synthesis and the production of DNA-filled viral capsids. The structures discussed include those that promote or impede HCMV replication (such as viral replication compartments and promyelocytic leukaemia nuclear bodies, respectively) and those whose role in the infected cell is unclear (for example, nucleoli and nuclear speckles). Viral and cellular proteins associated with subnuclear structures are also discussed. The data reviewed here highlight advances in our understanding of HCMV biology and emphasize the complexity of HCMV replication and virus-host interactions in the nucleus. © 2015 The Authors.

Morphing hybrid honeycomb (MOHYCOMB) with in situ Poisson’s ratio modulation

NASA Astrophysics Data System (ADS)

Heath, Callum J. C.; Neville, Robin M.; Scarpa, Fabrizio; Bond, Ian P.; Potter, Kevin D.

2016-08-01

Electrostatic adhesion can be used as a means of reversible attachment. Through application of high voltage (~2 kV) across closely spaced parallel plate electrodes, significant shear stresses (11 kPa) can be generated. The highest levels of electrostatic holding force can be achieved through close contact of connection surfaces; this is facilitated by flexible electrodes which can conform to reduce air gaps. Cellular structures are comprised of thin walled elements, making them ideal host structures for electrostatic adhesive elements. The reversible adhesion provides control of the internal connectivity of the cellular structure, and determines the effective cell geometry. This would offer variable stiffness and control of the effective Poisson’s ratio of the global cellular array. Using copper-polyimide thin film laminates and PVDF thin film dielectrics, double lap shear electrostatic adhesive elements have been introduced to a cellular geometry. By activating different groups of reversible adhesive interfaces, the cellular array can assume four different cell configurations. A maximum stiffness modulation of 450% between the ‘All off’ and ‘All on’ cell morphologies has been demonstrated. This structure is also capable of in situ effective Poisson’s ratio variations, with the ability to switch between values of -0.45 and 0.54. Such a structure offers the potential for tuneable vibration absorption (due to its variable stiffness properties), or as a smart honeycomb with controllable curvature and is termed morphing hybrid honeycomb.

Magnetic alginate microfibers as scaffolding elements for the fabrication of microvascular-like structures.

PubMed

Sun, Tao; Shi, Qing; Huang, Qiang; Wang, Huaping; Xiong, Xiaolu; Hu, Chengzhi; Fukuda, Toshio

2018-01-15

Traditional cell-encapsulating scaffolds may elicit adverse host responses and inhomogeneity in cellular distribution. Thus, fabrication techniques for cellular self-assembly with micro-scaffold incorporation have been used recently to generate toroidal cellular modules for the bottom-up construction of vascular-like structures. The micro-scaffolds show advantage in promoting tissue formation. However, owing to the lack of annular cell micro-scaffolds, it remains a challenge to engineer micro-scale toroidal cellular modules (micro-TCMs) to fabricate microvascular-like structures. Here, magnetic alginate microfibers (MAMs) are used as scaffolding elements, where a winding strategy enables them to be formed into micro-rings as annular cell micro-scaffolds. These micro-rings were investigated for NIH/3T3 fibroblast growth as a function of surface chemistry and MAM size. Afterwards, micro-TCMs were successfully fabricated with the formation of NIH/3T3 fibroblasts and extracellular matrix layers on the three-dimensional micro-ring surfaces. Simple non-contact magnetic assembly was used to stack the micro-TCMs along a micro-pillar, after which cell fusion rapidly connected the assembled micro-TCMs into a microvascular-like structure. Endothelial cells or drugs encapsulated in the MAMs could be included in the microvascular-like structures as in vitro cellular models for vascular tissue engineering, or as miniaturization platforms for pharmaceutical drug testing in the future. Magnetic alginate microfibers functioned as scaffolding elements for guiding cell growth in micro-scale toroidal cellular modules (micro-TCMs) and provided a magnetic functionality to the micro-TCMs for non-contact 3D assembly in external magnetic fields. By using the liquid/air interface, the non-contact spatial manipulation of the micro-TCMs in the liquid environment was performed with a cost-effective motorized electromagnetic needle. A new biofabrication paradigm of construct of microvascular-like structure. The micro-tubal-shaped structures allowed direct cell-to-cell contact that solved problems of cell-encapsulating scaffolds. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

A search for structurally similar cellular internal ribosome entry sites

PubMed Central

Baird, Stephen D.; Lewis, Stephen M.; Turcotte, Marcel; Holcik, Martin

2007-01-01

Internal ribosome entry sites (IRES) allow ribosomes to be recruited to mRNA in a cap-independent manner. Some viruses that impair cap-dependent translation initiation utilize IRES to ensure that the viral RNA will efficiently compete for the translation machinery. IRES are also employed for the translation of a subset of cellular messages during conditions that inhibit cap-dependent translation initiation. IRES from viruses like Hepatitis C and Classical Swine Fever virus share a similar structure/function without sharing primary sequence similarity. Of the cellular IRES structures derived so far, none were shown to share an overall structural similarity. Therefore, we undertook a genome-wide search of human 5′UTRs (untranslated regions) with an empirically derived structure of the IRES from the key inhibitor of apoptosis, X-linked inhibitor of apoptosis protein (XIAP), to identify novel IRES that share structure/function similarity. Three of the top matches identified by this search that exhibit IRES activity are the 5′UTRs of Aquaporin 4, ELG1 and NF-kappaB repressing factor (NRF). The structures of AQP4 and ELG1 IRES have limited similarity to the XIAP IRES; however, they share trans-acting factors that bind the XIAP IRES. We therefore propose that cellular IRES are not defined by overall structure, as viral IRES, but are instead dependent upon short motifs and trans-acting factors for their function. PMID:17591613

Effect of the temperature-rate parameters of directional solidification on the structure formation in high-temperature materials

NASA Astrophysics Data System (ADS)

Svetlov, I. L.; Neiman, A. V.

2017-03-01

The effect of the temperature gradient and the crystal growth rate on the structure formation in nickel and niobium superalloys is studied under the conditions of the flat, cellular, dendritic, or dendritic-cellular configuration of a solidification front during directional solidification.

Close the Textbook & Open "The Cell: An Image Library"

ERIC Educational Resources Information Center

Saunders, Cheston; Taylor, Amy

2014-01-01

Many students leave the biology classroom with misconceptions centered on cellular structure. This article presents an activity in which students utilize images from an online database called "The Cell: An Image Library" (http://www.cellimagelibrary. org/) to gain a greater understanding of the diversity of cellular structure and the…

Cellular imaging of deep organ using two-photon Bessel light-sheet nonlinear structured illumination microscopy

PubMed Central

Zhao, Ming; Zhang, Han; Li, Yu; Ashok, Amit; Liang, Rongguang; Zhou, Weibin; Peng, Leilei

2014-01-01

In vivo fluorescent cellular imaging of deep internal organs is highly challenging, because the excitation needs to penetrate through strong scattering tissue and the emission signal is degraded significantly by photon diffusion induced by tissue-scattering. We report that by combining two-photon Bessel light-sheet microscopy with nonlinear structured illumination microscopy (SIM), live samples up to 600 microns wide can be imaged by light-sheet microscopy with 500 microns penetration depth, and diffused background in deep tissue light-sheet imaging can be reduced to obtain clear images at cellular resolution in depth beyond 200 microns. We demonstrate in vivo two-color imaging of pronephric glomeruli and vasculature of zebrafish kidney, whose cellular structures located at the center of the fish body are revealed in high clarity by two-color two-photon Bessel light-sheet SIM. PMID:24876996

From Stochastic Foam to Designed Structure: Balancing Cost and Performance of Cellular Metals

PubMed Central

Lehmhus, Dirk; Vesenjak, Matej

2017-01-01

Over the past two decades, a large number of metallic foams have been developed. In recent years research on this multi-functional material class has further intensified. However, despite their unique properties only a limited number of large-scale applications have emerged. One important reason for this sluggish uptake is their high cost. Many cellular metals require expensive raw materials, complex manufacturing procedures, or a combination thereof. Some attempts have been made to decrease costs by introducing novel foams based on cheaper components and new manufacturing procedures. However, this has often yielded materials with unreliable properties that inhibit utilization of their full potential. The resulting balance between cost and performance of cellular metals is probed in this editorial, which attempts to consider cost not in absolute figures, but in relation to performance. To approach such a distinction, an alternative classification of cellular metals is suggested which centers on structural aspects and the effort of realizing them. The range thus covered extends from fully stochastic foams to cellular structures designed-to-purpose. PMID:28786935

Engineering cellular fibers for musculoskeletal soft tissues using directed self-assembly.

PubMed

Schiele, Nathan R; Koppes, Ryan A; Chrisey, Douglas B; Corr, David T

2013-05-01

Engineering strategies guided by developmental biology may enhance and accelerate in vitro tissue formation for tissue engineering and regenerative medicine applications. In this study, we looked toward embryonic tendon development as a model system to guide our soft tissue engineering approach. To direct cellular self-assembly, we utilized laser micromachined, differentially adherent growth channels lined with fibronectin. The micromachined growth channels directed human dermal fibroblast cells to form single cellular fibers, without the need for a provisional three-dimensional extracellular matrix or scaffold to establish a fiber structure. Therefore, the resulting tissue structure and mechanical characteristics were determined solely by the cells. Due to the self-assembly nature of this approach, the growing fibers exhibit some key aspects of embryonic tendon development, such as high cellularity, the rapid formation (within 24 h) of a highly organized and aligned cellular structure, and the expression of cadherin-11 (indicating direct cell-to-cell adhesions). To provide a dynamic mechanical environment, we have also developed and characterized a method to apply precise cyclic tensile strain to the cellular fibers as they develop. After an initial period of cellular fiber formation (24 h postseeding), cyclic strain was applied for 48 h, in 8-h intervals, with tensile strain increasing from 0.7% to 1.0%, and at a frequency of 0.5 Hz. Dynamic loading dramatically increased cellular fiber mechanical properties with a nearly twofold increase in both the linear region stiffness and maximum load at failure, thereby demonstrating a mechanism for enhancing cellular fiber formation and mechanical properties. Tissue engineering strategies, designed to capture key aspects of embryonic development, may provide unique insight into accelerated maturation of engineered replacement tissue, and offer significant advances for regenerative medicine applications in tendon, ligament, and other fibrous soft tissues.

Production, properties, and applications of hydrocolloid cellular solids.

PubMed

Nussinovitch, Amos

2005-02-01

Many common synthetic and edible materials are, in fact, cellular solids. When classifying the structure of cellular solids, a few variables, such as open vs. closed cells, flexible vs. brittle cell walls, cell-size distribution, cell-wall thickness, cell shape, the uniformity of the structure of the cellular solid and the different scales of length are taken into account. Compressive stress-strain relationships of most cellular solids can be easily identified according to their characteristic sigmoid shape, reflecting three deformation mechanisms: (i) elastic distortion under small strains, (ii) collapse and/or fracture of the cell walls, and (iii) densification. Various techniques are used to produce hydrocolloid (gum) cellular solids. The products of these include (i) sponges, obtained when the drying gel contains the occasionally produced gas bubbles; (ii) sponges produced by the immobilization of microorganisms; (iii) solid foams produced by drying foamed solutions or gels containing oils, and (iv) hydrocolloid sponges produced by enzymatic reactions. The porosity of the manufactured cellular solid is subject to change and depends on its composition and the processing technique. The porosity is controlled by a range of methods and the resulting surface structures can be investigated by microscopy and analyzed using fractal methods. Models used to describe stress-strain behaviors of hydrocolloid cellular solids as well as multilayered products and composites are discussed in detail in this manuscript. Hydrocolloid cellular solids have numerous purposes, simple and complex, ranging from dried texturized fruits to carriers of vitamins and other essential micronutrients. They can also be used to control the acoustic response of specific dry food products, and have a great potential for future use in countless different fields, from novel foods and packaging to medicine and medical care, daily commodities, farming and agriculture, and the environmental, chemical, and even electronic industries.

Distinction of broken cellular wall Ganoderma lucidum spores and G. lucidum spores using FTIR microspectroscopy.

PubMed

Chen, Xianliang; Liu, Xingcun; Sheng, Daping; Huang, Dake; Li, Weizu; Wang, Xin

2012-11-01

In this paper, FTIR microspectroscopy was used to identify broken cellular wall Ganoderma lucidum spores and G. lucidum spores. For IR spectra, broken cellular wall G. lucidum spores and G. lucidum spores were mainly different in the regions of 3000-2800, 1660-1600, 1400-1200 and 1100-1000 cm(-1). For curve fitting, the results showed the differences in the protein secondary structures and the polysaccharide structures/content between broken cellular wall G. lucidum spores and G. lucidum spores. Moreover, the value of A1078/A1741 might be a potentially useful factor to distinguish broken cellular wall G. lucidum spores from G. lucidum spores. Additionally, FTIR microspectroscopy could identify broken cellular wall G. lucidum spores and G. lucidum spores accurately when it was combined with hierarchical cluster analysis. The result suggests FTIR microspectroscopy is very simple and efficient for distinction of broken cellular wall G. lucidum spores and G. lucidum spores. The result also indicates FTIR microspectroscopy may be useful for TCM identification. Copyright © 2012 Elsevier B.V. All rights reserved.

Using cellular automata to generate image representation for biological sequences.

PubMed

Xiao, X; Shao, S; Ding, Y; Huang, Z; Chen, X; Chou, K-C

2005-02-01

A novel approach to visualize biological sequences is developed based on cellular automata (Wolfram, S. Nature 1984, 311, 419-424), a set of discrete dynamical systems in which space and time are discrete. By transforming the symbolic sequence codes into the digital codes, and using some optimal space-time evolvement rules of cellular automata, a biological sequence can be represented by a unique image, the so-called cellular automata image. Many important features, which are originally hidden in a long and complicated biological sequence, can be clearly revealed thru its cellular automata image. With biological sequences entering into databanks rapidly increasing in the post-genomic era, it is anticipated that the cellular automata image will become a very useful vehicle for investigation into their key features, identification of their function, as well as revelation of their "fingerprint". It is anticipated that by using the concept of the pseudo amino acid composition (Chou, K.C. Proteins: Structure, Function, and Genetics, 2001, 43, 246-255), the cellular automata image approach can also be used to improve the quality of predicting protein attributes, such as structural class and subcellular location.

The extracellular matrix: Structure, composition, age-related differences, tools for analysis and applications for tissue engineering.

PubMed

Kular, Jaspreet K; Basu, Shouvik; Sharma, Ram I

2014-01-01

The extracellular matrix is a structural support network made up of diverse proteins, sugars and other components. It influences a wide number of cellular processes including migration, wound healing and differentiation, all of which is of particular interest to researchers in the field of tissue engineering. Understanding the composition and structure of the extracellular matrix will aid in exploring the ways the extracellular matrix can be utilised in tissue engineering applications especially as a scaffold. This review summarises the current knowledge of the composition, structure and functions of the extracellular matrix and introduces the effect of ageing on extracellular matrix remodelling and its contribution to cellular functions. Additionally, the current analytical technologies to study the extracellular matrix and extracellular matrix-related cellular processes are also reviewed.

Altered Cell Mechanics from the Inside: Dispersed Single Wall Carbon Nanotubes Integrate with and Restructure Actin

PubMed Central

Holt, Brian D.; Shams, Hengameh; Horst, Travis A.; Basu, Saurav; Rape, Andrew D.; Wang, Yu-Li; Rohde, Gustavo K.; Mofrad, Mohammad R. K.; Islam, Mohammad F.; Dahl, Kris Noel

2012-01-01

With a range of desirable mechanical and optical properties, single wall carbon nanotubes (SWCNTs) are a promising material for nanobiotechnologies. SWCNTs also have potential as biomaterials for modulation of cellular structures. Previously, we showed that highly purified, dispersed SWCNTs grossly alter F-actin inside cells. F-actin plays critical roles in the maintenance of cell structure, force transduction, transport and cytokinesis. Thus, quantification of SWCNT-actin interactions ranging from molecular, sub-cellular and cellular levels with both structure and function is critical for developing SWCNT-based biotechnologies. Further, this interaction can be exploited, using SWCNTs as a unique actin-altering material. Here, we utilized molecular dynamics simulations to explore the interactions of SWCNTs with actin filaments. Fluorescence lifetime imaging microscopy confirmed that SWCNTs were located within ~5 nm of F-actin in cells but did not interact with G-actin. SWCNTs did not alter myosin II sub-cellular localization, and SWCNT treatment in cells led to significantly shorter actin filaments. Functionally, cells with internalized SWCNTs had greatly reduced cell traction force. Combined, these results demonstrate direct, specific SWCNT alteration of F-actin structures which can be exploited for SWCNT-based biotechnologies and utilized as a new method to probe fundamental actin-related cellular processes and biophysics. PMID:24955540

Computer Modeling of the Earliest Cellular Structures and Functions

NASA Technical Reports Server (NTRS)

Pohorille, Andrew; Chipot, Christophe; Schweighofer, Karl

2000-01-01

In the absence of extinct or extant record of protocells (the earliest ancestors of contemporary cells). the most direct way to test our understanding of the origin of cellular life is to construct laboratory models of protocells. Such efforts are currently underway in the NASA Astrobiology Program. They are accompanied by computational studies aimed at explaining self-organization of simple molecules into ordered structures and developing designs for molecules that perform proto-cellular functions. Many of these functions, such as import of nutrients, capture and storage of energy. and response to changes in the environment are carried out by proteins bound to membrane< We will discuss a series of large-scale, molecular-level computer simulations which demonstrate (a) how small proteins (peptides) organize themselves into ordered structures at water-membrane interfaces and insert into membranes, (b) how these peptides aggregate to form membrane-spanning structures (eg. channels), and (c) by what mechanisms such aggregates perform essential proto-cellular functions, such as proton transport of protons across cell walls, a key step in cellular bioenergetics. The simulations were performed using the molecular dynamics method, in which Newton's equations of motion for each item in the system are solved iteratively. The problems of interest required simulations on multi-nanosecond time scales, which corresponded to 10(exp 6)-10(exp 8) time steps.

Point process models for localization and interdependence of punctate cellular structures.

PubMed

Li, Ying; Majarian, Timothy D; Naik, Armaghan W; Johnson, Gregory R; Murphy, Robert F

2016-07-01

Accurate representations of cellular organization for multiple eukaryotic cell types are required for creating predictive models of dynamic cellular function. To this end, we have previously developed the CellOrganizer platform, an open source system for generative modeling of cellular components from microscopy images. CellOrganizer models capture the inherent heterogeneity in the spatial distribution, size, and quantity of different components among a cell population. Furthermore, CellOrganizer can generate quantitatively realistic synthetic images that reflect the underlying cell population. A current focus of the project is to model the complex, interdependent nature of organelle localization. We built upon previous work on developing multiple non-parametric models of organelles or structures that show punctate patterns. The previous models described the relationships between the subcellular localization of puncta and the positions of cell and nuclear membranes and microtubules. We extend these models to consider the relationship to the endoplasmic reticulum (ER), and to consider the relationship between the positions of different puncta of the same type. Our results do not suggest that the punctate patterns we examined are dependent on ER position or inter- and intra-class proximity. With these results, we built classifiers to update previous assignments of proteins to one of 11 patterns in three distinct cell lines. Our generative models demonstrate the ability to construct statistically accurate representations of puncta localization from simple cellular markers in distinct cell types, capturing the complex phenomena of cellular structure interaction with little human input. This protocol represents a novel approach to vesicular protein annotation, a field that is often neglected in high-throughput microscopy. These results suggest that spatial point process models provide useful insight with respect to the spatial dependence between cellular structures. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.

Coupled pulsating and cellular structure in the propagation of globally planar detonations in free space

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Wenhu; Key Laboratory for Thermal Science and Power Engineering of Ministry of Education, Department of Thermal Engineering, Tsinghua University, Beijing 100084; Gao, Yang, E-mail: gaoyang-00@mails.tsinghua.edu.cn

The globally planar detonation in free space is numerically simulated, with particular interest to understand and quantify the emergence and evolution of the one-dimensional pulsating instability and the two-dimensional cellular structure which is inherently also affected by pulsating instability. It is found that the pulsation includes three stages: rapid decay of the overdrive, approach to the Chapman-Jouguet state and emergence of weak pulsations, and the formation of strong pulsations; while evolution of the cellular structure also exhibits distinct behavior at these three stages: no cell formation, formation of small-scale, irregular cells, and formation of regular cells of a larger scale.more » Furthermore, the average shock pressure in the detonation front consists of fine-scale oscillations reflecting the collision dynamics of the triple-shock structure and large-scale oscillations affected by the global pulsation. The common stages of evolution between the cellular structure and the pulsating behavior, as well as the existence of shock-front pressure oscillation, suggest highly correlated mechanisms between them. Detonations with period doubling, period quadrupling, and chaotic amplitudes were also observed and studied for progressively increasing activation energies.« less

[Morphochemical changes in the substantia nigra cellular structures in Parkinson's disease].

PubMed

Salkov, V N; Khudoerkov, R M; Voronkov, D N; Sobolev, V B; Kutukova, K A

to clarify the features of morphochemical changes in the substantia nigra cellular structures in Parkinson's disease. The structural characteristics of the substantia nigra were studied microscopically and quantified using computer morphometric methods at brain autopsies of individuals with Parkinson's disease who had died from intercurrent diseases and those who had no evidence of neurological disorders in their history (a control group). This investigation could clarify the features of morphochemical changes in both the neural network structures and the glial populations of the substantia nigra in Parkinson's disease. The number of neurons containing tyrosine hydroxylase (a marker of dopamine neurons) in the compact part of the substantia nigra (a ventral region) was smaller and the density distribution of Lewy bodies was higher in the patients with Parkinson's disease than in the control group. The accumulation of iron (II) compounds in the cellular elements and neuropile and the increased expression of glial fibrillary acidic protein in Parkinson's disease were more pronounced than those in the controls. Postmortem diagnosis in Parkinson's disease should be based on a full description of a set of neuronal and glial morphochemical and structural changes in the substantia nigra rather than on the identification of cellular markers for the neurodegenerative process.

The hierarchical structure and mechanics of plant materials.

PubMed

Gibson, Lorna J

2012-11-07

The cell walls in plants are made up of just four basic building blocks: cellulose (the main structural fibre of the plant kingdom) hemicellulose, lignin and pectin. Although the microstructure of plant cell walls varies in different types of plants, broadly speaking, cellulose fibres reinforce a matrix of hemicellulose and either pectin or lignin. The cellular structure of plants varies too, from the largely honeycomb-like cells of wood to the closed-cell, liquid-filled foam-like parenchyma cells of apples and potatoes and to composites of these two cellular structures, as in arborescent palm stems. The arrangement of the four basic building blocks in plant cell walls and the variations in cellular structure give rise to a remarkably wide range of mechanical properties: Young's modulus varies from 0.3 MPa in parenchyma to 30 GPa in the densest palm, while the compressive strength varies from 0.3 MPa in parenchyma to over 300 MPa in dense palm. The moduli and compressive strength of plant materials span this entire range. This study reviews the composition and microstructure of the cell wall as well as the cellular structure in three plant materials (wood, parenchyma and arborescent palm stems) to explain the wide range in mechanical properties in plants as well as their remarkable mechanical efficiency.

Quantitative Analysis of Cellular Metabolic Dissipative, Self-Organized Structures

PubMed Central

de la Fuente, Ildefonso Martínez

2010-01-01

One of the most important goals of the postgenomic era is understanding the metabolic dynamic processes and the functional structures generated by them. Extensive studies during the last three decades have shown that the dissipative self-organization of the functional enzymatic associations, the catalytic reactions produced during the metabolite channeling, the microcompartmentalization of these metabolic processes and the emergence of dissipative networks are the fundamental elements of the dynamical organization of cell metabolism. Here we present an overview of how mathematical models can be used to address the properties of dissipative metabolic structures at different organizational levels, both for individual enzymatic associations and for enzymatic networks. Recent analyses performed with dissipative metabolic networks have shown that unicellular organisms display a singular global enzymatic structure common to all living cellular organisms, which seems to be an intrinsic property of the functional metabolism as a whole. Mathematical models firmly based on experiments and their corresponding computational approaches are needed to fully grasp the molecular mechanisms of metabolic dynamical processes. They are necessary to enable the quantitative and qualitative analysis of the cellular catalytic reactions and also to help comprehend the conditions under which the structural dynamical phenomena and biological rhythms arise. Understanding the molecular mechanisms responsible for the metabolic dissipative structures is crucial for unraveling the dynamics of cellular life. PMID:20957111

The hierarchical structure and mechanics of plant materials

PubMed Central

Gibson, Lorna J.

2012-01-01

The cell walls in plants are made up of just four basic building blocks: cellulose (the main structural fibre of the plant kingdom) hemicellulose, lignin and pectin. Although the microstructure of plant cell walls varies in different types of plants, broadly speaking, cellulose fibres reinforce a matrix of hemicellulose and either pectin or lignin. The cellular structure of plants varies too, from the largely honeycomb-like cells of wood to the closed-cell, liquid-filled foam-like parenchyma cells of apples and potatoes and to composites of these two cellular structures, as in arborescent palm stems. The arrangement of the four basic building blocks in plant cell walls and the variations in cellular structure give rise to a remarkably wide range of mechanical properties: Young's modulus varies from 0.3 MPa in parenchyma to 30 GPa in the densest palm, while the compressive strength varies from 0.3 MPa in parenchyma to over 300 MPa in dense palm. The moduli and compressive strength of plant materials span this entire range. This study reviews the composition and microstructure of the cell wall as well as the cellular structure in three plant materials (wood, parenchyma and arborescent palm stems) to explain the wide range in mechanical properties in plants as well as their remarkable mechanical efficiency. PMID:22874093

Fabrication of cellular materials

NASA Astrophysics Data System (ADS)

Prud'homme, Robert K.; Aksay, Ilhan A.; Garg, Rajeev

1996-02-01

Nature uses cellular materials in applications requiring strength while, simultaneously, minimizing raw materials requirements. Minimizing raw materials is efficient both in terms of the energy expended by the organism to synthesize the structure and in terms of the strength- to-weight ratio of the structure. Wood is the most obvious example of cellular bio-materials, and it is the focus of other presentations in this symposium. The lightweight bone structure of birds is another excellent example where weight is a key criterion. The anchoring foot of the common muscle [Mytilus edulis] whereby it attaches itself to objects is a further example of a biological system that uses a foam to fill space and yet conserve on raw materials. In the case of the muscle the foam is water filled and the foot structure distributes stress over a larger area so that the strength of the byssal thread from which it is suspended is matched to the strength of interfacial attachment of the foot to a substrate. In these examples the synthesis and fabrication of the cellular material is directed by intercellular, genetically coded, biochemical reactions. The resulting cell sizes are microns in scale. Cellular materials at the next larger scale are created by organisms at the next higher level of integration. For example an African tree frog lays her eggs in a gas/fluid foam sack she builds on a branch overhanging a pond. The outside of the foam sack hardens in the sun and prevents water evaporation. The foam structure minimizes the amount of fluid that needs to be incorporated into the sack and minimizes its weight. However, as far as the developing eggs are concerned, they are in an aqueous medium, i.e. the continuous fluid phase of the foam. After precisely six days the eggs hatch, and the solidified outer wall re-liquefies and dumps the emerging tadpoles into the pond below. The bee honeycomb is an example of a cellular material with exquisite periodicity at millimeter length scales. The cellular structure provides strength through geometric regularity and functions as both honey storage vessels and incubators.

Correlation of Emulsion Structure with Cellular Uptake Behavior of Encapsulated Bioactive Nutrients: Influence of Droplet Size and Interfacial Structure.

PubMed

Lu, Wei; Kelly, Alan L; Maguire, Pierce; Zhang, Hongzhou; Stanton, Catherine; Miao, Song

2016-11-16

In this study, an in vitro Caco-2 cell culture assay was employed to evaluate the correlation between emulsion structure and cellular uptake of encapsulated β-carotene. After 4 h of incubation, an emulsion stabilized with whey protein isolate showed the highest intracellular accumulation of β-carotene (1.06 μg), followed by that stabilized with sodium caseinate (0.60 μg) and Tween 80 (0.20 μg), which are 13-, 7.5-, and 2.5-fold higher than that of free β-carotene (0.08 μg), respectively. Emulsions with small droplet size (239 ± 5 nm) showed a higher cellular uptake of β-carotene (1.56 μg) than emulsiond with large droplet size (489 ± 9 nm) (0.93 μg) (p < 0.01). The results suggested that delivery in an emulsion significantly improved the cellular uptake of β-carotene and thus potentially its bioavailability; uptake was closely correlated with the interfacial composition and droplet size of emulsions. The findings support the potential for achieving optimal controlled and targeted delivery of bioactive nutrients by structuring emulsions.

Manufacturing and Characterization of 18Ni Marage 300 Lattice Components by Selective Laser Melting

PubMed Central

Contuzzi, Nicola; Campanelli, Sabina L.; Casavola, Caterina; Lamberti, Luciano

2013-01-01

The spreading use of cellular structures brings the need to speed up manufacturing processes without deteriorating mechanical properties. By using Selective Laser Melting (SLM) to produce cellular structures, the designer has total freedom in defining part geometry and manufacturing is simplified. The paper investigates the suitability of Selective Laser Melting for manufacturing steel cellular lattice structures with characteristic dimensions in the micrometer range. Alternative lattice topologies including reinforcing bars in the vertical direction also are considered. The selected lattice structure topology is shown to be superior over other lattice structure designs considered in literature. Compression tests are carried out in order to evaluate mechanical strength of lattice strut specimens made via SLM. Compressive behavior of samples also is simulated by finite element analysis and numerical results are compared with experimental data in order to assess the constitutive behavior of the lattice structure designs considered in this study. Experimental data show that it is possible to build samples of relative density in the 0.2456–0.4367 range. Compressive strength changes almost linearly with respect to relative density, which in turns depends linearly on the number of vertical reinforces. Specific strength increases with cell and strut edge size. Numerical simulations confirm the plastic nature of the instability phenomena that leads the cellular structures to collapse under compression loading. PMID:28811445

Micromechanics of Amorphous Metal/Polymer Hybrid Structures with 3D Cellular Architectures: Size Effects, Buckling Behavior, and Energy Absorption Capability.

PubMed

Mieszala, Maxime; Hasegawa, Madoka; Guillonneau, Gaylord; Bauer, Jens; Raghavan, Rejin; Frantz, Cédric; Kraft, Oliver; Mischler, Stefano; Michler, Johann; Philippe, Laetitia

2017-02-01

By designing advantageous cellular geometries and combining the material size effects at the nanometer scale, lightweight hybrid microarchitectured materials with tailored structural properties are achieved. Prior studies reported the mechanical properties of high strength cellular ceramic composites, obtained by atomic layer deposition. However, few studies have examined the properties of similar structures with metal coatings. To determine the mechanical performance of polymer cellular structures reinforced with a metal coating, 3D laser lithography and electroless deposition of an amorphous layer of nickel-boron (NiB) is used for the first time to produce metal/polymer hybrid structures. In this work, the mechanical response of microarchitectured structures is investigated with an emphasis on the effects of the architecture and the amorphous NiB thickness on their deformation mechanisms and energy absorption capability. Microcompression experiments show an enhancement of the mechanical properties with the NiB thickness, suggesting that the deformation mechanism and the buckling behavior are controlled by the brittle-to-ductile transition in the NiB layer. In addition, the energy absorption properties demonstrate the possibility of tuning the energy absorption efficiency with adequate designs. These findings suggest that microarchitectured metal/polymer hybrid structures are effective in producing materials with unique property combinations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantification of the Spatial Organization of the Nuclear Lamina as a Tool for Cell Classification

PubMed Central

Righolt, Christiaan H.; Zatreanu, Diana A.; Raz, Vered

2013-01-01

The nuclear lamina is the structural scaffold of the nuclear envelope that plays multiple regulatory roles in chromatin organization and gene expression as well as a structural role in nuclear stability. The lamina proteins, also referred to as lamins, determine nuclear lamina organization and define the nuclear shape and the structural integrity of the cell nucleus. In addition, lamins are connected with both nuclear and cytoplasmic structures forming a dynamic cellular structure whose shape changes upon external and internal signals. When bound to the nuclear lamina, the lamins are mobile, have an impact on the nuclear envelop structure, and may induce changes in their regulatory functions. Changes in the nuclear lamina shape cause changes in cellular functions. A quantitative description of these structural changes could provide an unbiased description of changes in cellular function. In this review, we describe how changes in the nuclear lamina can be measured from three-dimensional images of lamins at the nuclear envelope, and we discuss how structural changes of the nuclear lamina can be used for cell classification. PMID:27335676

Quantification of the Spatial Organization of the Nuclear Lamina as a Tool for Cell Classification.

PubMed

Righolt, Christiaan H; Zatreanu, Diana A; Raz, Vered

2013-01-01

The nuclear lamina is the structural scaffold of the nuclear envelope that plays multiple regulatory roles in chromatin organization and gene expression as well as a structural role in nuclear stability. The lamina proteins, also referred to as lamins, determine nuclear lamina organization and define the nuclear shape and the structural integrity of the cell nucleus. In addition, lamins are connected with both nuclear and cytoplasmic structures forming a dynamic cellular structure whose shape changes upon external and internal signals. When bound to the nuclear lamina, the lamins are mobile, have an impact on the nuclear envelop structure, and may induce changes in their regulatory functions. Changes in the nuclear lamina shape cause changes in cellular functions. A quantitative description of these structural changes could provide an unbiased description of changes in cellular function. In this review, we describe how changes in the nuclear lamina can be measured from three-dimensional images of lamins at the nuclear envelope, and we discuss how structural changes of the nuclear lamina can be used for cell classification.

Structure and Function of Viral Deubiquitinating Enzymes.

PubMed

Bailey-Elkin, Ben A; Knaap, Robert C M; Kikkert, Marjolein; Mark, Brian L

2017-11-10

Post-translational modification of cellular proteins by ubiquitin regulates numerous cellular processes, including innate and adaptive immune responses. Ubiquitin-mediated control over these processes can be reversed by cellular deubiquitinating enzymes (DUBs), which remove ubiquitin from cellular targets and depolymerize polyubiquitin chains. The importance of protein ubiquitination to host immunity has been underscored by the discovery of viruses that encode proteases with deubiquitinating activity, many of which have been demonstrated to actively corrupt cellular ubiquitin-dependent processes to suppress innate antiviral responses and promote viral replication. DUBs have now been identified in diverse viral lineages, and their characterization is providing valuable insights into virus biology and the role of the ubiquitin system in host antiviral mechanisms. Here, we provide an overview of the structural biology of these fascinating viral enzymes and their role innate immune evasion and viral replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Resource constrained flux balance analysis predicts selective pressure on the global structure of metabolic networks.

PubMed

Abedpour, Nima; Kollmann, Markus

2015-11-23

A universal feature of metabolic networks is their hourglass or bow-tie structure on cellular level. This architecture reflects the conversion of multiple input nutrients into multiple biomass components via a small set of precursor metabolites. However, it is yet unclear to what extent this structural feature is the result of natural selection. We extend flux balance analysis to account for limited cellular resources. Using this model, optimal structure of metabolic networks can be calculated for different environmental conditions. We observe a significant structural reshaping of metabolic networks for a toy-network and E. coli core metabolism if we increase the share of invested resources for switching between different nutrient conditions. Here, hub nodes emerge and the optimal network structure becomes bow-tie-like as a consequence of limited cellular resource constraint. We confirm this theoretical finding by comparing the reconstructed metabolic networks of bacterial species with respect to their lifestyle. We show that bow-tie structure can give a system-level fitness advantage to organisms that live in highly competitive and fluctuating environments. Here, limitation of cellular resources can lead to an efficiency-flexibility tradeoff where it pays off for the organism to shorten catabolic pathways if they are frequently activated and deactivated. As a consequence, generalists that shuttle between diverse environmental conditions should have a more predominant bow-tie structure than specialists that visit just a few isomorphic habitats during their life cycle.

In silico methods for co-transcriptional RNA secondary structure prediction and for investigating alternative RNA structure expression.

PubMed

Meyer, Irmtraud M

2017-05-01

RNA transcripts are the primary products of active genes in any living organism, including many viruses. Their cellular destiny not only depends on primary sequence signals, but can also be determined by RNA structure. Recent experimental evidence shows that many transcripts can be assigned more than a single functional RNA structure throughout their cellular life and that structure formation happens co-transcriptionally, i.e. as the transcript is synthesised in the cell. Moreover, functional RNA structures are not limited to non-coding transcripts, but can also feature in coding transcripts. The picture that now emerges is that RNA structures constitute an additional layer of information that can be encoded in any RNA transcript (and on top of other layers of information such as protein-context) in order to exert a wide range of functional roles. Moreover, different encoded RNA structures can be expressed at different stages of a transcript's life in order to alter the transcript's behaviour depending on its actual cellular context. Similar to the concept of alternative splicing for protein-coding genes, where a single transcript can yield different proteins depending on cellular context, it is thus appropriate to propose the notion of alternative RNA structure expression for any given transcript. This review introduces several computational strategies that my group developed to detect different aspects of RNA structure expression in vivo. Two aspects are of particular interest to us: (1) RNA secondary structure features that emerge during co-transcriptional folding and (2) functional RNA structure features that are expressed at different times of a transcript's life and potentially mutually exclusive. Copyright © 2017. Published by Elsevier Inc.

Minimal entropy approximation for cellular automata

NASA Astrophysics Data System (ADS)

Fukś, Henryk

2014-02-01

We present a method for the construction of approximate orbits of measures under the action of cellular automata which is complementary to the local structure theory. The local structure theory is based on the idea of Bayesian extension, that is, construction of a probability measure consistent with given block probabilities and maximizing entropy. If instead of maximizing entropy one minimizes it, one can develop another method for the construction of approximate orbits, at the heart of which is the iteration of finite-dimensional maps, called minimal entropy maps. We present numerical evidence that the minimal entropy approximation sometimes outperforms the local structure theory in characterizing the properties of cellular automata. The density response curve for elementary CA rule 26 is used to illustrate this claim.

Use of Lightweight Cellular Mats to Reduce the Settlement of Structure on Soft Soil

NASA Astrophysics Data System (ADS)

Ganasan, R.; Lim, A. J. M. S.; Wijeyesekera, D. C.

2016-07-01

Construction of structures on soft soils gives rise to some difficulties in Malaysia and other country especially in settlement both in short and long term. The focus of this research is to minimize the differential and non-uniform settlement on peat soil with the use of an innovative cellular mat. The behaviour and performance of the lightweight geo-material (in block form) is critically investigated and in particular the use as a fill in embankment on soft ground. Hemic peat soil, sponge and innovative cellular mat will be used as the main material in this study. The monitoring in settlement behavior from this part of research will be done as laboratory testing only. The uneven settlement in this problem was uniquely monitored photographically using spot markers. In the end of the research, it is seen that the innovative cellular mat has reduce the excessive and differential settlement up to 50% compare to flexible and rigid foundations. This had improve the stiffness of soils as well as the porous contain in cellular structure which help in allowing water/moisture to flow through in or out thus resulting in prevent the condition of floating.

IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)

PubMed Central

Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

2016-01-01

Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

Cellular Structure Fabricated on Ni Wire by a Simple and Cost-Effective Direct-Flame Approach and Its Application in Fiber-Shaped Supercapacitors.

PubMed

Wang, Zhihong; Cao, Fenhui; Chen, Kongfa; Yan, Yingming; Chen, Yifu; Zhang, Yaohui; Zhu, Xingbao; Wei, Bo; Xiong, Yueping; Lv, Zhe

2018-03-09

Cellular metals with the large surface/volume ratios and excellent electrical conductivity are widely applicable and have thus been studied extensively. It is highly desirable to develop a facile and cost-effective process for fabrication of porous metallic structures, and yet more so for micro/nanoporous structures. A direct-flame strategy is developed for in situ fabrication of micron-scale cellular architecture on a Ni metal precursor. The flame provides the required heat and also serves as a fuel reformer, which provides a gas mixture of H 2 , CO, and O 2 for redox treatment of metallic Ni. The redox processes at elevated temperatures allow fast reconstruction of the metal, leading to a cellular structure on Ni wire. This process is simple and clean and avoids the use of sacrificial materials or templates. Furthermore, nanocrystalline MnO 2 is coated on the microporous Ni wire (MPNW) to form a supercapacitor electrode. The MnO 2 /MPNW electrode and the corresponding fiber-shaped supercapacitor exhibit high specific capacitance and excellent cycling stability. Moreover, this work provides a novel strategy for the fabrication of cellular metals and alloys for a variety of applications, including catalysis, energy storage and conversion, and chemical sensing. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biomechanical and ultrastructural comparison of cryopreservation and a novel cellular extraction of porcine aortic valve leaflets.

PubMed

Courtman, D W; Pereira, C A; Omar, S; Langdon, S E; Lee, J M; Wilson, G J

1995-12-01

Heart valve substitutes of biological origin often fail by degenerative mechanisms. Many authors have hypothesized that mechanical fatigue and structural degradation are instrumental to in vivo failure. Since the properties of the structural matrix at implantation may predetermine failure, we have examined the ultrastructure, fracture, mechanics, and uniaxial high-strain-rate viscoelastic properties of: (1) fresh, (2) cryopreserved, and (3) cellular extracted porcine aortic valve leaflets. The cellular extraction process is being developed in order to reduce immunological attack and calcification. Cryopreservation causes cellular disruption and necrotic changes throughout the tissue, whereas extraction removes all cells and lipid membranes. Both processes leave an intact collagen and elastin structural matrix and preserve the high-strain-rate viscoelastic characteristics of the fresh leaflets. Extraction does cause a 20% reduction in the fracture tension and increases tissue extensibility, with the percent strain at fracture rising to 45.3 +/- 4 (mean +/- SEM) from 31.5 +/- 3 for fresh leaflets. However, extraction does preserve matrix structure and mechanics over the physiological loading range. Glutaraldehyde fixation produces increased extensibility, increased elastic behavior, and, when applied to extracted leaflets, it causes a marked drop in fracture tension, to 50% of that for fresh leaflets. The combination of extraction and fixation may lead to early degenerative failure. The cellular extraction technique alone may be a useful alternative to glutaraldehyde fixation in preparing bioprosthetic heart valves.

Manifestation of the shape-memory effect in polyetherurethane cellular plastics, fabric composites, and sandwich structures under microgravity

NASA Astrophysics Data System (ADS)

Babaevskii, P. G.; Kozlov, N. A.; Agapov, I. G.; Reznichenko, G. M.; Churilo, N. V.; Churilo, I. V.

2016-09-01

The results of experiments that were performed to test the feasibility of creating sandwich structures (consisting of thin-layer sheaths of polymer composites and a cellular polymer core) with the shapememory effect as models of the transformable components of space structures have been given. The data obtained indicate that samples of sandwich structures under microgravity conditions on board the International Space Station have recovered their shape to almost the same degree as under terrestrial conditions, which makes it possible to recommend them for creating components of transformable space structures on their basis.

[Reparative and neoplastic spheroid cellular structures and their mathematical model].

PubMed

Kogan, E A; Namiot, V A; Demura, T A; Faĭzullina, N M; Sukhikh, G T

2014-01-01

Spheroid cell structures in the cell cultures have been described and are used for studying cell-cell and cell- matrix interactions. At the same time, spheroid cell structure participation in the repair and development of cancer in vivo remains unexplored. The aim of this study was to investigate the cellular composition of spherical structures and their functional significance in the repair of squamous epithelium in human papilloma virus-associated cervical pathology--chronic cervicitis and cervical intraepithelial neoplasia 1-3 degree, and also construct a mathematical model to explain the development and behavior of such spheroid cell structure.

System-wide organization of actin cytoskeleton determines organelle transport in hypocotyl plant cells

PubMed Central

Nowak, Jacqueline; Ivakov, Alexander; Somssich, Marc; Persson, Staffan; Nikoloski, Zoran

2017-01-01

The actin cytoskeleton is an essential intracellular filamentous structure that underpins cellular transport and cytoplasmic streaming in plant cells. However, the system-level properties of actin-based cellular trafficking remain tenuous, largely due to the inability to quantify key features of the actin cytoskeleton. Here, we developed an automated image-based, network-driven framework to accurately segment and quantify actin cytoskeletal structures and Golgi transport. We show that the actin cytoskeleton in both growing and elongated hypocotyl cells has structural properties facilitating efficient transport. Our findings suggest that the erratic movement of Golgi is a stable cellular phenomenon that might optimize distribution efficiency of cell material. Moreover, we demonstrate that Golgi transport in hypocotyl cells can be accurately predicted from the actin network topology alone. Thus, our framework provides quantitative evidence for system-wide coordination of cellular transport in plant cells and can be readily applied to investigate cytoskeletal organization and transport in other organisms. PMID:28655850

Design, Fabrication and Testing of a Crushable Energy Absorber for a Passive Earth Entry Vehicle

NASA Technical Reports Server (NTRS)

Kellas, Sotiris; Corliss, James M. (Technical Monitor)

2002-01-01

A conceptual study was performed to investigate the impact response of a crushable energy absorber for a passive Earth entry vehicle. The spherical energy-absorbing concept consisted of a foam-filled composite cellular structure capable of omni-directional impact-load attenuation as well as penetration resistance. Five composite cellular samples of hemispherical geometry were fabricated and tested dynamically with impact speeds varying from 30 to 42 meters per second. Theoretical crush load predictions were obtained with the aid of a generalized theory which accounts for the energy dissipated during the folding deformation of the cell-walls. Excellent correlation was obtained between theoretical predictions and experimental tests on characteristic cell-web intersections. Good correlation of theory with experiment was also found to exist for the more complex spherical cellular structures. All preliminary design requirements were met by the cellular structure concept, which exhibited a near-ideal sustained crush-load and approximately 90% crush stroke.

Modeling of time dependent localized flow shear stress and its impact on cellular growth within additive manufactured titanium implants

PubMed Central

Zhang, Ziyu; Yuan, Lang; Lee, Peter D; Jones, Eric; Jones, Julian R

2014-01-01

Bone augmentation implants are porous to allow cellular growth, bone formation and fixation. However, the design of the pores is currently based on simple empirical rules, such as minimum pore and interconnects sizes. We present a three-dimensional (3D) transient model of cellular growth based on the Navier–Stokes equations that simulates the body fluid flow and stimulation of bone precursor cellular growth, attachment, and proliferation as a function of local flow shear stress. The model's effectiveness is demonstrated for two additive manufactured (AM) titanium scaffold architectures. The results demonstrate that there is a complex interaction of flow rate and strut architecture, resulting in partially randomized structures having a preferential impact on stimulating cell migration in 3D porous structures for higher flow rates. This novel result demonstrates the potential new insights that can be gained via the modeling tool developed, and how the model can be used to perform what-if simulations to design AM structures to specific functional requirements. PMID:24664988

Simulation Based Optimization of Complex Monolithic Composite Structures Using Cellular Core Technology

NASA Astrophysics Data System (ADS)

Hickmott, Curtis W.

Cellular core tooling is a new technology which has the capability to manufacture complex integrated monolithic composite structures. This novel tooling method utilizes thermoplastic cellular cores as inner tooling. The semi-rigid nature of the cellular cores makes them convenient for lay-up, and under autoclave temperature and pressure they soften and expand providing uniform compaction on all surfaces including internal features such as ribs and spar tubes. This process has the capability of developing fully optimized aerospace structures by reducing or eliminating assembly using fasteners or bonded joints. The technology is studied in the context of evaluating its capabilities, advantages, and limitations in developing high quality structures. The complex nature of these parts has led to development of a model using the Finite Element Analysis (FEA) software Abaqus and the plug-in COMPRO Common Component Architecture (CCA) provided by Convergent Manufacturing Technologies. This model utilizes a "virtual autoclave" technique to simulate temperature profiles, resin flow paths, and ultimately deformation from residual stress. A model has been developed simulating the temperature profile during curing of composite parts made with the cellular core technology. While modeling of composites has been performed in the past, this project will look to take this existing knowledge and apply it to this new manufacturing method capable of building more complex parts and develop a model designed specifically for building large, complex components with a high degree of accuracy. The model development has been carried out in conjunction with experimental validation. A double box beam structure was chosen for analysis to determine the effects of the technology on internal ribs and joints. Double box beams were manufactured and sectioned into T-joints for characterization. Mechanical behavior of T-joints was performed using the T-joint pull-off test and compared to traditional tooling methods. Components made with the cellular core tooling method showed an improved strength at the joints. It is expected that this knowledge will help optimize the processing of complex, integrated structures and benefit applications in aerospace where lighter, structurally efficient components would be advantageous.

Cellular Automata

NASA Astrophysics Data System (ADS)

Gutowitz, Howard

1991-08-01

Cellular automata, dynamic systems in which space and time are discrete, are yielding interesting applications in both the physical and natural sciences. The thirty four contributions in this book cover many aspects of contemporary studies on cellular automata and include reviews, research reports, and guides to recent literature and available software. Chapters cover mathematical analysis, the structure of the space of cellular automata, learning rules with specified properties: cellular automata in biology, physics, chemistry, and computation theory; and generalizations of cellular automata in neural nets, Boolean nets, and coupled map lattices. Current work on cellular automata may be viewed as revolving around two central and closely related problems: the forward problem and the inverse problem. The forward problem concerns the description of properties of given cellular automata. Properties considered include reversibility, invariants, criticality, fractal dimension, and computational power. The role of cellular automata in computation theory is seen as a particularly exciting venue for exploring parallel computers as theoretical and practical tools in mathematical physics. The inverse problem, an area of study gaining prominence particularly in the natural sciences, involves designing rules that possess specified properties or perform specified task. A long-term goal is to develop a set of techniques that can find a rule or set of rules that can reproduce quantitative observations of a physical system. Studies of the inverse problem take up the organization and structure of the set of automata, in particular the parameterization of the space of cellular automata. Optimization and learning techniques, like the genetic algorithm and adaptive stochastic cellular automata are applied to find cellular automaton rules that model such physical phenomena as crystal growth or perform such adaptive-learning tasks as balancing an inverted pole. Howard Gutowitz is Collaborateur in the Service de Physique du Solide et Résonance Magnetique, Commissariat a I'Energie Atomique, Saclay, France.

Giant viruses coexisted with the cellular ancestors and represent a distinct supergroup along with superkingdoms Archaea, Bacteria and Eukarya

PubMed Central

2012-01-01

Background The discovery of giant viruses with genome and physical size comparable to cellular organisms, remnants of protein translation machinery and virus-specific parasites (virophages) have raised intriguing questions about their origin. Evidence advocates for their inclusion into global phylogenomic studies and their consideration as a distinct and ancient form of life. Results Here we reconstruct phylogenies describing the evolution of proteomes and protein domain structures of cellular organisms and double-stranded DNA viruses with medium-to-very-large proteomes (giant viruses). Trees of proteomes define viruses as a ‘fourth supergroup’ along with superkingdoms Archaea, Bacteria, and Eukarya. Trees of domains indicate they have evolved via massive and primordial reductive evolutionary processes. The distribution of domain structures suggests giant viruses harbor a significant number of protein domains including those with no cellular representation. The genomic and structural diversity embedded in the viral proteomes is comparable to the cellular proteomes of organisms with parasitic lifestyles. Since viral domains are widespread among cellular species, we propose that viruses mediate gene transfer between cells and crucially enhance biodiversity. Conclusions Results call for a change in the way viruses are perceived. They likely represent a distinct form of life that either predated or coexisted with the last universal common ancestor (LUCA) and constitute a very crucial part of our planet’s biosphere. PMID:22920653

Building bridges between cellular and molecular structural biology.

PubMed

Patwardhan, Ardan; Brandt, Robert; Butcher, Sarah J; Collinson, Lucy; Gault, David; Grünewald, Kay; Hecksel, Corey; Huiskonen, Juha T; Iudin, Andrii; Jones, Martin L; Korir, Paul K; Koster, Abraham J; Lagerstedt, Ingvar; Lawson, Catherine L; Mastronarde, David; McCormick, Matthew; Parkinson, Helen; Rosenthal, Peter B; Saalfeld, Stephan; Saibil, Helen R; Sarntivijai, Sirarat; Solanes Valero, Irene; Subramaniam, Sriram; Swedlow, Jason R; Tudose, Ilinca; Winn, Martyn; Kleywegt, Gerard J

2017-07-06

The integration of cellular and molecular structural data is key to understanding the function of macromolecular assemblies and complexes in their in vivo context. Here we report on the outcomes of a workshop that discussed how to integrate structural data from a range of public archives. The workshop identified two main priorities: the development of tools and file formats to support segmentation (that is, the decomposition of a three-dimensional volume into regions that can be associated with defined objects), and the development of tools to support the annotation of biological structures.

A simple and fast method for fixation of cultured cell lines that preserves cellular structures containing gamma-tubulin.

PubMed

Alvarado-Kristensson, Maria

2018-01-01

When using fluorescence microscope techniques to study cells, it is essential that the cell structure and contents are preserved after preparation of the samples, and that the preparation method employed does not create artefacts that can be perceived as cellular structure/components. γ-Tubulin forms filaments that in some cases are immunostained with an anti-γ-tubulin antibody, but this immunostaining is not reproducible [[1], [2

A tandem regression-outlier analysis of a ligand cellular system for key structural modifications around ligand binding.

PubMed

Lin, Ying-Ting

2013-04-30

A tandem technique of hard equipment is often used for the chemical analysis of a single cell to first isolate and then detect the wanted identities. The first part is the separation of wanted chemicals from the bulk of a cell; the second part is the actual detection of the important identities. To identify the key structural modifications around ligand binding, the present study aims to develop a counterpart of tandem technique for cheminformatics. A statistical regression and its outliers act as a computational technique for separation. A PPARγ (peroxisome proliferator-activated receptor gamma) agonist cellular system was subjected to such an investigation. Results show that this tandem regression-outlier analysis, or the prioritization of the context equations tagged with features of the outliers, is an effective regression technique of cheminformatics to detect key structural modifications, as well as their tendency of impact to ligand binding. The key structural modifications around ligand binding are effectively extracted or characterized out of cellular reactions. This is because molecular binding is the paramount factor in such ligand cellular system and key structural modifications around ligand binding are expected to create outliers. Therefore, such outliers can be captured by this tandem regression-outlier analysis.

Primary Cilia and Dendritic Spines: Different but Similar Signaling Compartments

PubMed Central

Nechipurenko, Inna V.; Doroquez, David B.; Sengupta, Piali

2013-01-01

Primary non-motile cilia and dendritic spines are cellular compartments that are specialized to sense and transduce environmental cues and presynaptic signals, respectively. Despite their unique cellular roles, both compartments exhibit remarkable parallels in the general principles, as well as molecular mechanisms, by which their protein composition, membrane domain architecture, cellular interactions, and structural and functional plasticity are regulated. We compare and contrast the pathways required for the generation and function of cilia and dendritic spines, and suggest that insights from the study of one may inform investigations into the other of these critically important signaling structures. PMID:24048681

Instability-driven electromagnetic fields in coronal plasmas

DOE PAGES

Manuel, M. J.-E.; Li, C. K.; Seguin, F. H.; ...

2013-04-15

Filamentary electromagnetic fields previously observed in the coronae of laser-driven spherical targets [F. H. S eguin et al., Phys. Plasma. 19, 012701 (2012)] have been further investigated in laser irradiated plastic foils. Face-on proton-radiography provides an axial view of these filaments and shows coherent cellular structure regardless of initial foil-surface conditions. The observed cellular fields are shown to have an approximately constant scale size of 210 lm throughout the plasma evolution. A discussion of possible field-generation mechanisms is provided and it is demonstrated that the likely source of the cellular field structure is the magnetothermal instability. Using predicted temperature andmore » density profiles, the fastest growing modes of this instability were found to be slowly varying in time and consistent with the observed cellular size.« less

Origins of cellular geometry

PubMed Central

2011-01-01

Cells are highly complex and orderly machines, with defined shapes and a startling variety of internal organizations. Complex geometry is a feature of both free-living unicellular organisms and cells inside multicellular animals. Where does the geometry of a cell come from? Many of the same questions that arise in developmental biology can also be asked of cells, but in most cases we do not know the answers. How much of cellular organization is dictated by global cell polarity cues as opposed to local interactions between cellular components? Does cellular structure persist across cell generations? What is the relationship between cell geometry and tissue organization? What ensures that intracellular structures are scaled to the overall size of the cell? Cell biology is only now beginning to come to grips with these questions. PMID:21880160

Intracellular Localization and Cellular Factors Interaction of HTLV-1 and HTLV-2 Tax Proteins: Similarities and Functional Differences

PubMed Central

Bertazzoni, Umberto; Turci, Marco; Avesani, Francesca; Di Gennaro, Gianfranco; Bidoia, Carlo; Romanelli, Maria Grazia

2011-01-01

Human T-lymphotropic viruses type 1 (HTLV-1) and type 2 (HTLV-2) present very similar genomic structures but HTLV-1 is more pathogenic than HTLV-2. Is this difference due to their transactivating Tax proteins, Tax-1 and Tax-2, which are responsible for viral and cellular gene activation? Do Tax-1 and Tax-2 differ in their cellular localization and in their interaction pattern with cellular factors? In this review, we summarize Tax-1 and Tax-2 structural and phenotypic properties, their interaction with factors involved in signal transduction and their localization-related behavior within the cell. Special attention will be given to the distinctions between Tax-1 and Tax-2 that likely play an important role in their transactivation activity. PMID:21994745

3D cellular structures and co-cultures formed through the contactless magnetic manipulation of cells on adherent surfaces.

PubMed

Abdel Fattah, Abdel Rahman; Mishriki, Sarah; Kammann, Tobias; Sahu, Rakesh P; Geng, Fei; Puri, Ishwar K

2018-02-27

A magnet array is employed to manipulate diamagnetic cells that are contained in paramagnetic medium to demonstrate for the first time the contactless bioprinting of three-dimensional (3D) cellular structures and co-cultures of breast cancer MCF-7 and endothelial HUVEC at prescribed locations on tissue culture treated well plates. Sequential seeding of different cell lines and the spatial displacement of the magnet array creates co-cultured cellular structures within a well without using physically intrusive well inserts. Both monotypic and co-culture experiments produce morphologically rich 3D cell structures that are otherwise absent in regular monolayer cell cultures. The magnetic contactless bioprinting of cells provides further insight into cell behaviour, invasion strategies and transformations that are useful for potential applications in drug screening, 3D cell culture formation and tissue engineering.

Development of nano-fabrication technique utilizing self-organizational behavior of point defects induced by ion irradiation

NASA Astrophysics Data System (ADS)

Nitta, Noriko; Taniwaki, Masafumi

2006-04-01

The present authors proposed a novel nano-fabrication technique that is able to arrange the fine cells orderly, based on their finding in GaSb implanted at a low temperature. In this article, first the experimental results that anomalous cellular structure was formed in GaSb by ion implantation is introduced and the self-organizational formation mechanism of the structure is described. Next a nano-fabrication technique that utilizes focused ion beam is described. This technique consists of two procedures, i.e. the formation process of the voids array and the development of the initial array to ordered cellular structure. Finally, the nano-fabrication is actually performed by this technique and their results are reported. Fabrication succeeded in structures where the dot (cell) interval was 100 nm or larger. The minimum ion dose for initial voids which develops to the ordered cellular structure is evaluated. It is also shown that the substrate temperature during implantation is an essential parameter for this technique.

Design and testing of botanical thermotropic actuator mechanisms in thermally adaptive building coverings

NASA Astrophysics Data System (ADS)

Barrett, Ronald M.; Barrett, Ronald P.; Barrett, Cassandra M.

2017-09-01

This paper lays out the inspiration, operational principles, analytical modeling and coupon testing of a new class of thermally adaptive building coverings. The fundamental driving concepts for these coverings are derived from various families of thermotropic plant structures. Certain plant cellular structures like those in Mimosa pudica (Sensitive Plant), Rhododendron leaves or Albizia julibrissin (Mimosa Tree), exhibit actuation physiology which depends on changes in cellular turgor pressures to generate motion. This form of cellular action via turgor pressure manipulation is an inspiration for a new field of thermally adaptive building coverings which use various forms of cellular foam to aid or enable actuation much like plant cells are used to move leaves. When exposed to high solar loading, the structures use the inherent actuation capability of pockets of air trapped in closed cell foam as actuators to curve plates upwards and outwards. When cold, these same structures curve back towards the building forming large convex pockets of dead air to insulate the building. This paper describes basic classical laminated plate theory models comparing theory and experiment of such coupons containing closed-cell foam actuators. The study concludes with a global description of the effectiveness of this class of thermally adaptive building coverings.

In search of mitochondrial mechanisms: interfield excursions between cell biology and biochemistry.

PubMed

Bechtel, William; Abrahamsen, Adele

2007-01-01

Developing models of biological mechanisms, such as those involved in respiration in cells, often requires collaborative effort drawing upon techniques developed and information generated in different disciplines. Biochemists in the early decades of the 20th century uncovered all but the most elusive chemical operations involved in cellular respiration, but were unable to align the reaction pathways with particular structures in the cell. During the period 1940-1965 cell biology was emerging as a new discipline and made distinctive contributions to understanding the role of the mitochondrion and its component parts in cellular respiration. In particular, by developing techniques for localizing enzymes or enzyme systems in specific cellular components, cell biologists provided crucial information about the organized structures in which the biochemical reactions occurred. Although the idea that biochemical operations are intimately related to and depend on cell structures was at odds with the then-dominant emphasis on systems of soluble enzymes in biochemistry, a reconceptualization of energetic processes in the 1960s and 1970s made it clear why cell structure was critical to the biochemical account. This paper examines how numerous excursions between biochemistry and cell biology contributed a new understanding of the mechanism of cellular respiration.

Freeform inkjet printing of cellular structures with bifurcations.

PubMed

Christensen, Kyle; Xu, Changxue; Chai, Wenxuan; Zhang, Zhengyi; Fu, Jianzhong; Huang, Yong

2015-05-01

Organ printing offers a great potential for the freeform layer-by-layer fabrication of three-dimensional (3D) living organs using cellular spheroids or bioinks as building blocks. Vascularization is often identified as a main technological barrier for building 3D organs. As such, the fabrication of 3D biological vascular trees is of great importance for the overall feasibility of the envisioned organ printing approach. In this study, vascular-like cellular structures are fabricated using a liquid support-based inkjet printing approach, which utilizes a calcium chloride solution as both a cross-linking agent and support material. This solution enables the freeform printing of spanning and overhang features by providing a buoyant force. A heuristic approach is implemented to compensate for the axially-varying deformation of horizontal tubular structures to achieve a uniform diameter along their axial directions. Vascular-like structures with both horizontal and vertical bifurcations have been successfully printed from sodium alginate only as well as mouse fibroblast-based alginate bioinks. The post-printing fibroblast cell viability of printed cellular tubes was found to be above 90% even after a 24 h incubation, considering the control effect. © 2014 Wiley Periodicals, Inc.

Rapid construction of mechanically- confined multi- cellular structures using dendrimeric intercellular linker.

PubMed

Mo, Xuejun; Li, Qiushi; Yi Lui, Lena Wai; Zheng, Baixue; Kang, Chiang Huen; Nugraha, Bramasta; Yue, Zhilian; Jia, Rui Rui; Fu, Hong Xia; Choudhury, Deepak; Arooz, Talha; Yan, Jie; Lim, Chwee Teck; Shen, Shali; Hong Tan, Choon; Yu, Hanry

2010-10-01

Tissue constructs that mimic the in vivo cell-cell and cell-matrix interactions are especially useful for applications involving the cell- dense and matrix- poor internal organs. Rapid and precise arrangement of cells into functional tissue constructs remains a challenge in tissue engineering. We demonstrate rapid assembly of C3A cells into multi- cell structures using a dendrimeric intercellular linker. The linker is composed of oleyl- polyethylene glycol (PEG) derivatives conjugated to a 16 arms- polypropylenimine hexadecaamine (DAB) dendrimer. The positively charged multivalent dendrimer concentrates the linker onto the negatively charged cell surface to facilitate efficient insertion of the hydrophobic oleyl groups into the cellular membrane. Bringing linker- treated cells into close proximity to each other via mechanical means such as centrifugation and micromanipulation enables their rapid assembly into multi- cellular structures within minutes. The cells exhibit high levels of viability, proliferation, three- dimensional (3D) cell morphology and other functions in the constructs. We constructed defined multi- cellular structures such as rings, sheets or branching rods that can serve as potential tissue building blocks to be further assembled into complex 3D tissue constructs for biomedical applications. 2010 Elsevier Ltd. All rights reserved.

The cellular mastermind(?) – Mechanotransduction and the nucleus

PubMed Central

Kaminski, Ashley; Fedorchak, Gregory R.; Lammerding, Jan

2015-01-01

Cells respond to mechanical stimulation by activation of specific signaling pathways and genes that allow the cell to adapt to its dynamic physical environment. How cells sense the various mechanical inputs and translate them into biochemical signals remains an area of active investigation. Recent reports suggest that the cell nucleus may be directly implicated in this cellular mechanotransduction process. In this chapter, we discuss how forces applied to the cell surface and cytoplasm induce changes in nuclear structure and organization, which could directly affect gene expression, while also highlighting the complex interplay between nuclear structural proteins and transcriptional regulators that may further modulate mechanotransduction signaling. Taken together, these findings paint a picture of the nucleus as a central hub in cellular mechanotransduction—both structurally and biochemically—with important implications in physiology and disease. PMID:25081618

Femtosecond laser nanosurgery of sub-cellular structures in HeLa cells by employing Third Harmonic Generation imaging modality as diagnostic tool.

PubMed

Tserevelakis, George J; Psycharakis, Stylianos; Resan, Bojan; Brunner, Felix; Gavgiotaki, Evagelia; Weingarten, Kurt; Filippidis, George

2012-02-01

Femtosecond laser assisted nanosurgery of microscopic biological specimens is a relatively new technique which allows the selective disruption of sub-cellular structures without causing any undesirable damage to the surrounding regions. The targeted structures have to be stained in order to be clearly visualized for the nanosurgery procedure. However, the validation of the final nanosurgery result is difficult, since the targeted structure could be simply photobleached rather than selectively destroyed. This fact comprises a main drawback of this technique. In our study we employed a multimodal system which integrates non-linear imaging modalities with nanosurgery capabilities, for the selective disruption of sub-cellular structures in HeLa cancer cells. Third Harmonic Generation (THG) imaging modality was used as a tool for the identification of structures that were subjected to nanosurgery experiments. No staining of the biological samples was required, since THG is an intrinsic property of matter. Furthermore, cells' viability after nanosurgery processing was verified via Two Photon Excitation Fluorescence (TPEF) measurements. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Total cellular glycomics allows characterizing cells and streamlining the discovery process for cellular biomarkers.

PubMed

Fujitani, Naoki; Furukawa, Jun-ichi; Araki, Kayo; Fujioka, Tsuyoshi; Takegawa, Yasuhiro; Piao, Jinhua; Nishioka, Taiki; Tamura, Tomohiro; Nikaido, Toshio; Ito, Makoto; Nakamura, Yukio; Shinohara, Yasuro

2013-02-05

Although many of the frequently used pluripotency biomarkers are glycoconjugates, a glycoconjugate-based exploration of novel cellular biomarkers has proven difficult due to technical difficulties. This study reports a unique approach for the systematic overview of all major classes of oligosaccharides in the cellular glycome. The proposed method enabled mass spectrometry-based structurally intensive analyses, both qualitatively and quantitatively, of cellular N- and O-linked glycans derived from glycoproteins, glycosaminoglycans, and glycosphingolipids, as well as free oligosaccharides of human embryonic stem cells (hESCs), induced pluripotent stem cells (hiPSCs), and various human cells derived from normal and carcinoma cells. Cellular total glycomes were found to be highly cell specific, demonstrating their utility as unique cellular descriptors. Structures of glycans of all classes specifically observed in hESCs and hiPSCs tended to be immature in general, suggesting the presence of stem cell-specific glycosylation spectra. The current analysis revealed the high similarity of the total cellular glycome between hESCs and hiPSCs, although it was suggested that hESCs are more homogeneous than hiPSCs from a glycomic standpoint. Notably, this study enabled a priori identification of known pluripotency biomarkers such as SSEA-3, -4, and -5 and Tra-1-60/81, as well as a panel of glycans specifically expressed by hESCs and hiPSCs.

SPED light sheet microscopy: fast mapping of biological system structure and function

PubMed Central

Tomer, Raju; Lovett-Barron, Matthew; Kauvar, Isaac; Andalman, Aaron; Burns, Vanessa M.; Sankaran, Sethuraman; Grosenick, Logan; Broxton, Michael; Yang, Samuel; Deisseroth, Karl

2016-01-01

The goal of understanding living nervous systems has driven interest in high-speed and large field-of-view volumetric imaging at cellular resolution. Light-sheet microscopy approaches have emerged for cellular-resolution functional brain imaging in small organisms such as larval zebrafish, but remain fundamentally limited in speed. Here we have developed SPED light sheet microscopy, which combines large volumetric field-of-view via an extended depth of field with the optical sectioning of light sheet microscopy, thereby eliminating the need to physically scan detection objectives for volumetric imaging. SPED enables scanning of thousands of volumes-per-second, limited only by camera acquisition rate, through the harnessing of optical mechanisms that normally result in unwanted spherical aberrations. We demonstrate capabilities of SPED microscopy by performing fast sub-cellular resolution imaging of CLARITY mouse brains and cellular-resolution volumetric Ca2+ imaging of entire zebrafish nervous systems. Together, SPED light sheet methods enable high-speed cellular-resolution volumetric mapping of biological system structure and function. PMID:26687363

Analysis of Students' Aptitude to Provide Meaning to Images that Represent Cellular Components at the Molecular Level

ERIC Educational Resources Information Center

Dahmani, Hassen-Reda; Schneeberger, Patricia; Kramer, IJsbrand M.

2009-01-01

The number of experimentally derived structures of cellular components is rapidly expanding, and this phenomenon is accompanied by the development of a new semiotic system for teaching. The infographic approach is shifting from a schematic toward a more realistic representation of cellular components. By realistic we mean artist-prepared or…

DNA Secondary Structure at Chromosomal Fragile Sites in Human Disease

PubMed Central

Thys, Ryan G; Lehman, Christine E; Pierce, Levi C. T; Wang, Yuh-Hwa

2015-01-01

DNA has the ability to form a variety of secondary structures that can interfere with normal cellular processes, and many of these structures have been associated with neurological diseases and cancer. Secondary structure-forming sequences are often found at chromosomal fragile sites, which are hotspots for sister chromatid exchange, chromosomal translocations, and deletions. Structures formed at fragile sites can lead to instability by disrupting normal cellular processes such as DNA replication and transcription. The instability caused by disruption of replication and transcription can lead to DNA breakage, resulting in gene rearrangements and deletions that cause disease. In this review, we discuss the role of DNA secondary structure at fragile sites in human disease. PMID:25937814

Multisubunit DNA-Dependent RNA Polymerases from Vaccinia Virus and Other Nucleocytoplasmic Large-DNA Viruses: Impressions from the Age of Structure.

PubMed

Mirzakhanyan, Yeva; Gershon, Paul D

2017-09-01

The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.

Murine Electrophysiological Models of Cardiac Arrhythmogenesis

PubMed Central

2016-01-01

Cardiac arrhythmias can follow disruption of the normal cellular electrophysiological processes underlying excitable activity and their tissue propagation as coherent wavefronts from the primary sinoatrial node pacemaker, through the atria, conducting structures and ventricular myocardium. These physiological events are driven by interacting, voltage-dependent, processes of activation, inactivation, and recovery in the ion channels present in cardiomyocyte membranes. Generation and conduction of these events are further modulated by intracellular Ca2+ homeostasis, and metabolic and structural change. This review describes experimental studies on murine models for known clinical arrhythmic conditions in which these mechanisms were modified by genetic, physiological, or pharmacological manipulation. These exemplars yielded molecular, physiological, and structural phenotypes often directly translatable to their corresponding clinical conditions, which could be investigated at the molecular, cellular, tissue, organ, and whole animal levels. Arrhythmogenesis could be explored during normal pacing activity, regular stimulation, following imposed extra-stimuli, or during progressively incremented steady pacing frequencies. Arrhythmic substrate was identified with temporal and spatial functional heterogeneities predisposing to reentrant excitation phenomena. These could arise from abnormalities in cardiac pacing function, tissue electrical connectivity, and cellular excitation and recovery. Triggering events during or following recovery from action potential excitation could thereby lead to sustained arrhythmia. These surface membrane processes were modified by alterations in cellular Ca2+ homeostasis and energetics, as well as cellular and tissue structural change. Study of murine systems thus offers major insights into both our understanding of normal cardiac activity and its propagation, and their relationship to mechanisms generating clinical arrhythmias. PMID:27974512

Design and implementation of a novel mechanical testing system for cellular solids.

PubMed

Nazarian, Ara; Stauber, Martin; Müller, Ralph

2005-05-01

Cellular solids constitute an important class of engineering materials encompassing both man-made and natural constructs. Materials such as wood, cork, coral, and cancellous bone are examples of cellular solids. The structural analysis of cellular solid failure has been limited to 2D sections to illustrate global fracture patterns. Due to the inherent destructiveness of 2D methods, dynamic assessment of fracture progression has not been possible. Image-guided failure assessment (IGFA), a noninvasive technique to analyze 3D progressive bone failure, has been developed utilizing stepwise microcompression in combination with time-lapsed microcomputed tomographic imaging (microCT). This method allows for the assessment of fracture progression in the plastic region, where much of the structural deformation/energy absorption is encountered in a cellular solid. Therefore, the goal of this project was to design and fabricate a novel micromechanical testing system to validate the effectiveness of the stepwise IGFA technique compared to classical continuous mechanical testing, using a variety of engineered and natural cellular solids. In our analysis, we found stepwise compression to be a valid approach for IGFA with high precision and accuracy comparable to classical continuous testing. Therefore, this approach complements the conventional mechanical testing methods by providing visual insight into the failure propagation mechanisms of cellular solids. (c) 2005 Wiley Periodicals, Inc.

Inferring the Limit Behavior of Some Elementary Cellular Automata

NASA Astrophysics Data System (ADS)

Ruivo, Eurico L. P.; de Oliveira, Pedro P. B.

Cellular automata locally define dynamical systems, discrete in space, time and in the state variables, capable of displaying arbitrarily complex global emergent behavior. One core question in the study of cellular automata refers to their limit behavior, that is, to the global dynamical features in an infinite time evolution. Previous works have shown that for finite time evolutions, the dynamics of one-dimensional cellular automata can be described by regular languages and, therefore, by finite automata. Such studies have shown the existence of growth patterns in the evolution of such finite automata for some elementary cellular automata rules and also inferred the limit behavior of such rules based upon the growth patterns; however, the results on the limit behavior were obtained manually, by direct inspection of the structures that arise during the time evolution. Here we present the formalization of an automatic method to compute such structures. Based on this, the rules of the elementary cellular automata space were classified according to the existence of a growth pattern in their finite automata. Also, we present a method to infer the limit graph of some elementary cellular automata rules, derived from the analysis of the regular expressions that describe their behavior in finite time. Finally, we analyze some attractors of two rules for which we could not compute the whole limit set.

Bioaccessibility and Cellular Uptake of β-Carotene Encapsulated in Model O/W Emulsions: Influence of Initial Droplet Size and Emulsifiers

PubMed Central

Kelly, Alan L.

2017-01-01

The effects of the initial emulsion structure (droplet size and emulsifier) on the properties of β-carotene-loaded emulsions and the bioavailability of β-carotene after passing through simulated gastrointestinal tract (GIT) digestion were investigated. Exposure to GIT significantly changed the droplet size, surface charge and composition of all emulsions, and these changes were dependent on their initial droplet size and the emulsifiers used. Whey protein isolate (WPI)-stabilized emulsion showed the highest β-carotene bioaccessibility, while sodium caseinate (SCN)-stabilized emulsion showed the highest cellular uptake of β-carotene. The bioavailability of emulsion-encapsulated β-carotene based on the results of bioaccessibility and cellular uptake showed the same order with the results of cellular uptake being SCN > TW80 > WPI. An inconsistency between the results of bioaccessibility and bioavailability was observed, indicating that the cellular uptake assay is necessary for a reliable evaluation of the bioavailability of emulsion-encapsulated compounds. The findings in this study contribute to a better understanding of the correlation between emulsion structure and the digestive fate of emulsion-encapsulated nutrients, which make it possible to achieve controlled or potential targeted delivery of nutrients by designing the structure of emulsion-based carriers. PMID:28930195

Star cell type core configuration for structural sandwich materials

DOEpatents

Christensen, Richard M.

1995-01-01

A new pattern for cellular core material used in sandwich type structural materials. The new pattern involves star shaped cells intermixed with hexagonal shaped cells. The new patterned cellular core material includes star shaped cells interconnected at points thereof and having hexagonal shape cells positioned adjacent the star points. The new pattern allows more flexibility and can conform more easily to curved shapes.

Cellular compartmentation follows rules: The Schnepf theorem, its consequences and exceptions: A biological membrane separates a plasmatic from a non-plasmatic phase.

PubMed

Moog, Daniel; Maier, Uwe G

2017-08-01

Is the spatial organization of membranes and compartments within cells subjected to any rules? Cellular compartmentation differs between prokaryotic and eukaryotic life, because it is present to a high degree only in eukaryotes. In 1964, Prof. Eberhard Schnepf formulated the compartmentation rule (Schnepf theorem), which posits that a biological membrane, the main physical structure responsible for cellular compartmentation, usually separates a plasmatic form a non-plasmatic phase. Here we review and re-investigate the Schnepf theorem by applying the theorem to different cellular structures, from bacterial cells to eukaryotes with their organelles and compartments. In conclusion, we can confirm the general correctness of the Schnepf theorem, noting explicit exceptions only in special cases such as endosymbiosis and parasitism. © 2017 WILEY Periodicals, Inc.

Mechanics of the Nucleus

PubMed Central

Lammerding, Jan

2015-01-01

The nucleus is the distinguishing feature of eukaryotic cells. Until recently, it was often considered simply as a unique compartment containing the genetic information of the cell and associated machinery, without much attention to its structure and mechanical properties. This article provides compelling examples that illustrate how specific nuclear structures are associated with important cellular functions, and how defects in nuclear mechanics can cause a multitude of human diseases. During differentiation, embryonic stem cells modify their nuclear envelope composition and chromatin structure, resulting in stiffer nuclei that reflect decreased transcriptional plasticity. In contrast, neutrophils have evolved characteristic lobulated nuclei that increase their physical plasticity, enabling passage through narrow tissue spaces in their response to inflammation. Research on diverse cell types further demonstrates how induced nuclear deformations during cellular compression or stretch can modulate cellular function. Pathological examples of disturbed nuclear mechanics include the many diseases caused by mutations in the nuclear envelope proteins lamin A/C and associated proteins, as well as cancer cells that are often characterized by abnormal nuclear morphology. In this article, we will focus on determining the functional relationship between nuclear mechanics and cellular (dys-)function, describing the molecular changes associated with physiological and pathological examples, the resulting defects in nuclear mechanics, and the effects on cellular function. New insights into the close relationship between nuclear mechanics and cellular organization and function will yield a better understanding of normal biology and will offer new clues into therapeutic approaches to the various diseases associated with defective nuclear mechanics. PMID:23737203

Cellularized Cellular Solids via Freeze-Casting.

PubMed

Christoph, Sarah; Kwiatoszynski, Julien; Coradin, Thibaud; Fernandes, Francisco M

2016-02-01

The elaboration of metabolically active cell-containing materials is a decisive step toward the successful application of cell based technologies. The present work unveils a new process allowing to simultaneously encapsulate living cells and shaping cell-containing materials into solid-state macroporous foams with precisely controlled morphology. Our strategy is based on freeze casting, an ice templating materials processing technique that has recently emerged for the structuration of colloids into macroporous materials. Our results indicate that it is possible to combine the precise structuration of the materials with cellular metabolic activity for the model organism Saccharomyces cerevisiae. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Is central dogma a global property of cellular information flow?

PubMed Central

Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar

2012-01-01

The central dogma of molecular biology has come under scrutiny in recent years. Here, we reviewed high-throughput mRNA and protein expression data of Escherichia coli, Saccharomyces cerevisiae, and several mammalian cells. At both single cell and population scales, the statistical comparisons between the entire transcriptomes and proteomes show clear correlation structures. In contrast, the pair-wise correlations of single transcripts to proteins show nullity. These data suggest that the organizing structure guiding cellular processes is observed at omics-wide scale, and not at single molecule level. The central dogma, thus, globally emerges as an average integrated flow of cellular information. PMID:23189060

Is central dogma a global property of cellular information flow?

PubMed

Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar

2012-01-01

The central dogma of molecular biology has come under scrutiny in recent years. Here, we reviewed high-throughput mRNA and protein expression data of Escherichia coli, Saccharomyces cerevisiae, and several mammalian cells. At both single cell and population scales, the statistical comparisons between the entire transcriptomes and proteomes show clear correlation structures. In contrast, the pair-wise correlations of single transcripts to proteins show nullity. These data suggest that the organizing structure guiding cellular processes is observed at omics-wide scale, and not at single molecule level. The central dogma, thus, globally emerges as an average integrated flow of cellular information.

The mechanics of the primary cilium: an intricate structure with complex function.

PubMed

Hoey, David A; Downs, Matthew E; Jacobs, Christopher R

2012-01-03

The primary cilium is a non-motile singular cellular structure that extends from the surface of nearly every cell in the body. The cilium has been shown to play numerous roles in maintaining tissue homeostasis, through regulating signaling pathways and sensing both biophysical and biochemical changes in the extracellular environment. The structural performance of the cilium is paramount to its function as defective cilia have been linked to numerous pathologies. In particular, the cilium has demonstrated a mechanosensory role in tissues such as the kidney, liver, endothelium and bone, where cilium deflection under mechanical loading triggers a cellular response. Understanding of how cilium structure and subsequent mechanical behavior contributes to the roles that cilium plays in regulating cellular behavior is a compelling question, yet is a relatively untouched research area. Recent advances in biophysical measurements have demonstrated the cilium to be a structurally intricate organelle containing an array of load bearing proteins. Furthermore advances in modeling of this organelle have revealed the importance of these proteins at regulating the cilium's mechanosensitivity. Remarkably, the cilium is capable of adapting its mechanical state, altering its length and possibly it's bending resistance, to regulate its mechanosensitivity demonstrating the importance of cilium mechanics in cellular responses. In this review, we introduce the cilium as a mechanosensor; discuss the advances in the mechanical modeling of cilia; explore the structural features of the cilium, which contribute to its mechanics and finish with possible mechanisms in which alteration in structure may affect ciliary mechanics, consequently affecting ciliary based mechanosensing. Copyright © 2011 Elsevier Ltd. All rights reserved.

On the phase space structure of IP3 induced Ca2+ signalling and concepts for predictive modeling

NASA Astrophysics Data System (ADS)

Falcke, Martin; Moein, Mahsa; TilÅ«naitÄ--, Agne; Thul, Rüdiger; Skupin, Alexander

2018-04-01

The correspondence between mathematical structures and experimental systems is the basis of the generalizability of results found with specific systems and is the basis of the predictive power of theoretical physics. While physicists have confidence in this correspondence, it is less recognized in cellular biophysics. On the one hand, the complex organization of cellular dynamics involving a plethora of interacting molecules and the basic observation of cell variability seem to question its possibility. The practical difficulties of deriving the equations describing cellular behaviour from first principles support these doubts. On the other hand, ignoring such a correspondence would severely limit the possibility of predictive quantitative theory in biophysics. Additionally, the existence of functional modules (like pathways) across cell types suggests also the existence of mathematical structures with comparable universality. Only a few cellular systems have been sufficiently investigated in a variety of cell types to follow up these basic questions. IP3 induced Ca2+signalling is one of them, and the mathematical structure corresponding to it is subject of ongoing discussion. We review the system's general properties observed in a variety of cell types. They are captured by a reaction diffusion system. We discuss the phase space structure of its local dynamics. The spiking regime corresponds to noisy excitability. Models focussing on different aspects can be derived starting from this phase space structure. We discuss how the initial assumptions on the set of stochastic variables and phase space structure shape the predictions of parameter dependencies of the mathematical models resulting from the derivation.

A 3D Image Filter for Parameter-Free Segmentation of Macromolecular Structures from Electron Tomograms

PubMed Central

Ali, Rubbiya A.; Landsberg, Michael J.; Knauth, Emily; Morgan, Garry P.; Marsh, Brad J.; Hankamer, Ben

2012-01-01

3D image reconstruction of large cellular volumes by electron tomography (ET) at high (≤5 nm) resolution can now routinely resolve organellar and compartmental membrane structures, protein coats, cytoskeletal filaments, and macromolecules. However, current image analysis methods for identifying in situ macromolecular structures within the crowded 3D ultrastructural landscape of a cell remain labor-intensive, time-consuming, and prone to user-bias and/or error. This paper demonstrates the development and application of a parameter-free, 3D implementation of the bilateral edge-detection (BLE) algorithm for the rapid and accurate segmentation of cellular tomograms. The performance of the 3D BLE filter has been tested on a range of synthetic and real biological data sets and validated against current leading filters—the pseudo 3D recursive and Canny filters. The performance of the 3D BLE filter was found to be comparable to or better than that of both the 3D recursive and Canny filters while offering the significant advantage that it requires no parameter input or optimisation. Edge widths as little as 2 pixels are reproducibly detected with signal intensity and grey scale values as low as 0.72% above the mean of the background noise. The 3D BLE thus provides an efficient method for the automated segmentation of complex cellular structures across multiple scales for further downstream processing, such as cellular annotation and sub-tomogram averaging, and provides a valuable tool for the accurate and high-throughput identification and annotation of 3D structural complexity at the subcellular level, as well as for mapping the spatial and temporal rearrangement of macromolecular assemblies in situ within cellular tomograms. PMID:22479430

Rapid enrichment of rare-earth metals by carboxymethyl cellulose-based open-cellular hydrogel adsorbent from HIPEs template.

PubMed

Zhu, Yongfeng; Wang, Wenbo; Zheng, Yian; Wang, Feng; Wang, Aiqin

2016-04-20

A series of monolithic open-cellular hydrogel adsorbents based on carboxymethylcellulose (CMC) were prepared through high internal phase emulsions (HIPEs) and used to enrich the rare-earth metals La(3+) and Ce(3+). The changes of pore structure, and the effects of pH, contact time, initial concentration on the adsorption performance were systematically studied. The results show that the as-prepared monolithic hydrogel adsorbents possess good open-cellular framework structure and have fast adsorption kinetics and high adsorption capacity for La(3+) and Ce(3+). The involved adsorption system can reach equilibrium within 30min and the maximal adsorption capacity is determined to be 384.62mg/g for La(3+) and 333.33mg/g for Ce(3+). Moreover, these porous hydrogel adsorbents show an excellent adsorptive reusability for La(3+) and Ce(3+) through five adsorption-desorption cycles. Such a pore hierarchy structure makes this monolithic open-cellular hydrogel adsorbent be an effective adsorbent for effective enrichment of La(3+) and Ce(3+) from aqueous solution. Copyright © 2015 Elsevier Ltd. All rights reserved.

Modeling of time dependent localized flow shear stress and its impact on cellular growth within additive manufactured titanium implants.

PubMed

Zhang, Ziyu; Yuan, Lang; Lee, Peter D; Jones, Eric; Jones, Julian R

2014-11-01

Bone augmentation implants are porous to allow cellular growth, bone formation and fixation. However, the design of the pores is currently based on simple empirical rules, such as minimum pore and interconnects sizes. We present a three-dimensional (3D) transient model of cellular growth based on the Navier-Stokes equations that simulates the body fluid flow and stimulation of bone precursor cellular growth, attachment, and proliferation as a function of local flow shear stress. The model's effectiveness is demonstrated for two additive manufactured (AM) titanium scaffold architectures. The results demonstrate that there is a complex interaction of flow rate and strut architecture, resulting in partially randomized structures having a preferential impact on stimulating cell migration in 3D porous structures for higher flow rates. This novel result demonstrates the potential new insights that can be gained via the modeling tool developed, and how the model can be used to perform what-if simulations to design AM structures to specific functional requirements. © 2014 Wiley Periodicals, Inc.

Biological effects of weightlessness and clinostatic conditions registered in cells of root meristem and cap of higher plants

NASA Astrophysics Data System (ADS)

Sytnik, K. M.; Kordyum, E. L.; Belyavskaya, N. A.; Nedukha, E. M.; Tarasenko, V. A.

Research in cellular reproduction, differentiation and vital activity, i.e. processes underlying the development and functioning of organisms, plants included, is essential for solving fundamental and applied problems of space biology. Detailed anatomical analysis of roots of higher plants grown on board the Salyut 6 orbital research station show that under conditions of weightlessness for defined duration mitosis, cytokinesis and tissue differentiation in plant vegetative organs occur essentially normally. At the same time, certain rearrangements in the structural organization of cellular organelles - mainly the plastid apparatus, mitochondria, Golgi apparatus and nucleus - are established in the root meristem and cap of the experimental plants. This is evidence for considerable changes in cellular metabolism. The structural changes in the subcellular level arising under spaceflight conditions are partially absent in clinostat experiments designed to simulate weightlessness. Various clinostatic conditions have different influences on the cell structural and functional organization than does space flight. It is suggested that alterations of cellular metabolism under weightlessness and clinostatic conditions occur within existing genetic programs.

Cellular response of preosteoblasts to nanograined/ultrafine-grained structures.

PubMed

Misra, R D K; Thein-Han, W W; Pesacreta, T C; Hasenstein, K H; Somani, M C; Karjalainen, L P

2009-06-01

Metallic materials with submicron- to nanometer-sized grains provide surfaces that are different from conventional polycrystalline materials because of the large proportion of grain boundaries with high free energy. In the study described here, the combination of cellular and molecular biology, materials science and engineering advances our understanding of cell-substrate interactions, especially the cellular activity between preosteoblasts and nanostructured metallic surfaces. Experiments on the effect of nano-/ultrafine grains have shown that cell attachment, proliferation, viability, morphology and spread are favorably modulated and significantly different from conventional coarse-grained structures. Additionally, immunofluorescence studies demonstrated stronger vinculin signals associated with actin stress fibers in the outer regions of the cells and cellular extensions on nanograined/ultrafine-grained substrate. These observations suggest enhanced cell-substrate interaction and activity. The differences in the cellular response on nanograined/ultrafine-grained and coarse-grained substrates are attributed to grain size and degree of hydrophilicity. The outcomes of the study are expected to reduce challenges to engineer bulk nanostructured materials with specific physical and surface properties for medical devices with improved cellular attachment and response. The data lay the foundation for a new branch of nanostructured materials for biomedical applications.

Star cell type core configuration for structural sandwich materials

DOEpatents

Christensen, R.M.

1995-08-01

A new pattern for cellular core material used in sandwich type structural materials is disclosed. The new pattern involves star shaped cells intermixed with hexagonal shaped cells. The new patterned cellular core material includes star shaped cells interconnected at points thereof and having hexagonal shape cells positioned adjacent the star points. The new pattern allows more flexibility and can conform more easily to curved shapes. 3 figs.

Developmental consequences of cryopreservation of mammalian oocytes and embryos.

PubMed

Smith, Gary D; Silva E Silva, Cristine Ane

2004-08-01

During the last three decades, significant advances have been made in successful cryopreservation of mammalian preimplantation embryos, and more recently oocytes. The ability to cryopreserve, thaw, and establish pregnancies with supernumerary preimplantation embryos has become an important tool in fertility treatment. Human oocyte cryopreservation has practical application in preserving fertility for individuals at risk of compromised egg quality due to cancer treatments or advanced maternal age. While oocyte/embryo cryopreservation success has increased over time, there is still room for improvement. Oocytes and embryos are susceptible to cryo-damage, which collectively entails cellular damage caused by mechanical, chemical, or thermal forces during the freeze-thaw process. Basic studies focused on understanding cellular structures, their composition, and more importantly their functions, in normal cell developments will continue to be critical in assessing, understanding, and correcting oocyte/embryo cryo-damage. This review will delineate many of the oocyte/embryo intracellular and extracellular structures that are or may be compromised during cryopreservation. A global theme presented throughout this review is that many structural components of the oocyte/embryo also have essential functional roles in development. Compromising these cellular structures, and thus their cellular homeostatic functions, can deleteriously influence initial cryo-survival or compromise subsequent normal development through effects on the oocyte and/or early embryo.

Variation of the chemical reactivity of Thermus thermophilus HB8 ribosomal proteins as a function of pH.

PubMed

Running, William E; Reilly, James P

2010-10-01

Ribosomes occupy a central position in cellular metabolism, converting stored genetic information into active cellular machinery. Ribosomal proteins modulate both the intrinsic function of the ribosome and its interaction with other cellular complexes, such as chaperonins or the signal recognition particle. Chemical modification of proteins combined with mass spectrometric detection of the extent and position of covalent modifications is a rapid, sensitive method for the study of protein structure and flexibility. By altering the pH of the solution, we have induced non-denaturing changes in the structure of bacterial ribosomal proteins and detected these conformational changes by covalent labeling. Changes in ribosomal protein modification across a pH range from 6.6 to 8.3 are unique to each protein, and correlate with their structural environment in the ribosome. Lysine residues whose extent of modification increases as a function of increasing pH are on the surface of proteins, but in close proximity either to glutamate and aspartate residues, or to rRNA backbone phosphates. Increasing pH disrupts tertiary and quaternary interactions mediated by hydrogen bonding or ionic interactions, and regions of protein structure whose conformations are sensitive to these changes are of potential importance in modulating the flexibility of the ribosome or its interaction with other cellular complexes.

A numerical investigation into the influence of the properties of cobalt chrome cellular structures on the load transfer to the periprosthetic femur following total hip arthroplasty.

PubMed

Hazlehurst, Kevin Brian; Wang, Chang Jiang; Stanford, Mark

2014-04-01

Stress shielding of the periprosthetic femur following total hip arthroplasty is a problem that can promote the premature loosening of femoral stems. In order to reduce the need for revision surgery it is thought that more flexible implant designs need to be considered. In this work, the mechanical properties of laser melted square pore cobalt chrome molybdenum cellular structures have been incorporated into the design of a traditional monoblock femoral stem. The influence of incorporating the properties of cellular structures on the load transfer to the periprosthetic femur was investigated using a three dimensional finite element model. Eleven different stiffness configurations were investigated by using fully porous and functionally graded approaches. This investigation confirms that the periprosthetic stress values depend on the stiffness configuration of the stem. The numerical results showed that stress shielding is reduced in the periprosthetic Gruen zones when the mechanical properties of cobalt chrome molybdenum cellular structures are used. This work identifies that monoblock femoral stems manufactured using a laser melting process, which are designed for reduced stiffness, have the potential to contribute towards reducing stress shielding. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

Analytical Simulations of Energy-Absorbing Impact Spheres for a Mars Sample Return Earth Entry Vehicle

NASA Technical Reports Server (NTRS)

Billings, Marcus Dwight; Fasanella, Edwin L. (Technical Monitor)

2002-01-01

Nonlinear dynamic finite element simulations were performed to aid in the design of an energy-absorbing impact sphere for a passive Earth Entry Vehicle (EEV) that is a possible architecture for the Mars Sample Return (MSR) mission. The MSR EEV concept uses an entry capsule and energy-absorbing impact sphere designed to contain and limit the acceleration of collected samples during Earth impact without a parachute. The spherical shaped impact sphere is composed of solid hexagonal and pentagonal foam-filled cells with hybrid composite, graphite-epoxy/Kevlar cell walls. Collected Martian samples will fit inside a smaller spherical sample container at the center of the EEV's cellular structure. Comparisons were made of analytical results obtained using MSC.Dytran with test results obtained from impact tests performed at NASA Langley Research Center for impact velocities from 30 to 40 m/s. Acceleration, velocity, and deformation results compared well with the test results. The correlated finite element model was then used for simulations of various off-nominal impact scenarios. Off-nominal simulations at an impact velocity of 40 m/s included a rotated cellular structure impact onto a flat surface, a cellular structure impact onto an angled surface, and a cellular structure impact onto the corner of a step.

Impaired ATP6V0A2 expression contributes to Golgi dispersion and glycosylation changes in senescent cells.

PubMed

Udono, Miyako; Fujii, Kaoru; Harada, Gakuro; Tsuzuki, Yumi; Kadooka, Keishi; Zhang, Pingbo; Fujii, Hiroshi; Amano, Maho; Nishimura, Shin-Ichiro; Tashiro, Kosuke; Kuhara, Satoru; Katakura, Yoshinori

2015-11-27

Many genes and signaling pathways have been found to be involved in cellular senescence program. In the present study, we have identified 16 senescence-associated genes by differential proteomic analysis of the normal human diploid fibroblast cell line, TIG-1, and focused on ATP6V0A2. The aim of this study is to clarify the role of ATP6V0A2, the causal gene for ARCL2, a syndrome of abnormal glycosylation and impaired Golgi trafficking, in cellular senescence program. Here we showed that ATP6V0A2 is critical for cellular senescence; impaired expression of ATP6V0A2 disperses the Golgi structure and triggers senescence, suggesting that ATP6V0A2 mediates these processes. FITC-lectin staining and glycoblotting revealed significantly different glycosylation structures in presenescent (young) and senescent (old) TIG-1 cells; reducing ATP6V0A2 expression in young TIG-1 cells yielded structures similar to those in old TIG-1 cells. Our results suggest that senescence-associated impaired expression of ATP6V0A2 triggers changes in Golgi structure and glycosylation in old TIG-1 cells, which demonstrates a role of ATP6V0A2 in cellular senescence program.

Impaired ATP6V0A2 expression contributes to Golgi dispersion and glycosylation changes in senescent cells

PubMed Central

Udono, Miyako; Fujii, Kaoru; Harada, Gakuro; Tsuzuki, Yumi; Kadooka, Keishi; Zhang, Pingbo; Fujii, Hiroshi; Amano, Maho; Nishimura, Shin-Ichiro; Tashiro, Kosuke; Kuhara, Satoru; Katakura, Yoshinori

2015-01-01

Many genes and signaling pathways have been found to be involved in cellular senescence program. In the present study, we have identified 16 senescence-associated genes by differential proteomic analysis of the normal human diploid fibroblast cell line, TIG-1, and focused on ATP6V0A2. The aim of this study is to clarify the role of ATP6V0A2, the causal gene for ARCL2, a syndrome of abnormal glycosylation and impaired Golgi trafficking, in cellular senescence program. Here we showed that ATP6V0A2 is critical for cellular senescence; impaired expression of ATP6V0A2 disperses the Golgi structure and triggers senescence, suggesting that ATP6V0A2 mediates these processes. FITC-lectin staining and glycoblotting revealed significantly different glycosylation structures in presenescent (young) and senescent (old) TIG-1 cells; reducing ATP6V0A2 expression in young TIG-1 cells yielded structures similar to those in old TIG-1 cells. Our results suggest that senescence-associated impaired expression of ATP6V0A2 triggers changes in Golgi structure and glycosylation in old TIG-1 cells, which demonstrates a role of ATP6V0A2 in cellular senescence program. PMID:26611489

Femtosecond laser fabricated spike structures for selective control of cellular behavior.

PubMed

Schlie, Sabrina; Fadeeva, Elena; Koch, Jürgen; Ngezahayo, Anaclet; Chichkov, Boris N

2010-09-01

In this study we investigate the potential of femtosecond laser generated micrometer sized spike structures as functional surfaces for selective cell controlling. The spike dimensions as well as the average spike to spike distance can be easily tuned by varying the process parameters. Moreover, negative replications in soft materials such as silicone elastomer can be produced. This allows tailoring of wetting properties of the spike structures and their negative replicas representing a reduced surface contact area. Furthermore, we investigated material effects on cellular behavior. By comparing human fibroblasts and SH-SY5Y neuroblastoma cells we found that the influence of the material was cell specific. The cells not only changed their morphology, but also the cell growth was affected. Whereas, neuroblastoma cells proliferated at the same rate on the spike structures as on the control surfaces, the proliferation of fibroblasts was reduced by the spike structures. These effects can result from the cell specific adhesion patterns as shown in this work. These findings show a possibility to design defined surface microstructures, which could control cellular behavior in a cell specific manner.

Wild yeast harbor a variety of distinct amyloid structures with strong prion-inducing capabilities

PubMed Central

Westergard, Laura; True, Heather L.

2014-01-01

Summary Variation in amyloid structures profoundly influences a wide array of pathological phenotypes in mammalian protein conformation disorders and dominantly inherited phenotypes in yeast. Here, we describe, for the first time, naturally occurring, self-propagating, structural variants of a prion protein isolated from wild strains of the yeast Saccharomyces cerevisiae. Variants of the [RNQ+] prion propagating in a variety of wild yeast differ biochemically, in their intracellular distributions, and in their ability to promote formation of the [PSI+] prion. [PSI+] is an epigenetic regulator of cellular phenotype and adaptability. Strikingly, we find that most natural [RNQ+] variants induced [PSI+] at high frequencies and the majority of [PSI+] variants elicited strong cellular phenotypes. We hypothesize that the presence of an efficient [RNQ+] template primes the cell for [PSI+] formation in order to induce [PSI+] in conditions where it would be advantageous. These studies utilize naturally occurring structural variants to expand our understanding of the consequences of diverse prion conformations on cellular phenotypes. PMID:24673812

Mammalian HspB1 (Hsp27) is a molecular sensor linked to the physiology and environment of the cell.

PubMed

Arrigo, André-Patrick

2017-07-01

Constitutively expressed small heat shock protein HspB1 regulates many fundamental cellular processes and plays major roles in many human pathological diseases. In that regard, this chaperone has a huge number of apparently unrelated functions that appear linked to its ability to recognize many client polypeptides that are subsequently modified in their activity and/or half-life. A major parameter to understand how HspB1 is dedicated to interact with particular clients in defined cellular conditions relates to its complex oligomerization and phosphorylation properties. Indeed, HspB1 structural organization displays dynamic and complex rearrangements in response to changes in the cellular environment or when the cell physiology is modified. These structural modifications probably reflect the formation of structural platforms aimed at recognizing specific client polypeptides. Here, I have reviewed data from the literature and re-analyzed my own studies to describe and discuss these fascinating changes in HspB1 structural organization.

Harnessing cell-to-cell variations to probe bacterial structure and biophysics

NASA Astrophysics Data System (ADS)

Cass, Julie A.

Advances in microscopy and biotechnology have given us novel insights into cellular biology and physics. While bacteria were long considered to be relatively unstructured, the development of fluorescence microscopy techniques, and spatially and temporally resolved high-throughput quantitative studies, have uncovered that the bacterial cell is highly organized, and its structure rigorously maintained. In this thesis I will describe our gateTool software, designed to harness cell-to-cell variations to probe bacterial structure, and discuss two exciting aspects of structure that we have employed gateTool to investigate: (i) chromosome organization and the cellular mechanisms for controlling DNA dynamics, and (ii) the study of cell wall synthesis, and how the genes in the synthesis pathway impact cellular shape. In the first project, we develop a spatial and temporal mapping of cell-cycle-dependent chromosomal organization, and use this quantitative map to discover that chromosomal loci segregate from midcell with universal dynamics. In the second project, I describe preliminary time- lapse and snapshot imaging analysis suggesting phentoypical coherence across peptidoglycan synthesis pathways.

A review of reagents for fluorescence microscopy of cellular compartments and structures, Part III: reagents for actin, tubulin, cellular membranes, and whole cell and cytoplasm.

PubMed

Kilgore, Jason A; Dolman, Nick J; Davidson, Michael W

2014-01-02

Non-antibody commercial fluorescent reagents for imaging of cytoskeletal structures have been limited primarily to tubulin and actin, with the main factor in choice based mainly on whether cells are live or fixed and permeabilized. A wider range of options exist for cell membrane dyes, and the choice of reagent primarily depends on the preferred localization in the cell (i.e., all membranes or only the plasma membrane) and usage (i.e., whether the protocol involves fixation and permeabilization). For whole-cell or cytoplasmic imaging, the choice of reagent is determined mostly by the length of time that the cells need to be visualized (hours or days) and by fixation status. Presented here is a discussion on choosing commercially available reagents for these cellular structures, with an emphasis on use for microscopic imaging, with a featured reagent for each structure, a recommended protocol, troubleshooting guide, and example image. Copyright © 2014 John Wiley & Sons, Inc.

Shock enhancement of cellular materials subjected to intensive pulse loading

NASA Astrophysics Data System (ADS)

Zhang, J.; Fan, J.; Wang, Z.; Zhao, L.; Li, Z.

2018-03-01

Cellular materials can dissipate a large amount of energy due to their considerable stress plateau, which contributes to their extensive applications in structural design for crashworthiness. However, in some experiments with specimens subjected to intense impact loads, transmitted stress enhancement has been observed, leading to severe damage to the objects protected. Transmitted stress through two-dimensional Voronoi cellular materials as a protective device is qualitatively studied in this paper. Dimensionless parameters of material properties and loading parameters are defined to give critical conditions for shock enhancement and clarify the correlation between the deformations and stress enhancement. The effect of relative density on this amplifying phenomenon is investigated as well. In addition, local strain fields are calculated by using the optimal local deformation gradient, which gives a clear presentation of deformations and possible local non-uniformity in the crushing process. This research provides valuable insight into the reliability of cellular materials as protective structures.

Self-organized perturbations enhance class IV behavior and 1/f power spectrum in elementary cellular automata.

PubMed

Nakajima, Kohei; Haruna, Taichi

2011-09-01

In this paper, we propose a new class of cellular automata based on the modification of its state space. It is introduced to model a computation which is exposed to an environment. We formalized the computation as extension and projection processes of its state space and resulting misidentifications of the state. This is motivated to embed the role of an environment into the system itself, which naturally induces self-organized internal perturbations rather than the usual external perturbations. Implementing this structure into the elementary cellular automata, we characterized its effect by means of input entropy and power spectral analysis. As a result, the cellular automata with this structure showed robust class IV behavior and a 1/f power spectrum in a wide range of rule space comparative to the notion of the edge of chaos. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Multi-scale Imaging of Cellular and Sub-cellular Structures using Scanning Probe Recognition Microscopy.

NASA Astrophysics Data System (ADS)

Chen, Q.; Rice, A. F.

2005-03-01

Scanning Probe Recognition Microscopy is a new scanning probe capability under development within our group to reliably return to and directly interact with a specific nanobiological feature of interest. In previous work, we have successfully recognized and classified tubular versus globular biological objects from experimental atomic force microscope images using a method based on normalized central moments [ref. 1]. In this paper we extend this work to include recognition schemes appropriate for cellular and sub-cellular structures. Globular cells containing tubular actin filaments are under investigation. Thus there are differences in external/internal shapes and scales. Continuous Wavelet Transform with a differential Gaussian mother wavelet is employed for multi- scale analysis. [ref. 1] Q. Chen, V. Ayres and L. Udpa, ``Biological Investigation Using Scanning Probe Recognition Microscopy,'' Proceedings 3rd IEEE Conference on Nanotechnology, vol. 2, p 863-865 (2003).

High-speed atomic force microscopy combined with inverted optical microscopy for studying cellular events

PubMed Central

Suzuki, Yuki; Sakai, Nobuaki; Yoshida, Aiko; Uekusa, Yoshitsugu; Yagi, Akira; Imaoka, Yuka; Ito, Shuichi; Karaki, Koichi; Takeyasu, Kunio

2013-01-01

A hybrid atomic force microscopy (AFM)-optical fluorescence microscopy is a powerful tool for investigating cellular morphologies and events. However, the slow data acquisition rates of the conventional AFM unit of the hybrid system limit the visualization of structural changes during cellular events. Therefore, high-speed AFM units equipped with an optical/fluorescence detection device have been a long-standing wish. Here we describe the implementation of high-speed AFM coupled with an optical fluorescence microscope. This was accomplished by developing a tip-scanning system, instead of a sample-scanning system, which operates on an inverted optical microscope. This novel device enabled the acquisition of high-speed AFM images of morphological changes in individual cells. Using this instrument, we conducted structural studies of living HeLa and 3T3 fibroblast cell surfaces. The improved time resolution allowed us to image dynamic cellular events. PMID:23823461

High-speed atomic force microscopy combined with inverted optical microscopy for studying cellular events.

PubMed

Suzuki, Yuki; Sakai, Nobuaki; Yoshida, Aiko; Uekusa, Yoshitsugu; Yagi, Akira; Imaoka, Yuka; Ito, Shuichi; Karaki, Koichi; Takeyasu, Kunio

2013-01-01

A hybrid atomic force microscopy (AFM)-optical fluorescence microscopy is a powerful tool for investigating cellular morphologies and events. However, the slow data acquisition rates of the conventional AFM unit of the hybrid system limit the visualization of structural changes during cellular events. Therefore, high-speed AFM units equipped with an optical/fluorescence detection device have been a long-standing wish. Here we describe the implementation of high-speed AFM coupled with an optical fluorescence microscope. This was accomplished by developing a tip-scanning system, instead of a sample-scanning system, which operates on an inverted optical microscope. This novel device enabled the acquisition of high-speed AFM images of morphological changes in individual cells. Using this instrument, we conducted structural studies of living HeLa and 3T3 fibroblast cell surfaces. The improved time resolution allowed us to image dynamic cellular events.

Study of Barley Grain Molecular Structure for Ruminants Using DRIFT, FTIR-ATR and Synchrotron Radiation Infrared Microspectroscopy (SR-IMS): A Review

NASA Astrophysics Data System (ADS)

Yu, Peiqiang

2012-05-01

Barley inherent structures are highly associated with nutrient utilization and availability in both humans and animals. Barley has different degradation kinetics compared with other cereal grains. It has a relatively higher degradation rate and extent, which often cause digestive disorder in the rumen. Therefore understanding barley inherent structure at cellular and molecular levels and processing-induced structure changes is important, because we can manipulate barley inherent structures and digestive behaviors. Several molecular spectroscopy techniques can be used to detect barley inherent structures at cellular and molecular levels. This article reviews several applications of the IR molecular spectral bioanalytical techniques - DRIFT, FT/IR-ATR and SR-IMS for barley chemistry, molecular structure and molecular nutrition research

Phase separation and the formation of cellular bodies

NASA Astrophysics Data System (ADS)

Xu, Bin; Broedersz, Chase P.; Meir, Yigal; Wingreen, Ned S.

Cellular bodies in eukaryotic cells spontaneously assemble to form cellular compartments. Among other functions, these bodies carry out essential biochemical reactions. Cellular bodies form micron-sized structures, which, unlike canonical cell organelles, are not surrounded by membranes. A recent in vitro experiment has shown that phase separation of polymers in solution can explain the formation of cellular bodies. We constructed a lattice-polymer model to capture the essential mechanism leading to this phase separation. We used both analytical and numerical tools to predict the phase diagram of a system of two interacting polymers, including the concentration of each polymer type in the condensed and dilute phase.

Reversible Flip-Flops in Quantum-Dot Cellular Automata

NASA Astrophysics Data System (ADS)

Rad, Samaneh Kazemi; Heikalabad, Saeed Rasouli

2017-09-01

Quantum-dot cellular automata is a new technology to design the efficient combinational and sequential circuits at the nano-scale. This technology has many desirable advantages compared to the CMOS technology such as low power consumption, less occupation area and low latency. These features make it suitable for use in flip-flop design. In this paper, with knowing the characteristics of reversible logic, we design new structures for flip-flops. The operations of these structures are evaluated with QCADesigner Version 2.0.3 simulator. In addition, we calculate the power dissipation of these structures by QCAPro tool. The results illustrated that proposed structures are efficient compared to the previous ones.

Algorithm for repairing the damaged images of grain structures obtained from the cellular automata and measurement of grain size

NASA Astrophysics Data System (ADS)

Ramírez-López, A.; Romero-Romo, M. A.; Muñoz-Negron, D.; López-Ramírez, S.; Escarela-Pérez, R.; Duran-Valencia, C.

2012-10-01

Computational models are developed to create grain structures using mathematical algorithms based on the chaos theory such as cellular automaton, geometrical models, fractals, and stochastic methods. Because of the chaotic nature of grain structures, some of the most popular routines are based on the Monte Carlo method, statistical distributions, and random walk methods, which can be easily programmed and included in nested loops. Nevertheless, grain structures are not well defined as the results of computational errors and numerical inconsistencies on mathematical methods. Due to the finite definition of numbers or the numerical restrictions during the simulation of solidification, damaged images appear on the screen. These images must be repaired to obtain a good measurement of grain geometrical properties. Some mathematical algorithms were developed to repair, measure, and characterize grain structures obtained from cellular automata in the present work. An appropriate measurement of grain size and the corrected identification of interfaces and length are very important topics in materials science because they are the representation and validation of mathematical models with real samples. As a result, the developed algorithms are tested and proved to be appropriate and efficient to eliminate the errors and characterize the grain structures.

Simulations of Living Cell Origins Using a Cellular Automata Model

NASA Astrophysics Data System (ADS)

Ishida, Takeshi

2014-04-01

Understanding the generalized mechanisms of cell self-assembly is fundamental for applications in various fields, such as mass producing molecular machines in nanotechnology. Thus, the details of real cellular reaction networks and the necessary conditions for self-organized cells must be elucidated. We constructed a 2-dimensional cellular automata model to investigate the emergence of biological cell formation, which incorporated a looped membrane and a membrane-bound information system (akin to a genetic code and gene expression system). In particular, with an artificial reaction system coupled with a thermal system, the simultaneous formation of a looped membrane and an inner reaction process resulted in a more stable structure. These double structures inspired the primitive biological cell formation process from chemical evolution stage. With a model to simulate cellular self-organization in a 2-dimensional cellular automata model, 3 phenomena could be realized: (1) an inner reaction system developed as an information carrier precursor (akin to DNA); (2) a cell border emerged (akin to a cell membrane); and (3) these cell structures could divide into 2. This double-structured cell was considered to be a primary biological cell. The outer loop evolved toward a lipid bilayer membrane, and inner polymeric particles evolved toward precursor information carriers (evolved toward DNA). This model did not completely clarify all the necessary and sufficient conditions for biological cell self-organization. Further, our virtual cells remained unstable and fragile. However, the "garbage bag model" of Dyson proposed that the first living cells were deficient; thus, it would be reasonable that the earliest cells were more unstable and fragile than the simplest current unicellular organisms.

Simulations of living cell origins using a cellular automata model.

PubMed

Ishida, Takeshi

2014-04-01

Understanding the generalized mechanisms of cell self-assembly is fundamental for applications in various fields, such as mass producing molecular machines in nanotechnology. Thus, the details of real cellular reaction networks and the necessary conditions for self-organized cells must be elucidated. We constructed a 2-dimensional cellular automata model to investigate the emergence of biological cell formation, which incorporated a looped membrane and a membrane-bound information system (akin to a genetic code and gene expression system). In particular, with an artificial reaction system coupled with a thermal system, the simultaneous formation of a looped membrane and an inner reaction process resulted in a more stable structure. These double structures inspired the primitive biological cell formation process from chemical evolution stage. With a model to simulate cellular self-organization in a 2-dimensional cellular automata model, 3 phenomena could be realized: (1) an inner reaction system developed as an information carrier precursor (akin to DNA); (2) a cell border emerged (akin to a cell membrane); and (3) these cell structures could divide into 2. This double-structured cell was considered to be a primary biological cell. The outer loop evolved toward a lipid bilayer membrane, and inner polymeric particles evolved toward precursor information carriers (evolved toward DNA). This model did not completely clarify all the necessary and sufficient conditions for biological cell self-organization. Further, our virtual cells remained unstable and fragile. However, the "garbage bag model" of Dyson proposed that the first living cells were deficient; thus, it would be reasonable that the earliest cells were more unstable and fragile than the simplest current unicellular organisms.

Smartphone confocal microscopy for imaging cellular structures in human skin in vivo.

PubMed

Freeman, Esther E; Semeere, Aggrey; Osman, Hany; Peterson, Gary; Rajadhyaksha, Milind; González, Salvador; Martin, Jeffery N; Anderson, R Rox; Tearney, Guillermo J; Kang, Dongkyun

2018-04-01

We report development of a low-cost smartphone confocal microscope and its first demonstration of in vivo human skin imaging. The smartphone confocal microscope uses a slit aperture and diffraction grating to conduct two-dimensional confocal imaging without using any beam scanning devices. Lateral and axial resolutions of the smartphone confocal microscope were measured as 2 and 5 µm, respectively. In vivo confocal images of human skin revealed characteristic cellular structures, including spinous and basal keratinocytes and papillary dermis. Results suggest that the smartphone confocal microscope has a potential to examine cellular details in vivo and may help disease diagnosis in resource-poor settings, where conducting standard histopathologic analysis is challenging.

Smartphone confocal microscopy for imaging cellular structures in human skin in vivo

PubMed Central

Freeman, Esther E.; Semeere, Aggrey; Osman, Hany; Peterson, Gary; Rajadhyaksha, Milind; González, Salvador; Martin, Jeffery N.; Anderson, R. Rox; Tearney, Guillermo J.; Kang, Dongkyun

2018-01-01

We report development of a low-cost smartphone confocal microscope and its first demonstration of in vivo human skin imaging. The smartphone confocal microscope uses a slit aperture and diffraction grating to conduct two-dimensional confocal imaging without using any beam scanning devices. Lateral and axial resolutions of the smartphone confocal microscope were measured as 2 and 5 µm, respectively. In vivo confocal images of human skin revealed characteristic cellular structures, including spinous and basal keratinocytes and papillary dermis. Results suggest that the smartphone confocal microscope has a potential to examine cellular details in vivo and may help disease diagnosis in resource-poor settings, where conducting standard histopathologic analysis is challenging. PMID:29675328

Structure and Electromagnetic Properties of Cellular Glassy Carbon Monoliths with Controlled Cell Size

PubMed Central

Szczurek, Andrzej; Plyushch, Artyom; Macutkevic, Jan

2018-01-01

Electromagnetic shielding is a topic of high importance for which lightweight materials are highly sought. Porous carbon materials can meet this goal, but their structure needs to be controlled as much as possible. In this work, cellular carbon monoliths of well-defined porosity and cell size were prepared by a template method, using sacrificial paraffin spheres as the porogen and resorcinol-formaldehyde (RF) resin as the carbon precursor. Physicochemical studies were carried out for investigating the conversion of RF resin into carbon, and the final cellular monoliths were investigated in terms of elemental composition, total porosity, surface area, micropore volumes, and micro/macropore size distributions. Electrical and electromagnetic (EM) properties were investigated in the static regime and in the Ka-band, respectively. Due to the phenolic nature of the resin, the resultant carbon was glasslike, and the special preparation protocol that was used led to cellular materials whose cell size increased with density. The materials were shown to be relevant for EM shielding, and the relationships between those properties and the density/cell size of those cellular monoliths were elucidated. PMID:29723961

Phase imaging of mechanical properties of live cells (Conference Presentation)

NASA Astrophysics Data System (ADS)

Wax, Adam

2017-02-01

The mechanisms by which cells respond to mechanical stimuli are essential for cell function yet not well understood. Many rheological tools have been developed to characterize cellular viscoelastic properties but these typically require direct mechanical contact, limiting their throughput. We have developed a new approach for characterizing the organization of subcellular structures using a label free, noncontact, single-shot phase imaging method that correlates to measured cellular mechanical stiffness. The new analysis approach measures refractive index variance and relates it to disorder strength. These measurements are compared to cellular stiffness, measured using the same imaging tool to visualize nanoscale responses to flow shear stimulus. The utility of the technique is shown by comparing shear stiffness and phase disorder strength across five cellular populations with varying mechanical properties. An inverse relationship between disorder strength and shear stiffness is shown, suggesting that cell mechanical properties can be assessed in a format amenable to high throughput studies using this novel, non-contact technique. Further studies will be presented which include examination of mechanical stiffness in early carcinogenic events and investigation of the role of specific cellular structural proteins in mechanotransduction.

Gravitational Effects on Cellular Flame Structure

NASA Technical Reports Server (NTRS)

Dunsky, C. M.; Fernandez-Pello, A. C.

1991-01-01

An experimental investigation has been conducted of the effect of gravity on the structure of downwardly propagating, cellular premixed propane-oxygen-nitrogen flames anchored on a water-cooled porous-plug burner. The flame is subjected to microgravity conditions in the NASA Lewis 2.2-second drop tower, and flame characteristics are recorded on high-speed film. These are compared to flames at normal gravity conditions with the same equivalence ratio, dilution index, mixture flow rate, and ambient pressure. The results show that the cellular instability band, which is located in the rich mixture region, changes little under the absence of gravity. Lifted normal-gravity flames near the cellular/lifted limits, however, are observed to become cellular when gravity is reduced. Observations of a transient cell growth period following ignition point to heat loss as being an important mechanism in the overall flame stability, dominating the stabilizing effect of buoyancy for these downwardly-propagating burner-anchored flames. The pulsations that are observed in the plume and diffusion flame generated downstream of the premixed flame in the fuel rich cases disappear in microgravity, verifying that these fluctuations are gravity related.

Interwoven Aligned Conductive Nanofiber Yarn/Hydrogel Composite Scaffolds for Engineered 3D Cardiac Anisotropy.

PubMed

Wu, Yaobin; Wang, Ling; Guo, Baolin; Ma, Peter X

2017-06-27

Mimicking the anisotropic cardiac structure and guiding 3D cellular orientation play a critical role in designing scaffolds for cardiac tissue regeneration. Significant advances have been achieved to control cellular alignment and elongation, but it remains an ongoing challenge for engineering 3D cardiac anisotropy using these approaches. Here, we present a 3D hybrid scaffold based on aligned conductive nanofiber yarns network (NFYs-NET, composition: polycaprolactone, silk fibroin, and carbon nanotubes) within a hydrogel shell for mimicking the native cardiac tissue structure, and further demonstrate their great potential for engineering 3D cardiac anisotropy for cardiac tissue engineering. The NFYs-NET structures are shown to control cellular orientation and enhance cardiomyocytes (CMs) maturation. 3D hybrid scaffolds were then fabricated by encapsulating NFYs-NET layers within hydrogel shell, and these 3D scaffolds performed the ability to promote aligned and elongated CMs maturation on each layer and individually control cellular orientation on different layers in a 3D environment. Furthermore, endothelialized myocardium was constructed by using this hybrid strategy via the coculture of CMs on NFYs-NET layer and endothelial cells within hydrogel shell. Therefore, these 3D hybrid scaffolds, containing NFYs-NET layer inducing cellular orientation, maturation, and anisotropy and hydrogel shell providing a suitable 3D environment for endothelialization, has great potential in engineering 3D cardiac anisotropy.

Macro-cellular silica foams: synthesis during the natural creaming process of an oil-in-water emulsion.

PubMed

Sen, T; Tiddy, G J T; Casci, J L; Anderson, M W

2003-09-07

The room-temperature synthesis of a macro-mesoporous silica material during the natural creaming process of an oil-in-water emulsion is reported. The material has 3-dimensional interconnected macropores with a strut-like structure similar to meso-cellular silica foams with mesoporous walls of worm-hole structure. The material has very high surface area (approximately 800 m2 g(-1)) with narrow mesopore size distribution.

Biomolecular interactions modulate macromolecular structure and dynamics in atomistic model of a bacterial cytoplasm.

PubMed

Yu, Isseki; Mori, Takaharu; Ando, Tadashi; Harada, Ryuhei; Jung, Jaewoon; Sugita, Yuji; Feig, Michael

2016-11-01

Biological macromolecules function in highly crowded cellular environments. The structure and dynamics of proteins and nucleic acids are well characterized in vitro, but in vivo crowding effects remain unclear. Using molecular dynamics simulations of a comprehensive atomistic model cytoplasm we found that protein-protein interactions may destabilize native protein structures, whereas metabolite interactions may induce more compact states due to electrostatic screening. Protein-protein interactions also resulted in significant variations in reduced macromolecular diffusion under crowded conditions, while metabolites exhibited significant two-dimensional surface diffusion and altered protein-ligand binding that may reduce the effective concentration of metabolites and ligands in vivo. Metabolic enzymes showed weak non-specific association in cellular environments attributed to solvation and entropic effects. These effects are expected to have broad implications for the in vivo functioning of biomolecules. This work is a first step towards physically realistic in silico whole-cell models that connect molecular with cellular biology.

Nuclear Mechanics in Disease

PubMed Central

Zwerger, Monika; Ho, Chin Yee; Lammerding, Jan

2015-01-01

Over the past two decades, the biomechanical properties of cells have emerged as key players in a broad range of cellular functions, including migration, proliferation, and differentiation. Although much of the attention has focused on the cytoskeletal networks and the cell’s microenvironment, relatively little is known about the contribution of the cell nucleus. Here, we present an overview of the structural elements that determine the physical properties of the nucleus and discuss how changes in the expression of nuclear components or mutations in nuclear proteins can affect not only nuclear mechanics but also modulate cytoskeletal organization and diverse cellular functions. These findings illustrate that the nucleus is tightly integrated into the surrounding cellular structure. Consequently, changes in nuclear structure and composition are highly relevant to normal development and physiology and can contribute to many human diseases, such as muscular dystrophy, dilated cardiomyopathy, (premature) aging, and cancer. PMID:21756143

Accurate Construction of Photoactivated Localization Microscopy (PALM) Images for Quantitative Measurements

PubMed Central

Coltharp, Carla; Kessler, Rene P.; Xiao, Jie

2012-01-01

Localization-based superresolution microscopy techniques such as Photoactivated Localization Microscopy (PALM) and Stochastic Optical Reconstruction Microscopy (STORM) have allowed investigations of cellular structures with unprecedented optical resolutions. One major obstacle to interpreting superresolution images, however, is the overcounting of molecule numbers caused by fluorophore photoblinking. Using both experimental and simulated images, we determined the effects of photoblinking on the accurate reconstruction of superresolution images and on quantitative measurements of structural dimension and molecule density made from those images. We found that structural dimension and relative density measurements can be made reliably from images that contain photoblinking-related overcounting, but accurate absolute density measurements, and consequently faithful representations of molecule counts and positions in cellular structures, require the application of a clustering algorithm to group localizations that originate from the same molecule. We analyzed how applying a simple algorithm with different clustering thresholds (tThresh and dThresh) affects the accuracy of reconstructed images, and developed an easy method to select optimal thresholds. We also identified an empirical criterion to evaluate whether an imaging condition is appropriate for accurate superresolution image reconstruction with the clustering algorithm. Both the threshold selection method and imaging condition criterion are easy to implement within existing PALM clustering algorithms and experimental conditions. The main advantage of our method is that it generates a superresolution image and molecule position list that faithfully represents molecule counts and positions within a cellular structure, rather than only summarizing structural properties into ensemble parameters. This feature makes it particularly useful for cellular structures of heterogeneous densities and irregular geometries, and allows a variety of quantitative measurements tailored to specific needs of different biological systems. PMID:23251611

Understanding the impact of grain structure in austenitic stainless steel from a nanograined regime to a coarse-grained regime on osteoblast functions using a novel metal deformation-annealing sequence.

PubMed

Misra, R D K; Nune, C; Pesacreta, T C; Somani, M C; Karjalainen, L P

2013-04-01

Metallic biomedical devices with nanometer-sized grains (NGs) provide surfaces that are different from their coarse-grained (CG) (tens of micrometer) counterparts in terms of increased fraction of grain boundaries (NG>50%; CG<2-3%). The novel concept of 'phase-reversion' involving a controlled deformation-annealing sequence is used to obtain a wide range of grain structures, starting from the NG regime to the CG regime, to demonstrate that the grain structure significantly impacts cellular interactions and osteoblast functions. The uniqueness of this concept is the ability to address the critical aspect of cellular activity in nanostructured materials, because a range of grain sizes from NG to CG are obtained in a single material using an identical set of parameters. This is in addition to a high strength/weight ratio and superior wear and corrosion resistance. These multiple attributes are important for the long-term stability of biomedical devices. Experiments on the interplay between grain structure from the NG regime to CG in austenitic stainless steel on osteoblast functions indicated that cell attachment, proliferation, viability, morphology and spread varied with grain size and were favorably modulated on the NG and ultrafine-grain structure. Furthermore, immunofluorescence studies demonstrated stronger vinculin signals associated with actin stress fibers in the outer regions of the cells and cellular extensions on the NG surface. The differences in the cellular response with change in grain structure are attributed to grain structure and degree of hydrophilicity. The study lays the foundation for a new branch of nanostructured materials for biomedical applications. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Cellular water distribution, transport, and its investigation methods for plant-based food material.

PubMed

Khan, Md Imran H; Karim, M A

2017-09-01

Heterogeneous and hygroscopic characteristics of plant-based food material make it complex in structure, and therefore water distribution in its different cellular environments is very complex. There are three different cellular environments, namely the intercellular environment, the intracellular environment, and the cell wall environment inside the food structure. According to the bonding strength, intracellular water is defined as loosely bound water, cell wall water is categorized as strongly bound water, and intercellular water is known as free water (FW). During food drying, optimization of the heat and mass transfer process is crucial for the energy efficiency of the process and the quality of the product. For optimizing heat and mass transfer during food processing, understanding these three types of waters (strongly bound, loosely bound, and free water) in plant-based food material is essential. However, there are few studies that investigate cellular level water distribution and transport. As there is no direct method for determining the cellular level water distributions, various indirect methods have been applied to investigate the cellular level water distribution, and there is, as yet, no consensus on the appropriate method for measuring cellular level water in plant-based food material. Therefore, the main aim of this paper is to present a comprehensive review on the available methods to investigate the cellular level water, the characteristics of water at different cellular levels and its transport mechanism during drying. The effect of bound water transport on quality of food product is also discussed. This review article presents a comparative study of different methods that can be applied to investigate cellular water such as nuclear magnetic resonance (NMR), bioelectric impedance analysis (BIA), differential scanning calorimetry (DSC), and dilatometry. The article closes with a discussion of current challenges to investigating cellular water. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of pH and aggregation in the human prion conversion into scrapie form: a study using molecular dynamics with excited normal modes.

PubMed

Lima, Angelica Nakagawa; de Oliveira, Ronaldo Junio; Braz, Antônio Sérgio Kimus; de Souza Costa, Maurício Garcia; Perahia, David; Scott, Luis Paulo Barbour

2018-03-15

There are two different prion conformations: (1) the cellular natural (PrP C ) and (2) the scrapie (PrP Sc ), an infectious form that tends to aggregate under specific conditions. PrP C and PrP Sc are widely different regarding secondary and tertiary structures. PrP Sc contains more and longer β-strands compared to PrP C . The lack of solved PrP Sc structures precludes a proper understanding of the mechanisms related to the transition between cellular and scrapie forms, as well as the aggregation process. In order to investigate the conformational transition between PrP C and PrP Sc , we applied MDeNM (molecular dynamics with excited normal modes), an enhanced sampling simulation technique that has been recently developed to probe large structural changes. These simulations yielded new structural rearrangements of the cellular prion that would have been difficult to obtain with standard MD simulations. We observed an increase in β-sheet formation under low pH (≤ 4) and upon oligomerization, whose relevance was discussed on the basis of the energy landscape theory for protein folding. The characterization of intermediate structures corresponding to transition states allowed us to propose a conversion model from the cellular to the scrapie prion, which possibly ignites the fibril formation. This model can assist the design of new drugs to prevent neurological disorders related to the prion aggregation mechanism.

Cationic liposome/DNA complexes: from structure to interactions with cellular membranes.

PubMed

Caracciolo, Giulio; Amenitsch, Heinz

2012-10-01

Gene-based therapeutic approaches are based upon the concept that, if a disease is caused by a mutation in a gene, then adding back the wild-type gene should restore regular function and attenuate the disease phenotype. To deliver the gene of interest, both viral and nonviral vectors are used. Viruses are efficient, but their application is impeded by detrimental side-effects. Among nonviral vectors, cationic liposomes are the most promising candidates for gene delivery. They form stable complexes with polyanionic DNA (lipoplexes). Despite several advantages over viral vectors, the transfection efficiency (TE) of lipoplexes is too low compared with those of engineered viral vectors. This is due to lack of knowledge about the interactions between complexes and cellular components. Rational design of efficient lipoplexes therefore requires deeper comprehension of the interactions between the vector and the DNA as well as the cellular pathways and mechanisms involved. The importance of the lipoplex structure in biological function is revealed in the application of synchrotron small-angle X-ray scattering in combination with functional TE measurements. According to current understanding, the structure of lipoplexes can change upon interaction with cellular membranes and such changes affect the delivery efficiency. Recently, a correlation between the mechanism of gene release from complexes, the structure, and the physical and chemical parameters of the complexes has been established. Studies aimed at correlating structure and activity of lipoplexes are reviewed herein. This is a fundamental step towards rational design of highly efficient lipid gene vectors.

The role of actin networks in cellular mechanosensing

NASA Astrophysics Data System (ADS)

Azatov, Mikheil

Physical processes play an important role in many biological phenomena, such as wound healing, organ development, and tumor metastasis. During these processes, cells constantly interact with and adapt to their environment by exerting forces to mechanically probe the features of their surroundings and generating appropriate biochemical responses. The mechanisms underlying how cells sense the physical properties of their environment are not well understood. In this thesis, I present my studies to investigate cellular responses to the stiffness and topography of the environment. In order to sense the physical properties of their environment, cells dynamically reorganize the structure of their actin cytoskeleton, a dynamic network of biopolymers, altering the shape and spatial distribution of protein assemblies. Several observations suggest that proteins that crosslink actin filaments may play an important role in cellular mechanosensitivity. Palladin is an actin-crosslinking protein that is found in the lamellar actin network, stress fibers and focal adhesions, cellular structures that are critical for mechanosensing of the physical environment. By virtue of its close interactions with these structures in the cell, palladin may play an important role in cell mechanics. However, the role of actin crosslinkers in general, and palladin in particular, in cellular force generation and mechanosensing is not well known. I have investigated the role of palladin in regulating the plasticity of the actin cytoskeleton and cellular force generation in response to alterations in substrate stiffness. I have shown that the expression levels of palladin modulate the forces exerted by cells and their ability to sense substrate stiffness. Perturbation experiments also suggest that palladin levels in cells altered myosin motor activity. These results suggest that the actin crosslinkers, such as palladin, and myosin motors coordinate for optimal cell function and to prevent aberrant behavior as in cancer metastasis. In addition to stiffness, the local geometry or topography of the surface has been shown to modulate the movement, morphology, and cytoskeletal organization of cells. However, the effect of topography on fluctuations of intracellular structures, which arise from motor driven activity on a viscoelastic actin network are not known. I have used nanofabricated substrates with parallel ridges to show that the cell shape, the actin cytoskeleton and focal adhesions all align along the direction of the ridges, exhibiting a biphasic dependence on the spacing between ridges. I further demonstrated that palladin bands along actin stress fibers undergo a complex diffusive motion with velocities aligned along the direction of ridges. These results provide insight into the mechanisms of cellular mechanosensing of the environment, suggesting a complex interplay between the actin cytoskeleton and cellular adhesions in coordinating cellular response to surface topography. Overall, this work has advanced our understanding of mechanisms that govern cellular responses to their physical environment.

Physiological enzymology: The next frontier in understanding protein structure and function at the cellular level.

PubMed

Lee, Irene; Berdis, Anthony J

2016-01-01

Historically, the study of proteins has relied heavily on characterizing the activity of a single purified protein isolated from other cellular components. This classic approach allowed scientists to unambiguously define the intrinsic kinetic and chemical properties of that protein. The ultimate hope was to extrapolate this information toward understanding how the enzyme or receptor behaves within its native cellular context. These types of detailed in vitro analyses were necessary to reduce the innate complexities of measuring the singular activity and biochemical properties of a specific enzyme without interference from other enzymes and potential competing substrates. However, recent developments in fields encompassing cell biology, molecular imaging, and chemical biology now provide the unique chemical tools and instrumentation to study protein structure, function, and regulation in their native cellular environment. These advancements provide the foundation for a new field, coined physiological enzymology, which quantifies the function and regulation of enzymes and proteins at the cellular level. In this Special Edition, we explore the area of Physiological Enzymology and Protein Function through a series of review articles that focus on the tools and techniques used to measure the cellular activity of proteins inside living cells. This article is part of a Special Issue entitled: Physiological Enzymology and Protein Functions. Copyright © 2015 Elsevier B.V. All rights reserved.

Pressure-actuated cellular structures.

PubMed

Pagitz, M; Lamacchia, E; Hol, J M A M

2012-03-01

Shape changing structures will play an important role in future engineering designs since rigid structures are usually only optimal for a small range of service conditions. Hence, a concept for reliable and energy-efficient morphing structures that possess a large strength to self-weight ratio would be widely applicable. We propose a novel concept for morphing structures that is inspired by the nastic movement of plants. The idea is to connect prismatic cells with tailored pentagonal and/or hexagonal cross sections such that the resulting cellular structure morphs into given target shapes for certain cell pressures. An efficient algorithm for computing equilibrium shapes as well as cross-sectional geometries is presented. The potential of this novel concept is demonstrated by several examples that range from a flagellum like propulsion device to a morphing aircraft wing.

Structure determination and total synthesis of a novel antibacterial substance, AB0022A, produced by a cellular slime mold.

PubMed

Sawada, T; Aono, M; Asakawa, S; Ito, A; Awano, K

2000-09-01

A novel antibacterial substance, AB0022A, was isolated from the cellular slime mold Dictyostelium purpureum K1001. It inhibited the growth of Gram-positive bacteria, and its MICs ranged from 0.39 to 50 microg/ml. Because AB0022A was a highly substituted aromatic compound, we could not determine its structure based on only its physico-chemical and spectral data. We therefore used a dehalogenated derivative from AB0022A and deduced that its structure was 1,9-dihydroxy-3,7-dimethoxy-2-hexanoyl-4,6,8-trichlorodibenzofuran . To confirm this structure, we synthesized the compound having the deduced structure. The synthetic compound was identical to naturally occurring AB0022A.

Periodic Cellular Structure Technology for Shape Memory Alloys

NASA Technical Reports Server (NTRS)

Chen, Edward Y.

2015-01-01

Shape memory alloys are being considered for a wide variety of adaptive components for engine and airframe applications because they can undergo large amounts of strain and then revert to their original shape upon heating or unloading. Transition45 Technologies, Inc., has developed an innovative periodic cellular structure (PCS) technology for shape memory alloys that enables fabrication of complex bulk configurations, such as lattice block structures. These innovative structures are manufactured using an advanced reactive metal casting technology that offers a relatively low cost and established approach for constructing near-net shape aerospace components. Transition45 is continuing to characterize these structures to determine how best to design a PCS to better exploit the use of shape memory alloys in aerospace applications.

A cellular glass substrate solar concentrator

NASA Technical Reports Server (NTRS)

Bedard, R.; Bell, D.

1980-01-01

The design of a second generation point focusing solar concentration is discussed. The design is based on reflective gores fabricated of thin glass mirror bonded continuously to a contoured substrate of cellular glass. The concentrator aperture and structural stiffness was optimized for minimum concentrator cost given the performance requirement of delivering 56 kWth to a 22 cm diameter receiver aperture with a direct normal insolation of 845 watts sq m and an operating wind of 50 kmph. The reflective panel, support structure, drives, foundation and instrumentation and control subsystem designs, optimized for minimum cost, are summarized. The use of cellular glass as a reflective panel substrate material is shown to offer significant weight and cost advantages compared to existing technology materials.

How-to-Do-It: Demonstrating the Effects of Stress on Cellular Membranes.

ERIC Educational Resources Information Center

Vodopich, Darrell S.; Moore, Randy

1989-01-01

Describes two simple procedures allowing students to experiment with living membranes and to relate their results to fundamental membrane structure. Provides instructions for determining the effects of temperature and organic solvent stress on cellular membranes, and spectrophotometric analysis. (RT)

Structural classification of proteins using texture descriptors extracted from the cellular automata image.

PubMed

Kavianpour, Hamidreza; Vasighi, Mahdi

2017-02-01

Nowadays, having knowledge about cellular attributes of proteins has an important role in pharmacy, medical science and molecular biology. These attributes are closely correlated with the function and three-dimensional structure of proteins. Knowledge of protein structural class is used by various methods for better understanding the protein functionality and folding patterns. Computational methods and intelligence systems can have an important role in performing structural classification of proteins. Most of protein sequences are saved in databanks as characters and strings and a numerical representation is essential for applying machine learning methods. In this work, a binary representation of protein sequences is introduced based on reduced amino acids alphabets according to surrounding hydrophobicity index. Many important features which are hidden in these long binary sequences can be clearly displayed through their cellular automata images. The extracted features from these images are used to build a classification model by support vector machine. Comparing to previous studies on the several benchmark datasets, the promising classification rates obtained by tenfold cross-validation imply that the current approach can help in revealing some inherent features deeply hidden in protein sequences and improve the quality of predicting protein structural class.

Cations Form Sequence Selective Motifs within DNA Grooves via a Combination of Cation-Pi and Ion-Dipole/Hydrogen Bond Interactions

PubMed Central

Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

2013-01-01

The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl+) and the polarized first hydration shell waters of divalent cations (Mg2+, Ca2+) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves. PMID:23940752

Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

PubMed

Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

2013-01-01

The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

Towards a Quantum Game of Life

NASA Astrophysics Data System (ADS)

Flitney, Adrian P.; Abbott, Derek

Cellular automata provide a means of obtaining complex behaviour from a simple array of cells and a deterministic transition function. They supply a method of computation that dispenses with the need for manipulation of individual cells and they are computationally universal. Classical cellular automata have proved of great interest to computer scientists but the construction of quantum cellular automata pose particular difficulties. We present a version of John Conway's famous two-dimensional classical cellular automata Life that has some quantum-like features, including interference effects. Some basic structures in the new automata are given and comparisons are made with Conway's game.

Molecular and cellular aspects of rhabdovirus entry.

PubMed

Albertini, Aurélie A V; Baquero, Eduard; Ferlin, Anna; Gaudin, Yves

2012-01-01

Rhabdoviruses enter the cell via the endocytic pathway and subsequently fuse with a cellular membrane within the acidic environment of the endosome. Both receptor recognition and membrane fusion are mediated by a single transmembrane viral glycoprotein (G). Fusion is triggered via a low-pH induced structural rearrangement. G is an atypical fusion protein as there is a pH-dependent equilibrium between its pre- and post-fusion conformations. The elucidation of the atomic structures of these two conformations for the vesicular stomatitis virus (VSV) G has revealed that it is different from the previously characterized class I and class II fusion proteins. In this review, the pre- and post-fusion VSV G structures are presented in detail demonstrating that G combines the features of the class I and class II fusion proteins. In addition to these similarities, these G structures also reveal some particularities that expand our understanding of the working of fusion machineries. Combined with data from recent studies that revealed the cellular aspects of the initial stages of rhabdovirus infection, all these data give an integrated view of the entry pathway of rhabdoviruses into their host cell.

Molecular and Cellular Aspects of Rhabdovirus Entry

PubMed Central

Albertini, Aurélie A. V.; Baquero, Eduard; Ferlin, Anna; Gaudin, Yves

2012-01-01

Rhabdoviruses enter the cell via the endocytic pathway and subsequently fuse with a cellular membrane within the acidic environment of the endosome. Both receptor recognition and membrane fusion are mediated by a single transmembrane viral glycoprotein (G). Fusion is triggered via a low-pH induced structural rearrangement. G is an atypical fusion protein as there is a pH-dependent equilibrium between its pre- and post-fusion conformations. The elucidation of the atomic structures of these two conformations for the vesicular stomatitis virus (VSV) G has revealed that it is different from the previously characterized class I and class II fusion proteins. In this review, the pre- and post-fusion VSV G structures are presented in detail demonstrating that G combines the features of the class I and class II fusion proteins. In addition to these similarities, these G structures also reveal some particularities that expand our understanding of the working of fusion machineries. Combined with data from recent studies that revealed the cellular aspects of the initial stages of rhabdovirus infection, all these data give an integrated view of the entry pathway of rhabdoviruses into their host cell. PMID:22355455

Three-dimensional Sponges with Super Mechanical Stability: Harnessing True Elasticity of Individual Carbon Nanotubes in Macroscopic Architectures

PubMed Central

Dai, Zhaohe; Liu, Luqi; Qi, Xiaoying; Kuang, Jun; Wei, Yueguang; Zhu, Hongwei; Zhang, Zhong

2016-01-01

Efficient assembly of carbon nanotube (CNT) based cellular solids with appropriate structure is the key to fully realize the potential of individual nanotubes in macroscopic architecture. In this work, the macroscopic CNT sponge consisting of randomly interconnected individual carbon nanotubes was grown by CVD, exhibiting a combination of super-elasticity, high strength to weight ratio, fatigue resistance, thermo-mechanical stability and electro-mechanical stability. To deeply understand such extraordinary mechanical performance compared to that of conventional cellular materials and other nanostructured cellular architectures, a thorough study on the response of this CNT-based spongy structure to compression is conducted based on classic elastic theory. The strong inter-tube bonding between neighboring nanotubes is examined, believed to play a critical role in the reversible deformation such as bending and buckling without structural collapse under compression. Based on in-situ scanning electron microscopy observation and nanotube deformation analysis, structural evolution (completely elastic bending-buckling transition) of the carbon nanotubes sponges to deformation is proposed to clarify their mechanical properties and nonlinear electromechanical coupling behavior. PMID:26732143

Synthesis of structurally diverse major groove DNA interstrand crosslinks using three different aldehyde precursors

PubMed Central

Mukherjee, Shivam; Guainazzi, Angelo; Schärer, Orlando D.

2014-01-01

DNA interstrand crosslinks (ICLs) are extremely cytotoxic lesions that block essential cellular processes, such as replication and transcription. Crosslinking agents are widely used in cancer chemotherapy and form an array of structurally diverse ICLs. Despite the clinical success of these agents, resistance of tumors to crosslinking agents, for example, through repair of these lesions by the cellular machinery remains a problem. We have previously reported the synthesis of site-specific ICLs mimicking those formed by nitrogen mustards to facilitate the studies of cellular responses to ICL formation. Here we extend these efforts and report the synthesis of structurally diverse major groove ICLs that induce severe, little or no distortion in the DNA. Our approach employs the incorporation of aldehyde precursors of different lengths into complementary strands and ICL formation using a double reductive amination with a variety of amines. Our studies provide insight into the structure and reactivity parameters of ICL formation by double reductive amination and yield a set of diverse ICLs that will be invaluable for exploring structure–activity relationships in ICL repair. PMID:24782532

A virus or more in (nearly) every cell: ubiquitous networks of virus-host interactions in extreme environments.

PubMed

Munson-McGee, Jacob H; Peng, Shengyun; Dewerff, Samantha; Stepanauskas, Ramunas; Whitaker, Rachel J; Weitz, Joshua S; Young, Mark J

2018-06-01

The application of viral and cellular metagenomics to natural environments has expanded our understanding of the structure, functioning, and diversity of microbial and viral communities. The high diversity of many communities, e.g., soils, surface ocean waters, and animal-associated microbiomes, make it difficult to establish virus-host associations at the single cell (rather than population) level, assign cellular hosts, or determine the extent of viral host range from metagenomics studies alone. Here, we combine single-cell sequencing with environmental metagenomics to characterize the structure of virus-host associations in a Yellowstone National Park (YNP) hot spring microbial community. Leveraging the relatively low diversity of the YNP environment, we are able to overlay evidence at the single-cell level with contextualized viral and cellular community structure. Combining evidence from hexanucelotide analysis, single cell read mapping, network-based analytics, and CRISPR-based inference, we conservatively estimate that >60% of cells contain at least one virus type and a majority of these cells contain two or more virus types. Of the detected virus types, nearly 50% were found in more than 2 cellular clades, indicative of a broad host range. The new lens provided by the combination of metaviromics and single-cell genomics reveals a network of virus-host interactions in extreme environments, provides evidence that extensive virus-host associations are common, and further expands the unseen impact of viruses on cellular life.

Community College Biology Lesson Catalogue.

ERIC Educational Resources Information Center

Herrick, Kathie G.

This catalog contains descriptions of the available biology lessons on PLATO IV, compiled to assist instructors in planning their curricula. Information is provided for 87 lessons in the following areas: experimental tools and techniques; chemical basis of life; cellular structure and function; bioenergetics - enzymes and cellular metabolism;…

Mitochondrial-associated metabolic disorders: foundations, pathologies and recent progress

PubMed Central

2013-01-01

Research in the last decade has revolutionized the way in which we view mitochondria. Mitochondria are no longer viewed solely as cellular powerhouses; rather, mitochondria are now understood to be vibrant, mobile structures, constantly undergoing fusion and fission, and engaging in intimate interactions with other cellular compartments and structures. Findings have implicated mitochondria in a wide variety of cellular processes and molecular interactions, such as calcium buffering, lipid flux, and intracellular signaling. As such, it does not come as a surprise that an increasing number of human pathologies have been associated with functional defects in mitochondria. The difficulty in understanding and treating human pathologies caused by mitochondrial dysfunction arises from the complex relationships between mitochondria and other cellular processes, as well as the genetic background of such diseases. This review attempts to provide a summary of the background knowledge and recent developments in mitochondrial processes relating to mitochondrial-associated metabolic diseases arising from defects or deficiencies in mitochondrial function, as well as insights into current and future avenues for investigation. PMID:24499129

Brushes, cables, and anchors: recent insights into multiscale assembly and mechanics of cellular structural networks.

PubMed

Lele, Tanmay P; Kumar, Sanjay

2007-01-01

The remarkable ability of living cells to sense, process, and respond to mechanical stimuli in their environment depends on the rapid and efficient interconversion of mechanical and chemical energy at specific times and places within the cell. For example, application of force to cells leads to conformational changes in specific mechanosensitive molecules which then trigger cellular signaling cascades that may alter cellular structure, mechanics, and migration and profoundly influence gene expression. Similarly, the sensitivity of cells to mechanical stresses is governed by the composition, architecture, and mechanics of the cellular cytoskeleton and extracellular matrix (ECM), which are in turn driven by molecular-scale forces between the constituent biopolymers. Understanding how these mechanochemical systems coordinate over multiple length and time scales to produce orchestrated cell behaviors represents a fundamental challenge in cell biology. Here, we review recent advances in our understanding of these complex processes in three experimental systems: the assembly of axonal neurofilaments, generation of tensile forces by actomyosin stress fiber bundles, and mechanical control of adhesion assembly.

Therapeutic intervention at cellular quality control systems in Alzheimer's and Parkinson's diseases.

PubMed

Arduino, Daniela M; Esteves, A Raquel; Silva, Diana F F; Martins-Branco, Diogo; Santos, Daniel; Pimentel, Diana F Gomes; Cardoso, Sandra M

2011-01-01

Cellular homeostasis relies on quality control systems so that damaged biologic structures are either repaired or degraded and entirely replaced by newly formed proteins or even organelles. The clearance of dysfunctional cellular structures in long-lived postmitotic cells, like neurons, is essential to eliminate, per example, defective mitochondria, lipofuscin-loaded lysosomes and oxidized proteins. Short-lived proteins are degraded mainly by proteases and proteasomes whether most long-lived proteins and all organelles are digested by autophagy in the lysosomes. Recently, it an interplay was established between the ubiquitin-proteasome system and macroautophagy, so that both degradative mechanisms compensate for each other. In this article we describe each of these clearance systems and their contribution to neuronal quality control. We will highlight some of the findings that provide evidence for the dysfunction of these systems in Alzheimer's and Parkinson's diseases. Ultimately, we provide an outline on potential therapeutic interventions based on the modulation of cellular degradative systems.

Predictive model to describe water migration in cellular solid foods during storage.

PubMed

Voogt, Juliën A; Hirte, Anita; Meinders, Marcel B J

2011-11-01

Water migration in cellular solid foods during storage causes loss of crispness. To improve crispness retention, physical understanding of this process is needed. Mathematical models are suitable tools to gain this physical knowledge. Water migration in cellular solid foods involves migration through both the air cells and the solid matrix. For systems in which the water migration distance is large compared with the cell wall thickness of the solid matrix, the overall water flux through the system is dominated by the flux through the air. For these systems, water migration can be approximated well by a Fickian diffusion model. The effective diffusion coefficient can be expressed in terms of the material properties of the solid matrix (i.e. the density, sorption isotherm and diffusion coefficient of water in the solid matrix) and the morphological properties of the cellular structure (i.e. water vapour permeability and volume fraction of the solid matrix). The water vapour permeability is estimated from finite element method modelling using a simplified model for the cellular structure. It is shown that experimentally observed dynamical water profiles of bread rolls that differ in crust permeability are predicted well by the Fickian diffusion model. Copyright © 2011 Society of Chemical Industry.

The Safety Dance: Biophysics of Membrane Protein Folding and Misfolding in a Cellular Context

PubMed Central

Schlebach, Jonathan P.; Sanders, Charles R.

2015-01-01

Most biological processes require the production and degradation of proteins, a task that weighs heavily on the cell. Mutations that compromise the conformational stability of proteins place both specific and general burdens on cellular protein homeostasis (proteostasis) in ways that contribute to numerous diseases. Efforts to elucidate the chain of molecular events responsible for diseases of protein folding address one of the foremost challenges in biomedical science. However, relatively little is known about the processes by which mutations prompt the misfolding of α-helical membrane proteins, which rely on an intricate network of cellular machinery to acquire and maintain their functional structures within cellular membranes. In this review, we summarize the current understanding of the physical principles that guide membrane protein biogenesis and folding in the context of mammalian cells. Additionally, we explore how pathogenic mutations that influence biogenesis may differ from those that disrupt folding and assembly, as well as how this may relate to disease mechanisms and therapeutic intervention. These perspectives indicate an imperative for the use of information from structural, cellular, and biochemical studies of membrane proteins in the design of novel therapeutics and in personalized medicine. PMID:25420508

Maximum entropy and equations of state for random cellular structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivier, N.

Random, space-filling cellular structures (biological tissues, metallurgical grain aggregates, foams, etc.) are investigated. Maximum entropy inference under a few constraints yields structural equations of state, relating the size of cells to their topological shape. These relations are known empirically as Lewis's law in Botany, or Desch's relation in Metallurgy. Here, the functional form of the constraints is now known as a priori, and one takes advantage of this arbitrariness to increase the entropy further. The resulting structural equations of state are independent of priors, they are measurable experimentally and constitute therefore a direct test for the applicability of MaxEnt inferencemore » (given that the structure is in statistical equilibrium, a fact which can be tested by another simple relation (Aboav's law)). 23 refs., 2 figs., 1 tab.« less

Sulfolobus turreted icosahedral virus c92 protein responsible for the formation of pyramid-like cellular lysis structures.

PubMed

Snyder, Jamie C; Brumfield, Susan K; Peng, Nan; She, Qunxin; Young, Mark J

2011-07-01

Host cells infected by Sulfolobus turreted icosahedral virus (STIV) have been shown to produce unusual pyramid-like structures on the cell surface. These structures represent a virus-induced lysis mechanism that is present in Archaea and appears to be distinct from the holin/endolysin system described for DNA bacteriophages. This study investigated the STIV gene products required for pyramid formation in its host Sulfolobus solfataricus. Overexpression of STIV open reading frame (ORF) c92 in S. solfataricus alone is sufficient to produce the pyramid-like lysis structures in cells. Gene disruption of c92 within STIV demonstrates that c92 is an essential protein for virus replication. Immunolocalization of c92 shows that the protein is localized to the cellular membranes forming the pyramid-like structures.

Processing Characteristics and Properties of the Cellular Products Made by Using Special Foaming Agents

NASA Astrophysics Data System (ADS)

Garbacz, Tomasz; Dulebova, Ludmila

2012-12-01

The paper describes the manufacturing process of extruded products by the cellular extrusion method, and presents specifications of the blowing agents used in the extrusion process as well as process conditions. The process of cellular extrusion of thermoplastic materials is aimed at obtaining cellular shapes and coats with reduced density, presenting no hollows on the surface of extruder product and displaying minimal contraction under concurrent maintenance of properties similar to properties of products extruded by means of the conventional method. In order to obtain cellular structure, the properties of extruded product are modified by applying suitable plastic or inserting auxiliary agents.

Force-activatable coating enables high-resolution cellular force imaging directly on regular cell culture surfaces.

PubMed

Sarkar, Anwesha; Zhao, Yuanchang; Wang, Yongliang; Wang, Xuefeng

2018-06-25

Integrin-transmitted cellular forces are crucial mechanical signals regulating a vast range of cell functions. Although various methods have been developed to visualize and quantify cellular forces at the cell-matrix interface, a method with high performance and low technical barrier is still in demand. Here we developed a force-activatable coating (FAC), which can be simply coated on regular cell culture apparatus' surfaces by physical adsorption, and turn these surfaces to force reporting platforms that enable cellular force mapping directly by fluorescence imaging. The FAC molecule consists of an adhesive domain for surface coating and a force-reporting domain which can be activated to fluoresce by integrin molecular tension. The tension threshold required for FAC activation is tunable in 10-60 piconewton (pN), allowing the selective imaging of cellular force contributed by integrin tension at different force levels. We tested the performance of two FACs with tension thresholds of 12 and 54 pN (nominal values), respectively, on both glass and polystyrene surfaces. Cellular forces were successfully mapped by fluorescence imaging on all the surfaces. FAC-coated surfaces also enable co-imaging of cellular forces and cell structures in both live cells and immunostained cells, therefore opening a new avenue for the study of the interplay of force and structure. We demonstrated the co-imaging of integrin tension and talin clustering in live cells, and concluded that talin clustering always occurs before the generation of integrin tension above 54 pN, reinforcing the notion that talin is an important adaptor protein for integrin tension transmission. Overall, FAC provides a highly convenient approach that is accessible to general biological laboratories for the study of cellular forces with high sensitivity and resolution, thus holding the potential to greatly boost the research of cell mechanobiology.

Intracellular cargo delivery by virus capsid protein-based vehicles: From nano to micro.

PubMed

Gao, Ding; Lin, Xiu-Ping; Zhang, Zhi-Ping; Li, Wei; Men, Dong; Zhang, Xian-En; Cui, Zong-Qiang

2016-02-01

Cellular delivery is an important concern for the efficiency of medicines and sensors for disease diagnoses and therapy. However, this task is quite challenging. Self-assembly virus capsid proteins might be developed as building blocks for multifunctional cellular delivery vehicles. In this work, we found that SV40 VP1 (Simian virus 40 major capsid protein) could function as a new cell-penetrating protein. The VP1 protein could carry foreign proteins into cells in a pentameric structure. A double color structure, with red QDs (Quantum dots) encapsulated by viral capsids fused with EGFP, was created for imaging cargo delivery and release from viral capsids. The viral capsids encapsulating QDs were further used for cellular delivery of micron-sized iron oxide particles (MPIOs). MPIOs were efficiently delivered into live cells and controlled by a magnetic field. Therefore, our study built virus-based cellular delivery systems for different sizes of cargos: protein molecules, nanoparticles, and micron-sized particles. Much research is being done to investigate methods for efficient and specific cellular delivery of drugs, proteins or genetic material. In this article, the authors describe their approach in using self-assembly virus capsid proteins SV40 VP1 (Simian virus 40 major capsid protein). The cell-penetrating behavior provided excellent cellular delivery and should give a new method for biomedical applications. Copyright © 2015 Elsevier Inc. All rights reserved.

The β-Arrestins: Multifunctional Regulators of G Protein-coupled Receptors*

PubMed Central

Smith, Jeffrey S.; Rajagopal, Sudarshan

2016-01-01

The β-arrestins (βarrs) are versatile, multifunctional adapter proteins that are best known for their ability to desensitize G protein-coupled receptors (GPCRs), but also regulate a diverse array of cellular functions. To signal in such a complex fashion, βarrs adopt multiple conformations and are regulated at multiple levels to differentially activate downstream pathways. Recent structural studies have demonstrated that βarrs have a conserved structure and activation mechanism, with plasticity of their structural fold, allowing them to adopt a wide array of conformations. Novel roles for βarrs continue to be identified, demonstrating the importance of these dynamic regulators of cellular signaling. PMID:26984408

Biomolecular interactions modulate macromolecular structure and dynamics in atomistic model of a bacterial cytoplasm

PubMed Central

Yu, Isseki; Mori, Takaharu; Ando, Tadashi; Harada, Ryuhei; Jung, Jaewoon; Sugita, Yuji; Feig, Michael

2016-01-01

Biological macromolecules function in highly crowded cellular environments. The structure and dynamics of proteins and nucleic acids are well characterized in vitro, but in vivo crowding effects remain unclear. Using molecular dynamics simulations of a comprehensive atomistic model cytoplasm we found that protein-protein interactions may destabilize native protein structures, whereas metabolite interactions may induce more compact states due to electrostatic screening. Protein-protein interactions also resulted in significant variations in reduced macromolecular diffusion under crowded conditions, while metabolites exhibited significant two-dimensional surface diffusion and altered protein-ligand binding that may reduce the effective concentration of metabolites and ligands in vivo. Metabolic enzymes showed weak non-specific association in cellular environments attributed to solvation and entropic effects. These effects are expected to have broad implications for the in vivo functioning of biomolecules. This work is a first step towards physically realistic in silico whole-cell models that connect molecular with cellular biology. DOI: http://dx.doi.org/10.7554/eLife.19274.001 PMID:27801646

VHL negatively regulates SARS coronavirus replication by modulating nsp16 ubiquitination and stability.

PubMed

Yu, Xiao; Chen, Shuliang; Hou, Panpan; Wang, Min; Chen, Yu; Guo, Deyin

2015-04-03

Eukaryotic cellular and most viral RNAs carry a 5'-terminal cap structure, a 5'-5' triphosphate linkage between the 5' end of the RNA and a guanosine nucleotide (cap-0). SARS coronavirus (SARS-CoV) nonstructural protein nsp16 functions as a methyltransferase, to methylate mRNA cap-0 structure at the ribose 2'-O position of the first nucleotide to form cap-1 structures. However, whether there is interplay between nsp16 and host proteins was not yet clear. In this report, we identified several potential cellular nsp16-interacting proteins from a human thymus cDNA library by yeast two-hybrid screening. VHL, one of these proteins, was proven to interact with nsp16 both in vitro and in vivo. Further studies showed that VHL can inhibit SARS-CoV replication by regulating nsp16 ubiquitination and promoting its degradation. Our results have revealed the role of cellular VHL in the regulation of SARS-CoV replication. Copyright © 2015 Elsevier Inc. All rights reserved.

Atrial fibrillation in the elderly: the potential contribution of reactive oxygen species

PubMed Central

Schillinger, Kurt J.; Patel, Vickas V.

2012-01-01

Atrial fibrillation (AF) is the most commonly encountered cardiac arrhythmia, and is a significant source of healthcare expenditures throughout the world. It is an arrhythmia with a very clearly defined predisposition for individuals of advanced age, and this fact has led to intense study of the mechanistic links between aging and AF. By promoting oxidative damage to multiple subcellular and cellular structures, reactive oxygen species (ROS) have been shown to induce the intra- and extra-cellular changes necessary to promote the pathogenesis of AF. In addition, the generation and accumulation of ROS have been intimately linked to the cellular processes which underlie aging. This review begins with an overview of AF pathophysiology, and introduces the critical structures which, when damaged, predispose an otherwise healthy atrium to AF. The available evidence that ROS can lead to damage of these critical structures is then reviewed. Finally, the evidence linking the process of aging to the pathogenesis of AF is discussed. PMID:23341843

Impact Test and Simulation of Energy Absorbing Concepts for Earth Entry Vehicles

NASA Technical Reports Server (NTRS)

Billings, Marcus D.; Fasanella, Edwin L.; Kellas, Sotiris

2001-01-01

Nonlinear dynamic finite element simulations have been performed to aid in the design of an energy absorbing concept for a highly reliable passive Earth Entry Vehicle (EEV) that will directly impact the Earth without a parachute. EEV's are designed to return materials from asteroids, comets, or planets for laboratory analysis on Earth. The EEV concept uses an energy absorbing cellular structure designed to contain and limit the acceleration of space exploration samples during Earth impact. The spherical shaped cellular structure is composed of solid hexagonal and pentagonal foam-filled cells with hybrid graphite- epoxy/Kevlar cell walls. Space samples fit inside a smaller sphere at the center of the EEV's cellular structure. Comparisons of analytical predictions using MSC,Dytran with test results obtained from impact tests performed at NASA Langley Research Center were made for three impact velocities ranging from 32 to 40 m/s. Acceleration and deformation results compared well with the test results. These finite element models will be useful for parametric studies of off-nominal impact conditions.

The Structure of Sucrose Synthase-1 from Arabidopsis thaliana and Its Functional Implications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Yi; Anderson, Spencer; Zhang, Yanfeng

2014-10-02

Sucrose transport is the central system for the allocation of carbon resources in vascular plants. During growth and development, plants control carbon distribution by coordinating sites of sucrose synthesis and cleavage in different plant organs and different cellular locations. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, provides a direct and reversible means to regulate sucrose flux. Depending on the metabolic environment, sucrose synthase alters its cellular location to participate in cellulose, callose, and starch biosynthesis through its interactions with membranes, organelles, and cytoskeletal actin. The x-ray crystal structure of sucrose synthase isoform 1 from Arabidopsis thaliana (AtSus1) hasmore » been determined as a complex with UDP-glucose and as a complex with UDP and fructose, at 2.8- and 2.85-{angstrom} resolutions, respectively. The AtSus1 structure provides insights into sucrose catalysis and cleavage, as well as the regulation of sucrose synthase and its interactions with cellular targets.« less

Cellular and multicellular form and function.

PubMed

Liu, Wendy F; Chen, Christopher S

2007-11-10

Engineering artificial tissue constructs requires the appropriate spatial arrangement of cells within scaffolds. The introduction of microengineering tools to the biological community has provided a valuable set of techniques to manipulate the cellular environment, and to examine how cell structure affects cellular function. Using micropatterning techniques, investigators have found that the geometric presentation of cell-matrix adhesions are important regulators of various cell behaviors including cell growth, proliferation, differentiation, polarity and migration. Furthermore, the presence of neighboring cells in multicellular aggregates has a significant impact on the proliferative and differentiated state of cells. Using microengineering tools, it will now be possible to manipulate the various environmental factors for practical applications such as engineering tissue constructs with greater control over the physical structure and spatial arrangement of cells within their surrounding microenvironment.

Electron cryo-tomography captures macromolecular complexes in native environments.

PubMed

Baker, Lindsay A; Grange, Michael; Grünewald, Kay

2017-10-01

Transmission electron microscopy has a long history in cellular biology. Fixed and stained samples have been used for cellular imaging for over 50 years, but suffer from sample preparation induced artifacts. Electron cryo-tomography (cryoET) instead uses frozen-hydrated samples, without chemical modification, to determine the structure of macromolecular complexes in their native environment. Recent developments in electron microscopes and associated technologies have greatly expanded our ability to visualize cellular features and determine the structures of macromolecular complexes in situ. This review highlights the technological improvements and the new areas of biology these advances have made accessible. We discuss the potential of cryoET to reveal novel and significant biological information on the nanometer or subnanometer scale, and directions for further work. Copyright © 2017. Published by Elsevier Ltd.

Papillomavirus E6 oncoproteins

PubMed Central

Vande Pol, Scott B.; Klingelhutz, Aloysius J.

2013-01-01

Papillomaviruses induce benign and malignant epithelial tumors, and the viral E6 oncoprotein is essential for full transformation. E6 contributes to transformation by associating with cellular proteins, docking on specific acidic LXXLL peptide motifs found on the associated cellular proteins. This review examines insights from recent studies of human and animal E6 proteins that determine the three-dimensional structure of E6 when bound to acidic LXXLL peptides. The structure of E6 is related to recent advances in the purification and identification of E6 associated protein complexes. These E6 protein-complexes, together with other proteins that bind to E6, alter a broad array of biological outcomes including modulation of cell survival, cellular transcription, host cell differentiation, growth factor dependence, DNA damage responses, and cell cycle progression. PMID:23711382

Emerging Biomimetic Applications of DNA Nanotechnology.

PubMed

Shen, Haijing; Wang, Yingqian; Wang, Jie; Li, Zhihao; Yuan, Quan

2018-06-25

Re-engineering cellular components and biological processes has received great interest and promised compelling advantages in applications ranging from basic cell biology to biomedicine. With the advent of DNA nanotechnology, the programmable self-assembly ability makes DNA an appealing candidate for rational design of artificial components with different structures and functions. This Forum Article summarizes recent developments of DNA nanotechnology in mimicking the structures and functions of existing cellular components. We highlight key successes in the achievements of DNA-based biomimetic membrane proteins and discuss the assembly behavior of these artificial proteins. Then, we focus on the construction of higher-order structures by DNA nanotechnology to recreate cell-like structures. Finally, we explore the current challenges and speculate on future directions of DNA nanotechnology in biomimetics.

Structural, biological and biophysical properties of glycated and glycoxidized phosphatidylethanolamines

PubMed Central

Annibal, Andrea; Riemer, Thomas; Jovanovic, Olga; Westphal, Dennis; Griesser, Eva; Pohl, Elena E.; Schiller, Jürgen; Hoffmann, Ralf; Fedorova, Maria

2018-01-01

Glycation and glycoxidation of proteins and peptides have been intensively studied and are considered as reliable diagnostic biomarkers of hyperglycemia and early stages of type II diabetes. However, glucose can also react with primary amino groups present in other cellular components, such as aminophospholipids (aminoPLs). Although it is proposed that glycated aminoPLs can induce many cellular responses and contribute to the development and progression of diabetes, the routes of their formation and their biological roles are only partially revealed. The same is true for the influence of glucose-derived modifications on the biophysical properties of PLs. Here we studied structural, signaling, and biophysical properties of glycated and glycoxidized phosphatidylethanolamines (PEs). By combining high resolution mass spectrometry and nuclear magnetic resonance spectroscopy it was possible to deduce the structures of several intermediates indicating an oxidative cleavage of the Amadori product yielding glycoxidized PEs including advanced glycation end products, such as carboxyethyl- and carboxymethyl-ethanolamines. The pro-oxidative role of glycated PEs was demonstrated and further associated with several cellular responses including activation of NFκB signaling pathways. Label free proteomics indicated significant alterations in proteins regulating cellular metabolisms. Finally, the biophysical properties of PL membranes changed significantly upon PE glycation, such as melting temperature (Tm), membrane surface charge, and ion transport across the phospholipid bilayer. PMID:27012418

Joining and Assembly of Bulk Metallic Glass Composites Through Capacitive Discharge

NASA Technical Reports Server (NTRS)

Hofmann, Douglas C.; Roberts, Scott; Kozachkov, Henry; Demetriou, Marios D.; Schramm, Joseph P.; Johnson, William L.

2012-01-01

Bulk metallic glasses (BMGs), a class of amorphous metals defined as having a thickness greater than 1 mm, are being broadly investigated by NASA for use in spacecraft hardware. Their unique properties, attained from their non-crystalline structure, motivate several game-changing aerospace applications. BMGs have low melting temperatures so they can be cheaply and repeatedly cast into complex net shapes, such as mirrors or electronic casings. They are extremely strong and wear-resistant, which motivates their use in gears and bearings. Amorphous metal coatings are hard, corrosion-resistant, and have high reflectivity. BMG composites, reinforced with soft second phases, can be fabricated into energy-absorbing cellular panels for orbital debris shielding. One limitation of BMG materials is their inability to be welded, bonded, brazed, or fastened in a convenient method to form larger structures. Cellular structures (which can be classified as trusses, foams, honeycombs, egg boxes, etc.) are useful for many NASA, commercial, and military aerospace applications, including low-density paneling and shields. Although conventional cellular structures exhibit high specific strength, their porous structures make them challenging to fabricate. In particular, metal cellular structures are extremely difficult to fabricate due to their high processing temperatures. Aluminum honeycomb sandwich panels, for example, are used widely as spacecraft shields due to their low density and ease of fabrication, but suffer from low strength. A desirable metal cellular structure is one with high strength, combined with low density and simple fabrication. The thermoplastic joining process described here allows for the fabrication of monolithic BMG truss-like structures that are 90% porous and have no heat-affected zone, weld, bond, or braze. This is accomplished by welding the nodes of stacked BMG composite panels using a localized capacitor discharge, forming a single monolithic structure. This removes many complicated and costly fabrication steps. Moreover, the cellular structures detailed in this work are among the highest- strength and most energy-absorbent materials known. This implies that a fabricated structure made from these materials would have unequaled mechanical properties compared to other metal foams or trusses. The process works by taking advantage of the electrical properties of the matrix material in the metal-matrix composite, which in this case is a metallic glass. Due to the random nanoscale arrangement of atoms (without any grain boundaries), the matrix glass exhibits a near-constant electrical resistivity as a function of temperature. By placing the composite panels between two copper electrode plates and discharging a capacitor, the entire matrix of the panel can be heated to approximately 700 C in 10 milliseconds, which is above the alloy s solidus but below the liquidus. By designing the geometry of the panels into the shape of an egg box, the electrical discharge localizes only in the tips of each pyramidal cell. By applying a forging load during discharge, the nodes of the panels can be fused together into a single piece, which then dissipates heat through radiation back into a glassy state. This means that two panels can be metallurgically fused into one panel with no heat-affected zone, creating a seamless connection between panels. During the process, the soft metal particles (dendrites) that are uniformly distributed in the glassy matrix to increase the toughness are completely unaffected by the thermoplastic joining. The novelty is that a truss (or foam-like) structure can be formed with excellent energy- absorbing capabilities without the need for machining. The technique allows for large-scale fabrication of panels, well-suited for spacecraft shields or military vehicle door panels. Crystalline metal cellular structures cannot be fabricated using the thermoplastic joining technique described here. If metal panels were te assembled into a cellular structure, they would either have to be welded, brazed, bonded, or fastened together, creating a weak spot in the structure at each connection. Welded parts require a welding material to be added to the joint and exhibit a soft and weak heat-affected zone. Brazing and bonding do not form a metallurgical joint and thus exhibit low strengths, especially when the panels are pulled apart and fasteners require high-stress-concentration holes to be drilled. No equivalent rapid heating method exists for assembling metal panels together into cellular structures, and thus, those parts must be foamed, machined, or investment cast if they are to form a monolithic structure. If the crystalline panels were to be joined using capacitive discharge, as with a spot welder, their bond would be very weak, and the panels would have to be extremely thin. In contrast, the strength of joined BMG parts has been demonstrated to have strength comparable to the parent material. This technique opens up the possibility of using large-scale BMG hardware in spacecraft, military, or commercial applications.

Membrane Microdomain Structures of Liposomes and Their Contribution to the Cellular Uptake Efficiency into HeLa Cells.

PubMed

Onuki, Yoshinori; Obata, Yasuko; Kawano, Kumi; Sano, Hiromu; Matsumoto, Reina; Hayashi, Yoshihiro; Takayama, Kozo

2016-02-01

The purpose of this study is to obtain a comprehensive relationship between membrane microdomain structures of liposomes and their cellular uptake efficiency. Model liposomes consisting of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)/1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC)/cholesterol (Ch) were prepared with various lipid compositions. To detect distinct membrane microdomains in the liposomes, fluorescence-quenching assays were performed at temperatures ranging from 25 to 60 °C using 1,6-diphenyl-1,3,5-hexatriene-labeled liposomes and (2,2,6,6-tetramethylpiperidin-1-yl)oxyl. From the data analysis using the response surface method, we gained a better understanding of the conditions for forming distinct domains (Lo, Ld, and gel phase membranes) as a function of lipid composition. We further performed self-organizing maps (SOM) clustering to simplify the complicated behavior of the domain formation to obtain its essence. As a result, DPPC/DOPC/Ch liposomes in any lipid composition were integrated into five distinct clusters in terms of similarity of the domain structure. In addition, the findings from synchrotron small-angle X-ray scattering analysis offered further insight into the domain structures. As a last phase of this study, an in vitro cellular uptake study using HeLa cells was conducted using SOM clusters' liposomes with/without PEGylation. As a consequence of this study, higher cellular uptake was observed from liposomes having Ch-rich ordered domains.

Nanobodies and recombinant binders in cell biology

PubMed Central

Helma, Jonas; Cardoso, M. Cristina; Muyldermans, Serge

2015-01-01

Antibodies are key reagents to investigate cellular processes. The development of recombinant antibodies and binders derived from natural protein scaffolds has expanded traditional applications, such as immunofluorescence, binding arrays, and immunoprecipitation. In addition, their small size and high stability in ectopic environments have enabled their use in all areas of cell research, including structural biology, advanced microscopy, and intracellular expression. Understanding these novel reagents as genetic modules that can be integrated into cellular pathways opens up a broad experimental spectrum to monitor and manipulate cellular processes. PMID:26056137

Comparison of structural, architectural and mechanical aspects of cellular and acellular bone in two teleost fish.

PubMed

Cohen, Liat; Dean, Mason; Shipov, Anna; Atkins, Ayelet; Monsonego-Ornan, Efrat; Shahar, Ron

2012-06-01

The histological diversity of the skeletal tissues of fishes is impressive compared with that of other vertebrate groups, yet our understanding of the functional consequences of this diversity is limited. In particular, although it has been known since the mid-1800s that a large number of fish species possess acellular bones, the mechanical advantages and consequences of this structural characteristic - and therefore the nature of the evolution of this feature - remain unclear. Although several studies have examined the material properties of fish bone, these have used a variety of techniques and there have been no direct contrasts of acellular and cellular bone. We report on a comparison of the structural and mechanical properties of the ribs and opercula between two freshwater fish - the common carp Cyprinus carpio (a fish with cellular bone) and the tilapia Oreochromis aureus (a fish with acellular bone). We used light microscopy to show that the bones in both fish species exhibit poor blood supply and possess discrete tissue zones, with visible layering suggesting differences in the underlying collagen architecture. We performed identical micromechanical testing protocols on samples of the two bone types to determine the mechanical properties of the bone material of opercula and ribs. Our data support the consensus of literature values, indicating that Young's moduli of cellular and acellular bones are in the same range, and lower than Young's moduli of the bones of mammals and birds. Despite these similarities in mechanical properties between the bone tissues of the fish species tested here, cellular bone had significantly lower mineral content than acellular bone; furthermore, the percentage ash content and bone mineral density values (derived from micro-CT scans) show that the bone of these fishes is less mineralized than amniote bone. Although we cannot generalize from our data to the numerous remaining teleost species, the results presented here suggest that while cellular and acellular fish bone may perform similarly from a mechanical standpoint, there are previously unappreciated differences in the structure and composition of these bone types.

Fundamentals of diffusion MRI physics.

PubMed

Kiselev, Valerij G

2017-03-01

Diffusion MRI is commonly considered the "engine" for probing the cellular structure of living biological tissues. The difficulty of this task is threefold. First, in structurally heterogeneous media, diffusion is related to structure in quite a complicated way. The challenge of finding diffusion metrics for a given structure is equivalent to other problems in physics that have been known for over a century. Second, in most cases the MRI signal is related to diffusion in an indirect way dependent on the measurement technique used. Third, finding the cellular structure given the MRI signal is an ill-posed inverse problem. This paper reviews well-established knowledge that forms the basis for responding to the first two challenges. The inverse problem is briefly discussed and the reader is warned about a number of pitfalls on the way. Copyright © 2017 John Wiley & Sons, Ltd.

Compression deformation behavior of Ti-6Al-4V alloy with cellular structures fabricated by electron beam melting.

PubMed

Cheng, X Y; Li, S J; Murr, L E; Zhang, Z B; Hao, Y L; Yang, R; Medina, F; Wicker, R B

2012-12-01

Ti-6Al-4V alloy with two kinds of open cellular structures of stochastic foam and reticulated mesh was fabricated by additive manufacturing (AM) using electron beam melting (EBM), and microstructure and mechanical properties of these samples with high porosity in the range of 62%∼92% were investigated. Optical observations found that the cell struts and ligaments consist of primary α' martensite. These cellular structures have comparable compressive strength (4∼113 MPa) and elastic modulus (0.2∼6.3 GPa) to those of trabecular and cortical bone. The regular mesh structures exhibit higher specific strength than other reported metallic foams under the condition of identical specific stiffness. During the compression, these EBM samples have a brittle response and undergo catastrophic failure after forming crush band at their peak loading. These bands have identical angle of ∼45° with compression axis for the regular reticulated meshes and such failure phenomenon was explained by considering the cell structure. Relative strength and density follow a linear relation as described by the well-known Gibson-Ashby model but its exponential factor is ∼2.2, which is relative higher than the idea value of 1.5 derived from the model. Copyright © 2012 Elsevier Ltd. All rights reserved.

Cellular structure of the healthy and keratoconic human cornea imaged in-vivo with sub-micrometer axial resolution OCT(Conference Presentation)

NASA Astrophysics Data System (ADS)

Bizheva, Kostadinka; Tan, Bingyao; Mason, Erik; Carter, Kirsten; Haines, Lacey; Sorbara, Luigina

2017-02-01

Keratoconus causes progressive morphological changes in the corneal epithelium (EPI), Bowman's membrane (BM) and anterior stroma. However, it is still not well understood if KC originates in the corneal epithelium and propagates to the anterior stroma through disruptions of the BM, or vice versa. In this study we used a sub-micrometer axial resolution OCT system to image in-vivo the cellular structure of the EPI layer and the fibrous structure of the BM and the anterior stroma in mild to advanced keratoconics, as well as healthy subjects. The imaging study was approved by the University of Waterloo Human Research Ethics Committee. The OCT system operates in the 800 nm spectral region at 34 kHz image acquisition rate and provides 0.95 um axial and < 2 um lateral resolution in corneal tissue, which is sufficient to visualize the cellular structure of the corneal epithelium and the fibrous structure of the BM. In some subjects, localized thinning and thickening of the EPI layer was observed, while there was no visible damage to the BM or anterior stroma. In other subjects, localized breakage of the stromal collagen fibrils was observed with no significant morphological changes of the corneal EPI.

Elementary Mode Analysis: A Useful Metabolic Pathway Analysis Tool for Characterizing Cellular Metabolism

PubMed Central

Trinh, Cong T.; Wlaschin, Aaron; Srienc, Friedrich

2010-01-01

Elementary Mode Analysis is a useful Metabolic Pathway Analysis tool to identify the structure of a metabolic network that links the cellular phenotype to the corresponding genotype. The analysis can decompose the intricate metabolic network comprised of highly interconnected reactions into uniquely organized pathways. These pathways consisting of a minimal set of enzymes that can support steady state operation of cellular metabolism represent independent cellular physiological states. Such pathway definition provides a rigorous basis to systematically characterize cellular phenotypes, metabolic network regulation, robustness, and fragility that facilitate understanding of cell physiology and implementation of metabolic engineering strategies. This mini-review aims to overview the development and application of elementary mode analysis as a metabolic pathway analysis tool in studying cell physiology and as a basis of metabolic engineering. PMID:19015845

Dynamic shaping of cellular membranes by phospholipids and membrane-deforming proteins.

PubMed

Suetsugu, Shiro; Kurisu, Shusaku; Takenawa, Tadaomi

2014-10-01

All cellular compartments are separated from the external environment by a membrane, which consists of a lipid bilayer. Subcellular structures, including clathrin-coated pits, caveolae, filopodia, lamellipodia, podosomes, and other intracellular membrane systems, are molded into their specific submicron-scale shapes through various mechanisms. Cells construct their micro-structures on plasma membrane and execute vital functions for life, such as cell migration, cell division, endocytosis, exocytosis, and cytoskeletal regulation. The plasma membrane, rich in anionic phospholipids, utilizes the electrostatic nature of the lipids, specifically the phosphoinositides, to form interactions with cytosolic proteins. These cytosolic proteins have three modes of interaction: 1) electrostatic interaction through unstructured polycationic regions, 2) through structured phosphoinositide-specific binding domains, and 3) through structured domains that bind the membrane without specificity for particular phospholipid. Among the structured domains, there are several that have membrane-deforming activity, which is essential for the formation of concave or convex membrane curvature. These domains include the amphipathic helix, which deforms the membrane by hemi-insertion of the helix with both hydrophobic and electrostatic interactions, and/or the BAR domain superfamily, known to use their positively charged, curved structural surface to deform membranes. Below the membrane, actin filaments support the micro-structures through interactions with several BAR proteins as well as other scaffold proteins, resulting in outward and inward membrane micro-structure formation. Here, we describe the characteristics of phospholipids, and the mechanisms utilized by phosphoinositides to regulate cellular events. We then summarize the precise mechanisms underlying the construction of membrane micro-structures and their involvements in physiological and pathological processes. Copyright © 2014 the American Physiological Society.

New structural and functional defects in polyphosphate deficient bacteria: a cellular and proteomic study.

PubMed

Varela, Cristian; Mauriaca, Cecilia; Paradela, Alberto; Albar, Juan P; Jerez, Carlos A; Chávez, Francisco P

2010-01-12

Inorganic polyphosphate (polyP), a polymer of tens or hundreds of phosphate residues linked by ATP-like bonds, is found in all organisms and performs a wide variety of functions. PolyP is synthesized in bacterial cells by the actions of polyphosphate kinases (PPK1 and PPK2) and degraded by exopolyphosphatase (PPX). Bacterial cells with polyP deficiencies due to knocking out the ppk1 gene are affected in many structural and important cellular functions such as motility, quorum sensing, biofilm formation and virulence among others. The cause of this pleiotropy is not entirely understood. The overexpression of exopolyphosphatase in bacteria mimicked some pleitropic defects found in ppk1 mutants. By using this approach we found new structural and functional defects in the polyP-accumulating bacteria Pseudomonas sp. B4, which are most likely due to differences in the polyP-removal strategy. Colony morphology phenotype, lipopolysaccharide (LPS) structure changes and cellular division malfunction were observed. Finally, we used comparative proteomics in order to elucidate the cellular adjustments that occurred during polyP deficiency in this bacterium and found some clues that helped to understand the structural and functional defects observed. The results obtained suggest that during polyP deficiency energy metabolism and particularly nucleoside triphosphate (NTP) formation were affected and that bacterial cells overcame this problem by increasing the flux of energy-generating metabolic pathways such as tricarboxilic acid (TCA) cycle, beta-oxidation and oxidative phosphorylation and by reducing energy-consuming ones such as active transporters and amino acid biosynthesis. Furthermore, our results suggest that a general stress response also took place in the cell during polyP deficiency.

Laser induced hierarchical calcium phosphate structures.

PubMed

Kurella, Anil; Dahotre, Narendra B

2006-11-01

The surface properties of biomedical implant materials control the dynamic interactions at tissue-implant interfaces. At such interfaces, if the nanoscale features influence protein interactions, those of the microscale and mesoscale aid cell orientation and provide tissue integration, respectively. It seems imperative that the synthetic materials expected to replace natural hard tissues are engineered to mimic the complexity of their hierarchical assembly. However, the current surface engineering approaches are single scaled. It is demonstrated that using laser surface engineering a controlled multiscale surface can be synthesized for bioactive functions. A systematic organization of bioactive calcium phosphate coating with multiphase composition on Ti-alloy substrate ranging from nano- to mesoscale has been achieved by effectively controlling the thermo physical interactions during laser processing. The morphology of the coating consisted of a periodic arrangement of Ti-rich and Ca-P-deficient star-like phases uniformly distributed inside a Ca-P-rich self-assembled cellular structure with the presence of CaO, alpha-tricalcium phosphate, CaTiO(3), TiO(2) and Ti phase in the coating matrix. The cellular structures ranged in diameter from 2.5 microm to 10 microm as an assembly of cuboid shaped particles of dimensions of approximately 200 nm x 1 microm. The multiscale texture also included nanoscale particles that are the precursors for many of these phases. The rapid cooling associated with the laser processing resulted in formation, organization and controlling dimensions of the Ca-P-rich glassy phase into a micron scale cellular morphology and submicron scale clusters of CaTiO(3) phase inside the cellular structures. The self-assembly of the coating into multiscale structure was influenced by chemical and physical interactions among the multiphases that evolved during laser processing.

Plate-impact loading of cellular structures formed by selective laser melting

NASA Astrophysics Data System (ADS)

Winter, R. E.; Cotton, M.; Harris, E. J.; Maw, J. R.; Chapman, D. J.; Eakins, D. E.; McShane, G.

2014-03-01

Porous materials are of great interest because of improved energy absorption over their solid counterparts. Their properties, however, have been difficult to optimize. Additive manufacturing has emerged as a potential technique to closely define the structure and properties of porous components, i.e. density, strut width and pore size; however, the behaviour of these materials at very high impact energies remains largely unexplored. We describe an initial study of the dynamic compression response of lattice materials fabricated through additive manufacturing. Lattices consisting of an array of intersecting stainless steel rods were fabricated into discs using selective laser melting. The resulting discs were impacted against solid stainless steel targets at velocities ranging from 300 to 700 m s-1 using a gas gun. Continuum CTH simulations were performed to identify key features in the measured wave profiles, while 3D simulations, in which the individual cells were modelled, revealed details of microscale deformation during collapse of the lattice structure. The validated computer models have been used to provide an understanding of the deformation processes in the cellular samples. The study supports the optimization of cellular structures for application as energy absorbers.

RNA Helicases at work: binding and rearranging

PubMed Central

Jankowsky, Eckhard

2010-01-01

RNA helicases are ubiquitous, highly conserved enzymes that participate in nearly all aspects of RNA metabolism. These proteins bind or remodel RNA or RNA–protein complexes in an ATP-dependent fashion. How RNA helicases physically perform their cellular tasks has been a longstanding question, but in recent years, intriguing models have started to link structure, mechanism and biological function for some RNA helicases. This review outlines our current view on major structural and mechanistic themes of RNA helicase function, and on emerging physical models for cellular roles of these enzymes. PMID:20813532

A morphometric analysis of cellular differentiation in caps of primary and lateral roots of Helianthus annuus

NASA Technical Reports Server (NTRS)

Moore, R.

1985-01-01

In order to determine if patterns of cell differentiation are similar in primary and lateral roots, I performed a morphometric analysis of the ultrastructure of calyptrogen, columella, and peripheral cells in primary and lateral roots of Helianthus annuus. Each cell type is characterized by a unique ultrastructure, and the ultrastructural changes characteristic of cellular differentiation in root caps are organelle specific. No major structural differences exist in the structures of the composite cell types, or in patterns of cell differentiation in caps of primary vs. lateral roots.

Porous and Cellular Materials for Structural Applications; Symposium Held in San Francisco, California on April 13-15, 1998

DTIC Science & Technology

1998-04-01

Industrial Scale 179 M. Schmidt and F. Schwertfeger Structural Graphitic Carbon Foams 185 Kristen M. Kearns, David P. Anderson, and Heather J...Nanostructured Powders and Their Industrial Application, Q. Beaucage, J.E. Mark, Q. Burns, H. Duen-Wu, 1998, ISBN: 1-55899-426-2 Volume 521—Porous and Cellular...has faces which are 0.03" thick and the core is 0.4" thick. Bonding between the core and face is achieved using a standard industrial epoxy adhesive

Visualizing Morphological Changes of Abscission Zone Cells in Arabidopsis by Scanning Electron Microscope.

PubMed

Shi, Chun-Lin; Butenko, Melinka A

2018-01-01

Scanning electron microscope (SEM) is a type of electron microscope which produces detailed images of surface structures. It has been widely used in plants and animals to study cellular structures. Here, we describe a detailed protocol to prepare samples of floral abscission zones (AZs) for SEM, as well as further image analysis. We show that it is a powerful tool to detect morphologic changes at the cellular level during the course of abscission in wild-type plants and to establish the details of phenotypic alteration in abscission mutants.

Hardwiring stem cell communication through tissue structure

PubMed Central

Xin, Tianchi; Greco, Valentina; Myung, Peggy

2016-01-01

Adult stem cells across diverse organs self-renew and differentiate to maintain tissue homeostasis. How stem cells receive input to preserve tissue structure and function largely relies on their communication with surrounding cellular and non-cellular elements. As such, how tissues are organized and patterned not only reflects organ function but also inherently hardwires networks of communication between stem cells and their environment to direct tissue homeostasis and injury repair. This review highlights how different methods of stem cell communication reflect the unique organization and function of diverse tissues. PMID:26967287

Cellular convection in the atmosphere of Venus

NASA Technical Reports Server (NTRS)

Baker, R. D., II; Schubert, Gerald

1992-01-01

Among the most intriguing feature of the atmosphere of Venus is the presence of cellular structures near and downwind of the subpolar point. It has been suggested that the structures are atmospheric convection cells, but their breadth and thinness would pose a severe challenge to the dynamics of convection. It is proposed here that strongly penetrative convection into the stable regions above and below the neutrally stable cloud layer coupled with penetrative convection from the surface increases the vertical dimensions of the cells, thereby helping to explain their large horizontal extent.

Latitudinal Transport of Angular Momentum by Cellular Flows Observed with MDI

NASA Technical Reports Server (NTRS)

Hathaway, David H.; Gilman, Peter A.; Beck, John G.; Rose, M. Franklin (Technical Monitor)

2001-01-01

We have analyzed Doppler velocity images from the MDI instrument on SOHO to determine the latitudinal transport of angular momentum by the cellular photospheric flows. Doppler velocity images from 60-days in May to July of 1996 were processed to remove the p-mode oscillations, the convective blue shift, the axisymmetric flows, and any instrumental artifacts. The remaining cellular flows were examined for evidence of latitudinal angular momentum transport. Small cells show no evidence of any such transport. Cells the size of supergranules (30,000 km in diameter) show strong evidence for a poleward transport of angular momentum. This would be expected if supergranules are influenced by the Coriolis force, and if the cells are elongated in an east-west direction. We find good evidence for just such an east-west elongation of the supergranules. This elongation may be the result of differential rotation shearing the cellular structures. Data simulations of this effect support the conclusion that elongated supergranules transport angular momentum from the equator toward the poles, Cells somewhat larger than supergranules do not show evidence for this poleward transport. Further analysis of the data is planned to determine if the direction of angular momentum transport reverses for even larger cellular structures. The Sun's rapidly rotating equator must be maintained by such transport somewhere within the convection zone.

Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes.

PubMed Central

Dougherty, W G; Semler, B L

1993-01-01

Many viruses express their genome, or part of their genome, initially as a polyprotein precursor that undergoes proteolytic processing. Molecular genetic analyses of viral gene expression have revealed that many of these processing events are mediated by virus-encoded proteinases. Biochemical activity studies and structural analyses of these viral enzymes reveal that they have remarkable similarities to cellular proteinases. However, the viral proteinases have evolved unique features that permit them to function in a cellular environment. In this article, the current status of plant and animal virus proteinases is described along with their role in the viral replication cycle. The reactions catalyzed by viral proteinases are not simple enzyme-substrate interactions; rather, the processing steps are highly regulated, are coordinated with other viral processes, and frequently involve the participation of other factors. Images PMID:8302216

The β-Arrestins: Multifunctional Regulators of G Protein-coupled Receptors.

PubMed

Smith, Jeffrey S; Rajagopal, Sudarshan

2016-04-22

The β-arrestins (βarrs) are versatile, multifunctional adapter proteins that are best known for their ability to desensitize G protein-coupled receptors (GPCRs), but also regulate a diverse array of cellular functions. To signal in such a complex fashion, βarrs adopt multiple conformations and are regulated at multiple levels to differentially activate downstream pathways. Recent structural studies have demonstrated that βarrs have a conserved structure and activation mechanism, with plasticity of their structural fold, allowing them to adopt a wide array of conformations. Novel roles for βarrs continue to be identified, demonstrating the importance of these dynamic regulators of cellular signaling. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Fundamental Characteristics of AAA+ Protein Family Structure and Function.

PubMed

Miller, Justin M; Enemark, Eric J

2016-01-01

Many complex cellular events depend on multiprotein complexes known as molecular machines to efficiently couple the energy derived from adenosine triphosphate hydrolysis to the generation of mechanical force. Members of the AAA+ ATPase superfamily (ATPases Associated with various cellular Activities) are critical components of many molecular machines. AAA+ proteins are defined by conserved modules that precisely position the active site elements of two adjacent subunits to catalyze ATP hydrolysis. In many cases, AAA+ proteins form a ring structure that translocates a polymeric substrate through the central channel using specialized loops that project into the central channel. We discuss the major features of AAA+ protein structure and function with an emphasis on pivotal aspects elucidated with archaeal proteins.

Amazing structure of respirasome: unveiling the secrets of cell respiration.

PubMed

Guo, Runyu; Gu, Jinke; Wu, Meng; Yang, Maojun

2016-12-01

Respirasome, a huge molecular machine that carries out cellular respiration, has gained growing attention since its discovery, because respiration is the most indispensable biological process in almost all living creatures. The concept of respirasome has renewed our understanding of the respiratory chain organization, and most recently, the structure of respirasome solved by Yang's group from Tsinghua University (Gu et al. Nature 237(7622):639-643, 2016) firstly presented the detailed interactions within this huge molecular machine, and provided important information for drug design and screening. However, the study of cellular respiration went through a long history. Here, we briefly showed the detoured history of respiratory chain investigation, and then described the amazing structure of respirasome.

Protein Structure in Context: The Molecular Landscape of Angiogenesis

ERIC Educational Resources Information Center

Span, Elise A.; Goodsell, David S.; Ramchandran, Ramani; Franzen, Margaret A.; Herman, Tim; Sem, Daniel S.

2013-01-01

A team of students, educators, and researchers has developed new materials to teach cell signaling within its cellular context. Two nontraditional modalities are employed: physical models, to explore the atomic details of several of the proteins in the angiogenesis signaling cascade, and illustrations of the proteins in their cellular environment,…

Chemical Blistering: Cellular and Macromolecular Components

DTIC Science & Technology

1984-11-15

accumulation of fluid appears to Sbe secondary to fundamental damage to cellular structures (1). As noted by Warthin and Weller (2) and by Sinclair (3...Medicine. fT. P. Fitzpatrick, A. Z. Eisen, K. Wolff, I. M. Freedberg and K. F. Austen, Eds.) McGraw-Hill, New York, pp. 287-294). 2.’ Warthin , A. S., and

Dynamic cellular uptake of mixed-monolayer protected nanoparticles.

PubMed

Carney, Randy P; Carney, Tamara M; Mueller, Marie; Stellacci, Francesco

2012-12-01

Nanoparticles (NPs) are gaining increasing attention for potential application in medicine; consequently, studying their interaction with cells is of central importance. We found that both ligand arrangement and composition on gold nanoparticles play a crucial role in their cellular internalization. In our previous investigation, we showed that 66-34OT nanoparticles coated with stripe-like domains of hydrophobic (octanethiol, OT, 34%) and hydrophilic (11-mercaptoundecane sulfonate, MUS, 66%) ligands permeated through the cellular lipid bilayer via passive diffusion, in addition to endo-/pino-cytosis. Here, we show an analysis of NP internalization by DC2.4, 3T3, and HeLa cells at two temperatures and multiple time points. We study four NPs that differ in their surface structures and ligand compositions and report on their cellular internalization by intracellular fluorescence quantification. Using confocal laser scanning microscopy we have found that all three cell types internalize the 66-34OT NPs more than particles coated only with MUS, or particles coated with a very similar coating but lacking any detectable ligand shell structure, or 'striped' particles but with a different composition (34-66OT) at multiple data points.

Synchrotron IR microspectroscopy for protein structure analysis: Potential and questions

DOE PAGES

Yu, Peiqiang

2006-01-01

Synchrotron radiation-based Fourier transform infrared microspectroscopy (S-FTIR) has been developed as a rapid, direct, non-destructive, bioanalytical technique. This technique takes advantage of synchrotron light brightness and small effective source size and is capable of exploring the molecular chemical make-up within microstructures of a biological tissue without destruction of inherent structures at ultra-spatial resolutions within cellular dimension. To date there has been very little application of this advanced technique to the study of pure protein inherent structure at a cellular level in biological tissues. In this review, a novel approach was introduced to show the potential of the newly developed, advancedmore » synchrotron-based analytical technology, which can be used to localize relatively “pure“ protein in the plant tissues and relatively reveal protein inherent structure and protein molecular chemical make-up within intact tissue at cellular and subcellular levels. Several complex protein IR spectra data analytical techniques (Gaussian and Lorentzian multi-component peak modeling, univariate and multivariate analysis, principal component analysis (PCA), and hierarchical cluster analysis (CLA) are employed to relatively reveal features of protein inherent structure and distinguish protein inherent structure differences between varieties/species and treatments in plant tissues. By using a multi-peak modeling procedure, RELATIVE estimates (but not EXACT determinations) for protein secondary structure analysis can be made for comparison purpose. The issues of pro- and anti-multi-peaking modeling/fitting procedure for relative estimation of protein structure were discussed. By using the PCA and CLA analyses, the plant molecular structure can be qualitatively separate one group from another, statistically, even though the spectral assignments are not known. The synchrotron-based technology provides a new approach for protein structure research in biological tissues at ultraspatial resolutions.« less

Multiscale Feature Analysis of Salivary Gland Branching Morphogenesis

PubMed Central

Baydil, Banu; Daley, William P.; Larsen, Melinda; Yener, Bülent

2012-01-01

Pattern formation in developing tissues involves dynamic spatio-temporal changes in cellular organization and subsequent evolution of functional adult structures. Branching morphogenesis is a developmental mechanism by which patterns are generated in many developing organs, which is controlled by underlying molecular pathways. Understanding the relationship between molecular signaling, cellular behavior and resulting morphological change requires quantification and categorization of the cellular behavior. In this study, tissue-level and cellular changes in developing salivary gland in response to disruption of ROCK-mediated signaling by are modeled by building cell-graphs to compute mathematical features capturing structural properties at multiple scales. These features were used to generate multiscale cell-graph signatures of untreated and ROCK signaling disrupted salivary gland organ explants. From confocal images of mouse submandibular salivary gland organ explants in which epithelial and mesenchymal nuclei were marked, a multiscale feature set capturing global structural properties, local structural properties, spectral, and morphological properties of the tissues was derived. Six feature selection algorithms and multiway modeling of the data was performed to identify distinct subsets of cell graph features that can uniquely classify and differentiate between different cell populations. Multiscale cell-graph analysis was most effective in classification of the tissue state. Cellular and tissue organization, as defined by a multiscale subset of cell-graph features, are both quantitatively distinct in epithelial and mesenchymal cell types both in the presence and absence of ROCK inhibitors. Whereas tensor analysis demonstrate that epithelial tissue was affected the most by inhibition of ROCK signaling, significant multiscale changes in mesenchymal tissue organization were identified with this analysis that were not identified in previous biological studies. We here show how to define and calculate a multiscale feature set as an effective computational approach to identify and quantify changes at multiple biological scales and to distinguish between different states in developing tissues. PMID:22403724

Taming the Sphinx: Mechanisms of Cellular Sphingolipid Homeostasis

PubMed Central

Olson, D. K.; Fröhlich, F.; Farese, R; Walther, T. C.

2016-01-01

Sphingolipids are important structural membrane components of eukaryotic cells, and potent signaling molecules. As such, their levels must be maintained to optimize cellular functions in different cellular membranes. Here, we review the current knowledge of homeostatic sphingolipid regulation. We describe recent studies in Saccharomyces cerevisiae that have provided insights into how cells sense changes in sphingolipid levels in the plasma membrane and acutely regulate sphingolipid biosynthesis by altering signaling pathways. We also discuss how cellular trafficking has emerged as an important determinant of sphingolipid homeostasis. Finally, we highlight areas where work is still needed to elucidate the mechanisms of sphingolipid regulation and the physiological functions of such regulatory networks, especially in mammalian cells. PMID:26747648

Chitosan based hydrogels: characteristics and pharmaceutical applications

PubMed Central

Ahmadi, F.; Oveisi, Z.; Samani, S. Mohammadi; Amoozgar, Z.

2015-01-01

Hydrogel scaffolds serve as semi synthetic or synthetic extra cellular matrix to provide an amenable environment for cellular adherence and cellular remodeling in three dimensional structures mimicking that of natural cellular environment. Additionally, hydrogels have the capacity to carry small molecule drugs and/or proteins, growth factors and other necessary components for cell growth and differentiation. In the context of drug delivery, hydrogels can be utilized to localize drugs, increase drugs concentration at the site of action and consequently reduce off-targeted side effects. The current review aims to describe and classify hydrogels and their methods of production. The main highlight is chitosan-based hydrogels as biocompatible and medically relevant hydrogels for drug delivery. PMID:26430453

The structure of a cholesterol-trapping protein

Science.gov Websites

Date February 28, 2003 Date Berkeley Lab Science Beat Berkeley Lab Science Beat The structure of a Institute researchers determined the three-dimensional structure of a protein that controls cholesterol level in the bloodstream. Knowing the structure of the protein, a cellular receptor that ensnares

Age-related structural alterations in human skeletal muscle fibers and mitochondria are sex specific: relationship to single-fiber function.

PubMed

Callahan, Damien M; Bedrin, Nicholas G; Subramanian, Meenakumari; Berking, James; Ades, Philip A; Toth, Michael J; Miller, Mark S

2014-06-15

Age-related loss of skeletal muscle mass and function is implicated in the development of disease and physical disability. However, little is known about how age affects skeletal muscle structure at the cellular and ultrastructural levels or how such alterations impact function. Thus we examined skeletal muscle structure at the tissue, cellular, and myofibrillar levels in young (21-35 yr) and older (65-75 yr) male and female volunteers, matched for habitual physical activity level. Older adults had smaller whole muscle tissue cross-sectional areas (CSAs) and mass. At the cellular level, older adults had reduced CSAs in myosin heavy chain II (MHC II) fibers, with no differences in MHC I fibers. In MHC II fibers, older men tended to have fewer fibers with large CSAs, while older women showed reduced fiber size across the CSA range. Older adults showed a decrease in intermyofibrillar mitochondrial size; however, the age effect was driven primarily by women (i.e., age by sex interaction effect). Mitochondrial size was inversely and directly related to isometric tension and myosin-actin cross-bridge kinetics, respectively. Notably, there were no intermyofibrillar or subsarcolemmal mitochondrial fractional content or myofilament ultrastructural differences in the activity-matched young and older adults. Collectively, our results indicate age-related reductions in whole muscle size do not vary by sex. However, age-related structural alterations at the cellular and subcellular levels are different between the sexes and may contribute to different functional phenotypes in ways that modulate sex-specific reductions in physical capacity with age. Copyright © 2014 the American Physiological Society.

'Laba' garlic processed by dense phase carbon dioxide: the relation between green colour generation and cellular structure, alliin consumption and alliinase activity.

PubMed

Tao, Dandan; Zhou, Bing; Zhang, Luyao; Hu, Xiaosong; Liao, Xiaojun; Zhang, Yan

2016-07-01

'Laba' garlic is usually processed by soaking garlic in vinegar for more than 1 week during winter. It is popular for its unique green colour and tasty flavour. Greening is desirable and required for this product as its characteristic. Dense phase carbon dioxide (DPCD) had a significant effect on the greening of intact garlic (Allium sativum L.) cloves. The relation between green colour generation and alliin consumption, alliinase activity and the cellular structure of garlic, respectively, were investigated in this work. The effects of treatment time, pressure and temperature of DPCD were also analysed and discussed. DPCD had a significant effect on the cellular structure of garlic cells. Garlic protoplast underwent greater morphological change after DPCD treatments at higher temperatures while the amount of precipitate increased with greater treatment time and temperature. Common trends on garlic greening and alliin consumption were observed except for DPCD treatment at 10 MPa and 65 °C. The alliinase activity decreased with increasing treatment time, pressure and temperature. It reached the lowest level at 13 MPa and 55 °C. The formation of the green colour was a comprehensive result of DPCD on changing cellular structure, alliin consumption and alliinase activity. DPCD treatment at 10 MPa and 55 °C was the optimum condition for the greening of 'Laba' garlic. This work further facilitated the application of DPCD in the industrial production of 'Laba' garlic. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Structure-activity relationships for the impact of selected isothiazol-3-one biocides on glutathione metabolism and glutathione reductase of the human liver cell line Hep G2.

PubMed

Arning, Jürgen; Dringen, Ralf; Schmidt, Maike; Thiessen, Anette; Stolte, Stefan; Matzke, Marianne; Bottin-Weber, Ulrike; Caesar-Geertz, Birgit; Jastorff, Bernd; Ranke, Johannes

2008-04-18

To investigate the toxic mode of action of isothiazol-3-one biocides the four compounds N-methylisothiazol-3-one (MIT), 5-chloro-N-methylisothiazol-3-one (CIT), N-octylisothiazol-3-one (OIT) and 4,5-dichloro-N-octylisothiazol-3-one (DCOIT) were purified and tested as single chemical entities for their effects on the human hepatoblastoma cell line Hep G2 and on isolated and cellular glutathione reductase GR). The two chlorinated substances CIT and DCOIT significantly decreased the amount of total cellular glutathione (GSx) in a dose and time dependent manner. Concomitantly, an increase in the level of oxidised glutathione (GSSG) was observed. The resulting shift in the GSH/GSSG ratio entailing the breakdown of the cellular thiol reduction potential was accompanied by necrotic morphological changes like swelling of the plasma membrane and subsequent lysis of the cells. Additionally, CIT and DCOIT were found to inhibit cellular GR in the cells in a concentration dependent manner. The T-SAR-based (thinking in terms of structure-activity relationships) comparison of the chlorine-substituted structures CIT and DCOIT with their non-chlorinated and less active analogues MIT and OIT identified the chlorine substituents and the resulting reaction mechanisms to be the key structural mediators of the observed toxic effects. Furthermore, differences in the activity of both chlorinated substances could be explained using the T-SAR approach to link the lipophilicity and the intrinsic glutathione-reactivity of the compounds to the expected target site concentrations inside the cells.

Strategies for using cellular automata to locate constrained layer damping on vibrating structures

NASA Astrophysics Data System (ADS)

Chia, C. M.; Rongong, J. A.; Worden, K.

2009-01-01

It is often hard to optimise constrained layer damping (CLD) for structures more complicated than simple beams and plates as its performance depends on its location, the shape of the applied patch, the mode shapes of the structure and the material properties. This paper considers the use of cellular automata (CA) in conjunction with finite element analysis to obtain an efficient coverage of CLD on structures. The effectiveness of several different sets of local rules governing the CA are compared against each other for a structure with known optimum coverage—namely a plate. The algorithm which attempts to replicate most closely known optimal configurations is considered the most successful. This algorithm is then used to generate an efficient CLD treatment that targets several modes of a curved composite panel. To validate the modelling approaches used, results are also presented of a comparison between theoretical and experimentally obtained modal properties of the damped curved panel.

Intracellular Delivery of a Planar DNA Origami Structure by the Transferrin-Receptor Internalization Pathway.

PubMed

Schaffert, David H; Okholm, Anders H; Sørensen, Rasmus S; Nielsen, Jesper S; Tørring, Thomas; Rosen, Christian B; Kodal, Anne Louise B; Mortensen, Michael R; Gothelf, Kurt V; Kjems, Jørgen

2016-05-01

DNA origami provides rapid access to easily functionalized, nanometer-sized structures making it an intriguing platform for the development of defined drug delivery and sensor systems. Low cellular uptake of DNA nanostructures is a major obstacle in the development of DNA-based delivery platforms. Herein, significant strong increase in cellular uptake in an established cancer cell line by modifying a planar DNA origami structure with the iron transport protein transferrin (Tf) is demonstrated. A variable number of Tf molecules are coupled to the origami structure using a DNA-directed, site-selective labeling technique to retain ligand functionality. A combination of confocal fluorescence microscopy and quantitative (qPCR) techniques shows up to 22-fold increased cytoplasmic uptake compared to unmodified structures and with an efficiency that correlates to the number of transferrin molecules on the origami surface. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Zika virus produces noncoding RNAs using a multi-pseudoknot structure that confounds a cellular exonuclease

DOE PAGES

Akiyama, Benjamin M.; Laurence, Hannah M.; Massey, Aaron R.; ...

2016-11-10

The outbreak of Zika virus (ZIKV) and associated fetal microcephaly mandates efforts to understand the molecular processes of infection. Related flaviviruses produce noncoding subgenomic flaviviral RNAs (sfRNAs) that are linked to pathogenicity in fetal mice. These viruses make sfRNAs by co-opting a cellular exonuclease via structured RNAs called xrRNAs. We found that ZIKV-infected monkey and human epithelial cells, mouse neurons, and mosquito cells produce sfRNAs. The RNA structure that is responsible for ZIKV sfRNA production forms a complex fold that is likely found in many pathogenic flaviviruses. Mutations that disrupt the structure affect exonuclease resistance in vitro and sfRNA formationmore » during infection. The complete ZIKV xrRNA structure clarifies the mechanism of exonuclease resistance and identifies features that may modulate function in diverse flaviviruses.« less

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

PubMed Central

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B; Belcher-Dufrisne, Meagan; Wiriyasermkul, Pattama; Giese, M Hunter; Leal-Pinto, Edgar; Kloss, Brian; Tabuso, Shantelle; Love, James; Punta, Marco; Banerjee, Surajit; Rajashankar, Kanagalaghatta R; Rost, Burkhard; Logothetis, Diomedes; Quick, Matthias; Hendrickson, Wayne A

2018-01-01

Sulfur, most abundantly found in the environment as sulfate (SO42-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO42- at the molecular level is limited. CysZ has been described as a SO42- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO42- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO42- across membranes. CysZ structures from three different bacterial species display a hitherto unknown fold and have subunits organized with inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. Mutational studies highlight the functional relevance of conserved CysZ residues. PMID:29792261

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B.

Sulfur, most abundantly found in the environment as sulfate (SO42-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO42- at the molecular level is limited. CysZ has been described as a SO42- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO42- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO42- across membranes. CysZ structures from three different bacterial species display a hitherto unknown fold and have subunits organized withmore » inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. Mutational studies highlight the functional relevance of conserved CysZ residues.« less

Extracellular matrix structure.

PubMed

Theocharis, Achilleas D; Skandalis, Spyros S; Gialeli, Chrysostomi; Karamanos, Nikos K

2016-02-01

Extracellular matrix (ECM) is a non-cellular three-dimensional macromolecular network composed of collagens, proteoglycans/glycosaminoglycans, elastin, fibronectin, laminins, and several other glycoproteins. Matrix components bind each other as well as cell adhesion receptors forming a complex network into which cells reside in all tissues and organs. Cell surface receptors transduce signals into cells from ECM, which regulate diverse cellular functions, such as survival, growth, migration, and differentiation, and are vital for maintaining normal homeostasis. ECM is a highly dynamic structural network that continuously undergoes remodeling mediated by several matrix-degrading enzymes during normal and pathological conditions. Deregulation of ECM composition and structure is associated with the development and progression of several pathologic conditions. This article emphasizes in the complex ECM structure as to provide a better understanding of its dynamic structural and functional multipotency. Where relevant, the implication of the various families of ECM macromolecules in health and disease is also presented. Copyright © 2015 Elsevier B.V. All rights reserved.

Quantum cellular automata

NASA Astrophysics Data System (ADS)

Porod, Wolfgang; Lent, Craig S.; Bernstein, Gary H.

1994-06-01

The Notre Dame group has developed a new paradigm for ultra-dense and ultra-fast information processing in nanoelectronic systems. These Quantum Cellular Automata (QCA's) are the first concrete proposal for a technology based on arrays of coupled quantum dots. The basic building block of these cellular arrays is the Notre Dame Logic Cell, as it has been called in the literature. The phenomenon of Coulomb exclusion, which is a synergistic interplay of quantum confinement and Coulomb interaction, leads to a bistable behavior of each cell which makes possible their use in large-scale cellular arrays. The physical interaction between neighboring cells has been exploited to implement logic functions. New functionality may be achieved in this fashion, and the Notre Dame group invented a versatile majority logic gate. In a series of papers, the feasibility of QCA wires, wire crossing, inverters, and Boolean logic gates was demonstrated. A major finding is that all logic functions may be integrated in a hierarchial fashion which allows the design of complicated QCA structures. The most complicated system which was simulated to date is a one-bit full adder consisting of some 200 cells. In addition to exploring these new concepts, efforts are under way to physically realize such structures both in semiconductor and metal systems. Extensive modeling work of semiconductor quantum dot structures has helped identify optimum design parameters for QCA experimental implementations.

The reticulons: Guardians of the structure and function of the endoplasmic reticulum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Di Sano, Federica; Bernardoni, Paolo; Piacentini, Mauro, E-mail: mauro.piacentini@uniroma2.it

2012-07-01

The endoplasmic reticulum (ER) consists of the nuclear envelope and a peripheral network of tubules and membrane sheets. The tubules are shaped by a specific class of curvature stabilizing proteins, the reticulons and DP1; however it is still unclear how the sheets are assembled. The ER is the cellular compartment responsible for secretory and membrane protein synthesis. The reducing conditions of ER lead to the intra/inter-chain formation of new disulphide bonds into polypeptides during protein folding assessed by enzymatic or spontaneous reactions. Moreover, ER represents the main intracellular calcium storage site and it plays an important role in calcium signalingmore » that impacts many cellular processes. Accordingly, the maintenance of ER function represents an essential condition for the cell, and ER morphology constitutes an important prerogative of it. Furthermore, it is well known that ER undergoes prominent shape transitions during events such as cell division and differentiation. Thus, maintaining the correct ER structure is an essential feature for cellular physiology. Now, it is known that proper ER-associated proteins play a fundamental role in ER tubules formation. Among these ER-shaping proteins are the reticulons (RTN), which are acquiring a relevant position. In fact, beyond the structural role of reticulons, in very recent years new and deeper functional implications of these proteins are emerging in relation to their involvement in several cellular processes.« less

Taming the sphinx: Mechanisms of cellular sphingolipid homeostasis.

PubMed

Olson, D K; Fröhlich, F; Farese, R V; Walther, T C

2016-08-01

Sphingolipids are important structural membrane components of eukaryotic cells, and potent signaling molecules. As such, their levels must be maintained to optimize cellular functions in different cellular membranes. Here, we review the current knowledge of homeostatic sphingolipid regulation. We describe recent studies in Saccharomyces cerevisiae that have provided insights into how cells sense changes in sphingolipid levels in the plasma membrane and acutely regulate sphingolipid biosynthesis by altering signaling pathways. We also discuss how cellular trafficking has emerged as an important determinant of sphingolipid homeostasis. Finally, we highlight areas where work is still needed to elucidate the mechanisms of sphingolipid regulation and the physiological functions of such regulatory networks, especially in mammalian cells. This article is part of a Special Issue entitled: The cellular lipid landscape edited by Tim P. Levine and Anant K. Menon. Copyright © 2015. Published by Elsevier B.V.

Stair evacuation simulation based on cellular automata considering evacuees’ walk preferences

NASA Astrophysics Data System (ADS)

Ding, Ning; Zhang, Hui; Chen, Tao; Peter, B. Luh

2015-06-01

As a physical model, the cellular automata (CA) model is widely used in many areas, such as stair evacuation. However, existing CA models do not consider evacuees’ walk preferences nor psychological status, and the structure of the basic model is unapplicable for the stair structure. This paper is to improve the stair evacuation simulation by addressing these issues, and a new cellular automata model is established. Several evacuees’ walk preference and how evacuee’s psychology influences their behaviors are introduced into this model. Evacuees’ speeds will be influenced by these features. To validate this simulation, two fire drills held in two high-rise buildings are video-recorded. It is found that the simulation results are similar to the fire drill results. The structure of this model is simple, and it is easy to further develop and utilize in different buildings with various kinds of occupants. Project supported by the National Basic Research Program of China (Grant No. 2012CB719705) and the National Natural Science Foundation of China (Grant Nos. 91224008, 91024032, and 71373139).

Reduced native state stability in crowded cellular environment due to protein-protein interactions.

PubMed

Harada, Ryuhei; Tochio, Naoya; Kigawa, Takanori; Sugita, Yuji; Feig, Michael

2013-03-06

The effect of cellular crowding environments on protein structure and stability is a key issue in molecular and cellular biology. The classical view of crowding emphasizes the volume exclusion effect that generally favors compact, native states. Here, results from molecular dynamics simulations and NMR experiments show that protein crowders may destabilize native states via protein-protein interactions. In the model system considered here, mixtures of villin head piece and protein G at high concentrations, villin structures become increasingly destabilized upon increasing crowder concentrations. The denatured states observed in the simulation involve partial unfolding as well as more subtle conformational shifts. The unfolded states remain overall compact and only partially overlap with unfolded ensembles at high temperature and in the presence of urea. NMR measurements on the same systems confirm structural changes upon crowding based on changes of chemical shifts relative to dilute conditions. An analysis of protein-protein interactions and energetic aspects suggests the importance of enthalpic and solvation contributions to the crowding free energies that challenge an entropic-centered view of crowding effects.

Genetically targeted 3D visualisation of Drosophila neurons under Electron Microscopy and X-Ray Microscopy using miniSOG

PubMed Central

Ng, Julian; Browning, Alyssa; Lechner, Lorenz; Terada, Masako; Howard, Gillian; Jefferis, Gregory S. X. E.

2016-01-01

Large dimension, high-resolution imaging is important for neural circuit visualisation as neurons have both long- and short-range patterns: from axons and dendrites to the numerous synapses at terminal endings. Electron Microscopy (EM) is the favoured approach for synaptic resolution imaging but how such structures can be segmented from high-density images within large volume datasets remains challenging. Fluorescent probes are widely used to localise synapses, identify cell-types and in tracing studies. The equivalent EM approach would benefit visualising such labelled structures from within sub-cellular, cellular, tissue and neuroanatomical contexts. Here we developed genetically-encoded, electron-dense markers using miniSOG. We demonstrate their ability in 1) labelling cellular sub-compartments of genetically-targeted neurons, 2) generating contrast under different EM modalities, and 3) segmenting labelled structures from EM volumes using computer-assisted strategies. We also tested non-destructive X-ray imaging on whole Drosophila brains to evaluate contrast staining. This enabled us to target specific regions for EM volume acquisition. PMID:27958322

Review of combined isotopic and optical nanoscopy

PubMed Central

Richter, Katharina N.; Rizzoli, Silvio O.; Jähne, Sebastian; Vogts, Angela; Lovric, Jelena

2017-01-01

Abstract. Investigating the detailed substructure of the cell is beyond the ability of conventional optical microscopy. Electron microscopy, therefore, has been the only option for such studies for several decades. The recent implementation of several super-resolution optical microscopy techniques has rendered the investigation of cellular substructure easier and more efficient. Nevertheless, optical microscopy only provides an image of the present structure of the cell, without any information on its long-temporal changes. These can be investigated by combining super-resolution optics with a nonoptical imaging technique, nanoscale secondary ion mass spectrometry, which investigates the isotopic composition of the samples. The resulting technique, combined isotopic and optical nanoscopy, enables the investigation of both the structure and the “history” of the cellular elements. The age and the turnover of cellular organelles can be read by isotopic imaging, while the structure can be analyzed by optical (fluorescence) approaches. We present these technologies, and we discuss their implementation for the study of biological samples. We conclude that, albeit complex, this type of technology is reliable enough for mass application to cell biology. PMID:28466025

Effects of ultrasound on polymeric foam porosity.

PubMed

Torres-Sanchez, C; Corney, J R

2008-04-01

A variety of materials require functionally graded cellular microstructures whose porosity is engineered to meet specific applications (e.g. mimic bone structure for orthopaedic applications; fulfil mechanical, thermal or acoustic constraints in structural foamed components, etc.). Although a huge variety of foams can be manufactured with homogenous porosity, there are no generic processes for controlling the distribution of porosity within the resulting matrix. Motivated by the desire to create a flexible process for engineering heterogeneous foams, the authors have investigated how ultrasound, applied during the formation of a polyurethane foam, affects its cellular structure. The experimental results demonstrated how the parameters of ultrasound exposure (i.e. frequency and applied power) influenced the volume and distribution of pores within the final polyurethane matrix: the data demonstrates that porosity (i.e. volume fraction) varies in direct proportion to both the acoustic pressure and frequency of the ultrasound signal. The effects of ultrasound on porosity demonstrated by this work offer the prospect of a manufacturing process that can adjust the cellular geometry of foam and hence ensure that the resulting characteristics match the functional requirements.

The Temperature Effect on the Compressive Behavior of Closed-Cell Aluminum-Alloy Foams

NASA Astrophysics Data System (ADS)

Movahedi, Nima; Linul, Emanoil; Marsavina, Liviu

2018-01-01

In this research, the mechanical behavior of closed-cell aluminum (Al)-alloy foams was investigated at different temperatures in the range of 25-450 °C. The main mechanical properties of porous Al-alloy foams are affected by the testing temperature, and they decrease with the increase in the temperature during uniaxial compression. From both the constant/serrated character of stress-strain curves and macro/microstructural morphology of deformed cellular structure, it was found that Al foams present a transition temperature from brittle to ductile behavior around 192 °C. Due to the softening of the cellular structure at higher temperatures, linear correlations of the stress amplitude and that of the absorbed energy with the temperature were proposed. Also, it was observed that the presence of inherent defects like micropores in the foam cell walls induced further local stress concentration which weakens the cellular structure's strength and crack propagation and cell-wall plastic deformation are the dominant collapse mechanisms. Finally, an energy absorption study was performed and an optimum temperature was proposed.

Cellular organization of cortical barrel columns is whisker-specific

PubMed Central

Meyer, Hanno S.; Egger, Robert; Guest, Jason M.; Foerster, Rita; Reissl, Stefan; Oberlaender, Marcel

2013-01-01

The cellular organization of the cortex is of fundamental importance for elucidating the structural principles that underlie its functions. It has been suggested that reconstructing the structure and synaptic wiring of the elementary functional building block of mammalian cortices, the cortical column, might suffice to reverse engineer and simulate the functions of entire cortices. In the vibrissal area of rodent somatosensory cortex, whisker-related “barrel” columns have been referred to as potential cytoarchitectonic equivalents of functional cortical columns. Here, we investigated the structural stereotypy of cortical barrel columns by measuring the 3D neuronal composition of the entire vibrissal area in rat somatosensory cortex and thalamus. We found that the number of neurons per cortical barrel column and thalamic “barreloid” varied substantially within individual animals, increasing by ∼2.5-fold from dorsal to ventral whiskers. As a result, the ratio between whisker-specific thalamic and cortical neurons was remarkably constant. Thus, we hypothesize that the cellular architecture of sensory cortices reflects the degree of similarity in sensory input and not columnar and/or cortical uniformity principles. PMID:24101458

The effect of hydrodynamic conditions on the phenotype of Pseudomonas fluorescens biofilms.

PubMed

Simões, Manuel; Pereira, Maria O; Sillankorva, Sanna; Azeredo, Joana; Vieira, Maria J

2007-01-01

This study investigated the phenotypic characteristics of monoculture P. fluorescens biofilms grown under turbulent and laminar flow, using flow cells reactors with stainless steel substrata. The cellular physiology and the overall biofilm activity, structure and composition were characterized, and compared, within hydrodynamically distinct conditions. The results indicate that turbulent flow-generated biofilm cells were significantly less extensive, with decreased metabolic activity and a lower protein and polysaccharides composition per cell than those from laminar flow-generated biofilms. The effect of flow regime did not cause significantly different outer membrane protein expression. From the analysis of biofilm activity, structure and composition, turbulent flow-generated biofilms were metabolically more active, had twice more mass per cm(2), and higher cellular density and protein content (mainly cellular) than laminar flow-generated biofilms. Conversely, laminar flow-generated biofilms presented higher total and matrix polysaccharide contents. Direct visualisation and scanning electron microscopy analysis showed that these different flows generate structurally different biofilms, corroborating the quantitative results. The combination of applied methods provided useful information regarding a broad spectrum of biofilm parameters, which can contribute to control and model biofilm processes.

Nanobodies and recombinant binders in cell biology.

PubMed

Helma, Jonas; Cardoso, M Cristina; Muyldermans, Serge; Leonhardt, Heinrich

2015-06-08

Antibodies are key reagents to investigate cellular processes. The development of recombinant antibodies and binders derived from natural protein scaffolds has expanded traditional applications, such as immunofluorescence, binding arrays, and immunoprecipitation. In addition, their small size and high stability in ectopic environments have enabled their use in all areas of cell research, including structural biology, advanced microscopy, and intracellular expression. Understanding these novel reagents as genetic modules that can be integrated into cellular pathways opens up a broad experimental spectrum to monitor and manipulate cellular processes. © 2015 Helma et al.

The effect of nanoparticle size on in vivo pharmacokinetics and cellular interaction

PubMed Central

Hoshyar, Nazanin; Gray, Samantha; Han, Hongbin; Bao, Gang

2016-01-01

Nanoparticle-based technologies offer exciting new approaches to disease diagnostics and therapeutics. To take advantage of unique properties of nanoscale materials and structures, the size, shape and/or surface chemistry of nanoparticles need to be optimized, allowing their functionalities to be tailored for different biomedical applications. Here we review the effects of nanoparticle size on cellular interaction and in vivo pharmacokinetics, including cellular uptake, biodistribution and circulation half-life of nanoparticles. Important features of nanoparticle probes for molecular imaging and modeling of nanoparticle size effects are also discussed. PMID:27003448

Cellular Automata with Anticipation: Examples and Presumable Applications

NASA Astrophysics Data System (ADS)

Krushinsky, Dmitry; Makarenko, Alexander

2010-11-01

One of the most prospective new methodologies for modelling is the so-called cellular automata (CA) approach. According to this paradigm, the models are built from simple elements connected into regular structures with local interaction between neighbours. The patterns of connections usually have a simple geometry (lattices). As one of the classical examples of CA we mention the game `Life' by J. Conway. This paper presents two examples of CA with anticipation property. These examples include a modification of the game `Life' and a cellular model of crowd movement.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Advances in molecular labeling, high throughput imaging and machine intelligence portend powerful functional cellular biochemistry tools.

PubMed

Price, Jeffrey H; Goodacre, Angela; Hahn, Klaus; Hodgson, Louis; Hunter, Edward A; Krajewski, Stanislaw; Murphy, Robert F; Rabinovich, Andrew; Reed, John C; Heynen, Susanne

2002-01-01

Cellular behavior is complex. Successfully understanding systems at ever-increasing complexity is fundamental to advances in modern science and unraveling the functional details of cellular behavior is no exception. We present a collection of prospectives to provide a glimpse of the techniques that will aid in collecting, managing and utilizing information on complex cellular processes via molecular imaging tools. These include: 1) visualizing intracellular protein activity with fluorescent markers, 2) high throughput (and automated) imaging of multilabeled cells in statistically significant numbers, and 3) machine intelligence to analyze subcellular image localization and pattern. Although not addressed here, the importance of combining cell-image-based information with detailed molecular structure and ligand-receptor binding models cannot be overlooked. Advanced molecular imaging techniques have the potential to impact cellular diagnostics for cancer screening, clinical correlations of tissue molecular patterns for cancer biology, and cellular molecular interactions for accelerating drug discovery. The goal of finally understanding all cellular components and behaviors will be achieved by advances in both instrumentation engineering (software and hardware) and molecular biochemistry. Copyright 2002 Wiley-Liss, Inc.

Mathematical Modeling of Cellular Metabolism.

PubMed

Berndt, Nikolaus; Holzhütter, Hermann-Georg

Cellular metabolism basically consists of the conversion of chemical compounds taken up from the extracellular environment into energy (conserved in energy-rich bonds of organic phosphates) and a wide array of organic molecules serving as catalysts (enzymes), information carriers (nucleic acids), and building blocks for cellular structures such as membranes or ribosomes. Metabolic modeling aims at the construction of mathematical representations of the cellular metabolism that can be used to calculate the concentration of cellular molecules and the rates of their mutual chemical interconversion in response to varying external conditions as, for example, hormonal stimuli or supply of essential nutrients. Based on such calculations, it is possible to quantify complex cellular functions as cellular growth, detoxification of drugs and xenobiotic compounds or synthesis of exported molecules. Depending on the specific questions to metabolism addressed, the methodological expertise of the researcher, and available experimental information, different conceptual frameworks have been established, allowing the usage of computational methods to condense experimental information from various layers of organization into (self-) consistent models. Here, we briefly outline the main conceptual frameworks that are currently exploited in metabolism research.

Studies on the structure of the boundary tissue of the white rat seminiferous tubules.

PubMed

Cieciura, L

1988-01-01

The studies on boundary tissue of the white rat seminiferous tubules with light and electron microscopy were carried out. The wall of the tubules consists of four layers: two cellular and two amorphous ones. In cellular external sheath the characteristic intercellular fissures a network of hexagonal meshes were seen resembling the honey-combs.

Regulation of cellular senescence by the essential caveolar component PTRF/Cavin-1

PubMed Central

Bai, Lin; Deng, Xiaoli; Li, Juanjuan; Wang, Miao; Li, Qian; An, Wei; A, Deli; Cong, Yu-Sheng

2011-01-01

Polymerase I and transcript release factor (PTRF, also known as Cavin-1) is an essential component in the biogenesis and function of caveolae. Here, we show that PTRF expression is increased in senescent human fibroblasts. Importantly, overexpression of PTRF induced features characteristic of cellular senescence, whereas reduced PTRF expression extended the cellular replicative lifespan. Interestingly, we found that PTRF localized primarily to the nuclei of young and quiescent WI-38 human fibroblasts, but translocated to the cytosol and plasma membrane during cellular senescence. Furthermore, electron microscopic analysis demonstrated an increased number of caveolar structures in senescent and PTRF-transfected WI-38 cells. Our data suggest that the role of PTRF in cellular senescence is dependent on its targeting to caveolae and its interaction with caveolin-1, which appeared to be regulated by the phosphorylation of PTRF. Taken together, our findings identify PTRF as a novel regulator of cellular senescence that acts through the p53/p21 and caveolar pathways. PMID:21445100

Evaluation of cellular glasses for solar mirror panel applications

NASA Technical Reports Server (NTRS)

Giovan, M.; Adams, M.

1979-01-01

An analytic technique was developed to compare the structural and environmental performance of various materials considered for backing of second surface glass solar mirrors. Cellular glass was determined to be a prime candidate due to its low cost, high stiffness-to-weight ratio, thermal expansion match to mirror glass, evident minimal environmental impact and chemical and dimensional stability under conditions of use. The current state of the art and anticipated developments in cellular glass technology are discussed; material properties are correlated to design requirements. A mathematical model is presented which suggests a design approach which allows minimization of life cost; and, a mechanical and environmental testing program is outlined, designed to provide a material property basis for development of cellular glass hardware, together with methodology for collecting lifetime predictive data. Preliminary material property data from measurements are given. Microstructure of several cellular materials is shown, and sensitivity of cellular glass to freeze-thaw degradation and to slow crack growth is discussed. The effect of surface coating is addressed.

Wavelet-based multiscale analysis of bioimpedance data measured by electric cell-substrate impedance sensing for classification of cancerous and normal cells.

PubMed

Das, Debanjan; Shiladitya, Kumar; Biswas, Karabi; Dutta, Pranab Kumar; Parekh, Aditya; Mandal, Mahitosh; Das, Soumen

2015-12-01

The paper presents a study to differentiate normal and cancerous cells using label-free bioimpedance signal measured by electric cell-substrate impedance sensing. The real-time-measured bioimpedance data of human breast cancer cells and human epithelial normal cells employs fluctuations of impedance value due to cellular micromotions resulting from dynamic structural rearrangement of membrane protrusions under nonagitated condition. Here, a wavelet-based multiscale quantitative analysis technique has been applied to analyze the fluctuations in bioimpedance. The study demonstrates a method to classify cancerous and normal cells from the signature of their impedance fluctuations. The fluctuations associated with cellular micromotion are quantified in terms of cellular energy, cellular power dissipation, and cellular moments. The cellular energy and power dissipation are found higher for cancerous cells associated with higher micromotions in cancer cells. The initial study suggests that proposed wavelet-based quantitative technique promises to be an effective method to analyze real-time bioimpedance signal for distinguishing cancer and normal cells.

Nuclear microprobe imaging of gallium nitrate in cancer cells

NASA Astrophysics Data System (ADS)

Ortega, Richard; Suda, Asami; Devès, Guillaume

2003-09-01

Gallium nitrate is used in clinical oncology as treatment for hypercalcemia and for cancer that has spread to the bone. Its mechanism of antitumor action has not been fully elucidated yet. The knowledge of the intracellular distribution of anticancer drugs is of particular interest in oncology to better understand their cellular pharmacology. In addition, most metal-based anticancer compounds interact with endogenous trace elements in cells, altering their metabolism. The purpose of this experiment was to examine, by use of nuclear microprobe analysis, the cellular distribution of gallium and endogenous trace elements within cancer cells exposed to gallium nitrate. In a majority of cellular analyses, gallium was found homogeneously distributed in cells following the distribution of carbon. In a smaller number of cells, however, gallium appeared concentrated together with P, Ca and Fe within round structures of about 2-5 μm diameter located in the perinuclear region. These intracellular structures are typical of lysosomial material.

Microstructure and calorimetric behavior of laser welded open cell foams in CuZnAl shape memory alloy

NASA Astrophysics Data System (ADS)

Biffi, Carlo Alberto; Previtali, Barbara; Tuissi, Ausonio

Cellular shape memory alloys (SMAs) are very promising smart materials able to combine functional properties of the material with lightness, stiffness, and damping capacity of the cellular structure. Their processing with low modification of the material properties remains an open question. In this work, the laser weldability of CuZnAl SMA in the form of open cell foams was studied. The cellular structure was proved to be successfully welded in lap joint configuration by using a thin plate of the same alloy. Softening was seen in the welded bead in all the investigated ranges of process speed as well as a double stage heat affected zone was identified due to different microstructures; the martensitic transformation was shifted to higher temperatures and the corresponding peaks were sharper with respect to the base material due to the rapid solidification of the material. Anyways, no compositional variations were detected in the joints.

Predictive modeling of multicellular structure formation by using Cellular Particle Dynamics simulations

NASA Astrophysics Data System (ADS)

McCune, Matthew; Shafiee, Ashkan; Forgacs, Gabor; Kosztin, Ioan

2014-03-01

Cellular Particle Dynamics (CPD) is an effective computational method for describing and predicting the time evolution of biomechanical relaxation processes of multicellular systems. A typical example is the fusion of spheroidal bioink particles during post bioprinting structure formation. In CPD cells are modeled as an ensemble of cellular particles (CPs) that interact via short-range contact interactions, characterized by an attractive (adhesive interaction) and a repulsive (excluded volume interaction) component. The time evolution of the spatial conformation of the multicellular system is determined by following the trajectories of all CPs through integration of their equations of motion. CPD was successfully applied to describe and predict the fusion of 3D tissue construct involving identical spherical aggregates. Here, we demonstrate that CPD can also predict tissue formation involving uneven spherical aggregates whose volumes decrease during the fusion process. Work supported by NSF [PHY-0957914]. Computer time provided by the University of Missouri Bioinformatics Consortium.

A High-Performance Cellular Automaton Model of Tumor Growth with Dynamically Growing Domains

PubMed Central

Poleszczuk, Jan; Enderling, Heiko

2014-01-01

Tumor growth from a single transformed cancer cell up to a clinically apparent mass spans many spatial and temporal orders of magnitude. Implementation of cellular automata simulations of such tumor growth can be straightforward but computing performance often counterbalances simplicity. Computationally convenient simulation times can be achieved by choosing appropriate data structures, memory and cell handling as well as domain setup. We propose a cellular automaton model of tumor growth with a domain that expands dynamically as the tumor population increases. We discuss memory access, data structures and implementation techniques that yield high-performance multi-scale Monte Carlo simulations of tumor growth. We discuss tumor properties that favor the proposed high-performance design and present simulation results of the tumor growth model. We estimate to which parameters the model is the most sensitive, and show that tumor volume depends on a number of parameters in a non-monotonic manner. PMID:25346862

Functional response of osteoblasts in functionally gradient titanium alloy mesh arrays processed by 3D additive manufacturing.

PubMed

Nune, K C; Kumar, A; Misra, R D K; Li, S J; Hao, Y L; Yang, R

2017-02-01

We elucidate here the osteoblasts functions and cellular activity in 3D printed interconnected porous architecture of functionally gradient Ti-6Al-4V alloy mesh structures in terms of cell proliferation and growth, distribution of cell nuclei, synthesis of proteins (actin, vinculin, and fibronectin), and calcium deposition. Cell culture studies with pre-osteoblasts indicated that the interconnected porous architecture of functionally gradient mesh arrays was conducive to osteoblast functions. However, there were statistically significant differences in the cellular response depending on the pore size in the functionally gradient structure. The interconnected porous architecture contributed to the distribution of cells from the large pore size (G1) to the small pore size (G3), with consequent synthesis of extracellular matrix and calcium precipitation. The gradient mesh structure significantly impacted cell adhesion and influenced the proliferation stage, such that there was high distribution of cells on struts of the gradient mesh structure. Actin and vinculin showed a significant difference in normalized expression level of protein per cell, which was absent in the case of fibronectin. Osteoblasts present on mesh struts formed a confluent sheet, bridging the pores through numerous cytoplasmic extensions. The gradient mesh structure fabricated by electron beam melting was explored to obtain fundamental insights on cellular activity with respect to osteoblast functions. Copyright © 2016 Elsevier B.V. All rights reserved.

Nondestructive cryomicro-CT imaging enables structural and molecular analysis of human lung tissue.

PubMed

Vasilescu, Dragoş M; Phillion, André B; Tanabe, Naoya; Kinose, Daisuke; Paige, David F; Kantrowitz, Jacob J; Liu, Gang; Liu, Hanqiao; Fishbane, Nick; Verleden, Stijn E; Vanaudenaerde, Bart M; Lenburg, Marc; Stevenson, Christopher S; Spira, Avrum; Cooper, Joel D; Hackett, Tillie-Louise; Hogg, James C

2017-01-01

Micro-computed tomography (CT) enables three-dimensional (3D) imaging of complex soft tissue structures, but current protocols used to achieve this goal preclude cellular and molecular phenotyping of the tissue. Here we describe a radiolucent cryostage that permits micro-CT imaging of unfixed frozen human lung samples at an isotropic voxel size of (11 µm) 3 under conditions where the sample is maintained frozen at -30°C during imaging. The cryostage was tested for thermal stability to maintain samples frozen up to 8 h. This report describes the methods used to choose the materials required for cryostage construction and demonstrates that whole genome mRNA integrity and expression are not compromised by exposure to micro-CT radiation and that the tissue can be used for immunohistochemistry. The new cryostage provides a novel method enabling integration of 3D tissue structure with cellular and molecular analysis to facilitate the identification of molecular determinants of disease. The described micro-CT cryostage provides a novel way to study the three-dimensional lung structure preserved without the effects of fixatives while enabling subsequent studies of the cellular matrix composition and gene expression. This approach will, for the first time, enable researchers to study structural changes of lung tissues that occur with disease and correlate them with changes in gene or protein signatures. Copyright © 2017 the American Physiological Society.

Characterization of the Fluorescence Properties of 4-Dialkylaminochalcones and Investigation of the Cytotoxic Mechanism of Chalcones.

PubMed

Zhou, Bo; Jiang, Peixin; Lu, Junxuan; Xing, Chengguo

2016-07-01

Understanding the mechanisms responsible for the various biological activities of chalcones, particularly the direct cellular targets, presents an unmet challenge. Here, we prepared a series of fluorescent chalcone derivatives as chemical probes for their mechanistic investigation. Upon systematic physicochemical characterization, we explored their potential to elucidate the mode of action of chalcones' cytotoxicity. The fluorescence of the chalcones was found to be highly sensitive to structural and environmental factors. Structurally, a 4-dialkylamino group on the B ring, suitable electronic properties of the A ring substituents, and the planar conformation of the chalcone's core structure were essential for optimal fluorescence. Environmental factors influencing fluorescence included solvent polarity, pH, and the interactions of the chalcones with proteins and detergents. It was found that 18 chalcones showed a fluorescent brightness greater than 6000 M(-1)  cm(-1) in DMSO. However, water dramatically quenched the fluorescence, although it could be partially recovered in the presence of BSA or detergents. As expected, these fluorescent chalcones showed a sharp structure-activity relationship in their cellular cytotoxicity, leading to the identification of structurally similar cytotoxic and non-cytotoxic fluorescent chalcones as chemical probes. Confocal microscopy results revealed the co-localization of the cytotoxic probe C8 and tubulin in cells, supporting tubulin as the direct cellular target responsible for the cytotoxicity of chalcones. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cellular Electron Cryotomography: Toward Structural Biology In Situ.

PubMed

Oikonomou, Catherine M; Jensen, Grant J

2017-06-20

Electron cryotomography (ECT) provides three-dimensional views of macromolecular complexes inside cells in a native frozen-hydrated state. Over the last two decades, ECT has revealed the ultrastructure of cells in unprecedented detail. It has also allowed us to visualize the structures of macromolecular machines in their native context inside intact cells. In many cases, such machines cannot be purified intact for in vitro study. In other cases, the function of a structure is lost outside the cell, so that the mechanism can be understood only by observation in situ. In this review, we describe the technique and its history and provide examples of its power when applied to cell biology. We also discuss the integration of ECT with other techniques, including lower-resolution fluorescence imaging and higher-resolution atomic structure determination, to cover the full scale of cellular processes.

Students Fail to Transfer Knowledge of Chromosome Structure to Topics Pertaining to Cell Division

PubMed Central

Newman, Dina L.; Catavero, Christina M.; Wright, L. Kate

2012-01-01

Cellular processes that rely on knowledge of molecular behavior are difficult for students to comprehend. For example, thorough understanding of meiosis requires students to integrate several complex concepts related to chromosome structure and function. Using a grounded theory approach, we have unified classroom observations, assessment data, and in-depth interviews under the theory of knowledge transfer to explain student difficulties with concepts related to chromosomal behavior. In this paper, we show that students typically understand basic chromosome structure but do not activate cognitive resources that would allow them to explain macromolecular phenomena (e.g., homologous pairing during meiosis). To improve understanding of topics related to genetic information flow, we suggest that instructors use pedagogies and activities that prime students for making connections between chromosome structure and cellular processes. PMID:23222838

Ultra-spatial synchrotron radiation for imaging molecular chemical structure: Applications in plant and animal studies

DOE PAGES

Yu, Peiqiang

2007-01-01

Synchrotron-based Fourier transform infrared microspectroscopy (S-FTIR) has been developed as a rapid, direct, non-destructive, bioanalytical technique. This technique takes advantage of synchrotron light brightness and small effective source size and is capable of exploring the molecular chemical features and make-up within microstructures of a biological tissue without destruction of inherent structures at ultra-spatial resolutions within cellular dimension. To date there has been very little application of this advanced synchrotron technique to the study of plant and animal tissues' inherent structure at a cellular or subcellular level. In this article, a novel approach was introduced to show the potential of themore » newly developed, advanced synchrotron-based analytical technology, which can be used to reveal molecular structural-chemical features of various plant and animal tissues.« less

Modeling of fracture of protective concrete structures under impact loads

NASA Astrophysics Data System (ADS)

Radchenko, P. A.; Batuev, S. P.; Radchenko, A. V.; Plevkov, V. S.

2015-10-01

This paper presents results of numerical simulation of interaction between a Boeing 747-400 aircraft and the protective shell of a nuclear power plant. The shell is presented as a complex multilayered cellular structure consisting of layers of concrete and fiber concrete bonded with steel trusses. Numerical simulation was performed three-dimensionally using the original algorithm and software taking into account algorithms for building grids of complex geometric objects and parallel computations. Dynamics of the stress-strain state and fracture of the structure were studied. Destruction is described using a two-stage model that allows taking into account anisotropy of elastic and strength properties of concrete and fiber concrete. It is shown that wave processes initiate destruction of the cellular shell structure; cells start to destruct in an unloading wave originating after the compression wave arrival at free cell surfaces.

Noninvasive 3D Visualization of Defects and Crack Propagation in Layered Foam Structures by Phase Contrast Microimaging

NASA Technical Reports Server (NTRS)

Hu, Z. W.; DeCarlo, F.

2006-01-01

Applications of polymeric foams in our modern society continue to grow because of their light weight, high strength, excellent thermal and mechanical insulation, and the ease of engineering. Among others, closed-cell foam has been structurally used for thermally insulating the shuttle external tank. However, internal defects of the foams were difficult to observe non-invasively due to limited sensitivity to the low-density structures possessed by traditional imaging tools such as computed X-ray tomography By combining phase contrast X-ray imaging with pressure loading, we succeeded in precisely mapping intact cellular structure and defects inside the bulk of layered foam and visualizing its subsequent response to the pressure in three-dimensional space. The work demonstrated a powerfir1 approach for yielding insight into underlying problems in lightweight cellular materials otherwise unobtainable.

The evolution of void-filled cosmological structures

NASA Technical Reports Server (NTRS)

Regos, Eniko; Geller, Margaret J.

1991-01-01

1D, 2D, and 3D simulations are used here to investigate the salient features in the evolution of void-filled cosmological structures in universes with arbitrary values of Omega. It is found that the growth of a void as a function of time decreases significantly at the time corresponding to Omega = 0.5. In models constructed in 2D and 3D, suitable initial conditions lead to cellular structure with faceted voids similar to those observed in redshift surveys. Matter compressed to planes flows more rapidly toward condensations at the intersections than would be expected for spherical infall. The peculiar streaming velocities for void diameters of 5000 km/s should be observable. The simulations provide a more physical basis and dynamics for the bubbly and Voronois tesselation models used to derive statistical properties of cellular large-scale structure.

Structured crowding and its effects on enzyme catalysis.

PubMed

Ma, Buyong; Nussinov, Ruth

2013-01-01

Macromolecular crowding decreases the diffusion rate, shifts the equilibrium of protein-protein and protein-substrate interactions, and changes protein conformational dynamics. Collectively, these effects contribute to enzyme catalysis. Here we describe how crowding may bias the conformational change and dynamics of enzyme populations and in this way affect catalysis. Crowding effects have been studied using artificial crowding agents and in vivo-like environments. These studies revealed a correlation between protein dynamics and function in the crowded environment. We suggest that crowded environments be classified into uniform crowding and structured crowding. Uniform crowding represents random crowding conditions created by synthetic particles with a narrow size distribution. Structured crowding refers to the highly coordinated cellular environment, where proteins and other macromolecules are clustered and organized. In structured crowded environments the perturbation of protein thermal stability may be lower; however, it may still be able to modulate functions effectively and dynamically. Dynamic, allosteric enzymes could be more sensitive to cellular perturbations if their free energy landscape is flatter around the native state; on the other hand, if their free energy landscape is rougher, with high kinetic barriers separating deep minima, they could be more robust. Above all, cells are structured; and this holds both for the cytosol and for the membrane environment. The crowded environment is organized, which limits the search, and the crowders are not necessarily inert. More likely, they too transmit allosteric effects, and as such play important functional roles. Overall, structured cellular crowding may lead to higher enzyme efficiency and specificity.

Origins of the protein synthesis cycle

NASA Technical Reports Server (NTRS)

Fox, S. W.

1981-01-01

Largely derived from experiments in molecular evolution, a theory of protein synthesis cycles has been constructed. The sequence begins with ordered thermal proteins resulting from the self-sequencing of mixed amino acids. Ordered thermal proteins then aggregate to cell-like structures. When they contained proteinoids sufficiently rich in lysine, the structures were able to synthesize offspring peptides. Since lysine-rich proteinoid (LRP) also catalyzes the polymerization of nucleoside triphosphate to polynucleotides, the same microspheres containing LRP could have synthesized both original cellular proteins and cellular nucleic acids. The LRP within protocells would have provided proximity advantageous for the origin and evolution of the genetic code.

Laser-based nanoengineering of surface topographies for biomedical applications

NASA Astrophysics Data System (ADS)

Schlie, Sabrina; Fadeeva, Elena; Koroleva, Anastasia; Ovsianikov, Aleksandr; Koch, Jürgen; Ngezahayo, Anaclet; Chichkov, Boris. N.

2011-04-01

In this study femtosecond laser systems were used for nanoengineering of special surface topographies in silicon and titanium. Besides the control of feature sizes, we demonstrated that laser structuring caused changes in material wettability due to a reduced surface contact area. These laser-engineered topographies were tested for their capability to control cellular behavior of human fibroblasts, SH-SY5Y neuroblastoma cells, and MG-63 osteoblasts. We found that fibroblasts reduced cell growth on the structures, while the other cell types proliferated at the same rate. These findings make laser-surface structuring very attractive for biomedical applications. Finally, to explain the results the correlation between topography and the biophysics of cellular adhesion, which is the key step of selective cell control, is discussed.

Fundamental Characteristics of AAA+ Protein Family Structure and Function

PubMed Central

2016-01-01

Many complex cellular events depend on multiprotein complexes known as molecular machines to efficiently couple the energy derived from adenosine triphosphate hydrolysis to the generation of mechanical force. Members of the AAA+ ATPase superfamily (ATPases Associated with various cellular Activities) are critical components of many molecular machines. AAA+ proteins are defined by conserved modules that precisely position the active site elements of two adjacent subunits to catalyze ATP hydrolysis. In many cases, AAA+ proteins form a ring structure that translocates a polymeric substrate through the central channel using specialized loops that project into the central channel. We discuss the major features of AAA+ protein structure and function with an emphasis on pivotal aspects elucidated with archaeal proteins. PMID:27703410

Structure and biochemical characterization of proliferating cellular nuclear antigen from a parasitic protozoon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cardona-Felix, Cesar S.; Lara-Gonzalez, Samuel; Brieba, Luis G.

2012-02-08

Proliferating cellular nuclear antigen (PCNA) is a toroidal-shaped protein that is involved in cell-cycle control, DNA replication and DNA repair. Parasitic protozoa are early-diverged eukaryotes that are responsible for neglected diseases. In this work, a PCNA from a parasitic protozoon was identified, cloned and biochemically characterized and its crystal structure was determined. Structural and biochemical studies demonstrate that PCNA from Entamoeba histolytica assembles as a homotrimer that is able to interact with and stimulate the activity of a PCNA-interacting peptide-motif protein from E. histolytica, EhDNAligI. The data indicate a conservation of the biochemical mechanisms of PCNA-mediated interactions between metazoa, yeastmore » and parasitic protozoa.« less

Negative index effects from a homogeneous positive index prism

NASA Astrophysics Data System (ADS)

Marcus, Sherman W.; Epstein, Ariel

2017-12-01

Cellular structured negative index metamaterials in the form of a right triangular prism have often been tested by observing the refraction of a beam across the prism hypotenuse which is serrated in order to conform to the cell walls. We show that not only can this negative index effect be obtained from a homogeneous dielectric prism having a positive index of refraction, but in addition, for sampling at the walls of the cellular structure, the phase in the material has the illusory appearance of moving in a negative direction. Although many previous reports relied on refraction direction and phase velocity of prism structures to verify negative index design, our investigation indicates that to unambiguously demonstrate material negativity additional empirical evidence is required.

From SHAPE Signatures to 3-D Structures | Center for Cancer Research

Cancer.gov

RNAs undergo extensive folding to form sophisticated based-paired secondary structures that are, in part, indicators of more complex three-dimensional structures.  These 3-D shapes are an integral part of the cellular gene-expression machinery. Deconstructing these structures is no small matter, yet it is critical to understanding their function.

Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal

PubMed Central

Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

2014-01-01

Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a non­canonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided. PMID:25478840

Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal.

PubMed

Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

2014-12-01

Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a noncanonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided.

Cellular automata with object-oriented features for parallel molecular network modeling.

PubMed

Zhu, Hao; Wu, Yinghui; Huang, Sui; Sun, Yan; Dhar, Pawan

2005-06-01

Cellular automata are an important modeling paradigm for studying the dynamics of large, parallel systems composed of multiple, interacting components. However, to model biological systems, cellular automata need to be extended beyond the large-scale parallelism and intensive communication in order to capture two fundamental properties characteristic of complex biological systems: hierarchy and heterogeneity. This paper proposes extensions to a cellular automata language, Cellang, to meet this purpose. The extended language, with object-oriented features, can be used to describe the structure and activity of parallel molecular networks within cells. Capabilities of this new programming language include object structure to define molecular programs within a cell, floating-point data type and mathematical functions to perform quantitative computation, message passing capability to describe molecular interactions, as well as new operators, statements, and built-in functions. We discuss relevant programming issues of these features, including the object-oriented description of molecular interactions with molecule encapsulation, message passing, and the description of heterogeneity and anisotropy at the cell and molecule levels. By enabling the integration of modeling at the molecular level with system behavior at cell, tissue, organ, or even organism levels, the program will help improve our understanding of how complex and dynamic biological activities are generated and controlled by parallel functioning of molecular networks. Index Terms-Cellular automata, modeling, molecular network, object-oriented.

Combinatorial contextualization of peptidic epitopes for enhanced cellular immunity.

PubMed

Ito, Masaki; Hayashi, Kazumi; Adachi, Eru; Minamisawa, Tamiko; Homma, Sadamu; Koido, Shigeo; Shiba, Kiyotaka

2014-01-01

Invocation of cellular immunity by epitopic peptides remains largely dependent on empirically developed protocols, such as interfusion of aluminum salts or emulsification using terpenoids and surfactants. To explore novel vaccine formulation, epitopic peptide motifs were co-programmed with structural motifs to produce artificial antigens using our "motif-programming" approach. As a proof of concept, we used an ovalbumin (OVA) system and prepared an artificial protein library by combinatorially polymerizing MHC class I and II sequences from OVA along with a sequence that tends to form secondary structures. The purified endotoxin-free proteins were then examined for their ability to activate OVA-specific T-cell hybridoma cells after being processed within dendritic cells. One clone, F37A (containing three MHC I and two MHC II OVA epitopes), possessed a greater ability to evoke cellular immunity than the native OVA or the other artificial antigens. The sensitivity profiles of drugs that interfered with the F37A uptake differed from those of the other artificial proteins and OVA, suggesting that alteration of the cross-presentation pathway is responsible for the enhanced immunogenicity. Moreover, F37A, but not an epitopic peptide, invoked cellular immunity when injected together with monophosphoryl lipid A (MPL), and retarded tumor growth in mice. Thus, an artificially synthesized protein antigen induced cellular immunity in vivo in the absence of incomplete Freund's adjuvant or aluminum salts. The method described here could be potentially used for developing vaccines for such intractable ailments as AIDS, malaria and cancer, ailments in which cellular immunity likely play a crucial role in prevention and treatment.

3D Printed Shock Mitigating Structures

NASA Astrophysics Data System (ADS)

Schrand, Amanda; Elston, Edwin; Dennis, Mitzi; Metroke, Tammy; Chen, Chenggang; Patton, Steven; Ganguli, Sabyasachi; Roy, Ajit

Here we explore the durability, and shock mitigating potential, of solid and cellular 3D printed polymers and conductive inks under high strain rate, compressive shock wave and high g acceleration conditions. Our initial designs include a simple circuit with 4 resistors embedded into circular discs and a complex cylindrical gyroid shape. A novel ink consisting of silver-coated carbon black nanoparticles in a thermoplastic polyurethane was used as the trace material. One version of the disc structural design has the advantage of allowing disassembly after testing for direct failure analysis. After increasing impacts, printed and traditionally potted circuits were examined for functionality. Additionally, in the open disc design, trace cracking and delamination of resistors were able to be observed. In a parallel study, we examined the shock mitigating behavior of 3D printed cellular gyroid structures on a Split Hopkinson Pressure Bar (SHPB). We explored alterations to the classic SHPB setup for testing the low impedance, cellular samples to most accurately reflect the stress state inside the sample (strain rates from 700 to 1750 s-1). We discovered that the gyroid can effectively absorb the impact of the test resulting in crushing the structure. Future studies aim to tailor the unit cell dimensions for certain frequencies, increase print accuracy and optimize material compositions for conductivity and adhesion to manufacture more durable devices.

Towards a virtual lung: multi-scale, multi-physics modelling of the pulmonary system.

PubMed

Burrowes, K S; Swan, A J; Warren, N J; Tawhai, M H

2008-09-28

The essential function of the lung, gas exchange, is dependent on adequate matching of ventilation and perfusion, where air and blood are delivered through complex branching systems exposed to regionally varying transpulmonary and transmural pressures. Structure and function in the lung are intimately related, yet computational models in pulmonary physiology usually simplify or neglect structure. The geometries of the airway and vascular systems and their interaction with parenchymal tissue have an important bearing on regional distributions of air and blood, and therefore on whole lung gas exchange, but this has not yet been addressed by modelling studies. Models for gas exchange have typically incorporated considerable detail at the level of chemical reactions, with little thought for the influence of structure. To date, relatively little attention has been paid to modelling at the cellular or subcellular level in the lung, or to linking information from the protein structure/interaction and cellular levels to the operation of the whole lung. We review previous work in developing anatomically based models of the lung, airways, parenchyma and pulmonary vasculature, and some functional studies in which these models have been used. Models for gas exchange at several spatial scales are briefly reviewed, and the challenges and benefits from modelling cellular function in the lung are discussed.

Cellular DNA breakage by soy isoflavone genistein and its methylated structural analogue biochanin A.

PubMed

Ullah, Mohd Fahad; Shamim, Uzma; Hanif, Sarmad; Azmi, Asfar S; Hadi, Sheikh M

2009-11-01

Epidemiological studies have indicated that populations with high isoflavone intake through soy consumption have lower rates of breast, prostate, and colon cancer. The isoflavone polyphenol genistein in soybean is considered to be a potent chemopreventive agent against cancer. In order to explore the chemical basis of chemopreventive activity of genistein, in this paper we have examined the structure-activity relationship between genistein and its structural analogue biochanin A. We show that both genistein and its methylated derivative biochanin A are able to mobilize nuclear copper in human lymphocyte, leading to degradation of cellular DNA. However, the relative rate of DNA breakage was greater in the case of genistein. Further, the cellular DNA degradation was inhibited by copper chelator (neocuproine/bathocuproine) but not by compounds that specifically bind iron and zinc (desferrioxamine mesylate and histidine, respectively). We also compared the antioxidant activity of the two isoflavones against tert-butylhydroperoxide-induced oxidative breakage in lymphocytes. Again genistein was found to be more effective than biochanin A in providing protection against oxidative stress induced by tert-butylhydroperoxide. It would therefore appear that the structural features of isoflavones that are important for antioxidant properties are also the ones that contribute to their pro-oxidant action through a mechanism that involves redox cycling of chromatin-bound nuclear copper.

Pathway towards Programmable Wave Anisotropy in Cellular Metamaterials

NASA Astrophysics Data System (ADS)

Celli, Paolo; Zhang, Weiting; Gonella, Stefano

2018-01-01

In this work, we provide a proof-of-concept experimental demonstration of the wave-control capabilities of cellular metamaterials endowed with populations of tunable electromechanical resonators. Each independently tunable resonator comprises a piezoelectric patch and a resistor-inductor shunt, and its resonant frequency can be seamlessly reprogrammed without interfering with the cellular structure's default properties. We show that, by strategically placing the resonators in the lattice domain and by deliberately activating only selected subsets of them, chosen to conform to the directional features of the beamed wave response, it is possible to override the inherent wave anisotropy of the cellular medium. The outcome is the establishment of tunable spatial patterns of energy distillation resulting in a nonsymmetric correction of the wave fields.

Fracture mechanics of cellular glass

NASA Technical Reports Server (NTRS)

Zwissler, J. G.; Adams, M. A.

1981-01-01

The fracture mechanics of cellular glasses (for the structural substrate of mirrored glass for solr concentrator reflecting panels) are discussed. Commercial and developmental cellular glasses were tested and analyzed using standard testing techniques and models developed from linear fracture mechanics. Two models describing the fracture behavior of these materials were developed. Slow crack growth behavior in cellular glass was found to be more complex than that encountered in dense glasses or ceramics. The crack velocity was found to be strongly dependent upon water vapor transport to the tip of the moving crack. The existence of a static fatigue limit was not conclusively established, however, it is speculated that slow crack growth behavior in Region 1 may be slower, by orders of magnitude, than that found in dense glasses.

Shape selection criterion for cellular array during constrained growth of binary alloys - Need for low gravity experiment

NASA Technical Reports Server (NTRS)

Tewari, Surendra N.; Trivedi, Rohit

1991-01-01

Development of steady-state periodic cellular array is one of the critical problems in the study of nonlinear pattern formation during directional solidification of binary alloys. The criterion which establishes the values of cell tip radius and spacing under given growth condition is not known. Theoretical models, such as marginal stability and microscopic solvability, have been developed for purely diffusive regime. However, the experimental conditions where cellular structures are stable are precisely the ones where the convection effects are predominant. Thus, the critical data for meaningful evaluation of cellular array growth models can only be obtained by partial directional solidification and quenching experiments carried out in the low gravity environment of space.

Endoplasmic Reticulum-Plasma Membrane Contacts Regulate Cellular Excitability.

PubMed

Dickson, Eamonn J

2017-01-01

Cells that have intrinsic electrical excitability utilize changes in membrane potential to communicate with neighboring cells and initiate cellular cascades. Excitable cells like neurons and myocytes have evolved highly specialized subcellular architectures to translate these electrical signals into cellular events. One such structural specialization is sarco-/endoplasmic reticulum-plasma membrane contact sites. These membrane contact sites are positioned by specific membrane-membrane tethering proteins and contain an ever-expanding list of additional proteins that organize information transfer across the junctional space (~ 15-25 nm distance) to shape membrane identity and control cellular excitability. In this chapter we discuss how contacts between the sarco-/endoplasmic reticulum and plasma membrane are essential for regulated excitation-contraction coupling in striated muscle and control of lipid-dependent ion channels.

Influence of microgravity on cellular differentiation in root caps of Zea mays

NASA Technical Reports Server (NTRS)

Moore, R.; Fondren, W. M.; McClelen, C. E.; Wang, C. L.

1987-01-01

We launched imbibed seeds of Zea mays into outer space aboard the space shuttle Columbia to determine the influence of microgravity on cellular differentiation in root caps. The influence of microgravity varied with different stages of cellular differentiation. Overall, microgravity tended to 1) increase relative volumes of hyaloplasm and lipid bodies, 2) decrease the relative volumes of plastids, mitochondria, dictyosomes, and the vacuome, and 3) exert no influence on the relative volume of nuclei in cells comprising the root cap. The reduced allocation of dictyosomal volume in peripheral cells of flight-grown seedlings correlated positively with their secretion of significantly less mucilage than peripheral cells of Earth-grown seedlings. These results indicate that 1) microgravity alters the patterns of cellular differentiation and structures of all cell types comprising the root cap, and 2) the influence of microgravity on cellular differentiation in root caps of Zea mays is organelle specific.

Evolutionary Relationships Based on Cellular Structure.

ERIC Educational Resources Information Center

Van Winkle, Lon J.

1979-01-01

This laboratory exercise integrates the topics of cell structure, classification of living organisms, and evolution. It is suitable for secondary or college biology courses and was used in an interdisciplinary science course for nonscience majors. (BB)

Using small molecule reagents to help distinguish among prion structural models

USDA-ARS?s Scientific Manuscript database

The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...

Conception on the Cell Mechanisms of Bone Tissue Loss

NASA Astrophysics Data System (ADS)

Rodionova, N. V.

2008-06-01

Basing on the analysis of available literature, the results of our own electron microscopic and radioautographic researches the data are presented about the morphofunctional peculiarities and succession of cellular interactions in adaptive remodeling of bone structures after exposure of animals (rats, monkeys) to microgravity (station SLS-2, Bion-11). The probable cellular mechanisms of the development of osteopenia and osteoporosis are considered.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A cellular automaton implementation of a quantum battle of the sexes game with imperfect information

NASA Astrophysics Data System (ADS)

Alonso-Sanz, Ramón

2015-10-01

The dynamics of a spatial quantum formulation of the iterated battle of the sexes game with imperfect information is studied in this work. The game is played with variable entangling in a cellular automata manner, i.e. with local and synchronous interaction. The effect of spatial structure is assessed in fair and unfair scenarios.

Raman microscopy of bladder cancer cells expressing green fluorescent protein

NASA Astrophysics Data System (ADS)

Mandair, Gurjit S.; Han, Amy L.; Keller, Evan T.; Morris, Michael D.

2016-11-01

Gene engineering is a commonly used tool in cellular biology to determine changes in function or expression of downstream targets. However, the impact of genetic modulation on biochemical effects is less frequently evaluated. The aim of this study is to use Raman microscopy to assess the biochemical effects of gene silencing on T24 and UMUC-13 bladder cancer cell lines. Cellular biochemical information related to nucleic acid and lipogenic components was obtained from deconvolved Raman spectra. We show that the green fluorescence protein (GFP), the chromophore that served as a fluorescent reporter for gene silencing, could also be detected by Raman microscopy. Only the gene-silenced UMUC-13 cell lines exhibited low-to-moderate GFP fluorescence as determined by fluorescence imaging and Raman spectroscopic studies. Moreover, we show that gene silencing and cell phenotype had a greater effect on nucleic acid and lipogenic components with minimal interference from GFP expression. Gene silencing was also found to perturb cellular protein secondary structure in which the amount of disorderd protein increased at the expense of more ordered protein. Overall, our study identified the spectral signature for cellular GFP expression and elucidated the effects of gene silencing on cancer cell biochemistry and protein secondary structure.

Analysis of Students' Aptitude to Provide Meaning to Images that Represent Cellular Components at the Molecular Level

PubMed Central

Dahmani, Hassen-Reda; Schneeberger, Patricia

2009-01-01

The number of experimentally derived structures of cellular components is rapidly expanding, and this phenomenon is accompanied by the development of a new semiotic system for teaching. The infographic approach is shifting from a schematic toward a more realistic representation of cellular components. By realistic we mean artist-prepared or computer graphic images that closely resemble experimentally derived structures and are characterized by a low level of styling and simplification. This change brings about a new challenge for teachers: designing course instructions that allow students to interpret these images in a meaningful way. To determine how students deal with this change, we designed several image-based, in-course assessments. The images were highly relevant for the cell biology course but did not resemble any of the images in the teaching documents. We asked students to label the cellular components, describe their function, or both. What we learned from these tests is that realistic images, with a higher apparent level of complexity, do not deter students from investigating their meaning. When given a choice, the students do not necessarily choose the most simplified representation, and they were sensitive to functional indications embedded in realistic images. PMID:19723817

Proteomic analysis reveals diverse proline hydroxylation-mediated oxygen-sensing cellular pathways in cancer cells

PubMed Central

Liu, Bing; Gao, Yankun; Ruan, Hai-Bin; Chen, Yue

2016-01-01

Proline hydroxylation is a critical cellular mechanism regulating oxygen-response pathways in tumor initiation and progression. Yet, its substrate diversity and functions remain largely unknown. Here, we report a system-wide analysis to characterize proline hydroxylation substrates in cancer cells using an immunoaffinity-purification assisted proteomics strategy. We identified 562 sites from 272 proteins in HeLa cells. Bioinformatic analysis revealed that proline hydroxylation substrates are significantly enriched with mRNA processing and stress-response cellular pathways with canonical and diverse flanking sequence motifs. Structural analysis indicates a significant enrichment of proline hydroxylation participating in the secondary structure of substrate proteins. Our study identified and validated Brd4, a key transcription factor, as a novel proline hydroxylation substrate. Functional analysis showed that the inhibition of proline hydroxylation pathway significantly reduced the proline hydroxylation abundance on Brd4 and affected Brd4-mediated transcriptional activity as well as cell proliferation in AML leukemia cells. Taken together, our study identified a broad regulatory role of proline hydroxylation in cellular oxygen-sensing pathways and revealed potentially new targets that dynamically respond to hypoxia microenvironment in tumor cells. PMID:27764789

High-speed imaging and small-scale explosive characterization techniques to understand effects of primary blast-induced injury on nerve cell structure and function

NASA Astrophysics Data System (ADS)

Piehler, T.; Banton, R.; Zander, N.; Duckworth, J.; Benjamin, R.; Sparks, R.

2018-01-01

Traumatic brain injury (TBI) is often associated with blast exposure. Even in the absence of penetrating injury or evidence of tissue injury on imaging, blast TBI may trigger a series of neural/glial cellular and functional changes. Unfortunately, the diagnosis and proper treatment of mild traumatic brain injury (mTBI) caused by explosive blast is challenging, as it is not easy to clinically distinguish blast from non-blast TBI on the basis of patient symptoms. Damage to brain tissue, cell, and subcellular structures continues to occur slowly and in a manner undetectable by conventional imaging techniques. The threshold shock impulse levels required to induce damage and the cumulative effects upon multiple exposures are not well characterized. Understanding how functional and structural damage from realistic blast impact at cellular and tissue levels at variable timescales after mTBI events may be vital for understanding this injury phenomenon and for linking mechanically induced structural changes with measurable effects on the nervous system. Our working hypothesis is that there is some transient physiological dysfunction occurring at cellular and subcellular levels within the central nervous system due to primary blast exposure. We have developed a novel in vitro indoor experimental system that uses real military explosive charges to more accurately represent military blast exposure and to probe the effects of primary explosive blast on dissociated neurons. We believe this system offers a controlled experimental method to analyze and characterize primary explosive blast-induced cellular injury and to understand threshold injury phenomenon. This paper will also focus on the modeling aspect of our work and how it relates to the experimental work.

Mechanical behavior of regular open-cell porous biomaterials made of diamond lattice unit cells.

PubMed

Ahmadi, S M; Campoli, G; Amin Yavari, S; Sajadi, B; Wauthle, R; Schrooten, J; Weinans, H; Zadpoor, A A

2014-06-01

Cellular structures with highly controlled micro-architectures are promising materials for orthopedic applications that require bone-substituting biomaterials or implants. The availability of additive manufacturing techniques has enabled manufacturing of biomaterials made of one or multiple types of unit cells. The diamond lattice unit cell is one of the relatively new types of unit cells that are used in manufacturing of regular porous biomaterials. As opposed to many other types of unit cells, there is currently no analytical solution that could be used for prediction of the mechanical properties of cellular structures made of the diamond lattice unit cells. In this paper, we present new analytical solutions and closed-form relationships for predicting the elastic modulus, Poisson׳s ratio, critical buckling load, and yield (plateau) stress of cellular structures made of the diamond lattice unit cell. The mechanical properties predicted using the analytical solutions are compared with those obtained using finite element models. A number of solid and porous titanium (Ti6Al4V) specimens were manufactured using selective laser melting. A series of experiments were then performed to determine the mechanical properties of the matrix material and cellular structures. The experimentally measured mechanical properties were compared with those obtained using analytical solutions and finite element (FE) models. It has been shown that, for small apparent density values, the mechanical properties obtained using analytical and numerical solutions are in agreement with each other and with experimental observations. The properties estimated using an analytical solution based on the Euler-Bernoulli theory markedly deviated from experimental results for large apparent density values. The mechanical properties estimated using FE models and another analytical solution based on the Timoshenko beam theory better matched the experimental observations. Copyright © 2014 Elsevier Ltd. All rights reserved.

Relation of murine thoracic aortic structural and cellular changes with aging to passive and active mechanical properties.

PubMed

Wheeler, Jason B; Mukherjee, Rupak; Stroud, Robert E; Jones, Jeffrey A; Ikonomidis, John S

2015-02-25

Maintenance of the structure and mechanical properties of the thoracic aorta contributes to aortic function and is dependent on the composition of the extracellular matrix and the cellular content within the aortic wall. Age-related alterations in the aorta include changes in cellular content and composition of the extracellular matrix; however, the precise roles of these age-related changes in altering aortic mechanical function are not well understood. Thoracic aortic rings from the descending segment were harvested from C57BL/6 mice aged 6 and 21 months. Thoracic aortic diameter and wall thickness were higher in the old mice. Cellular density was reduced in the medial layer of aortas from the old mice; concomitantly, collagen content was higher in old mice, but elastin content was similar between young and old mice. Stress relaxation, an index of compliance, was reduced in aortas from old mice and correlated with collagen fraction. Contractility of the aortic rings following potassium stimulation was reduced in old versus young mice. Furthermore, collagen gel contraction by aortic smooth muscle cells was reduced with age. These results demonstrate that numerous age-related structural changes occurred in the thoracic aorta and were related to alterations in mechanical properties. Aortic contractility decreased with age, likely because of a reduction in medial cell number in addition to a smooth muscle contractile deficit. Together, these unique findings provide evidence that the age-related changes in structure and mechanical function coalesce to provide an aortic substrate that may be predisposed to aortopathies. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

Erythrocyte disorders leading to potassium loss and cellular dehydration.

PubMed

Glader, B E; Sullivan, D W

1979-01-01

RBC K loss and cellular dehydration are associated with a variety of normal and abnormal erythrocyte conditions. In some cases (normal RBC aging, pyruvate-kinase-deficient RBCs and irreversibly sickled cells) cation and water changes are related to adenosine triphosphate (ATP) depletion and to increased RBC calcium content. In other disorders, such as hereditary xerocytosis, cation depletion and cellular hydration are not related to altered energy or calcium metabolism. Rather, this condition is thought to be due to a structural membrane defect which is manifested by imbalanced cation leaks (K less greater than Na gain) for which the active cation transport is unable to compensate. None of the disorders described here are associated with known structural membrane alterations. The fact that K loss and cellular dehydration are common to several RBC disorders suggests that this phenomenon may have a direct role in membrane injury. This hypothesis is supported by two separate observations: 1)Formation of irreversible sickled cells in vitro is prevented if K and water loss are inhibited, and these effects are independent of ATP depletion and calcium accumulation; 2) the mean critical hemolytic volume is markedly reduced in K- and water-depleted normal RBCs. RBC dehydration without intracellular cation depletion, however, is not associated with changes in mean critical hemolytic volume. These data thus indicate that K loss may have a direct role in RBC membrane injury. The mechanism by which this occurs and the associated alterations in membrane structure, however, remain to be identified.

The critical protein interactions and structures that elicit growth deregulation in cancer and viral replication

PubMed Central

Ou, Horng D.; May, Andrew P.

2010-01-01

One of the greatest challenges in biomedicine is to define the critical targets and network interactions that are subverted to elicit growth deregulation in human cells. Understanding and developing rational treatments for cancer requires a definition of the key molecular targets and how they interact to elicit the complex growth deregulation phenotype. Viral proteins provide discerning and powerful probes to understand both how cells work and how they can be manipulated using a minimal number of components. The small DNA viruses have evolved to target inherent weaknesses in cellular protein interaction networks to hijack the cellular DNA and protein replication machinery. In the battle to escape the inevitability of senescence and programmed cell death, cancers have converged on similar mechanisms, through the acquisition and selection of somatic mutations that drive unchecked cellular replication in tumors. Understanding the dynamic mechanisms through which a minimal number of viral proteins promote host cells to undergo unscheduled and pathological replication is a powerful strategy to identify critical targets that are also disrupted in cancer. Viruses can therefore be used as tools to probe the system-wide protein-protein interactions and structures that drive growth deregulation in human cells. Ultimately this can provide a path for developing system context-dependent therapeutics. This review will describe ongoing experimental approaches using viruses to study pathways deregulated in cancer, with a particular focus on viral cellular protein-protein interactions and structures. PMID:21061422

Earlier Detection of Tumor Treatment Response Using Magnetic Resonance Diffusion Imaging with Oscillating Gradients

PubMed Central

Colvin, Daniel C.; Loveless, Mary E.; Does, Mark D.; Yue, Zou; Yankeelov, Thomas E.; Gore, John C.

2011-01-01

An improved method for detecting early changes in tumors in response to treatment, based on a modification of diffusion-weighted magnetic resonance imaging, has been demonstrated in an animal model. Early detection of therapeutic response in tumors is important both clinically and in pre-clinical assessments of novel treatments. Non-invasive imaging methods that can detect and assess tumor response early in the course of treatment, and before frank changes in tumor morphology are evident, are of considerable interest as potential biomarkers of treatment efficacy. Diffusion-weighted magnetic resonance imaging is sensitive to changes in water diffusion rates in tissues that result from structural variations in the local cellular environment, but conventional methods mainly reflect changes in tissue cellularity and do not convey information specific to micro-structural variations at sub-cellular scales. We implemented a modified imaging technique using oscillating gradients of the magnetic field for evaluating water diffusion rates over very short spatial scales that are more specific for detecting changes in intracellular structure that may precede changes in cellularity. Results from a study of orthotopic 9L gliomas in rat brains indicate that this method can detect changes as early as 24 hours following treatment with 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), when conventional approaches do not find significant effects. These studies suggest that diffusion imaging using oscillating gradients may be used to obtain an earlier indication of treatment efficacy than previous magnetic resonance imaging methods. PMID:21190804

Calcification and Silicification: Fossilization Potential of Cyanobacteria from Stromatolites of Niuafo‘ou's Caldera Lakes (Tonga) and Implications for the Early Fossil Record

PubMed Central

Kazmierczak, Józef; Łukomska-Kowalczyk, Maja; Kempe, Stephan

2012-01-01

Abstract Calcification and silicification processes of cyanobacterial mats that form stromatolites in two caldera lakes of Niuafo‘ou Island (Vai Lahi and Vai Si‘i) were evaluated, and their importance as analogues for interpreting the early fossil record are discussed. It has been shown that the potential for morphological preservation of Niuafo‘ou cyanobacteria is highly dependent on the timing and type of mineral phase involved in the fossilization process. Four main modes of mineralization of cyanobacteria organic parts have been recognized: (i) primary early postmortem calcification by aragonite nanograins that transform quickly into larger needle-like crystals and almost totally destroy the cellular structures, (ii) primary early postmortem silicification of almost intact cyanobacterial cells that leave a record of spectacularly well-preserved cellular structures, (iii) replacement by silica of primary aragonite that has already recrystallized and obliterated the cellular structures, (iv) occasional replacement of primary aragonite precipitated in the mucopolysaccharide sheaths and extracellular polymeric substances by Al-Mg-Fe silicates. These observations suggest that the extremely scarce earliest fossil record may, in part, be the result of (a) secondary replacement by silica of primary carbonate minerals (aragonite, calcite, siderite), which, due to recrystallization, had already annihilated the cellular morphology of the mineralized microbiota or (b) relatively late primary silicification of already highly degraded and no longer morphologically identifiable microbial remains. Key Words: Stromatolites—Cyanobacteria—Calcification—Silicification—Niuafo‘ou (Tonga)—Archean. Astrobiology 12, 535–548. PMID:22794297

Zn2+ at a cellular crossroads

PubMed Central

Liang, Xiaomeng; Dempski, Robert E.; Burdette, Shawn C.

2016-01-01

Zinc is an essential micronutrient for cellular homeostasis. Initially proposed to only contribute to cellular viability through structural roles and non-redox catalysis, advances in quantifying changes in nM and pM quantities of Zn2+ have elucidated increasing functions as an important signaling molecule. This includes Zn2+-mediated regulation of transcription factors and subsequent protein expression, storage and release of intracellular compartments of zinc quanta into the extracellular space which modulates plasma membrane protein function, as well as intracellular signaling pathways which contribute to the immune response. This review highlights some recent advances in our understanding of zinc signaling. PMID:27010344

Nonsynchronous updating in the multiverse of cellular automata

NASA Astrophysics Data System (ADS)

Reia, Sandro M.; Kinouchi, Osame

2015-04-01

In this paper we study updating effects on cellular automata rule space. We consider a subset of 6144 order-3 automata from the space of 262144 bidimensional outer-totalistic rules. We compare synchronous to asynchronous and sequential updatings. Focusing on two automata, we discuss how update changes destroy typical structures of these rules. Besides, we show that the first-order phase transition in the multiverse of synchronous cellular automata, revealed with the use of a recently introduced control parameter, seems to be robust not only to changes in update schema but also to different initial densities.

Protein structure in context: The molecular landscape of angiogenesis

PubMed Central

Span, Elise A.; Goodsell, David S.; Ramchandran, Ramani; Franzen, Margaret; Herman, Timothy; Sem, Daniel S.

2014-01-01

A team of students, educators, and researchers has developed new materials to teach cell signaling within its cellular context. Two non-traditional modalities are employed: physical models, to explore the atomic details of several of the proteins in the angiogenesis signaling cascade, and illustrations of the proteins in their cellular environment, to give an intuitive understanding of the cellular context of the pathway. The experiences of the team underscore the utility of these types of materials as an effective mode for fostering students’ understanding of the molecular world, and the scientific method used to define it. PMID:23868376

Nonsynchronous updating in the multiverse of cellular automata.

PubMed

Reia, Sandro M; Kinouchi, Osame

2015-04-01

In this paper we study updating effects on cellular automata rule space. We consider a subset of 6144 order-3 automata from the space of 262144 bidimensional outer-totalistic rules. We compare synchronous to asynchronous and sequential updatings. Focusing on two automata, we discuss how update changes destroy typical structures of these rules. Besides, we show that the first-order phase transition in the multiverse of synchronous cellular automata, revealed with the use of a recently introduced control parameter, seems to be robust not only to changes in update schema but also to different initial densities.

Effect of gravity on the stability and structure of lean hydrogen-air flames

NASA Technical Reports Server (NTRS)

Patnaik, G.; Kailasanath, K.

1991-01-01

Detailed, time-dependent, 2D numerical simulations with full hydrogen-oxygen chemistry are used to investigate the effects of gravity on the stability and structure of laminar flames in lean, premixed hydrogen-air mixtures. The calculations show that the effects of gravity becomes more important as the lean flammability limit is approached. In a 12 percent hydrogen-air mixture, gravity plays only a secondary role in determining the multidimensional structure of the flame with the stability and structure of the flame controlled primarily by the thermo-diffusive instability mechanism. However, in leaner hydrogen-air mixtures gravity becomes more important. Upward-propagating flames are highly curved and evolve into a bubble rising upwards in the tube. Downward-propagating flames are flat or even oscillate between structures with concave and convex curvatures. The zero-gravity flame shows only cellular structures. Cellular structures which are present in zero gravity can be suppressed by the effect of buoyancy for mixtures leaner than 11 percent hydrogen. These observations are explained on the basis of an interaction between the processes leading to buoyancy-induced Rayleigh-Taylor instability and the thermo-diffusive instability.

Cell Structure Study.

ERIC Educational Resources Information Center

Ekstrom, James V.

2000-01-01

Presents an activity in which students use microscopes and digital images to examine Elodea, a fresh water plant, before and after the process of plasmolysis, identify plant cellular structures before and after plasmolysis, and calculate the size of the plant's vacuole. (ASK)

Cellular Ti-6Al-4V structures with interconnected macro porosity for bone implants fabricated by selective electron beam melting.

PubMed

Heinl, Peter; Müller, Lenka; Körner, Carolin; Singer, Robert F; Müller, Frank A

2008-09-01

Selective electron beam melting (SEBM) was successfully used to fabricate novel cellular Ti-6Al-4V structures for orthopaedic applications. Micro computer tomography (microCT) analysis demonstrated the capability to fabricate three-dimensional structures with an interconnected porosity and pore sizes suitable for tissue ingrowth and vascularization. Mechanical properties, such as compressive strength and elastic modulus, of the tested structures were similar to those of human bone. Thus, stress-shielding effects after implantation might be avoided due to a reduced stiffness mismatch between implant and bone. A chemical surface modification using HCl and NaOH induced apatite formation during in vitro bioactivity tests in simulated body fluid under dynamic conditions. The modified bioactive surface is expected to enhance the fixation of the implant in the surrounding bone as well as to improve its long-term stability.

The Structure of an Infectious Human Polyomavirus and Its Interactions with Cellular Receptors.

PubMed

Hurdiss, Daniel L; Frank, Martin; Snowden, Joseph S; Macdonald, Andrew; Ranson, Neil A

2018-06-05

BK polyomavirus (BKV) causes polyomavirus-associated nephropathy and hemorrhagic cystitis in immunosuppressed patients. These are diseases for which we currently have limited treatment options, but potential therapies could include pre-transplant vaccination with a multivalent BKV vaccine or therapeutics which inhibit capsid assembly or block attachment and entry into target cells. A useful tool in such efforts would be a high-resolution structure of the infectious BKV virion and how this interacts with its full repertoire of cellular receptors. We present the 3.4-Å cryoelectron microscopy structure of native, infectious BKV in complex with the receptor fragment of GT1b ganglioside. We also present structural evidence that BKV can utilize glycosaminoglycans as attachment receptors. This work highlights features that underpin capsid stability and provides a platform for rational design and development of urgently needed pharmacological interventions for BKV-associated diseases. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Modeling of fracture of protective concrete structures under impact loads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Radchenko, P. A., E-mail: radchenko@live.ru; Batuev, S. P.; Radchenko, A. V.

This paper presents results of numerical simulation of interaction between a Boeing 747-400 aircraft and the protective shell of a nuclear power plant. The shell is presented as a complex multilayered cellular structure consisting of layers of concrete and fiber concrete bonded with steel trusses. Numerical simulation was performed three-dimensionally using the original algorithm and software taking into account algorithms for building grids of complex geometric objects and parallel computations. Dynamics of the stress-strain state and fracture of the structure were studied. Destruction is described using a two-stage model that allows taking into account anisotropy of elastic and strength propertiesmore » of concrete and fiber concrete. It is shown that wave processes initiate destruction of the cellular shell structure; cells start to destruct in an unloading wave originating after the compression wave arrival at free cell surfaces.« less

Time, space, and disorder in the expanding proteome universe.

PubMed

Minde, David-Paul; Dunker, A Keith; Lilley, Kathryn S

2017-04-01

Proteins are highly dynamic entities. Their myriad functions require specific structures, but proteins' dynamic nature ranges all the way from the local mobility of their amino acid constituents to mobility within and well beyond single cells. A truly comprehensive view of the dynamic structural proteome includes: (i) alternative sequences, (ii) alternative conformations, (iii) alternative interactions with a range of biomolecules, (iv) cellular localizations, (v) alternative behaviors in different cell types. While these aspects have traditionally been explored one protein at a time, we highlight recently emerging global approaches that accelerate comprehensive insights into these facets of the dynamic nature of protein structure. Computational tools that integrate and expand on multiple orthogonal data types promise to enable the transition from a disjointed list of static snapshots to a structurally explicit understanding of the dynamics of cellular mechanisms. © 2017 The Authors. Proteomics Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structure of the measles virus hemagglutinin bound to its cellular receptor SLAM.

PubMed

Hashiguchi, Takao; Ose, Toyoyuki; Kubota, Marie; Maita, Nobuo; Kamishikiryo, Jun; Maenaka, Katsumi; Yanagi, Yusuke

2011-02-01

Measles virus, a major cause of childhood morbidity and mortality worldwide, predominantly infects immune cells using signaling lymphocyte activation molecule (SLAM) as a cellular receptor. Here we present crystal structures of measles virus hemagglutinin (MV-H), the receptor-binding glycoprotein, in complex with SLAM. The MV-H head domain binds to a β-sheet of the membrane-distal ectodomain of SLAM using the side of its β-propeller fold. This is distinct from attachment proteins of other paramyxoviruses that bind receptors using the top of their β-propeller. The structure provides templates for antiviral drug design, an explanation for the effectiveness of the measles virus vaccine, and a model of the homophilic SLAM-SLAM interaction involved in immune modulations. Notably, the crystal structures obtained show two forms of the MV-H-SLAM tetrameric assembly (dimer of dimers), which may have implications for the mechanism of fusion triggering.

Effects of sub-lethal high-pressure homogenization treatment on the outermost cellular structures and the volatile-molecule profiles of two strains of probiotic lactobacilli.

PubMed

Tabanelli, Giulia; Vernocchi, Pamela; Patrignani, Francesca; Del Chierico, Federica; Putignani, Lorenza; Vinderola, Gabriel; Reinheimer, Jorge A; Gardini, Fausto; Lanciotti, Rosalba

2015-01-01

Applying sub-lethal levels of high-pressure homogenization (HPH) to lactic acid bacteria has been proposed as a method of enhancing some of their functional properties. Because the principal targets of HPH are the cell-surface structures, the aim of this study was to examine the effect of sub-lethal HPH treatment on the outermost cellular structures and the proteomic profiles of two known probiotic bacterial strains. Moreover, the effect of HPH treatment on the metabolism of probiotic cells within a dairy product during its refrigerated storage was investigated using SPME-GC-MS. Transmission electron microscopy was used to examine the microstructural changes in the outermost cellular structures due to HPH treatment. These alterations may be involved in the changes in some of the technological and functional properties of the strains that were observed after pressure treatment. Moreover, the proteomic profiles of the probiotic strains treated with HPH and incubated at 37°C for various periods showed different peptide patterns compared with those of the untreated cells. In addition, there were differences in the peaks that were observed in the low-mass spectral region (2000-3000 Da) of the spectral profiles of the control and treated samples. Due to pressure treatment, the volatile-molecule profiles of buttermilk inoculated with treated or control cells and stored at 4°C for 30 days exhibited overall changes in the aroma profile and in the production of molecules that improved its sensory profile, although the two different species imparted specific fingerprints to the product. The results of this study will contribute to understanding the changes that occur in the outermost cellular structures and the metabolism of LAB in response to HPH treatment. The findings of this investigation may contribute to elucidating the relationships between these changes and the alterations of the technological and functional properties of LAB induced by pressure treatment.

Cellular Particle Dynamics simulation of biomechanical relaxation processes of multi-cellular systems

NASA Astrophysics Data System (ADS)

McCune, Matthew; Kosztin, Ioan

2013-03-01

Cellular Particle Dynamics (CPD) is a theoretical-computational-experimental framework for describing and predicting the time evolution of biomechanical relaxation processes of multi-cellular systems, such as fusion, sorting and compression. In CPD, cells are modeled as an ensemble of cellular particles (CPs) that interact via short range contact interactions, characterized by an attractive (adhesive interaction) and a repulsive (excluded volume interaction) component. The time evolution of the spatial conformation of the multicellular system is determined by following the trajectories of all CPs through numerical integration of their equations of motion. Here we present CPD simulation results for the fusion of both spherical and cylindrical multi-cellular aggregates. First, we calibrate the relevant CPD model parameters for a given cell type by comparing the CPD simulation results for the fusion of two spherical aggregates to the corresponding experimental results. Next, CPD simulations are used to predict the time evolution of the fusion of cylindrical aggregates. The latter is relevant for the formation of tubular multi-cellular structures (i.e., primitive blood vessels) created by the novel bioprinting technology. Work supported by NSF [PHY-0957914]. Computer time provided by the University of Missouri Bioinformatics Consortium.

Microstructure-based hyperelastic models for closed-cell solids

PubMed Central

Wyatt, Hayley

2017-01-01

For cellular bodies involving large elastic deformations, mesoscopic continuum models that take into account the interplay between the geometry and the microstructural responses of the constituents are developed, analysed and compared with finite-element simulations of cellular structures with different architecture. For these models, constitutive restrictions for the physical plausibility of the material responses are established, and global descriptors such as nonlinear elastic and shear moduli and Poisson’s ratio are obtained from the material characteristics of the constituents. Numerical results show that these models capture well the mechanical responses of finite-element simulations for three-dimensional periodic structures of neo-Hookean material with closed cells under large tension. In particular, the mesoscopic models predict the macroscopic stiffening of the structure when the stiffness of the cell-core increases. PMID:28484340

Microstructure-based hyperelastic models for closed-cell solids.

PubMed

Mihai, L Angela; Wyatt, Hayley; Goriely, Alain

2017-04-01

For cellular bodies involving large elastic deformations, mesoscopic continuum models that take into account the interplay between the geometry and the microstructural responses of the constituents are developed, analysed and compared with finite-element simulations of cellular structures with different architecture. For these models, constitutive restrictions for the physical plausibility of the material responses are established, and global descriptors such as nonlinear elastic and shear moduli and Poisson's ratio are obtained from the material characteristics of the constituents. Numerical results show that these models capture well the mechanical responses of finite-element simulations for three-dimensional periodic structures of neo-Hookean material with closed cells under large tension. In particular, the mesoscopic models predict the macroscopic stiffening of the structure when the stiffness of the cell-core increases.

Microstructure-based hyperelastic models for closed-cell solids

NASA Astrophysics Data System (ADS)

Mihai, L. Angela; Wyatt, Hayley; Goriely, Alain

2017-04-01

For cellular bodies involving large elastic deformations, mesoscopic continuum models that take into account the interplay between the geometry and the microstructural responses of the constituents are developed, analysed and compared with finite-element simulations of cellular structures with different architecture. For these models, constitutive restrictions for the physical plausibility of the material responses are established, and global descriptors such as nonlinear elastic and shear moduli and Poisson's ratio are obtained from the material characteristics of the constituents. Numerical results show that these models capture well the mechanical responses of finite-element simulations for three-dimensional periodic structures of neo-Hookean material with closed cells under large tension. In particular, the mesoscopic models predict the macroscopic stiffening of the structure when the stiffness of the cell-core increases.

Rigor-like structures from muscle myosins reveal key mechanical elements in the transduction pathways of this allosteric motor.

PubMed

Yang, Yuting; Gourinath, S; Kovács, Mihály; Nyitray, László; Reutzel, Robbie; Himmel, Daniel M; O'Neall-Hennessey, Elizabeth; Reshetnikova, Ludmilla; Szent-Györgyi, Andrew G; Brown, Jerry H; Cohen, Carolyn

2007-05-01

Unlike processive cellular motors such as myosin V, whose structure has recently been determined in a "rigor-like" conformation, myosin II from contracting muscle filaments necessarily spends most of its time detached from actin. By using squid and sea scallop sources, however, we have now obtained similar rigor-like atomic structures for muscle myosin heads (S1). The significance of the hallmark closed actin-binding cleft in these crystal structures is supported here by actin/S1-binding studies. These structures reveal how different duty ratios, and hence cellular functions, of the myosin isoforms may be accounted for, in part, on the basis of detailed differences in interdomain contacts. Moreover, the rigor-like position of switch II turns out to be unique for myosin V. The overall arrangements of subdomains in the motor are relatively conserved in each of the known contractile states, and we explore qualitatively the energetics of these states.

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B.

Sulfur, most abundantly found in the environment as sulfate (SO 4 2-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO 4 2- at the molecular level is limited. CysZ has been described as a SO 4 2- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO 4 2- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO 4 2- across membranes. CysZ structures from three different bacterial speciesmore » display a hitherto unknown fold and have subunits organized with inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. In conclusion, mutational studies highlight the functional relevance of conserved CysZ residues.« less

Structure-based analysis of CysZ-mediated cellular uptake of sulfate

DOE PAGES

Assur Sanghai, Zahra; Liu, Qun; Clarke, Oliver B.; ...

2018-05-24

Sulfur, most abundantly found in the environment as sulfate (SO 4 2-), is an essential element in metabolites required by all living cells, including amino acids, co-factors and vitamins. However, current understanding of the cellular delivery of SO 4 2- at the molecular level is limited. CysZ has been described as a SO 4 2- permease, but its sequence family is without known structural precedent. Based on crystallographic structure information, SO 4 2- binding and flux experiments, we provide insight into the molecular mechanism of CysZ-mediated translocation of SO 4 2- across membranes. CysZ structures from three different bacterial speciesmore » display a hitherto unknown fold and have subunits organized with inverted transmembrane topology. CysZ from Pseudomonas denitrificans assembles as a trimer of antiparallel dimers and the CysZ structures from two other species recapitulate dimers from this assembly. In conclusion, mutational studies highlight the functional relevance of conserved CysZ residues.« less

Enterovirus 71 induces anti-viral stress granule-like structures in RD cells.

PubMed

Zhu, Yuanmei; Wang, Bei; Huang, He; Zhao, Zhendong

2016-08-05

Stress granules (SGs) are dynamic cytoplasmic granules formed in response to a variety of stresses, including viral infection. Several viruses can modulate the formation of SG with different effects, but the relationship between SG formation and EV71 infection is poorly understood. In this study, we report that EV71 inhibits canonical SGs formation in infected cells and induces the formation of novel RNA granules that were distinguished from canonical SGs in composition and morphology, which we termed 'SG like structures'. Our results also demonstrated that EV71 triggered formation of SG-like structures is dependent on PKR and eIF2α phosphorylation and requires ongoing cellular mRNA synthesis. Finally, we found that SG-like structures are antiviral RNA granules that promote cellular apoptosis and suppress EV71 propagation. Taken together, our findings explain the formation mechanism of SG-like structures induced by EV71 and shed light on virus-host interaction and molecular mechanism underlying EV71 pathogenesis. Copyright © 2016. Published by Elsevier Inc.

A microfluidic device for study of the effect of tumor vascular structures on the flow field and HepG2 cellular flow behaviors.

PubMed

Ke, Ming; Cai, Shaoxi; Zou, Misha; Zhao, Yi; Li, Bo; Chen, Sijia; Chen, Longcong

2018-01-29

To build a microfluidic device with various morphological features of the tumor vasculature for study of the effects of tumor vascular structures on the flow field and tumor cellular flow behaviors. The designed microfluidic device was able to approximatively simulate the in vivo structures of tumor vessels and the flow within it. In this models, the influences of the angle of bifurcation, the number of branches, and the narrow channels on the flow field and the influence of vorticity on the retention of HepG2 cells were significant. Additionally, shear stress below physiological conditions of blood circulation has considerable effect on the formation of the lumen-like structures (LLSs) of HepG2 cells. These results can provide some data and reference in the understanding of the interaction between hemorheological properties and tumor vascular structures in solid tumors. Copyright © 2018. Published by Elsevier Inc.

The cytoskeleton in cell-autonomous immunity: structural determinants of host defence

PubMed Central

Mostowy, Serge; Shenoy, Avinash R.

2016-01-01

Host cells use antimicrobial proteins, pathogen-restrictive compartmentalization and cell death in their defence against intracellular pathogens. Recent work has revealed that four components of the cytoskeleton — actin, microtubules, intermediate filaments and septins, which are well known for their roles in cell division, shape and movement — have important functions in innate immunity and cellular self-defence. Investigations using cellular and animal models have shown that these cytoskeletal proteins are crucial for sensing bacteria and for mobilizing effector mechanisms to eliminate them. In this Review, we highlight the emerging roles of the cytoskeleton as a structural determinant of cell-autonomous host defence. PMID:26292640

Experimental study of auxetic behavior of cellular structure

NASA Astrophysics Data System (ADS)

Chentsov, A. V.; Lisovenko, D. S.

2018-04-01

The uniaxial tension of two-dimensional auxetic cellular constructions is studied experimentally. Samples were made of nonauxetic polyethylene terephthalate (PET-A amorphous) and subjected to monotonous uniaxial tension until the last moment when they still remained plane. As a result of the experimental data analysis, comparison of the mechanical properties is given for a faultless sample and constructions in which one horizontal or vertical element in the central area of the sample was removed. It is shown that the lack of one horizontal element of the construction has little influence on the auxetic properties of these constructions unlike the structures with one vertical element being absent.

MAXIMA IN RATE-CONCENTRATION CURVES AND THEIR RELATION TO THE STRUCTURAL ASPECTS OF CELLULAR METABOLISM

PubMed Central

Spiegelman, S.; Reiner, J. M.

1945-01-01

1. Reproducible maxima are exhibited in the rate-concentration curves obtained by studying the effects of ethyl- and phenylurethanes on regeneration rates of hydranths in Tubularia. 2. The general problem of maxima in rate-concentration curves is analyzed in terms of reaction kinetics of relatively simple systems. 3. Certain systems were shown to exhibit this phenomenon. A comparison is made of these with similar ones which fail to do so. 4. The possible rôle in this phenomenon of cellular structure and its attendant geometrical constraints is discussed in terms of the above comparison. PMID:19873428

Interfacing cellular networks of S. cerevisiae and E. coli: Connecting dynamic and genetic information

PubMed Central

2013-01-01

Background In recent years, various types of cellular networks have penetrated biology and are nowadays used omnipresently for studying eukaryote and prokaryote organisms. Still, the relation and the biological overlap among phenomenological and inferential gene networks, e.g., between the protein interaction network and the gene regulatory network inferred from large-scale transcriptomic data, is largely unexplored. Results We provide in this study an in-depth analysis of the structural, functional and chromosomal relationship between a protein-protein network, a transcriptional regulatory network and an inferred gene regulatory network, for S. cerevisiae and E. coli. Further, we study global and local aspects of these networks and their biological information overlap by comparing, e.g., the functional co-occurrence of Gene Ontology terms by exploiting the available interaction structure among the genes. Conclusions Although the individual networks represent different levels of cellular interactions with global structural and functional dissimilarities, we observe crucial functions of their network interfaces for the assembly of protein complexes, proteolysis, transcription, translation, metabolic and regulatory interactions. Overall, our results shed light on the integrability of these networks and their interfacing biological processes. PMID:23663484

Cuttlebone-like V2O5 Nanofibre Scaffolds - Advances in Structuring Cellular Solids.

PubMed

Knöller, Andrea; Runčevski, Tomče; Dinnebier, Robert E; Bill, Joachim; Burghard, Zaklina

2017-02-20

The synthesis of ceramic materials combining high porosity and permeability with good mechanical stability is challenging, as optimising the latter requires compromises regarding the first two properties. Nonetheless, significant progress can be made in this direction by taking advantage of the structural design principles evolved by nature. Natural cellular solids achieve good mechanical stability via a defined hierarchical organisation of the building blocks they are composed of. Here, we report the first synthetic, ceramic-based scaffold whose architecture closely mimics that of cuttlebone -a structural biomaterial whose porosity exceeds that of most other natural cellular solids, whilst preserving an excellent mechanical strength. The nanostructured, single-component scaffold, obtained by ice-templated assembly of V 2 O 5 nanofibres, features a highly sophisticated and elaborate architecture of equally spaced lamellas, which are regularly connected by pillars as lamella support. It displays an unprecedented porosity of 99.8 %, complemented by an enhanced mechanical stability. This novel bioinspired, functional material not only displays mechanical characteristics similar to natural cuttlebone, but the multifunctionality of the V 2 O 5 nanofibres also renders possible applications, including catalysts, sensors and electrodes for energy storage.

Cuttlebone-like V2O5 Nanofibre Scaffolds - Advances in Structuring Cellular Solids

NASA Astrophysics Data System (ADS)

Knöller, Andrea; Runčevski, Tomče; Dinnebier, Robert E.; Bill, Joachim; Burghard, Zaklina

2017-02-01

The synthesis of ceramic materials combining high porosity and permeability with good mechanical stability is challenging, as optimising the latter requires compromises regarding the first two properties. Nonetheless, significant progress can be made in this direction by taking advantage of the structural design principles evolved by nature. Natural cellular solids achieve good mechanical stability via a defined hierarchical organisation of the building blocks they are composed of. Here, we report the first synthetic, ceramic-based scaffold whose architecture closely mimics that of cuttlebone -a structural biomaterial whose porosity exceeds that of most other natural cellular solids, whilst preserving an excellent mechanical strength. The nanostructured, single-component scaffold, obtained by ice-templated assembly of V2O5 nanofibres, features a highly sophisticated and elaborate architecture of equally spaced lamellas, which are regularly connected by pillars as lamella support. It displays an unprecedented porosity of 99.8 %, complemented by an enhanced mechanical stability. This novel bioinspired, functional material not only displays mechanical characteristics similar to natural cuttlebone, but the multifunctionality of the V2O5 nanofibres also renders possible applications, including catalysts, sensors and electrodes for energy storage.

A Symphony of Regulations Centered on p63 to Control Development of Ectoderm-Derived Structures

PubMed Central

Guerrini, Luisa; Costanzo, Antonio; Merlo, Giorgio R.

2011-01-01

The p53-related transcription factor p63 is critically important for basic cellular functions during development of the ectoderm and derived structure and tissues, including skin, limb, palate, and hair. On the one side, p63 is required to sustain the proliferation of keratinocyte progenitors, while on the other side it is required for cell stratification, commitment to differentiate, cell adhesion, and epithelial-mesenchymal signaling. Molecules that are components or regulators of the p63 pathway(s) are rapidly being identified, and it comes with no surprise that alterations in the p63 pathway lead to congenital conditions in which the skin and other ectoderm-derived structures are affected. In this paper, we summarize the current knowledge of the molecular and cellular regulations centered on p63, derived from the comprehension of p63-linked human diseases and the corresponding animal models, as well as from cellular models and high-throughput molecular approaches. We point out common themes and features, that allow to speculate on the possible role of p63 downstream events and their potential exploitation in future attempts to correct the congenital defect in preclinical studies. PMID:21716671

Efficient Analysis of Systems Biology Markup Language Models of Cellular Populations Using Arrays.

PubMed

Watanabe, Leandro; Myers, Chris J

2016-08-19

The Systems Biology Markup Language (SBML) has been widely used for modeling biological systems. Although SBML has been successful in representing a wide variety of biochemical models, the core standard lacks the structure for representing large complex regular systems in a standard way, such as whole-cell and cellular population models. These models require a large number of variables to represent certain aspects of these types of models, such as the chromosome in the whole-cell model and the many identical cell models in a cellular population. While SBML core is not designed to handle these types of models efficiently, the proposed SBML arrays package can represent such regular structures more easily. However, in order to take full advantage of the package, analysis needs to be aware of the arrays structure. When expanding the array constructs within a model, some of the advantages of using arrays are lost. This paper describes a more efficient way to simulate arrayed models. To illustrate the proposed method, this paper uses a population of repressilator and genetic toggle switch circuits as examples. Results show that there are memory benefits using this approach with a modest cost in runtime.

RAGE is a key cellular target for Aβ-induced perturbation in Alzheimer's disease

PubMed Central

Yan, Shirley ShiDu; Chen, Doris; Yan, Shiqian; Guo, Lan; Chen, John Xi

2013-01-01

RAGE, a receptor for advanced glycation endproducts, is an immunoglobulin-like cell surface receptor that is often described as a pattern recognition receptor due to the structural heterogeneity of its ligand. RAGE is an important cellular cofactor for amyloid β-peptide (Aβ)-mediated cellular perturbation relevant to the pathogenesis of Alzheimer's disease (AD). The interaction of RAGE with Aβ in neurons, microglia, and vascular cells accelerates and amplifies deleterious effects on neuronal and synaptic function. RAGE-dependent signaling contributes to Aβ-mediated amyloid pathology and cognitive dysfunction observed in the AD mouse model. Blockade of RAGE significantly attenuates neuronal and synaptic injury. In this review, we summarize the role of RAGE in the pathogenesis of AD, specifically in Aβ-induced cellular perturbation. PMID:22202057

Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

PubMed

Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

2012-01-01

Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

The effects of perception of risk and importance of answering and initiating a cellular phone call while driving.

PubMed

Nelson, Erik; Atchley, Paul; Little, Todd D

2009-05-01

Recent data suggest that laws banning cellular phone use while driving may not change use patterns, especially among young drivers with high rates of mobile phone adoption. We examined reasons younger drivers choose or do not choose to talk on a phone while driving among a sample of young drivers (n=276) with very high ownership of cellular phones (over 99%) and a very high use of cellular phones while driving (100% for those that were primary operators of an automobile). Respondents were surveyed for patterns of use, types of call, perceived risk, and motivations for use. The data were analyzed using structural equation modeling (SEM) to explore the relationships between perceived risk of the behavior, emotionality of the call, perceived importance of the call, and how often calls were initiated versus answered. The model suggests that even though people believe that talking on a cellular phone while driving is dangerous, they will tend to initiate a cellular conversation if they believe that the call is important.

Evaluation of nanoparticles as endocytic tracers in cellular microbiology

NASA Astrophysics Data System (ADS)

Zhang, Yuying; Hensel, Michael

2013-09-01

The study of pathogen interactions with eukaryotic host cells requires the introduction of fluorescent probes to visualize processes such as endocytosis, intracellular transport or host cell manipulation by the pathogen. Here, three types of fluorescent nanoparticles (NPs), i.e. Rhodamine-labeled polymethacrylate (PMA) NPs, silica NPs and gold NPs, were employed to label the host cellular endolysosomal system and monitor manipulations by the pathogen Salmonella enterica. Using live cell imaging, we investigated the performance of NPs in cellular uptake, labeling of endocytic vesicles and lysosomes, as well as interaction with the pathogen. We show that fluorescent gold and silica, but not PMA NPs appropriately label host cell structures and efficiently track rearrangements of the host endosomal system by the activities of intracellular Salmonella. Silica NPs slightly aggregated and located in Salmonella-induced compartments as isolated dots, while gold NPs distributed uniformly inside such structures. Both silica and gold NPs exhibited no adverse impact on either host cells or pathogens, and are versatile tools for infection biology.The study of pathogen interactions with eukaryotic host cells requires the introduction of fluorescent probes to visualize processes such as endocytosis, intracellular transport or host cell manipulation by the pathogen. Here, three types of fluorescent nanoparticles (NPs), i.e. Rhodamine-labeled polymethacrylate (PMA) NPs, silica NPs and gold NPs, were employed to label the host cellular endolysosomal system and monitor manipulations by the pathogen Salmonella enterica. Using live cell imaging, we investigated the performance of NPs in cellular uptake, labeling of endocytic vesicles and lysosomes, as well as interaction with the pathogen. We show that fluorescent gold and silica, but not PMA NPs appropriately label host cell structures and efficiently track rearrangements of the host endosomal system by the activities of intracellular Salmonella. Silica NPs slightly aggregated and located in Salmonella-induced compartments as isolated dots, while gold NPs distributed uniformly inside such structures. Both silica and gold NPs exhibited no adverse impact on either host cells or pathogens, and are versatile tools for infection biology. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr01550e

Sculpting Cells with Play Doh.

ERIC Educational Resources Information Center

Way, Virginia A.

1982-01-01

Suggests using Play Doh to mold models of the nucleus, mitochondria, and inner cellular structures. Students can conceptualize the cell's structures as three-dimensional even though they appear two-dimensional under a microscope. Includes instructions for preparing homemade dough. (Author/JN)

Fatigue and biological properties of Ti-6Al-4V ELI cellular structures with variously arranged cubic cells made by selective laser melting.

PubMed

Dallago, M; Fontanari, V; Torresani, E; Leoni, M; Pederzolli, C; Potrich, C; Benedetti, M

2018-02-01

Traditional implants made of bulk titanium are much stiffer than human bone and this mismatch can induce stress shielding. Although more complex to produce and with less predictable properties compared to bulk implants, implants with a highly porous structure can be produced to match the bone stiffness and at the same time favor bone ingrowth and regeneration. This paper presents the results of the mechanical and dimensional characterization of different regular cubic open-cell cellular structures produced by Selective Laser Melting (SLM) of Ti6Al4V alloy, all with the same nominal elastic modulus of 3GPa that matches that of human trabecular bone. The main objective of this research was to determine which structure has the best fatigue resistance through fully reversed fatigue tests on cellular specimens. The quality of the manufacturing process and the discrepancy between the actual measured cell parameters and the nominal CAD values were assessed through an extensive metrological analysis. The results of the metrological assessment allowed us to discuss the effect of manufacturing defects (porosity, surface roughness and geometrical inaccuracies) on the mechanical properties. Half of the specimens was subjected to a stress relief thermal treatment while the other half to Hot Isostatic Pressing (HIP), and we compared the effect of the treatments on porosity and on the mechanical properties. Fatigue strength seems to be highly dependent on the surface irregularities and notches introduced during the manufacturing process. In fully reversed fatigue tests, the high performances of stretching dominated structures compared to bending dominated structures are not found. In fact, with thicker struts, such structures proved to be more resistant, even if bending actions were present. Copyright © 2017 Elsevier Ltd. All rights reserved.

A core viral protein binds host nucleosomes to sequester immune danger signals

PubMed Central

Avgousti, Daphne C.; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J.; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C.; Blumenthal, Daniel; Paris, Andrew J.; Reyes, Emigdio D.; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H.; Worthen, G. Scott; Black, Ben E.; Garcia, Benjamin A.; Weitzman, Matthew D.

2016-01-01

Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses1. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important role in innate immune responses2. Viral encoded core basic proteins compact viral genomes but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones3. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles4,5, it is unknown whether protein VII impacts cellular chromatin. Our observation that protein VII alters cellular chromatin led us to hypothesize that this impacts antiviral responses during adenovirus infection. We found that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in chromatin of members of the high-mobility group protein B family (HMGB1, HMGB2, and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses6,7. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling. PMID:27362237

Determination of the mechanical properties of solid and cellular polymeric dosage forms by diametral compression.

PubMed

Blaesi, Aron H; Saka, Nannaji

2016-07-25

At present, the immediate-release solid dosage forms, such as the oral tablets and capsules, are granular solids. They release drug rapidly and have adequate mechanical properties, but their manufacture is fraught with difficulties inherent in processing particulate matter. Such difficulties, however, could be overcome by liquid-based processing. Therefore, we have recently introduced polymeric cellular (i.e., highly porous) dosage forms prepared from a melt process. Experiments have shown that upon immersion in a dissolution medium, the cellular dosage forms with polyethylene glycol (PEG) as excipient and with predominantly open-cell topology disintegrate by exfoliation, thus enabling rapid drug release. If the volume fraction of voids of the open-cell structures is too large, however, their mechanical strength is adversely affected. At present, the common method for determining the tensile strength of brittle, solid dosage forms (such as select granular forms) is the diametral compression test. In this study, the theory of diametral compression is first refined to demonstrate that the relevant mechanical properties of ductile and cellular solids (i.e., the elastic modulus and the yield strength) can also be extracted from this test. Diametral compression experiments are then conducted on PEG-based solid and cellular dosage forms. It is found that the elastic modulus and yield strength of the open-cell structures are about an order of magnitude smaller than those of the non-porous solids, but still are substantially greater than the stiffness and strength requirements for handling the dosage forms manually. This work thus demonstrates that melt-processed polymeric cellular dosage forms that release drug rapidly can be designed and manufactured to have adequate mechanical properties. Copyright © 2016. Published by Elsevier B.V.

Molecular Signaling Network Motifs Provide a Mechanistic Basis for Cellular Threshold Responses

PubMed Central

Bhattacharya, Sudin; Conolly, Rory B.; Clewell, Harvey J.; Kaminski, Norbert E.; Andersen, Melvin E.

2014-01-01

Background: Increasingly, there is a move toward using in vitro toxicity testing to assess human health risk due to chemical exposure. As with in vivo toxicity testing, an important question for in vitro results is whether there are thresholds for adverse cellular responses. Empirical evaluations may show consistency with thresholds, but the main evidence has to come from mechanistic considerations. Objectives: Cellular response behaviors depend on the molecular pathway and circuitry in the cell and the manner in which chemicals perturb these circuits. Understanding circuit structures that are inherently capable of resisting small perturbations and producing threshold responses is an important step towards mechanistically interpreting in vitro testing data. Methods: Here we have examined dose–response characteristics for several biochemical network motifs. These network motifs are basic building blocks of molecular circuits underpinning a variety of cellular functions, including adaptation, homeostasis, proliferation, differentiation, and apoptosis. For each motif, we present biological examples and models to illustrate how thresholds arise from specific network structures. Discussion and Conclusion: Integral feedback, feedforward, and transcritical bifurcation motifs can generate thresholds. Other motifs (e.g., proportional feedback and ultrasensitivity)produce responses where the slope in the low-dose region is small and stays close to the baseline. Feedforward control may lead to nonmonotonic or hormetic responses. We conclude that network motifs provide a basis for understanding thresholds for cellular responses. Computational pathway modeling of these motifs and their combinations occurring in molecular signaling networks will be a key element in new risk assessment approaches based on in vitro cellular assays. Citation: Zhang Q, Bhattacharya S, Conolly RB, Clewell HJ III, Kaminski NE, Andersen ME. 2014. Molecular signaling network motifs provide a mechanistic basis for cellular threshold responses. Environ Health Perspect 122:1261–1270; http://dx.doi.org/10.1289/ehp.1408244 PMID:25117432

Thermosensitivity of growth is determined by chaperone-mediated proteome reallocation

PubMed Central

Chen, Ke; Gao, Ye; Mih, Nathan; O’Brien, Edward J.; Yang, Laurence; Palsson, Bernhard O.

2017-01-01

Maintenance of a properly folded proteome is critical for bacterial survival at notably different growth temperatures. Understanding the molecular basis of thermoadaptation has progressed in two main directions, the sequence and structural basis of protein thermostability and the mechanistic principles of protein quality control assisted by chaperones. Yet we do not fully understand how structural integrity of the entire proteome is maintained under stress and how it affects cellular fitness. To address this challenge, we reconstruct a genome-scale protein-folding network for Escherichia coli and formulate a computational model, FoldME, that provides statistical descriptions of multiscale cellular response consistent with many datasets. FoldME simulations show (i) that the chaperones act as a system when they respond to unfolding stress rather than achieving efficient folding of any single component of the proteome, (ii) how the proteome is globally balanced between chaperones for folding and the complex machinery synthesizing the proteins in response to perturbation, (iii) how this balancing determines growth rate dependence on temperature and is achieved through nonspecific regulation, and (iv) how thermal instability of the individual protein affects the overall functional state of the proteome. Overall, these results expand our view of cellular regulation, from targeted specific control mechanisms to global regulation through a web of nonspecific competing interactions that modulate the optimal reallocation of cellular resources. The methodology developed in this study enables genome-scale integration of environment-dependent protein properties and a proteome-wide study of cellular stress responses. PMID:29073085

Anodic Aluminum Oxide (AAO) Membranes for Cellular Devices

NASA Astrophysics Data System (ADS)

Ventura, Anthony P.

Anodic Aluminum Oxide (AAO) membranes can be fabricated with a highly tunable pore structure making them a suitable candidate for cellular hybrid devices with single-molecule selectivity. The objective of this study was to characterize the cellular response of AAO membranes with varying pore sizes to serve as a proof-of-concept for an artificial material/cell synapse system. AAO membranes with pore diameters ranging from 34-117 nm were achieved via anodization at a temperature of -1°C in a 2.7% oxalic acid electrolyte. An operating window was established for this setup to create membranes with through-pore and disordered pore morphologies. C17.2 neural stem cells were seeded onto the membranes and differentiated via serum withdrawal. The data suggests a highly tunable correlation between AAO pore diameter and differentiated cell populations. Analysis of membranes before and after cell culture indicated no breakdown of the through-pore structure. Immunocytochemistry (ICC) showed that AAO membranes had increased neurite outgrowth when compared to tissue culture treated (TCT) glass, and neurite outgrowth varied with pore diameter. Additionally, lower neuronal percentages were found on AAO as compared to TCT glass; however, neuronal population was also found to vary with pore diameter. Scanning electron microscopy (SEM) and ICC images suggested the presence of a tissue-like layer with a mixed-phenotype population. AAO membranes appear to be an excellent candidate for cellular devices, but more work must be completed to understand the surface chemistry of the AAO membranes as it relates to cellular response.

A unique hinge binder of extremely selective aminopyridine-based Mps1 (TTK) kinase inhibitors with cellular activity.

PubMed

Kusakabe, Ken-ichi; Ide, Nobuyuki; Daigo, Yataro; Itoh, Takeshi; Yamamoto, Takahiko; Kojima, Eiichi; Mitsuoka, Yasunori; Tadano, Genta; Tagashira, Sachie; Higashino, Kenichi; Okano, Yousuke; Sato, Yuji; Inoue, Makiko; Iguchi, Motofumi; Kanazawa, Takayuki; Ishioka, Yukichi; Dohi, Keiji; Kido, Yasuto; Sakamoto, Shingo; Ando, Shigeru; Maeda, Masahiro; Higaki, Masayo; Yoshizawa, Hidenori; Murai, Hitoshi; Nakamura, Yusuke

2015-05-01

Mps1, also known as TTK, is a dual-specificity kinase that regulates the spindle assembly check point. Increased expression levels of Mps1 are observed in cancer cells, and the expression levels correlate well with tumor grade. Such evidence points to selective inhibition of Mps1 as an attractive strategy for cancer therapeutics. Starting from an aminopyridine-based lead 3a that binds to a flipped-peptide conformation at the hinge region in Mps1, elaboration of the aminopyridine scaffold at the 2- and 6-positions led to the discovery of 19c that exhibited no significant inhibition for 287 kinases as well as improved cellular Mps1 and antiproliferative activities in A549 lung carcinoma cells (cellular Mps1 IC₅₀=5.3 nM, A549 IC₅₀=26 nM). A clear correlation between cellular Mps1 and antiproliferative IC₅₀ values indicated that the antiproliferative activity observed in A549 cells would be responsible for the cellular inhibition of Mps1. The X-ray structure of 19c in complex with Mps1 revealed that this compound retains the ability to bind to the peptide flip conformation. Finally, comparative analysis of the X-ray structures of 19c, a deamino analogue 33, and a known Mps1 inhibitor bound to Mps1 provided insights into the unique binding mode at the hinge region. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cannabinoids Modulate Neuronal Activity and Cancer by CB1 and CB2 Receptor-Independent Mechanisms

PubMed Central

Soderstrom, Ken; Soliman, Eman; Van Dross, Rukiyah

2017-01-01

Cannabinoids include the active constituents of Cannabis or are molecules that mimic the structure and/or function of these Cannabis-derived molecules. Cannabinoids produce many of their cellular and organ system effects by interacting with the well-characterized CB1 and CB2 receptors. However, it has become clear that not all effects of cannabinoid drugs are attributable to their interaction with CB1 and CB2 receptors. Evidence now demonstrates that cannabinoid agents produce effects by modulating activity of the entire array of cellular macromolecules targeted by other drug classes, including: other receptor types; ion channels; transporters; enzymes, and protein- and non-protein cellular structures. This review summarizes evidence for these interactions in the CNS and in cancer, and is organized according to the cellular targets involved. The CNS represents a well-studied area and cancer is emerging in terms of understanding mechanisms by which cannabinoids modulate their activity. Considering the CNS and cancer together allow identification of non-cannabinoid receptor targets that are shared and divergent in both systems. This comparative approach allows the identified targets to be compared and contrasted, suggesting potential new areas of investigation. It also provides insight into the diverse sources of efficacy employed by this interesting class of drugs. Obtaining a comprehensive understanding of the diverse mechanisms of cannabinoid action may lead to the design and development of therapeutic agents with greater efficacy and specificity for their cellular targets. PMID:29066974

Elements of the cellular metabolic structure

PubMed Central

De la Fuente, Ildefonso M.

2015-01-01

A large number of studies have demonstrated the existence of metabolic covalent modifications in different molecular structures, which are able to store biochemical information that is not encoded by DNA. Some of these covalent mark patterns can be transmitted across generations (epigenetic changes). Recently, the emergence of Hopfield-like attractor dynamics has been observed in self-organized enzymatic networks, which have the capacity to store functional catalytic patterns that can be correctly recovered by specific input stimuli. Hopfield-like metabolic dynamics are stable and can be maintained as a long-term biochemical memory. In addition, specific molecular information can be transferred from the functional dynamics of the metabolic networks to the enzymatic activity involved in covalent post-translational modulation, so that determined functional memory can be embedded in multiple stable molecular marks. The metabolic dynamics governed by Hopfield-type attractors (functional processes), as well as the enzymatic covalent modifications of specific molecules (structural dynamic processes) seem to represent the two stages of the dynamical memory of cellular metabolism (metabolic memory). Epigenetic processes appear to be the structural manifestation of this cellular metabolic memory. Here, a new framework for molecular information storage in the cell is presented, which is characterized by two functionally and molecularly interrelated systems: a dynamic, flexible and adaptive system (metabolic memory) and an essentially conservative system (genetic memory). The molecular information of both systems seems to coordinate the physiological development of the whole cell. PMID:25988183

Deoxycholic acid modulates cell death signaling through changes in mitochondrial membrane properties[S

PubMed Central

Sousa, Tânia; Castro, Rui E.; Pinto, Sandra N.; Coutinho, Ana; Lucas, Susana D.; Moreira, Rui; Rodrigues, Cecília M. P.; Prieto, Manuel; Fernandes, Fábio

2015-01-01

Cytotoxic bile acids, such as deoxycholic acid (DCA), are responsible for hepatocyte cell death during intrahepatic cholestasis. The mechanisms responsible for this effect are unclear, and recent studies conflict, pointing to either a modulation of plasma membrane structure or mitochondrial-mediated toxicity through perturbation of mitochondrial outer membrane (MOM) properties. We conducted a comprehensive comparative study of the impact of cytotoxic and cytoprotective bile acids on the membrane structure of different cellular compartments. We show that DCA increases the plasma membrane fluidity of hepatocytes to a minor extent, and that this effect is not correlated with the incidence of apoptosis. Additionally, plasma membrane fluidity recovers to normal values over time suggesting the presence of cellular compensatory mechanisms for this perturbation. Colocalization experiments in living cells confirmed the presence of bile acids within mitochondrial membranes. Experiments with active isolated mitochondria revealed that physiologically active concentrations of DCA change MOM order in a concentration- and time-dependent manner, and that these changes preceded the mitochondrial permeability transition. Importantly, these effects are not observed on liposomes mimicking MOM lipid composition, suggesting that DCA apoptotic activity depends on features of mitochondrial membranes that are absent in protein-free mimetic liposomes, such as the double-membrane structure, lipid asymmetry, or mitochondrial protein environment. In contrast, the mechanism of action of cytoprotective bile acids is likely not associated with changes in cellular membrane structure. PMID:26351365

Tension Monitoring during Epithelial-to-Mesenchymal Transition Links the Switch of Phenotype to Expression of Moesin and Cadherins in NMuMG Cells

PubMed Central

Schneider, David; Baronsky, Thilo; Pietuch, Anna; Rother, Jan; Oelkers, Marieelen; Fichtner, Dagmar; Wedlich, Doris; Janshoff, Andreas

2013-01-01

Structural alterations during epithelial-to-mesenchymal transition (EMT) pose a substantial challenge to the mechanical response of cells and are supposed to be key parameters for an increased malignancy during metastasis. Herein, we report that during EMT, apical tension of the epithelial cell line NMuMG is controlled by cell-cell contacts and the architecture of the underlying actin structures reflecting the mechanistic interplay between cellular structure and mechanics. Using force spectroscopy we find that tension in NMuMG cells slightly increases 24 h after EMT induction, whereas upon reaching the final mesenchymal-like state characterized by a complete loss of intercellular junctions and a concerted down-regulation of the adherens junction protein E-cadherin, the overall tension becomes similar to that of solitary adherent cells and fibroblasts. Interestingly, the contribution of the actin cytoskeleton on apical tension increases significantly upon EMT induction, most likely due to the formation of stable and highly contractile stress fibers which dominate the elastic properties of the cells after the transition. The structural alterations lead to the formation of single, highly motile cells rendering apical tension a good indicator for the cellular state during phenotype switching. In summary, our study paves the way towards a more profound understanding of cellular mechanics governing fundamental morphological programs such as the EMT. PMID:24339870

Membraneless organelles can melt nucleic acid duplexes and act as biomolecular filters

NASA Astrophysics Data System (ADS)

Nott, Timothy J.; Craggs, Timothy D.; Baldwin, Andrew J.

2016-06-01

Membraneless organelles are cellular compartments made from drops of liquid protein inside a cell. These compartments assemble via the phase separation of disordered regions of proteins in response to changes in the cellular environment and the cell cycle. Here we demonstrate that the solvent environment within the interior of these cellular bodies behaves more like an organic solvent than like water. One of the most-stable biological structures known, the DNA double helix, can be melted once inside the liquid droplet, and simultaneously structures formed from regulatory single-stranded nucleic acids are stabilized. Moreover, proteins are shown to have a wide range of absorption or exclusion from these bodies, and can act as importers for otherwise-excluded nucleic acids, which suggests the existence of a protein-mediated trafficking system. A common strategy in organic chemistry is to utilize different solvents to influence the behaviour of molecules and reactions. These results reveal that cells have also evolved this capability by exploiting the interiors of membraneless organelles.

Architecture and biogenesis of plus-strand RNA virus replication factories

PubMed Central

Paul, David; Bartenschlager, Ralf

2013-01-01

Plus-strand RNA virus replication occurs in tight association with cytoplasmic host cell membranes. Both, viral and cellular factors cooperatively generate distinct organelle-like structures, designated viral replication factories. This compartmentalization allows coordination of the different steps of the viral replication cycle, highly efficient genome replication and protection of the viral RNA from cellular defense mechanisms. Electron tomography studies conducted during the last couple of years revealed the three dimensional structure of numerous plus-strand RNA virus replication compartments and highlight morphological analogies between different virus families. Based on the morphology of virus-induced membrane rearrangements, we propose two separate subclasses: the invaginated vesicle/spherule type and the double membrane vesicle type. This review discusses common themes and distinct differences in the architecture of plus-strand RNA virus-induced membrane alterations and summarizes recent progress that has been made in understanding the complex interplay between viral and co-opted cellular factors in biogenesis and maintenance of plus-strand RNA virus replication factories. PMID:24175228

Development of High-Pressure Structural and Cellular Biophysics at Miami University

NASA Astrophysics Data System (ADS)

Urayama, Paul

2004-04-01

Pressures found in the biosphere (up to 1200 atm) have large effects on enzyme specificity and activity, molecular associations, protein folding, viral infectivity, and cellular morphology. The importance of pressure in pharmaceuticals, medical, and biomaterials sciences is beginning to be appreciated. Enzyme reactions under high pressure or in supercritical fluids may be promising in the synthesis of pharmaceuticals. High pressure processing of biopolymer networks may be important in producing matrices for biomaterials applications. In medicine, herpes, immunodeficiency viruses, and certain prion proteins are inactivated by pressure, which may be useful in the ex vivo treatment of blood. Even physiologically generated pressures, such as during colon peristalsis, have biological effects, for example, on the adhesion properties of epithelial cells in colon cancer. This presentation describes a new high-pressure structural and cellular biophysics laboratory under development at Miami University. Applications of specific methods, including high-pressure time-resolved fluorescence spectroscopy; high-pressure fluorescence microscopy; and high-pressure x-ray macromolecular crystallography will be discussed.

Untangling the origin of viruses and their impact on cellular evolution.

PubMed

Nasir, Arshan; Sun, Feng-Jie; Kim, Kyung Mo; Caetano-Anollés, Gustavo

2015-04-01

The origin and evolution of viruses remain mysterious. Here, we focus on the distribution of viral replicons in host organisms, their morphological features, and the evolution of highly conserved protein and nucleic acid structures. The apparent inability of RNA viral replicons to infect contemporary akaryotic species suggests an early origin of RNA viruses and their subsequent loss in akaryotes. A census of virion morphotypes reveals that advanced forms were unique to viruses infecting a specific supergroup, while simpler forms were observed in viruses infecting organisms in all forms of cellular life. Results hint toward an ancient origin of viruses from an ancestral virus harboring either filamentous or spherical virions. Finally, phylogenetic trees built from protein domain and tRNA structures in thousands of genomes suggest that viruses evolved via reductive evolution from ancient cells. The analysis presents a complete account of the evolutionary history of cells and viruses and identifies viruses as crucial agents influencing cellular evolution. © 2015 New York Academy of Sciences.

Accounting for structural compliance in nanoindentation measurements of bioceramic bone scaffolds

Treesearch

Juan Vivanco; Joseph E. Jakes; Josh Slane; Heidi-Lynn Ploeg

2014-01-01

Structural properties have been shown to be critical in the osteoconductive capacity and strength of bioactive ceramic bone scaffolds. Given the cellular foam-like structure of bone scaffolds, nanoindentation has been used as a technique to assess the mechanical properties of individual components of the scaffolds. Nevertheless, nanoindents placed on scaffolds may...

Mathematics, Thermodynamics, and Modeling to Address Ten Common Misconceptions about Protein Structure, Folding, and Stability

ERIC Educational Resources Information Center

Robic, Srebrenka

2010-01-01

To fully understand the roles proteins play in cellular processes, students need to grasp complex ideas about protein structure, folding, and stability. Our current understanding of these topics is based on mathematical models and experimental data. However, protein structure, folding, and stability are often introduced as descriptive, qualitative…

PACS—Realization of an adaptive concept using pressure actuated cellular structures

NASA Astrophysics Data System (ADS)

Gramüller, B.; Boblenz, J.; Hühne, C.

2014-10-01

A biologically inspired concept is investigated which can be utilized to develop energy efficient, lightweight and applicational flexible adaptive structures. Building a real life morphing unit is an ambitious task as the numerous works in the particular field show. Summarizing fundamental demands and barriers regarding shape changing structures, the basic challenges of designing morphing structures are listed. The concept of Pressure Actuated Cellular Structures (PACS) is arranged within the recent morphing activities and it is shown that it complies with the underlying demands. Systematically divided into energy-related and structural subcomponents the working principle is illuminated and relationships between basic design parameters are expressed. The analytical background describing the physical mechanisms of PACS is presented in concentrated manner. This work focuses on the procedure of dimensioning, realizing and experimental testing of a single cell and a single row cantilever made of PACS. The experimental outcomes as well as the results from the FEM computations are used for evaluating the analytical methods. The functionality of the basic principle is thus validated and open issues are determined pointing the way ahead.

A Structural Perspective on the Modulation of Protein-Protein Interactions with Small Molecules.

PubMed

Demirel, Habibe Cansu; Dogan, Tunca; Tuncbag, Nurcan

2018-05-31

Protein-protein interactions (PPIs) are the key components in many cellular processes including signaling pathways, enzymatic reactions and epigenetic regulation. Abnormal interactions of some proteins may be pathogenic and cause various disorders including cancer and neurodegenerative diseases. Although inhibiting PPIs with small molecules is a challenging task, it gained an increasing interest because of its strong potential for drug discovery and design. The knowledge of the interface as well as the structural and chemical characteristics of the PPIs and their roles in the cellular pathways are necessary for a rational design of small molecules to modulate PPIs. In this study, we review the recent progress in the field and detail the physicochemical properties of PPIs including binding hot spots with a focus on structural methods. Then, we review recent approaches for structural prediction of PPIs. Finally, we revisit the concept of targeting PPIs in a systems biology perspective and we refer to the non-structural approaches, usually employed when the structural information is not present. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

[Cell signaling pathways interaction in cellular proliferation: Potential target for therapeutic interventionism].

PubMed

Valdespino-Gómez, Víctor Manuel; Valdespino-Castillo, Patricia Margarita; Valdespino-Castillo, Víctor Edmundo

2015-01-01

Nowadays, cellular physiology is best understood by analysing their interacting molecular components. Proteins are the major components of the cells. Different proteins are organised in the form of functional clusters, pathways or networks. These molecules are ordered in clusters of receptor molecules of extracellular signals, transducers, sensors and biological response effectors. The identification of these intracellular signaling pathways in different cellular types has required a long journey of experimental work. More than 300 intracellular signaling pathways have been identified in human cells. They participate in cell homeostasis processes for structural and functional maintenance. Some of them participate simultaneously or in a nearly-consecutive progression to generate a cellular phenotypic change. In this review, an analysis is performed on the main intracellular signaling pathways that take part in the cellular proliferation process, and the potential use of some components of these pathways as target for therapeutic interventionism are also underlined. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

Super-Resolution Microscopy: Shedding Light on the Cellular Plasma Membrane.

PubMed

Stone, Matthew B; Shelby, Sarah A; Veatch, Sarah L

2017-06-14

Lipids and the membranes they form are fundamental building blocks of cellular life, and their geometry and chemical properties distinguish membranes from other cellular environments. Collective processes occurring within membranes strongly impact cellular behavior and biochemistry, and understanding these processes presents unique challenges due to the often complex and myriad interactions between membrane components. Super-resolution microscopy offers a significant gain in resolution over traditional optical microscopy, enabling the localization of individual molecules even in densely labeled samples and in cellular and tissue environments. These microscopy techniques have been used to examine the organization and dynamics of plasma membrane components, providing insight into the fundamental interactions that determine membrane functions. Here, we broadly introduce the structure and organization of the mammalian plasma membrane and review recent applications of super-resolution microscopy to the study of membranes. We then highlight some inherent challenges faced when using super-resolution microscopy to study membranes, and we discuss recent technical advancements that promise further improvements to super-resolution microscopy and its application to the plasma membrane.

Single-cell topological RNA-Seq analysis reveals insights into cellular differentiation and development

PubMed Central

Rizvi, Abbas H.; Camara, Pablo G.; Kandror, Elena K.; Roberts, Thomas J.; Schieren, Ira; Maniatis, Tom; Rabadan, Raul

2017-01-01

Transcriptional programs control cellular lineage commitment and differentiation during development. Understanding cell fate has been advanced by studying single-cell RNA-seq, but is limited by the assumptions of current analytic methods regarding the structure of data. We present single-cell topological data analysis (scTDA), an algorithm for topology-based computational analyses to study temporal, unbiased transcriptional regulation. Compared to other methods, scTDA is a non-linear, model-independent, unsupervised statistical framework that can characterize transient cellular states. We applied scTDA to the analysis of murine embryonic stem cell (mESC) differentiation in vitro in response to inducers of motor neuron differentiation. scTDA resolved asynchrony and continuity in cellular identity over time, and identified four transient states (pluripotent, precursor, progenitor, and fully differentiated cells) based on changes in stage-dependent combinations of transcription factors, RNA-binding proteins and long non-coding RNAs. scTDA can be applied to study asynchronous cellular responses to either developmental cues or environmental perturbations. PMID:28459448

Experimental micro mechanics methods for conventional and negative Poisson's ratio cellular solids as Cosserat continua

NASA Technical Reports Server (NTRS)

Lakes, R.

1991-01-01

Continuum representations of micromechanical phenomena in structured materials are described, with emphasis on cellular solids. These phenomena are interpreted in light of Cosserat elasticity, a generalized continuum theory which admits degrees of freedom not present in classical elasticity. These are the rotation of points in the material, and a couple per unit area or couple stress. Experimental work in this area is reviewed, and other interpretation schemes are discussed. The applicability of Cosserat elasticity to cellular solids and fibrous composite materials is considered as is the application of related generalized continuum theories. New experimental results are presented for foam materials with negative Poisson's ratios.

Rapid Solidification in Bulk Ti-Nb Alloys by Single-Track Laser Melting

NASA Astrophysics Data System (ADS)

Roehling, John D.; Perron, Aurélien; Fattebert, Jean-Luc; Haxhimali, Tomorr; Guss, Gabe; Li, Tian T.; Bober, David; Stokes, Adam W.; Clarke, Amy J.; Turchi, Patrice E. A.; Matthews, Manyalibo J.; McKeown, Joseph T.

2018-05-01

Single-track laser melting experiments were performed on bulk Ti-Nb alloys to explore process parameters and the resultant macroscopic structure and microstructure. The microstructures in Ti-20Nb and Ti-50Nb (at.%) alloys exhibited cellular growth during rapid solidification, with average cell size of approximately 0.5 µm. Solidification velocities during cellular growth were calculated from images of melt tracks. Measurements of the composition in the cellular and intercellular regions revealed nonequilibrium partitioning and its dependence on velocity during rapid solidification. Experimental results were used to benchmark a phase-field model to describe rapid solidification under conditions relevant to additive manufacturing.

Cellular structures with interconnected microchannels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shaefer, Robert Shahram; Ghoniem, Nasr M.; Williams, Brian

A method for fabricating a cellular tritium breeder component includes obtaining a reticulated carbon foam skeleton comprising a network of interconnected ligaments. The foam skeleton is then melt-infiltrated with a tritium breeder material, for example, lithium zirconate or lithium titanate. The foam skeleton is then removed to define a cellular breeder component having a network of interconnected tritium purge channels. In an embodiment the ligaments of the foam skeleton are enlarged by adding carbon using chemical vapor infiltration (CVI) prior to melt-infiltration. In an embodiment the foam skeleton is coated with a refractory material, for example, tungsten, prior to meltmore » infiltration.« less

Network signatures of nuclear and cytoplasmic density alterations in a model of pre and postmetastatic colorectal cancer

NASA Astrophysics Data System (ADS)

Damania, Dhwanil; Subramanian, Hariharan; Backman, Vadim; Anderson, Eric C.; Wong, Melissa H.; McCarty, Owen J. T.; Phillips, Kevin G.

2014-01-01

Cells contributing to the pathogenesis of cancer possess cytoplasmic and nuclear structural alterations that accompany their aberrant genetic, epigenetic, and molecular perturbations. Although it is known that architectural changes in primary and metastatic tumor cells can be quantified through variations in cellular density at the nanometer and micrometer spatial scales, the interdependent relationships among nuclear and cytoplasmic density as a function of tumorigenic potential has not been thoroughly investigated. We present a combined optical approach utilizing quantitative phase microscopy and partial wave spectroscopic microscopy to perform parallel structural characterizations of cellular architecture. Using the isogenic SW480 and SW620 cell lines as a model of pre and postmetastatic transition in colorectal cancer, we demonstrate that nuclear and cytoplasmic nanoscale disorder, micron-scale dry mass content, mean dry mass density, and shape metrics of the dry mass density histogram are uniquely correlated within and across different cellular compartments for a given cell type. The correlations of these physical parameters can be interpreted as networks whose nodal importance and level of connection independence differ according to disease stage. This work demonstrates how optically derived biophysical parameters are linked within and across different cellular compartments during the architectural orchestration of the metastatic phenotype.

Investigation of the subcellular architecture of L7 neurons of Aplysia californica using magnetic resonance microscopy (MRM) at 7.8 microns.

PubMed

Lee, Choong H; Flint, Jeremy J; Hansen, Brian; Blackband, Stephen J

2015-06-10

Magnetic resonance microscopy (MRM) is a non-invasive diagnostic tool which is well-suited to directly resolve cellular structures in ex vivo and in vitro tissues without use of exogenous contrast agents. Recent advances in its capability to visualize mammalian cellular structure in intact tissues have reinvigorated analytical interest in aquatic cell models whose previous findings warrant up-to-date validation of subcellular components. Even if the sensitivity of MRM is less than other microscopic technologies, its strength lies in that it relies on the same image contrast mechanisms as clinical MRI which make it a unique tool for improving our ability to interpret human diagnostic imaging through high resolution studies of well-controlled biological model systems. Here, we investigate the subcellular MR signal characteristics of isolated cells of Aplysia californica at an in-plane resolution of 7.8 μm. In addition, direct correlation and positive identification of subcellular architecture in the cells is achieved through well-established histology. We hope this methodology will serve as the groundwork for studying pathophysiological changes through perturbation studies and allow for development of disease-specific cellular modeling tools. Such an approach promises to reveal the MR contrast changes underlying cellular mechanisms in various human diseases, for example in ischemic stroke.

Structural basis of lentiviral subversion of a cellular protein degradation pathway

NASA Astrophysics Data System (ADS)

Schwefel, David; Groom, Harriet C. T.; Boucherit, Virginie C.; Christodoulou, Evangelos; Walker, Philip A.; Stoye, Jonathan P.; Bishop, Kate N.; Taylor, Ian A.

2014-01-01

Lentiviruses contain accessory genes that have evolved to counteract the effects of host cellular defence proteins that inhibit productive infection. One such restriction factor, SAMHD1, inhibits human immunodeficiency virus (HIV)-1 infection of myeloid-lineage cells as well as resting CD4+ T cells by reducing the cellular deoxynucleoside 5'-triphosphate (dNTP) concentration to a level at which the viral reverse transcriptase cannot function. In other lentiviruses, including HIV-2 and related simian immunodeficiency viruses (SIVs), SAMHD1 restriction is overcome by the action of viral accessory protein x (Vpx) or the related viral protein r (Vpr) that target and recruit SAMHD1 for proteasomal degradation. The molecular mechanism by which these viral proteins are able to usurp the host cell's ubiquitination machinery to destroy the cell's protection against these viruses has not been defined. Here we present the crystal structure of a ternary complex of Vpx with the human E3 ligase substrate adaptor DCAF1 and the carboxy-terminal region of human SAMHD1. Vpx is made up of a three-helical bundle stabilized by a zinc finger motif, and wraps tightly around the disc-shaped DCAF1 molecule to present a new molecular surface. This adapted surface is then able to recruit SAMHD1 via its C terminus, making it a competent substrate for the E3 ligase to mark for proteasomal degradation. The structure reported here provides a molecular description of how a lentiviral accessory protein is able to subvert the cell's normal protein degradation pathway to inactivate the cellular viral defence system.

Thiol Specific and Mitochondria Selective Fluorogenic Benzofurazan Sulfide for Live Cell Nonprotein Thiol Imaging and Quantification in Mitochondria.

PubMed

Wang, Shenggang; Yin, Huihui; Huang, Yue; Guan, Xiangming

2018-06-11

Cellular thiols are divided into two major categories: nonprotein thiols (NPSH) and protein thiols (PSH). Thiols are unevenly distributed inside the cell and compartmentalized in subcellular structures. Most of our knowledge on functions/dysfunctions of cellular/subcellular thiols is based on the quantification of cellular/subcellular thiols through homogenization of cellular/subcellular structures followed by a thiol quantification method. We would like to report a thiol-specific mitochondria-selective fluorogenic benzofurazan sulfide {7,7'-thiobis( N-rhodamine-benzo[c][1,2,5]oxadiazole-4-sulfonamide) (TBROS)} that can effectively image and quantify live cell NPSH in mitochondria through fluorescence intensity. Limited methods are available for imaging thiols in mitochondria in live cells especially in a quantitative manner. The thiol specificity of TBROS was demonstrated by its ability to react with thiols and inability to react with biologically relevant nucleophilic functional groups other than thiols. TBROS, with minimal fluorescence, formed strong fluorescent thiol adducts (λ ex = 550 nm, λ em = 580 nm) when reacting with NPSH confirming its fluorogenicity. TBROS failed to react with PSH from bovine serum albumin and cell homogenate proteins. The high mitochondrial thiol selectivity of TBROS was achieved by its mitochondria targeting structure and its higher reaction rate with NPSH at mitochondrial pH. Imaging of mitochondrial NPSH in live cells was confirmed by two colocalization methods and use of a thiol-depleting reagent. TBROS effectively imaged NPSH changes in a quantitative manner in mitochondria in live cells. The reagent will be a useful tool in exploring physiological and pathological roles of mitochondrial thiols.

Cellular Delivery of Nanoparticles Revealed with Combined Optical and Isotopic Nanoscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proetto, Maria T.; Anderton, Christopher R.; Hu, Dehong

Synthetic drug-carrying nanomaterials offer great potential as targeted cellular delivery vehicles. Typically, their size, morphology, surface chemistry and stability are optimized in order to control their effect on drug release kinetics, cellular uptake pathways, efficiency and site of action. However, methods to track the carriers and their cargo independently at the micro- and nanoscale have been severely underutilized preventing the correlation between structure and function. Here we show that by using combined optical and isotopic nanoscopy we can track the uptake in cancer cells and subsequent drug release of a Pt(II)-loaded anticancer nanoparticle (NP) system. We found that by directlymore » polymerizing an oxaliplatin analogue containing a norbornyl moiety amenable to polymerization via ring opening metathesis polymerization (ROMP) we could generate amphiphiles in one pot. Spontaneous self-assembly of the drug-containing polymers in aqueous solution led to well-defined NPs in a reproducible manner. Our results demonstrate that the covalently loaded NPs are equipotent with free oxaliplatin and are taken up intact via endocytic pathways before release of the cytotoxic cargo. This was confirmed by super resolution fluorescence structured illumination microscopy (SIM) and nanoscale secondary ion mass spectrometry (NanoSIMS). We anticipate that this type of multimodal cellular tracking of NP and drug will bridge the knowledge gap between particle structure and performance for the vast array of currently generalizable systems in the literature. Furthermore, the use of covalently loaded NP drug systems should allow development of more stable, reproducible and site specific nanodelivery agents.« less

Higher-order assemblies of BAR domain proteins for shaping membranes.

PubMed

Suetsugu, Shiro

2016-06-01

Most cellular organelles contain lipid bilayer membranes. The earliest characterization of cellular organelles was performed by electron microscopy observation of such membranes. However, the precise mechanisms for shaping the membrane in particular subcellular organelles is poorly understood. Classically, the overall cellular shape, i.e. the shape of the plasma membrane, was thought to be governed by the reorganization of cytoskeletal components such as actin and microtubules. The plasma membrane contains various submicron structures such as clathrin-coated pits, caveolae, filopodia and lamellipodia. These subcellular structures are either invaginations or protrusions and are associated with the cytoskeleton. Therefore, it could be hypothesized that there are membrane-binding proteins that cooperates with cytoskeleton in shaping of plasma membrane organelles. Proteins with the Bin-Amphiphysin-Rvs (BAR) domain connect a variety of membrane shapes to actin filaments. The BAR domains themselves bend the membranes by their rigidity and then mold the membranes into tubules through their assembly as spiral polymers, which are thought to be involved in the various submicron structures. Membrane tubulation by polymeric assembly of the BAR domains is supposed to be regulated by binding proteins, binding lipids and the mechanical properties of the membrane. This review gives an overview of BAR protein assembly, describes the significance of the assembly and discusses how to study the assembly in the context of membrane and cellular morphology. The technical problems encountered in microscopic observation of BAR domain assembly are also discussed. © The Author 2016. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Biomechanics of subcellular structures by non-invasive Brillouin microscopy

NASA Astrophysics Data System (ADS)

Antonacci, Giuseppe; Braakman, Sietse

2016-11-01

Cellular biomechanics play a pivotal role in the pathophysiology of several diseases. Unfortunately, current methods to measure biomechanical properties are invasive and mostly limited to the surface of a cell. As a result, the mechanical behaviour of subcellular structures and organelles remains poorly characterised. Here, we show three-dimensional biomechanical images of single cells obtained with non-invasive, non-destructive Brillouin microscopy with an unprecedented spatial resolution. Our results quantify the longitudinal elastic modulus of subcellular structures. In particular, we found the nucleoli to be stiffer than both the nuclear envelope (p < 0.0001) and the surrounding cytoplasm (p < 0.0001). Moreover, we demonstrate the mechanical response of cells to Latrunculin-A, a drug that reduces cell stiffness by preventing cytoskeletal assembly. Our technique can therefore generate valuable insights into cellular biomechanics and its role in pathophysiology.

Tiptoeing to chromosome tips: facts, promises and perils of today's human telomere biology.

PubMed

Fajkus, J; Simícková, M; Maláska, J

2002-04-29

The past decade has witnessed an explosion of knowledge concerning the structure and function of chromosome terminal structures-telomeres. Today's telomere research has advanced from a pure descriptive approach of DNA and protein components to an elementary understanding of telomere metabolism, and now to promising applications in medicine. These applications include 'passive' ones, among which the use of analysis of telomeres and telomerase (a cellular reverse transcriptase that synthesizes telomeres) for cancer diagnostics is the best known. The 'active' applications involve targeted downregulation or upregulation of telomere synthesis, either to mortalize immortal cancer cells, or to rejuvenate mortal somatic cells and tissues for cellular transplantations, respectively. This article reviews the basic data on structure and function of human telomeres and telomerase, as well as both passive and active applications of human telomere biology.

Experimental investigation of the limits of ethanol combustion in the boundary layer behind an obstacle

NASA Astrophysics Data System (ADS)

Boyarshinov, B. F.

2018-01-01

Experimental data on the flow structure and mass transfer near the boundaries of the region existence of the laminar and turbulent boundary layers with combustion are considered. These data include the results of in-vestigation on reacting flow stability at mixed convection, mass transfer during ethanol evaporation "on the floor" and "on the ceiling", when the flame surface curves to form the large-scale cellular structures. It is shown with the help of the PIV equipment that when Rayleigh-Taylor instability manifests, the mushroom-like structures are formed, where the motion from the flame front to the wall and back alternates. The cellular flame exists in a narrow range of velocities from 0.55 to 0.65 m/s, and mass transfer is three times higher than its level in the standard laminar boundary layer.

Structural basis of membrane disruption and cellular toxicity by α-synuclein oligomers.

PubMed

Fusco, Giuliana; Chen, Serene W; Williamson, Philip T F; Cascella, Roberta; Perni, Michele; Jarvis, James A; Cecchi, Cristina; Vendruscolo, Michele; Chiti, Fabrizio; Cremades, Nunilo; Ying, Liming; Dobson, Christopher M; De Simone, Alfonso

2017-12-15

Oligomeric species populated during the aggregation process of α-synuclein have been linked to neuronal impairment in Parkinson's disease and related neurodegenerative disorders. By using solution and solid-state nuclear magnetic resonance techniques in conjunction with other structural methods, we identified the fundamental characteristics that enable toxic α-synuclein oligomers to perturb biological membranes and disrupt cellular function; these include a highly lipophilic element that promotes strong membrane interactions and a structured region that inserts into lipid bilayers and disrupts their integrity. In support of these conclusions, mutations that target the region that promotes strong membrane interactions by α-synuclein oligomers suppressed their toxicity in neuroblastoma cells and primary cortical neurons. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

The extracellular matrix of Volvox carteri: molecular structure of the cellular compartment.

PubMed

Ertl, H; Mengele, R; Wenzl, S; Engel, J; Sumper, M

1989-12-01

The extracellular matrix (ECM) of Volvox contains insoluble fibrous layers that surround individual cells at a distance to form contiguous cellular compartments. Using immunological techniques, we identified a sulfated surface glycoprotein (SSG 185) as the monomeric precursor of this substructure within the ECM. The primary structure of the SSG 185 poly-peptide chain has been derived from cDNA and genomic DNA. A central domain of the protein, 80 amino acid residues long, consists almost exclusively of hydroxyproline residues. The chemical structure of the highly sulfated polysaccharide covalently attached to SSG 185 has been determined by permethylation analysis. As revealed by EM, SSG 185 is a rod-shaped molecule with a 21-nm-long polysaccharide strand protruding from its central region. The chemical nature of the cross-links between SSG 185 monomers is discussed.

Quantitative phase-digital holographic microscopy: a new imaging modality to identify original cellular biomarkers of diseases

NASA Astrophysics Data System (ADS)

Marquet, P.; Rothenfusser, K.; Rappaz, B.; Depeursinge, C.; Jourdain, P.; Magistretti, P. J.

2016-03-01

Quantitative phase microscopy (QPM) has recently emerged as a powerful label-free technique in the field of living cell imaging allowing to non-invasively measure with a nanometric axial sensitivity cell structure and dynamics. Since the phase retardation of a light wave when transmitted through the observed cells, namely the quantitative phase signal (QPS), is sensitive to both cellular thickness and intracellular refractive index related to the cellular content, its accurate analysis allows to derive various cell parameters and monitor specific cell processes, which are very likely to identify new cell biomarkers. Specifically, quantitative phase-digital holographic microscopy (QP-DHM), thanks to its numerical flexibility facilitating parallelization and automation processes, represents an appealing imaging modality to both identify original cellular biomarkers of diseases as well to explore the underlying pathophysiological processes.

Increase in cellular triacylglycerol content and emergence of large ER-associated lipid droplets in the absence of CDP-DG synthase function

PubMed Central

He, Yue; Yam, Candice; Pomraning, Kyle; Chin, Jacqueline S. R.; Yew, Joanne Y.; Freitag, Michael; Oliferenko, Snezhana

2014-01-01

Excess fatty acids and sterols are stored as triacylglycerols and sterol esters in specialized cellular organelles, called lipid droplets. Understanding what determines the cellular amount of neutral lipids and their packaging into lipid droplets is of fundamental and applied interest. Using two species of fission yeast, we show that cycling cells deficient in the function of the ER-resident CDP-DG synthase Cds1 exhibit markedly increased triacylglycerol content and assemble large lipid droplets closely associated with the ER membranes. We demonstrate that these unusual structures recruit the triacylglycerol synthesis machinery and grow by expansion rather than by fusion. Our results suggest that interfering with the CDP-DG route of phosphatidic acid utilization rewires cellular metabolism to adopt a triacylglycerol-rich lifestyle reliant on the Kennedy pathway. PMID:25318672

Left ventricular remodeling in the post-infarction heart: a review of cellular, molecular mechanisms, and therapeutic modalities.

PubMed

Gajarsa, Jason J; Kloner, Robert A

2011-01-01

As more patients survive myocardial infarctions, the incidence of heart failure increases. After an infarction, the human heart undergoes a series of structural changes, which are governed by cellular and molecular mechanisms in a pathological metamorphosis termed "remodeling." This review will discuss the current developments in our understanding of these molecular and cellular events in remodeling and the various pharmacological, cellular and device therapies used to treat, and potentially retard, this condition. Specifically, this paper will examine the neurohormonal activity of the renin-angiotensin-aldosterone axis and its molecular effects on the heart. The emerging understanding of the extra-cellular matrix and the various active molecules within it, such as the matrix metalloproteinases, elicits new appreciation for their role in cardiac remodeling and as possible future therapeutic targets. Cell therapy with stem cells is another recent therapy with great potential in improving post-infarcted hearts. Lastly, the cellular and molecular effects of left ventricular assist devices on remodeling will be reviewed. Our increasing knowledge of the cellular and molecular mechanisms underlying cardiac remodeling enables us not only to better understand how our more successful therapies, like angiotensin-converting enzyme inhibitors, work, but also to explore new therapies of the future.

Novel functions of CCM1 delimit the relationship of PTB/PH domains.

PubMed

Zhang, Jun; Dubey, Pallavi; Padarti, Akhil; Zhang, Aileen; Patel, Rinkal; Patel, Vipulkumar; Cistola, David; Badr, Ahmed

2017-10-01

Three NPXY motifs and one FERM domain in CCM1 makes it a versatile scaffold protein for tethering the signaling components together within the CCM signaling complex (CSC). The cellular role of CCM1 protein remains inadequately expounded. Both phosphotyrosine binding (PTB) and pleckstrin homology (PH) domains were recognized as structurally related but functionally distinct domains. By utilizing molecular cloning, protein binding assays and RT-qPCR to identify novel cellular partners of CCM1 and its cellular expression patterns; by screening candidate PTB/PH proteins and subsequently structurally simulation in combining with current X-ray crystallography and NMR data to defined the essential structure of PTB/PH domain for NPXY-binding and the relationship among PTB, PH and FERM domain(s). We identified a group of 28 novel cellular partners of CCM1, all of which contain either PTB or PH domain(s), and developed a novel classification system for these PTB/PH proteins based on their relationship with different NPXY motifs of CCM1. Our results demonstrated that CCM1 has a wide spectrum of binding to different PTB/PH proteins and perpetuates their specificity to interact with certain PTB/PH domains through selective combination of three NPXY motifs. We also demonstrated that CCM1 can be assembled into oligomers through intermolecular interaction between its F3 lobe in FERM domain and one of the three NPXY motifs. Despite being embedded in FERM domain as F3 lobe, F3 module acts as a fully functional PH domain to interact with NPXY motif. The most salient feature of the study was that both PTB and PH domains are structurally and functionally comparable, suggesting that PTB domain is likely evolved from PH domain with polymorphic structural additions at its N-terminus. A new β1A-strand of the PTB domain was discovered and new minimum structural requirement of PTB/PH domain for NPXY motif-binding was determined. Based on our data, a novel theory of structure, function and relationship of PTB, PH and FERM domains has been proposed, which extends the importance of the NPXY-PTB/PH interaction on the CSC signaling and/or other cell receptors with great potential pointing to new therapeutic strategies. The study provides new insight into the structural characteristics of PTB/PH domains, essential structural elements of PTB/PH domain required for NPXY motif-binding, and function and relationship among PTB, PH and FERM domains. Copyright © 2017 Elsevier B.V. All rights reserved.

Microengineering as a tool to study substratum modulation and cell behaviour.

PubMed

Keatch, R P; Armoogum, K; Schor, S L; Pridham, M S; Banks, K; Khor, T Y; Matthew, C

2002-01-01

This research is an investigation of the means by which geometrical parameters (e.g. area and shape) and various surface attributes (materials and surface finish) of microengineered structures can modulate cellular response. This is based on biological observations indicating that: (i) the response of tissue cells to injury is determined by the net signal transduction response elicited by soluble regulatory molecules (e.g. cytokines), (ii) common matrix constituents (e.g. collagen) directly affect cell behaviour by the same signal transduction mechanisms mediating cytokine bioactivity, (iii) cellular response to cytokines is modulated by the precise nature of the extracellular matrix to which the target cells are adherent, including its biochemical composition and physical structure.

Characterization of Thermal and Mechanical Impact on Aluminum Honeycomb Structures

NASA Technical Reports Server (NTRS)

Robinson, Christen M.

2013-01-01

This study supports NASA Kennedy Space Center's research in the area of intelligent thermal management systems and multifunctional thermal systems. This project addresses the evaluation of the mechanical and thermal properties of metallic cellular solid (MCS) materials; those that are lightweight; high strength, tunable, multifunctional and affordable. A portion of the work includes understanding the mechanical properties of honeycomb structured cellular solids upon impact testing under ambient, water-immersed, liquid nitrogen-cooled, and liquid nitrogen-immersed conditions. Additionally, this study will address characterization techniques of the aluminum honeycomb's ability to resist multiple high-rate loadings or impacts in varying environmental conditions, using various techniques for the quantitative and qualitative determination for commercial applicability.

Collective dynamics in heterogeneous networks of neuronal cellular automata

NASA Astrophysics Data System (ADS)

Manchanda, Kaustubh; Bose, Amitabha; Ramaswamy, Ramakrishna

2017-12-01

We examine the collective dynamics of heterogeneous random networks of model neuronal cellular automata. Each automaton has b active states, a single silent state and r - b - 1 refractory states, and can show 'spiking' or 'bursting' behavior, depending on the values of b. We show that phase transitions that occur in the dynamical activity can be related to phase transitions in the structure of Erdõs-Rényi graphs as a function of edge probability. Different forms of heterogeneity allow distinct structural phase transitions to become relevant. We also show that the dynamics on the network can be described by a semi-annealed process and, as a result, can be related to the Boolean Lyapunov exponent.

The endoplasmic reticulum: structure, function and response to cellular signaling.

PubMed

Schwarz, Dianne S; Blower, Michael D

2016-01-01

The endoplasmic reticulum (ER) is a large, dynamic structure that serves many roles in the cell including calcium storage, protein synthesis and lipid metabolism. The diverse functions of the ER are performed by distinct domains; consisting of tubules, sheets and the nuclear envelope. Several proteins that contribute to the overall architecture and dynamics of the ER have been identified, but many questions remain as to how the ER changes shape in response to cellular cues, cell type, cell cycle state and during development of the organism. Here we discuss what is known about the dynamics of the ER, what questions remain, and how coordinated responses add to the layers of regulation in this dynamic organelle.

Quantification of asymmetric microtubule nucleation at sub-cellular structures

PubMed Central

Zhu, Xiaodong; Kaverina, Irina

2012-01-01

Cell polarization is important for multiple physiological processes. In polarized cells, microtubules (MTs) are organized into a spatially polarized array. Generally, in non-differentiated cells, it is assumed that MTs are symmetrically nucleated exclusively from centrosome (microtubule organizing center, MTOC) and then reorganized into the asymmetric array. We have recently identified the Golgi complex as an additional MTOC that asymmetrically nucleates MTs toward one side of the cell. Methods used for alternative MTOC identification include microtubule re-growth after complete drug-induced depolymerization and tracking of growing microtubules using fluorescence labeled MT +TIP binding proteins in living cells. These approaches can be used for quantification of MT nucleation sites at diverse sub-cellular structures. PMID:21773933

Human cell structure-driven model construction for predicting protein subcellular location from biological images.

PubMed

Shao, Wei; Liu, Mingxia; Zhang, Daoqiang

2016-01-01

The systematic study of subcellular location pattern is very important for fully characterizing the human proteome. Nowadays, with the great advances in automated microscopic imaging, accurate bioimage-based classification methods to predict protein subcellular locations are highly desired. All existing models were constructed on the independent parallel hypothesis, where the cellular component classes are positioned independently in a multi-class classification engine. The important structural information of cellular compartments is missed. To deal with this problem for developing more accurate models, we proposed a novel cell structure-driven classifier construction approach (SC-PSorter) by employing the prior biological structural information in the learning model. Specifically, the structural relationship among the cellular components is reflected by a new codeword matrix under the error correcting output coding framework. Then, we construct multiple SC-PSorter-based classifiers corresponding to the columns of the error correcting output coding codeword matrix using a multi-kernel support vector machine classification approach. Finally, we perform the classifier ensemble by combining those multiple SC-PSorter-based classifiers via majority voting. We evaluate our method on a collection of 1636 immunohistochemistry images from the Human Protein Atlas database. The experimental results show that our method achieves an overall accuracy of 89.0%, which is 6.4% higher than the state-of-the-art method. The dataset and code can be downloaded from https://github.com/shaoweinuaa/. dqzhang@nuaa.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Simultaneous cryo X-ray ptychographic and fluorescence microscopy of green algae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Junjing; Vine, David J.; Chen, Si

Trace metals play important roles in normal and in disease-causing biological functions. X-ray fluorescence microscopy reveals trace elements with no dependence on binding affinities (unlike with visible light fluorophores) and with improved sensitivity relative to electron probes. However, X-ray fluorescence is not very sensitive for showing the light elements that comprise the majority of cellular material. Here we show that X-ray ptychography can be combined with fluorescence to image both cellular structure and trace element distribution in frozen-hydrated cells at cryogenic temperatures, with high structural and chemical fidelity. Ptychographic reconstruction algorithms deliver phase and absorption contrast images at a resolutionmore » beyond that of the illuminating lens or beam size. Using 5.2-keV X-rays, we have obtained sub-30-nm resolution structural images and ~90-nm-resolution fluorescence images of several elements in frozen-hydrated green algae. Finally, this combined approach offers a way to study the role of trace elements in their structural context.« less

Simultaneous cryo X-ray ptychographic and fluorescence microscopy of green algae

DOE PAGES

Deng, Junjing; Vine, David J.; Chen, Si; ...

2015-02-24

Trace metals play important roles in normal and in disease-causing biological functions. X-ray fluorescence microscopy reveals trace elements with no dependence on binding affinities (unlike with visible light fluorophores) and with improved sensitivity relative to electron probes. However, X-ray fluorescence is not very sensitive for showing the light elements that comprise the majority of cellular material. Here we show that X-ray ptychography can be combined with fluorescence to image both cellular structure and trace element distribution in frozen-hydrated cells at cryogenic temperatures, with high structural and chemical fidelity. Ptychographic reconstruction algorithms deliver phase and absorption contrast images at a resolutionmore » beyond that of the illuminating lens or beam size. Using 5.2-keV X-rays, we have obtained sub-30-nm resolution structural images and ~90-nm-resolution fluorescence images of several elements in frozen-hydrated green algae. Finally, this combined approach offers a way to study the role of trace elements in their structural context.« less

Simultaneous cryo X-ray ptychographic and fluorescence microscopy of green algae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Junjing; Vine, David J.; Chen, Si

Trace metals play important roles in normal and in disease-causing biological functions. X-ray fluorescence microscopy reveals trace elements with no dependence on binding affinities (unlike with visible light fluorophores) and with improved sensitivity relative to electron probes. However, X-ray fluorescence is not very sensitive for showing the light elements that comprise the majority of cellular material. Here we show that X-ray ptychography can be combined with fluorescence to image both cellular structure and trace element distribution in frozen-hydrated cells at cryogenic temperatures, with high structural and chemical fidelity. Ptychographic reconstruction algorithms deliver phase and absorption contrast images at a resolutionmore » beyond that of the illuminating lens or beam size. Using 5.2-keV X-rays, we have obtained sub-30-nm resolution structural images and similar to 90-nm-resolution fluorescence images of several elements in frozen-hydrated green algae. This combined approach offers a way to study the role of trace elements in their structural context.« less

Measurement of replication structures at the nanometer scale using super-resolution light microscopy

PubMed Central

Baddeley, D.; Chagin, V. O.; Schermelleh, L.; Martin, S.; Pombo, A.; Carlton, P. M.; Gahl, A.; Domaing, P.; Birk, U.; Leonhardt, H.; Cremer, C.; Cardoso, M. C.

2010-01-01

DNA replication, similar to other cellular processes, occurs within dynamic macromolecular structures. Any comprehensive understanding ultimately requires quantitative data to establish and test models of genome duplication. We used two different super-resolution light microscopy techniques to directly measure and compare the size and numbers of replication foci in mammalian cells. This analysis showed that replication foci vary in size from 210 nm down to 40 nm. Remarkably, spatially modulated illumination (SMI) and 3D-structured illumination microscopy (3D-SIM) both showed an average size of 125 nm that was conserved throughout S-phase and independent of the labeling method, suggesting a basic unit of genome duplication. Interestingly, the improved optical 3D resolution identified 3- to 5-fold more distinct replication foci than previously reported. These results show that optical nanoscopy techniques enable accurate measurements of cellular structures at a level previously achieved only by electron microscopy and highlight the possibility of high-throughput, multispectral 3D analyses. PMID:19864256

3D Structure Determination of Native Mammalian Cells using Cryo-FIB and Cryo-electron Tomography

PubMed Central

Wang, Ke; Strunk, Korrinn; Zhao, Gongpu; Gray, Jennifer L.; Zhang, Peijun

2012-01-01

Cryo-electron tomography (cryo-ET) has enabled high resolution three-dimensional (3D) structural analysis of virus and host cell interactions and many cell signaling events; these studies, however, have largely been limited to very thin, peripheral regions of eukaryotic cells or to small prokaryotic cells. Recent efforts to make thin, vitreous sections using cryo-ultramicrotomy have been successful, however, this method is technically very challenging and with many artifacts. Here, we report a simple and robust method for creating in situ, frozen-hydrated cell lamellas using a focused ion beam at cryogenic temperature (cryo-FIB), allowing access to any interior cellular regions of interest. We demonstrate the utility of cryo-FIB with high resolution 3D cellular structures from both bacterial cells and large mammalian cells. The method will not only facilitate high-throughput 3D structural analysis of biological specimens, but is also broadly applicable to sample preparation of thin films and surface materials without the need for FIB “lift-out”. PMID:22796867

Nuclear matrix - structure, function and pathogenesis.

PubMed

Wasąg, Piotr; Lenartowski, Robert

2016-12-20

The nuclear matrix (NM), or nuclear skeleton, is the non-chromatin, ribonucleoproteinaceous framework that is resistant to high ionic strength buffers, nonionic detergents, and nucleolytic enzymes. The NM fulfills a structural role in eukaryotic cells and is responsible for maintaining the shape of the nucleus and the spatial organization of chromatin. Moreover, the NM participates in several cellular processes, such as DNA replication/repair, gene expression, RNA transport, cell signaling and differentiation, cell cycle regulation, apoptosis and carcinogenesis. Short nucleotide sequences called scaffold/matrix attachment regions (S/MAR) anchor the chromatin loops to the NM proteins (NMP). The NMP composition is dynamic and depends on the cell type and differentiation stage or metabolic activity. Alterations in the NMP composition affect anchoring of the S/MARs and thus alter gene expression. This review aims to systematize information about the skeletal structure of the nucleus, with particular emphasis on the organization of the NM and its role in selected cellular processes. We also discuss several diseases that are caused by aberrant NM structure or dysfunction of individual NM elements.

WE-DE-202-02: Are Track Structure Simulations Truly Needed for Radiobiology at the Cellular and Tissue Levels?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, R.

Radiation therapy for the treatment of cancer has been established as a highly precise and effective way to eradicate a localized region of diseased tissue. To achieve further significant gains in the therapeutic ratio, we need to move towards biologically optimized treatment planning. To achieve this goal, we need to understand how the radiation-type dependent patterns of induced energy depositions within the cell (physics) connect via molecular, cellular and tissue reactions to treatment outcome such as tumor control and undesirable effects on normal tissue. Several computational biology approaches have been developed connecting physics to biology. Monte Carlo simulations are themore » most accurate method to calculate physical dose distributions at the nanometer scale, however simulations at the DNA scale are slow and repair processes are generally not simulated. Alternative models that rely on the random formation of individual DNA lesions within one or two turns of the DNA have been shown to reproduce the clusters of DNA lesions, including single strand breaks (SSBs), double strand breaks (DSBs) without the need for detailed track structure simulations. Efficient computational simulations of initial DNA damage induction facilitate computational modeling of DNA repair and other molecular and cellular processes. Mechanistic, multiscale models provide a useful conceptual framework to test biological hypotheses and help connect fundamental information about track structure and dosimetry at the sub-cellular level to dose-response effects on larger scales. In this symposium we will learn about the current state of the art of computational approaches estimating radiation damage at the cellular and sub-cellular scale. How can understanding the physics interactions at the DNA level be used to predict biological outcome? We will discuss if and how such calculations are relevant to advance our understanding of radiation damage and its repair, or, if the underlying biological processes are too complex for a mechanistic approach. Can computer simulations be used to guide future biological research? We will debate the feasibility of explaining biology from a physicists’ perspective. Learning Objectives: Understand the potential applications and limitations of computational methods for dose-response modeling at the molecular, cellular and tissue levels Learn about mechanism of action underlying the induction, repair and biological processing of damage to DNA and other constituents Understand how effects and processes at one biological scale impact on biological processes and outcomes on other scales J. Schuemann, NCI/NIH grantsS. McMahon, Funding: European Commission FP7 (grant EC FP7 MC-IOF-623630)« less

Developing Master Keys to Brain Pathology, Cancer and Aging from the Structural Biology of Proteins Controlling Reactive Oxygen Species and DNA Repair

PubMed Central

Perry, J. Jefferson P.; Fan, Li; Tainer, John A.

2007-01-01

This review is focused on proteins with key roles in pathways controlling either reactive oxygen species or DNA damage responses, both of which are essential for preserving the nervous system. An imbalance of reactive oxygen species or inappropriate DNA damage response likely causes mutational or cytotoxic outcomes, which may lead to cancer and/or aging phenotypes. Moreover, individuals with hereditary disorders in proteins of these cellular pathways have significant neurological abnormalities. Mutations in a superoxide dismutase, which removes oxygen free radicals, may cause the neurodegenerative disease amyotrophic lateral sclerosis. Additionally, DNA repair disorders that affect the brain to varying extents include ataxia-telangiectasia-like disorder, Cockayne syndrome or Werner syndrome. Here, we highlight recent advances gained through structural biochemistry studies on enzymes linked to these disorders and other related enzymes acting within the same cellular pathways. We describe the current understanding of how these vital proteins coordinate chemical steps and integrate cellular signaling and response events. Significantly, these structural studies may provide a set of master keys to developing a unified understanding of the survival mechanisms utilized after insults by reactive oxygen species and genotoxic agents, and also provide a basis for developing an informed intervention in brain tumor and neurodegenerative disease progression. PMID:17174478

Influence of Nutrient Availability and Quorum Sensing on the Formation of Metabolically Inactive Microcolonies Within Structurally Heterogeneous Bacterial Biofilms: An Individual-Based 3D Cellular Automata Model.

PubMed

Machineni, Lakshmi; Rajapantul, Anil; Nandamuri, Vandana; Pawar, Parag D

2017-03-01

The resistance of bacterial biofilms to antibiotic treatment has been attributed to the emergence of structurally heterogeneous microenvironments containing metabolically inactive cell populations. In this study, we use a three-dimensional individual-based cellular automata model to investigate the influence of nutrient availability and quorum sensing on microbial heterogeneity in growing biofilms. Mature biofilms exhibited at least three structurally distinct strata: a high-volume, homogeneous region sandwiched between two compact sections of high heterogeneity. Cell death occurred preferentially in layers in close proximity to the substratum, resulting in increased heterogeneity in this section of the biofilm; the thickness and heterogeneity of this lowermost layer increased with time, ultimately leading to sloughing. The model predicted the formation of metabolically dormant cellular microniches embedded within faster-growing cell clusters. Biofilms utilizing quorum sensing were more heterogeneous compared to their non-quorum sensing counterparts, and resisted sloughing, featuring a cell-devoid layer of EPS atop the substratum upon which the remainder of the biofilm developed. Overall, our study provides a computational framework to analyze metabolic diversity and heterogeneity of biofilm-associated microorganisms and may pave the way toward gaining further insights into the biophysical mechanisms of antibiotic resistance.

Exploring the Spatial and Temporal Organization of a Cell’s Proteome

PubMed Central

Beck, Martin; Topf, Maya; Frazier, Zachary; Tjong, Harianto; Xu, Min; Zhang, Shihua; Alber, Frank

2013-01-01

To increase our current understanding of cellular processes, such as cell signaling and division, knowledge is needed about the spatial and temporal organization of the proteome at different organizational levels. These levels cover a wide range of length and time scales: from the atomic structures of macromolecules for inferring their molecular function, to the quantitative description of their abundance, and distribution in the cell. Emerging new experimental technologies are greatly increasing the availability of such spatial information on the molecular organization in living cells. This review addresses three fields that have significantly contributed to our understanding of the proteome’s spatial and temporal organization: first, methods for the structure determination of individual macromolecular assemblies, specifically the fitting of atomic structures into density maps generated from electron microscopy techniques; second, research that visualizes the spatial distributions of these complexes within the cellular context using cryo electron tomography techniques combined with computational image processing; and third, methods for the spatial modeling of the dynamic organization of the proteome, specifically those methods for simulating reaction and diffusion of proteins and complexes in crowded intracellular fluids. The long-term goal is to integrate the varied data about a proteome’s organization into a spatially explicit, predictive model of cellular processes. PMID:21094684

Structure and functions of the chaperone-like p97/CDC48 in plants.

PubMed

Bègue, Hervé; Jeandroz, Sylvain; Blanchard, Cécile; Wendehenne, David; Rosnoblet, Claire

2017-01-01

The chaperone-like p97 is a member of the AAA+ ATPase enzyme family that contributes to numerous cellular activities. P97 has been broadly studied in mammals (VCP/p97) and yeasts (CDC48: Cell Division Cycle 48/p97) and numerous investigations highlighted that this protein is post-translationally regulated, is structured in homohexamer and interacts with partners and cofactors that direct it to distinct cellular signalization pathway including protein quality control and degradation, cell cycle regulation, genome stability, vesicular trafficking, autophagy and immunity. p97 is also conserved in plants (CDC48) but its functions are less understood. In the present review we intended to present the state of the art of the structure, regulation and functions of CDC48 in plants. Evidence accumulated underline that CDC48 plays a crucial role in development, cell cycle regulation and protein turnover in plants. Furthermore, its involvement in plant immunity has recently emerged and first interacting partners have been identified, shedding light on its putative cellular activities. Identification of emerging functions of CDC48 in plants opens new roads of research in immunity and provides new insights into the mechanisms of protein quality control. Copyright © 2016 Elsevier B.V. All rights reserved.

Design and evaluation of a novel subatmospheric pressure bioreactor for the preconditioning of tissue-engineered vascular constructs.

PubMed

Coakley, Daniel N; Shaikh, Faisal M; O'Sullivan, Kathleen; Kavanagh, Eamon G; Grace, Pierce A; McGloughlin, Tim M

2016-02-01

The pre-conditioning of tissue-engineered vascular scaffolds with mechanical stimuli is being recognised as an essential step in producing a functional vascular construct. In this study we design and evaluate a novel bioreactor, which exerts a mechanical strain on developing vascular scaffolds via subatmospheric pressure. We design and construct a bioreactor, which exerts subatmospheric pressure via a vacuum assisted closure unit. Vascular scaffolds seeded with human umbilical endothelial cells were evaluated for structural integrity, microbial contamination, cellular viability, von Willebrand factor (VWF) production, cell proliferation and morphology under a range of subatmospheric pressures (75-200mmHg). The bioreactor produced sustained subatmospheric pressures, which exerted a mechanical strain on the vascular scaffold. No microbial contamination was found during the study. The structural integrity of the vascular construct was maintained. There was no difference in cellular viability between control or subatmospheric pressure groups (p = 0.817). Cells continued to produce VWF under a range of subatmospheric pressures. Cells subjected to subatmospheric pressures of 125mmHg and 200mmHg exhibited higher levels of growth than cells in atmospheric pressure at 24 (p≤0.016) and 48 hour (p≤0.001). Negative pressure affected cellular morphology, which were more organised, elongated and expanded when exposed to subatmospheric pressure. We have constructed and validated a novel subatmospheric bioreactor. The bioreactor maintained a continuous subatmospheric pressure to the vascular scaffolds in a stable, sterile and constant environment. The bioreactor exerted a strain on the vascular sheets, which was shown to alter cellular morphology and enhance cellular proliferation.

Fibronectin Deposition Participates in Extracellular Matrix Assembly and Vascular Morphogenesis

PubMed Central

Hielscher, Abigail; Ellis, Kim; Qiu, Connie; Porterfield, Josh; Gerecht, Sharon

2016-01-01

The extracellular matrix (ECM) has been demonstrated to facilitate angiogenesis. In particular, fibronectin has been documented to activate endothelial cells, resulting in their transition from a quiescent state to an active state in which the cells exhibit enhanced migration and proliferation. The goal of this study is to examine the role of polymerized fibronectin during vascular tubulogenesis using a 3 dimensional (3D) cell-derived de-cellularized matrix. A fibronectin-rich 3D de-cellularized ECM was used as a scaffold to study vascular morphogenesis of endothelial cells (ECs). Confocal analyses of several matrix proteins reveal high intra- and extra-cellular deposition of fibronectin in formed vascular structures. Using a small peptide inhibitor of fibronectin polymerization, we demonstrate that inhibition of fibronectin fibrillogenesis in ECs cultured atop de-cellularized ECM resulted in decreased vascular morphogenesis. Further, immunofluorescence and ultrastructural analyses reveal decreased expression of stromal matrix proteins in the absence of polymerized fibronectin with high co-localization of matrix proteins found in association with polymerized fibronectin. Evaluating vascular kinetics, live cell imaging showed that migration, migration velocity, and mean square displacement, are disrupted in structures grown in the absence of polymerized fibronectin. Additionally, vascular organization failed to occur in the absence of a polymerized fibronectin matrix. Consistent with these observations, we tested vascular morphogenesis following the disruption of EC adhesion to polymerized fibronectin, demonstrating that block of integrins α5β1 and αvβ3, abrogated vascular morphogenesis. Overall, fibronectin deposition in a 3D cell-derived de-cellularized ECM appears to be imperative for matrix assembly and vascular morphogenesis. PMID:26811931

Reduction in lipophilicity improved the solubility, plasma–protein binding, and permeability of tertiary sulfonamide RORc inverse agonists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fauber, Benjamin P.; René, Olivier; de Leon Boenig, Gladys

2014-08-01

Using structure-based drug design principles, we identified opportunities to reduce the lipophilicity of our tertiary sulfonamide RORc inverse agonists. The new analogs possessed improved RORc cellular potencies with >77-fold selectivity for RORc over other nuclear receptors in our cell assay suite. The reduction in lipophilicity also led to an increased plasma–protein unbound fraction and improvements in cellular permeability and aqueous solubility.

Structure of the vault, a ubiquitous celular component.

PubMed

Kong, L B; Siva, A C; Rome, L H; Stewart, P L

1999-04-15

The vault is a ubiquitous and highly conserved ribonucleoprotein particle of approximately 13 MDa. This particle has been shown to be upregulated in certain multidrug-resistant cancer cell lines and to share a protein component with the telomerase complex. Determination of the structure of the vault was undertaken to provide a first step towards understanding the role of this cellular component in normal metabolism and perhaps to shed some light on its role in mediating drug resistance. Over 1300 particle images were combined to calculate an approximately 31 A resolution structure of the vault. Rotational power spectra did not yield a clear symmetry peak, either because of the thin, smooth walls or inherent flexibility of the vault. Although cyclic eightfold (C8) symmetry was imposed, the resulting reconstruction may be partially cylindrically averaged about the eightfold axis. Our results reveal the vault to be a hollow, barrel-like structure with two protruding caps and an invaginated waist. Although the normal cellular function of the vault is as yet undetermined, the structure of the vault is consistent with either a role in subcellular transport, as previously suggested, or in sequestering macromolecular assemblies.

Complex structure of the fission yeast SREBP-SCAP binding domains reveals an oligomeric organization.

PubMed

Gong, Xin; Qian, Hongwu; Shao, Wei; Li, Jingxian; Wu, Jianping; Liu, Jun-Jie; Li, Wenqi; Wang, Hong-Wei; Espenshade, Peter; Yan, Nieng

2016-11-01

Sterol regulatory element-binding protein (SREBP) transcription factors are master regulators of cellular lipid homeostasis in mammals and oxygen-responsive regulators of hypoxic adaptation in fungi. SREBP C-terminus binds to the WD40 domain of SREBP cleavage-activating protein (SCAP), which confers sterol regulation by controlling the ER-to-Golgi transport of the SREBP-SCAP complex and access to the activating proteases in the Golgi. Here, we biochemically and structurally show that the carboxyl terminal domains (CTD) of Sre1 and Scp1, the fission yeast SREBP and SCAP, form a functional 4:4 oligomer and Sre1-CTD forms a dimer of dimers. The crystal structure of Sre1-CTD at 3.5 Å and cryo-EM structure of the complex at 5.4 Å together with in vitro biochemical evidence elucidate three distinct regions in Sre1-CTD required for Scp1 binding, Sre1-CTD dimerization and tetrameric formation. Finally, these structurally identified domains are validated in a cellular context, demonstrating that the proper 4:4 oligomeric complex formation is required for Sre1 activation.

Structure-based optics of centric diatom frustules: modulation of the in vivo light field for efficient diatom photosynthesis.

PubMed

Goessling, Johannes W; Su, Yanyan; Cartaxana, Paulo; Maibohm, Christian; Rickelt, Lars F; Trampe, Erik C L; Walby, Sandra L; Wangpraseurt, Daniel; Wu, Xia; Ellegaard, Marianne; Kühl, Michael

2018-07-01

The optical properties of diatom silicate frustules inspire photonics and nanotechnology research. Whether light interaction with the nano-structure of the frustule also affects diatom photosynthesis has remained unclear due to lack of information on frustule optical properties under more natural conditions. Here we demonstrate that the optical properties of the frustule valves in water affect light harvesting and photosynthesis in live cells of centric diatoms (Coscinodiscus granii). Microscale cellular mapping of photosynthesis around localized spot illumination demonstrated optical coupling of chloroplasts to the valve wall. Photonic structures of the three-layered C. granii valve facilitated light redistribution and efficient photosynthesis in cell regions distant from the directly illuminated area. The different porous structure of the two sides of the valve exhibited photon trapping and forward scattering of blue light enhancing photosynthetic active radiation inside the cell. Photonic structures of diatom frustules thus alter the cellular light field with implications on diatom photobiology. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

Preliminary investigation of airgap electrospun silk-fibroin-based structures for ligament analogue engineering.

PubMed

Sell, S A; McClure, M J; Ayres, C E; Simpson, D G; Bowlin, G L

2011-01-01

The process of electrospinning has proven to be highly beneficial for use in a number of tissue-engineering applications due to its ease of use, flexibility and tailorable properties. There have been many publications on the creation of aligned fibrous structures created through various forms of electrospinning, most involving the use of a metal target rotating at high speeds. This work focuses on the use of a variation known as airgap electrospinning, which does not use a metal collecting target but rather a pair of grounded electrodes equidistant from the charged polymer solution to create highly aligned 3D structures. This study involved a preliminary investigation and comparison of traditionally and airgap electrospun silk-fibroin-based ligament constructs. Structures were characterized with SEM and alignment FFT, and underwent porosity, permeability, and mechanical anisotropy evaluation. Preliminary cell culture with human dermal fibroblasts was performed to determine the degree of cellular orientation and penetration. Results showed airgap electrospun structures to be anisotropic with significantly increased porosity and cellular penetration compared to their traditionally electrospun counterparts.

[Effect of electroacupuncture on cellular structure of hippocampus in splenic asthenia pedo-rats].

PubMed

Yang, Zhuo-xin; Zhuo, Yuan-yuan; Yu, Hai-bo; Wang, Ning

2010-02-01

To observe the effect of electroacupuncture (EA) on hippocampal structure in splenic asthenia pedo-rats. A total of 15 SD male rats were randomly assigned to normal control group (n=5), model group (n=5) and EA group (n=5). Splenic asthenic syndrome model was established by intragastric administration of rhubarb and intraperitoneal injection of Reserpine for 14 d. EA (1 mA, 3 Hz/iS Hz) was applied to bilateral "Zusanli" (ST 36) and "Sanyinjiao" (SP 6) for 20 mm, once a day for 14 days. The cellular structure of hippocampus was observed by light microscope and transmission electron microscope. Optical microscopic observation showed that in normal control group, the cellular nucleus was distinct, and the granular cell layer well-arranged and tight. In model group, the intracellular space was widened, and the granular cell layer was out of order in the arrangement. In EA group, the celluldr nucleus and the granular cell layer were nearly normal. Results of the electronic microscope showed that cells in model group had a karyopyknosis with irregular appearance and clear incisure, and some of them presented dissolving and necrotic phenomena; and those in EA group were milder in injury, had nearly-normal nucleus with visible nucleoli and relatively-intact nuclear membrane. Regarding the cellular plasma, in comparison with rich normal organelles of control group, the mitochondria in model group were swelling, with vague, dissolved and broken cristae, while in EA group, majority of the organelles were well-kept, and slightly dissolved mitochondrial cristae found. In regard to the synaptic structure, in comparison with control group, synaptic apomorphosis and swelling mitochondria were found in model group While in EA group, milder swelling and hydropic degeneration were seen. Different from the distinct pre- and post-synaptic membrane and synaptic vesicles of control group, while those in EA group were nearly-normal. electroacupunture can effectively relieve splenasthenic syndrome induced pathohistological changes of neurons of the hippocampus in the rat.

Cellular-foam polypropylene ferroelectrets with increased film thickness and reduced resonance frequency

NASA Astrophysics Data System (ADS)

Sborikas, Martynas; Wegener, Michael

2013-12-01

Ferroelectrets are piezoelectric materials suitable for acoustic applications such as airborne ultrasonic transducers. Typical ferroelectrets exhibit resonance frequencies in the high kHz to low MHz range. In order to decrease the transducer resonance frequencies to the low kHz range, processes such as gas-diffusion expansion and electric charging were adjusted to cellular films which are initially twice as thick as in earlier studies. The demonstrated film expansion and electric charging lead to mechanically soft cellular structures which show high piezoelectric activities with coefficients up to 130 pC/N. Due to the simultaneously increased film thicknesses, the resonance frequencies are lowered down to about 233 kHz.

Hierarchical Targeting Strategy for Enhanced Tumor Tissue Accumulation/Retention and Cellular Internalization.

PubMed

Wang, Sheng; Huang, Peng; Chen, Xiaoyuan

2016-09-01

Targeted delivery of therapeutic agents is an important way to improve the therapeutic index and reduce side effects. To design nanoparticles for targeted delivery, both enhanced tumor tissue accumulation/retention and enhanced cellular internalization should be considered simultaneously. So far, there have been very few nanoparticles with immutable structures that can achieve this goal efficiently. Hierarchical targeting, a novel targeting strategy based on stimuli responsiveness, shows good potential to enhance both tumor tissue accumulation/retention and cellular internalization. Here, the recent design and development of hierarchical targeting nanoplatforms, based on changeable particle sizes, switchable surface charges and activatable surface ligands, will be introduced. In general, the targeting moieties in these nanoplatforms are not activated during blood circulation for efficient tumor tissue accumulation, but re-activated by certain internal or external stimuli in the tumor microenvironment for enhanced cellular internalization. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Actin dynamics, architecture, and mechanics in cell motility.

PubMed

Blanchoin, Laurent; Boujemaa-Paterski, Rajaa; Sykes, Cécile; Plastino, Julie

2014-01-01

Tight coupling between biochemical and mechanical properties of the actin cytoskeleton drives a large range of cellular processes including polarity establishment, morphogenesis, and motility. This is possible because actin filaments are semi-flexible polymers that, in conjunction with the molecular motor myosin, can act as biological active springs or "dashpots" (in laymen's terms, shock absorbers or fluidizers) able to exert or resist against force in a cellular environment. To modulate their mechanical properties, actin filaments can organize into a variety of architectures generating a diversity of cellular organizations including branched or crosslinked networks in the lamellipodium, parallel bundles in filopodia, and antiparallel structures in contractile fibers. In this review we describe the feedback loop between biochemical and mechanical properties of actin organization at the molecular level in vitro, then we integrate this knowledge into our current understanding of cellular actin organization and its physiological roles.

CHIP as a membrane-shuttling proteostasis sensor

PubMed Central

Kopp, Yannick; Martínez-Limón, Adrián; Hofbauer, Harald F; Ernst, Robert; Calloni, Giulia

2017-01-01

Cells respond to protein misfolding and aggregation in the cytosol by adjusting gene transcription and a number of post-transcriptional processes. In parallel to functional reactions, cellular structure changes as well; however, the mechanisms underlying the early adaptation of cellular compartments to cytosolic protein misfolding are less clear. Here we show that the mammalian ubiquitin ligase C-terminal Hsp70-interacting protein (CHIP), if freed from chaperones during acute stress, can dock on cellular membranes thus performing a proteostasis sensor function. We reconstituted this process in vitro and found that mainly phosphatidic acid and phosphatidylinositol-4-phosphate enhance association of chaperone-free CHIP with liposomes. HSP70 and membranes compete for mutually exclusive binding to the tetratricopeptide repeat domain of CHIP. At new cellular locations, access to compartment-specific substrates would enable CHIP to participate in the reorganization of the respective organelles, as exemplified by the fragmentation of the Golgi apparatus (effector function). PMID:29091030

Laboratory testing of a building envelope segment based on cellular concrete

NASA Astrophysics Data System (ADS)

Fořt, Jan; Pavlík, Zbyšek; Černý, Robert

2016-07-01

Hygrothermal performance of a building envelope based on cellular concrete blocks is studied in the paper. Simultaneously, the strain fields induced by the heat and moisture changes are monitored. The studied wall is exposed to the climatic load corresponding to the winter climatic conditions of the moderate year for Prague. The winter climatic exposure is chosen in order to simulate the critical conditions of the building structure from the point of view of material performance and temperature and humidity loading. The evaluation of hygrothermal performance of a researched wall is done on the basis of relative humidity and temperature profiles measured along the cross section of the cellular concrete blocks. Strain gauges are fixed on the wall surface in expected orientation of the blocks expansion. The obtained results show a good hygrothermal function of the analyzed cellular concrete wall and its insignificant strain.

Cellular therapy in bone-tendon interface regeneration

PubMed Central

Rothrauff, Benjamin B; Tuan, Rocky S

2014-01-01

The intrasynovial bone-tendon interface is a gradual transition from soft tissue to bone, with two intervening zones of uncalcified and calcified fibrocartilage. Following injury, the native anatomy is not restored, resulting in inferior mechanical properties and an increased risk of re-injury. Recent in vivo studies provide evidence of improved healing when surgical repair of the bone-tendon interface is augmented with cells capable of undergoing chondrogenesis. In particular, cellular therapy in bone-tendon healing can promote fibrocartilage formation and associated improvements in mechanical properties. Despite these promising results in animal models, cellular therapy in human patients remains largely unexplored. This review highlights the development and structure-function relationship of normal bone-tendon insertions. The natural healing response to injury is discussed, with subsequent review of recent research on cellular approaches for improved healing. Finally, opportunities for translating in vivo findings into clinical practice are identified. PMID:24326955

Transition from a planar interface to cellular and dendritic structures during rapid solidification processing

NASA Technical Reports Server (NTRS)

Laxmanan, V.

1986-01-01

The development of theoretical models which characterize the planar-cellular and cell-dendrite transitions is described. The transitions are analyzed in terms of the Chalmers number, the solute Peclet number, and the tip stability parameter, which correlate microstructural features and processing conditions. The planar-cellular transition is examined using the constitutional supercooling theory of Chalmers et al., (1953) and it is observed that the Chalmers number is between 0 and 1 during dendritic and cellular growth. Analysis of cell-dendrite transition data reveal that the transition occurs when the solute Peclet number goes through a minimum, the primary arm spacings go through a maximum, and the Chalmers number is equal to 1/2. The relation between the tip stability parameter and the solute Peclet number is investigated and it is noted that the tip stability parameter is useful for studying dendritic growth in alloys.

Probing Human Telomeric DNA and RNA Topology and Ligand Binding in a Cellular Model by Using Responsive Fluorescent Nucleoside Probes.

PubMed

Manna, Sudeshna; Panse, Cornelia H; Sontakke, Vyankat A; Sangamesh, Sarangamath; Srivatsan, Seergazhi G

2017-08-17

The development of biophysical systems that enable an understanding of the structure and ligand-binding properties of G-quadruplex (GQ)-forming nucleic acid sequences in cells or models that mimic the cellular environment would be highly beneficial in advancing GQ-directed therapeutic strategies. Herein, the establishment of a biophysical platform to investigate the structure and recognition properties of human telomeric (H-Telo) DNA and RNA repeats in a cell-like confined environment by using conformation-sensitive fluorescent nucleoside probes and a widely used cellular model, bis(2-ethylhexyl) sodium sulfosuccinate reverse micelles (RMs), is described. The 2'-deoxy and ribonucleoside probes, composed of a 5-benzofuran uracil base analogue, faithfully report the aqueous micellar core through changes in their fluorescence properties. The nucleoside probes incorporated into different loops of H-Telo DNA and RNA oligonucleotide repeats are minimally perturbing and photophysically signal the formation of respective GQ structures in both aqueous buffer and RMs. Furthermore, these sensors enable a direct comparison of the binding affinity of a ligand to H-Telo DNA and RNA GQ structures in the bulk and confined environment of RMs. These results demonstrate that this combination of a GQ nucleoside probe and easy-to-handle RMs could provide new opportunities to study and devise screening-compatible assays in a cell-like environment to discover GQ binders of clinical potential. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Expression and in vitro functional analyses of recombinant Gam1 protein

PubMed Central

Avila, Gustavo A.; Ramirez, Daniel H.; Hildenbrand, Zacariah L.; Jacquez, Pedro; Chiocca, Susanna; Sun, Jianjun; Rosas-Acosta, German; Xiao, Chuan

2014-01-01

Gam1, an early gene product of an avian adenovirus, is essential for viral replication. Gam1 is the first viral protein found to globally inhibit cellular SUMOylation, a critical posttranslational modification that alters the function and cellular localization of proteins. The interaction details at the interface between Gam1 and its cellular targets remain unclear due to the lack of structural information. Although Gam1 has been previously characterized, the purity of the protein was not suitable for structural investigations. In the present study, the gene of Gam1 was cloned and expressed in various bacterial expression systems to obtain pure and soluble recombinant Gam1 protein for in vitro functional and structural studies. While Gam1 was insoluble in most expression systems tested, it became soluble when it was expressed as a fusion protein with trigger factor (TF), a ribosome associated bacterial chaperone, under the control of a cold shock promoter. Careful optimization indicates that both low temperature induction and the chaperone function of TF play critical roles in increasing Gam1 solubility. Soluble Gam1 was purified to homogeneity through sequential chromatography techniques. Monomeric Gam1 was obtained via size exclusion chromatography and analyzed by dynamic light scattering. The SUMOylation inhibitory function of the purified Gam1 was confirmed in an in vitro assay. These results have built the foundation for further structural investigations that will broaden our understanding of Gam1’s roles in viral replication. PMID:25450237

Expression and in vitro functional analyses of recombinant Gam1 protein.

PubMed

Avila, Gustavo A; Ramirez, Daniel H; Hildenbrand, Zacariah L; Jacquez, Pedro; Chiocca, Susanna; Sun, Jianjun; Rosas-Acosta, German; Xiao, Chuan

2015-01-01

Gam1, an early gene product of an avian adenovirus, is essential for viral replication. Gam1 is the first viral protein found to globally inhibit cellular SUMOylation, a critical posttranslational modification that alters the function and cellular localization of proteins. The interaction details at the interface between Gam1 and its cellular targets remain unclear due to the lack of structural information. Although Gam1 has been previously characterized, the purity of the protein was not suitable for structural investigations. In the present study, the gene of Gam1 was cloned and expressed in various bacterial expression systems to obtain pure and soluble recombinant Gam1 protein for in vitro functional and structural studies. While Gam1 was insoluble in most expression systems tested, it became soluble when it was expressed as a fusion protein with trigger factor (TF), a ribosome associated bacterial chaperone, under the control of a cold shock promoter. Careful optimization indicates that both low temperature induction and the chaperone function of TF play critical roles in increasing Gam1 solubility. Soluble Gam1 was purified to homogeneity through sequential chromatography techniques. Monomeric Gam1 was obtained via size exclusion chromatography and analyzed by dynamic light scattering. The SUMOylation inhibitory function of the purified Gam1 was confirmed in an in vitro assay. These results have built the foundation for further structural investigations that will broaden our understanding of Gam1's roles in viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.

Ultrastructural studies on the boundary tissue of the seminiferous tubules of different mammals.

PubMed

Cieciura, L; Jaszczuk-Jarosz, B; Pietrzkowska, K

1988-01-01

The aims of our studies were to compare the ultrastructure of the boundary tissue of seminiferous tubules of various mammals (rat, mouse, hamster, guinea pig, rabbit, ram, bull and man). Visual analysis of electron micrographs revealed the similarity of structure of all layers at investigated animals. The boundary tissue consists of 4 layers: 1) amorphous inner lamina, 2) cellular inner lamina, 3) amorphous outer lamina, 4) cellular outer lamina. The outer lamina of boundary tissue of rat, mouse and hamster revealed in histochemical reactions meshes resembling honey-combs. The wall of seminiferous canalicules of bull and ram consists of more bigger and different structure than one at the other laboratory animals. The most different structure of boundary tissue in man was observed. The capillary vessels penetrate in the myofibroblastic layer, when comparted to that found in other mammals on the surface of the wall.

Mushroom Lectins: Specificity, Structure and Bioactivity Relevant to Human Disease

PubMed Central

Hassan, Mohamed Ali Abol; Rouf, Razina; Tiralongo, Evelin; May, Tom W.; Tiralongo, Joe

2015-01-01

Lectins are non-immunoglobulin proteins that bind diverse sugar structures with a high degree of selectivity. Lectins play crucial role in various biological processes such as cellular signaling, scavenging of glycoproteins from the circulatory system, cell–cell interactions in the immune system, differentiation and protein targeting to cellular compartments, as well as in host defence mechanisms, inflammation, and cancer. Among all the sources of lectins, plants have been most extensively studied. However, more recently fungal lectins have attracted considerable attention due to their antitumor, antiproliferative and immunomodulatory activities. Given that only 10% of mushroom species are known and have been taxonomically classified, mushrooms represent an enormous unexplored source of potentially useful and novel lectins. In this review we provide an up-to-date summary on the biochemical, molecular and structural properties of mushroom lectins, as well as their versatile applications specifically focusing on mushroom lectin bioactivity. PMID:25856678

Structured Post-IQ Domain Governs Selectivity of Myosin X for Fascin-Actin Bundles*

PubMed Central

Nagy, Stanislav; Rock, Ronald S.

2010-01-01

Without guidance cues, cytoskeletal motors would traffic components to the wrong destination with disastrous consequences for the cell. Recently, we identified a motor protein, myosin X, that identifies bundled actin filaments for transport. These bundles direct myosin X to a unique destination, the tips of cellular filopodia. Because the structural and kinetic features that drive bundle selection are unknown, we employed a domain-swapping approach with the nonselective myosin V to identify the selectivity module of myosin X. We found a surprising role of the myosin X tail region (post-IQ) in supporting long runs on bundles. Moreover, the myosin X head is adapted for initiating processive runs on bundles. We found that the tail is structured and biases the orientation of the two myosin X heads because a targeted insertion that introduces flexibility in the tail abolishes selectivity. Together, these results suggest how myosin motors may manage to read cellular addresses. PMID:20538587

Recent research in flaxseed (oil seed) on molecular structure and metabolic characteristics of protein, heat processing-induced effect and nutrition with advanced synchrotron-based molecular techniques.

PubMed

Doiron, Kevin J; Yu, Peiqiang

2017-01-02

Advanced synchrotron radiation-based infrared microspectroscopy is able to reveal feed and food structure feature at cellular and molecular levels and simultaneously provides composition, structure, environment, and chemistry within intact tissue. However, to date, this advanced synchrotron-based technique is still seldom known to food and feed scientists. This article aims to provide detailed background for flaxseed (oil seed) protein research and then review recent progress and development in flaxseed research in ruminant nutrition in the areas of (1) dietary inclusion of flaxseed in rations; (2) heat processing effect; (3) assessing dietary protein; (4) synchrotron-based Fourier transform infrared microspectroscopy as a tool of nutritive evaluation within cellular and subcellular dimensions; (5) recent synchrotron applications in flaxseed research on a molecular basis. The information described in this paper gives better insight in flaxseed research progress and update.

Membrane interactions of ionic liquids and imidazolium salts.

PubMed

Wang, Da; Galla, Hans-Joachim; Drücker, Patrick

2018-06-01

Room-temperature ionic liquids (RTILs) have attracted considerable attention in recent years due to their versatile properties such as negligible volatility, inflammability, high extractive selectivity and thermal stability. In general, RTILs are organic salts with a melting point below ~100 °C determined by the asymmetry of at least one of their ions. Due to their amphiphilic character, strong interactions with biological materials can be expected. However, rising attention has appeared towards their similarity and interaction with biomolecules. By employing structural modifications, the biochemical properties of RTILs can be designed to mimic lipid structures and to tune their hydrophobicity towards a lipophilic behavior. This is evident for the interaction with lipid-membranes where some of these compounds present membrane-disturbing effects or cellular toxicity. Moreover, they can form micelles or lipid-like bilayer structures by themselves. Both aspects, cellular effects and membrane-forming capacities, of a novel class of lipophilic imidazolium salts will be discussed.

Nanodiamond Landmarks for Subcellular Multimodal Optical and Electron Imaging

PubMed Central

Zurbuchen, Mark A.; Lake, Michael P.; Kohan, Sirus A.; Leung, Belinda; Bouchard, Louis-S.

2013-01-01

There is a growing need for biolabels that can be used in both optical and electron microscopies, are non-cytotoxic, and do not photobleach. Such biolabels could enable targeted nanoscale imaging of sub-cellular structures, and help to establish correlations between conjugation-delivered biomolecules and function. Here we demonstrate a sub-cellular multi-modal imaging methodology that enables localization of inert particulate probes, consisting of nanodiamonds having fluorescent nitrogen-vacancy centers. These are functionalized to target specific structures, and are observable by both optical and electron microscopies. Nanodiamonds targeted to the nuclear pore complex are rapidly localized in electron-microscopy diffraction mode to enable “zooming-in” to regions of interest for detailed structural investigations. Optical microscopies reveal nanodiamonds for in-vitro tracking or uptake-confirmation. The approach is general, works down to the single nanodiamond level, and can leverage the unique capabilities of nanodiamonds, such as biocompatibility, sensitive magnetometry, and gene and drug delivery. PMID:24036840

Visualizing Cochlear Mechanics Using Confocal Microscopy

NASA Astrophysics Data System (ADS)

Ulfendahl, M.; Boutet de Monvel, J.; Fridberger, A.

2003-02-01

The sound-evoked vibration pattern of the hearing organ is based on complex mechanical interactions between different cellular structures. To explore the structural changes occurring within the organ of Corti during basilar-membrane motion, stepwise alterations of the scala tympani pressure were applied in an in vitro preparation of the guinea-pig temporal bone. Confocal images were acquired at each pressure level. In this way, the motion of several structures could be simultaneously observed with high resolution in a nearly intact system. Images were analyzed using a novel wavelet-based optical-flow estimation algorithm. Under the present experimental conditions, the reticular lamina moved as a stiff plate with a center of rotation in the region of the inner hair cells. The outer hair cells appeared non-rigid and the basal, synaptic regions of these cells displayed significant radial motion indicative of cellular bending and internal shearing.

Numerical simulation of deformation and fracture of space protective shell structures from concrete and fiber concrete under pulse loading

NASA Astrophysics Data System (ADS)

Radchenko, P. A.; Batuev, S. P.; Radchenko, A. V.; Plevkov, V. S.

2015-11-01

This paper presents results of numerical simulation of interaction between aircraft Boeing 747-400 and protective shell of nuclear power plant. The shell is presented as complex multilayered cellular structure comprising layers of concrete and fiber concrete bonded with steel trusses. Numerical simulation was held three-dimensionally using the author's algorithm and software taking into account algorithms for building grids of complex geometric objects and parallel computations. The dynamics of stress-strain state and fracture of structure were studied. Destruction is described using two-stage model that allows taking into account anisotropy of elastic and strength properties of concrete and fiber concrete. It is shown that wave processes initiate destruction of shell cellular structure—cells start to destruct in unloading wave, originating after output of compression wave to the free surfaces of cells.

Ru(II)-polypyridyl surface functionalised gold nanoparticles as DNA targeting supramolecular structures and luminescent cellular imaging agents.

PubMed

Martínez-Calvo, Miguel; Orange, Kim N; Elmes, Robert B P; la Cour Poulsen, Bjørn; Williams, D Clive; Gunnlaugsson, Thorfinnur

2016-01-07

The development of Ru(II) functionalized gold nanoparticles 1–3·AuNP is described. These systems were found to be mono-disperse with a hydrodynamic radius of ca. 15 nm in water but gave rise to the formation of higher order structures in buffered solution. The interaction of 1–3·AuNP with DNA was also studied by spectroscopic and microscopic methods and suggested the formation of large self-assembly structures in solution. The uptake of 1–3·AuNP by cancer cells was studied using both confocal fluorescence as well as transmission electron microscopy (TEM), with the aim of investigating their potential as tools for cellular biology. These systems displaying a non-toxic profile with favourable photophysical properties may have application across various biological fields including diagnostics and therapeutics.

Minimal metabolic pathway structure is consistent with associated biomolecular interactions

PubMed Central

Bordbar, Aarash; Nagarajan, Harish; Lewis, Nathan E; Latif, Haythem; Ebrahim, Ali; Federowicz, Stephen; Schellenberger, Jan; Palsson, Bernhard O

2014-01-01

Pathways are a universal paradigm for functionally describing cellular processes. Even though advances in high-throughput data generation have transformed biology, the core of our biological understanding, and hence data interpretation, is still predicated on human-defined pathways. Here, we introduce an unbiased, pathway structure for genome-scale metabolic networks defined based on principles of parsimony that do not mimic canonical human-defined textbook pathways. Instead, these minimal pathways better describe multiple independent pathway-associated biomolecular interaction datasets suggesting a functional organization for metabolism based on parsimonious use of cellular components. We use the inherent predictive capability of these pathways to experimentally discover novel transcriptional regulatory interactions in Escherichia coli metabolism for three transcription factors, effectively doubling the known regulatory roles for Nac and MntR. This study suggests an underlying and fundamental principle in the evolutionary selection of pathway structures; namely, that pathways may be minimal, independent, and segregated. PMID:24987116

Long Time-lapse Nanoscopy with Spontaneously Blinking Membrane Probes

PubMed Central

Takakura, Hideo; Zhang, Yongdeng; Erdmann, Roman S.; Thompson, Alexander D.; Lin, Yu; McNellis, Brian; Rivera-Molina, Felix; Uno, Shin-nosuke; Kamiya, Mako; Urano, Yasuteru; Rothman, James E.; Bewersdorf, Joerg; Schepartz, Alanna; Toomre, Derek

2017-01-01

Long time-lapse, diffraction-unlimited super-resolution imaging of cellular structures and organelles in living cells is highly challenging, as it requires dense labeling, bright, highly photostable dyes, and non-toxic conditions. We developed a set of high-density, environment-sensitive (HIDE) membrane probes based on HMSiR that assemble in situ and enable long time-lapse, live cell nanoscopy of discrete cellular structures and organelles with high spatio-temporal resolution. HIDE-enabled nanoscopy movies are up to 50x longer than movies obtained with labeled proteins, reveal the 2D dynamics of the mitochondria, plasma membrane, and filopodia, and the 2D and 3D dynamics of the endoplasmic reticulum in living cells. These new HIDE probes also facilitate the acquisition of live cell, two-color, super-resolution images, greatly expanding the utility of nanoscopy to visualize processes and structures in living cells. PMID:28671662

Pollen structure visualization using high-resolution laboratory-based hard X-ray tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Qiong; Gluch, Jürgen; Krüger, Peter

A laboratory-based X-ray microscope is used to investigate the 3D structure of unstained whole pollen grains. For the first time, high-resolution laboratory-based hard X-ray microscopy is applied to study pollen grains. Based on the efficient acquisition of statistically relevant information-rich images using Zernike phase contrast, both surface- and internal structures of pine pollen - including exine, intine and cellular structures - are clearly visualized. The specific volumes of these structures are calculated from the tomographic data. The systematic three-dimensional study of pollen grains provides morphological and structural information about taxonomic characters that are essential in palynology. Such studies have amore » direct impact on disciplines such as forestry, agriculture, horticulture, plant breeding and biodiversity. - Highlights: • The unstained whole pine pollen was visualized by high-resolution laboratory-based HXRM for the first time. • The comparison study of pollen grains by LM, SEM and high-resolution laboratory-based HXRM. • Phase contrast imaging provides significantly higher contrast of the raw images compared to absorption contrast imaging. • Surface and internal structure of the pine pollen including exine, intine and cellular structures are clearly visualized. • 3D volume data of unstained whole pollen grains are acquired and the specific volumes of the different layer are calculated.« less

Empirical tests of a theory of language, mathematics, and matter.

PubMed

Abler, William L

2008-01-01

In an earlier paper (Abler, 2006), I proposed a theory of language, especially sentences, based on the symmetrical structure of the equation. Here, I use the structure of equations to deduce neural structures (e.g., mirror neurons or intra-cellular macromolecules, or crystals, or resonations) that might generate them. Ultimately, the properties described are a consequence of dimensional properties of matter

Mathematics, thermodynamics, and modeling to address ten common misconceptions about protein structure, folding, and stability.

PubMed

Robic, Srebrenka

2010-01-01

To fully understand the roles proteins play in cellular processes, students need to grasp complex ideas about protein structure, folding, and stability. Our current understanding of these topics is based on mathematical models and experimental data. However, protein structure, folding, and stability are often introduced as descriptive, qualitative phenomena in undergraduate classes. In the process of learning about these topics, students often form incorrect ideas. For example, by learning about protein folding in the context of protein synthesis, students may come to an incorrect conclusion that once synthesized on the ribosome, a protein spends its entire cellular life time in its fully folded native confirmation. This is clearly not true; proteins are dynamic structures that undergo both local fluctuations and global unfolding events. To prevent and address such misconceptions, basic concepts of protein science can be introduced in the context of simple mathematical models and hands-on explorations of publicly available data sets. Ten common misconceptions about proteins are presented, along with suggestions for using equations, models, sequence, structure, and thermodynamic data to help students gain a deeper understanding of basic concepts relating to protein structure, folding, and stability.

Analyzing structure-function relationships of artificial and cancer-associated PARP1 variants by reconstituting TALEN-generated HeLa PARP1 knock-out cells.

PubMed

Rank, Lisa; Veith, Sebastian; Gwosch, Eva C; Demgenski, Janine; Ganz, Magdalena; Jongmans, Marjolijn C; Vogel, Christopher; Fischbach, Arthur; Buerger, Stefanie; Fischer, Jan M F; Zubel, Tabea; Stier, Anna; Renner, Christina; Schmalz, Michael; Beneke, Sascha; Groettrup, Marcus; Kuiper, Roland P; Bürkle, Alexander; Ferrando-May, Elisa; Mangerich, Aswin

2016-12-01

Genotoxic stress activates PARP1, resulting in the post-translational modification of proteins with poly(ADP-ribose) (PAR). We genetically deleted PARP1 in one of the most widely used human cell systems, i.e. HeLa cells, via TALEN-mediated gene targeting. After comprehensive characterization of these cells during genotoxic stress, we analyzed structure-function relationships of PARP1 by reconstituting PARP1 KO cells with a series of PARP1 variants. Firstly, we verified that the PARP1\\E988K mutant exhibits mono-ADP-ribosylation activity and we demonstrate that the PARP1\\L713F mutant is constitutively active in cells. Secondly, both mutants exhibit distinct recruitment kinetics to sites of laser-induced DNA damage, which can potentially be attributed to non-covalent PARP1-PAR interaction via several PAR binding motifs. Thirdly, both mutants had distinct functional consequences in cellular patho-physiology, i.e. PARP1\\L713F expression triggered apoptosis, whereas PARP1\\E988K reconstitution caused a DNA-damage-induced G2 arrest. Importantly, both effects could be rescued by PARP inhibitor treatment, indicating distinct cellular consequences of constitutive PARylation and mono(ADP-ribosyl)ation. Finally, we demonstrate that the cancer-associated PARP1 SNP variant (V762A) as well as a newly identified inherited PARP1 mutation (F304L\\V762A) present in a patient with pediatric colorectal carcinoma exhibit altered biochemical and cellular properties, thereby potentially supporting human carcinogenesis. Together, we establish a novel cellular model for PARylation research, by revealing strong structure-function relationships of natural and artificial PARP1 variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Growth and setting of gas bubbles in a viscoelastic matrix imaged by X-ray microtomography: the evolution of cellular structures in fermenting wheat flour dough.

PubMed

Turbin-Orger, A; Babin, P; Boller, E; Chaunier, L; Chiron, H; Della Valle, G; Dendievel, R; Réguerre, A L; Salvo, L

2015-05-07

X-ray tomography is a relevant technique for the dynamic follow-up of gas bubbles in an opaque viscoelastic matrix, especially using image analysis. It has been applied here to pieces of fermenting wheat flour dough of various compositions, at two different voxel sizes (15 and 5 μm). The resulting evolution of the main cellular features shows that the creation of cellular structures follows two regimes that are defined by a characteristic time of connectivity, tc [30 and 80 min]: first (t ≤ tc), bubbles grow freely and then (t ≥ tc) they become connected since the percolation of the gas phase is limited by liquid films. During the first regime, bubbles can be tracked and the local strain rate can be measured. Its values (10(-4)-5 × 10(-4) s(-1)) are in agreement with those computed from dough viscosity and internal gas pressure, both of which depend on the composition. For higher porosity, P = 0.64 in our case, and thus occurring in the second regime, different cellular structures are obtained and XRT images show deformed gas cells that display complex shapes. The comparison of these images with confocal laser scanning microscopy images suggests the presence of liquid films that separate these cells. The dough can therefore be seen as a three-phase medium: viscoelastic matrix/gas cell/liquid phase. The contributions of the different levels of matter organization can be integrated by defining a capillary number (C = 0.1-1) that makes it possible to predict the macroscopic dough behavior.

The Evolving Contribution of Mass Spectrometry to Integrative Structural Biology

NASA Astrophysics Data System (ADS)

Faini, Marco; Stengel, Florian; Aebersold, Ruedi

2016-06-01

Protein complexes are key catalysts and regulators for the majority of cellular processes. Unveiling their assembly and structure is essential to understanding their function and mechanism of action. Although conventional structural techniques such as X-ray crystallography and NMR have solved the structure of important protein complexes, they cannot consistently deal with dynamic and heterogeneous assemblies, limiting their applications to small scale experiments. A novel methodological paradigm, integrative structural biology, aims at overcoming such limitations by combining complementary data sources into a comprehensive structural model. Recent applications have shown that a range of mass spectrometry (MS) techniques are able to generate interaction and spatial restraints (cross-linking MS) information on native complexes or to study the stoichiometry and connectivity of entire assemblies (native MS) rapidly, reliably, and from small amounts of substrate. Although these techniques by themselves do not solve structures, they do provide invaluable structural information and are thus ideally suited to contribute to integrative modeling efforts. The group of Brian Chait has made seminal contributions in the use of mass spectrometric techniques to study protein complexes. In this perspective, we honor the contributions of the Chait group and discuss concepts and milestones of integrative structural biology. We also review recent examples of integration of structural MS techniques with an emphasis on cross-linking MS. We then speculate on future MS applications that would unravel the dynamic nature of protein complexes upon diverse cellular states.

Native aggregation as a cause of origin of temporary cellular structures needed for all forms of cellular activity, signaling and transformations.

PubMed

Matveev, Vladimir V

2010-06-09

According to the hypothesis explored in this paper, native aggregation is genetically controlled (programmed) reversible aggregation that occurs when interacting proteins form new temporary structures through highly specific interactions. It is assumed that Anfinsen's dogma may be extended to protein aggregation: composition and amino acid sequence determine not only the secondary and tertiary structure of single protein, but also the structure of protein aggregates (associates). Cell function is considered as a transition between two states (two states model), the resting state and state of activity (this applies to the cell as a whole and to its individual structures). In the resting state, the key proteins are found in the following inactive forms: natively unfolded and globular. When the cell is activated, secondary structures appear in natively unfolded proteins (including unfolded regions in other proteins), and globular proteins begin to melt and their secondary structures become available for interaction with the secondary structures of other proteins. These temporary secondary structures provide a means for highly specific interactions between proteins. As a result, native aggregation creates temporary structures necessary for cell activity."One of the principal objects of theoretical research in any department of knowledge is to find the point of view from which the subject appears in its greatest simplicity."Josiah Willard Gibbs (1839-1903).

Multifunctional Cellular Materials Based on 2D Nanomaterials: Prospects and Challenges.

PubMed

Qiu, Ling; He, Zijun; Li, Dan

2018-01-01

Recent advances in emerging 2D nanomaterial-based cellular materials (2D-CMs) open up new opportunities for the development of next generation cellular solids with exceptional properties. Herein, an overview of the current research status of 2D-CMs is provided and their future opportunities are highlighted. First, the unique features of 2D nanomaterials are introduced to illustrate why these nanoscale building blocks are promising for the development of novel cellular materials and what the new features of 2D nanoscale building blocks can offer when compared to their 0D and 1D counterparts. An in-depth discussion on the structure-property relationships of 2D-CMs is then provided, and the remarkable functions that can be achieved by engineering their cellular architecture are highlighted. Additionally, the use of 2D-CMs to tackle key challenges in different practical applications is demonstrated. In conclusion, a personal perspective on the challenges and future research directions of 2D-CMs is given. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of a flavonoid C-glycoside as potent antioxidant.

PubMed

Wen, Lingrong; Zhao, Yupeng; Jiang, Yueming; Yu, Limei; Zeng, Xiaofang; Yang, Jiali; Tian, Miaomiao; Liu, Huiling; Yang, Bao

2017-09-01

Flavonoids have been documented to have good antioxidant activities in vitro. However, reports on the cellular antioxidant activities of flavonoid C-glycosides are very limited. In this work, an apigenin C-glycoside was purified from Artocarpus heterophyllus by column chromatography and was identified to be 2″-O-β-D-xylosylvitexin by nuclear magnetic resonance spectroscopy. The cellular antioxidant activity and anticancer activity of 2″-O-β-D-xylosylvitexin were evaluated for the first time. The quantitative structure-activity relationship was analysed by molecular modeling. Apigenin presented an unexpected cellular antioxidation behaviour. It had an antioxidant activity at low concentration and a prooxidant activity at high concentration, whereas 2″-O-β-D-xylosylvitexin showed a dose-dependent cellular antioxidant activity. It indicated that C-glycosidation improved the cellular antioxidation performance of apigenin and eliminated the prooxidant effect. The ortho-dihydroxyl at C-3'/C-4' and C-3 hydroxyl in the flavonoid skeleton play important roles in the antioxidation behaviour. The cell proliferation assay revealed a low cytotoxicity of 2″-O-β-D-xylosylvitexin. Copyright © 2017 Elsevier Inc. All rights reserved.

Folding, But Not Surface Area Expansion, Is Associated with Cellular Morphological Maturation in the Fetal Cerebral Cortex

PubMed Central

Studholme, Colin; Frias, Antonio E.

2017-01-01

Altered macroscopic anatomical characteristics of the cerebral cortex have been identified in individuals affected by various neurodevelopmental disorders. However, the cellular developmental mechanisms that give rise to these abnormalities are not understood. Previously, advances in image reconstruction of diffusion magnetic resonance imaging (MRI) have made possible high-resolution in utero measurements of water diffusion anisotropy in the fetal brain. Here, diffusion anisotropy within the developing fetal cerebral cortex is longitudinally characterized in the rhesus macaque, focusing on gestation day (G85) through G135 of the 165 d term. Additionally, for subsets of animals characterized at G90 and G135, immunohistochemical staining was performed, and 3D structure tensor analyses were used to identify the cellular processes that most closely parallel changes in water diffusion anisotropy with cerebral cortical maturation. Strong correlations were found between maturation of dendritic arbors on the cellular level and the loss of diffusion anisotropy with cortical development. In turn, diffusion anisotropy changes were strongly associated both regionally and temporally with cortical folding. Notably, the regional and temporal dependence of diffusion anisotropy and folding were distinct from the patterns observed for cerebral cortical surface area expansion. These findings strengthen the link proposed in previous studies between cellular-level changes in dendrite morphology and noninvasive diffusion MRI measurements of the developing cerebral cortex and support the possibility that, in gyroencephalic species, structural differentiation within the cortex is coupled to the formation of gyri and sulci. SIGNIFICANCE STATEMENT Abnormal brain morphology has been found in populations with neurodevelopmental disorders. However, the mechanisms linking cellular level and macroscopic maturation are poorly understood, even in normal brains. This study contributes new understanding to this subject using serial in utero MRI measurements of rhesus macaque fetuses, from which macroscopic and cellular information can be derived. We found that morphological differentiation of dendrites was strongly associated both regionally and temporally with folding of the cerebral cortex. Interestingly, parallel associations were not observed with cortical surface area expansion. These findings support the possibility that perturbed morphological differentiation of cells within the cortex may underlie abnormal macroscopic characteristics of individuals affected by neurodevelopmental disorders. PMID:28069920

Cellular commitment in the developing cerebellum

PubMed Central

Marzban, Hassan; Del Bigio, Marc R.; Alizadeh, Javad; Ghavami, Saeid; Zachariah, Robby M.; Rastegar, Mojgan

2014-01-01

The mammalian cerebellum is located in the posterior cranial fossa and is critical for motor coordination and non-motor functions including cognitive and emotional processes. The anatomical structure of cerebellum is distinct with a three-layered cortex. During development, neurogenesis and fate decisions of cerebellar primordium cells are orchestrated through tightly controlled molecular events involving multiple genetic pathways. In this review, we will highlight the anatomical structure of human and mouse cerebellum, the cellular composition of developing cerebellum, and the underlying gene expression programs involved in cell fate commitments in the cerebellum. A critical evaluation of the cell death literature suggests that apoptosis occurs in ~5% of cerebellar cells, most shortly after mitosis. Apoptosis and cellular autophagy likely play significant roles in cerebellar development, we provide a comprehensive discussion of their role in cerebellar development and organization. We also address the possible function of unfolded protein response in regulation of cerebellar neurogenesis. We discuss recent advancements in understanding the epigenetic signature of cerebellar compartments and possible connections between DNA methylation, microRNAs and cerebellar neurodegeneration. Finally, we discuss genetic diseases associated with cerebellar dysfunction and their role in the aging cerebellum. PMID:25628535

Structural and functional insights into sorting nexin 5/6 interaction with bacterial effector IncE.

PubMed

Sun, Qingxiang; Yong, Xin; Sun, Xiaodong; Yang, Fan; Dai, Zhonghua; Gong, Yanqiu; Zhou, Liming; Zhang, Xia; Niu, Dawen; Dai, Lunzhi; Liu, Jia-Jia; Jia, Da

2017-01-01

The endosomal trafficking pathways are essential for many cellular activities. They are also important targets by many intracellular pathogens. Key regulators of the endosomal trafficking include the retromer complex and sorting nexins (SNXs). Chlamydia trachomatis effector protein IncE directly targets the retromer components SNX5 and SNX6 and suppresses retromer-mediated transport, but the exact mechanism has remained unclear. We present the crystal structure of the PX domain of SNX5 in complex with IncE, showing that IncE binds to a highly conserved hydrophobic groove of SNX5. The unique helical hairpin of SNX5/6 is essential for binding, explaining the specificity of SNX5/6 for IncE. The SNX5/6-IncE interaction is required for cellular localization of IncE and its inhibitory function. Mechanistically, IncE inhibits the association of CI-MPR cargo with retromer-containing endosomal subdomains. Our study provides new insights into the regulation of retromer-mediated transport and illustrates the intricate competition between host and pathogens in controlling cellular trafficking.

Functional advantages of dynamic protein disorder.

PubMed

Berlow, Rebecca B; Dyson, H Jane; Wright, Peter E

2015-09-14

Intrinsically disordered proteins participate in many important cellular regulatory processes. The absence of a well-defined structure in the free state of a disordered domain, and even on occasion when it is bound to physiological partners, is fundamental to its function. Disordered domains are frequently the location of multiple sites for post-translational modification, the key element of metabolic control in the cell. When a disordered domain folds upon binding to a partner, the resulting complex buries a far greater surface area than in an interaction of comparably-sized folded proteins, thus maximizing specificity at modest protein size. Disorder also maintains accessibility of sites for post-translational modification. Because of their inherent plasticity, disordered domains frequently adopt entirely different structures when bound to different partners, increasing the repertoire of available interactions without the necessity for expression of many different proteins. This feature also adds to the faithfulness of cellular regulation, as the availability of a given disordered domain depends on competition between various partners relevant to different cellular processes. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Determining the Young's modulus of a cellular titanium implant by FEM simulation

NASA Astrophysics Data System (ADS)

Loginov, Yu. N.; Golodnov, A. I.; Stepanov, S. I.; Kovalev, E. Yu.

2017-12-01

The role of additive manufacturing is noted for the construction of titanium medical implants. The purpose of the study is to determine the Young's modulus of cellular titanium implants, which is based on calculations performed by finite element analysis. A honeycomb structure from intersecting cylinder surfaces is offered for the implant made of the Ti-6Al-4V alloy. Boundary conditions are stated for the loading of the implant structure. It is demonstrated that the Young's modulus can be reduced more than three times comparing to a solid titanium alloy. Zones of strain and stress localization located near the abutment of the cylindrical surfaces. Recommendations for the further improvement of the implant architecture are generated.

Magnetic apatite for structural insights on the plasma membrane

NASA Astrophysics Data System (ADS)

Stanca, Sarmiza E.; Müller, Robert; Dellith, Jan; Nietzsche, Sandor; Stöckel, Stephan; Biskup, Christoph; Deckert, Volker; Krafft, Christoph; Popp, Jürgen; Fritzsche, Wolfgang

2015-01-01

The iron oxide-hydroxyapatite (FeOxHA) nanoparticles reported here differ from those reported before by their advantage of homogeneity and simple preparation; moreover, the presence of carboxymethyldextran (CMD), together with hydroxyapatite (HA), allows access to the cellular membrane, which makes our magnetic apatite unique. These nanoparticles combine magnetic behavior, Raman label ability and the property of interaction with the cellular membrane; they therefore represent an interesting material for structural differentiation of the cell membrane. It was observed by Raman spectroscopy, scanning electron microscopy (SEM) and fluorescence microscopy that FeOxHA adheres to the plasma membrane and does not penetrate the membrane. These insights make the nanoparticles a promising material for magnetic cell sorting, e.g. in microfluidic device applications.

Magnetic apatite for structural insights on the plasma membrane.

PubMed

Stanca, Sarmiza E; Müller, Robert; Dellith, Jan; Nietzsche, Sandor; Stöckel, Stephan; Biskup, Christoph; Deckert, Volker; Krafft, Christoph; Popp, Jürgen; Fritzsche, Wolfgang

2015-01-21

The iron oxide-hydroxyapatite (FeOxHA) nanoparticles reported here differ from those reported before by their advantage of homogeneity and simple preparation; moreover, the presence of carboxymethyldextran (CMD), together with hydroxyapatite (HA), allows access to the cellular membrane, which makes our magnetic apatite unique. These nanoparticles combine magnetic behavior, Raman label ability and the property of interaction with the cellular membrane; they therefore represent an interesting material for structural differentiation of the cell membrane. It was observed by Raman spectroscopy, scanning electron microscopy (SEM) and fluorescence microscopy that FeOxHA adheres to the plasma membrane and does not penetrate the membrane. These insights make the nanoparticles a promising material for magnetic cell sorting, e.g. in microfluidic device applications.

Recent Progress of Microfluidics in Translational Applications

PubMed Central

Liu, Zongbin; Han, Xin

2016-01-01

Microfluidics, featuring microfabricated structures, is a technology for manipulating fluids at the micrometer scale. The small dimension and flexibility of microfluidic systems are ideal for mimicking molecular and cellular microenvironment, and show great potential in translational research and development. Here, the recent progress of microfluidics in biological and biomedical applications, including molecular analysis, cellular analysis, and chip-based material delivery and biomimetic design is presented. The potential future developments in the translational microfluidics field are also discussed. PMID:27091777

Interface Pattern Selection Criterion for Cellular Structures in Directional Solidification

NASA Technical Reports Server (NTRS)

Trivedi, R.; Tewari, S. N.; Kurtze, D.

1999-01-01

The aim of this investigation is to establish key scientific concepts that govern the selection of cellular and dendritic patterns during the directional solidification of alloys. We shall first address scientific concepts that are crucial in the selection of interface patterns. Next, the results of ground-based experimental studies in the Al-4.0 wt % Cu system will be described. Both experimental studies and theoretical calculations will be presented to establish the need for microgravity experiments.

3-D Cellular Ultrastructure Can Be Resolved by X-ray Microscopy | Center for Cancer Research

Cancer.gov

X-ray microscopy (XRM) is more rapid than cryoelectron tomography or super-resolution fluorescence microscopy and could fill an important gap in current technologies used to investigate in situ three-dimensional structure of cells. New XRM methods developed by first author Gerd Schneider, Ph.D., working with James McNally. Ph.D., and a team of colleagues, is capable of revealing full cellular ultrastructure without requiring fixation, staining, or sectioning.

Facile Synthesis of Uniform Virus-like Mesoporous Silica Nanoparticles for Enhanced Cellular Internalization

PubMed Central

2017-01-01

The low-efficiency cellular uptake property of current nanoparticles greatly restricts their application in the biomedical field. Herein, we demonstrate that novel virus-like mesoporous silica nanoparticles can easily be synthesized, showing greatly superior cellular uptake property. The unique virus-like mesoporous silica nanoparticles with a spiky tubular rough surface have been successfully synthesized via a novel single-micelle epitaxial growth approach in a low-concentration-surfactant oil/water biphase system. The virus-like nanoparticles’ rough surface morphology results mainly from the mesoporous silica nanotubes spontaneously grown via an epitaxial growth process. The obtained nanoparticles show uniform particle size and excellent monodispersity. The structural parameters of the nanoparticles can be well tuned with controllable core diameter (∼60–160 nm), tubular length (∼6–70 nm), and outer diameter (∼6–10 nm). Thanks to the biomimetic morphology, the virus-like nanoparticles show greatly superior cellular uptake property (invading living cells in large quantities within few minutes, <5 min), unique internalization pathways, and extended blood circulation duration (t1/2 = 2.16 h), which is much longer than that of conventional mesoporous silica nanoparticles (0.45 h). Furthermore, our epitaxial growth strategy can be applied to fabricate various virus-like mesoporous core–shell structures, paving the way toward designed synthesis of virus-like nanocomposites for biomedicine applications. PMID:28852697

Macro-architectured cellular materials: Properties, characteristic modes, and prediction methods

NASA Astrophysics Data System (ADS)

Ma, Zheng-Dong

2017-12-01

Macro-architectured cellular (MAC) material is defined as a class of engineered materials having configurable cells of relatively large (i.e., visible) size that can be architecturally designed to achieve various desired material properties. Two types of novel MAC materials, negative Poisson's ratio material and biomimetic tendon reinforced material, were introduced in this study. To estimate the effective material properties for structural analyses and to optimally design such materials, a set of suitable homogenization methods was developed that provided an effective means for the multiscale modeling of MAC materials. First, a strain-based homogenization method was developed using an approach that separated the strain field into a homogenized strain field and a strain variation field in the local cellular domain superposed on the homogenized strain field. The principle of virtual displacements for the relationship between the strain variation field and the homogenized strain field was then used to condense the strain variation field onto the homogenized strain field. The new method was then extended to a stress-based homogenization process based on the principle of virtual forces and further applied to address the discrete systems represented by the beam or frame structures of the aforementioned MAC materials. The characteristic modes and the stress recovery process used to predict the stress distribution inside the cellular domain and thus determine the material strengths and failures at the local level are also discussed.

Connecting synthetic chemistry decisions to cell and genome biology using small-molecule phenotypic profiling

PubMed Central

Wagner, Bridget K.; Clemons, Paul A.

2009-01-01

Discovering small-molecule modulators for thousands of gene products requires multiple stages of biological testing, specificity evaluation, and chemical optimization. Many cellular profiling methods, including cellular sensitivity, gene-expression, and cellular imaging, have emerged as methods to assess the functional consequences of biological perturbations. Cellular profiling methods applied to small-molecule science provide opportunities to use complex phenotypic information to prioritize and optimize small-molecule structures simultaneously against multiple biological endpoints. As throughput increases and cost decreases for such technologies, we see an emerging paradigm of using more information earlier in probe- and drug-discovery efforts. Moreover, increasing access to public datasets makes possible the construction of “virtual” profiles of small-molecule performance, even when multiplexed measurements were not performed or when multidimensional profiling was not the original intent. We review some key conceptual advances in small-molecule phenotypic profiling, emphasizing connections to other information, such as protein-binding measurements, genetic perturbations, and cell states. We argue that to maximally leverage these measurements in probe and drug discovery requires a fundamental connection to synthetic chemistry, allowing the consequences of synthetic decisions to be described in terms of changes in small-molecule profiles. Mining such data in the context of chemical structure and synthesis strategies can inform decisions about chemistry procurement and library development, leading to optimal small-molecule screening collections. PMID:19825513

Simple and Flexible Self-Reproducing Structures in Asynchronous Cellular Automata and Their Dynamics

NASA Astrophysics Data System (ADS)

Huang, Xin; Lee, Jia; Yang, Rui-Long; Zhu, Qing-Sheng

2013-03-01

Self-reproduction on asynchronous cellular automata (ACAs) has attracted wide attention due to the evident artifacts induced by synchronous updating. Asynchronous updating, which allows cells to undergo transitions independently at random times, might be more compatible with the natural processes occurring at micro-scale, but the dark side of the coin is the increment in the complexity of an ACA in order to accomplish stable self-reproduction. This paper proposes a novel model of self-timed cellular automata (STCAs), a special type of ACAs, where unsheathed loops are able to duplicate themselves reliably in parallel. The removal of sheath cannot only allow various loops with more flexible and compact structures to replicate themselves, but also reduce the number of cell states of the STCA as compared to the previous model adopting sheathed loops [Y. Takada, T. Isokawa, F. Peper and N. Matsui, Physica D227, 26 (2007)]. The lack of sheath, on the other hand, often tends to cause much more complicated interactions among loops, when all of them struggle independently to stretch out their constructing arms at the same time. In particular, such intense collisions may even cause the emergence of a mess of twisted constructing arms in the cellular space. By using a simple and natural method, our self-reproducing loops (SRLs) are able to retract their arms successively, thereby disentangling from the mess successfully.

Multi-Scale Modeling in Morphogenesis: A Critical Analysis of the Cellular Potts Model

PubMed Central

Voss-Böhme, Anja

2012-01-01

Cellular Potts models (CPMs) are used as a modeling framework to elucidate mechanisms of biological development. They allow a spatial resolution below the cellular scale and are applied particularly when problems are studied where multiple spatial and temporal scales are involved. Despite the increasing usage of CPMs in theoretical biology, this model class has received little attention from mathematical theory. To narrow this gap, the CPMs are subjected to a theoretical study here. It is asked to which extent the updating rules establish an appropriate dynamical model of intercellular interactions and what the principal behavior at different time scales characterizes. It is shown that the longtime behavior of a CPM is degenerate in the sense that the cells consecutively die out, independent of the specific interdependence structure that characterizes the model. While CPMs are naturally defined on finite, spatially bounded lattices, possible extensions to spatially unbounded systems are explored to assess to which extent spatio-temporal limit procedures can be applied to describe the emergent behavior at the tissue scale. To elucidate the mechanistic structure of CPMs, the model class is integrated into a general multiscale framework. It is shown that the central role of the surface fluctuations, which subsume several cellular and intercellular factors, entails substantial limitations for a CPM's exploitation both as a mechanistic and as a phenomenological model. PMID:22984409

In search of cellular control: signal transduction in context

NASA Technical Reports Server (NTRS)

Ingber, D.

1998-01-01

The field of molecular cell biology has experienced enormous advances over the last century by reducing the complexity of living cells into simpler molecular components and binding interactions that are amenable to rigorous biochemical analysis. However, as our tools become more powerful, there is a tendency to define mechanisms by what we can measure. The field is currently dominated by efforts to identify the key molecules and sequences that mediate the function of critical receptors, signal transducers, and molecular switches. Unfortunately, these conventional experimental approaches ignore the importance of supramolecular control mechanisms that play a critical role in cellular regulation. Thus, the significance of individual molecular constituents cannot be fully understood when studied in isolation because their function may vary depending on their context within the structural complexity of the living cell. These higher-order regulatory mechanisms are based on the cell's use of a form of solid-state biochemistry in which molecular components that mediate biochemical processing and signal transduction are immobilized on insoluble cytoskeletal scaffolds in the cytoplasm and nucleus. Key to the understanding of this form of cellular regulation is the realization that chemistry is structure and hence, recognition of the the importance of architecture and mechanics for signal integration and biochemical control. Recent work that has unified chemical and mechanical signaling pathways provides a glimpse of how this form of higher-order cellular control may function and where paths may lie in the future.

AAA+ Machines of Protein Destruction in Mycobacteria.

PubMed

Alhuwaider, Adnan Ali H; Dougan, David A

2017-01-01

The bacterial cytosol is a complex mixture of macromolecules (proteins, DNA, and RNA), which collectively are responsible for an enormous array of cellular tasks. Proteins are central to most, if not all, of these tasks and as such their maintenance (commonly referred to as protein homeostasis or proteostasis) is vital for cell survival during normal and stressful conditions. The two key aspects of protein homeostasis are, (i) the correct folding and assembly of proteins (coupled with their delivery to the correct cellular location) and (ii) the timely removal of unwanted or damaged proteins from the cell, which are performed by molecular chaperones and proteases, respectively. A major class of proteins that contribute to both of these tasks are the AAA+ (ATPases associated with a variety of cellular activities) protein superfamily. Although much is known about the structure of these machines and how they function in the model Gram-negative bacterium Escherichia coli , we are only just beginning to discover the molecular details of these machines and how they function in mycobacteria. Here we review the different AAA+ machines, that contribute to proteostasis in mycobacteria. Primarily we will focus on the recent advances in the structure and function of AAA+ proteases, the substrates they recognize and the cellular pathways they control. Finally, we will discuss the recent developments related to these machines as novel drug targets.

Fabrication of cell penetration enhanced poly (l-lactic acid-co-ɛ-caprolactone)/silk vascular scaffolds utilizing air-impedance electrospinning.

PubMed

Yin, Anlin; Li, Jiukai; Bowlin, Gary L; Li, Dawei; Rodriguez, Isaac A; Wang, Jing; Wu, Tong; Ei-Hamshary, Hany A; Al-Deyab, Salem S; Mo, Xiumei

2014-08-01

In the vascular prosthetic field, the prevailing thought is that for clinical, long-term success, especially bioresorbable grafts, cellular migration and penetration into the prosthetic structure is required to promote neointima formation and vascular wall development. In this study, we fabricated poly (l-lactic acid-co-ɛ-caprolactone) P(LLA-CL)/silk fibroin (SF) vascular scaffolds through electrospinning using both perforated mandrel subjected to various intraluminal air pressures (0-300kPa), and solid mandrel. The scaffolds were evaluated the cellular infiltration in vitro and mechanical properties. Vascular scaffolds were seeded with smooth muscle cells (SMCs) to evaluate cellular infiltration at 1, 7, and 14 days. The results revealed that air-impedance scaffolds allowed significantly more cell infiltration as compared to the scaffolds fabricated with solid mandrel. Meanwhile, results showed that both mandrel model and applied air pressure determined the interfiber distance and the alignment of fibers in the enhanced porosity regions of the structure which influenced cell infiltration. Uniaxial tensile testing indicated that the air-impedance scaffolds have sufficient ultimate strength, suture retention strength, and burst pressure as well as compliance approximating a native artery. In conclusion, the air-impedance scaffolds improved cellular infiltration without compromising overall biomechanical properties. These results support the scaffold's potential for vascular grafting and in situ regeneration. Copyright © 2014 Elsevier B.V. All rights reserved.

Microstructural architecture developed in the fabrication of solid and open-cellular copper components by additive manufacturing using electron beam melting

NASA Astrophysics Data System (ADS)

Ramirez, Diana Alejandra

The fabrication of Cu components were first built by additive manufacturing using electron beam melting (EBM) from low-purity, atomized Cu powder containing a high density of Cu2O precipitates leading to a novel example of precipitate-dislocation architecture. These microstructures exhibit cell-like arrays (1-3microm) in the horizontal reference plane perpendicular to the build direction with columnar-like arrays extending from ~12 to >60 microm in length and corresponding spatial dimensions of 1-3 microm. These observations were observed by the use of optical metallography, and scanning and transmission electron microscopy. The hardness measurements were taken both on the atomized powder and the Cu components. The hardness for these architectures ranged from ~HV 83 to 88, in contrast to the original Cu powder microindentation hardness of HV 72 and the commercial Cu base plate hardness of HV 57. These observations were utilized for the fabrication of open-cellular copper structures by additive manufacturing using EBM and illustrated the ability to fabricate some form of controlled microstructural architecture by EBM parameter alteration or optimizing. The fabrication of these structures ranged in densities from 0.73g/cm3 to 6.67g/cm3. These structures correspond to four different articulated mesh arrays. While these components contained some porosity as a consequence of some unmelted regions, the Cu2O precipitates also contributed to a reduced density. Using X-ray Diffraction showed the approximate volume fraction estimated to be ~2%. The addition of precipitates created in the EBM melt scan formed microstructural arrays which contributed to hardening contributing to the strength of mesh struts and foam ligaments. The measurements of relative stiffness versus relative density plots for Cu compared very closely with Ti-6Al-4V open cellular structures - both mesh and foams. The Cu reticulated mesh structures exhibit a slope of n = 2 in contrast to a slope of n = 2.4 for the stochastic Cu foams, consistent with the Gibson-Ashby foam model where n = 2. These open cellular structure components exhibit considerable potential for novel, complex, multi-functional electrical and thermal management systems, especially complex, monolithic heat exchange device.

On the holistic approach in cellular and cancer biology: nonlinearity, complexity, and quasi-determinism of the dynamic cellular network.

PubMed

Waliszewski, P; Molski, M; Konarski, J

1998-06-01

A keystone of the molecular reductionist approach to cellular biology is a specific deductive strategy relating genotype to phenotype-two distinct categories. This relationship is based on the assumption that the intermediary cellular network of actively transcribed genes and their regulatory elements is deterministic (i.e., a link between expression of a gene and a phenotypic trait can always be identified, and evolution of the network in time is predetermined). However, experimental data suggest that the relationship between genotype and phenotype is nonbijective (i.e., a gene can contribute to the emergence of more than just one phenotypic trait or a phenotypic trait can be determined by expression of several genes). This implies nonlinearity (i.e., lack of the proportional relationship between input and the outcome), complexity (i.e. emergence of the hierarchical network of multiple cross-interacting elements that is sensitive to initial conditions, possesses multiple equilibria, organizes spontaneously into different morphological patterns, and is controlled in dispersed rather than centralized manner), and quasi-determinism (i.e., coexistence of deterministic and nondeterministic events) of the network. Nonlinearity within the space of the cellular molecular events underlies the existence of a fractal structure within a number of metabolic processes, and patterns of tissue growth, which is measured experimentally as a fractal dimension. Because of its complexity, the same phenotype can be associated with a number of alternative sequences of cellular events. Moreover, the primary cause initiating phenotypic evolution of cells such as malignant transformation can be favored probabilistically, but not identified unequivocally. Thermodynamic fluctuations of energy rather than gene mutations, the material traits of the fluctuations alter both the molecular and informational structure of the network. Then, the interplay between deterministic chaos, complexity, self-organization, and natural selection drives formation of malignant phenotype. This concept offers a novel perspective for investigation of tumorigenesis without invalidating current molecular findings. The essay integrates the ideas of the sciences of complexity in a biological context.

Robust Structure and Reactivity of Aqueous Arsenous Acid-Platinum(II) Anticancer Complexes**

PubMed Central

Miodragović, Ðenana U.; Quentzel, Jeremy A.; Kurutz, Josh W.; Stern, Charlotte L.; Ahn, Richard W.; Kandela, Irawati; Mazar, Andrew; O’Halloran, Thomas V.

2014-01-01

The first molecular adducts of platinum and arsenic based anticancer drugs - arsenoplatins - show unanticipated structure, substitution chemistry, and cellular cytotoxicity. The PtII-AsIII bonds in these complexes are stable in aqueous solution and strongly influence the lability of the trans ligand. PMID:24038962

Synthesis of Messenger RNA and Chromosome Structure in the Cellular Slime Mold*

PubMed Central

Lodish, Harvey F.; Jacobson, Allan; Firtel, Richard; Alton, Tom; Tuchman, Jessica

1974-01-01

This paper summarizes our knowledge of the structure and biosynthesis of messenger RNA in the slime mold Dictyostelium discoideum, the arrangement of DNA sequences in the Dictyostelium chromosome, and the changes in the pattern of predominant polypeptides synthesized during Dictyostelium development. Images PMID:4531041

Temperature inducible β-sheet structure in the transactivation domains of retroviral regulatory proteins of the Rev family

NASA Astrophysics Data System (ADS)

Thumb, Werner; Graf, Christine; Parslow, Tristram; Schneider, Rainer; Auer, Manfred

1999-11-01

The interaction of the human immunodeficiency virus type 1 (HIV-1) regulatory protein Rev with cellular cofactors is crucial for the viral life cycle. The HIV-1 Rev transactivation domain is functionally interchangeable with analog regions of Rev proteins of other retroviruses suggesting common folding patterns. In order to obtain experimental evidence for similar structural features mediating protein-protein contacts we investigated activation domain peptides from HIV-1, HIV-2, VISNA virus, feline immunodeficiency virus (FIV) and equine infectious anemia virus (EIAV) by CD spectroscopy, secondary structure prediction and sequence analysis. Although different in polarity and hydrophobicity, all peptides showed a similar behavior with respect to solution conformation, concentration dependence and variations in ionic strength and pH. Temperature studies revealed an unusual induction of β-structure with rising temperatures in all activation domain peptides. The high stability of β-structure in this region was demonstrated in three different peptides of the activation domain of HIV-1 Rev in solutions containing 40% hexafluoropropanol, a reagent usually known to induce α-helix into amino acid sequences. Sequence alignments revealed similarities between the polar effector domains from FIV and EIAV and the leucine rich (hydrophobic) effector domains found in HIV-1, HIV-2 and VISNA. Studies on activation domain peptides of two dominant negative HIV-1 Rev mutants, M10 and M32, pointed towards different reasons for the biological behavior. Whereas the peptide containing the M10 mutation (L 78E 79→D 78L 79) showed wild-type structure, the M32 mutant peptide (L 78L 81L 83→A 78A 81A 83) revealed a different protein fold to be the reason for the disturbed binding to cellular cofactors. From our data, we conclude, that the activation domain of Rev proteins from different viral origins adopt a similar fold and that a β-structural element is involved in binding to a cellular cofactor.

Structure-function analysis of RBP-J-interacting and tubulin-associated (RITA) reveals regions critical for repression of Notch target genes.

PubMed

Tabaja, Nassif; Yuan, Zhenyu; Oswald, Franz; Kovall, Rhett A

2017-06-23

The Notch pathway is a cell-to-cell signaling mechanism that is essential for tissue development and maintenance, and aberrant Notch signaling has been implicated in various cancers, congenital defects, and cardiovascular diseases. Notch signaling activates the expression of target genes, which are regulated by the transcription factor CSL (CBF1/RBP-J, Su(H), Lag-1). CSL interacts with both transcriptional corepressor and coactivator proteins, functioning as both a repressor and activator, respectively. Although Notch activation complexes are relatively well understood at the structural level, less is known about how CSL interacts with corepressors. Recently, a new RBP-J (mammalian CSL ortholog)-interacting protein termed RITA has been identified and shown to export RBP-J out of the nucleus, thereby leading to the down-regulation of Notch target gene expression. However, the molecular details of RBP-J/RITA interactions are unclear. Here, using a combination of biochemical/cellular, structural, and biophysical techniques, we demonstrate that endogenous RBP-J and RITA proteins interact in cells, map the binding regions necessary for RBP-J·RITA complex formation, and determine the X-ray structure of the RBP-J·RITA complex bound to DNA. To validate the structure and glean more insights into function, we tested structure-based RBP-J and RITA mutants with biochemical/cellular assays and isothermal titration calorimetry. Whereas our structural and biophysical studies demonstrate that RITA binds RBP-J similarly to the RAM (RBP-J-associated molecule) domain of Notch, our biochemical and cellular assays suggest that RITA interacts with additional regions in RBP-J. Taken together, these results provide molecular insights into the mechanism of RITA-mediated regulation of Notch signaling, contributing to our understanding of how CSL functions as a transcriptional repressor of Notch target genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Cellular dislocations patterns in monolike silicon: Influence of stress, time under stress and impurity doping

NASA Astrophysics Data System (ADS)

Oliveira, V. A.; Rocha, M.; Lantreibecq, A.; Tsoutsouva, M. G.; Tran-Thi, T. N.; Baruchel, J.; Camel, D.

2018-05-01

Besides the well-known local sub-grain boundaries (SGBs) defects, monolike Si ingots grown by Directional Solidification present distributed background cellular dislocation structures. In the present work, the influence of stress level, time under stress, and doping by O and Ge, on the formation of dislocation cells in monolike silicon, is analysed. This is achieved by performing a comparative study of the dislocation structures respectively obtained during crystallisation of pilot scale monolike ingots on Czochralski (CZ) and monolike seeds, during annealing of Float Zone (FZ), CZ, and 1 × 1020 at/cm3 Ge-doped CZ (GCZ) samples, and during 4-point bending of FZ and GCZ samples at 1300 °C under resolved stresses of 0.3, 0.7 and 1.9 MPa during 1-20 h. Synchrotron X-ray White-beam Topography and Rocking Curve Imaging (RCI) are applied to visualize the dislocation arrangements and to quantify the spatial distribution of the associated lattice distortions. Annealed samples and samples bent under 0.3 MPa present dislocation structures corresponding to transient creep stages where dislocations generated from surface defects are propagating and multiplying in the bulk. The addition of the hardening element Ge is found to block the propagation of dislocations from these surface sources during the annealing test, and to retard dislocation multiplication during bending under 0.3 MPa. On the opposite, cellular structures corresponding to the final stationary creep stage are obtained both in the non-molten seeds and grown part of monolike ingots and in samples bent under 0.7 and 1.9 MPa. A comparative discussion is made of the dynamics of formation of these final dislocation structures during deformation at high temperature and monolike growth.

Topology Optimization - Engineering Contribution to Architectural Design

NASA Astrophysics Data System (ADS)

Tajs-Zielińska, Katarzyna; Bochenek, Bogdan

2017-10-01

The idea of the topology optimization is to find within a considered design domain the distribution of material that is optimal in some sense. Material, during optimization process, is redistributed and parts that are not necessary from objective point of view are removed. The result is a solid/void structure, for which an objective function is minimized. This paper presents an application of topology optimization to multi-material structures. The design domain defined by shape of a structure is divided into sub-regions, for which different materials are assigned. During design process material is relocated, but only within selected region. The proposed idea has been inspired by architectural designs like multi-material facades of buildings. The effectiveness of topology optimization is determined by proper choice of numerical optimization algorithm. This paper utilises very efficient heuristic method called Cellular Automata. Cellular Automata are mathematical, discrete idealization of a physical systems. Engineering implementation of Cellular Automata requires decomposition of the design domain into a uniform lattice of cells. It is assumed, that the interaction between cells takes place only within the neighbouring cells. The interaction is governed by simple, local update rules, which are based on heuristics or physical laws. The numerical studies show, that this method can be attractive alternative to traditional gradient-based algorithms. The proposed approach is evaluated by selected numerical examples of multi-material bridge structures, for which various material configurations are examined. The numerical studies demonstrated a significant influence the material sub-regions location on the final topologies. The influence of assumed volume fraction on final topologies for multi-material structures is also observed and discussed. The results of numerical calculations show, that this approach produces different results as compared with classical one-material problems.

Using in-cell SHAPE-Seq and simulations to probe structure-function design principles of RNA transcriptional regulators.

PubMed

Takahashi, Melissa K; Watters, Kyle E; Gasper, Paul M; Abbott, Timothy R; Carlson, Paul D; Chen, Alan A; Lucks, Julius B

2016-06-01

Antisense RNA-mediated transcriptional regulators are powerful tools for controlling gene expression and creating synthetic gene networks. RNA transcriptional repressors derived from natural mechanisms called attenuators are particularly versatile, though their mechanistic complexity has made them difficult to engineer. Here we identify a new structure-function design principle for attenuators that enables the forward engineering of new RNA transcriptional repressors. Using in-cell SHAPE-Seq to characterize the structures of attenuator variants within Escherichia coli, we show that attenuator hairpins that facilitate interaction with antisense RNAs require interior loops for proper function. Molecular dynamics simulations of these attenuator variants suggest these interior loops impart structural flexibility. We further observe hairpin flexibility in the cellular structures of natural RNA mechanisms that use antisense RNA interactions to repress translation, confirming earlier results from in vitro studies. Finally, we design new transcriptional attenuators in silico using an interior loop as a structural requirement and show that they function as desired in vivo. This work establishes interior loops as an important structural element for designing synthetic RNA gene regulators. We anticipate that the coupling of experimental measurement of cellular RNA structure and function with computational modeling will enable rapid discovery of structure-function design principles for a diverse array of natural and synthetic RNA regulators. © 2016 Takahashi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

In vitro effects of platinum compounds on renal cellular respiration in mice.

PubMed

Almarzooqi, Saeeda-S; Alfazari, Ali-S; Abdul-Kader, Hidaya-M; Saraswathiamma, Dhanya; Albawardi, Alia-S; Souid, Abdul-Kader

2015-01-01

Cisplatin, carboplatin and oxaliplatin are structurally-related compounds, which are commonly used in cancer therapy. Cisplatin (Platinol(®)) has Boxed Warning stating: "Cumulative renal toxicity associated with PLATINOL is severe", while carboplatin and oxaliplatin are less nephrotoxic. These drugs form platinum adducts with cellular DNA. Their bindings to cellular thiols (e.g., glutathione and metallothionein) are known to contribute to drug resistance while thiol depletion augments platinum toxicity. Using phosphorescence oxygen analyzer, this study investigated the effects of platinum drugs on renal cellular respiration (mitochondrial O2 consumption) in the presence and absence of the thiol blocking agent N-ethylmaleimide (used here as a model for thiol depletion). Renal cellular ATP was also determined. Kidney fragments from C57BL/6 mice were incubated at 37 °C in Krebs-Henseleit buffer (gassed with 95% O2:5% CO2) with and without 100 μM platinum drug in the presence and absence of 100 μM N-ethylmaleimide for ≤ 6 h. Platinum drugs alone had no effects on cellular respiration (P ≥ 0.143) or ATP (P ≥ 0.161). N-ethylmaleimide lowered cellular respiration (P ≤ 0.114) and ATP (P = 0.008). The combination of platinum drug and N-ethylmaleimide significantly lowered both cellular respiration (P ≤ 0.006) and ATP (P ≤ 0.003). Incubations with N-ethylmaleimide alone were associated with moderate-to-severe tubular necrosis. Incubations with cisplatin+N-ethylmaleimide vs. cisplatin alone produced similar severities of tubular necrosis. Tubular derangements were more prominent in carboplatin+N-ethylmaleimide vs. carboplatin alone and in oxaliplatin+N-ethylmaleimide vs. oxaliplatin alone. These results demonstrate the adverse events of thiol depletion on platinum-induced nephrotoxicities. The results suggest cellular bioenergetics is a useful surrogate biomarker for assessing drug-induced nephrotoxicities.

Exploring the protective effects of calcium-containing carrier against drying-induced cellular injuries of probiotics using single droplet drying technique.

PubMed

Zheng, Xufeng; Fu, Nan; Huang, Song; Jeantet, Romain; Chen, Xiao Dong

2016-12-01

Protective carriers that encapsulate probiotics in spray drying could improve the survival ratio of dried cells through different mechanisms. Unveiling the protective mechanism of each carrier will contribute to a rational design of high performance carrier formulation. This study utilized single droplet drying (SDD) technique to investigate the effects of calcium cation in varied carrier formulation. Inactivation histories of Lactobacillus rhamnosus GG (LGG) in different carriers were compared, and cellular injury history of probiotics during droplet drying was studied for the first time. Adding 1mM CaCl 2 to lactose carrier protected cell viability, mitigated cellular injuries, and enhanced regrowth capability as drying progressed, demonstrating the positive effect of Ca 2+ with possible mechanism of stabilizing sub-cellular structures. At later drying stages, cell survival in Lac/Ca carrier was increased by 0.5-1.5 log on selective media compared to lactose carrier. Supplementing calcium-binding agents lowered the protective effect, shortening the initiation of rapid cell inactivation down to 120s of drying. Adding CaCl 2 to trehalose carrier barely improved cell survival, indicating that the protective effect could be influenced by carrier formulation. Pure trehalose carrier exerted excellent protection on LGG, supporting cells to regrow in liquid rich medium even after 180s of drying. The protection of trehalose may stem from stabilization of sub-cellular structures, which possibly overlap the effect of Ca 2+ . The findings suggested that high performance carrier formulation might be developed by combining carrier materials with different protective mechanisms, for maximizing the survival of active dry probiotics in industrial spray drying operation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Protein Analysis of Purified Respiratory Syncytial Virus Particles Reveals an Important Role for Heat Shock Protein 90 in Virus Particle Assembly*

PubMed Central

Radhakrishnan, Anuradha; Yeo, Dawn; Brown, Gaie; Myaing, Myint Zu; Iyer, Laxmi Ravi; Fleck, Roland; Tan, Boon-Huan; Aitken, Jim; Sanmun, Duangmanee; Tang, Kai; Yarwood, Andy; Brink, Jacob; Sugrue, Richard J.

2010-01-01

In this study, we used imaging and proteomics to identify the presence of virus-associated cellular proteins that may play a role in respiratory syncytial virus (RSV) maturation. Fluorescence microscopy of virus-infected cells revealed the presence of virus-induced cytoplasmic inclusion bodies and mature virus particles, the latter appearing as virus filaments. In situ electron tomography suggested that the virus filaments were complex structures that were able to package multiple copies of the virus genome. The virus particles were purified, and the protein content was analyzed by one-dimensional nano-LC MS/MS. In addition to all the major virus structural proteins, 25 cellular proteins were also detected, including proteins associated with the cortical actin network, energy pathways, and heat shock proteins (HSP70, HSC70, and HSP90). Representative actin-associated proteins, HSC70, and HSP90 were selected for further biological validation. The presence of β-actin, filamin-1, cofilin-1, HSC70, and HSP90 in the virus preparation was confirmed by immunoblotting using relevant antibodies. Immunofluorescence microscopy of infected cells stained with antibodies against relevant virus and cellular proteins confirmed the presence of these cellular proteins in the virus filaments and inclusion bodies. The relevance of HSP90 to virus infection was examined using the specific inhibitors 17-N-Allylamino-17-demethoxygeldanamycin. Although virus protein expression was largely unaffected by these drugs, we noted that the formation of virus particles was inhibited, and virus transmission was impaired, suggesting an important role for HSP90 in virus maturation. This study highlights the utility of proteomics in facilitating both our understanding of the role that cellular proteins play during RSV maturation and, by extrapolation, the identification of new potential targets for antiviral therapy. PMID:20530633

Gestational food restriction decreases placental interleukin-10 expression and markers of autophagy and endoplasmic reticulum stress in murine intrauterine growth restriction.

PubMed

Chu, Alison; Thamotharan, Shanthie; Ganguly, Amit; Wadehra, Madhuri; Pellegrini, Matteo; Devaskar, Sherin U

2016-10-01

Intrauterine growth restriction (IUGR) affects up to 10% of pregnancies and often results in short- and long-term sequelae for offspring. The mechanisms underlying IUGR are poorly understood, but it is known that healthy placentation is essential for nutrient provision to fuel fetal growth, and is regulated by immunologic inputs. We hypothesized that in pregnancy, maternal food restriction (FR) resulting in IUGR would decrease the overall immunotolerant milieu in the placenta, leading to increased cellular stress and death. Our specific objectives were to evaluate (1) key cytokines (eg, IL-10) that regulate maternal-fetal tolerance, (2) cellular processes (autophagy and endoplasmic reticulum [ER] stress) that are immunologically mediated and important for cellular survival and functioning, and (3) the resulting IUGR phenotype and placental histopathology in this animal model. After subjecting pregnant mice to mild and moderate FR from gestational day 10 to 19, we collected placentas and embryos at gestational day 19. We examined RNA sequencing data to identify immunologic pathways affected in IUGR-associated placentas and validated messenger RNA expression changes of genes important in cellular integrity. We also evaluated histopathologic changes in vascular and trophoblastic structures as well as protein expression changes in autophagy, ER stress, and apoptosis in the mouse placentas. Several differentially expressed genes were identified in FR compared with control mice, including a considerable subset that regulates immune tolerance, inflammation, and cellular integrity. In summary, maternal FR decreases the anti-inflammatory effect of IL-10 and suppresses placental autophagic and ER stress responses, despite evidence of dysregulated vascular and trophoblast structures leading to IUGR. Copyright © 2016 Elsevier Inc. All rights reserved.

Complex formation and vectorization of a phosphorothioate oligonucleotide with an amphipathic leucine- and lysine-rich peptide: study at molecular and cellular levels.

PubMed

Boukhalfa-Heniche, Fatima-Zohra; Hernández, Belén; Gaillard, Stéphane; Coïc, Yves-Marie; Huynh-Dinh, Tam; Lecouvey, Marc; Seksek, Olivier; Ghomi, Mahmoud

2004-04-15

Optical spectroscopic techniques such as CD, Raman scattering, and fluorescence imaging allowed us to analyze the complex formation and vectorization of a single-stranded 20-mer phosphorothioate oligodeoxynucleotide with a 15-mer amphipathic peptide at molecular and cellular levels. Different solvent mixtures (methanol and water) and molecular ratios of peptide/oligodeoxynucleotide complexes were tested in order to overcome the problems related to solubility. Optimal conditions for both spectroscopic and cellular experiments were obtained with the molecular ratio peptide/oligodeoxynucleotide equal to 21:4, corresponding to a 7:5 ratio for their respective +/- charge ratio. At the molecular level, CD and Raman spectra were consistent with a alpha-helix conformation of the peptide in water or in a methanol-water mixture. The presence of methanol increased considerably the solubility of the peptide without altering its alpha-helix conformation, as evidenced by CD and Raman spectroscopies. UV absorption melting profile of the oligodeoxynucleotide gave rise to a flat melting profile, corresponding to its random structure in solution. Raman spectra of oligodeoxynucleotide/peptide complexes could only be studied in methanol/water mixture solutions. Drastic changes observed in Raman spectra have undoubtedly shown: (a) the perturbation occurred in the peptide secondary structure, and (b) possible interaction between the lysine residues of the peptide and the oligodeoxynucleotide. At the cellular level, the complex was prepared in a mixture of 10% methanol and 90% cell medium. Cellular uptake in optimal conditions for the oligodeoxynucleotide delivery with low cytotoxicity was controlled by fluorescence imaging allowing to specifically locate the compacted oligonucleotide labeled with fluorescein at its 5'-terminus with the peptide into human glioma cells after 1 h of incubation at 37 degrees C. Copyright 2004 Wiley Periodicals, Inc.

Differential effects of LifeAct-GFP and actin-GFP on cell mechanics assessed using micropipette aspiration.

PubMed

Sliogeryte, Kristina; Thorpe, Stephen D; Wang, Zhao; Thompson, Clare L; Gavara, Nuria; Knight, Martin M

2016-01-25

The actin cytoskeleton forms a dynamic structure involved in many fundamental cellular processes including the control of cell morphology, migration and biomechanics. Recently LifeAct-GFP (green fluorescent protein) has been proposed for visualising actin structure and dynamics in live cells as an alternative to actin-GFP which has been shown to affect cell mechanics. Here we compare the two approaches in terms of their effect on cellular mechanical behaviour. Human mesenchymal stem cells (hMSCs) were analysed using micropipette aspiration and the effective cellular equilibrium and instantaneous moduli calculated using the standard linear solid model. We show that LifeAct-GFP provides clearer visualisation of F-actin organisation and dynamics. Furthermore, LifeAct-GFP does not alter effective cellular mechanical properties whereas actin-GFP expression causes an increase in the cell modulus. Interestingly, LifeAct-GFP expression did produce a small (~10%) increase in the percentage of cells exhibiting aspiration-induced membrane bleb formation, whilst actin-GFP expression reduced blebbing. Further studies examined the influence of LifeAct-GFP in other cell types, namely chondrogenically differentiated hMSCs and murine chondrocytes. LifeAct-GFP also had no effect on the moduli of these non-blebbing cells for which mechanical properties are largely dependent on the actin cortex. In conclusion we show that LifeAct-GFP enables clearer visualisation of actin organisation and dynamics without disruption of the biomechanical properties of either the whole cell or the actin cortex. Thus the study provides new evidence supporting the use of LifeAct-GFP rather than actin-GFP for live cell microscopy and the study of cellular mechanobiology. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

At a glance: cellular biology for engineers.

PubMed

Khoshmanesh, K; Kouzani, A Z; Nahavandi, S; Baratchi, S; Kanwar, J R

2008-10-01

Engineering contributions have played an important role in the rise and evolution of cellular biology. Engineering technologies have helped biologists to explore the living organisms at cellular and molecular levels, and have created new opportunities to tackle the unsolved biological problems. There is now a growing demand to further expand the role of engineering in cellular biology research. For an engineer to play an effective role in cellular biology, the first essential step is to understand the cells and their components. However, the stumbling block of this step is to comprehend the information given in the cellular biology literature because it best suits the readers with a biological background. This paper aims to overcome this bottleneck by describing the human cell components as micro-plants that form cells as micro-bio-factories. This concept can accelerate the engineers' comprehension of the subject. In this paper, first the structure and function of different cell components are described. In addition, the engineering attempts to mimic various cell components through numerical modelling or physical implementation are highlighted. Next, the interaction of different cell components that facilitate complicated chemical processes, such as energy generation and protein synthesis, are described. These complex interactions are translated into simple flow diagrams, generally used by engineers to represent multi-component processes.

Cardiac system bioenergetics: metabolic basis of the Frank-Starling law

PubMed Central

Saks, Valdur; Dzeja, Petras; Schlattner, Uwe; Vendelin, Marko; Terzic, Andre; Wallimann, Theo

2006-01-01

The fundamental principle of cardiac behaviour is described by the Frank-Starling law relating force of contraction during systole with end-diastolic volume. While both work and respiration rates increase linearly with imposed load, the basis of mechano-energetic coupling in heart muscle has remained a long-standing enigma. Here, we highlight advances made in understanding of complex cellular and molecular mechanisms that orchestrate coupling of mitochondrial oxidative phosphorylation with ATP utilization for muscle contraction. Cardiac system bioenergetics critically depends on an interrelated metabolic infrastructure regulating mitochondrial respiration and energy fluxes throughout cellular compartments. The data reviewed indicate the significance of two interrelated systems regulating mitochondrial respiration and energy fluxes in cells: (1) the creatine kinase, adenylate kinase and glycolytic pathways that communicate flux changes generated by cellular ATPases within structurally organized enzymatic modules and networks; and (2) a secondary system based on mitochondrial participation in cellular calcium cycle, which adjusts substrate oxidation and energy-transducing processes to meet increasing cellular energy demands. By conveying energetic signals to metabolic sensors, coupled phosphotransfer reactions provide a high-fidelity regulation of the excitation–contraction cycle. Such integration of energetics with calcium signalling systems provides the basis for ‘metabolic pacing’, synchronizing the cellular electrical and mechanical activities with energy supply processes. PMID:16410283

Topological Optimization of Artificial Microstructure Strategies

DTIC Science & Technology

2015-04-02

a 3D microstructural architecture structure made from bulk metallic glass , 3DMGS, exhibiting a combination of ceramic-like high strength (>1000 MPa...Research Triangle Park, NC 27709-2211 materials, cellular structures, metallic glass REPORT DOCUMENTATION PAGE 11. SPONSOR/MONITOR’S REPORT NUMBER(S...demonstrate a 3D microstructural architecture structure made from bulk metallic glass , 3DMGS, exhibiting a combination of ceramic-like high strength

[Genome organization and life cycle of the hepatitis c virus].

PubMed

Kalinina, O V; Dmitriev, A V

2015-01-01

The review summarizes the current data about the hepatitis C viral genome and polyprotein organization. The functional role of the structural and non-structural viral proteins including their interaction with cellular regulatory proteins and cell structural elements is discussed. Specific peculiarities of the life cycle of the hepatitis C virus important for the understanding of the viral hepatitis C pathogenesis are summarized.

Biomimetic membranes and methods of making biomimetic membranes

DOEpatents

Rempe, Susan; Brinker, Jeffrey C.; Rogers, David Michael; Jiang, Ying-Bing; Yang, Shaorong

2016-11-08

The present disclosure is directed to biomimetic membranes and methods of manufacturing such membranes that include structural features that mimic the structures of cellular membrane channels and produce membrane designs capable of high selectivity and high permeability or adsorptivity. The membrane structure, material and chemistry can be selected to perform liquid separations, gas separation and capture, ion transport and adsorption for a variety of applications.

2016 Summer Series - Kenneth Cheung: Building Blocks for Aerospace Structures

NASA Image and Video Library

2016-06-16

Strong, ultra-lightweight materials are expected to play a key role in the design of future aircraft and space vehicles. Lower structural mass leads to improved performance, maneuverability, efficiency, range and payload capacity. Dr. Kenneth Cheung is developing cellular composite building blocks, or digital materials, to create transformable aerostructures. In his presentation, Dr. Cheung will discuss the implications of the digital materials and morphing structures.

Basalt fiber reinforced porous aggregates-geopolymer based cellular material

NASA Astrophysics Data System (ADS)

Luo, Xin; Xu, Jin-Yu; Li, Weimin

2015-09-01

Basalt fiber reinforced porous aggregates-geopolymer based cellular material (BFRPGCM) was prepared. The stress-strain curve has been worked out. The ideal energy-absorbing efficiency has been analyzed and the application prospect has been explored. The results show the following: fiber reinforced cellular material has successively sized pore structures; the stress-strain curve has two stages: elastic stage and yielding plateau stage; the greatest value of the ideal energy-absorbing efficiency of BFRPGCM is 89.11%, which suggests BFRPGCM has excellent energy-absorbing property. Thus, it can be seen that BFRPGCM is easy and simple to make, has high plasticity, low density and excellent energy-absorbing features. So, BFRPGCM is a promising energy-absorbing material used especially in civil defense engineering.

Mitochondria in Lung Diseases

PubMed Central

Aravamudan, Bharathi; Thompson, Michael A.; Pabelick, Christina M.; Prakash, Y. S.

2014-01-01

Summary Mitochondria are autonomous cellular organelles that oversee a variety of functions such as metabolism, energy production, calcium buffering, and cell fate determination. Regulation of their morphology and diverse activities beyond energy production are being recognized as playing major roles in cellular health and dysfunction. This review is aimed at summarizing what is known regarding mitochondrial contributions to pathogenesis of lung diseases. Emphasis is given to understanding the importance of structural and functional aspects of mitochondria in both normal cellular function (based on knowledge from other cell types) and in development and modulation of lung diseases such as asthma, COPD, cystic fibrosis and cancer. Emerging techniques that allow examination of mitochondria, and potential strategies to target mitochondria in the treatment of lung diseases are also discussed. PMID:23978003

Electron tomography of whole cultured cells using novel transmission electron imaging technique.

PubMed

Okumura, Taiga; Shoji, Minami; Hisada, Akiko; Ominami, Yusuke; Ito, Sukehiro; Ushiki, Tatsuo; Nakajima, Masato; Ohshima, Takashi

2018-01-01

Since a three-dimensional (3D) cellular ultrastructure is significant for biological functions, it has been investigated using various electron microscopic techniques. Although transmission electron microscopy (TEM)-based techniques are traditionally used, cells must be embedded in resin and sliced into ultrathin sections in sample preparation processes. Block-face observation using a scanning electron microscope (SEM) has also been recently applied to 3D observation of cellular components, but this is a destructive inspection and does not allow re-examination. Therefore, we developed electron tomography using a transmission electron imaging technique called Plate-TEM. With Plate-TEM, the cells cultured directly on a scintillator plate are inserted into a conventional SEM equipped with a Plate-TEM observation system, and their internal structures are observed by detecting scintillation light produced by electrons passing through the cells. This technology has the following four advantages. First, the cells cultured on the plate can be observed at electron-microscopic resolution since they remain on the plate. Second, both surface and internal information can be obtained simultaneously by using electron- and photo-detectors, respectively, because a Plate-TEM detector is installed in an SEM. Third, the cells on the scintillator plate can also be inspected using light microscopy because the plate has transparent features. Finally, correlative observation with other techniques, such as conventional TEM, is possible after Plate-TEM observation because Plate-TEM is a non-destructive analysis technique. We also designed a sample stage to tilt the samples for tomography with Plate-TEM, by which 3D organization of cellular structures can be visualized as a whole cell. In the present study, Mm2T cells were investigated using our tomography system, resulting in 3D visualization of cell organelles such as mitochondria, lipid droplets, and microvilli. Correlative observations with various imaging techniques were also conducted by successive observations with light microscopy, SEM, Plate-TEM, and conventional TEM. Consequently, the Plate-TEM tomography technique encourages understanding of cellular structures at high resolution, which can contribute to cellular biological research. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Molecular Chaperone TRiC/CCT Binds to the Trp-Asp 40 (WD40) Repeat Protein WDR68 and Promotes Its Folding, Protein Kinase DYRK1A Binding, and Nuclear Accumulation*

PubMed Central

Miyata, Yoshihiko; Shibata, Takeshi; Aoshima, Masato; Tsubata, Takuichi; Nishida, Eisuke

2014-01-01

Trp-Asp (WD) repeat protein 68 (WDR68) is an evolutionarily conserved WD40 repeat protein that binds to several proteins, including dual specificity tyrosine phosphorylation-regulated protein kinase (DYRK1A), MAPK/ERK kinase kinase 1 (MEKK1), and Cullin4-damage-specific DNA-binding protein 1 (CUL4-DDB1). WDR68 affects multiple and diverse physiological functions, such as controlling anthocyanin synthesis in plants, tissue growth in insects, and craniofacial development in vertebrates. However, the biochemical basis and the regulatory mechanism of WDR68 activity remain largely unknown. To better understand the cellular function of WDR68, here we have isolated and identified cellular WDR68 binding partners using a phosphoproteomic approach. More than 200 cellular proteins with wide varieties of biochemical functions were identified as WDR68-binding protein candidates. Eight T-complex protein 1 (TCP1) subunits comprising the molecular chaperone TCP1 ring complex/chaperonin-containing TCP1 (TRiC/CCT) were identified as major WDR68-binding proteins, and phosphorylation sites in both WDR68 and TRiC/CCT were identified. Co-immunoprecipitation experiments confirmed the binding between TRiC/CCT and WDR68. Computer-aided structural analysis suggested that WDR68 forms a seven-bladed β-propeller ring. Experiments with a series of deletion mutants in combination with the structural modeling showed that three of the seven β-propeller blades of WDR68 are essential and sufficient for TRiC/CCT binding. Knockdown of cellular TRiC/CCT by siRNA caused an abnormal WDR68 structure and led to reduction of its DYRK1A-binding activity. Concomitantly, nuclear accumulation of WDR68 was suppressed by the knockdown of TRiC/CCT, and WDR68 formed cellular aggregates when overexpressed in the TRiC/CCT-deficient cells. Altogether, our results demonstrate that the molecular chaperone TRiC/CCT is essential for correct protein folding, DYRK1A binding, and nuclear accumulation of WDR68. PMID:25342745

A Study of the Efficiency of High-strength, Steel, Cellular-core Sandwich Plates in Compression

NASA Technical Reports Server (NTRS)

Johnson, Aldie E , Jr; Semonian, Joseph W

1956-01-01

Structural efficiency curves are presented for high-strength, stainless-steel, cellular-core sandwich plates of various proportions subjected to compressive end loads for temperatures of 80 F and 600 F. Optimum proportions of sandwich plates for any value of the compressive loading intensity can be determined from the curves. The efficiency of steel sandwich plates of optimum proportions is compared with the efficiency of solid plates of high-strength steel and aluminum and titanium alloys at the two temperatures.

Cellular Bases of Light-regulated Gravity Responses

NASA Technical Reports Server (NTRS)

Roux, Stanley J.

2003-01-01

This report summarizes the most significant research accomplished in our NAG2-1347 project on the cellular bases of light-regulated gravity responses, It elaborates mainly on our discovery of the role of calcium currents in gravity-directed polar development in single germinating spore cells of the fern Ceratopteris, our development of RNA silencing as a viable method of suppressing the expression of specific genes in Ceratopteris, and on the structure, expression and distribution of members of the annexin family in flowering plants, especially Arabidopsis.

Recent Progress of Microfluidics in Translational Applications.

PubMed

Liu, Zongbin; Han, Xin; Qin, Lidong

2016-04-20

Microfluidics, featuring microfabricated structures, is a technology for manipulating fluids at the micrometer scale. The small dimension and flexibility of microfluidic systems are ideal for mimicking molecular and cellular microenvironment, and show great potential in translational research and development. Here, the recent progress of microfluidics in biological and biomedical applications, including molecular analysis, cellular analysis, and chip-based material delivery and biomimetic design is presented. The potential future developments in the translational microfluidics field are also discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular counting of membrane receptor subunits with single-molecule localization microscopy

NASA Astrophysics Data System (ADS)

Krüger, Carmen; Fricke, Franziska; Karathanasis, Christos; Dietz, Marina S.; Malkusch, Sebastian; Hummer, Gerhard; Heilemann, Mike

2017-02-01

We report on quantitative single-molecule localization microscopy, a method that next to super-resolved images of cellular structures provides information on protein copy numbers in protein clusters. This approach is based on the analysis of blinking cycles of single fluorophores, and on a model-free description of the distribution of the number of blinking events. We describe the experimental and analytical procedures, present cellular data of plasma membrane proteins and discuss the applicability of this method.

Primitive control of cellular metabolism

NASA Technical Reports Server (NTRS)

Mitz, M. A.

1974-01-01

It is pointed out that control substances must have existed from the earliest times in the evolution of life and that the same control mechanisms must exist today. The investigation reported is concerned with the concept that carbon dioxide is a primitive regulator of cell function. The effects of carbon dioxide on cellular materials are examined, taking into account questions of solubilization, dissociation, changes of charge, stabilization, structural changes, wettability, the exclusion of other gases, the activation of compounds, changes in plasticity, and changes in membrane permeability.

Monolithic porous magnesium silicide.

PubMed

Hayati-Roodbari, N; Berger, R J F; Bernardi, J; Kinge, S; Hüsing, N; Elsaesser, M S

2017-07-11

Macroporous magnesium silicide monoliths were successfully prepared by a two-step synthesis procedure. The reaction of gaseous magnesium vapor with macro-/mesoporous silicon, which was generated from hierarchically organized meso-/macroporous silica by a magnesiothermic reduction reaction, resulted in monolithic magnesium silicide with a cellular, open macroporous structure. By adjusting the reaction conditions, such as experimental set-up, temperature and time, challenges namely loss of porosity or phase purity of Mg 2 Si were addressed and monolithic magnesium silicide with a cellular network builtup was obtained.

A quantum relativistic battle of the sexes cellular automaton

NASA Astrophysics Data System (ADS)

Alonso-Sanz, Ramón; Situ, Haozhen

2017-02-01

The effect of variable entangling on the dynamics of a spatial quantum relativistic formulation of the iterated battle of the sexes game is studied in this work. The game is played in the cellular automata manner, i.e., with local and synchronous interaction. The game is assessed in fair and unfair contests. Despite the full range of quantum parameters initially accessible, they promptly converge into fairly stable configurations, that often show rich spatial structures in simulations with no negligible entanglement.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Mi; University of Chinese Academy of Sciences, Beijing 100049; Liu, Lianqing, E-mail: lqliu@sia.cn

Highlights: •Nanoscale cellular ultra-structures of macrophages were observed. •The binding affinities of FcγRs were measured directly on macrophages. •The nanoscale distributions of FcγRs were mapped on macrophages. -- Abstract: Fc gamma receptors (FcγR), widely expressed on effector cells (e.g., NK cells, macrophages), play an important role in clinical cancer immunotherapy. The binding of FcγRs to the Fc portions of antibodies that are attached to the target cells can activate the antibody-dependent cell-mediated cytotoxicity (ADCC) killing mechanism which leads to the lysis of target cells. In this work, we used atomic force microscopy (AFM) to observe the cellular ultra-structures and measuremore » the biophysical properties (affinity and distribution) of FcγRs on single macrophages in aqueous environments. AFM imaging was used to obtain the topographies of macrophages, revealing the nanoscale cellular fine structures. For molecular interaction recognition, antibody molecules were attached onto AFM tips via a heterobifunctional polyethylene glycol (PEG) crosslinker. With AFM single-molecule force spectroscopy, the binding affinities of FcγRs were quantitatively measured on single macrophages. Adhesion force mapping method was used to localize the FcγRs, revealing the nanoscale distribution of FcγRs on local areas of macrophages. The experimental results can improve our understanding of FcγRs on macrophages; the established approach will facilitate further research on physiological activities involved in antibody-based immunotherapy.« less

Preclinical Magnetic Resonance Imaging and Spectroscopy Studies of Memory, Aging, and Cognitive Decline

PubMed Central

Febo, Marcelo; Foster, Thomas C.

2016-01-01

Neuroimaging provides for non-invasive evaluation of brain structure and activity and has been employed to suggest possible mechanisms for cognitive aging in humans. However, these imaging procedures have limits in terms of defining cellular and molecular mechanisms. In contrast, investigations of cognitive aging in animal models have mostly utilized techniques that have offered insight on synaptic, cellular, genetic, and epigenetic mechanisms affecting memory. Studies employing magnetic resonance imaging and spectroscopy (MRI and MRS, respectively) in animal models have emerged as an integrative set of techniques bridging localized cellular/molecular phenomenon and broader in vivo neural network alterations. MRI methods are remarkably suited to longitudinal tracking of cognitive function over extended periods permitting examination of the trajectory of structural or activity related changes. Combined with molecular and electrophysiological tools to selectively drive activity within specific brain regions, recent studies have begun to unlock the meaning of fMRI signals in terms of the role of neural plasticity and types of neural activity that generate the signals. The techniques provide a unique opportunity to causally determine how memory-relevant synaptic activity is processed and how memories may be distributed or reconsolidated over time. The present review summarizes research employing animal MRI and MRS in the study of brain function, structure, and biochemistry, with a particular focus on age-related cognitive decline. PMID:27468264

3D-engineering of Cellularized Conduits for Peripheral Nerve Regeneration

NASA Astrophysics Data System (ADS)

Hu, Yu; Wu, Yao; Gou, Zhiyuan; Tao, Jie; Zhang, Jiumeng; Liu, Qianqi; Kang, Tianyi; Jiang, Shu; Huang, Siqing; He, Jiankang; Chen, Shaochen; Du, Yanan; Gou, Maling

2016-08-01

Tissue engineered conduits have great promise for bridging peripheral nerve defects by providing physical guiding and biological cues. A flexible method for integrating support cells into a conduit with desired architectures is wanted. Here, a 3D-printing technology is adopted to prepare a bio-conduit with designer structures for peripheral nerve regeneration. This bio-conduit is consisted of a cryopolymerized gelatin methacryloyl (cryoGelMA) gel cellularized with adipose-derived stem cells (ASCs). By modeling using 3D-printed “lock and key” moulds, the cryoGelMA gel is structured into conduits with different geometries, such as the designed multichannel or bifurcating and the personalized structures. The cryoGelMA conduit is degradable and could be completely degraded in 2-4 months in vivo. The cryoGelMA scaffold supports the attachment, proliferation and survival of the seeded ASCs, and up-regulates the expression of their neurotrophic factors mRNA in vitro. After implanted in a rat model, the bio-conduit is capable of supporting the re-innervation across a 10 mm sciatic nerve gap, with results close to that of the autografts in terms of functional and histological assessments. The study describes an indirect 3D-printing technology for fabricating cellularized designer conduits for peripheral nerve regeneration, and could lead to the development of future nerve bio-conduits for clinical use.

Porosity and mechanical properties of zirconium ceramics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buyakova, S., E-mail: sbuyakova@ispms.tsc.ru; Kulkov, S.; Tomsk Polytechnic University

2015-11-17

Has been studied a porous ceramics obtained from ultra-fine powders. Porous ceramic ZrO{sub 2}(MgO), ZrO{sub 2}(Y{sub 2}O{sub 3}) powder was prepared by pressing and subsequent sintering of compacts homologous temperatures ranging from 0.63 to 0.56 during the isothermal holding duration of 1 to 5 hours. The porosity of ceramic samples was from 15 to 80%. The structure of the ceramic materials produced from plasma-sprayed ZrO{sub 2} powder was represented as a system of cell and rod structure elements. Cellular structure formed by stacking hollow powder particles can be easily seen at the images of fracture surfaces of obtained ceramics. Theremore » were three types of pores in ceramics: large cellular hollow spaces, small interparticle pores which are not filled with powder particles and the smallest pores in the shells of cells. The cells generally did not have regular shapes. The size of the interior of the cells many times exceeded the thickness of the walls which was a single-layer packing of ZrO{sub 2} grains. A distinctive feature of all deformation diagrams obtained in the experiment was their nonlinearity at low deformations which was described by the parabolic law. It was shown that the observed nonlinear elasticity for low deformation on deformation diagrams is due to mechanical instability of the cellular elements in the ceramic carcass.« less

Studying Nuclear Receptor Complexes in the Cellular Environment.

PubMed

Schaufele, Fred

2016-01-01

The ligand-regulated structure and biochemistry of nuclear receptor complexes are commonly determined by in vitro studies of isolated receptors, cofactors, and their fragments. However, in the living cell, the complexes that form are governed not just by the relative affinities of isolated cofactors for the receptor but also by the cell-specific sequestration or concentration of subsets of competing or cooperating cofactors, receptors, and other effectors into distinct subcellular domains and/or their temporary diversion into other cellular activities. Most methods developed to understand nuclear receptor function in the cellular environment involve the direct tagging of the nuclear receptor or its cofactors with fluorescent proteins (FPs) and the tracking of those FP-tagged factors by fluorescence microscopy. One of those approaches, Förster resonance energy transfer (FRET) microscopy, quantifies the transfer of energy from a higher energy "donor" FP to a lower energy "acceptor" FP attached to a single protein or to interacting proteins. The amount of FRET is influenced by the ligand-induced changes in the proximities and orientations of the FPs within the tagged nuclear receptor complexes, which is an indicator of the structure of the complexes, and by the kinetics of the interaction between FP-tagged factors. Here, we provide a guide for parsing information about the structure and biochemistry of nuclear receptor complexes from FRET measurements in living cells.

Curcumin and derivatives function through protein phosphatase 2A and presenilin orthologues in Dictyostelium discoideum

PubMed Central

Cocorocchio, Marco; Baldwin, Amy J.; Stewart, Balint; Kim, Lou; Harwood, Adrian J.; Thompson, Christopher R. L.; Andrews, Paul L. R.

2018-01-01

ABSTRACT Natural compounds often have complex molecular structures and unknown molecular targets. These characteristics make them difficult to analyse using a classical pharmacological approach. Curcumin, the main curcuminoid of turmeric, is a complex molecule possessing wide-ranging biological activities, cellular mechanisms and roles in potential therapeutic treatment, including Alzheimer's disease and cancer. Here, we investigate the physiological effects and molecular targets of curcumin in Dictyostelium discoideum. We show that curcumin exerts acute effects on cell behaviour, reduces cell growth and slows multicellular development. We employed a range of structurally related compounds to show the distinct role of different structural groups in curcumin's effects on cell behaviour, growth and development, highlighting active moieties in cell function, and showing that these cellular effects are unrelated to the well-known antioxidant activity of curcumin. Molecular mechanisms underlying the effect of curcumin and one synthetic analogue (EF24) were then investigated to identify a curcumin-resistant mutant lacking the protein phosphatase 2A regulatory subunit (PsrA) and an EF24-resistant mutant lacking the presenilin 1 orthologue (PsenB). Using in silico docking analysis, we then showed that curcumin might function through direct binding to a key regulatory region of PsrA. These findings reveal novel cellular and molecular mechanisms for the function of curcumin and related compounds. PMID:29361519