Delphi Method Validation of a Procedural Performance Checklist for Insertion of an Ultrasound-Guided Internal Jugular Central Line.

PubMed

Hartman, Nicholas; Wittler, Mary; Askew, Kim; Manthey, David

2016-01-01

Placement of ultrasound-guided central lines is a critical skill for physicians in several specialties. Improving the quality of care delivered surrounding this procedure demands rigorous measurement of competency, and validated tools to assess performance are essential. Using the iterative, modified Delphi technique and experts in multiple disciplines across the United States, the study team created a 30-item checklist designed to assess competency in the placement of ultrasound-guided internal jugular central lines. Cronbach α was .94, indicating an excellent degree of internal consistency. Further validation of this checklist will require its implementation in simulated and clinical environments. © The Author(s) 2014.

Risk factors for upper extremity venous thrombosis associated with peripherally inserted central venous catheters.

PubMed

Marnejon, Thomas; Angelo, Debra; Abu Abdou, Ahmed; Gemmel, David

2012-01-01

To identify clinically important risk factors associated with upper extremity venous thrombosis following peripherally inserted central venous catheters (PICC). A retrospective case control study of 400 consecutive patients with and without upper extremity venous thrombosis post-PICC insertion was performed. Patient data included demographics, body mass index (BMI), ethnicity, site of insertion, size and lumen of catheter, internal length, infusate, and co-morbidities, such as diabetes mellitus, congestive heart failure, and renal failure. Additional risk factors analyzed were active cancer, any history of cancer, recent trauma, smoking, a history of prior deep vein thrombosis, and recent surgery, defined as surgery within three months prior to PICC insertion. The prevalence of trauma, renal failure, and infusion with antibiotics and total parenteral nutrition (TPN) was higher among patients exhibiting upper extremity venous thrombosis (UEVT), when compared to controls. Patients developing UEVT were also more likely to have PICC line placement in a basilic vein and less likely to have brachial vein placement (P<.001). Left-sided PICC line sites also posed a greater risk (P=.026). The rate of standard DVT prophylaxis with low molecular weight heparin and unfractionated heparin and the use of warfarin was similar in both groups. Average length of hospital stay was almost double among patients developing UEVT, 19.5 days, when compared to patients undergoing PICC line insertion without thrombosis, 10.8 days (t=6.98, P<.001). In multivariate analysis, trauma, renal failure, left-sided catheters, basilic placement, TPN, and infusion with antibiotics, specifically vancomycin, were significant risk factors for UEVT associated with PICC insertion. Prophylaxis with low molecular weight heparin, unfractionated heparin or use of warfarin did not prevent the development of venous thrombosis in patients with PICCs. Length of hospital stay and cost are markedly increased in patients who develop PICC-associated upper extremity venous thrombosis.

CT-Guided Superior Vena Cava Puncture: A Solution to Re-Establishing Access in Haemodialysis-Related Central Venous Occlusion Refractory to Conventional Endovascular Techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khalifa, Mohamed, E-mail: mkhalifa@nhs.net; Patel, Neeral R., E-mail: neeral.patel06@gmail.com; Moser, Steven, E-mail: steven.moser@imperial.nhs.uk

PurposeThe purpose of this technical note is to demonstrate the novel use of CT-guided superior vena cava (SVC) puncture and subsequent tunnelled haemodialysis (HD) line placement in end-stage renal failure (ESRF) patients with central venous obstruction refractory to conventional percutaneous venoplasty (PTV) and wire transgression, thereby allowing resumption of HD.MethodsThree successive ESRF patients underwent CT-guided SVC puncture with subsequent tract recanalisation. Ultrasound-guided puncture of the right internal jugular vein was performed, the needle advanced to the patent SVC under CT guidance, with subsequent insertion of a stabilisation guidewire. Following appropriate tract angioplasty, twin-tunnelled HD catheters were inserted and HD resumed.ResultsNomore » immediate complications were identified. There was resumption of HD in all three patients with a 100 % success rate. One patient’s HD catheter remained in use for 2 years post-procedure, and another remains functional 1 year to the present day. One patient died 2 weeks after the procedure due to pancreatitis-related abdominal sepsis unrelated to the Tesio lines.ConclusionCT-guided SVC puncture and tunnelled HD line insertion in HD-related central venous occlusion (CVO) refractory to conventional recanalisation options can be performed safely, requires no extra equipment and lies within the skill set and resources of most interventional radiology departments involved in the management of HD patients.« less

Elucidating the mechanism of posterior reversible encephalopathy syndrome: a case of transient blindness after central venous catheterization.

PubMed

Rao, Neal M; Raychev, Radoslav; Kim, Doojin; Liebeskind, David S

2012-11-01

Posterior reversible encephalopathy syndrome (PRES) is a condition characterized by reversible symptoms including headache, visual disturbances, focal neurological deficits, altered mentation, and seizures. It has been associated with circumstances that may affect the cerebrovascular system, such as hypertension, eclampsia, and immunosuppression with calcineurin inhibitors. The underlying etiology of PRES has remained unclear; however, cerebrovascular autoregulatory dysfunction, hyperperfusion, and endothelial activation have been implicated. We describe a case of a young patient with lung transplant, who presented with headache, acute binocular blindness, and seizure immediately after infusion of saline through a peripherally inserted central catheter line, which inadvertently terminated cephalad in the left internal jugular vein, near the jugular foramen. Subsequent brain magnetic resonance imaging revealed vasogenic edematous lesions in a pattern consistent with PRES--a diagnosis supported by his constellation of symptoms, history of lung transplantation on tacrolimus immunosuppression, and relative hypertension. This is the first reported case describing the development of PRES after the insertion of a peripherally inserted central catheter line. The development of PRES in a typical high-risk patient immediately after cerebral venous outflow obstruction implicates the role of the cerebral venous system and provides potential insight into the mechanism of this disorder that remains of unclear pathogenesis.

Placement of central venous port catheters and peripherally inserted central catheters in the routine clinical setting of a radiology department: analysis of costs and intervention duration learning curve.

PubMed

Rotzinger, Roman; Gebauer, Bernhard; Schnapauff, Dirk; Streitparth, Florian; Wieners, Gero; Grieser, Christian; Freyhardt, Patrick; Hamm, Bernd; Maurer, Martin H

2017-12-01

Background Placement of central venous port catheters (CVPS) and peripherally inserted central catheters (PICC) is an integral component of state-of-the-art patient care. In the era of increasing cost awareness, it is desirable to have more information to comprehensively assess both procedures. Purpose To perform a retrospective analysis of interventional radiologic implantation of CVPS and PICC lines in a large patient population including a cost analysis of both methods as well as an investigation the learning curve in terms of the interventions' durations. Material and Methods All CVPS and PICC line related interventions performed in an interventional radiology department during a three-year period from January 2011 to December 2013 were examined. Documented patient data included sex, venous access site, and indication for CVPS or PICC placement. A cost analysis including intervention times was performed based on the prorated costs of equipment use, staff costs, and expenditures for disposables. The decrease in intervention duration in the course of time conformed to the learning curve. Results In total, 2987 interventions were performed by 16 radiologists: 1777 CVPS and 791 PICC lines. An average implantation took 22.5 ± 0.6 min (CVPS) and 10.1 ± 0.9 min (PICC lines). For CVPS, this average time was achieved by seven radiologists newly learning the procedures after performing 20 CVPS implantations. Total costs per implantation were €242 (CVPS) and €201 (PICC lines). Conclusion Interventional radiologic implantations of CVPS and PICC lines are well-established procedures, easy to learn by residents, and can be implanted at low costs.

The 12th Annual International Meeting on Simulation Healthcare (IMSH) 2012

DTIC Science & Technology

2012-03-01

Title: Videorecording of Simulated Technical Errors as an Instructional Modality in a Central Venous Catheterization Course Sub Content: Knowledge...bedside procedures, such as insertion of peripheral and central venous catheters, are performed routinely by a wide spectrum of healthcare providers...with Chest Tubes and a Central Venous Line Monday January 30th 2012 4:00 pm – 5:15 pm Training Education and Assessment Shelby Marx, Donald

Emergent Management of Postpartum Hemorrhage for the General and Acute Care Surgeon

DTIC Science & Technology

2009-01-01

central intravenous access and arterial lines should be inserted for central venous pressure monitor- ing, additional fluid infusion, continuous blood...BioMed Central Page 1 of 12 (page number not for citation purposes) World Journal of Emergency Surgery Open AccessReview Emergent management of...2009 This article is available from: http://www.wjes.org/content/4/1/43 © 2009 Weisbrod et al; licensee BioMed Central Ltd. This is an Open Access

Infusion of noradrenaline through the proximal line of a migrated central venous catheter.

PubMed

Freer, M; Noble, S

2012-08-01

A 41-year-old, obese, patient was admitted to Accident and Emergency with a history of leg cellulitis. A central line was inserted. Documented aspiration of blood from all lines, central venous pressure trace obtained and correct position noted on the chest X-ray (CXR). The patient became increasingly septic despite antibiotic therapy. He was subsequently commenced on a noradrenaline infusion; however, the blood pressure was unresponsive. On admission to the intensive care unit (ICU), it was noted he had an area of white skin over the right clavicle. The infusions were stopped and a CXR confirmed proximal migration of the line. The central line was re-sited and his noradrenaline recommenced with an improvement in his blood pressure. Acute renal failure developed which required haemofiltration for 24 hours. The condition improved and the patient was discharged from ICU. It took several weeks for his renal function to return to normal, but he was discharged home with no permanent damage.

Ambulatory pediatric oncology CLABSIs: epidemiology and risk factors.

PubMed

Rinke, Michael L; Milstone, Aaron M; Chen, Allen R; Mirski, Kara; Bundy, David G; Colantuoni, Elizabeth; Pehar, Miriana; Herpst, Cynthia; Miller, Marlene R

2013-11-01

To compare the burden of central line-associated bloodstream infections (CLABSIs) in ambulatory versus inpatient pediatric oncology patients, and identify the epidemiology of and risk factors associated with ambulatory CLABSIs. We prospectively identified infections and retrospectively identified central line days and characteristics associated with CLABSIs from January 2009 to October 2010. A nested case-control design was used to identify characteristics associated with ambulatory CLABSIs. We identified 319 patients with central lines. There were 55 ambulatory CLABSIs during 84,705 ambulatory central line days (0.65 CLABSIs per 1,000 central line days (95% CI 0.49, 0.85)), and 19 inpatient CLABSIs during 8,682 inpatient central line days (2.2 CLABSIs per 1,000 central lines days (95% CI 1.3, 3.4)). In patients with ambulatory CLABSIs, 13% were admitted to an intensive care unit and 44% had their central lines removed due to the CLABSI. A secondary analysis with a sub-cohort, suggested children with tunneled, externalized catheters had a greater risk of ambulatory CLABSI than those with totally implantable devices (IRR 20.6, P < 0.001). Other characteristics independently associated with ambulatory CLABSIs included bone marrow transplantation within 100 days (OR 16, 95% CI 1.1, 264), previous bacteremia in any central line (OR 10, 95% CI 2.5, 43) and less than 1 month from central line insertion (OR 4.2, 95% CI 1.0, 17). In pediatric oncology patients, three times more CLABSIs occur in the ambulatory than inpatient setting. Ambulatory CLABSIs carry appreciable morbidity and have identifiable, associated factors that should be addressed in future ambulatory CLABSI prevention efforts. Copyright © 2013 Wiley Periodicals, Inc.

Aiming for zero: decreasing central line associated bacteraemia in the intensive care unit.

PubMed

Seddon, Mary E; Hocking, Catherine J; Mead, Pat; Simpson, Catherine

2011-07-29

To eliminate Central Line Associated Bacteraemia (CLAB) in the Critical Care Complex (CCC)-Intensive Care Unit (ICU) and High Dependency Unit (HDU)-Middlemore Hospital. Multifaceted quality improvement programme that included: engagement with ICU leadership and education of ICU staff; the introduction of a CLAB prevention bundle of care through standardised checklists for central line insertion (December 2008) and line maintenance (July 2009); the development of a central line pack; and rapid, visual feedback of results. Absolute numbers of CLAB in the CCC decreased from 14 in 2008, to 4 in 2009 and 1 in the first 6 months of 2010 (despite increase in bed census and a doubling of admissions). The CLAB rate per 1,000 line days decreased from 6.6 to 0.9. The days between CLAB increased from a median of 30 to >100 days, with zero CLAB for 5 of the last 6 months. Mortality for patients with CLAB was 37%, compared with mortality of 13% for all other ICU patients. The conservative cost savings were $200,000 in 2009 and $260,000 in 2010. Using an evidenced-based quality improvement approach, it is possible to significantly decrease Central Line Associated Bacteraemia in the Critical Care Complex. In doing so patient morbidity and mortality are reduced and money is saved for other healthcare needs.

Peripherally Inserted Central Catheters in Pediatric Patients: To Repair or Not Repair

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gnannt, Ralph, E-mail: ralph.gnannt@usz.ch; Patel, Premal; Temple, Michael

IntroductionPreservation of venous access in children is a major concern in pediatric interventional radiology. If a peripherally inserted central catheter (PICC) breaks, there are two options: repair the line with a repair kit or exchange the line over a wire in the interventional suite. The purpose of this study is to assess the outcome of PICC repairs in children and to compare these with the outcomes of PICC exchange.Materials and MethodsThis is a single-center, retrospective study of central line-associated bloodstream infection (CLABSI) following management of externally broken PICCs (2010–2014). The occurrence of CLABSI within 30 days after repair (Group A) ormore » exchange (Group B) of a line was analyzed, as well as PICCs exchanged following an initial and failed repair.ResultsA total of 235 PICC breaks were included in the study, of which 161 were repaired, and 116 of whom were successful (68%, Group A). No repair was performed in 74 PICCs—55/74 of these were exchanged over a wire (74%, Group B), and 19/74 lines were removed. The 30 days post-repair CLABSI rate (Group A) was 2.0 infections per 1000 catheter days, and the calculated risk was 4.3%. In comparison the 30 days post-exchange CLABSI rate (Group B) was 4.0 per 1000 catheter days and the calculated risk 10.9%. This difference was significant when adjusted for antibiotic use (OR 3.87; 95% CI 1.07–14.0, p = 0.039).ConclusionThe results of this study support repairing a broken PICC instead of removing or replacing the line.« less

A Randomized Parallel Study for Simulated Internal Jugular Vein Cannulation Using Simple Needle Guide Device

ClinicalTrials.gov

2017-08-14

Doctors Attending a Central Line Insertion Training Courses for New Residents of a University Hospital From March 2017 to June 2017; Physicians Who Had Less Than 10 Ultrasound Guided Internal Jugular Vein Cannulation Participate in This Study

Vascular air embolism

PubMed Central

Gordy, Stephanie; Rowell, Susan

2013-01-01

Vascular air embolism is a rare but potentially fatal event. It may occur in a variety of procedures and surgeries but is most often associated as an iatrogenic complication of central line catheter insertion. This article reviews the incidence, pathophysiology, diagnosis, treatment, and prevention of this phenomenon. PMID:23724390

Ultrasound Guidance as a Rescue Technique for Peripheral Intravenous Cannulation

DTIC Science & Technology

2006-09-14

painful, time consuming, and may result in arterial puncture, nerve damage, and paresthes ias.5 Other routes such as central venous or venous cut down...peripherally inserted central lines-PICCS), femoral catheterizations during cardiopulmonary resuscitation, and peripheral IV catheters in difficult...techniques for gaining venous access. What to do when peripheral intravenous catheterization is not possible. J Crit 11/n. 1993;8:435-442. 2. Nee PA

A novel infection prevention approach: Leveraging a mandatory electronic communication tool to decrease peripherally inserted central catheter infections, complications, and cost.

PubMed

Kim-Saechao, Sue J; Almario, Earl; Rubin, Zachary A

2016-11-01

Peripherally inserted central catheters (PICCs) removed prematurely for unconfirmed infection or thrombosis lead to subsequent reinsertions and associated complications. To improve clinical quality, a mandatory electronic communication tool (MECT) based on clinical practice guidelines was mandated for all inpatient adult PICCs in an academically affiliated tertiary medical center. This MECT facilitated early communication and specialized evaluation with the PICC team for any complications related to PICCs. A historical cohort study was conducted. Quality and cost measurements for 200 PICCs postinstitution of a MECT were compared with 200 PICCs 12 months prior. PICC removal and complication rates were compared for the 2 cohorts. Significant outcomes included a central-line associated blood stream infection rate that changed from 1.38/1,000 catheter days to 0/1,000 catheter days, 0 provider-led premature PICC removals, an overall 84% decrease in premature PICC removals (from 16%-2.5%; P < .0001), a decrease in the total complication rate from 45.5%-24% (P < .0001), and 25% reduction in radiology costs. A novel infection prevention approach leveraging a MECT resulted in 0 central line-associated bloodstream infections and provider-led premature PICC removals. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Use of peripherally inserted central venous catheters (PICCs) in children receiving autologous or allogeneic stem-cell transplantation.

PubMed

Benvenuti, Stefano; Ceresoli, Rosanna; Boroni, Giovanni; Parolini, Filippo; Porta, Fulvio; Alberti, Daniele

2018-03-01

The aim of our study was to present our experience with the use of peripherally inserted central catheters (PICCs) in pediatric patients receiving autologous or allogenic blood stem-cell transplantation. The insertion of the device in older children does not require general anesthesia and does not require a surgical procedure. From January 2014 to January 2017, 13 PICCs were inserted as a central venous device in 11 pediatric patients submitted to 14 autologous or allogeneic stem-cell transplantation, at the Bone Marrow Transplant Unit of the Children's Hospital of Brescia. The mean age of patients at the time of the procedure was 11.3 years (range 3-18 years). PICCs remained in place for an overall period of 4104 days. All PICCs were positioned by the same specifically trained physician and utilized by nurses of our stem-cell transplant unit. No insertion-related complications were observed. Late complications were catheter ruptures and line occlusions (1.2 per 1000 PICC days). No rupture or occlusion required removal of the device. No catheter-related venous thrombosis, catheter-related bloodstream infection (CRBSI), accidental removal or permanent lumen occlusion were observed. Indications for catheter removal were completion of therapy (8 patients) and death (2 patients). Three PICCs are currently being used for blood sampling in follow-up patients after transplantation. Our data suggest that PICCs are a safe and effective alternative to conventional central venous catheters even in pediatric patients with high risk of infectious and hemorrhagic complications such as patients receiving stem-cell transplantation.

Target CLAB Zero: A national improvement collaborative to reduce central line-associated bacteraemia in New Zealand intensive care units.

PubMed

Gray, Jonathon; Proudfoot, Suzanne; Power, Maxine; Bennett, Brandon; Wells, Sue; Seddon, Mary

2015-09-04

Central line-associated bacteraemia (CLAB) is a preventable cause of patient morbidity and mortality in intensive care units. Target CLAB Zero was a national campaign that ran from October 2011 to March 2013 across all New Zealand ICUs (intensive care units). The campaign aimed to reduce the national CLAB rate to less than one incident per 1,000 line days and to establish a national measurement system for CLAB. We used Institute for Healthcare Improvement (IHI) Breakthrough Series methodology to structure the campaign. IHI bundles of care for catheter insertion and maintenance were implemented across 25 New Zealand ICUs. We collected monthly data on line days, CLAB infections and compliance with the bundles. Data were analysed using run charts. The rate of CLAB per 1,000 line days fell from 3.32 at baseline to an average of 0.28 between April 2012 and March 2013. In the final 3-month period, January to March 2013, average insertion bundle compliance was 80% and average maintenance bundle compliance was 75%. All ICUs participated in the collaborative. Over 90% of those invited attended all three national learning sessions and bi-monthly regional learning sessions. National collaboratives can effect improvement and shared learning in New Zealand. International evidence combined with New Zealand experience, a supportive methodology, partnership, clinical respect and an effective communication plan were keys to successful engagement.

Effectiveness of insertion and maintenance bundles to prevent central-line-associated bloodstream infections in critically ill patients of all ages: a systematic review and meta-analysis.

PubMed

Ista, Erwin; van der Hoven, Ben; Kornelisse, René F; van der Starre, Cynthia; Vos, Margreet C; Boersma, Eric; Helder, Onno K

2016-06-01

Central-line-associated bloodstream infections (CLABSIs) are a major problem in intensive care units (ICUs) worldwide. We aimed to quantify the effectiveness of central-line bundles (insertion or maintenance or both) to prevent these infections. We searched Embase, MEDLINE OvidSP, Web-of-Science, and Cochrane Library to identify studies reporting the implementation of central-line bundles in adult ICU, paediatric ICU (PICU), or neonatal ICU (NICU) patients. We searched for studies published between Jan 1, 1990, and June 30, 2015. For the meta-analysis, crude estimates of infections were pooled by use of a DerSimonian and Laird random effect model. The primary outcome was the number of CLABSIs per 1000 catheter-days before and after implementation. Incidence risk ratios (IRRs) were obtained by use of random-effects models. We initially identified 4337 records, and after excluding duplicates and those ineligible, 96 studies met the eligibility criteria, 79 of which contained sufficient information for a meta-analysis. Median CLABSIs incidence were 5·7 per 1000 catheter-days (range 1·2-46·3; IQR 3·1-9·5) on adult ICUs; 5·9 per 1000 catheter-days (range 2·6-31·1; 4·8-9·4) on PICUs; and 8·4 per 1000 catheter-days (range 2·6-24·1; 3·7-16·0) on NICUs. After implementation of central-line bundles the CLABSI incidence ranged from 0 to 19·5 per 1000 catheter-days (median 2·6, IQR 1·2-4·4) in all types of ICUs. In our meta-analysis the incidence of infections decreased significantly from median 6·4 per 1000 catheter-days (IQR 3·8-10·9) to 2·5 per 1000 catheter-days (1·4-4·8) after implementation of bundles (IRR 0·44, 95% CI 0·39-0·50, p<0·0001; I(2)=89%). Implementation of central-line bundles has the potential to reduce the incidence of CLABSIs. None. Copyright © 2016 Elsevier Ltd. All rights reserved.

Early goal-directed therapy (EGDT) for severe sepsis/septic shock: which components of treatment are more difficult to implement in a community-based emergency department?

PubMed

O'Neill, Rory; Morales, Javier; Jule, Michael

2012-05-01

Early goal-directed therapy (EGDT) has been shown to reduce mortality in patients with severe sepsis/septic shock, however, implementation of this protocol in the emergency department (ED) is sometimes difficult. We evaluated our sepsis protocol to determine which EGDT elements were more difficult to implement in our community-based ED. This was a non-concurrent cohort study of adult patients entered into a sepsis protocol at a single community hospital from July 2008 to March 2009. Charts were reviewed for the following process measures: a predefined crystalloid bolus, antibiotic administration, central venous catheter insertion, central venous pressure measurement, arterial line insertion, vasopressor utilization, central venous oxygen saturation measurement, and use of a standardized order set. We also compared the individual component adherence with survival to hospital discharge. A total of 98 patients presented over a 9-month period. Measures with the highest adherence were vasopressor administration (79%; 95% confidence interval [CI] 69-89%) and antibiotic use (78%; 95% CI 68-85%). Measures with the lowest adherence included arterial line placement (42%; 95% CI 32-52%), central venous pressure measurement (27%; 95% CI 18-36%), and central venous oxygen saturation measurement (15%; 95% CI 7-23%). Fifty-seven patients survived to hospital discharge (Mortality: 33%). The only element of EDGT to demonstrate a statistical significance in patients surviving to hospital discharge was the crystalloid bolus (79% vs. 46%) (respiratory rate [RR] = 1.76, 95% CI 1.11-2.58). In our community hospital, arterial line placement, central venous pressure measurement, and central venous oxygen saturation measurement were the most difficult elements of EGDT to implement. Patients who survived to hospital discharge were more likely to receive the crystalloid bolus. Copyright © 2012 Elsevier Inc. All rights reserved.

Central Line Associated Blood Stream Infections in Pediatric Hematology/Oncology Patients With Different Types of Central Lines.

PubMed

Hord, Jeffrey D; Lawlor, John; Werner, Eric; Billett, Amy L; Bundy, David G; Winkle, Cindi; Gaur, Aditya H

2016-09-01

Central line associated bloodstream infections (CLABSIs) are a significant cause of morbidity and mortality in pediatric hematology/oncology (PHO) patients. Understanding the differences in CLABSI rates by central line (CL) type is important to inform clinical decisions. CLABSI, using similar definitions, noted with three commonly used CL types (totally implanted catheter [port], tunneled externalized catheter [TEC], peripherally inserted central catheter [PICC]) and CL-specific line days were prospectively tracked across 15 US PHO centers from May 2012 until April 2015 and CLABSI rates (CLABSI per 1,000 CL-specific line days) were calculated. Host and organism characterstics associated with the CLABSI events were analyzed. Over the course of 2.8 million line days, 1,113 CLABSI events (397 in inpatients and 716 in ambulatory patients) were noted. The inpatient CLABSI rate was higher than the ambulatory CLABSI rate for each of the CL types: 1.48 versus 0.16 for ports, 3.51 versus 1.38 for TECs, and 3.07 versus 1.16 for PICCs, respectively. TECs and PICCs were associated with higher CLABSI rates than ports, inpatient and ambulatory. We found that CLABSI rates were significantly higher for inpatients compared to ambulatory PHO patients for all CL types. Among ambulatory patients, TECs had the highest CLABSI rate and ports the lowest. Among inpatients, TECs and PICCs had higher CLABSI rates than ports but were not statistically different from one another. Cognizant that host and underlying disease attributes may contribute to these differences, these results can still inform CL choice in clinical practice. © 2016 Wiley Periodicals, Inc.

Distal Superficial Femoral Vein Cannulation for Peripherally Inserted Central Catheter Placement in Infants with Cardiac Disease.

PubMed

Richter, Robert P; Law, Mark A; Borasino, Santiago; Surd, Jessica A; Alten, Jeffrey A

2016-12-01

To describe a novel real-time ultrasound (US)-guided distal superficial femoral vein (DSFV) cannulation technique for insertion of peripherally inserted central catheters (PICC) in critically ill infants with congenital heart disease. Descriptive retrospective cohort study SETTING: Pediatric cardiac intensive care unit in a pediatric tertiary hospital PATIENTS: First 28 critically ill infants that received DSFV PICCs via this new technique. Thirty-seven US-guided DSFV PICCs were attempted on 31 infants from September 2012 to November 2014; 34 PICCs were placed in 28 patients (success rate 92%). Twenty-six of 28 patients underwent cardiac surgery. Median (IQR) age at time of PICC placement 39 days (13, 151); weight 3.4 kg (3.2, 5.3). 25/34 PICCs were placed in patients with STAT 4 or 5 category. Median PICC duration 16 days (11, 29); maximum duration 123 days. Ten infants (36%) had DSFV PICCs placed as the primary central venous access in perioperative period. Ten of 28 patients underwent cardiac catheterization while DSFV PICC was in place, four of which were performed through ipsilateral common femoral vein. Two patients had femoral arterial lines placed in the ipsilateral femoral artery while DSFV PICC was in place. There were no reported inadvertent arterial punctures. The PICC-associated infection rate was 4.6 per 1000 line days. Four of 34 DSFV PICCs (11.8%) were associated with deep venous thrombosis. DSFV is a novel venous access site for PICC placement with high success rate and sufficient longevity and flexibility for critically ill infants with cardiac disease. More experience and larger studies are needed to confirm its potential advantages. © 2016 Wiley Periodicals, Inc.

[Thrombosis and obstruction associated with central venous lines. Incidence and risk factors].

PubMed

Vivanco Allende, A; Rey Galán, C; Rodríguez de la Rúa, M V; Alvarez García, F; Medina Villanueva, A; Concha Torre, A; Mayordomo Colunga, J; Martínez Camblor, P

2013-09-01

To analyse the incidence of thrombosis and obstruction associated with central venous lines (CVL) inserted in critically ill children, and to determine their risk factors. Prospective observational study in a Pediatric Intensive Care Unit in a University Hospital. An analysis was made of 825 CVL placed in 546 patients. Age, gender, weight, type of catheter (lines, size, and brand), final location of the catheter, mechanical ventilation, type of sedation and analgesia used, initial failure by the doctor to perform CVL catheterization, number of attempts, CVL indication, admission diagnosis, emergency or scheduled procedure, and delayed mechanical complications (DMC). Risk factors for these complications were determined by a multiple regression analysis. A total of 52 cases of DMC, 42 cases of obstruction, and 10 of thrombosis were registered. Obstruction and thrombosis rates were 4.96 and 1.18 per 100 CVL, respectively. The only risk factor independently linked to obstruction was the duration of the CVL (OR 1.05; 95% CI; 1.00-1.10). The number of lines with thrombosis (OR 4.88; 95% CI; 1.26-18.0), as well as parenteral nutrition (OR 4.17; 95% CI; 1.06-16.31) was statistically significant according to bivariate analysis. However, no risk factors for thrombosis were found in the multivariate analysis. Obstruction and thrombosis of CVL inserted in a Pediatric Intensive Care Unit are relatively common complications. CVL duration is an independent risk factor for any line obstruction. Copyright © 2012 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Can a New Antiseptic Agent Reduce the Bacterial Colonization Rate of Central Venous Lines in Post-Cardiac Surgery Patients?

PubMed Central

Yousefshahi, Fardin; Azimpour, Khashayar; Boroumand, Mohammad Ali; Najafi, Mahdi; Barkhordari, Khosro; Vaezi, Mitra; Rouhipour, Nahid

2013-01-01

Background: Central venous (CV) catheters play an essential role in the management of critically ill patients in the Intensive Care Unit (ICU). CV lines are, however, allied to catheter-associated blood stream infections. Bacterial colonization of CV lines is deemed the main cause of catheter-associated infection. The purpose of our study was to compare bacterial colony counts in the catheter site before CV line insertion in two groups of post-cardiac surgery patients: a group receiving Sanosil (an antiseptic agent composed of H2O2 and silver) and a control group. Methods: This interventional prospective double-blinded clinical trial recruited the patients in three post-cardiac surgery ICUs of a heart center. The participants were divided into interventional (113 patients) and control (136 patients) groups. Sanosil was added to the routine preparation procedure (Chlorhexidine bath one day before and scrub with Povidone-Iodine just before the CV line insertion). After the removal of the CV lines, the catheters tips were sent for culture and evaluation of colony counts. Results: Catheter colonization occurred in 55 (22.1%) patients: 26 (23%) patients in the Sanosil group and 29 (21.3%) in the control group; there was no significant statistical difference between the two groups (p value = 0.75, RR = 1.05, 95% CI: 0.76–1.45). The most common organism having colonized in the cultures of the catheter tips was staphylococcus epidermis: 20 cases in the control group and 16 cases in the intervention group. Conclusion: Catheter colonization frequently occurs in post-cardiac surgery patients. However, our results did not indicate the effectiveness of adding Sanosil to the routine preparation procedure with respect to reducing catheter bacterial colonization. PMID:23967028

Can a new antiseptic agent reduce the bacterial colonization rate of central venous lines in post-cardiac surgery patients?

PubMed

Yousefshahi, Fardin; Azimpour, Khashayar; Boroumand, Mohammad Ali; Najafi, Mahdi; Barkhordari, Khosro; Vaezi, Mitra; Rouhipour, Nahid

2013-04-01

Central venous (CV) catheters play an essential role in the management of critically ill patients in the Intensive Care Unit (ICU). CV lines are, however, allied to catheter-associated blood stream infections. Bacterial colonization of CV lines is deemed the main cause of catheter-associated infection. The purpose of our study was to compare bacterial colony counts in the catheter site before CV line insertion in two groups of post-cardiac surgery patients: a group receiving Sanosil (an antiseptic agent composed of H2O2 and silver) and a control group. This interventional prospective double-blinded clinical trial recruited the patients in three post-cardiac surgery ICUs of a heart center. The participants were divided into interventional (113 patients) and control (136 patients) groups. Sanosil was added to the routine preparation procedure (Chlorhexidine bath one day before and scrub with Povidone-Iodine just before the CV line insertion). After the removal of the CV lines, the catheters tips were sent for culture and evaluation of colony counts. Catheter colonization occurred in 55 (22.1%) patients: 26 (23%) patients in the Sanosil group and 29 (21.3%) in the control group; there was no significant statistical difference between the two groups (p value = 0.75, RR = 1.05, 95% CI: 0.76-1.45). The most common organism having colonized in the cultures of the catheter tips was staphylococcus epidermis: 20 cases in the control group and 16 cases in the intervention group. Catheter colonization frequently occurs in post-cardiac surgery patients. However, our results did not indicate the effectiveness of adding Sanosil to the routine preparation procedure with respect to reducing catheter bacterial colonization.

Routine Chest Radiographs After Central Line Insertion: Mandatory Postprocedural Evaluation or Unnecessary Waste of Resources?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lucey, Brian; Varghese, Jose C.; Haslam, Philip

1999-09-15

Purpose: To study the cost and impact on patient management of the routine performance of chest radiographs in patients undergoing imaged-guided central venous catheter insertion. Methods: Six hundred and twenty-one catheters placed in 489 patients over a 42-month period formed the study group. Catheters were placed in the right internal jugular vein (425), left internal jugular vein (133), and subclavian veins (63). At the end of the procedure fluoroscopy was used to assess catheter position and check for complications. A postprocedural chest radiograph was obtained in all patients. Results: Postprocedural chest fluoroscopy showed no evidence of pneumothorax, hemothorax, or mediastinalmore » hematoma. Inappropriate catheter tip position or catheter kinks were noted with 90 catheters. These problems were all corrected while the patient was on the interventional table. Postprocedural chest radiographs showed no complications but proximal catheter tip migration was noted in six of 621 catheters (1%). These latter six catheters required further manipulation. The total technical and related charges for the postprocedural chest radiographs in this series were estimated at Pounds 15,525. Conclusion: Postprocedural chest radiographs after image-guided central venous catheter insertion are not routinely required. A postprocedural chest radiograph can be performed on a case-by-case basis at the discretion of the interventional radiologist.« less

Peripherally inserted central venous catheter-associated complications exert negative effects on body weight gain in neonatal intensive care units.

PubMed

Wen, Jie; Yu, Qun; Chen, Haiyan; Chen, Niannian; Huang, Shourong; Cai, Wei

2017-01-01

The placement of a peripherally inserted central venous catheter (PICC) is an essential procedure in neonatal intensive care units (NICU). The aim of this study was to determine the risk of PICC complications in NICU, and further identify the effects of PICC complications on body weight gain in premature infants. A total of 304 premature infants who had a PICC inserted in NICU were enrolled in this study. The weight-for-age z-score (WAZ) at the time of PICC insertion and removal were calculated, and changes of WAZ in different groups were compared using a t-test. Risk factors for PICC complications were assessed using the chi-squared test and multiple logistic regression analysis. Thirty (9.97%) PICCs were removed due to complications. Of them, 14 PICCs were removed because of non-infectious complications and 16 PICCs were removed for central-line-associated bloodstream infections (CLABSIs). Multiple logistic regression analysis showed that premature infants with birth weight >1,500 g were less likely to have PICC complications than infants with birth weight <=1,500 g (OR, 0.29; 95% CI: 0.10-0.82; p=0.020). In addition, the changes in WAZ between PICC insertion and removal were significantly different in both infectious (-0.144±0.122, p<0.005) and non-infectious (-0.65±0.528, p<0.001) complications groups, compared with the no complications group (0.291±0.552). Findings from this study suggest that birth weight is a risk factor for PICC-associated complications in the NICU, and both infectious and non-infectious PICC complications are associated with poor body weight gain in premature infants.

Use of peripherally inserted central catheters as an alternative to central catheters in neurocritical care units.

PubMed

DeLemos, Christi; Abi-Nader, Judy; Akins, Paul T

2011-04-01

Patients in neurological critical care units often have lengthy stays that require extended vascular access and invasive hemodynamic monitoring. The traditional approach for these patients has relied heavily on central venous and pulmonary artery catheters. The aim of this study was to evaluate peripherally inserted central catheters as an alternative to central venous catheters in neurocritical care settings. Data on 35 patients who had peripherally inserted central catheters rather than central venous or pulmonary artery catheters for intravascular access and monitoring were collected from a prospective registry of neurological critical care admissions. These data were cross-referenced with information from hospital-based data registries for peripherally inserted central catheters and subarachnoid hemorrhage. Complete data were available on 33 patients with Hunt-Hess grade IV-V aneurysmal subarachnoid hemorrhage. Catheters remained in place a total of 649 days (mean, 19 days; range, 4-64 days). One patient (3%) had deep vein thrombosis in an upper extremity. In 2 patients, central venous pressure measured with a peripherally inserted catheter was higher than pressure measured concurrently with a central venous catheter. None of the 33 patients had a central catheter bloodstream infection or persistent insertion-related complications. CONCLUSIONS Use of peripherally inserted central catheters rather than central venous catheters or pulmonary artery catheters in the neurocritical care unit reduced procedural and infection risk without compromising patient management.

Risk factors associated with PICC-related upper extremity venous thrombosis in cancer patients.

PubMed

Yi, Xiao-lei; Chen, Jie; Li, Jia; Feng, Liang; Wang, Yan; Zhu, Jia-An; Shen, E; Hu, Bing

2014-03-01

To investigate the incidence and risk factors for peripherally inserted central venous catheters-related upper extremity venous thrombosis in patients with cancer. With the widespread use of peripherally inserted central venous catheters, peripherally inserted central venous catheters-related upper extremity venous thrombosis in patients with cancer leads to increasing morbidity and mortality. It is very important to further explore the incidence and risk factors for peripherally inserted central venous catheters-related venous thrombosis. Consecutive patients with cancer who were scheduled to receive peripherally inserted central venous catheters, between September 2009 and May 2012, were prospectively studied in our centre. They were investigated for venous thrombosis by Doppler sonography three times a day within 30 days after catheter insertion. Univariable and multivariable logistic regressions' analyses were performed to identify the risk factors for peripherally inserted central venous catheters-related thrombosis. A total of 89 patients with cancer were studied in our research. Of these, 81 patients were followed up within one month. The mean interval between catheter insertion and the onset of thrombosis was 12.45 ± 6.17 days. The multivariable analyses showed that chemotherapy history, less activities and diabetes were the key risk factors for thrombosis. Peripherally inserted central venous catheters-related upper extremity venous thrombosis had high incidence rate, and most cases had no significant symptoms. The history of chemotherapy, less activities and diabetes were found to be the key risk factors. It should be routinely scanned in high-risk patients every 3-5 days after catheter insertion, which would then find blood clots in time and reduce the incidence of pulmonary embolism. Risk factors associated with peripherally inserted central venous catheters-related upper extremity venous thrombosis are of critical importance in improving the quality of patients' life. It is very important to grasp the indications to reduce the incidence rate of peripherally inserted central venous catheters-related upper extremity venous thrombosis. © 2013 John Wiley & Sons Ltd.

Effects of P Element Insertions on Quantitative Traits in Drosophila Melanogaster

PubMed Central

Mackay, TFC.; Lyman, R. F.; Jackson, M. S.

1992-01-01

P element mutagenesis was used to construct 94 third chromosome lines of Drosophila melanogaster which contained on average 3.1 stable P element inserts, in an inbred host strain background previously free of P elements. The homozygous and heterozygous effects of the inserts on viability and abdominal and sternopleural bristle number were ascertained by comparing the chromosome lines with inserts to insert-free control lines of the inbred host strain. P elements reduced average homozygous viability by 12.2% per insert and average heterozygous viability by 5.5% per insert, and induced recessive lethal mutations at a rate of 3.8% per insert. Mutational variation for the bristle traits averaged over both sexes was 0.03V(e) per homozygous P insert and 0.003V(e) per heterozygous P insert, where V(e) is the environmental variance. Mutational variation was greater for the sexes considered separately because inserts had large pleiotropic effects on sex dimorphism of bristle characters. The distributions of homozygous effects of inserts on the bristle traits were asymmetrical, with the largest effects in the direction of reducing bristle number; and highly leptokurtic, with most of the increase in variance contributed by a few lines with large effects. The inserts had partially recessive effects on the bristle traits. Insert lines with extreme bristle effects had on average greatly reduced viability. PMID:1311697

Beamline Insertions Manager at Jefferson Lab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Michael C.

2015-09-01

The beam viewer system at Jefferson Lab provides operators and beam physicists with qualitative and quantitative information on the transverse electron beam properties. There are over 140 beam viewers installed on the 12 GeV CEBAF accelerator. This paper describes an upgrade consisting of replacing the EPICS-based system tasked with managing all viewers with a mixed system utilizing EPICS and high-level software. Most devices, particularly the beam viewers, cannot be safely inserted into the beam line during high-current beam operations. Software is partly responsible for protecting the machine from untimely insertions. The multiplicity of beam-blocking and beam-vulnerable devices motivates us tomore » try a data-driven approach. The beamline insertions application components are centrally managed and configured through an object-oriented software framework created for this purpose. A rules-based engine tracks the configuration and status of every device, along with the beam status of the machine segment containing the device. The application uses this information to decide on which device actions are allowed at any given time.« less

Task analysis method for procedural training curriculum development.

PubMed

Riggle, Jakeb D; Wadman, Michael C; McCrory, Bernadette; Lowndes, Bethany R; Heald, Elizabeth A; Carstens, Patricia K; Hallbeck, M Susan

2014-06-01

A central venous catheter (CVC) is an important medical tool used in critical care and emergent situations. Integral to proper care in many circumstances, insertion of a CVC introduces the risk of central line-associated blood stream infections and mechanical adverse events; proper training is important for safe CVC insertion. Cognitive task analysis (CTA) methods have been successfully implemented in the medical field to improve the training of postgraduate medical trainees, but can be very time-consuming to complete and require a significant time commitment from many subject matter experts (SMEs). Many medical procedures such as CVC insertion are linear processes with well-documented procedural steps. These linear procedures may not require a traditional CTA to gather the information necessary to create a training curriculum. Accordingly, a novel, streamlined CTA method designed primarily to collect cognitive cues for linear procedures was developed to be used by medical professionals with minimal CTA training. This new CTA methodology required fewer trained personnel, fewer interview sessions, and less time commitment from SMEs than a traditional CTA. Based on this study, a streamlined CTA methodology can be used to efficiently gather cognitive information on linear medical procedures for the creation of resident training curricula and procedural skills assessments.

Web-based Learning and Computer Supported Collaborative Learning for psychomotor skill acquisition: perspectives of medical undergraduate students.

PubMed

Koh, Jansen; Cheung, Jeffrey J H; Mackinnon, Kim; Brett, Clare; Kapralos, Bill; Dubrowski, Adam

2013-01-01

There is a lack of evidence for the use of Web-based Learning (WBL) and Computer Supported Collaborative Learning (CSCL) for acquiring psychomotor skills in medical education. In this study, we surveyed medical undergraduate students attending a simulation based training session for central line insertion on their perspectives and utilization of WBL and CSCL for acquisition of a complex psychomotor skill.

Central venous access: techniques and indications in oncology.

PubMed

Marcy, Pierre-Yves

2008-10-01

Long lines can be inserted centrally or peripherally through patent veins into the central venous system down to the atrial caval junction. Traditionally surgeons, anesthetists, cardiologists and more recently interventional radiologists have been placing them using vein cutdown or percutaneous needle puncture techniques. Typical candidates for implanted venous catheters are cancer patients undergoing long-term chemotherapy. The most important issues, in addition to the patency of central veins and the history of previous indwelling catheters, pacewires or venous thrombosis, are the patient's performance status, body mass index, medical history and respiratory status, and the relevant technique. The present article will give an overview of the radiological and surgical implantation techniques and will highlight the impact of imaging means on the technical feasibility, assessment and treatment of device-related complications.

A High-Throughput Arabidopsis Reverse Genetics System

PubMed Central

Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

2002-01-01

A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

Incidence and trends of central line associated pneumothorax using radiograph report text search versus administrative database codes.

PubMed

Reeson, Marc; Forster, Alan; van Walraven, Carl

2018-05-25

Central line associated pneumothorax (CLAP) could be a good quality of care indicator because they are objectively measured, clearly undesirable and possibly avoidable. We measured the incidence and trends of CLAP using radiograph report text search with manual review and compared them with measures using routinely collected health administrative data. For each hospitalisation to a tertiary care teaching hospital between 2002 and 2015, we searched all chest radiography reports for a central line with a sensitive computer algorithm. Screen positive reports were manually reviewed to confirm central lines. The index and subsequent chest radiography reports were screened for pneumothorax followed by manual confirmation. Diagnostic and procedural codes were used to identify CLAP in administrative data. In 685 044 hospitalisations, 10 819 underwent central line insertion (1.6%) with CLAP occurring 181 times (1.7%). CLAP risk did not change over time. Codes for CLAP were inaccurate (sensitivity 13.8%, positive predictive value 6.6%). However, overall code-based CLAP risk (1.8%) was almost identical to actual values possibly because patient strata with inflated CLAP risk were balanced by more common strata having underestimated CLAP risk. Code-based methods inflated central line incidence 2.2 times and erroneously concluded that CLAP risk decreased significantly over time. Using valid methods, CLAP incidence was similar to those in the literature but has not changed over time. Although administrative database codes for CLAP were very inaccurate, they generated CLAP risks very similar to actual values because of offsetting errors. In contrast to those from radiograph report text search with manual review, CLAP trends decreased significantly using administrative data. Hospital CLAP risk should not be measured using administrative data. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

The Relationship Between Technical Errors and Decision Making Skills in the Junior Resident

PubMed Central

Nathwani, J. N.; Fiers, R.M.; Ray, R.D.; Witt, A.K.; Law, K. E.; DiMarco, S.M.; Pugh, C.M.

2017-01-01

Objective The purpose of this study is to co-evaluate resident technical errors and decision-making capabilities during placement of a subclavian central venous catheter (CVC). We hypothesize that there will be significant correlations between scenario based decision making skills, and technical proficiency in central line insertion. We also predict residents will have problems in anticipating common difficulties and generating solutions associated with line placement. Design Participants were asked to insert a subclavian central line on a simulator. After completion, residents were presented with a real life patient photograph depicting CVC placement and asked to anticipate difficulties and generate solutions. Error rates were analyzed using chi-square tests and a 5% expected error rate. Correlations were sought by comparing technical errors and scenario based decision making. Setting This study was carried out at seven tertiary care centers. Participants Study participants (N=46) consisted of largely first year research residents that could be followed longitudinally. Second year research and clinical residents were not excluded. Results Six checklist errors were committed more often than anticipated. Residents performed an average of 1.9 errors, significantly more than the 1 error, at most, per person expected (t(44)=3.82, p<.001). The most common error was performance of the procedure steps in the wrong order (28.5%, P<.001). Some of the residents (24%) had no errors, 30% committed one error, and 46 % committed more than one error. The number of technical errors committed negatively correlated with the total number of commonly identified difficulties and generated solutions (r(33)= −.429, p=.021, r(33)= −.383, p=.044 respectively). Conclusions Almost half of the surgical residents committed multiple errors while performing subclavian CVC placement. The correlation between technical errors and decision making skills suggests a critical need to train residents in both technique and error management. ACGME Competencies Medical Knowledge, Practice Based Learning and Improvement, Systems Based Practice PMID:27671618

[The ISP (Safe Insertion of PICCs) protocol: a bundle of 8 recommendations to minimize the complications related to the peripherally inserted central venous catheters (PICC)].

PubMed

Emoli, Alessandro; Cappuccio, Serena; Marche, Bruno; Musarò, Andrea; Scoppettuolo, Giancarlo; Pittiruti, Mauro

2014-01-01

The ISP (Safe Insertion of PICCs) protocol: a bundle of 8 recommendations to minimize the complications related to the peripherally inserted central venous catheters (PICC). The insertion of a peripherally inserted central venous catheter (PICC) is not without risks. The Italian Group for the Study of Long-Term Central Venous Access Devices (GAVeCeLT) has developed a protocol (SIP: Safe Implantation of PICCs) with the aim of minimizing the risks which may be associated with the placement of PICCs. The protocol is based on recommendations available in the literature and on the main clinical practice guidelines. The SIP protocol, a bundle of evidence-based recommendations, it is is easy to use, inexpensive, and cost-effective. If routinely used and carefully inplemented, it greatly reduces complications such as failure of venipuncture, accidental arterial puncture, damage of median nerve, infection and catheter related venous thrombosis.

Nuclear reactor removable radial shielding assembly having a self-bowing feature

DOEpatents

Pennell, William E.; Kalinowski, Joseph E.; Waldby, Robert N.; Rylatt, John A.; Swenson, Daniel V.

1978-01-01

A removable radial shielding assembly for use in the periphery of the core of a liquid-metal-cooled fast-breeder reactor, for closing interassembly gaps in the reactor core assembly load plane prior to reactor criticality and power operation to prevent positive reactivity insertion. The assembly has a lower nozzle portion for inserting into the core support and a flexible heat-sensitive bimetallic central spine surrounded by blocks of shielding material. At refueling temperature and below the spine is relaxed and in a vertical position so that the tolerances permitted by the interassembly gaps allow removal and replacement of the various reactor core assemblies. During an increase in reactor temperature from refueling to hot standby, the bimetallic spine expands, bowing the assembly toward the core center line, exerting a radially inward gap-closing-force on the above core load plane of the reactor core assembly, closing load plane interassembly gaps throughout the core prior to startup and preventing positive reactivity insertion.

Evaluating new technology to improve patient outcomes: a quality improvement approach.

PubMed

McMahon, Dorthea D

2002-01-01

The nurses in the peripherally inserted central catheter (PICC) program at the University of Washington Medical Center perform ongoing data tracking to measure team and patient outcomes. Quality improvement initiatives have included the transition to microintroducer technology and ultrasound-guided placement. Used together, this technology has allowed the PICC team to increase their bedside insertion success rate to 91%. The group has also changed PICC securement methods, and use of the Statlock anchoring device has reduced the incidence of catheter migration from 6% to 1.5% of all catheter lines placed. Catheter durability also was assessed. The Pressure Activated Safety Valve PICC was compared to the Groshong PICC and the rate of catheter repair and exchange due to breakage has been reduced from 11% to 1%.

Cross sectional survey of ultrasound use for central venous catheter insertion among resident physicians.

PubMed

Nomura, Jason T; Sierzenski, Paul R; Nace, Jason E; Bollinger, Melissa

2008-07-01

Use of ultrasound guidance for Central Venous Catheter insertion has been associated with decreased complications and increased success rates. Previous reports show low rates of use among physicians. Evaluation of the frequency of Ultrasound Guidance use for Central Venous Catheter insertion among residents at a teaching institution. A cross sectional electronic survey of resident physicians at a tertiary care teaching hospital was conducted to evaluate use of Ultrasound Guidance for Central Venous Catheterization. Assessment included self reported frequency of ultrasound guidance use, and volume of central venous catheter placement. Attitudes toward the use of ultrasound were assessed using Likert scales. There is a high rate. over 90%, of ultrasound guidance use for Internal Jugular central venous catheters among residents. The majority of residents use sterile real-time imaging with a single operator with a reported success rate greater then 80%. Resident use of ultrasound guidance for Internal Jugular central venous catheter insertion can be much higher than previously reported in the literature.

Core Vessel Insert Handling Robot for the Spallation Neutron Source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graves, Van B; Dayton, Michael J

2011-01-01

The Spallation Neutron Source provides the world's most intense pulsed neutron beams for scientific research and industrial development. Its eighteen neutron beam lines will eventually support up to twenty-four simultaneous experiments. Each beam line consists of various optical components which guide the neutrons to a particular instrument. The optical components nearest the neutron moderators are the core vessel inserts. Located approximately 9 m below the high bay floor, these inserts are bolted to the core vessel chamber and are part of the vacuum boundary. They are in a highly radioactive environment and must periodically be replaced. During initial SNS construction,more » four of the beam lines received Core Vessel Insert plugs rather than functional inserts. Remote replacement of the first Core Vessel Insert plug was recently completed using several pieces of custom-designed tooling, including a highly complicated Core Vessel Insert Robot. The design of this tool are discussed.« less

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Changing concepts in long-term central venous access: catheter selection and cost savings.

PubMed

Horattas, M C; Trupiano, J; Hopkins, S; Pasini, D; Martino, C; Murty, A

2001-02-01

Long-term central venous access is becoming an increasingly important component of health care today. Long-term central venous access is important therapeutically for a multitude of reasons, including the administration of chemotherapy, antibiotics, and total parenteral nutrition. Central venous access can be established in a variety of ways varying from catheters inserted at the bedside to surgically placed ports. Furthermore, in an effort to control costs, many traditionally inpatient therapies have moved to an outpatient setting. This raises many questions regarding catheter selection. Which catheter will result in the best outcome at the least cost? It has become apparent in our hospital that traditionally placed surgical catheters (ie, Hickmans and central venous ports) may no longer be the only options. The objective of this study was to explore the various modalities for establishing central venous access comparing indications, costs, and complications to guide the clinician in choosing the appropriate catheter with the best outcome at the least cost. We evaluated our institution's central venous catheter use during a 3-year period from 1995 through 1997. Data was obtained retrospectively through chart review. In addition to demographic data, specific information regarding catheter type, placement technique, indications, complications, and catheter history were recorded. Cost data were obtained from several departments including surgery, radiology, nursing, anesthesia, pharmacy, and the hospital purchasing department. During a 30-month period, 684 attempted central venous catheter insertions were identified, including 126 surgically placed central venous catheters, 264 peripherally inserted central catheters by the nursing service, and 294 radiologically inserted peripheral ports. Overall complications were rare but tended to be more severe in the surgical group. Relative cost differences between the groups were significant. Charges for peripherally inserted central catheters were $401 per procedure, compared with $3870 for radiologically placed peripheral ports and $3532 to $4296 for surgically placed catheters. Traditional surgically placed central catheters are increasingly being replaced by peripherally inserted central venous access devices. Significant cost savings and fewer severe complications can be realized by preferential use of peripherally inserted central catheters when clinically indicated. Cost savings may not be as significant when comparing radiologically placed versus surgically placed catheters. However, significant cost savings and fewer severe complications are associated with peripheral central venous access versus the surgical or radiologic approach.

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

Implementation of a children's hospital-wide central venous catheter insertion and maintenance bundle.

PubMed

Helder, Onno; Kornelisse, René; van der Starre, Cynthia; Tibboel, Dick; Looman, Caspar; Wijnen, René; Poley, Marten; Ista, Erwin

2013-10-14

Central venous catheter-associated bloodstream infections in children are an increasingly recognized serious safety problem worldwide, but are often preventable. Central venous catheter bundles have proved effective to prevent such infections. Successful implementation requires changes in the hospital system as well as in healthcare professionals' behaviour. The aim of the study is to evaluate process and outcome of implementation of a state-of-the-art central venous catheter insertion and maintenance bundle in a large university children's hospital. An interrupted time series design will be used; the study will encompass all children who need a central venous catheter. New state-of-the-art central venous catheter bundles will be developed. The Pronovost-model will guide the implementation process. We developed a tailored multifaceted implementation strategy consisting of reminders, feedback, management support, local opinion leaders, and education. Primary outcome measure is the number of catheter-associated infections per 1000 line-days. The process outcome is degree of adherence to use of these central venous catheter bundles is the secondary outcome. A cost-effectiveness analysis is part of the study. Outcomes will be monitored during three periods: baseline, pre-intervention, and post-intervention for over 48 months. This model-based implementation strategy will reveal the challenges of implementing a hospital-wide safety program. This work will add to the body of knowledge in the field of implementation. We postulate that healthcare workers' willingness to shift from providing habitual care to state-of-the-art care may reflect the need for consistent care improvement. Trial registration: Dutch trials registry, trial # 3635. Dutch trials registry (http://www.trialregister.nl), trial # 3635.

Central venous catheter-associated bloodstream infections in a pediatric intensive care unit: effect of the location of catheter insertion.

PubMed

Krishnaiah, Anil; Soothill, James; Wade, Angie; Mok, Quen Q; Ramnarayan, Padmanabhan

2012-05-01

To compare the rate of central venous catheter-associated bloodstream infections between pediatric intensive care unit admissions where central venous catheters were inserted within the same hospital (internal central venous catheters) and those where central venous catheters were inserted before transfer from other hospitals (external central venous catheters). Retrospective analysis of prospectively collected data. A tertiary care pediatric intensive care unit in London, UK. Consecutive pediatric intensive care unit admissions between May 2007 and March 2009. None. Catheter-associated bloodstream infections were identified using a widely accepted surveillance definition. The rate and time to occurrence of catheter-associated bloodstream infection were compared between internal and external nontunneled central venous catheters. A multilevel Cox-regression model was used to study the association between location of central venous catheter insertion and time to catheter-associated bloodstream infection. In total, 382 central venous catheters were studied (245 internal; 137 external) accounting for a total of 1,737 central venous catheter days. There was a higher catheter-associated bloodstream infection incidence density among external central venous catheters (23.1 [95% confidence interval 11.0-35.2] vs. 9.7 [95% confidence interval 3.9-15.5] per 1,000 catheter-days). Multivariable analyses demonstrated higher infection risk with external central venous catheters (hazard ratio 2.65 [95% confidence interval 1.18-5.96]) despite adjustment for confounding variables. The rate of catheter-associated bloodstream infections in the pediatric intensive care unit is significantly affected by external insertion of the central venous catheter. Future interventions to reduce nosocomial infections on pediatric intensive care units will need to be specifically targeted at this high-risk patient group.

SU-F-J-205: Effect of Cone Beam Factor On Cone Beam CT Number Accuracy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, W; Hua, C; Farr, J

Purpose: To examine the suitability of a Catphan™ 700 phantom for image quality QA of a cone beam computed tomography (CBCT) system deployed for proton therapy. Methods: Catphan phantoms, particularly Catphan™ 504, are commonly used in image quality QA for CBCT. As a newer product, Catphan™ 700 offers more tissue equivalent inserts which may be useful for generating the electron density – CT number curve for CBCT based treatment planning. The sensitometry-and-geometry module used in Catphan™ 700 is located at the end of the phantom and after the resolution line pair module. In Catphan™ 504 the line pair module ismore » located at the end of the phantom and after the sensitometry-and-geometry module. To investigate the effect of difference in location on CT number accuracy due to the cone beam factor, we scanned the Catphan™ 700 with the central plane of CBCT at the center of the phantom, line pair and sensitometry-andgeometry modules of the phantom, respectively. The protocol head and thorax scan modes were used. For each position, scans were repeated 4 times. Results: For the head scan mode, the standard deviation (SD) of the CT numbers of each insert under 4 repeated scans was up to 20 HU, 11 HU, and 11 HU, respectively, for the central plane of CBCT located at the center of the phantom, line pair, and sensitometry-and-geometry modules of the phantom. The mean of the SD was 9.9 HU, 5.7 HU, and 5.9 HU, respectively. For the thorax mode, the mean of the SD was 4.5 HU, 4.4 HU, and 4.4 HU, respectively. The assessment of image quality based on resolution and spatial linearity was not affected by imaging location changes. Conclusion: When the Catphan™ 700 was aligned to the center of imaging region, the CT number accuracy test may not meet expectations. We recommend reconfiguration of the modules.« less

Peripherally inserted central catheter - insertion

MedlinePlus

... ed. Philadelphia, PA: Elsevier Saunders; 2014:chap 26. Smith SF, Duell DJ, Martin BC, Gonzalez L, Aebersold M. Central vascular access devices. In: Smith SF, Duell DJ, Martin BC, Gonzalez L, Aebersold ...

Diamond-anvil high-pressure cell with improved x-ray collimation system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schiferl, D.; Olinger, B.W.; Livingston, R.W.

1986-07-22

This patent describes a diamond-anvil high-pressure cell having a tubular piston and a cylinder in which the piston is slidable to effect compression of a pair of opposed diamonds located between the piston and the cylinder. The piston includes a central bore opening on one end, an adjustable X-ray collimation system comprising a tubular insert engageable in the bore of the piston, the insert including a central bore and having first and second ends, with the first end of the insert being closest to the opposed diamonds and the second end of the insert extending out of the open endmore » of the piston, a collimator insertable in the bore of the tubular insert. The collimator has a central bore and having first and second ends corresponding respectively with the first and second ends of the insert, elastomeric pivot means mounted in the bore of the insert at the first end of the insert for flexibly retaining the first end of the collimator while allowing the collimator to pivot within the pivot means, and adjustable locking means located at the second end of the insert for adjusting and securing the second end of the collimator so as to be in alignment with the opposed diamonds.« less

A Cell Line Producing Recombinant Nerve Growth Factor Evokes Growth Responses in Intrinsic and Grafted Central Cholinergic Neurons

NASA Astrophysics Data System (ADS)

Ernfors, Patrik; Ebendal, Ted; Olson, Lars; Mouton, Peter; Stromberg, Ingrid; Persson, Hakan

1989-06-01

The rat β nerve growth factor (NGF) gene was inserted into a mammalian expression vector and cotransfected with a plasmid conferring resistance to neomycin into mouse 3T3 fibroblasts. From this transfection a stable cell line was selected that contains several hundred copies of the rat NGF gene and produces excess levels of recombinant NGF. Such genetically modified cells were implanted into the rat brain as a probe for in vivo effects of NGF on central nervous system neurons. In a model of the cortical cholinergic deficits in Alzheimer disease, we demonstrate a marked increase in the survival of, and fiber outgrowth from, grafts of fetal basal forebrain cholinergic neurons, as well as stimulation of fiber formation by intact adult intrinsic cholinergic circuits in the cerebral cortex. Adult cholinergic interneurons in intact striatum also sprout vigorously toward implanted fibroblasts. Our results suggest that this model has implications for future treatment of neurodegenerative diseases.

Peripherally inserted central catheters in the neonatal period.

PubMed

Uygun, Ibrahim; Okur, Mehmet Hanifi; Otcu, Selcuk; Ozturk, Hayrettin

2011-10-01

Peripherally inserted central catheters (PICC) have been extensively used in neonates. However, insertion of these thinnest catheters is a very delicate procedure associated with a high failure rate. In our Neonatal Surgical Intensive Care Unit, we developed a very easy new PICC insertion and evaluated the neonates treated with PICCs which were inserted by using our technique as well as catheter features such as success rate, number of insertion attempts, reason for removal and complications. Information was retrospectively collected on all 40 PICCs inserted at Kutahya Evliya Celebi Goverment Hospital and Dicle University Hospital during a 6-years period from September 2004 to September 2010. A total of 40 PICCs were inserted in 37 patients (26, 70% males, 11, 30% females) by using new technique. The median age of patients was 8.3 days (range 1 to 66 days) and the median weight of patients was 2365 g (range 600 to 5000 g). The vein most commonly accessed was long saphenous vein (85%). The length of PICCs in the body was 19.6 cm (range 5 cm to 30 cm). The tip was located in a central vein in all patients. Surgical abdomen was the most common cause for PICC insertion (38%). Duration of catheterization was 7.7±5.6 days (1-F 5.5 days, 2-F 8.6 days). Almost all of the PICCs were inserted successfully (40/42, success rate 95%) and in the first venipucture (36/42, 86%). Completion of therapy and removed after death were achieved with 87% of PICCs. Three minor complications were noted. Minor bleeding in the insertion site which was stopped via compression occurred in two neonates. Major complication was not seen. No deaths were directly attributed to PICCs use. The new insertion technique of the neonatal peripherally inserted central catheters may be one of the easiest and safest techniques, in comparison to previous techniques reported in the literature.

Endovascular Management of Extra-cranial Supra-aortic Vascular Injuries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Almazedi, Bahir, E-mail: b.almazedi@doctors.org.uk; Lyall, Harpreet; Bhatnagar, Priya

Supra-aortic vessel injuries are uncommon but can be life-threatening and surgically challenging. Trauma to these vessels may be blunt or penetrating, including iatrogenic trauma following the insertion of central venous lines, which may be preventable. Recent advances in technology have resulted in endovascular therapy becoming a common first-line treatment, and interventional radiologists now play a major role in the management of these vascular injuries. We review the literature on the endovascular management of these types of injuries and describe a spectrum of case-based extra-cranial supra-aortic vascular injuries managed at our institution and the range of imaging appearances, including active contrast extravasation,more » traumatic vessel occlusion, true aneurysms, pseudoaneurysms, and arteriovenous fistulae.« less

Greece reports prototype intervention with first peripherally inserted central catheter: case report and literature review.

PubMed

Konstantinou, Evangelos A; Stafylarakis, Emmanuil; Kapritsou, Maria; Mitsos, Aristotelis P; Fotis, Theofanis G; Kiekkas, Panagiotis; Mariolis-Sapsakos, Theodoros; Argyras, Eriphyli; Nomikou, Irini Th; Dimitrakopoulos, Antonios

2012-09-01

Placement of peripherally inserted central catheters (PICCs), definitely offers a clear advantage over any other method regarding central venous catheterization. Its ultrasonographic orientation enhances significantly its accuracy, safety and efficacy, making this method extremely comfortable for the patient who can continue his or her therapy even in an outpatient basis. We present the first reported case of a PICCS insertion in Greece, which has been performed by a university-degree nurse. The aim of this review of literature was to present the evolution in nursing practice in Greece. A PICC was inserted in a 77-year-old male patient suffering from a recent chemical pneumonia with a history of Alzheimer's disease. A description of all the technical details of this insertion is reported, focusing on the pros and cons of the method and a thorough review of the history and advances in central venous catheterization throughout the years is also presented. PICCs provide long-term intravenous access and facilitate the delivery of extended antibiotic therapy, chemotherapy and total parenteral nutrition. We strongly believe that PICCs are the safest and most effective method of peripherally inserted central venous catheterization. Larger series are necessary to prove the above hypothesis, and they are under construction by our team. Copyright © 2012 Society for Vascular Nursing, Inc. Published by Mosby, Inc. All rights reserved.

Using a Model of Clinical Events to Determine Supply Requirements for Marine Corps Shock Surgical Team/Triage (SST) and Acute Care Ward Units.

DTIC Science & Technology

1998-06-01

Infusion Blood Products • 248 Force Fluids • • 064 Venous Cutdown • 263 Partial Bath (Assisted) • • 065 Insert Central Venous Lines • 267 Linen Change...which are further complicated by inadequate patient histories , diagnostic tools, and logistic support. Timely and appropriate treatment may...Appropriate Medication • 011 Stabilize Cervical • • 148 Obtain Specimen for Lab Analysis • • 017 Suction (Oral/Trach/Endo) • • 149 Blood Drawing Venous

Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA

PubMed Central

Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary

2013-01-01

Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322

Modeling of Oxygen Transport Across Tumor Multicellular Layers

PubMed Central

Braun, Rod D.; Beatty, Alexis L.

2007-01-01

Purpose Tumor oxygen level plays a major role in the response of tumors to different treatments. The purpose of this study was to develop a method of determining oxygen transport properties in a recently developed 3-D model of tumor parenchyma, the multicellular layer (MCL). Methods OCM-1 human choroidal melanoma cells were grown as 3-D MCL on collagen-coated culture plate inserts. A recessed-cathode oxygen microelectrode was used to measure oxygen tension (PO2) profiles across 8 different MCL from the free surface to the insert membrane. The profiles were fitted to four different one-dimensional diffusion models: 1-, 2-, and 3-region models with uniform oxygen consumption (q) in each region and a modified 3-region model with a central region where q=0 and PO2=0. Results Depending upon the presence of a central region of anoxia, the PO2 profiles were fitted best by either the two-region model or the modified 3-region model. Consumption of tumor cells near the insert membrane was higher than that of cells close to the free surface (33.1 ± 13.6 x 10−4 vs. 11.8 ± 6.7 x 10−4 mm Hg/μm2, respectively). Conclusions The model is useful for determining oxygenation and consumption in MCL, especially for cell lines that cannot be grown as spheroids. In the future, this model will permit the study of parameters important in tumor oxygenation in vitro. PMID:17196225

Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize.

PubMed

Lough, Ashley N; Roark, Leah M; Kato, Akio; Ream, Thomas S; Lamb, Jonathan C; Birchler, James A; Newton, Kathleen J

2008-01-01

Mitochondrial DNA (mtDNA) insertions into nuclear chromosomes have been documented in a number of eukaryotes. We used fluorescence in situ hybridization (FISH) to examine the variation of mtDNA insertions in maize. Twenty overlapping cosmids, representing the 570-kb maize mitochondrial genome, were individually labeled and hybridized to root tip metaphase chromosomes from the B73 inbred line. A minimum of 15 mtDNA insertion sites on nine chromosomes were detectable using this method. One site near the centromere on chromosome arm 9L was identified by a majority of the cosmids. To examine variation in nuclear mitochondrial DNA sequences (NUMTs), a mixture of labeled cosmids was applied to chromosome spreads of ten diverse inbred lines: A188, A632, B37, B73, BMS, KYS, Mo17, Oh43, W22, and W23. The number of detectable NUMTs varied dramatically among the lines. None of the tested inbred lines other than B73 showed the strong hybridization signal on 9L, suggesting that there is a recent mtDNA insertion at this site in B73. Different sources of B73 and W23 were examined for NUMT variation within inbred lines. Differences were detectable, suggesting either that mtDNA is being incorporated or lost from the maize nuclear genome continuously. The results indicate that mtDNA insertions represent a major source of nuclear chromosomal variation.

Lymphatic Leak Complicating Central Venous Catheter Insertion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnacle, Alex M., E-mail: alexbarnacle@yahoo.co.uk; Kleidon, Tricia M.

2005-12-15

Many of the risks associated with central venous access are well recognized. We report a case of inadvertent lymphatic disruption during the insertion of a tunneled central venous catheter in a patient with raised left and right atrial pressures and severe pulmonary hypertension, which led to significant hemodynamic instability. To our knowledge, this rare complication is previously unreported.

Fishtail on a line technique for capsular tension ring insertion.

PubMed

Rixen, Jordan J; Oetting, Thomas A

2014-07-01

We describe a capsular tension ring (CTR) insertion technique that is a modification of the previously described fishtail technique. A suture line is used to pull the leading eyelet out through the main incision to form the fish configuration. Similar to the fishtail technique, this insertion technique minimizes the risk for zonular damage or a capsule tear because the CTR is not dialed into the capsular bag. The advantage of the suture line is that it prevents over bending of the CTR during insertion through the main incision, which can occur using the traditional fishtail technique. Neither author has a financial or proprietary interest in any material or method mentioned. Copyright © 2014 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Central venous catheters: incidence and predictive factors of venous thrombosis.

PubMed

Hammes, Mary; Desai, Amishi; Pasupneti, Shravani; Kress, John; Funaki, Brian; Watson, Sydeaka; Herlitz, Jean; Hines, Jane

2015-07-01

Central venous catheter access in an acute setting can be a challenge given underlying disease and risk for venous thrombosis. Peripherally inserted central venous catheters (PICCs) are commonly placed but limit sites for fistula creation in patients with chronic renal failure (CKD). The aim of this study is to determine the incidence of venous thrombosis from small bore internal jugular (SBIJ) and PICC line placement. This investigation identifies populations of patients who may not be ideal candidates for a PICC and highlights the importance of peripheral vein preservation in patients with renal failure. A venous Doppler ultrasound was performed at the time of SBIJ insertion and removal to evaluate for thrombosis in the internal jugular vein. Data was collected pre- and post-intervention to ascertain if increased vein preservation knowledge amongst the healthcare team led to less use of PICCs. Demographic factors were collected in the SBIJ and PICC groups and risk factor analysis was completed. 1,122 subjects had PICC placement and 23 had SBIJ placement. The incidence of thrombosis in the PICC group was 10%. One patient with an SBIJ had evidence of central vein thrombosis when the catheter was removed. Univariate and multivariate analysis demonstrated a history of transplant, and the indication of total parenteral nutrition was associated with thrombosis (p<0.001). The decrease in PICCs placed in patients with CKD 6 months before and after intervention was significant (p<0.05). There are subsets of patients ith high risk for thrombosis who may not be ideal candidates for a PICC.

The pht4;1-3 mutant line contains a loss of function allele in the Fatty Acid Desaturase 7 gene caused by a remnant inactivated selection marker-a cautionary tale.

PubMed

Nilsson, Anders K; Andersson, Mats X

2017-01-01

A striking and unexpected biochemical phenotype was found in an insertion mutant line in the model plant Arabidopsis thaliana . One of two investigated insertion mutant lines in the gene encoding the phosphate transporter PHT4;1 demonstrated a prominent loss of trienoic fatty acids, whereas the other insertion line was indistinguishable from wild type in this aspect. We demonstrate that the loss of trienoic fatty acids was due to a remnant inactive negative selection marker gene in this particular transposon tagged line, pht4;1-3 . This constitutes a cautionary tale that warns of the importance to confirm the loss of this type of selection markers and the importance of verifying the relationship between a phenotype and genotype by more than one independent mutant line or alternatively genetic complementation.

Surgical management of insertional calcific achilles tendinosis with a central tendon splitting approach.

PubMed

Johnson, Keith W; Zalavras, Charalampos; Thordarson, David B

2006-04-01

Insertional calcific Achilles tendinosis is a painful, frequently disabling condition. Numerous operative approaches for this problem have been described. This study evaluated the outcome of a central tendon splitting approach. Twenty-two patients were evaluated after a central tendon splitting approach for persistent insertional calcific Achilles tendinosis. Followup averaged 34 (11 to 64) months. Suture anchors were routinely used to augment the tendon insertion after debridement. An American Orthopaedic Foot and Ankle Society (AOFAS) hindfoot score, shoewear comfort, and return to work were evaluated. A paired t-test was used to evaluate the results. Pain significantly improved from 7 points preoperatively to 33 points postoperatively (p < 0.001). Function improved significantly from 36 points to 46 points (p < 0.001). The ankle-hindfoot score improved from 53 points to 89 points (p < 0.001). Age older or younger than 50 years did not affect outcome. A central tendon splitting approach yielded good relief of pain with improved function, shoewear, and ability to work without painful postoperative scars.

U. S. Army Medical Research and Development Technical Report

DTIC Science & Technology

1978-09-30

skin preparation prior to cathe- ter insertion, thi- type of catheter care following insertion, and the duration of central venous catheterization . An...NO. 3 A study is now underway to determine the optimal techniques for central venous catheter dressing care. A specially designed dress- ing tray that...chronically maintained male rhesus monkeys with indwelling central venous catheters. Two specific problems were en- countered. (1) Available data

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

PubMed

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

Abdominal paracentesis and thoracocentesis.

PubMed

Lee, Ser Yee; Pormento, James G; Koong, Heng Nung

2009-04-01

Abdominal paracentesis and thoracocentesis are common bedside procedures with diagnostic, therapeutic and palliative roles. We describe a useful and familiar a useful and familiar technique with the use of a multiple lumen catheter commonly used for central venous line insertion for drainage of ascites or moderate to large pleural effusions. The use of a multiple lumen catheter allows easier and more rapid aspiration of fluid with a smaller probability of the side holes being blocked as compared to the standard needle or single catheter methods. This is particularly useful in situations where the dedicated commercial kits for thoracocentesis and abdominal paracentesis are not readily available.

Central vein perforation during tunneled dialysis catheter insertion: principles of acute management.

PubMed

Pua, Uei

2014-10-01

Central venous perforation during dialysis catheter insertion is a potentially fatal complication. Prompt recognition and judicious initial steps are important in optimizing the outcome. The purpose of this manuscript is to illustrate the imaging features and steps in initial management. © 2014 International Society for Hemodialysis.

Percutaneous transfemoral repositioning of malpositioned central venous catheters.

PubMed

Hartnell, G G; Roizental, M

1995-04-01

Central venous catheters inserted by blind surgical placement may not advance into a satisfactory position and may require repositioning. Malpositioning via surgical insertion is common in patients in whom central venous catheters have previously been placed, as these patients are more likely to have central venous thrombosis and distortion of central venous anatomy. This is less of a problem when catheter placement is guided by imaging; however, even when insertion is satisfactory, central venous catheters may become displaced spontaneously after insertion (Fig. 1). Repositioning can be effected by direct manipulation using guidewires or tip-deflecting wires [1, 2], by manipulation via a transfemoral venous approach [3-5], and by injection of contrast material or saline [6]. Limitations of the direct approach include (1) the number and type of maneuvers that can be performed to effect repositioning when anatomy is distorted, (2) difficulty in accessing the catheter, and (3) the risk of introducing infection. Moreover, these patients are often immunosuppressed, and there is a risk of introducing infection by exposing and directly manipulating the venous catheter. Vigorous injection of contrast material or saline may be unsuccessful for the same reasons: It seldom exerts sufficient force to reposition large-caliber central venous catheters and may cause vessel damage or rupture if injection is made into a small or thrombosed vessel. We illustrate several alternative methods for catheter repositioning via a transfemoral venous approach.

Peripherally Inserted Central Catheter Use in Skilled Nursing Facilities: A Pilot Study.

PubMed

Chopra, Vineet; Montoya, Ana; Joshi, Darius; Becker, Carol; Brant, Amy; McGuirk, Helen; Clark, Jordyn; Harrod, Molly; Kuhn, Latoya; Mody, Lona

2015-09-01

To describe patterns of use, care practices, and outcomes related to peripherally inserted central catheter (PICC) use in skilled nursing facilities (SNFs). Prospective cohort study. Two community SNFs. Adult SNF residents with PICCs (N = 56). Information on indication for PICC use, device characteristics (e.g., lumens, gauge), and participant data (comorbidities, medications) were obtained from medical records. Care practices (e.g., frequency of flushing, dressing care) and problems related to PICCs were recorded. Major (central line-associated bloodstream infection, venous thromboembolism, catheter dislodgement) and minor (migration, dressing disruption, lumen occlusion, exit site infection) complications and process measures (flushing of PICC, assessment of necessity) were recorded. Bivariate analyses with t-tests, chi-square tests, or Fischer exact tests were used for continuous and categorical data. Participants were enrolled from two SNFs. The most common indication for PICC use was intravenous antibiotic delivery. The average PICC dwell time was 43 days, and most devices were single-lumen PICCs. Major and minor complications were common and occurred in 11 (20%) and 18 (32%) participants, respectively. Occlusion (23%, n = 13), accidental dislodgement (12%, n = 7), and dressing disruption (11%, n = 6) were the commonest complications observed. Documentation regarding catheter care practices occurred in 41% of cases. Quality improvement efforts that seek to benchmark practice, identify gaps, and institute efforts to improve PICC care and practice in SNFs appear necessary. © 2015, Copyright the Authors Journal compilation © 2015, The American Geriatrics Society.

High-throughput analysis of T-DNA location and structure using sequence capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE PAGES

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

2015-10-07

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

Ultrasound-guided central venous catheterization in cancer patients improves the success rate of cannulation and reduces mechanical complications: A prospective observational study of 1,978 consecutive catheterizations

PubMed Central

2010-01-01

Background A central venous catheter (CVC) currently represents the most frequently adopted intravenous line for patients undergoing infusional chemotherapy and/or high-dose chemotherapy with hematopoietic stem-cell transplantation and parenteral nutrition. CVC insertion represents a risk for pneumothorax, nerve or arterial punctures. The aim of this prospective observational study was to explore the safety and efficacy of CVC insertion under ultrasound (US) guidance and to confirm its utility in clinical practice in cancer patients. Methods Consecutive adult patients attending the oncology-hematology department were eligible if they had solid or hematologic malignancies and required CVC insertion. Four types of possible complication were defined a priore: mechanical, thrombotic, infection and malfunctioning. The patient was placed in Trendelenburg's position, a 7.5 MHZ puncturing US probe was placed in the supraclavicular site and a 16-gauge needle was advanced under real-time US guidance into the last portion of internal jugular vein. The Seldinger technique was used to place the catheter, which was advanced into the superior vena cava until insertion into right atrium. Within two hours after each procedure, an upright chest X-ray and ultrasound scanning were carried out to confirm the CVC position and to rule out a pneumotorax. CVC-related infections, symptomatic vein thrombosis and malfunctioning were recorded. Results From December 2000 to January 2009, 1,978 CVC insertional procedures were applied to 1,660 consecutive patients. The procedure was performed 580 times in patients with hematologic malignancies and 1,398 times those with solid tumors. A single-needle puncture of the vein was performed on 1,948 of 1,978 procedures (98.48%); only eighteen attempts among 1,978 failed (0.9%). No pneumotorax, no major bleeding, and no nerve puncture were reported; four cases (0.2%) showed self-limiting hematomas. The mean lifespan of CVC was 189.7 +/- 18.6 days (range 7-701). Symptomatic deep-vein thrombosis of the upper limbs developed in 48 patients (2.42%). Catheter-related infections occurred in 197 (9.96%) of the catheters inserted. They were successfully treated with antibiotics and only in 48 (2.9%) patients definitive CVC removal was required for infection and/or thrombosis or malfunctioning. Conclusions This study represents the largest published series of consecutive patients with cancer undergoing CVC insertion under US guidance; this procedure allowed the completion of the therapeutic program for 1,930/1,978 (97.6%) of the catheters inserted. The absence of pneumotorax and other major complications indicates that US guidance should be mandatory for CVC insertion in patients with cancer. PMID:20958986

Early cannulation prosthetic graft (Acuseal) for arteriovenous access: a useful option to provide a personal vascular access solution.

PubMed

Aitken, Emma L; Jackson, Andrew J; Kingsmore, David B

2014-01-01

Early cannulation arteriovenous grafts (ecAVGs), such as the GORE Acuseal, have "low bleed" properties permitting cannulation within 24 hours of insertion. They may provide an alternative to tunneled central venous catheters (and associated line complications) in patients requiring urgent vascular access. We present our early experience of 37 patients treated with the GORE Acuseal ecAVG. A total of 11 upper limb, 24 lower limb and 2 complex graft procedures were performed. Indications for ecAVG were as follows: bridge to transplantation (21.6%); bridge to arteriovenous fistula (AVF) maturation (8.1%); AVF salvage (8.1%); no native options (67.6%, including 17 patients with bilateral central vein stenosis); 36 AVGs (97.3%) were successfully cannulated. Mean time to first cannulation: 30.4±23.4 hours (range: 2-192). Primary and secondary patency rates at 3, 6 and 12 months were 64.9%, 48.6%, 32.4% and 70.2%, 59.4%, 40.5% respectively. The systemic bacteremia rate was 0.2 per 1,000 access days. There was one perioperative death. Other complications included hematoma at cannulation sites (n=9), pseudoaneurysm (n=3) and local infection at graft site (n=6). A total of 26 of 37 patients (70.6%) achieved a "personal vascular access solution": bridge to transplantation (n=8), bridge to functioning AVF/interposition AVG (n=5), maintenance hemodialysis via ecAVG (n=13); death with functioning AVG (n=1). Early experience with the GORE Acuseal is encouraging. Patency and bacteremia rates are at least comparable to standard polytetrafluoroethylene grafts. ecAVGs have permitted cannulation within 24 hours of insertion and line avoidance in the majority of patients. Nearly three-quarters of patients achieved a definitive "personal vascular access solution" from their ecAVG.

Integrated mechanism for the generation of the 5′ junctions of LINE inserts

PubMed Central

Yamaguchi, Katsumi; Kajikawa, Masaki; Okada, Norihiro

2014-01-01

To elucidate the molecular mechanism of the integration of long interspersed elements (LINEs), we characterized the 5′ ends of more than 200 LINE de novo retrotransposition events into chicken DT40 or human HeLa cells. Human L1 inserts produced 15-bp target-site duplications (TSDs) and zebrafish ZfL2-1 inserts produced 5-bp TSDs in DT40 cells, suggesting that TSD length depends on the LINE species. Further analysis of 5′ junctions revealed that the 5′-end-joining pathways of LINEs can be divided into two fundamental types—annealing or direct. We also found that the generation of 5′ inversions depends on host and LINE species. These results led us to propose a new model for 5′-end joining, the type of which is determined by the extent of exposure of 3′ overhangs generated after the second-strand cleavage and by the involvement of host factors. PMID:25378331

Integrated mechanism for the generation of the 5' junctions of LINE inserts.

PubMed

Yamaguchi, Katsumi; Kajikawa, Masaki; Okada, Norihiro

2014-12-01

To elucidate the molecular mechanism of the integration of long interspersed elements (LINEs), we characterized the 5' ends of more than 200 LINE de novo retrotransposition events into chicken DT40 or human HeLa cells. Human L1 inserts produced 15-bp target-site duplications (TSDs) and zebrafish ZfL2-1 inserts produced 5-bp TSDs in DT40 cells, suggesting that TSD length depends on the LINE species. Further analysis of 5' junctions revealed that the 5'-end-joining pathways of LINEs can be divided into two fundamental types-annealing or direct. We also found that the generation of 5' inversions depends on host and LINE species. These results led us to propose a new model for 5'-end joining, the type of which is determined by the extent of exposure of 3' overhangs generated after the second-strand cleavage and by the involvement of host factors. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Impact insertion of osteochondral grafts: Interference fit and central graft reduction affect biomechanics and cartilage damage.

PubMed

Su, Alvin W; Chen, Yunchan; Wailes, Dustin H; Wong, Van W; Cai, Shengqiang; Chen, Albert C; Bugbee, William D; Sah, Robert L

2018-01-01

An osteochondral graft (OCG) is an effective treatment for articular cartilage and osteochondral defects. Impact of an OCG during insertion into the osteochondral recipient site (OCR) can cause chondrocyte death and matrix damage. The aim of the present study was to analyze the effects of graft-host interference fit and a modified OCG geometry on OCG insertion biomechanics and cartilage damage. The effects of interference fit (radius of OCG - radius of OCR), loose (0.00 mm), moderate (0.05 mm), tight (0.10 mm), and of a tight fit with OCG geometry modification (central region of decreased radius), were analyzed for OCG cylinders and OCR blocks from adult bovine knee joints with an instrumented drop tower apparatus. An increasingly tight (OCG - OCR) interference fit led to increased taps for insertion, peak axial force, graft cartilage axial compression, cumulative and total energy delivery to cartilage, lower time of peak axial force, lesser graft advancement during each tap, higher total crack length in the cartilage surface, and lower chondrocyte viability. The modified OCG, with reduction of diameter in the central area, altered the biomechanical insertion variables and biological consequences to be similar to those of the moderate interference fit scenario. Micro-computed tomography confirmed structural interference between the OCR bone and both the proximal and distal bone segments of the OCGs, with the central regions being slightly separated for the modified OCGs. These results clarify OCG insertion biomechanics and mechanobiology, and introduce a simple modification of OCGs that facilitates insertion with reduced energy while maintaining a structural interference fit. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:377-386, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Efforts to deregulate Rainbow papaya in Japan: Molecular Characterization of Transgene and Vector Inserts

USDA-ARS?s Scientific Manuscript database

Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...

A review of the nursing role in central venous cannulation: implications for practice policy and research.

PubMed

Alexandrou, Evan; Spencer, Timothy R; Frost, Steve A; Parr, Michael J A; Davidson, Patricia M; Hillman, Kenneth M

2010-06-01

The aim of this article is to review published studies about central vein cannulation to identify implications for policy, practice and research in an advanced practice nursing role. Modified integrative literature review. Searches of the electronic databases: Cumulative Index of Nursing and Allied Health Literature (CINAHL); Medline, Embase, and the World Wide Web were undertaken using MeSH key words. Hand searching for relevant articles was also undertaken. All studies relating to the nurses role inserting central venous cannulae in adult populations met the search criteria and were reviewed by three authors using a critical appraisal tool. Ten studies met the inclusion criteria for the review, all reported data were from the UK. There were disparate models of service delivery and study populations and the studies were predominantly non experimental in design. The results of this review need to be considered within the methodological caveats associated with this approach. The studies identified did not demonstrate differences in rates of adverse events between a specialist nurse and a medical officer. There were only a small number of studies found in the literature review and the limited availability of clinical outcome data precluded formal analysis from being generated. Central vein cannulation is potentially an emerging practice area with important considerations for policy practice and research. Training specialist nurses to provide such a service may facilitate standardising of practice and improving surveillance of lines, and possibly improve the training and accreditation process for CVC insertions for junior medical officers. For this to occur, there is a need to undertake well-conducted clinical studies to clearly document the value and efficacy of this advanced practice nursing role.

Right Site, Wrong Route - Cannulating the Left Internal Jugular Vein.

PubMed

Paik, Peter; Arukala, Sanjay K; Sule, Anupam A

2018-01-09

Central venous catheters are placed in approximately five million patients annually in the US. The preferred site of insertion is one with fewer risks and easier access. Although the right internal jugular vein is preferred, on occasion, the left internal jugular may have to be accessed. A patient was admitted for septic shock, cerebrovascular accident, and non-ST-segment elevation myocardial infarction. A central venous line was needed for antibiotic and vasopressor administration. Due to trauma from a fall to the right side and previously failed catheterization attempts at the left subclavian and femoral veins, the left internal jugular vein was accessed. On chest radiography for confirmation, the left internal jugular central venous catheter was seen projecting down the left paraspinal region. It did not take the expected course across the midline toward the right and into the superior vena cava (SVC). A review of a computed tomography (CT) scan of the chest with contrast done on a prior admission revealed a duplicated SVC on the left side that had not been reported in the original CT scan interpretation. A left-sided SVC is present in approximately 0.3% to 0.5% of the population, with 90% of these draining into the coronary sinus. During placements of central venous lines and pacemakers, irritation of the coronary sinus may result in hypotension, arrhythmia, myocardial ischemia, or cardiac arrest. A widened mediastinum can be an indication of a duplicated SVC. When attempting a left internal jugular vein central venous catheter placement, it is important to be aware of venous anomalies in order to prevent complications.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Prevention of Device-Related Healthcare-Associated Infections

PubMed Central

Septimus, Edward J.; Moody, Julia

2016-01-01

Healthcare-associated infections (HAIs) are a leading cause of morbidity and mortality in hospitalized patients. Up to 15% of patients develop an infection while hospitalized in the United States, which accounts for approximately 1.7 million HAIs, 99,000 deaths annually and over 10 billion dollars in costs per year. A significant percentage of HAIs are preventable using evidenced-based strategies. In terms of device-related HAIs it is estimated that 65-70% of catheter-line associated bloodstream infections (CLABSIs) and catheter-associated urinary tract infections (CAUTIs) are preventable. To prevent CLABSIs a bundle which includes hand hygiene prior to insertion and catheter manipulation, use of chlorhexidene alcohol for site preparation and maintenance, use of maximum barrier for catheter insertion, site selection, removing nonessential lines, disinfect catheter hubs before assessing line, and dressing changes are essential elements of basic practices. To prevent CAUTIs a bundle that includes hand hygiene for insertion and catheter or bag manipulation, inserting catheters for appropriate indications, insert using aseptic technique, remove catheters when no longer needed, maintain a close system keeping bag and tubing below the bladder are the key components of basic practices. PMID:26918162

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

Inserting Phase Change Lines into Microsoft Excel® Graphs.

PubMed

Dubuque, Erick M

2015-10-01

Microsoft Excel® is a popular graphing tool used by behavior analysts to visually display data. However, this program is not always friendly to the graphing conventions used by behavior analysts. For example, adding phase change lines has typically been a cumbersome process involving the insertion of line objects that do not move when new data is added to a graph. The purpose of this article is to describe a novel way to add phase change lines that move when new data is added and when graphs are resized.

Use of electronic medical record-enhanced checklist and electronic dashboard to decrease CLABSIs.

PubMed

Pageler, Natalie M; Longhurst, Christopher A; Wood, Matthew; Cornfield, David N; Suermondt, Jaap; Sharek, Paul J; Franzon, Deborah

2014-03-01

We hypothesized that a checklist enhanced by the electronic medical record and a unit-wide dashboard would improve compliance with an evidence-based, pediatric-specific catheter care bundle and decrease central line-associated bloodstream infections (CLABSI). We performed a cohort study with historical controls that included all patients with a central venous catheter in a 24-bed PICU in an academic children's hospital. Postintervention CLABSI rates, compliance with bundle elements, and staff perceptions of communication were evaluated and compared with preintervention data. CLABSI rates decreased from 2.6 CLABSIs per 1000 line-days before intervention to 0.7 CLABSIs per 1000 line-days after intervention. Analysis of specific bundle elements demonstrated increased daily documentation of line necessity from 30% to 73% (P < .001), increased compliance with dressing changes from 87% to 90% (P = .003), increased compliance with cap changes from 87% to 93% (P < .001), increased compliance with port needle changes from 69% to 95% (P < .001), but decreased compliance with insertion bundle documentation from 67% to 62% (P = .001). Changes in the care plan were made during review of the electronic medical record checklist on 39% of patient rounds episodes. Use of an electronic medical record-enhanced CLABSI prevention checklist coupled with a unit-wide real-time display of adherence was associated with increased compliance with evidence-based catheter care and sustained decrease in CLABSI rates. These data underscore the potential for computerized interventions to promote compliance with proven best practices and prevent patient harm.

The impact of antibiotic impregnated PICC lines on the incidence of bacteremia in a regional burn center.

PubMed

Armstrong, Shannon D; Thomas, Wendy; Neaman, Keith C; Ford, Ronald D; Paulson, Jayne

2013-06-01

Peripherally inserted central catheters (PICCs) have been used increasingly in burn patients who often have decreased intravascular volumes and obtaining intravascular access for resuscitative efforts can be difficult. A potentially serious complication is bloodstream infection. The purpose of our study is to examine the impact of antibiotic impregnated PICC lines on the bacteremia rate in a regional burn center. Consecutive patients admitted to the burn unit and receiving an antibiotic impregnated PICC line were included in the study. Baseline demographics and bacteremia rate was recorded. A retrospective chart review was then undertaken of the 30 consecutive patients admitted to the burn unit and receiving a PICC line prior to the study period. Nineteen patients were enrolled over the two-year period. The bacteremia rate for the study group was 0% compared to the 50% bacteremia rate of the retrospective control group (p=<0.001). Antibiotic impregnated PICC lines decrease the bacteremia rate in our burn population. This has potential benefits for both patient morbidity and mortality as well as potential cost savings for the healthcare system. Copyright © 2012 Elsevier Ltd and ISBI. All rights reserved.

Tiny patients, tiny dressings: a guide to the neonatal PICC dressing change.

PubMed

Sharpe, Elizabeth L

2008-06-01

Advances in neonatology now support the survival of the tiniest of infants. The peripherally inserted central catheter (PICC) has now become an integral part of routine practice in neonatal intensive care units around the world. Keen attention to safe maintenance of these devices is essential. A properly applied and maintained PICC dressing is the first line of defense to minimize the risk of complications such as dislodgement, migration, and infection. This article describes a neonatal PICC dressing change and discusses the frequently encountered quandaries surrounding this important procedure, including dressing materials, frequency, site preparation, barrier precautions, and other relevant concerns.

Selection of early-occurring mutations dictates hormone-independent progression in mouse mammary tumor lines.

PubMed

Gattelli, Albana; Zimberlin, María N; Meiss, Roberto P; Castilla, Lucio H; Kordon, Edith C

2006-11-01

Mice harboring three mouse mammary tumor virus (MMTV) variants develop pregnancy-dependent (PD) tumors that progress to pregnancy-independent (PI) behavior through successive passages. Herein, we identified 10 predominant insertions in PI transplants from 8 independent tumor lines. These mutations were also detected in small cell populations in the early PD passages. In addition, we identified a new viral insertion upstream of the gene Rspo3, which is overexpressed in three of the eight independent tumor lines and codes for a protein very similar to the recently described protein encoded by Int7. This study suggests that during progression towards hormone independence, clonal expansion of cells with specific mutations might be more relevant than the occurrence of new MMTV insertions.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Long anterior zonules and pigment dispersion.

PubMed

Moroi, Sayoko E; Lark, Kurt K; Sieving, Paul A; Nouri-Mahdavi, Kouros; Schlötzer-Schrehardt, Ursula; Katz, Gregory J; Ritch, Robert

2003-12-01

To describe pigment dispersion associated with long anterior zonules. Multicenter observational case series. Fifteen patients, seven of whom were treated for glaucoma or ocular hypertension, were identified with long anterior zonules and pigment dispersion. Transmission electron microscopy was performed on one anterior capsule specimen. All patients had anterior zonules that inserted centrally on the lens capsule. Signs of pigment dispersion included corneal endothelial pigmentation, loss of the pupillary ruff, and variable trabecular meshwork pigmentation. Ultrasound biomicroscopy verified the lack of posterior iris insertion and concavity. There was no exfoliation material. Transmission electron microscopy showed zonular lamellae with adherent pigment granules, and no exfoliation material. Long anterior zonules inserted onto the central lens capsule may cause mechanical disruption of the pigment epithelium at the pupillary ruff and central iris leading to pigment dispersion.

[Teaching design of mastering scalp acupuncture fast].

PubMed

Li, Jie; Niu, Wenmin

2016-05-01

Scalp acupuncture is a method of treating whole-body diseases. The author takes the easy positioning of scalp acupuncture as starting point, covers the positioning of scalp acupuncture and needle insertion points, acupuncture manipulation and the selection of acupoints, so as to introduce the design of teaching the international standardized scalp acupuncture with texts and illustrations. The positions of scalp acupuncture are 4 lines in frontal area, 5 lines in parietal area, 2 lines in temporal area and 3 lines in occipital area. The needle insertion angle is 30° to the skin. Acupoints can be selected crossly and correspondingly in clinic.

Half-BPS Wilson loop and AdS 2/CFT 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giombi, Simone; Roiban, Radu; Tseytlin, Arkady A.

Here, we study correlation functions of local operator insertions on the 1/2-BPS Wilson line in N=4 super Yang–Mills theory. These correlation functions are constrained by the 1d superconformal symmetry pre-served by the 1/2-BPS Wilson line and define a defect CFT 1 living on the line. At strong coupling, a set of elementary operator insertions with protected scaling dimensions correspond to fluctuations of the dual fundamental string in AdS 5×S 5 ending on the line at the boundary and can be thought of as light fields propagating on the AdS 2 worldsheet. We use AdS/CFT techniques to compute the tree-level AdSmore » 2 Witten diagrams describing the strong coupling limit of the four-point functions of the dual operator insertions. Using the OPE, we also extract the leading strong coupling corrections to the anomalous dimensions of the “two-particle” operators built out of elementary excitations. In the case of the circular Wilson loop, we match our results for the 4-point functions of a special type of scalar insertions to the prediction of localization to 2d Yang–Mills theory.« less

Half-BPS Wilson loop and AdS 2/CFT 1

DOE PAGES

Giombi, Simone; Roiban, Radu; Tseytlin, Arkady A.

2017-09-01

Here, we study correlation functions of local operator insertions on the 1/2-BPS Wilson line in N=4 super Yang–Mills theory. These correlation functions are constrained by the 1d superconformal symmetry pre-served by the 1/2-BPS Wilson line and define a defect CFT 1 living on the line. At strong coupling, a set of elementary operator insertions with protected scaling dimensions correspond to fluctuations of the dual fundamental string in AdS 5×S 5 ending on the line at the boundary and can be thought of as light fields propagating on the AdS 2 worldsheet. We use AdS/CFT techniques to compute the tree-level AdSmore » 2 Witten diagrams describing the strong coupling limit of the four-point functions of the dual operator insertions. Using the OPE, we also extract the leading strong coupling corrections to the anomalous dimensions of the “two-particle” operators built out of elementary excitations. In the case of the circular Wilson loop, we match our results for the 4-point functions of a special type of scalar insertions to the prediction of localization to 2d Yang–Mills theory.« less

Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

PubMed

Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

2014-03-14

Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

Corrections to hyperfine splitting and Lamb shift induced by diagrams with second order radiative insertions in the electron line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eides, M.I.; Karshenboim, S.G.; Shelyuto, V.A.

1994-12-31

Contributions to HFS and to the Lamb shift intervals of order a{sup 2}(Za){sup 5} induced by gauge invariant set of nineteen topologically different graphs with two radiative photons inserted in the electron line are considered. Corrections both to HFS and Lamb shift induced by nine diagrams are calculated in the Fried-Yennie gauge.

Evaluation of cost-effectiveness from the funding body's point of view of ultrasound-guided central venous catheter insertion compared with the conventional technique.

PubMed

Noritomi, Danilo Teixeira; Zigaib, Rogério; Ranzani, Otavio T; Teich, Vanessa

2016-01-01

To evaluate the cost-effectiveness, from the funding body's point of view, of real-time ultrasound-guided central venous catheter insertion compared to the traditional method, which is based on the external anatomical landmark technique. A theoretical simulation based on international literature data was applied to the Brazilian context, i.e., the Unified Health System (Sistema Único de Saúde - SUS). A decision tree was constructed that showed the two central venous catheter insertion techniques: real-time ultrasonography versus external anatomical landmarks. The probabilities of failure and complications were extracted from a search on the PubMed and Embase databases, and values associated with the procedure and with complications were taken from market research and the Department of Information Technology of the Unified Health System (DATASUS). Each central venous catheter insertion alternative had a cost that could be calculated by following each of the possible paths on the decision tree. The incremental cost-effectiveness ratio was calculated by dividing the mean incremental cost of real-time ultrasound compared to the external anatomical landmark technique by the mean incremental benefit, in terms of avoided complications. When considering the incorporation of real-time ultrasound and the concomitant lower cost due to the reduced number of complications, the decision tree revealed a final mean cost for the external anatomical landmark technique of 262.27 Brazilian reals (R$) and for real-time ultrasound of R$187.94. The final incremental cost of the real-time ultrasound-guided technique was -R$74.33 per central venous catheter. The incremental cost-effectiveness ratio was -R$2,494.34 due to the pneumothorax avoided. Real-time ultrasound-guided central venous catheter insertion was associated with decreased failure and complication rates and hypothetically reduced costs from the view of the funding body, which in this case was the SUS.

Pes anserinus and anserine bursa: anatomical study

PubMed Central

Lee, Je-Hun; Kim, Kyung-Jin; Jeong, Young-Gil; Lee, Nam Seob; Han, Seung Yun; Lee, Chang Gug; Kim, Kyung-Yong

2014-01-01

This study investigated the boundary of anserine bursa with the recommended injection site and shape on the insertion area of pes anserinus (PA), with the aim of improving clinical practice. Eighty six legs from 45 Korean cadavers were investigated. The mixed gelatin solution was injected to identify the shape of anserine bursa, and then the insertion site of the PA tendons was exposed completely and carefully dissected to identify the shape of the PA. The sartorius was inserted into the superficial layer and gracilis, and the semitendinosus was inserted into the deep layer on the medial surface of the tibia. The number of the semitendinosus tendons at the insertion site varied: 1 in 66% of specimens, 2 in 31%, and 3 in 3%. The gracilis and semitendinosus tendons were connected to the deep fascia of leg. Overall, the shape of the anserine bursa was irregularly circular. Most of the anserine bursa specimens reached the proximal line of the tibia, and some of the specimens reached above the proximal line of the tibia. In the medial view of the tibia, the anserine bursa was located posteriorly and superiorly from the tibia's midline, and it followed the lines of the sartorius muscle. The injection site for anserine bursa should be carried out at 20° from the vertical line medially and inferiorly, 15 or 20 mm deeply, and at the point of about 20 mm medial and 12 mm superior from inferomedial point of tibial tuberosity. PMID:24987549

Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.

PubMed

d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P

2003-04-01

The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.

The Barriers and Facilitators to Transfer of Ultrasound-Guided Central Venous Line Skills From Simulation to Practice: Exploring Perceptions of Learners and Supervisors.

PubMed

Mema, Briseida; Harris, Ilene

2016-01-01

PHENOMENON: Ultrasound-guided central venous line insertion is currently the standard of care. Randomized controlled trials and systematic reviews show that simulation is superior to apprenticeship training. The purpose of this study is to explore, from the perspectives of participants in a simulation-training program, the factors that help or hinder the transfer of skills from simulation to practice. Purposeful sampling was used to select and study the experience and perspective of novice fellows after they had completed simulation training and then performed ultrasound-guided central venous line in practice. Seven novice pediatric intensive care unit fellows and six supervising faculty in a university-affiliated academic center in a large urban city were recruited between September 2012 and January 2013. We conducted a qualitative study using semistructured interviews as our data source, employing a constructivist, grounded theory methodology. Both curricular and real-life factors influence the transfer of skills from simulation to practice and the overall performance of trainees. Clear instructions, the opportunity to practice to mastery, one-on-one observation with feedback, supervision, and further real-life experiences were perceived as factors that facilitated the transfer of skills. Concern for patient welfare, live trouble shooting, complexity of the intensive care unit environment, and the procedure itself were perceived as real-life factors that hindered the transfer of skills. Insights: As more studies confirm the superiority of simulation training versus apprenticeship training for initial student learning, the faculty should gain insight into factors that facilitate and hinder the transfer of skills from simulation to bedside settings and impact learners' performances. As simulation further augments clinical learning, efforts should be made to modify the curricular and bedside factors that facilitate transfer of skills from simulation to practice settings.

Effects of Single P-Element Insertions on Bristle Number and Viability in Drosophila Melanogaster

PubMed Central

Lyman, R. F.; Lawrence, F.; Nuzhdin, S. V.; Mackay, TFC.

1996-01-01

Single P-element mutagenesis was used to construct 1094 lines with P[lArB] inserts on all three major chromosomes in an isogenic background previously free of P elements. The effects of insertions on bristle number and on viability were assessed by comparison to 392 control lines. The variance and effects of P-element inserts on bristle number and viability were larger than those inferred from spontaneous mutations. The distributions of effects on bristle number were symmetrical and highly leptokurtic, such that a few inserts with large effects caused most of the increase in variance. The distribution of effects on viability were negatively skewed and platykurtic. On average, the effects of P-element insertions on bristle number were partly recessive and on viability were completely recessive. P-element inserts with large effects on bristle number tended to have reduced viability, but the correlation between the absolute value of the effects on bristle number and on viability was not strong. Fifty P-element inserts tagging quantitative trait loci (QTLs) with large effects on bristle number were mapped cytogenetically. Two P-element-induced scabrous alleles and five extramacrochaetae alleles were generated. Single P-element mutagenesis is a powerful method for identifying QTLs at the level of genetic locus. PMID:8722781

Effects of single P-element insertions on bristle number and viability in Drosophila melanogaster.

PubMed

Lyman, R F; Lawrence, F; Nuzhdin, S V; Mackay, T F

1996-05-01

Single P-element mutagenesis was used to construct 1094 lines with P[lArB] inserts on all three major chromosomes in an isogenic background previously free of P elements. The effects of insertions on bristle number and on viability were assessed by comparison to 392 control lines. The variance and effects of P-element inserts on bristle number and viability were larger than those inferred from spontaneous mutations. The distributions of effects on bristle number were symmetrical and highly leptokurtic, such that a few inserts with large effects caused most of the increase in variance. The distribution of effects on viability were negatively skewed and platykurtic. On average, the effects of P-element insertions on bristle number were partly recessive and on viability were completely recessive. P-element inserts with large effects on bristle number tended to have reduced viability, but the correlation between the absolute value of the effects on bristle number and on viability was not strong. Fifty P-element inserts tagging quantitative trait loci (QTLs) with large effects on bristle number were mapped cytogenetically. Two P-element-induced scabrous alleles and five extramacrochaetae alleles were generated. Single P-element mutagenesis is a powerful method for identifying QTLs at the level of genetic locus.

Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

PubMed

Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

2001-08-01

Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

A new species of Astyanax (Characiformes: Characidae) from Costa Rica and Panama, with a key to the lower Central American species of the genus.

PubMed

Angulo, A; Santos, A C; López, M; Langeani, F; Mcmahan, C D

2018-06-01

Astyanax anai, a new species of characid fish, is described from the Sixaola River basin, eastern Costa Rica-western Panama, Central America. The new species can be distinguished from all other congeners by the following combination of characters: premaxillary teeth 4-5 at the inner series and 4-6 at the outer series; maxillary teeth tricuspid, 2-4; predorsal scale series irregular and incomplete, with an unscaled space behind tip of supraoccipital process and 12-14 scales; lateral line scales 34-39; humeral region with a conspicuous black and rounded to horizontally ovate spot and two diffuse brown and vertically elongate bars (the first through the rounded to horizontally ovate spot, the second 2-4 scales behind the first); body depth 36·6-42·3% of standard length (L S ); midlateral stripe formed by a series of 10-14 anteriorly-directed dermal herringbone, or chevron-shaped, marks, most apparent in juveniles and in preserved specimens, extending above the lateral line from the black humeral spot or just behind it (from the second vertical bar) to the caudal peduncle; scale rows from lateral line to base of first dorsal-fin ray 8-9; scale rows from lateral line to base of pelvic fin 7-8; pre-anal distance 53·9-61·9% of L S ; total anal-fin elements 29-33; caudal spot elongated, rhomboid or rectangular, with its anterior margin surpassing the middle of the caudal peduncle, usually reaching the anal-fin insertion, posteriorly covering 4-7 principal caudal-fin rays and not extending onto the ventral and dorsal margins of the caudal peduncle, covering 3-5 horizontal scale rows. In order to test the phylogenetic relationships of the new taxon in relation to the other North and Central American species of the genus, a new phylogenetic hypothesis based on a reanalysis of the morphological matrix by Schmitter-Soto (2016) is proposed. A key to the lower Central American (southern Nicaragua to eastern Panama) species of Astyanax is also provided. © 2018 The Fisheries Society of the British Isles.

[Unilateral pleural effusion caused by vessel perforation due to peripherally inserted central catheter: Indocyanine green as a diagnostic tool].

PubMed

Álvarez-Baena, L; Duque, P; Ramos, R; Zarain Obrador, L; Fernández-Quero, L

2016-01-01

A peripherally inserted central catheter (PICC) was inserted into a 44-year-old man to provide parenteral nutrition in a protein-calorie malnutrition secondary to a benign pyloric stenosis. On the fifth day while monitoring the catheter, the patient presented with a massive whitish pleural effusion after undergoing gastric endoscopy in order to treat pyloric stenosis. Chylothorax was initially suspected, and the patient was admitted to a recovery unit. Indocyanine green was administered through the PICC, obtaining a greenish discoloration in the pleural effusion 30 min later. This led to the diagnosis of a pleural effusion caused by a vessel perforation due to the PICC, leading to parenteral nutrition extravasation. Thoraco-abdominal computed tomography was performed, which confirmed an innominate vein perforation due to the PICC. PICC insertion may be associated with severe complications, such as central vessel perforation, and therefore the correct position of a central catheter should be always checked. Intravenous computed tomography contrast is the gold standard for central vascular perforation diagnosis. However if a pleural effusion occurs in this context, it is possible to use a dye, which administered intravenously can lead us to the correct diagnosis in situ. Indocyanine green was used for this purpose in this case. Copyright © 2015 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

Does a conservative tibial cut in conventional total knee arthroplasty violate the deep medial collateral ligament?

PubMed

Maes, Michael; Luyckx, Thomas; Bellemans, Johan

2014-11-01

Based on the anatomy of the deep medial collateral ligament (MCL), it was hypothesized that at least part of its cross-sectional insertion area is jeopardized while performing a standard tibial cut in conventional total knee arthroplasty (TKA). The aim of this study was to determine whether it is anatomically possible to preserve the tibial deep MCL insertion during conventional TKA. Thirty-three unpaired cadaveric knee specimens were used for this study. Knees with severe varus/valgus deformity or damage to the medial structures of the knee were excluded. In the first part of the study, the dimensions of the tibial insertion of the deep MCL and its relationship to the joint line were recorded. Next, the cross-sectional area of the deep MCL insertion was determined using calibrated digital photographic analysis. In the second part, the effect of a standard 9-mm 3° sloped tibial cut on the structural integrity of the deep MCL cross-sectional insertion area was determined using conventional instrumentation. The proximal border of the deep MCL insertion site on the tibia was located on average 4.7 ± 1.2 mm distally to the joint line. After performing a standard 9-mm 3° sloped tibial cut, on average 54% of the deep MCL insertion area was resected. In 29% of the cases, the deep MCL insertion area was completely excised. The deep MCL cannot routinely be preserved in conventional TKA. The deep MCL insertion is at risk and may be jeopardized in case of a tibial cut 9 mm below the native joint line. As the deep MCL is a distinct medial stabilizer and plays an important role in rotational stability, this may have implications in future designs of both unicondylar and total knee arthroplasty, but further research is necessary.

Procedural and educational interventions to reduce ventilator-associated pneumonia rate and central line-associated blood stream infection rate.

PubMed

Kellie, Scott P; Scott, Michael J; Cavallazzi, Rodrigo; Wiemken, Tim L; Goss, Linda; Parker, Deanna; Saad, Mohamed

2014-01-01

Implementing best practice guidelines for ventilator-associated pneumonia (VAP) and central line-associated blood stream infection (CLA-BSI) has variable success. Our institution was concerned with high rates of VAP and CLA-BSI. This retrospective study was undertaken to see whether implementation of the below practices would reduce the rates of VAP and CLA-BSI without resorting to more expensive interventions such as subglottic endotracheal (ET) tube suctioning or silver-impregnated ET tubes. We utilized easily collectable data (standardized infection ratios [SIRs]) to rapidly assess whether interventions already in place were successful. This avoided cumbersome data collection and review. Retrospective data review calculated SIRs using National Healthcare Safety Network benchmarks. Rates and SIRs were compared using z tests with P values <.05 considered statistically significant. This data review attempted to examine the impact of education campaigns, staff meetings, in-services, physician checklist, nurse checklist, charge nurse checklist implementation, and chlorhexidine gluconate oral care addition to the VAP bundle. Additionally, central line insertion required nursing supervision, a checklist, and physician signature. The incidence rate of VAP went from 9.88 occurrences/1000 vent days in 2009 to 0 occurrences/1000 vent days in 2010 (P < .001). The CLA-BSI occurrences/1000 line days were 2.86 in 2009 and 0.97 in 2010 (P = .0187). The SIR for VAP was 4.12 in 2009 and 0 in 2010 (P < .001). For CLA-BSI, the SIR was 1.1 in 2009 and 0.37 in 2010 (P = .04). Efforts to improve physician, patient, and staff education, and checklist implementation resulted in a decrease in VAP and CLA-BSI. This study confirms the applicability of best practice guidelines and suggests a benefit to the use of checklists. We utilize a practical approach for examining the success of these changes.

Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

2017-01-01

SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Risk factors for central venous catheter thrombotic complications in children and adolescents with cancer.

PubMed

Revel-Vilk, S; Yacobovich, J; Tamary, H; Goldstein, G; Nemet, S; Weintraub, M; Paltiel, O; Kenet, G

2010-09-01

The use of central venous catheters (CVCs) has greatly improved the quality of care in children with cancer, yet these catheters may cause serious infectious and thrombotic complications. The aim of this prospective registry study was to assess the host and CVC-related risk factors for CVC-created thrombotic complications. Patients undergoing CVC insertion for chemotherapy were followed prospectively for CVC complications. At the time of enrollment, demographic, clinical, and CVC-related data, and family history of thrombosis were collected. Survival and Cox regression analyses were performed. A total of 423 CVCs were inserted into 262 patients for a total of 76,540 catheter days. The incidence of CVC-related deep-vein thrombosis (DVT) was 0.13 per 1000 catheter-days (95% confidence interval [CI], 0.06-0.24). Insertion of peripherally inserted central catheters (PICCs) and insertion in an angiography suite significantly increased the risk of symptomatic CVC-related DVT. The incidence of CVC occlusion was 1.35 per 1000 catheter-days (95% CI, 1.1-1.63). Positive family history of thrombosis significantly increased the risk of CVC occlusion (hazard ratio [HR], 2.16; 95% CI, 1.2-3.8). The CVC-related risk factors were insertion of Hickman catheters, insertion in angiography suite, and proximal-tip location. Patients developing at least 1 episode of both CVC occlusion and infection had an increased risk for developing symptomatic CVC-related DVT (HR, 4.15; 95% CI, 1.2-14.4). Both patient-related and CVC-related factors are associated with higher risk of symptomatic thrombotic complications. These risk factors could be used in the clinical setting and in developing future studies for CVC thromboprophylaxis.

Placement of Intubating Laryngeal Mask Airway Is Easier than Placement of Laryngeal Tube during Manual In-Line Stabilisation of The Neck

PubMed Central

Komatsu, R.; Nagata, O.; Kamata, K.; Yamagata, K.; Sessler, D.I.; Ozaki, M.

2005-01-01

Summary We compared the usefulness of the laryngeal tube (LT) with the intubating laryngeal mask airway (ILMA) in 51 patients whose necks were stabilised by manual in-line traction. After induction of anaesthesia and neuromuscular block, the LT and ILMA were inserted consecutively in a randomised, crossover design. During pressure-controlled ventilation (20 cmH2O inspiratory pressure), we measured insertion attempts, time to establish positive-pressure ventilation, tidal volume, gastric insufflation, and minimum airway pressure at which gas leaked around the cuff. Data were compared using Wilcoxon signed-rank tests; P<0.05 was considered significant. Insertion was more difficult with the LT (successful at first attempt in 16 patients) than with the ILMA (successful at first attempt in 42 patients, P<0.0001). Time required for insertion was longer for the LT (28 [23–35] sec, median [interquartile range]) than the ILMA (20 [15–25] sec, P=0.0009). Tidal volume was less for the LT (440 [290–670] ml) than the ILMA. (630 [440–750] ml, P=0.013). Minimum airway pressure at which gas leak occurred and incidence of gastric insufflation were similar with two devices. In patients whose necks were stabilised with manual in-line traction, insertion of the ILMA was easier and quicker than insertion of the LT and tidal volume was greater with the ILMA than the LT. PMID:15644005

Accuracy of Intravenous Electrocardiography Confirmation of Peripherally Inserted Central Catheter for Parenteral Nutrition.

PubMed

Mundi, Manpreet S; Edakkanambeth Varayil, Jithinraj; McMahon, Megan T; Okano, Akiko; Vallumsetla, Nishanth; Bonnes, Sara L; Andrews, James C; Hurt, Ryan T

2016-04-01

Parenteral nutrition (PN) is a life-saving therapy for patients with intestinal failure. Safe delivery of hyperosmotic solution requires a central venous catheter (CVC) with tip in the lower superior vena cava (SVC) or at the SVC-right atrium (RA) junction. To reduce cost and delay in use of CVC, new techniques such as intravascular electrocardiogram (ECG) are being used for tip confirmation in place of chest x-ray (CXR). The present study assessed for accuracy of ECG confirmation in home PN (HPN). Records for all patients consulted for HPN from December 17, 2014, to June 16, 2015, were reviewed for patient demographics, diagnosis leading to HPN initiation, and ECG and CXR confirmation. CXRs were subsequently reviewed by a radiologist to reassess location of the CVC tip and identify those that should be adjusted. Seventy-three patients were eligible, and after assessment for research authorization and postplacement CXR, 17 patients (30% male) with an age of 54 ± 14 years were reviewed. In all patients, postplacement intravascular ECG reading stated tip in the SVC. However, based on CXR, the location of the catheter tip was satisfactory (low SVC or SVC-RA junction) in 10 of 17 patients (59%). Due to the high osmolality of PN, CVC tip location is of paramount importance. After radiology review of CXR, we noted that 7 of 17 (41%) peripherally inserted central catheter lines were in an unsatisfactory position despite ECG confirmation. With current data available, intravenous ECG confirmation should not be used as the sole source of tip confirmation in patients receiving HPN. © 2016 American Society for Parenteral and Enteral Nutrition.

CLABSI Conversations: Lessons From Peer-to-Peer Assessments to Reduce Central Line-Associated Bloodstream Infections.

PubMed

Pham, Julius Cuong; Goeschel, Christine A; Berenholtz, Sean M; Demski, Renee; Lubomski, Lisa H; Rosen, Michael A; Sawyer, Melinda D; Thompson, David A; Trexler, Polly; Weaver, Sallie J; Weeks, Kristina R; Pronovost, Peter J

2016-01-01

A national collaborative helped many hospitals dramatically reduce central line-associated bloodstream infections (CLABSIs), but some hospitals struggled to reduce infection rates. This article describes the development of a peer-to-peer assessment process (CLABSI Conversations) and the practical, actionable practices we discovered that helped intensive care unit teams achieve a CLABSI rate of less than 1 infection per 1000 catheter-days for at least 1 year. CLABSI Conversations was designed as a learning-oriented process, in which a team of peers visited hospitals to surface barriers to infection prevention and to share best practices and insights from successful intensive care units. Common practices led to 10 recommendations: executive and board leaders communicate the goal of zero CLABSI throughout the hospital; senior and unit-level leaders hold themselves accountable for CLABSI rates; unit physicians and nurse leaders own the problem; clinical leaders and infection preventionists build infection prevention training and simulation programs; infection preventionists participate in unit-based CLABSI reduction efforts; hospital managers make compliance with best practices easy; clinical leaders standardize the hospital's catheter insertion and maintenance practices and empower nurses to stop any potentially harmful acts; unit leaders and infection preventionists investigate CLABSIs to identify root causes; and unit nurses and staff audit catheter maintenance policies and practices.

Generation of transgenic papaya with double resistance to Papaya ringspot virus and Papaya leaf-distortion mosaic virus.

PubMed

Kung, Yi-Jung; Bau, Huey-Jiunn; Wu, Yi-Ling; Huang, Chiung-Huei; Chen, Tsui-Miao; Yeh, Shyi-Dong

2009-11-01

During the field tests of coat protein (CP)-transgenic papaya lines resistant to Papaya ringspot virus (PRSV), another Potyvirus sp., Papaya leaf-distortion mosaic virus (PLDMV), appeared as an emerging threat to the transgenic papaya. In this investigation, an untranslatable chimeric construct containing the truncated CP coding region of the PLDMV P-TW-WF isolate and the truncated CP coding region with the complete 3' untranslated region of PRSV YK isolate was transferred into papaya (Carica papaya cv. Thailand) via Agrobacterium-mediated transformation to generate transgenic plants with resistance to PLDMV and PRSV. Seventy-five transgenic lines were obtained and challenged with PRSV YK or PLDMV P-TW-WF by mechanical inoculation under greenhouse conditions. Thirty-eight transgenic lines showing no symptoms 1 month after inoculation were regarded as highly resistant lines. Southern and Northern analyses revealed that four weakly resistant lines have one or two inserts of the construct and accumulate detectable amounts of transgene transcript, whereas nine resistant lines contain two or three inserts without significant accumulation of transgene transcript. The results indicated that double virus resistance in transgenic lines resulted from double or more copies of the insert through the mechanism of RNA-mediated posttranscriptional gene silencing. Furthermore, three of nine resistant lines showed high levels of resistance to heterologous PRSV strains originating from Hawaii, Thailand, and Mexico. Our transgenic lines have great potential for controlling a number of PRSV strains and PLDMV in Taiwan and elsewhere.

Factors Influencing Intracavitary Electrocardiographic P-Wave Changes during Central Venous Catheter Placement

PubMed Central

Wang, Guorong; Guo, Ling; Jiang, Bin; Huang, Min; Zhang, Jian; Qin, Ying

2015-01-01

Amplitude changes in the P-wave of intracavitary electrocardiography have been used to assess the tip placement of central venous catheters. The research assessed the sensitivity and specificity of this sign in comparison with standard radiographic techniques for tip location, focusing on factors influencing its clinical utility. Both intracavitary electrocardiography guided tip location and X-ray positioning were used to verify catheter tip locations in patients undergoing central venous catheter insertion. Intracavitary electrocardiograms from 1119 patients (of a total 1160 subjects) showed specific amplitude changes in the P-wave. As the results show, compared with X-ray positioning, the sensitivity of electrocardiography-guided tip location was 97.3%, with false negative rate of 2.7%; the specificity was 1, with false positive rate of zero. Univariate analyses indicated that features including age, gender, height, body weight, and heart rate have no statistically significant influence on P-wave amplitude changes (P>0.05). Multivariate logistic regression revealed that catheter insertion routes (OR = 2.280, P = 0.003) and basal P-wave amplitude (OR = 0.553, P = 0.003) have statistically significant impacts on P-wave amplitude changes. As a reliable indicator of tip location, amplitude change in the P-wave has proved of good sensitivity and excellent specificity, and the minor, zero, false positive rate supports the clinical utility of this technique in early recognition of malpositioned tips. A better sensitivity was achieved in placement of centrally inserted central catheters (CICCs) than that of peripherally inserted central catheters (PICCs). In clinical practice, a combination of intracavitary electrocardiography, ultrasonic inspection and the anthropometric measurement method would further improve the accuracy. PMID:25915758

Prevention of hospital infections by intervention and training (PROHIBIT): results of a pan-European cluster-randomized multicentre study to reduce central venous catheter-related bloodstream infections.

PubMed

van der Kooi, Tjallie; Sax, Hugo; Pittet, Didier; van Dissel, Jaap; van Benthem, Birgit; Walder, Bernhard; Cartier, Vanessa; Clack, Lauren; de Greeff, Sabine; Wolkewitz, Martin; Hieke, Stefanie; Boshuizen, Hendriek; van de Kassteele, Jan; Van den Abeele, Annemie; Boo, Teck Wee; Diab-Elschahawi, Magda; Dumpis, Uga; Ghita, Camelia; FitzGerald, Susan; Lejko, Tatjana; Leleu, Kris; Martinez, Mercedes Palomar; Paniara, Olga; Patyi, Márta; Schab, Paweł; Raglio, Annibale; Szilágyi, Emese; Ziętkiewicz, Mirosław; Wu, Albert W; Grundmann, Hajo; Zingg, Walter

2018-01-01

To test the effectiveness of a central venous catheter (CVC) insertion strategy and a hand hygiene (HH) improvement strategy to prevent central venous catheter-related bloodstream infections (CRBSI) in European intensive care units (ICUs), measuring both process and outcome indicators. Adult ICUs from 14 hospitals in 11 European countries participated in this stepped-wedge cluster randomised controlled multicentre intervention study. After a 6 month baseline, three hospitals were randomised to one of three interventions every quarter: (1) CVC insertion strategy (CVCi); (2) HH promotion strategy (HHi); and (3) both interventions combined (COMBi). Primary outcome was prospective CRBSI incidence density. Secondary outcomes were a CVC insertion score and HH compliance. Overall 25,348 patients with 35,831 CVCs were included. CRBSI incidence density decreased from 2.4/1000 CVC-days at baseline to 0.9/1000 (p < 0.0001). When adjusted for patient and CVC characteristics all three interventions significantly reduced CRBSI incidence density. When additionally adjusted for the baseline decreasing trend, the HHi and COMBi arms were still effective. CVC insertion scores and HH compliance increased significantly with all three interventions. This study demonstrates that multimodal prevention strategies aiming at improving CVC insertion practice and HH reduce CRBSI in diverse European ICUs. Compliance explained CRBSI reduction and future quality improvement studies should encourage measuring process indicators.

Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster

PubMed Central

Weber, Kenneth; Johnson, Nancy; Champlin, David; Patty, April

2005-01-01

A screen of random, autosomal, homozygous-viable P-element insertions in D. melanogaster found small effects on wing shape in 11 of 50 lines. The effects were due to single insertions and remained stable and significant for over 5 years, in repeated, high-resolution measurements. All 11 insertions were within or near protein-coding transcription units, none of which were previously known to affect wing shape. Many sites in the genome can affect wing shape. PMID:15545659

Many P-element insertions affect wing shape in Drosophila melanogaster.

PubMed

Weber, Kenneth; Johnson, Nancy; Champlin, David; Patty, April

2005-03-01

A screen of random, autosomal, homozygous-viable P-element insertions in D. melanogaster found small effects on wing shape in 11 of 50 lines. The effects were due to single insertions and remained stable and significant for over 5 years, in repeated, high-resolution measurements. All 11 insertions were within or near protein-coding transcription units, none of which were previously known to affect wing shape. Many sites in the genome can affect wing shape.

Complications of silicone stent insertion in patients with expiratory central airway collapse.

PubMed

Murgu, Septimiu D; Colt, Henri G

2007-12-01

Silicone stent insertion is an alternative treatment for expiratory central airway collapse. This study evaluates the complications (mucus plugging, migration, and granulation tissue) associated with stenting in patients who failed medical therapy and were not surgical candidates. Chart review from 15 consecutive patients treated by silicone stent insertion was done over a 2-year period. Outcomes included (1) changes in functional class, extent and severity of airway collapse (graded from 1 to 4 by using a multidimensional system), procedure- and stent-related complications at 48 hours after stent insertion; (2) frequency of stent-related complications; and (3) frequency of emergent flexible and rigid bronchoscopy (scheduled or emergent) over the follow-up period. Mean functional class and severity and extent of airway collapse significantly improved within 48 hours after treatment (p < 0.05). There were no perioperative deaths. Stent-related complications within 48 hours after stent insertion occurred in 3 patients (1 granulation, 1 migration, and 1 mucus plugging). The mean duration of follow-up for the 12 patients who underwent clinical and bronchoscopic follow-up was 188 days. Twenty-six stent-related complications (12 mucus plugs, 8 migrations, and 6 granulation tissues) were seen in 10 of the 12 patients. Five emergent flexible bronchoscopies and 14 rigid bronchoscopies (6 of which were emergent) were performed during the follow-up period. Silicone stent insertion improves functional status immediately after intervention in patients with expiratory central airway collapse, but is associated with a high rate of stent-related complications and need for repeat bronchoscopic interventions.

Characterization of insertion sites in Rainbow papaya, the first commercialized transgenic tree-fruit crop

USDA-ARS?s Scientific Manuscript database

Inserts and insert sites in transgenic, commercial papaya line 55-1 derivatives Rainbow and SunUp were characterized as part of a petition to Japan to allow import of fresh fruit of these cultivars from the U.S. and to provide data for a larger study aimed at understanding the global impact of DNA t...

Central line infections - hospitals

MedlinePlus

... infection; CVC - infection; Central venous device - infection; Infection control - central line infection; Nosocomial infection - central line infection; Hospital acquired infection - central line infection; Patient safety - central ...

Genome-Wide Estimates of Transposable Element Insertion and Deletion Rates in Drosophila Melanogaster

PubMed Central

Adrion, Jeffrey R.; Song, Michael J.; Schrider, Daniel R.; Hahn, Matthew W.

2017-01-01

Abstract Knowing the rate at which transposable elements (TEs) insert and delete is critical for understanding their role in genome evolution. We estimated spontaneous rates of insertion and deletion for all known, active TE superfamilies present in a set of Drosophila melanogaster mutation-accumulation (MA) lines using whole genome sequence data. Our results demonstrate that TE insertions far outpace TE deletions in D. melanogaster. We found a significant effect of background genotype on TE activity, with higher rates of insertions in one MA line. We also found significant rate heterogeneity between the chromosomes, with both insertion and deletion rates elevated on the X relative to the autosomes. Further, we identified significant associations between TE activity and chromatin state, and tested for associations between TE activity and other features of the local genomic environment such as TE content, exon content, GC content, and recombination rate. Our results provide the most detailed assessment of TE mobility in any organism to date, and provide a useful benchmark for both addressing theoretical predictions of TE dynamics and for exploring large-scale patterns of TE movement in D. melanogaster and other species. PMID:28338986

A Conformational Change of the γ Subunit Indirectly Regulates the Activity of Cyanobacterial F1-ATPase*

PubMed Central

Sunamura, Ei-Ichiro; Konno, Hiroki; Imashimizu, Mari; Mochimaru, Mari; Hisabori, Toru

2012-01-01

The central shaft of the catalytic core of ATP synthase, the γ subunit consists of a coiled-coil structure of N- and C-terminal α-helices, and a globular domain. The γ subunit of cyanobacterial and chloroplast ATP synthase has a unique 30–40-amino acid insertion within the globular domain. We recently prepared the insertion-removed α3β3γ complex of cyanobacterial ATP synthase (Sunamura, E., Konno, H., Imashimizu-Kobayashi, M., and Hisabori, T. (2010) Plant Cell Physiol. 51, 855–865). Although the insertion is thought to be located in the periphery of the complex and far from catalytic sites, the mutant complex shows a remarkable increase in ATP hydrolysis activity due to a reduced tendency to lapse into ADP inhibition. We postulated that removal of the insertion affects the activity via a conformational change of two central α-helices in γ. To examine this hypothesis, we prepared a mutant complex that can lock the relative position of two central α-helices to each other by way of a disulfide bond formation. The mutant obtained showed a significant change in ATP hydrolysis activity caused by this restriction. The highly active locked complex was insensitive to N-dimethyldodecylamine-N-oxide, suggesting that the complex is resistant to ADP inhibition. In addition, the lock affected ϵ inhibition. In contrast, the change in activity caused by removal of the γ insertion was independent from the conformational restriction of the central axis component. These results imply that the global conformational change of the γ subunit indirectly regulates complex activity by changing both ADP inhibition and ϵ inhibition. PMID:23012354

Successful Salvage of Central Venous Catheters in Patients with Catheter-Related or Central Line-Associated Bloodstream Infections by Using a Catheter Lock Solution Consisting of Minocycline, EDTA, and 25% Ethanol

PubMed Central

Chaftari, Anne-Marie; Zakhour, Ramia; Jordan, Mary; Al Hamal, Zanaib; Jiang, Ying; Yousif, Ammar; Garoge, Kumait; Mulanovich, Victor; Viola, George M.; Kanj, Soha; Pravinkumar, Egbert; Rosenblatt, Joel; Hachem, Ray

2016-01-01

In cancer patients with long-term central venous catheters (CVC), removal and reinsertion of a new CVC at a different site might be difficult because of the unavailability of accessible vascular sites. In vitro and animal studies showed that a minocycline-EDTA-ethanol (M-EDTA-EtOH) lock solution may eradicate microbial organisms in biofilms, hence enabling the treatment of central line-associated bloodstream infections (CLABSI) while retaining the catheter in situ. Between April 2013 and July 2014, we enrolled 30 patients with CLABSI in a prospective study and compared them to a historical group of 60 patients with CLABSI who had their CVC removed and a new CVC inserted. Each catheter lumen was locked with an M-EDTA-EtOH solution for 2 h administered once daily, for a total of 7 doses. Patients who received locks had clinical characteristics that were comparable to those of the control group. The times to fever resolution and microbiological eradication were similar in the two groups. Patients with the lock intervention received a shorter duration of systemic antibiotic therapy than that of the control patients (median, 11 days versus 16 days, respectively; P < 0.0001), and they were able to retain their CVCs for a median of 74 days after the onset of bacteremia. The M-EDTA-EtOH lock was associated with a significantly decreased rate of mechanical and infectious complications compared to that of the CVC removal/reinsertion group, who received a longer duration of systemic antimicrobial therapy. (This study has been registered at ClinicalTrials.gov under registration no. NCT01539343.) PMID:27001822

A Novel Nonantibiotic Nitroglycerin-Based Catheter Lock Solution for Prevention of Intraluminal Central Venous Catheter Infections in Cancer Patients.

PubMed

Chaftari, Anne-Marie; Hachem, Ray; Szvalb, Ariel; Taremi, Mahnaz; Granwehr, Bruno; Viola, George Michael; Sapna, Amin; Assaf, Andrew; Numan, Yazan; Shah, Pankil; Gasitashvili, Ketevan; Natividad, Elizabeth; Jiang, Ying; Slack, Rebecca; Reitzel, Ruth; Rosenblatt, Joel; Mouhayar, Elie; Raad, Issam

2017-07-01

For long-term central lines (CL), the lumen is the major source of central line-associated bloodstream infections (CLABSI). The current standard of care for maintaining catheter patency includes flushing the CL with saline or heparin. Neither agent has any antimicrobial activity. Furthermore, heparin may enhance staphylococcal biofilm formation. We evaluated the safety and efficacy of a novel nonantibiotic catheter lock solution for the prevention of CLABSI. Between November 2015 and February 2016, we enrolled 60 patients with hematologic malignancies who had peripherally inserted central catheters (PICC) to receive the study lock solution. The study lock consisted of 15 or 30 μg/ml of nitroglycerin in combination with 4% sodium citrate and 22% ethanol. Each lumen was locked for at least 2 h once daily prior to being flushed. After enrollment of 10 patients at the lower nitroglycerin dose without evidence of toxicity, the dose was escalated to the higher dose (30 μg/ml). There were no serious related adverse events or episodes of hypotension with lock administration. Two patients experienced mild transient adverse events (one headache and one rash) possibly related to the lock and that resolved without residual effect. The CLABSI rate was 0 on lock days versus 1.6/1,000 catheter days (CD) off lock prophylaxis, compared with a rate of 1.9/1,000 CD at the institution in the same patient population. In conclusion, the nitroglycerin-based lock prophylaxis is safe and well tolerated. It may prevent CLABSI when given daily to cancer patients. Large, prospective, randomized clinical trials are needed to validate these findings. (This study has been registered at ClinicalTrials.gov under identifier NCT02577718.). Copyright © 2017 American Society for Microbiology.

A Novel Nonantibiotic Nitroglycerin-Based Catheter Lock Solution for Prevention of Intraluminal Central Venous Catheter Infections in Cancer Patients

PubMed Central

Hachem, Ray; Szvalb, Ariel; Taremi, Mahnaz; Granwehr, Bruno; Viola, George Michael; Sapna, Amin; Assaf, Andrew; Numan, Yazan; Shah, Pankil; Gasitashvili, Ketevan; Natividad, Elizabeth; Jiang, Ying; Slack, Rebecca; Reitzel, Ruth; Rosenblatt, Joel; Mouhayar, Elie; Raad, Issam

2017-01-01

ABSTRACT For long-term central lines (CL), the lumen is the major source of central line-associated bloodstream infections (CLABSI). The current standard of care for maintaining catheter patency includes flushing the CL with saline or heparin. Neither agent has any antimicrobial activity. Furthermore, heparin may enhance staphylococcal biofilm formation. We evaluated the safety and efficacy of a novel nonantibiotic catheter lock solution for the prevention of CLABSI. Between November 2015 and February 2016, we enrolled 60 patients with hematologic malignancies who had peripherally inserted central catheters (PICC) to receive the study lock solution. The study lock consisted of 15 or 30 μg/ml of nitroglycerin in combination with 4% sodium citrate and 22% ethanol. Each lumen was locked for at least 2 h once daily prior to being flushed. After enrollment of 10 patients at the lower nitroglycerin dose without evidence of toxicity, the dose was escalated to the higher dose (30 μg/ml). There were no serious related adverse events or episodes of hypotension with lock administration. Two patients experienced mild transient adverse events (one headache and one rash) possibly related to the lock and that resolved without residual effect. The CLABSI rate was 0 on lock days versus 1.6/1,000 catheter days (CD) off lock prophylaxis, compared with a rate of 1.9/1,000 CD at the institution in the same patient population. In conclusion, the nitroglycerin-based lock prophylaxis is safe and well tolerated. It may prevent CLABSI when given daily to cancer patients. Large, prospective, randomized clinical trials are needed to validate these findings. (This study has been registered at ClinicalTrials.gov under identifier NCT02577718.) PMID:28416559

SINE Retrotransposition: Evaluation of Alu Activity and Recovery of De Novo Inserts.

PubMed

Ade, Catherine; Roy-Engel, Astrid M

2016-01-01

Mobile element activity is of great interest due to its impact on genomes. However, the types of mobile elements that inhabit any given genome are remarkably varied. Among the different varieties of mobile elements, the Short Interspersed Elements (SINEs) populate many genomes, including many mammalian species. Although SINEs are parasites of Long Interspersed Elements (LINEs), SINEs have been highly successful in both the primate and rodent genomes. When comparing copy numbers in mammals, SINEs have been vastly more successful than other nonautonomous elements, such as the retropseudogenes and SVA. Interestingly, in the human genome the copy number of Alu (a primate SINE) outnumbers LINE-1 (L1) copies 2 to 1. Estimates suggest that the retrotransposition rate for Alu is tenfold higher than LINE-1 with about 1 insert in every twenty births. Furthermore, Alu-induced mutagenesis is responsible for the majority of the documented instances of human retroelement insertion-induced disease. However, little is known on what contributes to these observed differences between SINEs and LINEs. The development of an assay to monitor SINE retrotransposition in culture has become an important tool for the elucidation of some of these differences. In this chapter, we present details of the SINE retrotransposition assay and the recovery of de novo inserts. We also focus on the nuances that are unique to the SINE assay.

Muscle Insertion Line as a Simple Landmark To Identify the Transverse Sinus When Neuronavigation Is Unavailable.

PubMed

Kivelev, Juri; Kivisaari, Riku; Niemelä, Mika; Hernesniemi, Juha

2016-10-01

Skull opening in occipital and suboccipital regions might be associated with risk of damage to the transverse venous sinus and the confluence of sinuses. We analyze the value of magnetic resonance (MR) imaging in localizing the venous sinuses in relation to the superior muscle insertion line (MIL) on the occipital bone. We retrospectively analyzed head MR images of 100 consecutive patients imaged for any reason from 1 January 2013. All MR images were interpreted by a radiologist (R.K.). The superior MIL was identified at the midline and on both midpupillar lines, which represent the most frequent sites of skin incision and craniotomy (median and lateral suboccipital craniotomy, respectively). Patients comprised 56 women (56%) and 44 men (44%). Their mean age was 54 (range 18-84) years. The muscles of the posterior skull were readily visible and clearly identified in both T1 and T2 images of all patients. Identification of the insertion zone and its relation to the venous structures was most readily made in the sagittal plane. We found that the upper muscle insertion line on occipital bone corresponds to the underlying venous sinus and can be used as a reliable anatomic landmark. We identified it in 100% of preoperative MR images of heads with an intact occiput. Copyright © 2016 Elsevier Inc. All rights reserved.

Molecular Characteristics of the Mycobacterium tuberculosis LAM-RUS Family Prevalent in Central Russia▿ †

PubMed Central

Dubiley, Svetlana; Kirillov, Eugene; Ignatova, Anna; Stepanshina, Valentina; Shemyakin, Igor

2007-01-01

We analyzed IS6110-associated polymorphisms in the phospholipase C genes of 107 isolates of Mycobacterium tuberculosis selected to be representative of isolates circulating in central Russia. We found that the majority of Latin American-Mediterranean family strains contained an insertion in a unique position in the plcA gene, suggesting a common ancestor. This insertion can serve as a specific genetic marker for this group, which we designate the LAM-RUS family. PMID:17942651

Percutaneous pigtail catheter in the treatment of pneumothorax in major burns: the best alternative? Case report and review of literature.

PubMed

Sebastian, Raul; Ghanem, Omar; Diroma, Frank; Milner, Stephen M; Gerold, Kevin B; Price, Leigh A

2015-05-01

Multiple factors place burn patients at a high risk of pneumothorax development. Currently, no specific recommendations for the management of pneumothorax in large total body surface area (TBSA) burn patients exist. We present a case of a major burn patient who developed pneumothorax after central line insertion. After the traditional large bore (24 Fr) chest tube failed to resolve the pneumothorax, the pneumothorax was ultimately managed by a percutaneous placed pigtail catheter thoracostomy placement and resulted in its complete resolution. We will review the current recommendations of pneumothorax treatment and will highlight on the use of pigtail catheters in pneumothorax management in burn patients. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

Extravasation injuries in adults.

PubMed

Al-Benna, S; O'Boyle, C; Holley, J

2013-01-01

Insertion of an intravascular catheter is one of the most common invasive procedures in hospitals worldwide. These intravascular lines are crucial in resuscitation, allow vital medication to be administered, and can be used to monitor the patients' real-time vital parameters. There is, however, growing recognition of potential risks to life and limb associated with their use. Medical literature is now replete with isolated case reports of complications succinctly described by Garden and Laussen (2004) as "An unending supply of "unusual" complications from central venous catheters." This paper reviews complications of venous and arterial catheters and discusses treatment approaches and methods to prevent complications, based on current evidence and endeavours to provide information and guidance that will enable practitioners to prevent, recognise, and successfully treat extravasation injuries in adults.

Ultrasound as a Screening Tool for Central Venous Catheter Positioning and Exclusion of Pneumothorax.

PubMed

Amir, Rabia; Knio, Ziyad O; Mahmood, Feroze; Oren-Grinberg, Achikam; Leibowitz, Akiva; Bose, Ruma; Shaefi, Shahzad; Mitchell, John D; Ahmed, Muneeb; Bardia, Amit; Talmor, Daniel; Matyal, Robina

2017-07-01

Although real-time ultrasound guidance during central venous catheter insertion has become a standard of care, postinsertion chest radiograph remains the gold standard to confirm central venous catheter tip position and rule out associated lung complications like pneumothorax. We hypothesize that a combination of transthoracic echocardiography and lung ultrasound is noninferior to chest radiograph when used to accurately assess central venous catheter positioning and screen for pneumothorax. All operating rooms and surgical and trauma ICUs at the institution. Single-center, prospective noninferiority study. Patients receiving ultrasound-guided subclavian or internal jugular central venous catheters. During ultrasound-guided central venous catheter placement, correct positioning of central venous catheter was accomplished by real-time visualization of the guide wire and positive right atrial swirl sign using the subcostal four-chamber view. After insertion, pneumothorax was ruled out by the presence of lung sliding and seashore sign on M-mode. Data analysis was done for 137 patients. Chest radiograph ruled out pneumothorax in 137 of 137 patients (100%). Lung ultrasound was performed in 123 of 137 patients and successfully screened for pneumothorax in 123 of 123 (100%). Chest radiograph approximated accurate catheter tip position in 136 of 137 patients (99.3%). Adequate subcostal four-chamber views could not be obtained in 13 patients. Accurate positioning of central venous catheter with ultrasound was then confirmed in 121 of 124 patients (97.6%) as described previously. Transthoracic echocardiography and lung ultrasound are noninferior to chest x-ray for screening of pneumothorax and accurate central venous catheter positioning. Thus, the point of care use of ultrasound can reduce central venous catheter insertion to use time, exposure to radiation, and improve patient safety.

Management of end-stage central venous access in children referred for possible small bowel transplantation.

PubMed

Rodrigues, A F; van Mourik, I D M; Sharif, K; Barron, D J; de Giovanni, J V; Bennett, J; Bromley, P; Protheroe, S; John, P; de Ville de Goyet, J; Beath, S V

2006-04-01

The 3-year survival after small bowel transplantation (SBTx) has improved to between 73% and 88%. Impaired venous access for parenteral nutrition can be an indication for SBTx in children with chronic intestinal failure. To report our experience in management of children with extreme end-stage venous access. The study consisted of 6 children (all boys), median age of assessment 27 months (range, 13-52 months), diagnosed with total intestinal aganglionosis (1), protracted diarrhea (1), and short bowel syndrome (4), of which gastroschisis (2) and malrotation with midgut volvulus (2) were the causes. All had a documented history of more than 10 central venous catheter insertions previously. All had venograms, and 1 child additionally had a magnetic resonance angiogram to evaluate venous access. Five of 6 presented with thrombosis of the superior vena cava (SVC) and/or inferior vena cava. Venous access was reestablished as follows: transhepatic venous catheters (5), direct intra-atrial catheter via midline sternotomy (4), azygous venous catheters (2), dilatation of left subclavian vein after passage of a guide wire and then placing a catheter to reach the right atrium (1), radiological recanalization of the SVC and placement of a central venous catheter in situ (1), and direct puncture of SVC stump(1). Complications included serous pleural effusion after direct intra-atrial line insertion, which resolved after chest drain insertion (1), displacement of transhepatic catheter needing repositioning (2), and SVC stent narrowing requiring repeated balloon dilatation. Four children with permanent intestinal failure on assessment were offered SBTx, 3 of which were transplanted and were established on full enteral nutrition; the family of 1 child declined the procedure. In the remaining 2 children in whom bowel adaptation was still a possibility, attempts were made to provide adequate central venous access as feeds and drug manipulations were undertaken. One of them received liver and SBTx nearly 3 years after presenting with end-stage central venous access, because attempts to achieve independence from parenteral nutrition had failed. The other child died immediately after a transhepatic venous catheter placement, possibly from a nutritional depletion syndrome as no physical cause of death was found. Direct intra-atrial catheters in transplanted children proved to be adequate for the management of uncomplicated transplantation, although the usual infusion protocol had to be modified considerably, and the lack of access would have been critical if massive blood transfusion had been required during the transplant procedure. It was possible to reestablish central venous access in all cases. However, this was time consuming and difficult to assemble a skilled team consisting of one of more: surgeon, cardiologist, interventional radiologist, and transplant anesthetist. Small bowel transplantation is easier and safer with adequate central venous access, and we advocate liaison with an SBTx center at an early stage.

L1 Retrotransposon Heterogeneity in Ovarian Tumor Cell Evolution.

PubMed

Nguyen, Thu H M; Carreira, Patricia E; Sanchez-Luque, Francisco J; Schauer, Stephanie N; Fagg, Allister C; Richardson, Sandra R; Davies, Claire M; Jesuadian, J Samuel; Kempen, Marie-Jeanne H C; Troskie, Robin-Lee; James, Cini; Beaven, Elizabeth A; Wallis, Tristan P; Coward, Jermaine I G; Chetty, Naven P; Crandon, Alexander J; Venter, Deon J; Armes, Jane E; Perrin, Lewis C; Hooper, John D; Ewing, Adam D; Upton, Kyle R; Faulkner, Geoffrey J

2018-06-26

LINE-1 (L1) retrotransposons are a source of insertional mutagenesis in tumor cells. However, the clinical significance of L1 mobilization during tumorigenesis remains unclear. Here, we applied retrotransposon capture sequencing (RC-seq) to multiple single-cell clones isolated from five ovarian cancer cell lines and HeLa cells and detected endogenous L1 retrotransposition in vitro. We then applied RC-seq to ovarian tumor and matched blood samples from 19 patients and identified 88 tumor-specific L1 insertions. In one tumor, an intronic de novo L1 insertion supplied a novel cis-enhancer to the putative chemoresistance gene STC1. Notably, the tumor subclone carrying the STC1 L1 mutation increased in prevalence after chemotherapy, further increasing STC1 expression. We also identified hypomethylated donor L1s responsible for new L1 insertions in tumors and cultivated cancer cells. These congruent in vitro and in vivo results highlight L1 insertional mutagenesis as a common component of ovarian tumorigenesis and cancer genome heterogeneity. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Linkage disequilibrium and signatures of positive selection around LINE-1 retrotransposons in the human genome.

PubMed

Kuhn, Alexandre; Ong, Yao Min; Cheng, Ching-Yu; Wong, Tien Yin; Quake, Stephen R; Burkholder, William F

2014-06-03

Insertions of the human-specific subfamily of LINE-1 (L1) retrotransposon are highly polymorphic across individuals and can critically influence the human transcriptome. We hypothesized that L1 insertions could represent genetic variants determining important human phenotypic traits, and performed an integrated analysis of L1 elements and single nucleotide polymorphisms (SNPs) in several human populations. We found that a large fraction of L1s were in high linkage disequilibrium with their surrounding genomic regions and that they were well tagged by SNPs. However, L1 variants were only partially captured by SNPs on standard SNP arrays, so that their potential phenotypic impact would be frequently missed by SNP array-based genome-wide association studies. We next identified potential phenotypic effects of L1s by looking for signatures of natural selection linked to L1 insertions; significant extended haplotype homozygosity was detected around several L1 insertions. This finding suggests that some of these L1 insertions may have been the target of recent positive selection.

Leakproof Swaged Joints in Thin-Wall Tubing

NASA Technical Reports Server (NTRS)

Stuckenberg, F. H.; Crockett, L. K.; Snyder, W. E.

1986-01-01

Tubular inserts reinforce joints, reducing incidence of leaks. In new swaging technique, tubular inserts placed inside ends of both tubes to be joined. Made from thicker-wall tubing with outside diameter that matches inside diameter of thin tubing swaged, inserts support tube ends at joint. They ensure more uniform contact between swage fitting and tubing. New swaging technique developed for Al/Ti/V-alloy hydraulic supply lines.

Enhanced Sensitivity of Novel Surface Acoustic Wave Microelectromechanical System-Interdigital Transducer Gyroscope

NASA Astrophysics Data System (ADS)

Wang, Wen; Oh, Haekwan; Lee, Keekeun; Yoon, Sungjin; Yang, Sangsik

2009-06-01

In this paper, we present a novel microelectromechanical system-interdigital transducer (MEMS-IDT) surface acoustic wave (SAW) gyroscope with an 80 MHz central frequency on a 128° YX LiNbO3 wafer. The developed MEMS-IDT gyroscope is composed of a two-port SAW resonator, a dual delay line oscillator, and metallic dots. The SAW resonator provides a stable standing wave, and the vibrating metallic dot at an antinode of the standing wave induces the second SAW in the normal direction of its vibrating axis. The dual delay line oscillator detects the Coriolis force by comparing the resonant frequencies between two oscillators through the interference effect. The coupling of mode (COM) modeling was used to extract the optimal design parameters prior to fabrication. In the electrical testing by the network analyzer, the fabricated SAW resonator and delay lines showed low insertion loss and similar operation frequencies between a resonator and delay lines. When the device was rotated, the resonant frequency differences between two oscillators linearly varied owing to the Coriolis force. The obtained sensitivity was approximately 119 Hz deg-1 s-1 in the angular rate range of 0-1000 deg/s. Satisfactory linearity and superior directivity were also observed in the test.

In vitro culture may be the major contributing factor for transgenic versus nontransgenic proteomic plant differences.

PubMed

Fonseca, Cátia; Planchon, Sébastien; Serra, Tânia; Chander, Subhash; Saibo, Nelson J M; Renaut, Jenny; Oliveira, M Margarida; Batista, Rita

2015-01-01

Identification of differences between genetically modified plants and their original counterparts plays a central role in risk assessment strategy. Our main goal was to better understand the relevance of transgene presence, genetic, and epigenetic changes induced by transgene insertion, and in vitro culture in putative unintended differences between a transgenic and its comparator. Thus, we have used multiplex fluorescence 2DE coupled with MS to characterize the proteome of three different rice lines (Oryza sativa L. ssp. japonica cv. Nipponbare): a control conventional line (C), an Agrobacterium-transformed transgenic line (Ta) and a negative segregant (NSb). We observed that Ta and NSb appeared identical (with only one spot differentially abundant--fold difference ≥ 1.5), contrasting with the control (49 spots with fold difference ≥ 1.5, in both Ta and NSb vs. control). Given that in vitro culture was the only event in common between Ta and NSb, we hypothesize that in vitro culture stress was the most relevant condition contributing for the observed proteomic differences. MS protein identification support our hypothesis, indicating that Ta and NSb lines adjusted their metabolic pathways and altered the abundance of several stress related proteins in order to cope with in vitro culture. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Replaceable Inserts for Ship’s Line Handling Chocks

DTIC Science & Technology

2006-10-30

terms on the cover page. Page 12 - Nelson Engineering Co. Contract # N6553806M0156 Replaceable Inserts for Ship’s Line Handling Chocks Phase I Final... Nelson Engineering CO. 3655 Sells Arbor Circle T11tusvlle, FL 32760 (321)269-1113 Fax (321)269-0506 www.NelsonEngrCo.com Topic N06-059 Final Phase...2006 Carolyi’ S. Seringer, Oice President, POC Expiration of SBIR Data Rights Period: October 30, 2011 Nelson Engineering Co. exerts its data rights

Finite Ground Coplanar Waveguide Shunt MEMS Switches for Switched Line Phase Shifters

NASA Technical Reports Server (NTRS)

Ponchak, George E.; Simons, Rainee N.; Scardelletti, Maximillian; Varaljay, Nicholas C.

2000-01-01

Switches with low insertion loss and high isolation are required for switched line phase shifters and the transmit/receive switch at the front end of communication systems. A Finite Ground Coplanar (FGC) waveguide capacitive, shunt MEMS switch has been implemented on high resistivity Si. The switch has demonstrated an insertion loss of less than 0.3 dB and a return loss greater than 15 dB from 10 to 20, GHz. The switch design, fabrication, and characteristics are presented.

Study to Expand Simulation Cockpit Displays of Advanced Sensors

DTIC Science & Technology

1981-03-01

common source is being used for multiple sensor types). If inde- pendent displays and controls are desired then two independent video sources or sensor...line is inserted in each gap, the result is the familiar 211 in- terlace. If two lines are inserted, the result is 31l interlace, and so on. The total...symbol generators. If these systems are oper- ating at various scan rates and if a common display device, such as a multifunction display (MFD) is to

Rigid spine reinforced polymer microelectrode array probe and method of fabrication

DOEpatents

Tabada, Phillipe; Pannu, Satinderpall S

2014-05-27

A rigid spine-reinforced microelectrode array probe and fabrication method. The probe includes a flexible elongated probe body with conductive lines enclosed within a polymeric material. The conductive lines connect microelectrodes found near an insertion end of the probe to respective leads at a connector end of the probe. The probe also includes a rigid spine, such as made from titanium, fixedly attached to the probe body to structurally reinforce the probe body and enable the typically flexible probe body to penetrate and be inserted into tissue, such as neural tissue. By attaching or otherwise fabricating the rigid spine to connect to only an insertion section of the probe body, an integrally connected cable section of the probe body may remain flexible.

Incidence of upper limb venous thrombosis associated with peripherally inserted central catheters (PICC).

PubMed

Abdullah, B J J; Mohammad, N; Sangkar, J V; Abd Aziz, Y F; Gan, G G; Goh, K Y; Benedict, I

2005-07-01

The objective of this study was to prospectively determine the incidence of venous thrombosis (VT) in the upper limbs in patients with peripherally inserted central catheters (PICC). We prospectively investigated the incidence of VT in the upper limbs of 26 patients who had PICC inserted. The inclusion criteria were all patients who had a PICC inserted, whilst the exclusion criterion was the inability to perform a venogram (allergies, previous contrast medium reaction and inability of gaining venous access). Both valved and non-valved catheters were evaluated. Prior to removal of the PICC, an upper limb venogram was performed. The number of segments involved with VT were determined. The duration of central venous catheterization was classified as; less than 6 days, between 6 days and 14 days and more than 14 days. VT was confirmed in 38.5% (10/26) of the patients. The majority 85.7% (12/14) were complete occlusive thrombi and the majority of VT only involved one segment. There was no statistical correlation between the site of insertion of the PICC and the location of VT. Neither was there any observed correlation between the occurrence of VT with the patient's history of hypertension, hypercholesterolaemia, coronary artery disease, diabetes mellitus, cardiac insufficiency, smoking or cancer. There was also no statistical correlation with the size of the catheter. In conclusion, PICCs are associated with a significant risk of upper extremity deep vein thrombosis (UEVT).

Track Generator.

DTIC Science & Technology

provided for periodically inserting a new line of data in place of the oldest data line only, whereby a historical display is maintained while also showing progression of parameters represented by the data.

Polyaxial Screws in Locked Plating of Tibial Pilon Fractures.

PubMed

Yenna, Zachary C; Bhadra, Arup K; Ojike, Nwakile I; Burden, Robert L; Voor, Michael J; Roberts, Craig S

2015-08-01

This study examined the axial and torsional stiffness of polyaxial locked plating techniques compared with fixed-angle locked plating techniques in a distal tibia pilon fracture model. The effect of using a polyaxial screw to cross the fracture site was examined to determine its ability to control relative fracture site motion. A laboratory experiment was performed to investigate the biomechanical stiffness of distal tibia fracture models repaired with 3.5-mm anterior polyaxial distal tibial plates and locking screws. Sawbones Fourth Generation Composite Tibia models (Pacific Research Laboratories, Inc, Vashon, Washington) were used to model an Orthopaedic Trauma Association 43-A1.3 distal tibia pilon fracture. The polyaxial plates were inserted with 2 central locking screws at a position perpendicular to the cortical surface of the tibia and tested for load as a function of axial displacement and torque as a function of angular displacement. The 2 screws were withdrawn and inserted at an angle 15° from perpendicular, allowing them to span the fracture and insert into the opposing fracture surface. Each tibia was tested again for axial and torsional stiffness. In medial and posterior loading, no statistically significant difference was found between tibiae plated with the polyaxial plate and the central screws placed in the neutral position compared with the central screws placed at a 15° position. In torsional loading, a statistically significant difference was noted, showing greater stiffness in tibiae plated with the polyaxial plate and the central screws placed at a 15° position compared with tibiae plated with the central screws placed at a 0° (or perpendicular) position. This study showed that variable angle constructs show similar stiffness properties between perpendicular and 15° angle insertions in axial loading. The 15° angle construct shows greater stiffness in torsional loading. Copyright 2015, SLACK Incorporated.

Incidence and risk factors for central venous access port-related infection in Chinese cancer patients.

PubMed

Wang, Ting-Yao; Lee, Kuan-Der; Chen, Ping-Tsung; Chen, Min-Chi; Chen, Yi-Yang; Huang, Cih-En; Kuan, Feng-Che; Chen, Chih-Cheng; Lu, Chang Hsien

2015-11-01

Cytotoxic chemotherapy via central venous access ports is an important part of the standard treatment for most cancers, but it is accompanied with the risk of infections. This study aimed to analyze the incidence and risk factors for central venous access port-related infection (CPI) among Chinese patients receiving cytotoxic chemotherapy. Between January 1, 2002 and December 31, 2005 a total of 1391 cancer patients with 1449 totally implantable central venous access ports were evaluated. The log-rank test and Cox proportional hazards model were used for the analyses of risk factors. The overall CPI incidence rate was 0.21 per 1000 catheter-days. Hematological malignancies and head and neck cancer were associated with an increased risk of CPI (hazard ratio 4.00 and 4.11, respectively, both p < 0.001) and less infection-free catheter longevity (p < 0.001) compared with other cancer types. Chemotherapy in an adjuvant setting was associated with a lower risk of infection than for patients in a nonadjuvant setting (p < 0.001). The most common pathogens isolated from CPI were Pseudomonas aeruginosa and Candida. Infection remains to be a challenging issue for totally implantable central venous ports. Implementation of an insertion bundle for the prevention of central line-associated bloodstream infections is warranted, especially for those patients with hematological and head and neck cancers, as well as for patients receiving chemotherapy in the metastatic settings. Copyright © 2015. Published by Elsevier B.V.

Prospective comparison of two management strategies of central venous catheters in burn patients.

PubMed

Kealey, G P; Chang, P; Heinle, J; Rosenquist, M D; Lewis, R W

1995-03-01

Central venous catheters (CVCs) are associated with sepsis in burn patients. This study was undertaken to compare two strategies of CVC management in patients with major burn injuries. Forty-two burn patients with major burn injuries were randomly assigned to undergo site change every 48 hours of the CVC or to undergo wire guide exchange of the CVC every 48 hours at the same site. Catheter insertion site, distance from the burn wound, cultures of catheter tips, and blood cultures were obtained from all patients in a prospective manner. There was no difference in the incidence of CVC sepsis between the two groups studied. CVCs inserted less than 5 cm from the burn wound developed bacterial contamination at an earlier time than CVCs inserted more than 5 cm from the burn wound. There was no advantage to changing the CVC insertion site every 48 hours. Changing the CVC using the wire guide technique did not prevent, nor predict, CVC bacterial contamination.

``Dressing'' lines and vertices in calculations of matrix elements with the coupled-cluster method and determination of Cs atomic properties

NASA Astrophysics Data System (ADS)

Derevianko, Andrei; Porsev, Sergey G.

2005-03-01

We consider evaluation of matrix elements with the coupled-cluster method. Such calculations formally involve infinite number of terms and we devise a method of partial summation (dressing) of the resulting series. Our formalism is built upon an expansion of the product C†C of cluster amplitudes C into a sum of n -body insertions. We consider two types of insertions: particle (hole) line insertion and two-particle (two-hole) random-phase-approximation-like insertion. We demonstrate how to “dress” these insertions and formulate iterative equations. We illustrate the dressing equations in the case when the cluster operator is truncated at single and double excitations. Using univalent systems as an example, we upgrade coupled-cluster diagrams for matrix elements with the dressed insertions and highlight a relation to pertinent fourth-order diagrams. We illustrate our formalism with relativistic calculations of the hyperfine constant A(6s) and the 6s1/2-6p1/2 electric-dipole transition amplitude for the Cs atom. Finally, we augment the truncated coupled-cluster calculations with otherwise omitted fourth order diagrams. The resulting analysis for Cs is complete through the fourth order of many-body perturbation theory and reveals an important role of triple and disconnected quadruple excitations.

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Use of Electronic Medical Record–Enhanced Checklist and Electronic Dashboard to Decrease CLABSIs

PubMed Central

Longhurst, Christopher A.; Wood, Matthew; Cornfield, David N.; Suermondt, Jaap; Sharek, Paul J.; Franzon, Deborah

2014-01-01

OBJECTIVES: We hypothesized that a checklist enhanced by the electronic medical record and a unit-wide dashboard would improve compliance with an evidence-based, pediatric-specific catheter care bundle and decrease central line–associated bloodstream infections (CLABSI). METHODS: We performed a cohort study with historical controls that included all patients with a central venous catheter in a 24-bed PICU in an academic children’s hospital. Postintervention CLABSI rates, compliance with bundle elements, and staff perceptions of communication were evaluated and compared with preintervention data. RESULTS: CLABSI rates decreased from 2.6 CLABSIs per 1000 line-days before intervention to 0.7 CLABSIs per 1000 line-days after intervention. Analysis of specific bundle elements demonstrated increased daily documentation of line necessity from 30% to 73% (P < .001), increased compliance with dressing changes from 87% to 90% (P = .003), increased compliance with cap changes from 87% to 93% (P < .001), increased compliance with port needle changes from 69% to 95% (P < .001), but decreased compliance with insertion bundle documentation from 67% to 62% (P = .001). Changes in the care plan were made during review of the electronic medical record checklist on 39% of patient rounds episodes. CONCLUSIONS: Use of an electronic medical record–enhanced CLABSI prevention checklist coupled with a unit-wide real-time display of adherence was associated with increased compliance with evidence-based catheter care and sustained decrease in CLABSI rates. These data underscore the potential for computerized interventions to promote compliance with proven best practices and prevent patient harm. PMID:24567021

[Brief introduction of acupuncture needling and teaching keypoint].

PubMed

Hou, Shu-wei; Guo, Li; Kong, Su-ping

2014-09-01

We summarized our accumulated clinical and teaching experiences and explored the regularity of acupuncture needling and teaching. It is of great importance in pressing hand during inserting needle. Stroking and pressing are two crucial parts which deserve more attention, and seldom useage of pressing hand should be abolished. Operating hand needs practice before inserting needle, while it should fully relaxed during inserting. Blending "touching", "stretch" "gathering" "erupting" and "advancing" in single moment, applying appropriate dynamic mode of inserting needle such as "join 3 forces as one" "3 points in a line" expertly and naturally. In addition, enough attention should be paid on "altering direction" and "shifting point". Inserting deftly and powerfully, no/slight sensation, deqi when inserting needle are the highest reflection as an acupuncturist.

Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector.

PubMed

Lobo, N F; Hua-Van, A; Li, X; Nolen, B M; Fraser, M J

2002-04-01

Mosquito-vectored diseases such as yellow fever and dengue fever continue to have a substantial impact on human populations world-wide. Novel strategies for control of these mosquito vectored diseases can arise through the development of reliable systems for genetic manipulation of the insect vector. A piggyBac vector marked with the Drosophila melanogaster cinnabar (cn) gene was used to transform the white-eyed khw strain of Aedes aegypti. Microinjection of preblastoderm embryos resulted in four families of cinnabar transformed insects. An overall transformation frequency of 4%, with a range of 0% to as high as 13% for individual experiments, was achieved when using a heat-shock induced transposase providing helper plasmid. Southern hybridizations indicated multiple insertion events in three of four transgenic lines, while the presence of duplicated target TTAA sites at either ends of individual insertions confirmed characteristic piggyBac transposition events in these three transgenic lines. The transgenic phenotype has remained stable for more than twenty generations. The transformations effected using the piggyBac element establish the potential of this element as a germ-line transformation vector for Aedine mosquitoes.

Selection of Early-Occurring Mutations Dictates Hormone-Independent Progression in Mouse Mammary Tumor Lines▿

PubMed Central

Gattelli, Albana; Zimberlin, María N.; Meiss, Roberto P.; Castilla, Lucio H.; Kordon, Edith C.

2006-01-01

Mice harboring three mouse mammary tumor virus (MMTV) variants develop pregnancy-dependent (PD) tumors that progress to pregnancy-independent (PI) behavior through successive passages. Herein, we identified 10 predominant insertions in PI transplants from 8 independent tumor lines. These mutations were also detected in small cell populations in the early PD passages. In addition, we identified a new viral insertion upstream of the gene Rspo3, which is overexpressed in three of the eight independent tumor lines and codes for a protein very similar to the recently described protein encoded by Int7. This study suggests that during progression towards hormone independence, clonal expansion of cells with specific mutations might be more relevant than the occurrence of new MMTV insertions. PMID:16971449

Risk factors for health care-associated infections: From better knowledge to better prevention.

PubMed

Ferreira, Etelvina; Pina, Elaine; Sousa-Uva, Mafalda; Sousa-Uva, António

2017-10-01

Health care-associated infections (HCAIs) are preventable with adoption of recognized preventive measures. The first step is to identify patients at higher risk of HCAI. This study aimed to identify patient risk factors (RFs) present on admission and acquired during inpatient stay which could be associated with higher risk of acquiring HCAI. A case-control study was conducted in adult patients admitted during 2011 who were hospitalized for >48 hours. Cases were patients with HCAIs. Controls were selected in a ratio of 3:1, case matched by the admission date. The likelihood of increased HCAI was determined through binary logistic regression. RFs identified as being the more relevant for HCAI were being a man (odds ratio [OR], 2.4; 95% confidence interval [CI], 1.2-4.7), being aged >50 years (OR, 2.9; 95% CI, 1.3-6.9), and having an insertion of a central venous line during hospital stay (OR, 12.4; 95% CI, 5.0-30.5). RFs that showed statistical significance on admission were the patient's intrinsic factors, and RFs acquired during hospitalization were extrinsic RFs. When a set of RFs were present, the presence of a central venous line proved to be the more relevant one. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

First Person Point of View Augmented Reality for Central Line Insertion Training: A Usability and Feasibility Study

PubMed Central

Rochlen, Lauryn R.; Levine, Robert; Tait, Alan R.

2016-01-01

Introduction The value of simulation in medical education and procedural skills training is well recognized. Despite this, many mannequin-based trainers are limited by the inability of the trainee to view the internal anatomical structures. This study evaluates the usability and feasibility of a 1st person point of view (POV) augmented reality (AR) trainer on needle insertion as a component of central venous catheter (CVC) placement. Methods Forty subjects, including medical students and anesthesiology residents and faculty participated. AR glasses were provided through which the relevant internal anatomical landmarks were projected. Following a practice period, participants were asked to place the needle in the mannequin without the benefit of the AR projected internal anatomy. The ability of the trainees to correctly place the needle was documented. Participants also completed a short survey describing their perceptions of the AR technology. Results Participants reported that the AR technology was realistic (77.5%) and that the ability to view the internal anatomy was helpful (92.5%). Furthermore, 85% and 82.1%, respectively, believed that the AR technology promoted learning and should be incorporated into medical training. The ability to successfully place the needle was similar between experienced and non-experienced participants, however, less experienced participants were more likely to inadvertently puncture the carotid artery. Conclusions Results of this pilot study demonstrated the usability and feasibility of AR technology as a potentially important adjunct to simulated medical skills training. Further development and evaluation of this innovative technology under a variety of simulated medical training settings would be an important next step. PMID:27930431

First-Person Point-of-View-Augmented Reality for Central Line Insertion Training: A Usability and Feasibility Study.

PubMed

Rochlen, Lauryn R; Levine, Robert; Tait, Alan R

2017-02-01

The value of simulation in medical education and procedural skills training is well recognized. Despite this, many mannequin-based trainers are limited by the inability of the trainee to view the internal anatomical structures. This study evaluates the usability and feasibility of a first-person point-of-view-augmented reality (AR) trainer on needle insertion as a component of central venous catheter placement. Forty subjects, including medical students and anesthesiology residents and faculty, participated. Augmented reality glasses were provided through which the relevant internal anatomical landmarks were projected. After a practice period, participants were asked to place the needle in the mannequin without the benefit of the AR-projected internal anatomy. The ability of the trainees to correctly place the needle was documented. Participants also completed a short survey describing their perceptions of the AR technology. Participants reported that the AR technology was realistic (77.5%) and that the ability to view the internal anatomy was helpful (92.5%). Furthermore, 85% and 82.1%, respectively, believed that the AR technology promoted learning and should be incorporated into medical training. The ability to successfully place the needle was similar between experienced and nonexperienced participants; however, less experienced participants were more likely to inadvertently puncture the carotid artery. Results of this pilot study demonstrated the usability and feasibility of AR technology as a potentially important adjunct to simulated medical skills training. Further development and evaluation of this innovative technology under a variety of simulated medical training settings would be an important next step.

[Central venous catheter-related infections in critically ill patients].

PubMed

Diener, J R; Coutinho, M S; Zoccoli, C M

1996-01-01

To determine incidence rate, etiology and risk factors for central venous catheter (CVC)-related infections in critically-ill patients, a prospective cohort study was conducted in the general Intensive Care Unit (ICU) of a 212 bed Hospital in Florianópolis, Brazil. Patients admitted to ICU between May 1993 and February 1994, exposed to short-term CVC, were included in the study. Quantitative skin culture at CVC insertion site, semi-quantitative CVC tip culture, quantitative hub culture, and peripheral blood-culture were done. Results were submitted to univariate and multivariate analysis. Fifty-seven catheterization periods were analysed in 51 patients. The incidence rate was 21.1% (33.1 per 1,000 catheter-days) for local infection, and 8.7% (14.1 per 1,000 catheter-days) for catheter-associated bacteremia. The skin at the insertion site was colonized in 32.7% and the hub in 29.1% of the patients respectively. Potential sources of infection were the skin in 41.2% of the cases, the hub in 29.4%, remote site in 5.9% and unknown in 23.5%. The hub was implicated in 60% of the catheter-associated bacteremias. Coagulase-negative staphylococci were the main isolates. Another intravascular device and purulence at the insertion site were independently associated with local infection. Insertion at internal jugular site and hub colonization were independently associated with bacteremia. Catheter-associated bacteremia is a major complication of central venous catheterization in critically-ill patients. Internal jugular insertion and CVC hub colonization are important risk factors for significant catheter-related infections.

Novel biliary self-expanding metal stents: indications and applications.

PubMed

Blero, Daniel; Huberty, Vincent; Devière, Jacques

2015-03-01

Endoscopic insertion of a self-expanding metal stent (SEMS) through a malignant common bile duct stricture is the first line of palliation for malignant jaundice. Patency of these stents remains a major concern. SEMS dysfunction can result from tumor ingrowth, overgrowth and/or clogging. Initial SEMS modifications involved covering the central part of the stent in order to reduce ingrowth and ultimately increase patency. Fully covered stents became available shortly after reports of their use in human patients. The potential removability and radial strength of SEMS have led to evaluation of their use in new indications including benign biliary strictures, post sphincterotomy bleeding and perforation. Other aspects of development include the addition of features such as anti-reflux valves, drug elution and spontaneous biodegradability. These aspects and their clinical implications are reviewed and discussed.

Extravasation Injuries in Adults

PubMed Central

Al-Benna, S.; O'Boyle, C.; Holley, J.

2013-01-01

Insertion of an intravascular catheter is one of the most common invasive procedures in hospitals worldwide. These intravascular lines are crucial in resuscitation, allow vital medication to be administered, and can be used to monitor the patients' real-time vital parameters. There is, however, growing recognition of potential risks to life and limb associated with their use. Medical literature is now replete with isolated case reports of complications succinctly described by Garden and Laussen (2004) as “An unending supply of “unusual” complications from central venous catheters.” This paper reviews complications of venous and arterial catheters and discusses treatment approaches and methods to prevent complications, based on current evidence and endeavours to provide information and guidance that will enable practitioners to prevent, recognise, and successfully treat extravasation injuries in adults. PMID:23738141

Mechanical swirler for a low-NO{sub x}, weak-swirl burner

DOEpatents

Cheng, R.K.; Yegian, D.T.

1999-03-09

Disclosed is a mechanical swirler for generating diverging flow in lean premixed fuel burners. The swirler of the present invention includes a central passage with an entrance for accepting a feed gas, a flow balancing insert that introduces additional pressure drop beyond that occurring in the central passage in the absence of the flow balancing insert, and an exit aligned to direct the feed gas into a combustor. The swirler also has an annular passage about the central passage and including one or more vanes oriented to impart angular momentum to feed gas exiting the annular passage. The diverging flow generated by the swirler stabilizes lean combustion thus allowing for lower production of pollutants, particularly oxides of nitrogen. 16 figs.

Mechanical swirler for a low-NO.sub.x, weak-swirl burner

DOEpatents

Cheng, Robert K.; Yegian, Derek T.

1999-01-01

Disclosed is a mechanical swirler for generating diverging flow in lean premixed fuel burners. The swirler of the present invention includes a central passage with an entrance for accepting a feed gas, a flow balancing insert that introduces additional pressure drop beyond that occurring in the central passage in the absence of the flow balancing insert, and an exit aligned to direct the feed gas into a combustor. The swirler also has an annular passage about the central passage and including one or more vanes oriented to impart angular momentum to feed gas exiting the annular passage. The diverging flow generated by the swirler stabilizes lean combustion thus allowing for lower production of pollutants, particularly oxides of nitrogen.

Microstrip Butler matrix design and realization for 7 T MRI.

PubMed

Yazdanbakhsh, Pedram; Solbach, Klaus

2011-07-01

This article presents the design and realization of 8 × 8 and 16 × 16 Butler matrices for 7 T MRI systems. With the focus on low insertion loss and high amplitude/phase accuracy, the microstrip line integration technology (microwave-integrated circuit) was chosen for the realization. Laminate material of high permittivity (ε(r) = 11) and large thickness (h = 3.2 mm) is shown to allow the best trade-off of circuit board size versus insertion loss, saving circuit area by extensive folding of branch-line coupler topology and meandering phase shifter and connecting strip lines and reducing mutual coupling of neighboring strip lines by shield structures between strip lines. With this approach, 8 × 8 Butler matrices were produced in single boards of 310 mm × 530 mm, whereas the 16 × 16 Butler matrices combined two submatrices of 8 × 8 with two smaller boards. Insertion loss was found at 0.73 and 1.1 dB for an 8 × 8 matrix and 16 × 16 matrix, respectively. Measured amplitude and phase errors are shown to represent highly pure mode excitation with unwanted modes suppressed by 40 and 35 dB, respectively. Both types of matrices were implemented with a 7 T MRI system and 8- and 16-element coil arrays for RF mode shimming experiments and operated successfully with 8 kW of RF power. Copyright © 2011 Wiley-Liss, Inc.

Ideal tibial intramedullary nail insertion point varies with tibial rotation.

PubMed

Walker, Richard M; Zdero, Rad; McKee, Michael D; Waddell, James P; Schemitsch, Emil H

2011-12-01

The aim of the study was to investigate how superior entry point varies with tibial rotation and to identify landmarks that can be used to identify suitable radiographs for successful intramedullary nail insertion. The proximal tibia and knee were imaged for 12 cadaveric limbs undergoing 5° increments of internal and external rotation. Medial and lateral arthrotomies were performed, the ideal superior entry point was identified, and a 2-mm Kirschner wire inserted. A second Kirschner wire was sequentially placed at the 5-mm and then the 10-mm position, both medial and lateral to the initial Kirschner wire. Radiographs of the knee were obtained for all increments. The changing position of the ideal nail insertion point was recorded. A 30° arc (range, 25°-40°) provided a suitable anteroposterior radiograph. On the neutral anteroposterior radiograph, the Kirschner wire was 54% ± 1.5% (range, 51-56%) from the medial edge of the tibial plateau. For every 5° of rotation, the Kirschner wire moved 3% of the plateau width. During external rotation, a misleading medial entry point was obtained. A fibular bisector line correlated with an entry point that was ideal or up to 5 mm lateral to this but never medial. The film that best showed the fibular bisector line was between 0° and 10° of internal rotation of the tibia. The fibula head bisector line can be used to avoid choosing external rotation views and, thus, avoid medial insertion points. The current results may help the surgeon prevent malalignment during intramedullary nailing in proximal tibial fractures.

Imaging performance of annular apertures. II - Line spread functions

NASA Technical Reports Server (NTRS)

Tschunko, H. F. A.

1978-01-01

Line images formed by aberration-free optical systems with annular apertures are investigated in the whole range of central obstruction ratios. Annular apertures form lines images with central and side line groups. The number of lines in each line group is given by the ratio of the outer diameter of the annular aperture divided by the width of the annulus. The theoretical energy fraction of 0.889 in the central line of the image formed by an unobstructed aperture increases for centrally obstructed apertures to 0.932 for the central line group. Energy fractions for the central and side line groups are practically constant for all obstruction ratios and for each line group. The illumination of rectangular secondary apertures of various length/width ratios by apertures of various obstruction ratios is discussed.

Facility target insert shielding assessment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mocko, Michal

2015-10-06

Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In themore » present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.« less

Use of Electronic Tablets for Patient Education on Flushing Peripherally Inserted Central Catheters.

PubMed

Petroulias, Patricia L

The purpose of this study was to examine the efficacy of using an electronic tablet to provide patient education for flushing peripherally inserted central catheters (PICCs) as a way to reduce the incidence of occlusion. Eleven patients, newly diagnosed with cancer, participated in a pilot study that used a video on PICC flushing and remote coaching using FaceTime (Apple, Cupertino, CA) to teach patients how to maintain their PICCs in their homes. At the end of the 6-week intervention, no adverse outcomes (occlusions or infections) were noted among the patients who participated in the study.

Phenotypic characterization of an Arabidopsis T-DNA insertion line SALK_063500.

PubMed

Sng, Natasha J; Paul, Anna-Lisa; Ferl, Robert J

2018-06-01

In this article we report the identification of a homozygous lethal T-DNA (transfer DNA) line within the coding region of the At1G05290 gene in the genome of Arabidopsis thaliana (Arabidopsis) line, SALK_063500. The T-DNA insertion is found within exon one of the AT1G05290 gene, however a homozygous T-DNA allele is unattainable. In the heterozygous T-DNA allele the expression levels of AT1G05290 were compared to wild type Arabidopsis (Col-0, Columbia). Further analyses revealed an aberrant silique phenotype found in the heterozygous SALK_063500 plants that is attributed to the reduced rate of pollen tube germination. These data are original and have not been published elsewhere.

Persistent hyperplastic tunica vasculosa lentis and persistent hyperplastic primary vitreous in transgenic line TgN3261Rpw.

PubMed

Colitz, C M; Malarkey, D E; Woychik, R P; Wilkinson, J E

2000-09-01

Persistent hyperplastic tunica vasculosa lentis and persistent hyperplastic primary vitreous are congenital ocular anomalies that can lead to cataract formation. A line of insertional mutant mice, TgN3261Rpw, generated at the Oak Ridge National Laboratory in a large-scale insertional mutagenesis program was found to have a low incidence (8/243; 3.29%) of multiple developmental ocular abnormalities. The ocular abnormalities include persistent hyperplastic primary vitreous, persistent hyperplastic tunica vasculosa lentis, failure of cleavage of the anterior segment, retrolental fibrovascular membrane, posterior polar cataract, and detached retina. This transgenic mouse line provides an ontogenetic model because of the high degree of similarity of this entity in humans, dogs, and mice.

Circulatory filling pressures during transient microgravity induced by parabolic flight

NASA Technical Reports Server (NTRS)

Latham, Ricky D.; Fanton, John W.; White, C. D.; Vernalis, Mariana N.; Crisman, R. P.; Koenig, S. C.

1993-01-01

Theoretical concepts hold that blood in the gravity dependent portion of the body would relocate to more cephalad compartments under microgravity. The result is an increase in blood volume in the thoraic and cardiac chambers. However, experimental data has been somewhat contradictory and nonconclusive. Early studies of peripheral venous pressure and estimates of central venous pressure (CVP) from these data did not show an increase in CVP under microgravity. However, CVP recorded in human volunteers during a parabolic flight revealed an increase in CVP during the microgravity state. On the STS 40 shuttle mission, a payload specialist wore a fluid line that recorded CVP during the first few hours of orbital insertion. These data revealed decreased CVP. When this CVP catheter was tested during parabolic flight in four subjects, two had increased CVP recordings and two had decreased CVP measurements. In 1991, our laboratory performed parabolic flight studies in several chronic-instrumented baboons. It was again noted that centrally recorded right atrial pressure varied with exposure to microgravity, some animals having an increase, and others a decrease.

Thromboelastometry versus standard coagulation tests versus restrictive protocol to guide blood transfusion prior to central venous catheterization in cirrhosis: study protocol for a randomized controlled trial.

PubMed

Rocha, Leonardo Lima; Pessoa, Camila Menezes Souza; Neto, Ary Serpa; do Prado, Rogerio Ruscitto; Silva, Eliezer; de Almeida, Marcio Dias; Correa, Thiago Domingos

2017-02-27

Liver failure patients have traditionally been empirically transfused prior to invasive procedures. Blood transfusion is associated with immunologic and nonimmunologic reactions, increased risk of adverse outcomes and high costs. Scientific evidence supporting empirical transfusion is lacking, and the best approach for blood transfusion prior to invasive procedures in cirrhotic patients has not been established so far. The aim of this study is to compare three transfusion strategies (routine coagulation test-guided - ordinary or restrictive, or thromboelastometry-guided) prior to central venous catheterization in critically ill patients with cirrhosis. Design and setting: a double-blinded, parallel-group, single-center, randomized controlled clinical trial in a tertiary private hospital in São Paulo, Brazil. adults (aged 18 years or older) admitted to the intensive care unit with cirrhosis and an indication for central venous line insertion. Patients will be randomly assigned to three groups for blood transfusion strategy prior to central venous catheterization: standard coagulation tests-based, thromboelastometry-based, or restrictive. The primary efficacy endpoint will be the proportion of patients transfused with any blood product prior to central venous catheterization. The primary safety endpoint will be the incidence of major bleeding. Secondary endpoints will be the proportion of transfusion of fresh frozen plasma, platelets and cryoprecipitate; infused volume of blood products; hemoglobin and hematocrit before and after the procedure; intensive care unit and hospital length of stay; 28-day and hospital mortality; incidence of minor bleeding; transfusion-related adverse reactions; and cost analysis. This study will evaluate three strategies to guide blood transfusion prior to central venous line placement in severely ill patients with cirrhosis. We hypothesized that thromboelastometry-based and/or restrictive protocols are safe and would significantly reduce transfusion of blood products in this population, leading to a reduction in costs and transfusion-related adverse reactions. In this manner, this trial will add evidence in favor of reducing empirical transfusion in severely ill patients with coagulopathy. ClinicalTrials.gov, identifier: NCT02311985 . Retrospectively registered on 3 December 2014.

LINEs, SINEs and other retroelements: do birds of a feather flock together?

PubMed

Roy-Engel, Astrid M

2012-01-01

Mobile elements account for almost half of the mass of the human genome. Only the retroelements from the non-LTR (long terminal repeat) retrotransposon family, which include the LINE-1 (L1) and its non-autonomous partners, are currently active and contributing to new insertions. Although these elements seem to share the same basic amplification mechanism, the activity and success of the different types of retroelements varies. For example, Alu-induced mutagenesis is responsible for the majority of the documented instances of human disease induced by insertion of retroelements. Using copy number in mammals as an indicator, some SINEs have been vastly more successful than other retroelements, such as the retropseudogenes and even L1, likely due to differences in post-insertion selection and ability to overcome cellular controls. SINE and LINE integration can be differentially influenced by cellular factors, indicating some differences between in their amplification mechanisms. We focus on the known aspects of this group of retroelements and highlight their similarities and differences that may significantly influence their biological impact.

LINEs, SINEs and other retroelements: do birds of a feather flock together?

PubMed Central

Roy-Engel, Astrid M.

2012-01-01

Mobile elements account for almost half of the mass of the human genome. Only the retroelements from the non-LTR (long terminal repeat) retrotransposon family, which include the LINE-1 (L1) and its non-autonomous partners, are currently active and contributing to new insertions. Although these elements seem to share the same basic amplification mechanism, the activity and success of the different types of retroelements varies. For example, Alu-induced mutagenesis is responsible for the majority of the documented instances of human disease induced by insertion of retroelements. Using copy number in mammals as an indicator, some SINEs have been vastly more successful than other retroelements, such as the retropseudogenes and even L1, likely due to differences in post-insertion selection and ability to overcome cellular controls. SINE and LINE integration can be differentially influenced by cellular factors, indicating some differences between in their amplification mechanisms. We focus on the known aspects of this group of retroelements and highlight their similarities and differences that may significantly influence their biological impact. PMID:22201808

A short insertion mutation disrupts genesis of miR-16 and causes increased body weight in domesticated chicken.

PubMed

Jia, Xinzheng; Lin, Huiran; Nie, Qinghua; Zhang, Xiquan; Lamont, Susan J

2016-11-03

Body weight is one of the most important quantitative traits with high heritability in chicken. We previously mapped a quantitative trait locus (QTL) for body weight by genome-wide association study (GWAS) in an F2 chicken resource population. To identify the causal mutations linked to this QTL, expression profiles were determined on livers of high-weight and low-weight chicken lines by microarray. Combining the expression pattern with SNP effects by GWAS, miR-16 was identified as the most likely potential candidate with a 3.8-fold decrease in high-weight lines. Re-sequencing revealed that a 54-bp insertion mutation in the upstream region of miR-15a-16 displayed high allele frequencies in high-weight commercial broiler line. This mutation resulted in lower miR-16 expression by introducing three novel splicing sites instead of the missing 5' terminal splicing of mature miR-16. Elevating miR-16 significantly inhibited DF-1 chicken embryo cell proliferation, consistent with a role in suppression of cellular growth. The 54-bp insertion was significantly associated with increased body weight, bone size and muscle mass. Also, the insertion mutation tended towards fixation in commercial broilers (Fst > 0.4). Our findings revealed a novel causative mutation for body weight regulation that aids our basic understanding of growth regulation in birds.

Transposon-mediated generation of BCR-ABL1-expressing transgenic cell lines for unbiased sensitivity testing of tyrosine kinase inhibitors.

PubMed

Byrgazov, Konstantin; Lucini, Chantal Blanche; Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A; Hoermann, Gregor; Valent, Peter; Lion, Thomas

2016-11-22

Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance.

Prophylactic teicoplanin during insertion of Hickman catheters.

PubMed

Lim, S H; Smith, M P; Machin, S J; Goldstone, A H

1990-12-01

With the extensive use of Hickman catheters in patients requiring cytotoxic chemotherapy there is now a resurgence of Gram-positive septicaemia among these patients during the neutropenic periods. We are currently running a prospective randomized study of prophylactic teicoplanin during insertion of Hickman catheters to determine if it reduces the incidence of Gram-positive septicaemia. A total of 44 patients have completed the study (23 in the teicoplanin group and 21 in the control group). The diagnoses were: acute myelogenous leukaemia (13), non-Hodgkin's lymphoma (16), Hodgkin's disease (11), chronic granulocytic leukaemia (3) and acute lymphoblastic leukaemia (1). The number of days between insertion of Hickman catheters and the development of neutropenia was: teicoplanin group: mean 14.7, median 11, range 0-53; control group: mean 11.8, median 10, range 0-37. In the treated patients, there were four episodes of line-associated Gram-positive septicaemia and a total of four organisms were isolated. In the control group, 10 organisms were isolated from a total of nine episodes of line-associated Gram-positive septicaemia. The organisms were: coagulase-negative staphylococci (8), Streptococcus B, (1), Strep. faecalis (1), Strep. mitis (1), alpha streptococcus (1), diphtheriods (1) and Staphylococcus aureus (1). All organisms were sensitive to teicoplanin. No adverse reaction was observed in any patient. Prophylactic teicoplanin during insertion of Hickman catheters may therefore reduce the incidence of line-associated Gram-positive septicaemia in neutropenic patients.

A short insertion mutation disrupts genesis of miR-16 and causes increased body weight in domesticated chicken

PubMed Central

Jia, Xinzheng; Lin, Huiran; Nie, Qinghua; Zhang, Xiquan; Lamont, Susan J.

2016-01-01

Body weight is one of the most important quantitative traits with high heritability in chicken. We previously mapped a quantitative trait locus (QTL) for body weight by genome-wide association study (GWAS) in an F2 chicken resource population. To identify the causal mutations linked to this QTL, expression profiles were determined on livers of high-weight and low-weight chicken lines by microarray. Combining the expression pattern with SNP effects by GWAS, miR-16 was identified as the most likely potential candidate with a 3.8-fold decrease in high-weight lines. Re-sequencing revealed that a 54-bp insertion mutation in the upstream region of miR-15a-16 displayed high allele frequencies in high-weight commercial broiler line. This mutation resulted in lower miR-16 expression by introducing three novel splicing sites instead of the missing 5′ terminal splicing of mature miR-16. Elevating miR-16 significantly inhibited DF-1 chicken embryo cell proliferation, consistent with a role in suppression of cellular growth. The 54-bp insertion was significantly associated with increased body weight, bone size and muscle mass. Also, the insertion mutation tended towards fixation in commercial broilers (Fst > 0.4). Our findings revealed a novel causative mutation for body weight regulation that aids our basic understanding of growth regulation in birds. PMID:27808177

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Automating Phase Change Lines and Their Labels Using Microsoft Excel(R).

PubMed

Deochand, Neil

2017-09-01

Many researchers have rallied against drawn in graphical elements and offered ways to avoid them, especially regarding the insertion of phase change lines (Deochand, Costello, & Fuqua, 2015; Dubuque, 2015; Vanselow & Bourret, 2012). However, few have offered a solution to automating the phase labels, which are often utilized in behavior analytic graphical displays (Deochand et al., 2015). Despite the fact that Microsoft Excel® is extensively utilized by behavior analysts, solutions to resolve issues in our graphing practices are not always apparent or user-friendly. Considering the insertion of phase change lines and their labels constitute a repetitious and laborious endeavor, any minimization in the steps to accomplish these graphical elements could offer substantial time-savings to the field. The purpose of this report is to provide an updated way (and templates in the supplemental materials) to add phase change lines with their respective labels, which stay embedded to the graph when they are moved or updated.

Processed pseudogenes of human endogenous retroviruses generated by LINEs: their integration, stability, and distribution.

PubMed

Pavlícek, Adam; Paces, Jan; Elleder, Daniel; Hejnar, Jirí

2002-03-01

We report here the presence of numerous processed pseudogenes derived from the W family of endogenous retroviruses in the human genome. These pseudogenes are structurally colinear with the retroviral mRNA followed by a poly(A) tail. Our analysis of insertion sites of HERV-W processed pseudogenes shows a strong preference for the insertion motif of long interspersed nuclear element (LINE) retrotransposons. The genomic distribution, stability during evolution, and frequent truncations at the 5' end resemble those of the pseudogenes generated by LINEs. We therefore suggest that HERV-W processed pseudogenes arose by multiple and independent LINE-mediated retrotransposition of retroviral mRNA. These data document that the majority of HERV-W copies are actually nontranscribed promoterless pseudogenes. The current search for HERV-Ws associated with several human diseases should concentrate on a small subset of transcriptionally competent elements.

Attributable costs of central line-associated bloodstream infections in a pediatric hematology/oncology population.

PubMed

Wilson, Matthew Z; Rafferty, Colleen; Deeter, Deana; Comito, Melanie A; Hollenbeak, Christopher S

2014-11-01

Although several studies have estimated the attributable cost and length of stay (LOS) of central line-associated bloodstream infections (CLABSIs) in the pediatric intensive care unit setting, little is known about the attributable costs and LOS of CLABSIs in the vulnerable pediatric hematology/oncology population. We studied a total of 1562 inpatient admissions for 291 pediatric hematology/oncology patients at a single tertiary care children's hospital in the mid-Atlantic region between January 2008 and May 2011. Costs were normalized to year 2011 dollars. Propensity score matching was used to estimate the effect of CLABSIs on total cost and LOS while controlling for other covariates. Sixty CLABSIs occurred during the 1562 admissions. Compared with the patients without a CLABSI, those who developed a CLABSI tended to be older (9.0 years vs 7.5 years; P = .026) and to have a tunneled catheter (46.7% vs 27.0%) and a peripherally inserted central catheter (20.0% vs 11.2%) as opposed to other types of catheters (P < .0001). Propensity score matching yielded matched groups without significant differences in patient characteristics. In the propensity score analysis, the attributable LOS of a CLABSI was 21.2 days (P < .0001), and the attributable cost of a CLABSI was $69,332 (P < .0001). Among pediatric hematology/oncology patients, CLABSI was associated with an additional LOS of 21 days and increased costs of nearly $70,000. These findings may inform decisions regarding the value of investing in efforts to prevent CLABSIs in this vulnerable population. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

PubMed

Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

2014-12-10

Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

A Model for Ferroelectric Phase Shifters

NASA Technical Reports Server (NTRS)

Romanofsky, Robert R.; Qureshi, A. Haq

2000-01-01

Novel microwave phase shifters consisting of coupled microstrip lines on thin ferroelectric films have been demonstrated recently. A theoretical model useful for predicting the propagation characteristics (insertion phase shift, dielectric loss, impedance, and bandwidth) is presented here. The model is based on a variational solution for line capacitance and coupled strip transmission line theory.

On the Occurrence of Hypomyelination in a Transgenic Mouse Model: A Consequence of the Myelin Basic Protein Promoter?

PubMed Central

Gaupp, Stefanie; Arezzo, Joseph; Dutta, Dipankar J.; John, Gareth R.; Raine, Cedric S.

2013-01-01

Central nervous system hypomyelination is a feature common to a number of transgenic (Tg) mouse lines that express a variety of unrelated exogenous (i.e. non-CNS) transgenes. In this report we document hypomyelination structurally by immunocytochemistry and functionally in the Tg line MBP-JE, which overexpresses the chemokine CCL2 (MCP-1) within oligodendrocytes targeted by a myelin basic protein (MBP) promoter. Analysis of hypomyelinated optic nerves of Tg mice revealed progressive decrease in oligodendrocyte numbers with age (p < 0.01). Although molecular mechanisms underlying hypomyelination in this and other Tg models remain largely unknown, we present preliminary findings on oligodendrocyte progenitor cell (OPC) cultures in which, although OPC expressed CCR2, the receptor for CCL2, treatment with CCL2 had no significant effect on OPC proliferation, differentiation or apoptosis. We suggest that hypomyelination in the MBP-JE model might not be due to CCL2 expression but rather the result of transcriptional dysfunction related to random insertion of the MBP promoter that disrupts myelinogenesis and leads to oligodendrocytes demise. Because an MBP promoter is a common denominator in most Tg lines displaying hypomyelination, we hypothesize that use of myelin gene sequences in the regulator region of transgenic constructs might underlie this perturbation of myelination in such models. PMID:22082665

D Central Line Extraction of Fossil Oyster Shells

NASA Astrophysics Data System (ADS)

Djuricic, A.; Puttonen, E.; Harzhauser, M.; Mandic, O.; Székely, B.; Pfeifer, N.

2016-06-01

Photogrammetry provides a powerful tool to digitally document protected, inaccessible, and rare fossils. This saves manpower in relation to current documentation practice and makes the fragile specimens more available for paleontological analysis and public education. In this study, high resolution orthophoto (0.5 mm) and digital surface models (1 mm) are used to define fossil boundaries that are then used as an input to automatically extract fossil length information via central lines. In general, central lines are widely used in geosciences as they ease observation, monitoring and evaluation of object dimensions. Here, the 3D central lines are used in a novel paleontological context to study fossilized oyster shells with photogrammetric and LiDAR-obtained 3D point cloud data. 3D central lines of 1121 Crassostrea gryphoides oysters of various shapes and sizes were computed in the study. Central line calculation included: i) Delaunay triangulation between the fossil shell boundary points and formation of the Voronoi diagram; ii) extraction of Voronoi vertices and construction of a connected graph tree from them; iii) reduction of the graph to the longest possible central line via Dijkstra's algorithm; iv) extension of longest central line to the shell boundary and smoothing by an adjustment of cubic spline curve; and v) integration of the central line into the corresponding 3D point cloud. The resulting longest path estimate for the 3D central line is a size parameter that can be applied in oyster shell age determination both in paleontological and biological applications. Our investigation evaluates ability and performance of the central line method to measure shell sizes accurately by comparing automatically extracted central lines with manually collected reference data used in paleontological analysis. Our results show that the automatically obtained central line length overestimated the manually collected reference by 1.5% in the test set, which is deemed sufficient for the selected paleontological application, namely shell age determination.

Infection and natural history of emergency department-placed central venous catheters.

PubMed

LeMaster, Christopher H; Schuur, Jeremiah D; Pandya, Darshan; Pallin, Daniel J; Silvia, Jennifer; Yokoe, Deborah; Agrawal, Ashish; Hou, Peter C

2010-11-01

Central line-associated bloodstream infection (CLABSI, hereafter referred to in this paper as "bloodstream infection") is a leading cause of hospital-acquired infection. To our knowledge, there are no previously published studies designed to determine the rate of bloodstream infection among central venous catheters placed in the emergency department (ED). We design a retrospective chart review methodology to determine bloodstream infection and duration of catheterization for central venous catheters placed in the ED. Using hospital infection control, administrative, and ED billing databases, we identified patients with central venous catheters placed in the ED between January 1, 2007, and December 31, 2008, at one academic, urban ED with an annual census of 57,000. We performed a structured, explicit chart review to determine duration of catheterization and confirm bloodstream infection. We screened 4,251 charts and identified 656 patients with central venous catheters inserted in the ED, 3,622 catheter-days, and 7 bloodstream infections. The rate of bloodstream infection associated with central venous catheters placed in the ED was 1.93 per 1,000 catheter-days (95% confidence interval 0.50 to 3.36). The mean duration of catheterization was 5.5 days (median 4; range 1 to 29 days). Among infected central venous catheters, the mean duration of catheterization was 8.6 days (median 7; range 2 to 19 days). A total of 667 central venous catheters were placed in the internal jugular (392; 59%), subclavian (145; 22%), and femoral (130; 19%) veins. The sensitivity of using ED procedural billing code for identifying ED-placed central venous catheters among patients subsequently admitted to any ICU was 74.9% (95% confidence interval 71.4% to 78.3%). The rate of ED bloodstream infection at our institution is similar to current rates in ICUs. Central venous catheters placed in the ED remain in admitted patients for a substantial period. Copyright © 2010 American College of Emergency Physicians. Published by Mosby, Inc. All rights reserved.

Intrauterine device insertion in the postpartum period: a systematic review.

PubMed

Sonalkar, Sarita; Kapp, Nathalie

2015-02-01

Given new research on postpartum placement of levonorgestrel and copper intrauterine devices (IUDs), our objective was to update a prior systematic review of the safety and expulsion rates of postpartum IUDs. We searched MEDLINE, CENTRAL, LILACS, POPLINE, Web of Science, and ClinicalTrials.gov databases for articles between the database inception until July 2013. We included studies that compared IUD insertion time intervals and routes during the postpartum period. We used standard abstract forms and the United States Preventive Services Task Force grading system to summarise and assess the quality of the evidence. We included 18 articles. New evidence suggests that a levonorgestrel releasing-intrauterine system (LNG-IUS) insertion within 48 hours of delivery is safe. Postplacental insertion and insertion between 10 minutes and 48 hours after delivery result in higher expulsion rates than insertion 4 to 6 weeks postpartum, or non-postpartum insertion. Insertion at the time of caesarean section is associated with lower expulsion rates than postplacental insertion at the time of vaginal delivery. This review supports the evidence that insertion of an intrauterine contraceptive within the first 48 hours of vaginal or caesarean delivery is safe. Expulsion rates should be further studied in larger randomised controlled trials.

The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

PubMed

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

2007-03-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

Risk factors for acute adverse events during ultrasound-guided central venous cannulation in the emergency department.

PubMed

Theodoro, Daniel; Krauss, Missy; Kollef, Marin; Evanoff, Bradley

2010-10-01

Ultrasound (US) greatly facilitates cannulation of the internal jugular vein. Despite the ability to visualize the needle and anatomy, adverse events still occur. The authors hypothesized that the technique has limitations among certain patients and clinical scenarios. The purpose of this study was to identify characteristics of adverse events surrounding US-guided central venous cannulation (CVC). The authors assembled a prospective observational cohort of emergency department (ED) patients undergoing consecutive internal jugular CVC with US. The primary outcome of interest was a composite of acute mechanical adverse events including hematoma, arterial cannulation, pneumothorax, and unsuccessful placement. Physicians performing the CVC recorded anatomical site, reason for insertion, and acute complications. The patients with catheters were followed until the catheters were removed based on radiographic evidence or hospital nursing records. ED charts and pharmacy records contributed variables of interest. A self-reported online survey provided physician experience information. Logistic regression was used to calculate the odds of an adverse outcome.   Physicians attempted 289 CVCs on 282 patients. An adverse outcome occurred in 57 attempts (19.7%, 95% confidence interval [CI] = 15.5 to 24.7), the most common being 31 unsuccessful placements (11%, 95% CI = 7.7 to 14.8). Patients with a history of end-stage renal disease (odds ratio [OR] = 3.54, 95% CI = 1.59 to 7.89), and central lines placed by operators with intermediate experience (OR = 2.26, 95% CI = 1.19 to 4.32), were most likely to encounter adverse events. Previously cited predictors such as body mass index (BMI), coagulopathy, and pulmonary hyperinflation were not significant in our final model. Acute adverse events occurred in approximately one-fifth of US-guided internal jugular central line attempts. The study identified both patient (history of end-stage renal disease) and physician (intermediate experience level) factors that are associated with acute adverse events. © 2010 by the Society for Academic Emergency Medicine.

Disruption of a CAROTENOID CLEAVAGE DIOXYGENASE 4 gene converts flower colour from white to yellow in Brassica species.

PubMed

Zhang, Bao; Liu, Chao; Wang, Yaqin; Yao, Xuan; Wang, Fang; Wu, Jiangsheng; King, Graham J; Liu, Kede

2015-06-01

In Brassica napus, yellow petals had a much higher content of carotenoids than white petals present in a small number of lines, with violaxanthin identified as the major carotenoid compound in yellow petals of rapeseed lines. Using positional cloning we identified a carotenoid cleavage dioxygenase 4 gene, BnaC3.CCD4, responsible for the formation of flower colour, with preferential expression in petals of white-flowered B. napus lines. Insertion of a CACTA-like transposable element 1 (TE1) into the coding region of BnaC3.CCD4 had disrupted its expression in yellow-flowered rapeseed lines. α-Ionone was identified as the major volatile apocarotenoid released from white petals but not from yellow petals. We speculate that BnaC3.CCD4 may use δ- and/or α-carotene as substrates. Four variations, including two CACTA-like TEs (alleles M1 and M4) and two insertion/deletions (INDELs, alleles M2 and M3), were identified in yellow-flowered Brassica oleracea lines. The two CACTA-like TEs were also identified in the coding region of BcaC3.CCD4 in Brassica carinata. However, the two INDELs were not detected in B. napus and B. carinata. We demonstrate that the insertions of TEs in BolC3.CCD4 predated the formation of the two allotetraploids. © 2015 The Authors New Phytologist © 2015 New Phytologist Trust.

Trap seal for open circuit liquid cooled turbines

DOEpatents

Grondahl, Clayton M.; Germain, Malcolm R.

1980-01-01

An improved trap seal for open circuit liquid cooled turbines is disclosed. The trap seal of the present invention includes an annular recess formed in the supply conduit of cooling channels formed in the airfoil of the turbine buckets. A cylindrical insert is located in the annular recesses and has a plurality of axial grooves formed along the outer periphery thereof and a central recess formed in one end thereof. The axial grooves and central recess formed in the cylindrical insert cooperate with the annular recess to define a plurality of S-shaped trap seals which permit the passage of liquid coolant but prohibit passage of gaseous coolant.

Understanding the Patient Experience of Peripherally Inserted Central Catheter-Related Deep Vein Thrombosis Using Interpretive Phenomenology.

PubMed

Meyer, Britt M

The purpose of this interpretive phenomenological study was to determine what it means to patients to live with a peripherally inserted central catheter (PICC)-related deep vein thrombosis and to describe the influence of the experience on the individual's quality of life. The sample included 11 adult patients from an acute care setting who developed a PICC-related symptomatic thrombus between November 2014 and March 2016, using purposive sampling. Three distinct themes emerged from the data in this study: a loss of trust in health care providers, additional burdens to existing problems, and a yearning for understanding.

Port in oncology practice: 3-monthly locking with normal saline for catheter maintenance, a preliminary report.

PubMed

Solinas, Gianfranca; Platini, Francesca; Trivellato, Maurizio; Rigo, Carla; Alabiso, Oscar; Galetto, Alessandra S

2017-07-14

Patients with cancer need stable venous access using central vascular devices like central venous ports and peripherally inserted central catheters that can be used for a wide range of indications. Numerous flushing protocols exist including different frequencies for catheter locking to maintain catheter patency. The aim of this retrospective study was to evaluate the incidence of lumen occlusion of central venous ports in a group of adult cancer patients, adopting a policy of locking with normal saline every three months. This is a single-center retrospective observational study. During follow-up, we analyzed adult cancer patients who had undergone port insertion from January 1st, 2007 to August 31st, 2014. Flushing and locking were performed every three months with a syringe containing normal saline. We collected data from 381 patients with ports inserted in subclavian vein (379 patients) and in the right jugular vein (2 patients). Locking was performed during 3-monthly follow-up visits. Median follow-up was 810 days (90-2700 days). Among 381 ports, 59 were removed; the reasons for removal were: end of use (45 cases), catheter rupture (9 cases), dislocation (3 cases) and catheter-related bloodstream infection (2 cases). We had no reports of lumen occlusion. Our data suggest that locking ports with normal saline every three months is not associated with an increased risk of lumen occlusion.

Redundant via insertion in self-aligned double patterning

NASA Astrophysics Data System (ADS)

Song, Youngsoo; Jung, Jinwook; Shin, Youngsoo

2017-03-01

Redundant via (RV) insertion is employed to enhance via manufacturability, and has been extensively studied. Self-aligned double patterning (SADP) process, brings a new challenge to RV insertion since newly created cut for each RV insertion has to be taken care of. Specifically, when a cut for RV, which we simply call RV-cut, is formed, cut conflict may occur with nearby line-end cuts, which results in a decrease in RV candidates. We introduce cut merging to reduce the number of cut conflicts; merged cuts are processed with stitch using litho-etch-litho-etch (LELE) multi-patterning method. In this paper, we propose a new RV insertion method with cut merging in SADP for the first time. In our experiments, a simple RV insertion yields 55.3% vias to receives RVs; our proposed method that considers cut merging increases that number to 69.6% on average of test circuits.

Are early cannulation arteriovenous grafts (ecAVG) a viable alternative to tunnelled central venous catheters (TCVCs)? An observational "virtual study" and budget impact analysis.

PubMed

Aitken, Emma; Iqbal, Kashfa; Thomson, Peter; Kasthuri, Ram; Kingsmore, David

2016-05-07

Early cannulation arteriovenous grafts (ecAVGs) are advocated as an alternative to tunnelled central venous catheters (TCVCs). A real-time observational "virtual study" and budget impact model was performed to evaluate a strategy of ecAVG as a replacement to TCVC as a bridge to definitive access creation. Data on complications and access-related bed days was collected prospectively for all TCVCs inserted over a six-month period (n = 101). The feasibility and acceptability of an alternative strategy (ecAVGs) was also evaluated. A budget impact model comparing the two strategies was performed. Autologous access in the form of native fistula was the goal wherever possible. We found 34.7% (n = 35) of TCVCs developed significant complications (including 17 culture-proven bacteraemia and one death from line sepsis). Patients spent an average of 11.9 days/patient/year in hospital as a result of access-related complications. The wait for TCVC insertion delayed discharge in 35 patients (median: 6 days). The ecAVGs were a practical and acceptable alternative to TCVCs in over 80% of patients. Over a 6-month period, total treatment costs per patient wereGBP5882 in the TCVC strategy and GBP4954 in the ecAVG strategy, delivering potential savings ofGBP927 per patient. The ecAVGs had higher procedure and re-intervention costs (GBP3014 vs. GBP1836); however, these were offset by significant reductions in septicaemia treatment costs (GBP1322 vs. GBP2176) and in-patient waiting time bed costs (GBP619 vs. GBP1870). Adopting ecAVGs as an alternative to TCVCs in patients requiring immediate access for haemodialysis may provide better individual patient care and deliver cost savings to the hospital.

Indentation and needle insertion properties of the human eye

PubMed Central

Matthews, A; Hutnik, C; Hill, K; Newson, T; Chan, T; Campbell, G

2014-01-01

Purpose Characterization of the biomechanical properties of the human eye has a number of potential utilities. One novel purpose is to provide the basis for development of suitable tissue-mimicking material. The purpose of this study was to determine the indentation and needle insertion characteristics on human eye globes and tissue strips. Methods An indenter assessed the elastic response of human eye globes and tissue strips under increasing compressive loads. Needle insertion determined the force (N) needed to penetrate various areas of the eye wall. Results The results demonstrated that globes underwent slightly greater indentation at the midline than at the central cornea, and corneal strips indented twofold more than scleral strips, although neither difference was significant (P=0.400 and P=0.100, respectively). Significant differences were observed among various areas of needle insertion (P<0.001). Needle insertion through the anterior sclera (adjacent to the limbus) and posterior sclera (adjacent to the optic nerve) required the greatest amount of force (0.954 and 1.005 N, respectively). The force required to penetrate the central cornea (0.518 N) was significantly lower than all other areas except the midline sclera (0.700 N) Conclusion These data form the basis for further research into the development of a tissue-mimicking human eye construct with potential utility as a model for use in ophthalmology research and surgical teaching. PMID:24810571

Development of Needle Insertion Manipulator for Central Venous Catheterization

NASA Astrophysics Data System (ADS)

Kobayashi, Yo; Hong, Jaesung; Hamano, Ryutaro; Hashizume, Makoto; Okada, Kaoru; Fujie, Masakatsu G.

Central venous catheterization is a procedure, which a doctor insert a catheter into the patient’s vein for transfusion. Since there are risks of bleeding from arterial puncture or pneumothorax from pleural puncture. Physicians are strictly required to make needle reach up into the vein and to stop the needle in the middle of vein. We proposed a robot system for assisting the venous puncture, which can relieve the difficulties in conventional procedure, and the risks of complication. This paper reports the design structuring and experimental results of needle insertion manipulator. First, we investigated the relationship between insertion force and angle into the vein. The results indicated that the judgment of perforation using the reaction force is possible in case where the needling angle is from 10 to 20 degree. The experiment to evaluate accuracy of the robot also revealed that it has beyond 0.5 mm accuracy. We also evaluated the positioning accuracy in the ultrasound images. The results displays that the accuracy is beyond 1.0 mm and it has enough for venous puncture. We also carried out the venous puncture experiment to the phantom and confirm our manipulator realized to make needle reach up into the vein.

Horner's syndrome in patients admitted to the intensive care unit that have undergone central venous catheterization: a prospective study.

PubMed

Butty, Z; Gopwani, J; Mehta, S; Margolin, E

2016-01-01

PurposeCentral venous catheterization (CVC) is estimated to be performed in millions of patients per year. Swan-Ganz catheters used for CVC are most often inserted into the internal jugular vein and during this procedure they may come into contact with the sympathetic chain. This study aims to determine the incidence of Horner's syndrome in patients admitted to intensive care unit that have undergone internal jugular CVC insertion during their admission and to determine whether ultrasonography-assisted insertion has decreased the frequency of this complication.Patients and methodsA total of 100 prospective patients admitted to the ICU were examined for the presence of anisocoria and ptosis after undergoing recent CVC. Presence of Horner's syndrome was confirmed by testing with 0.5% apraclonidine and looking for the reversal of anisocoria.ResultsFrequency of Horner's syndrome after CVC was 2% in a sample of 100 prospectively examined patients.ConclusionHorner's syndrome remains a relatively rare but definitive complication of CVC. ICU physicians should be educated about its existence and prevalence and ophthalmologists should inquire about any history of ICU admission necessitating CVC insertion in any patient presenting with Horner's syndrome.

Atypical use of PICC in infants and small children: a unicentric experience.

PubMed

Bernasconi, Filippo; Zanaboni, Clelia; Dato, Andrea; Dolcino, Andrea; Bevilacqua, Michela; Montagnini, Luigi; Disma, Nicola

2017-11-17

The peripherally inserted central catheters (PICCs) are vascular access devices (VAD) that are increasingly being used in the pediatric population. If a small vein caliber prevents positioning the catheter in the arm, the following step is to position the same catheter in the supraclavicular area, which can be defined as an off-label use or "atypical" approach, first described by Pittiruti. We retrospectively reviewed PICC positioning with puncture-site in the supra-clavicular area ("atypical" PICC insertion) and then tunneled on the chest. Nineteen atypical PICCs were positioned in 18 patients. The median age of patients at the day of implant was 14 months (IQR 3-27 months), and weight 7.5 kg (IQR 4-12 kg). Within this population, 74% of cases scheduled for a typical PICC insertion presented vein caliber too small for this procedure. For this reason, the typical PICC insertion was changed in favor of an atypical PICC procedure. Atypical PICCs were successfully used in 100% of cases without immediate complications. Atypical PICC positioning is a safe and useful alternative to the conventional technique when there is need for a central vascular access device (CVAD) for mid- or long-term therapy.

Polygonal shaft hole rotor

DOEpatents

Hussey, John H.; Rose, John Scott; Meystrik, Jeffrey J.; White, Kent Lee

2001-01-23

A laminated rotor for an induction motor has a plurality of ferro-magnetic laminations mounted axially on a rotor shaft. Each of the plurality of laminations has a central aperture in the shape of a polygon with sides of equal length. The laminations are alternatingly rotated 180.degree. from one another so that the straight sides of the polygon shaped apertures are misaligned. As a circular rotor shaft is press fit into a stack of laminations, the point of maximum interference occurs at the midpoints of the sides of the polygon (i.e., at the smallest radius of the central apertures of the laminations). Because the laminates are alternatingly rotated, the laminate material at the points of maximum interference yields relatively easily into the vertices (i.e., the greatest radius of the central aperture) of the polygonal central aperture of the next lamination as the shaft is inserted into the stack of laminations. Because of this yielding process, the amount of force required to insert the shaft is reduced, and a tighter fit is achieved.

Transposon-mediated generation of BCR-ABL1-expressing transgenic cell lines for unbiased sensitivity testing of tyrosine kinase inhibitors

PubMed Central

Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A.; Hoermann, Gregor; Valent, Peter; Lion, Thomas

2016-01-01

Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance. PMID:27801667

Development of bacterial biofilms in dairy processing lines.

PubMed

Austin, J W; Bergeron, G

1995-08-01

Adherence of bacteria to various milk contact sites was examined by scanning electron microscopy and transmission electron microscopy. New gaskets, endcaps, vacuum breaker plugs and pipeline inserts were installed in different areas in lines carrying either raw or pasteurized milk, and a routine schedule of cleaning-in-place and sanitizing was followed. Removed cleaned and sanitized gaskets were processed for scanning or transmission electron microscopy. Adherent bacteria were observed on the sides of gaskets removed from both pasteurized and raw milk lines. Some areas of Buna-n gaskets were colonized with a confluent layer of bacterial cells surrounded by an extensive amorphous matrix, while other areas of Buna-n gaskets showed a diffuse adherence over large areas of the surface. Most of the bacteria attached to polytetrafluoroethylene (PTFE or Teflon) gaskets were found in crevices created by insertion of the gasket into the pipeline. Examination of stainless steel endcaps, pipeline inserts, and PTFE vacuum breaker plugs did not reveal the presence of adherent bacteria. The results of this study indicate that biofilms developed on the sides of gaskets in spite of cleaning-in-place procedures. These biofilms may be a source of post-pasteurization contamination.

Use of intraoperative venography to guide the distal portion of a ventriculoatrial shunt past an obstruction in the central veins: technical case report.

PubMed

Momin, Eric N; Recinos, Pablo F; Coon, Alexander L; Rigamonti, Daniele

2010-06-01

Ventriculoatrial (VA) shunting is commonly used to treat hydrocephalus when ventriculoperitoneal shunting has failed. Placement of a VA shunt in patients with narrowing or occlusion of the central veins presents considerable difficulty because few imaging modalities exist to safely and reliably insert a guidewire or atrial catheter past the occlusion. We report the use of intraoperative venography to guide the placement of the distal portion of a VA shunt in a patient with a valve blocking the left brachiocephalic vein. A 42-year-old man with pseudotumor cerebri and a left ventriculoperitoneal shunt presented with severe headaches. He was diagnosed with partial distal shunt obstruction. Because of a history of failed attempts at ventriculoperitoneal shunting, conversion to a VA shunt via the left internal jugular vein was planned. Surgery was performed by using the standard technique until resistance was encountered when inserting a guidewire into the internal jugular vein. Intraoperative venography of the central veins was performed, which showed a large valve blocking progression of the guidewire in the left brachiocephalic vein. Using fluoroscopic guidance, a 0.035-inch guidewire was successfully directed through the vein past the obstruction and exchanged for a peel-away introducer. The distal shunt catheter was then inserted, and the correct position in the atrium was confirmed fluoroscopically. When obstruction of the central veins is found during a VA shunting procedure, intraoperative venography is a useful method to aid in the placement of the atrial catheter through the central veins.

Comparison of routes for achieving parenteral access with a focus on the management of patients with Ebola virus disease.

PubMed

Ker, Katharine; Tansley, Gavin; Beecher, Deirdre; Perner, Anders; Shakur, Haleema; Harris, Tim; Roberts, Ian

2015-02-26

Dehydration is an important cause of death in patients with Ebola virus disease (EVD). Parenteral fluids are often required in patients with fluid requirements in excess of their oral intake. The peripheral intravenous route is the most commonly used method of parenteral access, but inserting and maintaining an intravenous line can be challenging in the context of EVD. Therefore it is important to consider the advantages and disadvantages of different routes for achieving parenteral access (e.g. intravenous, intraosseous, subcutaneous and intraperitoneal). To compare the reliability, ease of use and speed of insertion of different parenteral access methods. We ran the search on 17 November 2014. We searched the Cochrane Injuries Group's Specialised Register, Cochrane Central Register of Controlled Trials (CENTRAL, The Cochrane Library), Ovid MEDLINE(R) In-Process & Other Non-Indexed Citations, Ovid MEDLINE(R) Daily, Ovid MEDLINE(R) and Ovid OLDMEDLINE(R), Embase Classic + Embase (OvidSP), CINAHL (EBSCOhost), clinicaltrials.gov and screened reference lists. Randomised controlled trials comparing different parenteral routes for the infusion of fluids or medication. Two review authors examined the titles and abstracts of records obtained by searching the electronic databases to determine eligibility. Two review authors extracted data from the included trials and assessed the risk of bias. Outcome measures of interest were success of insertion; time required for insertion; number of insertion attempts; number of dislodgements; time period with functional access; local site reactions; clinicians' perception of ease of administration; needlestick injury to healthcare workers; patients' discomfort; and mortality. For trials involving the administration of fluids we also collected data on the volume of fluid infused, changes in serum electrolytes and markers of renal function. We rated the quality of the evidence as 'high', 'moderate', 'low' or 'very low' according to the GRADE approach for the following outcomes: success of insertion, time required for insertion, number of dislodgements, volume of fluid infused and needlestick injuries. We included 17 trials involving 885 participants. Parenteral access was used to infuse fluids in 11 trials and medications in six trials. None of the trials involved patients with EVD. Intravenous and intraosseous access was compared in four trials; intravenous and subcutaneous access in 11; peripheral intravenous and intraperitoneal access in one; saphenous vein cutdown and intraosseous access in one; and intraperitoneal with subcutaneous access in one. All of the trials assessing the intravenous method involved peripheral intravenous access.We judged few trials to be at low risk of bias for any of the assessed domains.Compared to the intraosseous group, patients in the intravenous group were more likely to experience an insertion failure (risk ratio (RR) 3.89, 95% confidence interval (CI) 2.39 to 6.33; n = 242; GRADE rating: low). We did not pool data for time to insertion but estimates from the trials suggest that inserting intravenous access takes longer (GRADE rating: moderate). Clinicians judged the intravenous route to be easier to insert (RR 0.15, 95% CI 0.04 to 0.61; n = 182). A larger volume of fluids was infused via the intravenous route (GRADE rating: moderate). There was no evidence of a difference between the two routes for any other outcomes, including adverse events.Compared to the subcutaneous group, patients in the intravenous group were more likely to experience an insertion failure (RR 14.79, 95% CI 2.87 to 76.08; n = 238; GRADE rating: moderate) and dislodgement of the device (RR 3.78, 95% CI 1.16 to 12.34; n = 67; GRADE rating: low). Clinicians also judged the intravenous route as being more difficult to insert and patients were more likely to be agitated in the intravenous group. Patients in the intravenous group were more likely to develop a local infection and phlebitis, but were less likely to develop erythema, oedema or swelling than those in the subcutaneous group. A larger volume of fluids was infused into patients via the intravenous route. There was no evidence of a difference between the two routes for any other outcome.There were insufficient data to reliably determine if the risk of insertion failure differed between the saphenous vein cutdown (SVC) and intraosseous method (RR 4.00, 95% CI 0.51 to 31.13; GRADE rating: low). Insertion using SVC took longer than the intraosseous method (MD 219.60 seconds, 95% CI 135.44 to 303.76; GRADE rating: moderate). There were no data and therefore there was no evidence of a difference between the two routes for any other outcome.There were insufficient data to reliably determine the relative effects of intraperitoneal or central intravenous access relative to any other parenteral access method. There are several different ways of achieving parenteral access in patients who are unable meet their fluid requirements with oral intake alone. The quality of the evidence, as assessed using the GRADE criteria, is somewhat limited because of the lack of adequately powered trials at low risk of bias. However, we believe that there is sufficient evidence to draw the following conclusions: if peripheral intravenous access can be achieved easily, this allows infusion of larger volumes of fluid than other routes; but if this is not possible, the intraosseous and subcutaneous routes are viable alternatives. The subcutaneous route may be suitable for patients who are not severely dehydrated but in whom ongoing fluid losses cannot be met by oral intake.A film to accompany this review can be viewed here (http://youtu.be/ArVPzkf93ng).

12 CFR Appendix A to Part 1024 - Instructions for Completing HUD-1 and HUD-1a Settlement Statements; Sample HUD-1 and HUD-1a...

Code of Federal Regulations, 2013 CFR

2013-01-01

... lines are provided in section L for any additional settlement charges. Blank lines are also provided for additional insertions in sections J and K. The names of the recipients of the settlement charges in section L... blank lines. Lines and columns in section J which relate to the Borrower's transaction may be left blank...

12 CFR Appendix A to Part 1024 - Instructions for Completing HUD-1 and HUD-1A Settlement Statements; Sample HUD-1 and HUD-1A...

Code of Federal Regulations, 2012 CFR

2012-01-01

... lines are provided in section L for any additional settlement charges. Blank lines are also provided for additional insertions in sections J and K. The names of the recipients of the settlement charges in section L... blank lines. Lines and columns in section J which relate to the Borrower's transaction may be left blank...

Barriers and Facilitators to Central Venous Catheter Insertion: A Qualitative Study.

PubMed

Cameron, Kenzie A; Cohen, Elaine R; Hertz, Joelle R; Wayne, Diane B; Mitra, Debi; Barsuk, Jeffrey H

2018-03-14

The aims of the study were to identify perceived barriers and facilitators to central venous catheter (CVC) insertion among healthcare providers and to understand the extent to which an existing Simulation-Based Mastery Learning (SBML) program may address barriers and leverage facilitators. Providers participating in a CVC insertion SBML train-the-trainer program, in addition to intensive care unit nurse managers, were purposively sampled from Veterans Administration Medical Centers located in geographically diverse areas. We conducted semistructured interviews to assess perceptions of barriers and facilitators to CVC insertion. Deidentified transcripts were analyzed using a grounded theory approach and the constant comparative method. We subsequently mapped identified barriers and facilitators to our SBML curriculum to determine whether or not the curriculum addresses these factors. We interviewed 28 providers at six Veterans Administration Medical Centers, identifying the following five overarching factors of perceived barriers to CVC insertion: (1) equipment, (2) personnel/staff, (3) setting or organizational context, (4) patient or provider, and (5) time-related barriers. Three overarching factors of facilitators emerged: (1) equipment, (2) personnel, and (3) setting or organizational context facilitators. The SBML curriculum seems to address most identified barriers, while leveraging many facilitators; building on the commonly identified facilitator of nursing staff contribution by expanding the curriculum to explicitly include nurse involvement could improve team efficiency and organizational culture of safety. Many identified facilitators (e.g., ability to use ultrasound, personnel confidence/competence) were also identified as barriers. Evidence-based SBML programs have the potential to amplify these facilitators while addressing the barriers by providing an opportunity to practice and master CVC insertion skills.

Complications Related to Insertion and Use of Central Venous Catheters (CVC).

PubMed

Hodzic, Samir; Golic, Darko; Smajic, Jasmina; Sijercic, Selma; Umihanic, Sekib; Umihanic, Sefika

2014-10-01

Central Venous Catheters (CVC) are essential in everyday medical practice, especially in treating patients in intensive care units (ICU). The application of these catheters is accompanied with the risk of complications, such as the complications caused during the CVC insertion, infections at the location of the insertion, and complications during the use of the catheter, sepsis and other metastatic infections. This study is a retrospective-prospective and it was implemented in the period 1(st) January 2011- 31(st) December 2012. It included 108 examinees with CVC placed for more than 7 days. The most common complications occurring in more than 2 attempts of CVC applications are: hearth arrhythmias in both groups in 12 cases, 7 in multi-lumen (12.72%) and 5 in mono-lumen ones (9.43%). Artery puncture occurs in both groups in 7 cases, 5 in multi-lumen (9.09%) and 2 in mono-lumen ones (3.77%). Hematoma occurred in both groups in 4 cases, 3 in multi-lumen CVCs (5.45%) and 1 in mono-lumen ones (1.88%). The most common complication in multi-lumen catheters was heart arrhythmia, in 20 cases (36.37%). The most common complications in mono-lumen CVCs was hearth arrhythmias, in 20 cases as extrasystoles and they were registered in 16 catheter insertions (30.18%). Out of total number of catheters of both groups, out of 108 catheters the complications during insertion occurred in 49 catheters (45.40%). The most common complications in both groups were heart arrhythmias, artery punctures and hematomas at the place of catheter insertion.

Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

PubMed

Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

2011-01-21

DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Octenidine hydrochloride for the care of central venous catheter insertion sites in severely immunocompromised patients.

PubMed

Tietz, Andreas; Frei, Reno; Dangel, Marc; Bolliger, Dora; Passweg, Jakob R; Gratwohl, Alois; Widmer, Andreas E

2005-08-01

To determine the efficacy and tolerability of octenidine hydrochloride, a non-alcoholic skin antiseptic, for the care of central venous catheter (CVC) insertion sites. Prospective, observational study. Bone marrow transplantation unit of a university hospital. All consecutive patients with a nontunneled CVC were enrolled prospectively after informed consent. Octenidine hydrochloride (0.1%) was applied for disinfection at the CVC insertion site during dressing changes. The following cultures were performed weekly as well as at the occurrence of any systemic inflammatory response syndrome criteria: cultures of the skin surrounding the CVC entry site, cultures of the three-way hub connected to the CVC, blood cultures, and cultures of the CVC tip on removal. Enhanced microbiological methods (skin swabs of a 24-cm2 standardized area, roll plate, and sonication of catheter tips) were applied. One hundred thirty-five CVCs were inserted in 62 patients during the study period and remained for a mean period of 19.1 days, corresponding to 2,462 catheter-days. Bacterial density at the insertion site declined substantially over time, and most cultures became negative 2 weeks after insertion. Only 6 patients had a documented catheter-related bloodstream infection. The incidence density was 2.39 catheter infections per 1,000 catheter-days. No side effects were noted with application of the antiseptic. Disinfection with a skin antiseptic that contains octenidine hydrochloride is highly active and well tolerated. It leads to a decrease in skin colonization over time and may be a new option for CVC care.

Gene flow in genetically modified wheat.

PubMed

Rieben, Silvan; Kalinina, Olena; Schmid, Bernhard; Zeller, Simon L

2011-01-01

Understanding gene flow in genetically modified (GM) crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer approach and that gene-flow distances can be efficiently estimated with population-level PCR analyses. © 2011 Rieben et al.

Gene Flow in Genetically Modified Wheat

PubMed Central

Rieben, Silvan; Kalinina, Olena; Schmid, Bernhard; Zeller, Simon L.

2011-01-01

Understanding gene flow in genetically modified (GM) crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting “phytometers” of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5–2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7–0.03% over the test distances of 0.5–2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer approach and that gene-flow distances can be efficiently estimated with population-level PCR analyses. PMID:22216349

Present Concepts in Internal Medicine, Nutritional Support Symposium. Volume 14, Number 1. Summer 1983,

DTIC Science & Technology

1983-01-01

7- peripheral intravenous route. CARE OF THE CENTRAL VENOUS CATHETER Central venous catheter insertion requires the follow- ing skin preparation: 1...receiving parenteral nutrition who develop sepsis from central venous catheters may show persistent temperature spikes to 38.9 *C to 40.0 *C every 12-24...hours. Evaluating the central venous catheter as the etiology for febrile episodes is often difficult because many patients have other potential

Target sites for the transposition of rat long interspersed repeated DNA elements (LINEs) are not random.

PubMed Central

Furano, A V; Somerville, C C; Tsichlis, P N; D'Ambrosio, E

1986-01-01

The long interspersed repeated DNA family of rats (LINE or L1Rn family) contains about 40,000 6.7-kilobase (kb) long members (1). LINE members may be currently mobile since their presence or absence causes allelic variation at three single copy loci (2, 3): insulin 1, Moloney leukemia virus integration 2 (Mlvi-2) (4), and immunoglobulin heavy chain (Igh). To characterize target sites for LINE insertion, we compared the DNA sequences of the unoccupied Mlvi-2 target site, its LINE-containing allele, and several other LINE-containing sites. Although not homologous overall, the target sites share three characteristics: First, depending on the site, they are from 68% to 86% (A+T) compared to 58% (A+T) for total rat DNA (5). Depending on the site, a 7- to 15-bp target site sequence becomes duplicated and flanks the inserted LINE member. The second is a version (0 or 1 mismatch) of the hexanucleotide, TACTCA, which is also present in the LINE member, in a highly conserved region located just before the A-rich right end of the LINE member. The third is a stretch of alternating purine/pyrimidine (PQ). The A-rich right ends of different LINE members vary in length and composition, and the sequence of a particularly long one suggests that it contains the A-rich target site from a previous transposition. PMID:3012480

Effect of metatarsal pad placement on plantar pressure in people with diabetes mellitus and peripheral neuropathy.

PubMed

Hastings, Mary K; Mueller, Michael J; Pilgram, Thomas K; Lott, Donovan J; Commean, Paul K; Johnson, Jeffrey E

2007-01-01

Standard prevention and treatment strategies to decrease peak plantar pressure include a total contact insert with a metatarsal pad, but no clear guidelines exist to determine optimal placement of the pad with respect to the metatarsal head. The purpose of this study was to determine the effect of metatarsal pad location on peak plantar pressure in subjects with diabetes mellitus and peripheral neuropathy. Twenty subjects with diabetes mellitus, peripheral neuropathy, and a history of forefoot plantar ulcers were studied (12 men and eight women, mean age=57+/-9 years). CT determined the position of the metatarsal pad relative to metatarsal head and peak plantar pressures were measured on subjects in three footwear conditions: extra-depth shoes and a 1) total contact insert, 2) total contact insert and a proximal metatarsal pad, and 3) total contact insert and a distal metatarsal pad. The change in peak plantar pressure between shoe conditions was plotted and compared to metatarsal pad position relative to the second metatarsal head. Compared to the total contact insert, all metatarsal pad placements between 6.1 mm to 10.6 mm proximal to the metatarsal head line resulted in a pressure reduction (average reduction=32+/-16%). Metatarsal pad placements between 1.8 mm distal and 6.1 mm proximal and between 10.6 mm proximal and 16.8 mm proximal to the metatarsal head line resulted in variable peak plantar pressure reduction (average reduction=16+/-21%). Peak plantar pressure increased when the metatarsal pad was located more than 1.8 mm distal to the metatarsal head line. Consistent peak plantar pressure reduction occurred when the metatarsal pad in this study was located between 6 to 11 mm proximal to the metatarsal head line. Pressure reduction lessened as the metatarsal pad moved outside of this range and actually increased if the pad was located too distal of this range. Computational models are needed to help predict optimal location of metatarsal pad with a variety of sizes, shapes, and material properties.

48 CFR 245.7205 - Reporting excess and surplus contractor inventory.

Code of Federal Regulations, 2010 CFR

2010-10-01

... surplus contractor inventory. 245.7205 Section 245.7205 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT GOVERNMENT PROPERTY Special... the report are self-explanatory except: (1) Line 1—Insert totals from line 7 of the preceding report...

ITER CS Model Coil and CS Insert Test Results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martovetsky, N; Michael, P; Minervina, J

2000-09-07

The Inner and Outer modules of the Central Solenoid Model Coil (CSMC) were built by US and Japanese home teams in collaboration with European and Russian teams to demonstrate the feasibility of a superconducting Central Solenoid for ITER and other large tokamak reactors. The CSMC mass is about 120 t, OD is about 3.6 m and the stored energy is 640 MJ at 46 kA and peak field of 13 T. Testing of the CSMC and the CS Insert took place at Japan Atomic Energy Research Institute (JAERI) from mid March until mid August 2000. This paper presents the mainmore » results of the tests performed.« less

US Army Institute of Surgical Research Annual Research Progress Report for Fiscal Year 1987.

DTIC Science & Technology

1987-10-01

oases, respiratory rate, chest roentgenograms), cardiovascular (blood pressure, central venous pressure, cardiac output), and renal (urine output, urine...Monitoring includes the precordial and/or esophageal stethoscope, peripheral pulse, blood pressure, central venous pressure, Swan-Ganz catheter... central venous , peripheral venous , and Swan-Ganz (7F, American Edward Laboratories, Irvine CA) catheters and an esophageal balloon were inserted. After a 2

Turbine nozzle stage having thermocouple guide tube

DOEpatents

Schotsch, Margaret Jones; Kirkpatrick, Francis Lawrence; Lapine, Eric Michael

2002-01-01

A guide tube is fixed adjacent opposite ends in outer and inner covers of a nozzle stage segment. The guide tube is serpentine in shape between the outer and inner covers and extends through a nozzle vane. An insert is disposed in the nozzle vane and has apertures to accommodate serpentine portions of the guide tube. Cooling steam is also supplied through chambers of the insert on opposite sides of a central insert chamber containing the guide tube. The opposite ends of the guide tube are fixed to sleeves, in turn fixed to the outer and inner covers.

Medical-grade honey does not reduce skin colonization at central venous catheter-insertion sites of critically ill patients: a randomized controlled trial

PubMed Central

2012-01-01

Introduction Catheter-related bloodstream infections (CRBSIs) associated with short-term central venous catheters (CVCs) in intensive care unit (ICU) patients are a major clinical problem. Bacterial colonization of the skin at the CVC insertion site is an important etiologic factor for CRBSI. The aim of this study was to assess the efficacy of medical-grade honey in reducing bacterial skin colonization at insertion sites. Methods A prospective, single-center, open-label randomized controlled trial was performed at the ICU of a university hospital in The Netherlands to assess the efficacy of medical-grade honey to reduce skin colonization of insertion sites. Medical-grade honey was applied in addition to standard CVC-site dressing and disinfection with 0.5% chlorhexidine in 70% alcohol. Skin colonization was assessed on a daily basis before CVC-site disinfection. The primary end point was colonization of insertion sites with >100 colony-forming units at the last sampling before removal of the CVC or transfer of the patient from the ICU. Secondary end points were quantitative levels of colonization of the insertion sites and colonization of insertion sites stratified for CVC location. Results Colonization of insertion sites was not affected by the use of medical-grade honey, as 44 (34%) of 129 and 36 (34%) of 106 patients in the honey and standard care groups, respectively, had a positive skin culture (P = 0.98). Median levels of skin colonization at the last sampling were 1 (0 to 2.84) and 1 (0 to 2.70) log colony-forming units (CFUs)/swab for the honey and control groups, respectively (P = 0.94). Gender, days of CVC placement, CVC location, and CVC type were predictive for a positive skin culture. Correction for these variables did not change the effect of honey on skin-culture positivity. Conclusions Medical-grade honey does not affect colonization of the skin at CVC insertion sites in ICU patients when applied in addition to standard disinfection with 0.5% chlorhexidine in 70% alcohol. Trial registration Netherlands Trial Registry, NTR1652. PMID:23111148

Medical-grade honey does not reduce skin colonization at central venous catheter-insertion sites of critically ill patients: a randomized controlled trial.

PubMed

Kwakman, Paulus H; Müller, Marcella C; Binnekade, Jan M; van den Akker, Johannes P; de Borgie, Corianne A; Schultz, Marcus J; Zaat, Sebastian A

2012-10-30

Catheter-related bloodstream infections (CRBSIs) associated with short-term central venous catheters (CVCs) in intensive care unit (ICU) patients are a major clinical problem. Bacterial colonization of the skin at the CVC insertion site is an important etiologic factor for CRBSI. The aim of this study was to assess the efficacy of medical-grade honey in reducing bacterial skin colonization at insertion sites. A prospective, single-center, open-label randomized controlled trial was performed at the ICU of a university hospital in The Netherlands to assess the efficacy of medical-grade honey to reduce skin colonization of insertion sites. Medical-grade honey was applied in addition to standard CVC-site dressing and disinfection with 0.5% chlorhexidine in 70% alcohol. Skin colonization was assessed on a daily basis before CVC-site disinfection. The primary end point was colonization of insertion sites with >100 colony-forming units at the last sampling before removal of the CVC or transfer of the patient from the ICU. Secondary end points were quantitative levels of colonization of the insertion sites and colonization of insertion sites stratified for CVC location. Colonization of insertion sites was not affected by the use of medical-grade honey, as 44 (34%) of 129 and 36 (34%) of 106 patients in the honey and standard care groups, respectively, had a positive skin culture (P = 0.98). Median levels of skin colonization at the last sampling were 1 (0 to 2.84) and 1 (0 to 2.70) log colony-forming units (CFUs)/swab for the honey and control groups, respectively (P = 0.94). Gender, days of CVC placement, CVC location, and CVC type were predictive for a positive skin culture. Correction for these variables did not change the effect of honey on skin-culture positivity. Medical-grade honey does not affect colonization of the skin at CVC insertion sites in ICU patients when applied in addition to standard disinfection with 0.5% chlorhexidine in 70% alcohol. Netherlands Trial Registry, NTR1652.

Technology Insertion-Engineering Services Process Characterization. Task Order No. 1. Volume 4. OO-ALC

DTIC Science & Technology

1989-12-15

Since no bridge crane exists in either the north or south plate areas, parts must be dismounted from one monorail /hoist and transferred to another...when the chemical operations involve more than one tank line. There are 19 tank lines in the shop with one monorail hoist for each pair of tank lines...except for tank line no. 19. The monorail system over line 19 does not connect with the rest of the interconnected serpentine monorail system. Solution

Human Alu insertion polymorphisms in North African populations.

PubMed

Cherni, Loth; Frigi, Sabeh; Ennafaa, Hajer; Mtiraoui, Nabil; Mahjoub, Touhami; Benammar-Elgaaied, Amel

2011-10-01

Several features make Alu insertions a powerful tool used in population genetic studies: the polymorphic nature of many Alu insertions, the stability of an Alu insertion event and, furthermore, the ancestral state of an Alu insertion is known to be the absence of the Alu element at a particular locus and the presence of an Alu insertion at the site that forward mutational change. This study analyses seven Alu insertion polymorphisms in a sample of 297 individuals from the autochthonous population of Tunisia (Thala, Smar, Zarzis, and Bou Salem) and Libya with the aim of studying their genetic structure with respect to the populations of North Africa, Western, Eastern and Central Europe. The comparative analyses carried out using the MDS and AMOVA methods reveal the existence of spatial heterogeneity, and identify four population groups. Study populations (Libya, Smar, Zarzis, and Bou Salem) are closest to North African populations whereas Thala is isolated and is closest to Western European populations. In conclusion, Results of the present study support the important role that migratory movements have played in the North African gene pool, at least since the Neolithic period.

Synthesis of amide isosteres of schweinfurthin-based stilbenes.

PubMed

Stockdale, David P; Beutler, John A; Wiemer, David F

2017-10-15

The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.

Variables associated with peripherally inserted central catheter related infection in high risk newborn infants 1

PubMed Central

Rangel, Uesliz Vianna; Gomes, Saint Clair dos Santos; Costa, Ana Maria Aranha Magalhães; Moreira, Maria Elisabeth Lopes

2014-01-01

OBJECTIVE: to relate the variables from a surveillance form for intravenous devices in high risk newborn infants with peripherally inserted central catheter related infection. METHODOLOGY: approximately 15 variables were studied, being associated with peripherally inserted central catheter related infection, this being defined by blood culture results. The variables analyzed were obtained from the surveillance forms used with intravenous devices, attached to the medical records of newborn infants weighing between 500 and 1,499 g. The statistical association was defined using the Chi-squared and Student t tests. The study was approved by the Research Ethics Committee of the Instituto Fernandes Figueira under process N. 140.703/12. RESULTS: 63 medical records were analyzed. The infection rate observed was 25.4%. Of the variables analyzed, only three had a statistically-significant relationship with the blood culture - the use of drugs capable of inhibiting acid secretion, post-natal steroid use, and undertaking more than one invasive procedure (p-value of 0.0141, 0.0472 and 0.0277, respectively). CONCLUSION: the absence of significance of the variables of the form may be related to the quality of the records and to the absence of standardization. It is recommended that the teams be encouraged to adhere to the protocol and fill out the form. PMID:25493681

Bringing central line-associated bloodstream infection prevention home: catheter maintenance practices and beliefs of pediatric oncology patients and families.

PubMed

Rinke, Michael L; Chen, Allen R; Milstone, Aaron M; Hebert, Lindsay C; Bundy, David G; Colantuoni, Elizabeth; Fratino, Lisa; Herpst, Cynthia; Kokoszka, Michelle; Miller, Marlene R

2015-04-01

A study was conducted to investigate (1) the extent to which best-practice central line maintenance practices were employed in the homes of pediatric oncology patients and by whom, (2) caregiver beliefs about central line care and central line-associated blood stream infection (CLABSI) risk, (3) barriers to optimal central line care by families, and (4) educational experiences and preferences regarding central line care. Researchers administered a survey to patients and families in a tertiary care pediatric oncology clinic that engaged in rigorous ambulatory and inpatient CLABSI prevention efforts. Of 110 invited patients and caregivers, 105 participated (95% response rate) in the survey (March-May 2012). Of the 50 respondents reporting that they or another caregiver change central line dressings, 48% changed a dressing whenever it was soiled as per protocol (many who did not change dressings per protocol also never personally changed dressings); 67% reported the oncology clinic primarily cares for their child's central line, while 29% reported that an adult caregiver or the patient primarily cares for the central line. Eight patients performed their own line care "always" or "most of the time." Some 13% of respondents believed that it was "slightly likely" or "not at all likely" that their child will get an infection if caregivers do not perform line care practices perfectly every time. Dressing change practices were the most difficult to comply with at home. Some 18% of respondents wished they learned more about line care, and 12% received contradictory training. Respondents cited a variety of preferences regarding line care teaching, although the majority looked to clinic nurses for modeling line care. Interventions aimed at reducing ambulatory CLABSIs should target appropriate educational experiences for adult caregivers and patients and identify ways to improve compliance with best-practice care.

The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

PubMed Central

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

2007-01-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

PubMed Central

Burke, W D; Calalang, C C; Eickbush, T H

1987-01-01

Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

PubMed

Rodić, Nemanja; Burns, Kathleen H

2013-03-01

LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

Templated sequence insertion polymorphisms in the human genome

NASA Astrophysics Data System (ADS)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.

PubMed

Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui

2009-04-01

Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

Gene expression of galectin-9/ecalectin, a potent eosinophil chemoattractant, and/or the insertional isoform in human colorectal carcinoma cell lines and detection of frame-shift mutations for protein sequence truncations in the second functional lectin domain.

PubMed

Lahm, H; Hoeflich, A; Andre, S; Sordat, B; Kaltner, H; Wolf, E; Gabius, H J

2000-09-01

The family of Ca2+-independent galactoside-binding lectins with the beta-strand topology of the jelly-roll, referred to as galectins, is known to mediate and modulate a variety of cellular activities. Their functional versatility explains the current interest in monitoring their expression in cancer research, so far primarily focused on galectin-1 and -3. Tandem-repeat-type galectin-9 and its (most probably) allelic variant ecalectin, a potent eosinophil chemoattractant, are known to be human leukocyte products. We show by RT-PCR with primers specific for both that their mRNA is expressed in 17 of 21 human colorectal cancer lines. As also indicated by restriction analysis, in addition to the expected transcript of 571 bp an otherwise identical isoform coding for a 32-amino acid extension of the link peptide was detected. Positive cell lines differentially expressed either one (7 lines) or both transcripts (10 lines). Sequence analysis of RT-PCR products, performed in four cases, allowed to assign the standard transcript to ecalectin in the case of SW480 cells and detected two point mutations in the insert of the link peptide-coding sequence in WiDr and Colo205. Furthermore, this analysis identified the insertion of a single nucleotide into the coding sequence generating a frame-shift mutation, an event which has so far not been reported for any galectin. This alteration encountered in both transcripts of the WiDr line and the isoform transcript of Colo205 cells will most likely truncate the protein part within the second (C-terminal) carbohydrate recognition domain. Our results thus reveal the presence of mRNA for a galectin-9-isoform or a potent eosinophil chemoattractant (ecalectin) or a truncated version thereof with preserved N-terminal carbohydrate recognition domain in established human colon cancer cell lines.

Risk of venous thromboembolism in hospitalized patients with peripherally inserted central catheters.

PubMed

Lobo, Bob L; Vaidean, Georgeta; Broyles, Joyce; Reaves, Anne B; Shorr, Ronald I

2009-09-01

Peripherally inserted central catheters (PICC) are increasingly used in hospitalized patients. The benefit can be offset by complications such as upper extremity deep vein thrombosis (UEDVT). Retrospective study of patients who received a PICC while hospitalized at the Methodist University Hospital (MUH) in Memphis, TN. All adult consecutive patients who had PICCs inserted during the study period and who did not have a UEDVT at the time of PICC insertion were included in the study. A UEDVT was defined as a symptomatic event in the ipsilateral extremity, leading to the performance of duplex ultrasonography, which confirmed the diagnosis of UEDVT. Pulmonary embolism (PE) was defined as a symptomatic event prompting the performance of ventilation-perfusion lung scan or spiral computed tomography (CT). Among 777 patients, 38 patients experienced 1 or more venous thromboembolisms (VTEs), yielding an incidence of 4.89%. A total of 7444 PICC-days were recorded for 777 patients. This yields a rate of 5.10 VTEs/1000 PICC-days. Compared to patients whose PICC was inserted in the SVC, patients whose PICC was in another location had an increased risk (odds ratio = 2.61 [95% CI = 1.28-5.35]) of VTE. PICC related VTE was significantly more common among patients with a past history of VTE (odds ratio = 10.83 [95% CI = 4.89-23.95]). About 5% of patients undergoing PICC placement in acute care hospitals will develop thromboembolic complications. Thromboembolic complications were especially common among persons with a past history of VTE. Catheter tip location at the time of insertion may be an important modifiable risk factor. Copyright 2009 Society of Hospital Medicine.

Caregiver Education Reduces the Incidence of Community-Acquired CLABSIs in the Pediatric Patient With Intestinal Failure.

PubMed

Drews, Barbie; Macaluso, Michelle; Piper, Hannah; Channabasappa, Nandini

Pediatric patients with intestinal failure often require central venous catheters for extended periods of time for parenteral nutrition, blood sampling, and medication administration, increasing morbidity, mortality, and costs. In 2007, we reported a central line-associated bloodstream infection rate of 7.0 per 1,000 catheter line-days in our pediatric patients with intestinal failure. On the basis of this high rate of catheter-associated infections, we developed and implemented a central line care curriculum for patients/family caregivers and home health nurses. We aim to show with the implementation of patient/family caregiver and home health nurse standardized education, the central line-associated bloodstream infection rate can be significantly reduced and that this is sustainable. A retrospective review of 80 pediatric outpatients with intestinal failure and long-term central venous access was performed between January 1, 2009, and December 31, 2014. During this time period, the nursing department at Children's Medical Center of Dallas implemented a systematic central line care education program for patients and/or caregivers. The number of community-acquired central line-associated bloodstream infections during this time period was collected and compared with our previously reported data from 2005 to 2007 prior to the implementation of education program. With the implementation of standardized care guidelines and a central venous catheter care curriculum, the community-acquired rate decreased from 4.8 to 2.9 per 1,000 catheter-days in 80 patients with intestinal failure between January 1, 2009, and December 31, 2014 (p < .001). This was also a significant decrease compared with the initial central line-associated bloodstream infection rate of 7.0 per 1,000 central line days in 2007 (p < .001) prior to the development of the central venous catheter care curriculum. We have shown that the incidence of community-acquired central line-associated bloodstream infections in children with intestinal failure can be reduced through formal education of central venous catheter care to family members.

Advantages and disadvantages of surgical placement of PD catheters with regard to other methods.

PubMed

Stegmayr, B

2006-01-01

Peritoneal dialysis is underused for various reasons. One reason may be problems with insertion of catheters for access. Another reason is the delayed start (break-in period) of about 2 weeks after operation. This review describes various approaches to the insertion of a peritoneal dialysis catheter. The optimal conditions to strive for are given as is an overview of various techniques. This article favours surgical placement while others might prefer other techniques. Described is the use a 3-purse string suture technique that allows immediate start of dialysis after catheter insertion both for acute dialysis indications as well as for acute start in chronic dialysis patients. A key to lesser complications is to establish a team devoted to the insertions rather than to allow various physicians to perform insertions as a training procedure. An optimal access is one of the important life lines for these patients.

Managing Inadvertent Arterial Catheterization During Central Venous Access Procedures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicholson, Tony, E-mail: Tony.Nicholson@leedsth.nhs.uk; Ettles, Duncan; Robinson, Graham

2004-01-15

Purpose: Approximately 200,000 central venous catheterizations are carried out annually in the National Health Service in the United Kingdom. Inadvertent arterial puncture occurs in up to 3.7%. Significant morbidity and death has been reported. We report on our experience in the endovascular treatment of this iatrogenic complication. Methods: Retrospective analysis was carried out of 9 cases referred for endovascular treatment of inadvertent arterial puncture during central venous catheterization over a 5 year period. Results: It was not possible to obtain accurate figures on the numbers of central venous catheterizations carried out during the time period. Five patients were referred withmore » carotid or subclavian pseudoaneurysms and hemothorax following inadvertent arterial catheter insertion and subsequent removal. These patients all underwent percutaneous balloon tamponade and/or stent-graft insertion. More recently 4 patients were referred with the catheter still in situ and were successfully treated with a percutaneous closure device. Conclusion: If inadvertent arterial catheterization during central venous access procedures is recognized and catheters removed, sequelae can be treated percutaneously. However, once the complication is recognized it is better to leave the catheter in situ and seal the artery percutaneously with a closure device.« less

Increased rate of venous thrombosis may be associated with inpatient dihydroergotamine treatment.

PubMed

Tso, Amy R; Patniyot, Irene R; Gelfand, Amy A; Goadsby, Peter J

2017-07-18

To review whether the incidence of catheter-associated venous thromboses was higher in patients receiving IV dihydroergotamine compared to lidocaine. We retrospectively reviewed all admissions at the University of California, San Francisco Headache Center from February 25, 2008, through October 31, 2014, for age, sex, diagnosis, aura, treatment dose, type of IV line used, days with line, superficial (SVT) or deep venous thrombosis (DVT), and pulmonary embolism (PE). A peripherally inserted central catheter (PICC) or midline catheter was placed in 315 of 589 (53%) admissions. Mean age was 38 years with a range of 6 to 79 years; 121 patients (21%) were ≤18 years old. Seventy-four percent (433 of 589) of patients were female. Of 263 dihydroergotamine admissions using a PICC or midline catheter, 19 (7.2%) had either an SVT or DVT or a PE; 2 patients were diagnosed with both DVT and PE. Of 52 lidocaine admissions using a PICC or midline catheter, none had a thrombotic event ( p = 0.05, Fisher exact test). Age, sex, aura, total dihydroergotamine dose, and number of days with line were not significant predictors of venous thrombosis. IV dihydroergotamine treatment may be associated with an increased risk of catheter-associated venous thrombosis. A low threshold for diagnostic ultrasound investigation is appropriate because anticoagulation therapy was frequently required. © 2017 American Academy of Neurology.

An integrated tunable isolator based on NiZn film fabricated by spin-spray plating

NASA Astrophysics Data System (ADS)

Guo, Rongdi; Lin, Hwaider; Shi, Wei; Gao, Yuan; Wang, Zhiguang; Sun, Nian Xiang; Yu, Zhong; Lan, Zhongwen

2018-05-01

An innovative type of tunable isolator with a planar comb-like microstrip transmission line, which generate circular polarization magnetic field, has been realized with polycrystalline NiZn ferrite thick films fabricated by spin-spray plating (SSP) process with thickness of 10μm. The phase compositions, microstructure, magnetic hysteresis loop, and ferromagnetic resonance (FMR) linewidth of NiZn ferrite thick films have been characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), vibrating sample magnetometer (VSM) and electron spin resonance (ESR) spectrometer, respectively. The NiZn ferrite thick films possess 4800Gauss saturation magnetization and 190Oe FMR linewidth measured at X-band. With an in-plane dc magnetic bias perpendicular to the comb-like microstrip transmission line, the transmission direction of left-hand circular polarization (LHCP) and right-hand circular polarization (RHCP) were proved to be opposite. The non-reciprocal ferromagnetic resonance absorption leads to 11.6dB isolation and 5.78dB insertion loss at 17.57GHz with magnetic bias field of 3.5kOe. Furthermore, with external in-plane magnetic fields range from 0.5kOe to 3.5kOe, the central frequency was tuned from 5.63GHz to 17.57GHz. The state-of-the-art tunable isolator with a planar comb-like microstrip transmission line exhibit a great potential to be applied in different microwave components and radar system.

Elastin Cables Define the Axial Connective Tissue System in the Murine Lung.

PubMed

Wagner, Willi; Bennett, Robert D; Ackermann, Maximilian; Ysasi, Alexandra B; Belle, Janeil; Valenzuela, Cristian D; Pabst, Andreas; Tsuda, Akira; Konerding, Moritz A; Mentzer, Steven J

2015-11-01

The axial connective tissue system is a fiber continuum of the lung that maintains alveolar surface area during changes in lung volume. Although the molecular anatomy of the axial system remains undefined, the fiber continuum of the lung is central to contemporary models of lung micromechanics and alveolar regeneration. To provide a detailed molecular structure of the axial connective tissue system, we examined the extracellular matrix of murine lungs. The lungs were decellularized using a 24 hr detergent treatment protocol. Systematic evaluation of the decellularized lungs demonstrated no residual cellular debris; morphometry demonstrated a mean 39 ± 7% reduction in lung dimensions. Scanning electron microscopy (SEM) demonstrated an intact structural hierarchy within the decellularized lung. Light, fluorescence, and SEM of precision-cut lung slices demonstrated that alveolar duct structure was defined by a cable line element encased in basement membrane. The cable line element arose in the distal airways, passed through septal tips and inserted into neighboring blood vessels and visceral pleura. The ropelike appearance, collagenase resistance and anti-elastin immunostaining indicated that the cable was an elastin macromolecule. Our results indicate that the helical line element of the axial connective tissue system is composed of an elastin cable that not only defines the structure of the alveolar duct, but also integrates the axial connective tissue system into visceral pleura and peripheral blood vessels. © 2015 Wiley Periodicals, Inc.

Using the Theory of Planned Behavior to explore hospital-based nurses' intention to use peripherally inserted central catheter (PICC): a survey study.

PubMed

Bertani, Laura; Carone, Maria; Caricati, Luca; Demaria, Serena; Fantuzzi, Silvia; Guarasci, Alessandro; Pirazzoli, Luca

2016-11-22

The peripherally inserted central catheters (PICC) have become an alternative to the traditional CVC. PICCs are usually inserted by trained nurses who decided to attend and complete a special training on PICC insertion and management. The present work aimed to investigate the intention of using PICC in a sample of hospital-based nurses using the theory of planned behavior as theoretical framework. A cross-sectional design was used in which a questionnaire was delivered to 199 nurses. According to the theory of planned behavior, the attitude toward the use of PICC, subjective norms and perceived self-efficacy predicted the intention to use PICC. Contrary to the expectations, the effect of subjective norms on intention to use PICC was mediated by attitude and self-efficacy. Finally, age of participants was negatively related to the intention to use the PICC. The theory of planned behavior offers a useful framework to explain nurses' intention to use PICC. Shared norms favoring the use of PICC seem to increase both nurse's positive attitudes and self-efficacy whit respect to the use of these devices. Thus, it appears that to train professionals individually does not necessarily results in an increased use of PICC.

[Peripherally inserted central catheter antibiotic therapy for cystic fibrosis patients].

PubMed

Betegnie, A-L; Cracowski, C; Bedouch, P; Segond, C; Robein-Dobremez, M-J; Pin, I; Allenet, B

2014-11-01

Peripherally inserted central catheters (PICC) are more and more used for intravenous antibiotic infusions in cystic fibrosis (CF) patients in the Grenoble area (France). The aim of this study was to assess the use of this technique in this indication. 1. Retrospective evaluation of 102 consecutive PICC insertions over 3years and the incidence of adverse events during the therapy. 2. Prospective evaluation of 12 patient's satisfaction and their nurses over a 3-month period. 3. Comparative analysis of single domiciliary treatment costs using PICC versus peripheral catheter (PC). 102 PICC insertions were attempted in 31 patients. Seven failures and 7 complications occurred during the treatment requiring removal of the PICC, i.e. an overall success rate of 86.2% (88/102). Pain during PICC introduction was 4.2/10 (visual analogical scale). Mean satisfaction levels during therapy were 9.3/10 for patients and 8.7/10 for nurses. Compared with PC, all the patients said that PICC was "more comfortable". Differential costs of treatment with PC and with PICC at home were estimated at 57.15€ and 590.16€ respectively. PICC is an alternative to CP for intravenous antibiotherapy in CF patients, providing better safety and comfort. PICC use should be promoted in this indication. Copyright © 2013 SPLF. Published by Elsevier Masson SAS. All rights reserved.

Generation and validation of homozygous fluorescent knock-in cells using CRISPR-Cas9 genome editing.

PubMed

Koch, Birgit; Nijmeijer, Bianca; Kueblbeck, Moritz; Cai, Yin; Walther, Nike; Ellenberg, Jan

2018-06-01

Gene tagging with fluorescent proteins is essential for investigations of the dynamic properties of cellular proteins. CRISPR-Cas9 technology is a powerful tool for inserting fluorescent markers into all alleles of the gene of interest (GOI) and allows functionality and physiological expression of the fusion protein. It is essential to evaluate such genome-edited cell lines carefully in order to preclude off-target effects caused by (i) incorrect insertion of the fluorescent protein, (ii) perturbation of the fusion protein by the fluorescent proteins or (iii) nonspecific genomic DNA damage by CRISPR-Cas9. In this protocol, we provide a step-by-step description of our systematic pipeline to generate and validate homozygous fluorescent knock-in cell lines.We have used the paired Cas9D10A nickase approach to efficiently insert tags into specific genomic loci via homology-directed repair (HDR) with minimal off-target effects. It is time-consuming and costly to perform whole-genome sequencing of each cell clone to check for spontaneous genetic variations occurring in mammalian cell lines. Therefore, we have developed an efficient validation pipeline of the generated cell lines consisting of junction PCR, Southern blotting analysis, Sanger sequencing, microscopy, western blotting analysis and live-cell imaging for cell-cycle dynamics. This protocol takes between 6 and 9 weeks. With this protocol, up to 70% of the targeted genes can be tagged homozygously with fluorescent proteins, thus resulting in physiological levels and phenotypically functional expression of the fusion proteins.

Finding a solution: Heparinised saline versus normal saline in the maintenance of invasive arterial lines in intensive care.

PubMed

Everson, Matthew; Webber, Lucy; Penfold, Chris; Shah, Sanjoy; Freshwater-Turner, Dan

2016-11-01

We assessed the impact of heparinised saline versus 0.9% normal saline on arterial line patency. Maintaining the patency of arterial lines is essential for obtaining accurate physiological measurements, enabling blood sampling and minimising line replacement. Use of heparinised saline is associated with risks such as thrombocytopenia, haemorrhage and mis-selection. Historical studies draw variable conclusions but suggest that normal saline is at least as effective at maintaining line patency, although recent evidence has questioned this. We conducted a prospective analysis of the use of heparinised saline versus normal saline on unselected patients in the intensive care of our hospital. Data concerning duration of 471 lines insertion and reason for removal was collected. We found a higher risk of blockage for lines flushed with normal saline compared with heparinised saline (RR = 2.15, 95% CI 1.392-3.32, p  ≤ 0.001). Of the 56 lines which blocked initially (19 heparinised saline and 37 normal saline lines), 16 were replaced with new lines; 5 heparinised saline lines and 11 normal saline lines were reinserted; 5 of these lines subsequently blocked again, 3 of which were flushed with normal saline. Our study demonstrates a clinically important reduction in arterial line longevity due to blockages when flushed with normal saline compared to heparinised saline. We have determined that these excess blockages have a significant clinical impact with further lines being inserted after blockage, resulting in increased risks to patients, wasted time and cost of resources. Our findings suggest that the current UK guidance favouring normal saline flushes should be reviewed.

Health care-associated infection prevention in Japan: the role of safety culture.

PubMed

Sakamoto, Fumie; Sakihama, Tomoko; Saint, Sanjay; Greene, M Todd; Ratz, David; Tokuda, Yasuharu

2014-08-01

Limited data exist on the use of infection prevention practices in Japan. We conducted a nationwide survey to examine the use of recommended infection prevention strategies and factors affecting their use in Japanese hospitals. Between April 1, 2012, and January 31, 2013, we surveyed 971 hospitals in Japan. The survey instrument assessed general hospital and infection prevention program characteristics and use of infection prevention practices, including practices specific to preventing catheter-associated urinary tract infection (CAUTI), central line-associated bloodstream infection (CLABSI), and ventilator-associated pneumonia (VAP). Logistic regression models were used to examine multivariable associations between hospital characteristics and the use of the various prevention practices. A total of 685 hospitals (71%) responded to the survey. Maintaining aseptic technique during catheter insertion and maintenance, avoiding routine central line changes, and using maximum sterile barrier precautions and semirecumbent positioning were the only practices regularly used by more than one-half of the hospitals to prevent CAUTI, CLABSI, and VAP, respectively. Higher safety-centeredness was associated with regular use of prevention practices across all infection types. Although certain practices were used commonly, the rate of regular use of many evidence-based prevention practices was low in Japanese hospitals. Our findings highlight the importance of fostering an organization-wide atmosphere that prioritizes patient safety. Such a commitment to patient safety should in turn promote the use of effective measures to reduce health care-associated infections in Japan. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

Implementation of a central line maintenance care bundle in hospitalized pediatric oncology patients.

PubMed

Rinke, Michael L; Chen, Allen R; Bundy, David G; Colantuoni, Elizabeth; Fratino, Lisa; Drucis, Kim M; Panton, Stephanie Y; Kokoszka, Michelle; Budd, Alicia P; Milstone, Aaron M; Miller, Marlene R

2012-10-01

To investigate whether a multidisciplinary, best-practice central line maintenance care bundle reduces central line-associated blood stream infection (CLABSI) rates in hospitalized pediatric oncology patients and to further delineate the epidemiology of CLABSIs in this population. We performed a prospective, interrupted time series study of a best-practice bundle addressing all areas of central line care: reduction of entries, aseptic entries, and aseptic procedures when changing components. Based on a continuous quality improvement model, targeted interventions were instituted to improve compliance with each of the bundle elements. CLABSI rates and epidemiological data were collected for 10 months before and 24 months after implementation of the bundle and compared in a Poisson regression model. CLABSI rates decreased from 2.25 CLABSIs per 1000 central line days at baseline to 1.79 CLABSIs per 1000 central line days during the intervention period (incidence rate ratio [IRR]: 0.80, P = .58). Secondary analyses indicated CLABSI rates were reduced to 0.81 CLABSIs per 1000 central line days in the second 12 months of the intervention (IRR: 0.36, P = .091). Fifty-nine percent of infections resulted from Gram-positive pathogens, 37% of patients with a CLABSI required central line removal, and patients with Hickman catheters were more likely to have a CLABSI than patients with Infusaports (IRR: 4.62, P = .02). A best-practice central line maintenance care bundle can be implemented in hospitalized pediatric oncology patients, although long ramp-up times may be necessary to reap maximal benefits. Further research is needed to determine if this CLABSI rate reduction can be sustained and spread.

Histological Analysis of the Tibial Anterior Cruciate Ligament Insertion

PubMed Central

Siebold, Rainer; Oka, Shinya; Traut, Ulrike; Schuhmacher, Peter; Kirsch, Joachim

2017-01-01

Objective: To describe the morphology of the tibial ACL insertion by histological assessment in the sagittal plane. Methods: For histology the native (undissected) tibial ACL insertion of 6 fresh-frozen cadaveric knees was cut into 4 sagittal sections parallel to the long axis of the medial tibial spine. The slices were stained with hematoxylin and eosin, Safranin O and Russell-Movat pentachrome. All slices were digitalized and analyzed at a magnification of ×20. Results: From medial to lateral the anterior-posterior lengths of the ACL insertion were an average of 10.2, 9.3, 7.6 and 5.8 mm. The anterior margin of the tibial ACL insertion raised from an anterior ridge. The most medial ACL fibers rose along with a peak of the anterior part of the medial tibial spine in which the direct insertion was adjacent to the articular cartilage. Parts of the bony insertions of the anterior and posterior horns of the lateral meniscus were in close contact to the lateral ACL insertion. A small fat pad was located just posterior to the tibial ACL insertion. There were no central or posterolateral inserting ACL fibers in the area intercondylaris anterior. Conclusion: The functional intraligamentous midsubstance ACL fibers arose from the most posterior part of its bony tibial insertion in a flat and “C-shape” way. The anterior border of this functional ACL started from a bony ‘anterior ridge’ and the medial border was along with a peak of the medial tibial spine.

An active ac/ds transposon system for activation tagging in tomato cultivar m82 using clonal propagation.

PubMed

Carter, Jared D; Pereira, Andy; Dickerman, Allan W; Veilleux, Richard E

2013-05-01

Tomato (Solanum lycopersicum) is a model organism for Solanaceae in both molecular and agronomic research. This project utilized Agrobacterium tumefaciens transformation and the transposon-tagging construct Activator (Ac)/Dissociator (Ds)-ATag-Bar_gosGFP to produce activation-tagged and knockout mutants in the processing tomato cultivar M82. The construct carried hygromycin resistance (hyg), green fluorescent protein (GFP), and the transposase (TPase) of maize (Zea mays) Activator major transcript X054214.1 on the stable Ac element, along with a 35S enhancer tetramer and glufosinate herbicide resistance (BAR) on the mobile Ds-ATag element. An in vitro propagation strategy was used to produce a population of 25 T0 plants from a single transformed plant regenerated in tissue culture. A T1 population of 11,000 selfed and cv M82 backcrossed progeny was produced from the functional T0 line. This population was screened using glufosinate herbicide, hygromycin leaf painting, and multiplex polymerase chain reaction (PCR). Insertion sites of transposed Ds-ATag elements were identified through thermal asymmetric interlaced PCR, and resulting product sequences were aligned to the recently published tomato genome. A population of 509 independent, Ds-only transposant lines spanning all 12 tomato chromosomes has been developed. Insertion site analysis demonstrated that more than 80% of these lines harbored Ds insertions conducive to activation tagging. The capacity of the Ds-ATag element to alter transcription was verified by quantitative real-time reverse transcription-PCR in two mutant lines. The transposon-tagged lines have been immortalized in seed stocks and can be accessed through an online database, providing a unique resource for tomato breeding and analysis of gene function in the background of a commercial tomato cultivar.

Unique and redundant functional domains of APETALA1 and CAULIFLOWER, two recently duplicated Arabidopsis thaliana floral MADS-box genes.

PubMed

Alvarez-Buylla, Elena R; García-Ponce, Berenice; Garay-Arroyo, Adriana

2006-01-01

APETALA1 (AP1) and CAULIFLOWER (CAL) are closely related MADS box genes that are partially redundant during Arabidopsis thaliana floral meristem determination. AP1 is able to fully substitute for CAL functions, but not vice versa, and AP1 has unique sepal and petal identity specification functions. In this study, the unique and redundant functions of these two genes has been mapped to the four protein domains that characterize type-II MADS-domain proteins by expressing all 15 chimeric combinations of AP1 and CAL cDNA regions under control of the AP1 promoter in ap1-1 loss-of-function plants. The "in vivo" function of these chimeric genes was analysed in Arabidopsis plants by expressing the chimeras. Rescue of flower meristem and sepal/petal identities was scored in single and multiple insert homozygous transgenic lines. Using these chimeric lines, it was found that distinct residues of the AP1 K domain not shared by the same CAL domain are necessary and sufficient for complete recovery of floral meristem identity, in the context of the CAL protein sequence, while both AP1 COOH and K domains are indispensable for complete rescue of sepal identity. By contrast, either one of these two AP1 domains is necessary and sufficient for complete petal identity recovery. It was also found that there were positive and negative synergies among protein domains and their combinations, and that multiple-insert lines showed relatively better rescue than equivalent single-insert lines. Finally, several lines had flowers with extra sepals and petals suggesting that chimeric proteins yield abnormal transcriptional complexes that may alter the expression or regulation of genes that control floral organ number under normal conditions.

Program Aids In Printing FORTRAN-Coded Output

NASA Technical Reports Server (NTRS)

Akian, Richard A.

1993-01-01

FORPRINT computer program prints FORTRAN-coded output files on most non-Postscript printers with such extra features as control of fonts for Epson and Hewlett Packard printers. Rewrites data to printer and inserts correct printer-control codes. Alternative uses include ability to separate data or ASCII file during printing by use of editing software to insert "1" in first column of data line that starts new page. Written in FORTRAN 77.

Unique transposon landscapes are pervasive across Drosophila melanogaster genomes

PubMed Central

Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.

2015-01-01

To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579

Somatically Acquired LINE-1 Insertions in Normal Esophagus Undergo Clonal Expansion in Esophageal Squamous Cell Carcinoma.

PubMed

Doucet-O'Hare, Tara T; Sharma, Reema; Rodić, Nemanja; Anders, Robert A; Burns, Kathleen H; Kazazian, Haig H

2016-09-01

Squamous cell carcinoma of the esophagus (SCC) is the most common form of esophageal cancer in the world and is typically diagnosed at an advanced stage when successful treatment is challenging. Understanding the mutational profile of this cancer may identify new treatment strategies. Because somatic retrotransposition has been shown in tumors of the gastrointestinal system, we focused on LINE-1 (L1) mobilization as a source of genetic instability in this cancer. We hypothesized that retrotransposition is ongoing in SCC patients. The expression of L1 encoded proteins is necessary for retrotransposition to occur; therefore, we evaluated the expression of L1 open reading frame 1 protein (ORF1p). Using immunohistochemistry, we detected ORF1p expression in all four SCC cases evaluated. Using L1-seq, we identified and validated 74 somatic insertions in eight tumors of the nine evaluated. Of these, 12 insertions appeared to be somatic, not genetically inherited, and sub-clonal (i.e., present in less than one copy per genome equivalent) in the adjacent normal esophagus (NE), while clonal in the tumor. Our results indicate that L1 retrotransposition is active in SCC of the esophagus and that insertion events are present in histologically NE that expands clonally in the subsequent tumor. © 2016 WILEY PERIODICALS, INC.

Comparison of nitrile gloves and nitrile over Nomex gloves.

PubMed

Vorih, Deirdre Cronin; Bolton, Lauri D; Marcelynas, James; Nowicki, Thomas A; Jacobs, Lenworth; Robinson, Kenneth J

2009-01-01

Aeromedical flight crews must perform many tasks in flight requiring manual dexterity and fine precision. A common perception is that safety-enhancing fire-retardant gloves compromise patient care if worn during such tasks by providing added bulk and barrier to the hand. This study is a quantitative and qualitative analysis of this possible compromise to patient care. Sixteen practicing flight nurses and respiratory therapists were asked to perform 10 different standard patient care tasks while wearing either nitrile gloves or a nitrile-Nomex glove pair. Tasks were timed, rated as completed successfully or not, and were subsequently judged subjectively by the participants. Whereas the time required to insert an intravenous catheter and to insert a central line while wearing only nitrile gloves was significantly faster than when wearing both gloves, the time to perform all other tasks was not significantly different. In subjective ratings, the nitrile glove alone was scored significantly better than the two-glove combination by the study participants. Comfort, dexterity, tactile discrimination, and ease of use were all adversely affected by wearing a Nomex glove under a nitrile glove. Although the differences in times for most tasks may not be clinically significant, the difference in the subjective parameters may be great enough to cause helicopter emergency medical services (HEMS) practitioners to not wear Nomex gloves under nitrile gloves while performing procedures.

Upregulation of the Nr2f1-A830082K12Rik gene pair in murine neural crest cells results in a complex phenotype reminiscent of Waardenburg syndrome type 4

PubMed Central

Bergeron, Karl-F.; Nguyen, Chloé M. A.; Cardinal, Tatiana; Charrier, Baptiste; Silversides, David W.

2016-01-01

ABSTRACT Waardenburg syndrome is a neurocristopathy characterized by a combination of skin and hair depigmentation, and inner ear defects. In the type 4 form, these defects show comorbidity with Hirschsprung disease, a disorder marked by an absence of neural ganglia in the distal colon, triggering functional intestinal obstruction. Here, we report that the Spot mouse line – obtained through an insertional mutagenesis screen for genes involved in neural crest cell (NCC) development – is a model for Waardenburg syndrome type 4. We found that the Spot insertional mutation causes overexpression of an overlapping gene pair composed of the transcription-factor-encoding Nr2f1 and the antisense long non-coding RNA A830082K12Rik in NCCs through a mechanism involving relief of repression of these genes. Consistent with the previously described role of Nr2f1 in promoting gliogenesis in the central nervous system, we further found that NCC-derived progenitors of the enteric nervous system fail to fully colonize Spot embryonic guts owing to their premature differentiation in glial cells. Taken together, our data thus identify silencer elements of the Nr2f1-A830082K12Rik gene pair as new candidate loci for Waardenburg syndrome type 4. PMID:27585883

Upregulation of the Nr2f1-A830082K12Rik gene pair in murine neural crest cells results in a complex phenotype reminiscent of Waardenburg syndrome type 4.

PubMed

Bergeron, Karl-F; Nguyen, Chloé M A; Cardinal, Tatiana; Charrier, Baptiste; Silversides, David W; Pilon, Nicolas

2016-11-01

Waardenburg syndrome is a neurocristopathy characterized by a combination of skin and hair depigmentation, and inner ear defects. In the type 4 form, these defects show comorbidity with Hirschsprung disease, a disorder marked by an absence of neural ganglia in the distal colon, triggering functional intestinal obstruction. Here, we report that the Spot mouse line - obtained through an insertional mutagenesis screen for genes involved in neural crest cell (NCC) development - is a model for Waardenburg syndrome type 4. We found that the Spot insertional mutation causes overexpression of an overlapping gene pair composed of the transcription-factor-encoding Nr2f1 and the antisense long non-coding RNA A830082K12Rik in NCCs through a mechanism involving relief of repression of these genes. Consistent with the previously described role of Nr2f1 in promoting gliogenesis in the central nervous system, we further found that NCC-derived progenitors of the enteric nervous system fail to fully colonize Spot embryonic guts owing to their premature differentiation in glial cells. Taken together, our data thus identify silencer elements of the Nr2f1-A830082K12Rik gene pair as new candidate loci for Waardenburg syndrome type 4. © 2016. Published by The Company of Biologists Ltd.

DMEK lenticule preparation using an air dissection technique: central versus peripheral injection.

PubMed

Feizi, Sepehr; Javadi, Mohammad Ali

2016-01-01

To compare 2 sites of air injection to prepare donor lenticules for Descemet membrane (DM) endothelial keratoplasty. Fifty-one human corneoscleral buttons from donors aged 4 to 57 years were used. Corneoscleral buttons were placed endothelial side up and a 27-G needle was inserted just outside Schwalbe line and advanced immediately beneath the endothelium. Air was injected centrally inside the 8-mm zone (group 1) or peripherally approximately 1 mm in front of the limbus (group 2). Air injection was continued to extend the DM detachment as far as possible into the corneal periphery. Comparisons of central versus peripheral air injection were performed for reproducibility, the rate of usable tissue, and the type and diameter of the acquired bubble. The mean donor age was 30.0 ± 12.9 years. A big bubble was achieved following central or peripheral air injection in all cases. A usable donor lenticule (≥ 8.0 mm) was achieved in 95.7% of cases in group 1 and 89.3% of cases in group 2 (p>0.99). Both injection sites were comparable with regard to the diameter of the achieved bubbles (9.57 ± 2.11 mm versus 10.22 ± 2.34 mm, respectively, p = 0.32), the chance of complete DM detachment (39.1% versus 53.6%, respectively, p = 0.25), and the risk of bubble bursting (4.4% versus 7.1%, respectively, p = 0.41). The odds of a type 2 bubble increased by 11.86 for peripheral air injections compared to central injections (p = 0.01). Both injection sites exhibited comparable rates of usable donor lenticules. However, peripheral air injection was more likely to yield stroma-free grafts.

LINE-ABOVE-GROUND ATTENUATOR

DOEpatents

Wilds, R.B.; Ames, J.R.

1957-09-24

The line-above-ground attenuator provides a continuously variable microwave attenuator for a coaxial line that is capable of high attenuation and low insertion loss. The device consists of a short section of the line-above- ground plane type transmission lime, a pair of identical rectangular slabs of lossy material like polytron, whose longitudinal axes are parallel to and indentically spaced away from either side of the line, and a geared mechanism to adjust amd maintain this spaced relationship. This device permits optimum fineness and accuracy of attenuator control which heretofore has been difficult to achieve.

A Design of Terahertz Parallel Plate Dielectric Waveguide with Signal Line inserted for Ballistic Deflection Transistor Travelling Wave Amplifier

NASA Astrophysics Data System (ADS)

Wang, H.; Knepper, R.; Hossain, N.; Marthi, P.; Milithaler, J.-F.; Margala, M.

2017-10-01

In this paper a new waveguide design is proposed to be implemented as part of Ballistic Deflection Transistor (BDT) Traveling Wave Amplifier Design. The BDT is designed to be operated in the Terahertz regime. Due to its relatively low transconductance (gm=200µA/V), the entire structure will consist of ten stages, with 15 BDTs/stage, to reach a total gain of 30mA/V. In this case, the total length of the transmission line will be more than 400µm. We did the investigation for different structures and materials of the transmission line. For our Parallel Plate Dielectric Waveguide with Signal Line inserted (PPDWS) design, we are able to get an average loss of 0.46dB/mm at 0.8-1.4THz from ANSYS HFSS simulation. The return loss for input and output are better than -20dB at 0.8-1.7THz. Although it is designed for our future travelling wave amplifier, it can also be used for various other THz frequency applications.

49 CFR 71.7 - Boundary line between central and mountain zones.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 1 2013-10-01 2013-10-01 false Boundary line between central and mountain zones... BOUNDARIES § 71.7 Boundary line between central and mountain zones. (a) Montana-North Dakota. Beginning at... south along the range line between Rs. 30 and 31 W. to the southwest corner of sec. 19, T. 33 N., R. 30...

49 CFR 71.7 - Boundary line between central and mountain zones.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 1 2012-10-01 2012-10-01 false Boundary line between central and mountain zones... BOUNDARIES § 71.7 Boundary line between central and mountain zones. (a) Montana-North Dakota. Beginning at... south along the range line between Rs. 30 and 31 W. to the southwest corner of sec. 19, T. 33 N., R. 30...

49 CFR 71.7 - Boundary line between central and mountain zones.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 1 2014-10-01 2014-10-01 false Boundary line between central and mountain zones... BOUNDARIES § 71.7 Boundary line between central and mountain zones. (a) Montana-North Dakota. Beginning at... south along the range line between Rs. 30 and 31 W. to the southwest corner of sec. 19, T. 33 N., R. 30...

[Genetic structure of people from the Volga-Ural region and Central Asia from data of Alu-polymorphism].

PubMed

Khusainova, R I; Akhmetova, V L; Kutuev, I A; Salimova, A Z; Korshunova, T Iu; Lebedev, Iu B; Khusnutdinova, E K

2004-04-01

Nine Alu loci (Ya5NBC5, Ya5NBC27, Ya5NBC148, Ya5NBC182, YA5NBC361, ACE, ApoA1, PV92, TPA25) were analyzed in six ethnic populations (Trans-Ural Bashkirs, Tatars-Mishars, Mordovians-Moksha, Mountain Maris, Udmurts, and Komi-Permyaks) of the Volga-Ural region and in three Central Asian populations (Uzbeks, Kazakhs, and Uigurs). All Alu insertions analyzed appeared to be polymorphic in all populations examined. The frequency of insertion varied from 0.110 in Mountain Maris at the Ya5NBC5 locus to 0.914 in Tatars at the ApoA1 locus. The data on the allele frequency distribution at nine loci point to the existence of substantial genetic diversity in the populations examined. The value of the observed heterozygosity averaged over nine Alu insertions varied from 0.326 in Mountain Maris to 0.445 in Kazakhs and Uigurs. The level of the interpopulation genetic differences for the Volga-Ural population (Fst = 0.061) was higher than for the populations of Central Asia (Fst = 0.024), Europe (Fst = 0.02), and Southeastern Asia (Fst = 0.018). The populations examined were highly differentiated both in respect of linguistic characteristics and the geographical position. The data obtained confirmed the effectiveness of the marker system used for the assessment of genetic differentiation and the relationships between the ethnic groups.

A LINE-1 Insertion in DLX6 Is Responsible for Cleft Palate and Mandibular Abnormalities in a Canine Model of Pierre Robin Sequence

PubMed Central

Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.

2014-01-01

Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068

[Analysis of Alu-insertion polymorphism in three subethnic groups of Kalmyks].

PubMed

Khusainova, R I; Balinova, N V; Kutuev, I A; Spitsina, N Kh; Akhmetova, V L; Valiev, R R; Spitsyn, V A; Khusnutdinova, E K

2009-03-01

Eight Alu insertions at the NBC27, TPA25, NBC148, NBC123, ACE, APOA1, NBC51, and PV92 locus were examined in three subethnic groups of Kalmyks (Torgouds, Derbets, and Buzava). In general, the pattern of allele frequencies in Kalmyks was consistent with that in Asian populations of the world, and was similar to the Alu insertion frequencies pattern in Turkic populations of the Volga--Ural region and Central Asia. Pairwise comparisons of three subpopulations of Kalmyks with respect to the frequency distributions of eight Alu insertions revealed the differences between the groups examined. The coefficient of gene differentiation, F(st), constituted 1.37%, pointing to the common origin of the groups of interest, as well as to the uniformity of the gene pools of subethnic groups of Kalmyks examined.

Interfacial folding and membrane insertion of designed peptides studied by molecular dynamics simulations

PubMed Central

Im, Wonpil; Brooks, Charles L.

2005-01-01

The mechanism of interfacial folding and membrane insertion of designed peptides is explored by using an implicit membrane generalized Born model and replica-exchange molecular dynamics. Folding/insertion simulations initiated from fully extended peptide conformations in the aqueous phase, at least 28 Å away from the membrane interface, demonstrate a general mechanism for structure formation and insertion (when it occurs). The predominately hydrophobic peptides from the synthetic WALP and TMX series first become localized at the membrane-solvent interface where they form significant helical secondary structure via a helix–turn–helix motif that inserts the central hydrophobic residues into the membrane interior, and then fluctuations occur that provide a persistent helical structure throughout the peptide and it inserts with its N-terminal end moving across the membrane. More specifically, we observed that: (i) the WALP peptides (WALP16, WALP19, and WALP23) spontaneously insert in the membrane as just noted; (ii) TMX-1 also inserts spontaneously after a similar mechanism and forms a transmembrane helix with a population of ≈50% at 300 K; and (iii) TMX-3 does not insert, but exists in a fluctuating membrane interface-bound form. These findings are in excellent agreement with available experimental data and demonstrate the potential for new implicit solvent/membrane models together with advanced simulation protocols to guide experimental programs in exploring the nature and mechanism of membrane-associated folding and insertion of biologically important peptides. PMID:15860587

[Pregnancy date disk for inserting into prenatal records].

PubMed

Pluta, M; Dudenhausen, J W

1983-01-01

A pregnancy calculating disk - a loose-leaf insert for the antenatal record card--is intended to improve and relieve the prenatal service. A pregnancy calculating disk together with tables containing signs of risks and times for consultations helps towards speedy orientation in daily practice. The data displayed in graphic form gives the pregnant women information on the official guide-lines regarding recommended consultations and ultrasonic examinations during the course of a normal pregnancy.

Surprisingly facile CO2 insertion into cobalt alkoxide bonds: A theoretical investigation.

PubMed

Offermans, Willem K; Bizzarri, Claudia; Leitner, Walter; Müller, Thomas E

2015-01-01

Exploiting carbon dioxide as co-monomer with epoxides in the production of polycarbonates is economically highly attractive. More effective catalysts for this reaction are intensively being sought. To promote better understanding of the catalytic pathways, this study uses density functional theory calculations to elucidate the reaction step of CO2 insertion into cobalt(III)-alkoxide bonds, which is also the central step of metal catalysed carboxylation reactions. It was found that CO2 insertion into the cobalt(III)-alkoxide bond of [(2-hydroxyethoxy)Co(III)(salen)(L)] complexes (salen = N,N"-bis(salicyliden-1,6-diaminophenyl)) is exothermic, whereby the exothermicity depends on the trans-ligand L. The more electron-donating this ligand is, the more exothermic the insertion step is. Interestingly, we found that the activation barrier decreases with increasing exothermicity of the CO2 insertion. Hereby, a linear Brønsted-Evans-Polanyi relationship was found between the activation energy and the reaction energy.

Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes.

PubMed

Liu, Yangyang; Han, Xiao; Yuan, Junting; Geng, Tuoyu; Chen, Shihao; Hu, Xuming; Cui, Isabelle H; Cui, Hengmi

2017-04-07

The type II bacterial CRISPR/Cas9 system is a simple, convenient, and powerful tool for targeted gene editing. Here, we describe a CRISPR/Cas9-based approach for inserting a poly(A) transcriptional terminator into both alleles of a targeted gene to silence protein-coding and non-protein-coding genes, which often play key roles in gene regulation but are difficult to silence via insertion or deletion of short DNA fragments. The integration of 225 bp of bovine growth hormone poly(A) signals into either the first intron or the first exon or behind the promoter of target genes caused efficient termination of expression of PPP1R12C , NSUN2 (protein-coding genes), and MALAT1 (non-protein-coding gene). Both NeoR and PuroR were used as markers in the selection of clonal cell lines with biallelic integration of a poly(A) signal. Genotyping analysis indicated that the cell lines displayed the desired biallelic silencing after a brief selection period. These combined results indicate that this CRISPR/Cas9-based approach offers an easy, convenient, and efficient novel technique for gene silencing in cell lines, especially for those in which gene integration is difficult because of a low efficiency of homology-directed repair. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A Theoretical Model for Thin Film Ferroelectric Coupled Microstripline Phase Shifters

NASA Technical Reports Server (NTRS)

Romanofsky, R. R.; Quereshi, A. H.

2000-01-01

Novel microwave phase shifters consisting of coupled microstriplines on thin ferroelectric films have been demonstrated recently. A theoretical model useful for predicting the propagation characteristics (insertion phase shift, dielectric loss, impedance, and bandwidth) is presented here. The model is based on a variational solution for line capacitance and coupled strip transmission line theory.

Association between central papilla recession and gingival and interdental smile line.

PubMed

Kolte, Abhay P; Kolte, Rajashri A; Agrawal, Anshuka A; Shrirao, Tushar; Mankar, Kamal

2017-11-30

Interdental soft tissues play a critical role in pink esthetics. The presence and preservation of the interdental papillae in the esthetic zone is as crucial as the shape and contour of the anterior teeth in achieving an esthetically pleasing smile. The present study determines the association of central papilla recession with gingival and interdental smile line in periodontally healthy patients of different age groups. The present study included 200 patients equally divided into 21 to 40 years and 41 to 60 years age groups. The clinical and photographic evaluation of the central papilla, with midfacial gingiva, and its relationship with the vermilion border was performed. In total, 137 patients exhibited presence of central papilla, whilst 63 patients had central papilla recession with variable extent. The male patients predominantly had presence of central papilla in both the age groups, with 86% and 64%, compared with 74% and 50% in females, respectively. High gingival smile line was seen in the majority of the patients (62%), and this trend was similar to high interdental smile line (82% of the patients). Esthetics is affected in individuals having papilla recession along with high gingival smile line and interdental smile line as compared to individuals with low or cupid bow gingival smile line and interdental smile line.

Supraclavicular Approach to Ultrasound-Guided Brachiocephalic Vein Cannulation in Children and Neonates

PubMed Central

Merchaoui, Zied; Lausten-Thomsen, Ulrik; Pierre, Florence; Ben Laiba, Maher; Le Saché, Nolwenn; Tissieres, Pierre

2017-01-01

The correct choice of intra vascular access in critically ill neonates should be individualized depending on the type and duration of therapy, gestational and chronological age, weight and/or size, diagnosis, clinical status, and venous system patency. Accordingly, there is an ongoing demand for optimization of catheterization. Recently, the use of ultrasound (US)-guided cannulation of the subclavian vein (SCV) has been described in children and neonates. This article gives an overview of the current use of US for achieving central venous catheter placement in the SCV or the brachiocephalic vein (BCV) in neonates. More than 1,250 catheters have been reported inserted in children and neonates for a cumulated success rate of 98.4% and the complication rate is reported to be low. The technical aspects of various approaches are discussed, and we offer our recommendation of an US-guided technique for SCV and BCV cannulation based on our experience in a large NICU setting. Although the cannulation the SCV or BCV does not substitute the use of peripherally inserted central catheters or umbilical venous central catheters in neonates, it is a feasible route in very small children who are in need of a large caliber central venous access. PMID:29051889

Genomic deletions created upon LINE-1 retrotransposition.

PubMed

Gilbert, Nicolas; Lutz-Prigge, Sheila; Moran, John V

2002-08-09

LINE-1 (L1) retrotransposition continues to impact the human genome, yet little is known about how L1 integrates into DNA. Here, we developed a plasmid-based rescue system and have used it to recover 37 new L1 retrotransposition events from cultured human cells. Sequencing of the insertions revealed the usual L1 structural hallmarks; however, in four instances, retrotransposition generated large target site deletions. Remarkably, three of those resulted in the formation of chimeric L1s, containing the 5' end of an endogenous L1 fused precisely to our engineered L1. Thus, our data demonstrate multiple pathways for L1 integration in cultured cells, and show that L1 is not simply an insertional mutagen, but that its retrotransposition can result in significant deletions of genomic sequence.

Rugged fiber optic probe for raman measurement

DOEpatents

O'Rourke, Patrick E.; Toole, Jr., William R.; Nave, Stanley E.

1998-01-01

An optical probe for conducting light scattering analysis is disclosed. The probe comprises a hollow housing and a probe tip. A fiber assembly made up of a transmitting fiber and a receiving bundle is inserted in the tip. A filter assembly is inserted in the housing and connected to the fiber assembly. A signal line from the light source and to the spectrometer also is connected to the filter assembly and communicates with the fiber assembly. By using a spring-loaded assembly to hold the fiber connectors together with the in-line filters, complex and sensitive alignment procedures are avoided. The close proximity of the filter assembly to the probe tip eliminates or minimizes self-scattering generated by the optical fiber. Also, because the probe can contact the sample directly, sensitive optics can be eliminated.

Endovascular intervention for central venous cannulation in patients with vascular occlusion after previous catheterization.

PubMed

Pikwer, Andreas; Acosta, Stefan; Kölbel, Tilo; Åkeson, Jonas

2010-01-01

This study was designed to assess endovascular intervention for central venous cannulation in patients with vascular occlusion after previous catheterization. Patients referred for endovascular management of central venous occlusion during a 42-month period were identified from a regional endovascular database, providing prospective information on techniques and clinical outcome. Corresponding patient records, angiograms, and radiographic reports were analyzed retrospectively. Sixteen patients aged 48 years (range 0.5-76), including 11 females, were included. All patients but 1 had had multiple central venous catheters with a median total indwelling time of 37 months. Eleven patients cannulated for hemodialysis had had significantly fewer individual catheters inserted compared with 5 patients cannulated for nutritional support (mean 3.6 vs. 10.2, p<0.001) before endovascular intervention. Preoperative imaging by magnetic resonance tomography (MRT) in 8 patients, computed tomography (CT) venography in 3, conventional angiography in 6, and/or ultrasonography in 8, verified 15 brachiocephalic, 13 internal jugular, 3 superior caval, and/or 3 subclavian venous occlusions. Patients were subjected to recanalization (n=2), recanalization and percutaneous transluminal angioplasty (n=5), or stenting for vena cava superior syndrome (n=1) prior to catheter insertion. The remaining 8 patients were cannulated by avoiding the occluded route. Central venous occlusion occurs particularly in patients under hemodialysis and with a history of multiple central venous catheterizations with large-diameter catheters and/or long total indwelling time periods. Patients with central venous occlusion verified by CT or MRT venography and need for central venous access should be referred for endovascular intervention.

Fibrin Sheath Angioplasty: A Technique to Prevent Superior Vena Cava Stenosis Secondary to Dialysis Catheters

PubMed Central

Hacker, Robert I.; Garcia, Lorena De Marco; Chawla, Ankur; Panetta, Thomas F.

2012-01-01

Fibrin sheaths are a heterogeneous matrix of cells and debris that form around catheters and are a known cause of central venous stenosis and catheter failure. A total of 50 cases of central venous catheter fibrin sheath angioplasty (FSA) after catheter removal or exchange are presented. A retrospective review of an outpatient office database identified 70 eligible patients over a 19-month period. After informed consent was obtained, the dialysis catheter exiting the skin was clamped, amputated, and a wire was inserted. The catheter was then removed and a 9-French sheath was inserted into the superior vena cava, a venogram was performed. If a fibrin sheath was present, angioplasty was performed using an 8 × 4 or 10 × 4 balloon along the entire length of the fibrin sheath. A completion venogram was performed to document obliteration of the sheath. During the study, 50 patients were diagnosed with a fibrin sheath, and 43 had no pre-existing central venous stenosis. After FSA, 39 of the 43 patient's (91%) central systems remained patent without the need for subsequent interventions; 3 patients (7%) developed subclavian stenoses requiring repeat angioplasty and stenting; 1 patent (2.3%) developed an occlusion requiring a reintervention. Seven patients with prior central stenosis required multiple angioplasties; five required stenting of their central lesions. Every patient had follow-up fistulograms to document long-term patency. We propose that FSA is a prudent and safe procedure that may help reduce the risk of central venous stenosis from fibrin sheaths due to central venous catheters. PMID:23997555

Anatomic and isometric points on femoral attachment site of popliteus muscle-tendon complex for the posterolateral corner reconstruction.

PubMed

Yang, Jae-Hyuk; Lim, Hong Chul; Bae, Ji Hoon; Fernandez, Harry; Bae, Tae Soo; Wang, Joon Ho

2011-10-01

Descriptive laboratory study. The femoral anatomic insertion site and the optimal isometric point of popliteus tendon for posterolateral reconstruction are not well known. Purpose of this study was to determine the relative relationship between the femoral anatomic insertion and isometric point of popliteus muscle-tendon complex with the lateral epicondyle of femur. Thirty unpaired cadaveric knees were dissected to determine the anatomic femoral insertion of the popliteus tendon. The distance and the angle from the lateral epicondyle of femur to the center of the anatomic insertion of the popliteus tendon were measured using digital caliper and goniometer. Eight unpaired fresh cadaveric knees were examined to determine the optimal isometric point of femoral insertion of popliteus tendon using computer-controlled motion capture analysis system (Motion Analysis, CA, USA). Distances from targeted tibial tunnel for popliteus tendon reconstruction to the 35 points gained on the lateral surface of femur were recorded at 0, 30, 60, 90, and 120° knee flexion. A point with the least excursion (<2.0 mm) was determined as the isometric point. The center of anatomic insertion points and the optimal isometric point for the main fibers of popliteus tendon were found to be posterior and distal to the lateral epicondyle of femur. The distance from the lateral epicondyle of femur to the center of anatomic femoral insertion of popliteus tendon was 11.3 ± 1.2 mm (mean ± SD). The angle between long axis of femur and the line from lateral epicondyle of femur to anatomic femoral insertion of popliteus tendon was 31.4 ± 5.3°. The isometric points for the femoral insertion of popliteus muscle-tendon complex were situated posterior and distal to the lateral epicondyle in all 8 knees. The distance between the least excursion point and the lateral epicondyle was calculated as 10.4 ± 1.7 mm. The angle between the long axis of femur and the line from lateral epicondyle of femur to optimum isometric point of popliteus tendon was calculated as 41.3 ± 14.9°. The optimal isometric point for the femoral insertion of popliteus muscle-tendon complex is situated posterior and distal to the lateral epicondyle of femur. Femoral tunnel for "posterolateral corner sling procedure" should be placed at this point to achieve least amount of graft excursion during knee motion.

Functional impact of the human mobilome.

PubMed

Babatz, Timothy D; Burns, Kathleen H

2013-06-01

The human genome is replete with interspersed repetitive sequences derived from the propagation of mobile DNA elements. Three families of human retrotransposons remain active today: LINE1, Alu, and SVA elements. Since 1988, de novo insertions at previously recognized disease loci have been shown to generate highly penetrant alleles in Mendelian disorders. Only recently has the extent of germline-transmitted retrotransposon insertion polymorphism (RIP) in human populations been fully realized. Also exciting are recent studies of somatic retrotransposition in human tissues and reports of tumor-specific insertions, suggesting roles in tissue heterogeneity and tumorigenesis. Here we discuss mobile elements in human disease with an emphasis on exciting developments from the last several years. Copyright © 2013 Elsevier Ltd. All rights reserved.

49 CFR 71.5 - Boundary line between eastern and central zones.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 1 2010-10-01 2010-10-01 false Boundary line between eastern and central zones... BOUNDARIES § 71.5 Boundary line between eastern and central zones. (a) Minnesota-Michigan-Wisconsin. From the junction of the western boundary of the State of Michigan with the boundary between the United States and...

Mixed Modeling of a SAW Delay Line Using VHDL-AMS

NASA Technical Reports Server (NTRS)

Wilson, William C.; Atkinson, Gary M.

2006-01-01

To aid in the development of SAW sensors for aerospace applications we have created a model of a SAW Delay line using VHDL. The model implements the Impulse Response method to calculate the frequency response, impedance, and insertion loss. The model includes optimization for the number of finger pairs in the IDTs and for the aperture height. This paper presents the model and the results from the model for a SAW delay line design.

Central venous access by trainees: a systematic review and meta-analysis of the use of simulation to improve success rate on patients.

PubMed

Madenci, Arin L; Solis, Carolina V; de Moya, Marc A

2014-02-01

Simulation training for invasive procedures may improve patient safety by enabling efficient training. This study is a meta-analysis with rigorous inclusion and exclusion criteria designed to assess the real patient procedural success of simulation training for central venous access. Published randomized controlled trials and prospective 2-group cohort studies that used simulation for the training of procedures involving central venous access were identified. The quality of each study was assessed. The primary outcome was the proportion of trainees who demonstrated the ability to successfully complete the procedure. Secondary outcomes included the mean number of attempts to procedural success and periprocedural adverse events. Proportions were compared between groups using risk ratios (RRs), whereas continuous variables were compared using weighted mean differences. Random-effects analysis was used to determine pooled effect sizes. We identified 550 studies, of which 5 (3 randomized controlled trials, 2 prospective 2-group cohort studies) studies of central venous catheter (CVC) insertion were included in the meta-analysis, composed of 407 medical trainees. The simulation group had a significantly larger proportion of trainees who successfully placed CVCs (RR, 1.09; 95% confidence interval [CI], 1.03-1.16, P<0.01). In addition, the simulation group had significantly fewer mean attempts to CVC insertion (weighted mean difference, -1.42; 95% CI, -2.34 to -0.49, P<0.01). There was no significant difference in the rate of adverse events between the groups (RR, 0.50; 95% CI, 0.19-1.29; P=0.15). Training programs should consider adopting simulation training for CVC insertion to improve the real patient procedural success of trainees.

Knowledge of nursing students about central venous catheters.

PubMed

Mlinar, Suzana; Malnarsić, Rosanda Rasković

2012-04-01

Central venous catheters (CVC) are at the crucial importance, particulary in the intensive therapy units. In order to handle a CVC safely, nursing students need to acquire theoretical and practical knowledge during the course of their studies. The aim of the study was to establish theoretical knowledge of nursing students about the procedures of nurses in placing and removing a central venous catheter (CVC), dressing the catheter entry point, the reasons for measuring central venous pressure (CVP), possible complications and risk factors for developing infections related to CVC. The questionnaire developed specifically for this cross-sectionl study was handed out to 87 full-time students and 57 part-time students. The results show that all the surveyed nursing students know why chest radiography is carried out when inserting a catheter, have relatively good knowledge of CVC insertion points, procedures carried out in case of a suspected catheter sepsis and complications and risk factors for the development of infections related to CVC. However, the study show that the majority of students have insufficient knowledge of the procedures accompanying insertion of a catheter, signs that indicate correct functioning of CVC, frequency of flushing a catheter when it is not in use and the reasons for introducing an implanted CVC. Based on the results of the study it can be concluded that the second-year nursing students have insufficient knowledge of CVC. In order to correctly and safely handle a CVC, good theoretical knowledge and relevant practical experience are needed. The authors therefore believe that, in future, the classes should be organized in smaller groups with step-by-step demonstrations of individual procedures in handling a CVC, and the students encouraged to learn as actively as possible.

Provirus Integration at the 3 Region of N‐myc in Cell Lines Established from Thymic Lymphomas Spontaneously Formed in AKR Mice and a [(BALB/c × B6)F1AKR] Bone Marrow Chimera

PubMed Central

Yano, Yoko; Kobayashi, Seiichi; Yasumizu, Ryoji; Tamaki, Junko; Kubo, Mitsumasa; Sasaki, Akio; Hasan, Shahid; Okuyama, Harue; Inaba, Muneo; Ikehara, Susumu; Hiai, Hiroshi; Kakinuma, Mitsuaki

1991-01-01

Among 18 thymic leukemia cell lines which have been established from spontaneous thymic lym‐phomas in AKR mice as well as in bone marrow chimeras which were constructed by transplanting allogeneic bone marrow cells into irradiated AKR mice, three proviral integration sites were identified; near c‐myc, N‐myc and pim‐l loci. No integration site specific for chimeric leukemia cell lines was found. In three thymic leukemia cell lines which contained rearranged N‐myc, genes, insertions of long terminal repeats (LTRs) of murine leukemia viruses were detected at 18 or 20 bp downstream of the translational termination codon. These results demonstrate that the 3’region of the N‐myc gene is one of the integration targets for murine leukemia viruses in spontaneous thymic lymphomas. In these three cell lines, N‐myc mRNA was stably transcribed and transcription of c‐myc mRNA was down‐regulated. The integrated murine leukemia viruses in AKR thymic leukemia were most likely AKV, though the DNA sequence of the LTR inserted in the genome of a leukemic cell line from [(BALB/c × B6)F1‐AKR], CAK20, was different from LTRs of murine leukemia viruses so far reported. PMID:1900822

Conservative site-specific and single-copy transgenesis in human LINE-1 elements

PubMed Central

Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter

2016-01-01

Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710

A novel role for the Drosophila epsin (lqf): involvement in autophagy.

PubMed

Csikós, György; Lippai, Mónika; Lukácsovich, Tamás; Juhász, Gábor; Henn, László; Erdélyi, Miklós; Maróy, Péter; Sass, Miklós

2009-07-01

Screening P-element-induced mutant collections, 52 lines were selected as potentially defected ones in endocytosis or autophagy. After excluding those which were rescued by 20-hydroxyecdysone treatment, the exact position of the inserted P-element was determined in the remaining lines. In the case of l(3)S011027 stock, the liquid facets (lqf) gene was affected which codes an epsin-homolog protein in Drosophila. We reveal that Lqf is essential to the receptor-mediated endocytosis of larval serum proteins (LSPs) in the larval fat body cells of Drosophila. In l(3)S011027 line, lack of Lqf fails the formation of autophagosomes thus leading to the arrest of destroying of trophocytes. Transgenic larvae carrying Lqf-RNAi construct were unable to generate endocytic and autophagic vacuoles and led to a prolonged larval stage. On the other hand, Lqf protein showed an exclusive colocalization with the LysoTracker Red- or GFP-Atg8a labeled autophagosomes. By using the antiserum generated against the fifth exon of lqf, we demonstrated that prior to the onset of developmental autophagy the Lqf protein was present in the nucleus of fat body cell, but thereafter the protein was localized in the territory of endocytic and autophagic vacuoles. The fact that the inhibition of the target of rapamycin (TOR) did not restore the autophagic process and the normal development in the case of lqf mutant larvae points to that the Lqf is downstream to the TOR, the central kinase of the autophagy pathway.

Binaural electric-acoustic interactions recorded from the inferior colliculus of Guinea pigs: the effect of masking observed in the central nucleus of the inferior colliculus.

PubMed

Noh, Heil; Lee, Dong-Hee

2012-09-01

To investigate the electric-acoustic interactions within the inferior colliculus of guinea pigs and to observe how central masking appears in invasive neural recordings of the inferior colliculus (IC). A platinum-iridium wire was inserted to scala tympani through cochleostomy with a depth no greater than 1 mm for intracochlear stimulation of electric pulse train. A 5 mm 100 µm, single-shank, thin-film, penetrating recording probe was inserted perpendicularly to the surface of the IC in the coronal plane at an angle of 30-40° off the parasagittal plane with a depth of 2.0-2.5 mm. The peripheral and central masking effects were compared using electric pulse trains to the left ear and acoustic noise to the left ear (ipsilateral) and to the right ear (contralateral). Binaural acoustic stimuli were presented with different time delays and compared with combined electric and acoustic stimuli. The averaged evoked potentials and total spike numbers were measured using thin-film electrodes inserted into the central nucleus of the IC. Ipsilateral noise had more obvious effects on the electric response than did contralateral noise. Contralateral noise decreased slightly the response amplitude to the electric pulse train stimuli. Immediately after the onset of acoustic noise, the response pattern changed transiently with shorter response intervals. The effects of contralateral noise were evident at the beginning of the continuous noise. The total spike number decreased when the binaural stimuli reached the IC most simultaneously. These results suggest that central masking is quite different from peripheral masking and occurs within the binaural auditory system, and this study showed that the effect of masking could be observed in the IC recording. These effects are more evident and consistent with the psychophysical data from spike number analyses than with the previously reported gross potential data.

Internal Medicine Point-of-Care Ultrasound Curriculum: Consensus Recommendations from the Canadian Internal Medicine Ultrasound (CIMUS) Group.

PubMed

Ma, Irene W Y; Arishenkoff, Shane; Wiseman, Jeffrey; Desy, Janeve; Ailon, Jonathan; Martin, Leslie; Otremba, Mirek; Halman, Samantha; Willemot, Patrick; Blouw, Marcus

2017-09-01

Bedside point-of-care ultrasound (POCUS) is increasingly used to assess medical patients. At present, no consensus exists for what POCUS curriculum is appropriate for internal medicine residency training programs. This document details the consensus-based recommendations by the Canadian Internal Medicine Ultrasound (CIMUS) group, comprising 39 members, representing 14 institutions across Canada. Guiding principles for selecting curricular content were determined a priori. Consensus was defined as agreement by at least 80% of the members on POCUS applications deemed appropriate for teaching and assessment of trainees in the core (internal medicine postgraduate years [PGY] 1-3) and expanded (general internal medicine PGY 4-5) training programs. We recommend four POCUS applications for the core PGY 1-3 curriculum (inferior vena cava, lung B lines, pleural effusion, and abdominal free fluid) and three ultrasound-guided procedures (central venous catheterization, thoracentesis, and paracentesis). For the expanded PGY 4-5 curriculum, we recommend an additional seven applications (internal jugular vein, lung consolidation, pneumothorax, knee effusion, gross left ventricular systolic function, pericardial effusion, and right ventricular strain) and four ultrasound-guided procedures (knee arthrocentesis, arterial line insertion, arterial blood gas sampling, and peripheral venous catheterization). These recommendations will provide a framework for training programs at a national level.

Direct versus indirect ACL femoral attachment fibres and their implications on ACL graft placement.

PubMed

Moulton, Samuel G; Steineman, Brett D; Haut Donahue, Tammy L; Fontboté, Cristián A; Cram, Tyler R; LaPrade, Robert F

2017-01-01

To further elucidate the direct and indirect fibre insertion morphology within the human ACL femoral attachment using scanning electron microscopy and determine where in the footprint each fibre type predominates. The hypothesis was that direct fibre attachment would be found centrally in the insertion site, while indirect fibre attachment would be found posteriorly adjacent to the posterior articular cartilage. Ten cadaveric knees were dissected to preserve and isolate the entirety of the femoral insertion of the ACL. Specimens were then prepared and evaluated with scanning electron microscopy to determine insertional fibre morphology and location. The entirety of the fan-like projection of the ACL attachment site lay posterior to the lateral intercondylar ridge. In all specimens, a four-phase architecture, consistent with previous descriptions of direct fibres, was found in the centre of the femoral attachment site. The posterior margin of the ACL attachment attached directly adjacent to the posterior articular cartilage with some fibres coursing into it. The posterior portion of the ACL insertion had a two-phase insertion, consistent with previous descriptions of indirect fibres. The transition from the ligament fibres to bone had less interdigitations, and the interdigitations were significantly smaller (p < 0.001) compared to the transition in the direct fibre area. The interdigitations of the direct fibres were 387 ± 81 μm (range 282-515 μm) wide, while the interdigitations of indirect fibres measured 228 ± 75 μm (range 89-331 μm). The centre of the ACL femoral attachment consisted of a direct fibre structure, while the posterior portion had an indirect fibre structure. These results support previous animal studies reporting that the centre of the ACL femoral insertion was comprised of the strongest reported fibre type. Clinically, the femoral ACL reconstruction tunnel should be oriented to cover the entirety of the central direct ACL fibres and may need to be customized based on graft type and the fixation device used during surgery.

Skin disinfection with octenidine dihydrochloride for central venous catheter site care: a double-blind, randomized, controlled trial.

PubMed

Dettenkofer, M; Wilson, C; Gratwohl, A; Schmoor, C; Bertz, H; Frei, R; Heim, D; Luft, D; Schulz, S; Widmer, A F

2010-06-01

To compare the efficacy of two commercially available, alcohol-based antiseptic solutions for preparation and care of central venous catheter (CVC) insertion sites, with and without octenidine dihydrochloride, a double-blind, randomized, controlled trial was undertaken in the haematology units and in one surgical unit of two university hospitals. Adult patients with a non-tunnelled CVC were randomly assigned to two different skin disinfection regimens at the insertion site: 0.1% octenidine with 30% 1-propanol and 45% 2-propanol, and as control 74% ethanol with 10% 2-propanol. Endpoints were (i) skin colonization at the insertion site; (ii) positive culture from the catheter tip (> or = 15 CFU); and (iii) occurrence of CVC-associated bloodstream infection (defined according to criteria set by the CDC). Four hundred patients with inserted CVC were enrolled from May 2002 through April 2005. Both groups were similar in respect of patient characteristics and co-morbidities. Skin colonization at the CVC insertion site during the first 10 days was significantly reduced by octenidine treatment (relative difference octenidine vs. control: 0.21; 95%CI: 0.11-0.39, p <0.0001). Positive culture of the catheter tip was significantly less frequent in the octenidine group (7.9%) than in the control group (17.8%): OR = 0.39 (95%CI: 0.20-0.80, p 0.009). Patients treated with octenidine had a non-significant reduction in catheter-associated bloodstream infections (4.1% vs. 8.3%; OR = 0.44; 95%CI: 0.18-1.08, p 0.081). Side effects were similar in both groups. This randomized controlled trial supports the results of two observational studies demonstrating octenidine in alcoholic solution to be a better option than alcohol alone for the prevention of CVC-associated infections.

Use of simulation-based education to reduce catheter-related bloodstream infections.

PubMed

Barsuk, Jeffrey H; Cohen, Elaine R; Feinglass, Joe; McGaghie, William C; Wayne, Diane B

2009-08-10

Simulation-based education improves procedural competence in central venous catheter (CVC) insertion. The effect of simulation-based education in CVC insertion on the incidence of catheter-related bloodstream infection (CRBSI) is unknown. The aim of this study was to determine if simulation-based training in CVC insertion reduces CRBSI. This was an observational education cohort study set in an adult intensive care unit (ICU) in an urban teaching hospital. Ninety-two internal medicine and emergency medicine residents completed a simulation-based mastery learning program in CVC insertion skills. Rates of CRBSI from CVCs inserted by residents in the ICU before and after the simulation-based educational intervention were compared over a 32-month period. There were fewer CRBSIs after the simulator-trained residents entered the intervention ICU (0.50 infections per 1000 catheter-days) compared with both the same unit prior to the intervention (3.20 per 1000 catheter-days) (P = .001) and with another ICU in the same hospital throughout the study period (5.03 per 1000 catheter-days) (P = .001). An educational intervention in CVC insertion significantly improved patient outcomes. Simulation-based education is a valuable adjunct in residency education.

LagLoc - a new surgical technique for locking plate systems.

PubMed

Triana, Miguel; Gueorguiev, Boyko; Sommer, Christoph; Stoffel, Karl; Agarwal, Yash; Zderic, Ivan; Helfen, Tobias; Krieg, James C; Krause, Fabian; Knobe, Matthias; Richards, R Geoff; Lenz, Mark

2018-06-19

Treatment of oblique and spiral fractures remains challenging. The aim of this study was to introduce and investigate the new LagLoc technique for locked plating with generation of interfragmentary compression, combining the advantages of lag-screw and locking-head-screw techniques. Oblique fracture was simulated in artificial diaphyseal bones, assigned to three groups for plating with a 7-hole locking compression plate. Group I was plated with three locking screws in holes 1, 4 and 7. The central screw crossed the fracture line. In group II the central hole was occupied with a lag screw perpendicular to fracture line. Group III was instrumented applying the LagLoc technique as follows. Hole 4 was predrilled perpendicularly to the plate, followed by overdrilling of the near cortex and insertion of a locking screw whose head was covered by a holding sleeve to prevent temporarily the locking in the plate hole and generate interfragmentary compression. Subsequently, the screw head was released and locked in the plate hole. Holes 1 and 7 were occupied with locking screws. Interfragmentary compression in the fracture gap was measured using pressure sensors. All screws in the three groups were tightened with 4Nm torque. Interfragmentary compression in group I (167 ± 25N) was significantly lower in comparison to groups II (431 ± 21N) and III (379 ± 59N), p≤0.005. The difference in compression between groups II and III remained not significant (p = 0.999). The new LagLoc technique offers an alternative tool to generate interfragmentary compression with the application of locking plates by combining the biomechanical advantages of lag screw and locking screw fixations. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Evaluation of the need for chest X-rays in the management of asymptomatic, intraluminal vascular access device occlusion in childhood cancer.

PubMed

Stammers, David; Connolly, Bairbre; Brandão, Leonardo R; Zupanec, Sue; Gupta, Sumit

2017-07-01

Venous access device (VAD) occlusion from intraluminal thrombus is a common complication during childhood cancer treatment. Current practice at many institutions is to assess VAD position with a chest X-ray (CXR) prior to intraluminal administration of tissue plasminogen activator (tPA). We aimed to determine the utility of this practice. A retrospective chart review of children with newly diagnosed cancer with a VAD, treated at The Hospital for Sick Children between 2010 and 2011, was performed. Episodes of line occlusion were identified both by reviewing patient CXRs for indication and identifying tPA doses dispensed. These episodes were reviewed to determine whether CXR findings resulted in management other than tPA. Cases in which the X-ray resulted in a change in management were further reviewed to determine whether administration of tPA could have resulted in potential patient harm. A total of 330 patients with newly diagnosed cancer with VADs were identified. Eighty-five (25.8%) patients experienced 123 episodes of VAD occlusion. VAD occlusions occurred more frequently in patients with tunneled external central venous lines (16/39, 41.5%) and peripherally inserted central catheters (PICC) (27/73, 37.0%) versus PORT (42/216, 19.4%; P = 0.001). There were nine (8.1%) episodes of VAD occlusion evaluated with a CXR in which the findings led to a change in management other than administering tPA. In each case, multiple specialists independently concluded that administration of tPA would have been unlikely to cause patient harm. Routine CXRs prior to the administration of tPA for asymptomatic VAD occlusion can safely be omitted. © 2016 Wiley Periodicals, Inc.

Implementation of central line-associated bloodstream infection prevention bundles in a surgical intensive care unit using peer tutoring.

PubMed

Park, Sang-Won; Ko, Suhui; An, Hye-Sun; Bang, Ji Hwan; Chung, Woo-Young

2017-01-01

Central line-associated bloodstream infections (CLABSIs) can be prevented through well-coordinated, multifaceted programs. However, implementation of CLABSI prevention programs requires individualized strategies for different institutional situations, and the best strategy in resource-limited settings is uncertain. Peer tutoring may be an efficient and effective method that is applicable in such settings. A prospective intervention was performed to reduce CLABSIs in a surgical intensive care unit (SICU) at a tertiary hospital. The core interventions consisted of implementation of insertion and maintenance bundles for CLABSI prevention. The overall interventions were guided and coordinated by active educational programs using peer tutoring. The CLABSI rates were compared for 9 months pre-intervention, 6 months during the intervention and 9 months post-intervention. The CLABSI rate was further observed for three years after the intervention. The rate of CLABSIs per 1000 catheter-days decreased from 6.9 infections in the pre-intervention period to 2.4 and 1.8 in the intervention (6 m; P  = 0.102) and post-intervention (9 m; P  = 0.036) periods, respectively. A regression model showed a significantly decreasing trend in the infection rate from the pre-intervention period ( P  < 0.001), with incidence-rate ratios of 0.348 (95% confidence interval [CI], 0.98-1.23) in the intervention period and 0.257 (95% CI, 0.07-0.91) in the post-intervention period. However, after the 9-month post-intervention period, the yearly CLABSI rates reverted to 3.0-5.4 infections per 1000 catheter-days over 3 years. Implementation of CLABSI prevention bundles using peer tutoring in a resource-limited setting was useful and effectively reduced CLABSIs. However, maintaining the reduced CLABSI rate will require further strategies.

Calibration of optimal use parameters for an ultraviolet light-emitting diode in eliminating bacterial contamination on needleless connectors.

PubMed

Hutchens, M P; Drennan, S L; Cambronne, E D

2015-06-01

Needleless connectors may develop bacterial contamination and cause central-line-associated bloodstream infections (CLABSI) despite rigorous application of best-practice. Ultraviolet (UV) light-emitting diodes (LED) are an emerging, increasingly affordable disinfection technology. We tested the hypothesis that a low-power UV LED could reliably eliminate bacteria on needleless central-line ports in a laboratory model of central-line contamination. Needleless central-line connectors were inoculated with Staphylococcus aureus. A 285 nm UV LED was used in calibrated fashion to expose contaminated connectors. Ports were directly applied to agar plates and flushed with sterile saline, allowing assessment of bacterial survival on the port surface and in simulated usage flow-through fluid. UV applied to needleless central-line connectors was highly lethal at 0·5 cm distance at all tested exposure times. At distances >1·5 cm both simulated flow-through and port surface cultures demonstrated significant bacterial growth following UV exposure. Logarithmic-phase S. aureus subcultures were highly susceptible to UV induction/maintenance dosing. Low-power UV LED doses at fixed time and distance from needleless central-line connector ports reduced cultivable S. aureus from >10(6) CFU to below detectable levels in this laboratory simulation of central-line port contamination. Low-power UV LEDs may represent a feasible alternative to current best-practice in connector decontamination. © 2015 The Society for Applied Microbiology.

Histological analysis of the tibial anterior cruciate ligament insertion.

PubMed

Oka, Shinya; Schuhmacher, Peter; Brehmer, Axel; Traut, Ulrike; Kirsch, Joachim; Siebold, Rainer

2016-03-01

This study was performed to investigate the morphology of the tibial anterior cruciate ligament (ACL) by histological assessment. The native (undissected) tibial ACL insertion of six fresh-frozen cadaveric knees was cut into four sagittal sections parallel to the long axis of the medial tibial spine. For histological evaluation, the slices were stained with haematoxylin and eosin, Safranin O and Russell-Movat pentachrome. All slices were digitalized and analysed at a magnification of 20×. The anterior tibial ACL insertion was bordered by a bony anterior ridge. The most medial ACL fibres inserted from the medial tibial spine and were adjacent to the articular cartilage of the medial tibial plateau. Parts of the bony insertions of the anterior and posterior horns of the lateral meniscus were in close contact with the lateral part of the tibial ACL insertion. A small fat pad was located just posterior to the functional ACL fibres. The anterior-posterior length of the medial ACL insertion was an average of 10.8 ± 1.1 mm compared with the lateral, which was only 6.2 ± 1.1 mm (p < 0.001). There were no central or posterolateral inserting ACL fibres. The shape of the bony tibial ACL insertion was 'duck-foot-like'. In contrast to previous findings, the functional mid-substance fibres arose from the most posterior part of the 'duck-foot' in a flat and 'c-shaped' way. The most anterior part of the tibial ACL insertion was bordered by a bony anterior ridge and the most medial by the medial tibial spine. No posterolateral fibres nor ACL bundles have been found histologically. This histological investigation may improve our understanding of the tibial ACL insertion and may provide important information for anatomical ACL reconstruction.

CE: Original Research: Does Certification in Vascular Access Matter? An Analysis of the PICC1 Survey.

PubMed

Chopra, Vineet; Kuhn, Latoya; Vaughn, Valerie; Ratz, David; Winter, Suzanne; Moureau, Nancy; Meyer, Britt; Krein, Sarah

2017-12-01

: Background: Although certification by an accredited agency is often a practice prerequisite in health care, it is not required of vascular access specialists who insert peripherally inserted central catheters (PICCs). Whether certification is associated with differences in practice among inserters is unknown. The purpose of this study was to gather information regarding whether certified and noncertified PICC inserters differ with respect to their practices and views about PICC use. We conducted a national survey of vascular access specialists, identifying certified PICC inserters as those who had received board certification from the Association for Vascular Access, the Infusion Nurses Society, or both. The 76-item survey asked about PICC policies and procedures at respondents' facilities, use of insertion technologies, device management, management of complications, perceptions about PICC use, and relationships with other health care providers. Additional data about respondents, including years in practice and primary practice settings, were also gathered. Bivariable comparisons were made using χ tests; two-sided α with P ≤ 0.05 was considered statistically significant. Of the 1,450 respondents in the final sample, 1,007 (69%) said they were certified inserters and 443 (31%) said they were not. Significantly higher percentages of certified than noncertified inserters reported having practiced for five or more years (78% versus 54%) and having placed 1,000 or more PICCs (58% versus 32%). Significantly more certified than noncertified inserters also reported being the vascular access lead for their facility (56% versus 44%). Reported practice patterns for insertion, care, and management of PICCs varied based on certification status. Some evidence-based practices (such as the use of ultrasound to measure catheter-to-vein ratios) were more often reported by certified inserters, while others (such as the use of maximal sterile barriers during PICC insertion) were not. Asked about their perceptions of PICC use at their institution, certified inserters reported higher percentages of inappropriate insertion and removal than noncertified inserters. Certified PICC inserters appear to be a distinct group of vascular access specialists. A better understanding of how and why practices differ between certified and noncertified inserters is necessary to ensuring safer, high-quality patient care.

Blood Transfusions (For Teens)

MedlinePlus

... person usually gets a blood transfusion through an intravenous line , a tiny tube that is inserted into ... blood cells. So some people getting treatment for cancer might need a transfusion of red blood cells ...

Multifunctional Antenna Techniques

DTIC Science & Technology

2015-11-25

the planar structure that can be sufficiently isolated from the radiation mechanism of the antenna and transformed into a TEM transmission line feed...an equivalent transmission line structure, and isolate the physical 5 | P a g e mechanisms responsible for impedance and radiation behavior...gap-fed Archimedean spiral antenna in free space with non-negligible metal width, insertion PMC boundaries to isolate the radiation and propagation

Peripherally inserted central catheter - dressing change

MedlinePlus

... chlorhexidine) in a single-use small applicator Special sponges or wipes that contain a cleaning agent, such ... Clean your skin around the site with the sponge and cleaning solution for 30 seconds. Let the ...

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

[Post mortem temperature equilibration of the structures of the head. I. Thermometric techniques and principal investigations (author's transl)].

PubMed

Brinkmann, B; May, D; Riemann, U

1976-06-30

Special thin and flexible thermometric probes showing a diameter of 1 mm and a sharp end were used for post mortem (p.m.) thermometric studies in several tissues. Brain temperatures were measured by inserting a double probe through the superior orbital fissura thus allowing to record the central and the peripheral brain regions separately. Another probe was inserted into the galea and a fourth into the liver. Temperature changes were recorded simultaneously. Many variables of the human head were measured. Sixteen corpses were investigated. The results were as follows: 1. Of all temperature curves registered those of the central brain regions showed the smallest variance. 2. The p.m. temperature curve of the brain shows a sigmoid shape with a rather short "plateau" in the beginning. 3. In the early p.m. phase there is an increasing difference of temperatures between central and peripheral brain regions amounting to 2-4, 6 degrees C in the time period between 78th and 128th minute. 4. The insertion of the thin probes does not cause visible damages. Thus it should be considered for use in forensic practice. 5. Some artificial "head models" were constructed and temperature decrease recorded after warming. The curves showed the same type of sigmoid shape as those obtained from the corpses. 6. Of the possible variables measured that could influence the temperature decrease only the density of the hair seems to be of interest.

Access technique and its problems in parenteral nutrition – Guidelines on Parenteral Nutrition, Chapter 9

PubMed Central

Jauch, K. W.; Schregel, W.; Stanga, Z.; Bischoff, S. C.; Braß, P.; Hartl, W.; Muehlebach, S.; Pscheidl, E.; Thul, P.; Volk, O.

2009-01-01

Catheter type, access technique, and the catheter position should be selected considering to the anticipated duration of PN aiming at the lowest complication risks (infectious and non-infectious). Long-term (>7–10 days) parenteral nutrition (PN) requires central venous access whereas for PN <3 weeks percutaneously inserted catheters and for PN >3 weeks subcutaneous tunnelled catheters or port systems are appropriate. CVC (central venous catheter) should be flushed with isotonic NaCl solution before and after PN application and during CVC occlusions. Strict indications are required for central venous access placement and the catheter should be removed as soon as possible if not required any more. Blood samples should not to be taken from the CVC. If catheter infection is suspected, peripheral blood-culture samples and culture samples from each catheter lumen should be taken simultaneously. Removal of the CVC should be carried out immediately if there are pronounced signs of local infection at the insertion site and/or clinical suspicion of catheter-induced sepsis. In case PN is indicated for a short period (max. 7–10 days), a peripheral venous access can be used if no hyperosmolar solutions (>800 mosm/L) or solutions with a high titration acidity or alkalinity are used. A peripheral venous catheter (PVC) can remain in situ for as long as it is clinically required unless there are signs of inflammation at the insertion site. PMID:20049083

Using in situ hybridization and PFGE Southern hybridization to detect translocation breakpoints in a BOR/TRPS patient cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, J.Z.; Sapru, M.; Smith, D.

Branchio-oto-renal syndrome (BOR) is an autosomal dominant disorder characterized by ear malformations, cervical fistulae, hearing loss and renal abnormalities. We have integrated the Genethon YAC contig maps with additional markers in the chromosome 8q region genetically linked by a unique patient cell line. This cell line is from a patient who has both the branchio-oto-renal syndrome and tricho-rhino-phalangeal syndrome (TRPS). High resolution cytogenetics demonstrated a direct insertion of materials from 8q13.3q21.13 to 8q24.11. TRPS has been previously linked to deletions involving 8q24.11-q24.13. The rearrangement in this patient suggests that TRPS results from loss of gene function due to insertion atmore » the 8q24.11 breakpoint and the possible location for the BOR gene is at either of the two breakpoints of 8q13.3 and 8q21.13. We have constructed cosmid contigs in 8q24.11. In situ hybridization with cosmids mapped to these locations as probes has helped to narrow down the breakpoints. Combinations of cosmids on either side or overlapping the 8q24.11 breakpoint show split signals on one chromosome 8q arm due to insertion of the materials from the proximal region. Cosmids mapped to the TRPS deletion region have been used to hybridize to pulsed field gel genomic blots of DNA from the patient cell line and detected rearranged genomic fragments. Both in situ hybridization and genomic PFGE Southern blot will be used to precisely locate the breakpoints.« less

Decreasing dialysis catheter rates by creating a multidisciplinary dialysis access program.

PubMed

Rosenberry, Patricia M; Niederhaus, Silke V; Schweitzer, Eugene J; Leeser, David B

2018-03-01

Centers for Medicare and Medicaid Services have determined that chronic dialysis units should have <12% of their patients utilizing central venous catheters for hemodialysis treatments. On the Eastern Shore of Maryland, the central venous catheter rates in the dialysis units averaged >45%. A multidisciplinary program was established with goals of decreasing catheter rates in order to decrease central line-associated bloodstream infections, decrease mortality associated with central line-associated bloodstream infection, decrease hospital days, and provide savings to the healthcare system. We collected the catheter rates within three dialysis centers served over a 5-year period. Using published data surrounding the incidence and related costs of central line-associated bloodstream infection and mortality per catheter day, the number of central line-associated bloodstream infection events, the costs, and the related mortality could be determined prior to and after the initiation of the dialysis access program. An organized dialysis access program resulted in a 82% decrease in the number of central venous catheter days which lead to a concurrent reduction in central line-associated bloodstream infection and deaths. As a result of creating an access program, central venous catheter rates decreased from an average rate of 45% to 8%. The cost savings related to the program was calculated to be over US$5 million. The decrease in the number of mortalities is estimated to be between 13 and 27 patients. We conclude that a formalized access program decreases catheter rates, central line-associated bloodstream infection, and the resultant hospitalizations, mortality, and costs. Areas with high hemodialysis catheter rates should develop access programs to better serve their patient population.

Comparing the Use of Global Rating Scale with Checklists for the Assessment of Central Venous Catheterization Skills Using Simulation

ERIC Educational Resources Information Center

Ma, Irene W. Y.; Zalunardo, Nadia; Pachev, George; Beran, Tanya; Brown, Melanie; Hatala, Rose; McLaughlin, Kevin

2012-01-01

The use of checklists is recommended for the assessment of competency in central venous catheterization (CVC) insertion. To explore the use of a global rating scale in the assessment of CVC skills, this study seeks to compare its use with two checklists, within the context of a formative examination using simulation. Video-recorded performances of…

Lentiviral vector-mediated genetic modification of human neural progenitor cells for ex vivo gene therapy.

PubMed

Capowski, Elizabeth E; Schneider, Bernard L; Ebert, Allison D; Seehus, Corey R; Szulc, Jolanta; Zufferey, Romain; Aebischer, Patrick; Svendsen, Clive N

2007-07-30

Human neural progenitor cells (hNPC) hold great potential as an ex vivo system for delivery of therapeutic proteins to the central nervous system. When cultured as aggregates, termed neurospheres, hNPC are capable of significant in vitro expansion. In the current study, we present a robust method for lentiviral vector-mediated gene delivery into hNPC that maintains the differentiation and proliferative properties of neurosphere cultures while minimizing the amount of viral vector used and controlling the number of insertion sites per population. This method results in long-term, stable expression even after differentiation of the hNPC to neurons and astrocytes and allows for generation of equivalent transgenic populations of hNPC. In addition, the in vitro analysis presented predicts the behavior of transgenic lines in vivo when transplanted into a rodent model of Parkinson's disease. The methods presented provide a powerful tool for assessing the impact of factors such as promoter systems or different transgenes on the therapeutic utility of these cells.

Wideband bandpass filters employing broadside-coupled microstrip lines for MIC and MMIC applications

NASA Technical Reports Server (NTRS)

Tran, M.; Nguyen, C.

1994-01-01

Wideband bandpass filters employing half-wavelength broadside-coupled microstrip lines suitable for microwave and mm-wave integrated monolithic integrated circuits (MIC and MMIC) are presented. Several filters have been developed at X-band (8 to 12 GHz) with 1 dB insertion loss. Fair agreement between the measured and calculated results has been observed. The analysis of the broadside-coupled microstrip lines used in the filters, based on the quasi-static spectral domain technique, is also described.

Superresolution microscopy reveals the three-dimensional organization of meiotic chromosome axes in intact Caenorhabditis elegans tissue

PubMed Central

Köhler, Simone; Wojcik, Michal; Dernburg, Abby F.

2017-01-01

When cells enter meiosis, their chromosomes reorganize as linear arrays of chromatin loops anchored to a central axis. Meiotic chromosome axes form a platform for the assembly of the synaptonemal complex (SC) and play central roles in other meiotic processes, including homologous pairing, recombination, and chromosome segregation. However, little is known about the 3D organization of components within the axes, which include cohesin complexes and additional meiosis-specific proteins. Here, we investigate the molecular organization of meiotic chromosome axes in Caenorhabditis elegans through STORM (stochastic optical reconstruction microscopy) and PALM (photo-activated localization microscopy) superresolution imaging of intact germ-line tissue. By tagging one axis protein (HIM-3) with a photoconvertible fluorescent protein, we established a spatial reference for other components, which were localized using antibodies against epitope tags inserted by CRISPR/Cas9 genome editing. Using 3D averaging, we determined the position of all known components within synapsed chromosome axes to high spatial precision in three dimensions. We find that meiosis-specific HORMA domain proteins span a gap between cohesin complexes and the central region of the SC, consistent with their essential roles in SC assembly. Our data further suggest that the two different meiotic cohesin complexes are distinctly arranged within the axes: Although cohesin complexes containing the kleisin REC-8 protrude above and below the plane defined by the SC, complexes containing COH-3 or -4 kleisins form a central core, which may physically separate sister chromatids. This organization may help to explain the role of the chromosome axes in promoting interhomolog repair of meiotic double-strand breaks by inhibiting intersister repair. PMID:28559338

Estimating duration of central venous catheter at time of insertion: Clinician judgment and clinical predictors.

PubMed

Holmberg, Mathias J; Andersen, Lars W; Graver, Amanda; Wright, Sharon B; Yassa, David; Howell, Michael D; Donnino, Michael W; Cocchi, Michael N

2015-12-01

The aim of this study was to investigate whether clinicians can estimate the length of time a central venous catheter (CVC) will remain in place and to identify variables that may predict CVC duration. We conducted a prospective study of patients admitted to the intensive care unit over a 1-year period. Clinicians estimated the anticipated CVC duration at time of insertion. We collected demographics, medical history, type of intensive care unit, anatomical site of CVC placement, vital signs, laboratory values, Sequential Organ Failure Assessment score, mechanical ventilation, and use of vasopressors. Pearson correlation coefficient was used to assess the correlation between estimated and actual CVC time. We performed multivariable logistic regression to identify predictors of long duration (>5 days). We enrolled 200 patients; median age was 65 years (quartiles 52, 75); 91 (46%) were female; and mortality was 24%. Correlation between estimated and actual CVC time was low (r=0.26; r2=0.07; P<.001). Mechanical ventilation (odds ratio, 2.20; 95% confidence interval, 1.22-3.97; P=.009) at time of insertion and a medical history of cancer (odds ratio, 0.35; 95% confidence interval, 0.16-0.75; P=.007) were significantly associated with long duration. Our results suggest a low correlation between clinician prediction and actual CVC duration. We did not find any strong predictors of long CVC duration identifiable at the time of insertion. Copyright © 2015 Elsevier Inc. All rights reserved.

The mid-sternal length, a practical anatomical landmark for optimal positioning of long-term central venous catheters

PubMed Central

Salimi, Fereshte; Imani, Mohammad Reza; Ghasemi, Navab; Keshavarzian, Amir; Jazi, Amir Hosein Davarpanah

2013-01-01

Background: Long-term tunneled catheters are used for the hemodialysis or chemotherapy in many patients. Proper placement of the catheter tip could reduce early and late catheter related complications. Aim of the present study was to evaluate a new formula for proper placement of tunneled hemodialysis or infusion port device by using an external anatomic landmark. Materials and Methods: A total of 64 adult patients undergoing elective placement of tunneled Central Venous Catheter (CVC) requiring hemodialysis or chemotherapy were enrolled in this prospective study during 2011-2012 in the university hospital. The catheter length to be inserted in the right internal jugular vein (IJV) was calculated by adding two measurements (the shortest straight length between the insertion point of the needle and the suprasternal notch plus and half of sternal length). The catheter position was considered correct if the tip was positioned in the right atrium (RA) or Superior vena cava (SVC)-RA junction. Results: The patients were 55.28 ± 19.85 years of age, weighed 5.78 ± 16.62 kg and were 166.07 ± 10.27 cm tall. Catheters were inserted successfully in 88% of patients (n = 56). Catheter tip positions in the failures were SVC (n = 5), tricuspid valve (n = 2), and right ventricle (n = 1) in our patients. Conclusion: Long-term hemodialysis or port CVC could easily insert in the right IJV by using half of the sternal length as an external land marks among adult patients. PMID:24174941

78 FR 54955 - Mississippi Central Railroad Co.-Lease and Change in Operators Exemption-Line of Mississippi...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-06

... Central Railroad Co.--Lease and Change in Operators Exemption--Line of Mississippi-Alabama Railroad Authority Mississippi Central Railroad Co. (MSCI), a Class III rail carrier, has filed a verified notice of exemption under 49 CFR 1150.41 to lease and operate a 41.5-mile line of railroad between milepost IC-529.5...

Pacific Pediatric Advanced Care Initiative

DTIC Science & Technology

2009-10-01

Prepare IV ports:  Identify IV ports (UVC, Femoral venous line, other central venous lines, or PIV) for easy access to push meds or administer volume...Supply Department CVL central venous line CXR chest xray DC discontinue DI Diagnostic Imaging DIC disseminated intravascular coagulation diff...programs at KMCWC. These include the blood bank, blood utilization committee, clinical laboratories, operating room, central supply, pharmacy

Incidence of Central Vein Stenosis and Occlusion Following Upper Extremity PICC and Port Placement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonsalves, Carin F., E-mail: Carin.Gonsalves@mail.tju.edu; Eschelman, David J.; Sullivan, Kevin L.

2003-04-15

The purpose of this study was to determine the incidence of central vein stenosis and occlusion following upper extremity placement of peripherally inserted central venous catheters(PICCs) and venous ports. One hundred fifty-four patients who underwent venography of the ipsilateral central veins prior to initial and subsequent venous access device insertion were retrospectively identified. All follow-up venograms were interpreted at the time of catheter placement by one interventional radiologist over a 5-year period and compared to the findings on initial venography. For patients with central vein abnormalities, hospital and home infusion service records and radiology reports were reviewed to determine cathetermore » dwelltime and potential alternative etiologies of central vein stenosis or occlusion. The effect of catheter caliber and dwell time on development of central vein abnormalities was evaluated. Venography performed prior to initial catheter placement showed that 150 patients had normal central veins. Three patients had central vein stenosis, and one had central vein occlusion. Subsequent venograms (n = 154)at the time of additional venous access device placement demonstrated 8 patients with occlusions and 10 with stenoses. Three of the 18 patients with abnormal follow-up venograms were found to have potential alternative causes of central vein abnormalities. Excluding these 3 patients and the 4 patients with abnormal initial venograms, a 7% incidence of central vein stenosis or occlusion was found in patients with prior indwelling catheters and normal initial venograms. Catheter caliber showed no effect on the subsequent development of central vein abnormalities. Patients who developed new or worsened central vein stenosis or occlusion had significantly (p =0.03) longer catheter dwell times than patients without central vein abnormalities. New central vein stenosis or occlusion occurred in 7% of patients following upper arm placement of venous access devices.Patients with longer catheter dwell time were more likely to develop central vein abnormalities. In order to preserve vascular access for dialysis fistulae and grafts and adhere to Dialysis Outcomes Quality Initiative guidelines, alternative venous access sites should be considered for patients with chronic renal insufficiency and end-stage renal disease.« less

The acoustic sensor for rapid analysis of bacterial cells in the conductive suspensions.

PubMed

Borodina, I A; Zaitsev, B D; Guliy, O; Teplykh, A A; Shikhabudinov, A M

2017-11-01

The possibility of using the acoustic sensor on the basis of a two-channel delay line for rapid analysis of bacterial cells in the conductive suspensions was investigated. The dependencies of change in phase and insertion loss of output signal of the sensor on conductivity of buffer solution with various concentrations of cells due to a specific interaction "bacterial cells - mini-antibodies" for electrically open and electrically shorted channels of delay line were measured. It has been found that these changes have the most values for the electrically open channel. It has been also shown that the sensor rapidly responds to the specific interaction and the time stabilization of the phase and insertion loss of output signal is less than 10min. Copyright © 2017 Elsevier B.V. All rights reserved.

Early infection risk with primary versus staged Hemodialysis Reliable Outflow (HeRO) graft implantation.

PubMed

Griffin, Andrew S; Gage, Shawn M; Lawson, Jeffrey H; Kim, Charles Y

2017-01-01

This study evaluated whether the use of a staged Hemodialysis Reliable Outflow (HeRO; Merit Medical, South Jordan, Utah) implantation strategy incurs increased early infection risk compared with conventional primary HeRO implantation. A retrospective review was performed of 192 hemodialysis patients who underwent HeRO graft implantation: 105 patients underwent primary HeRO implantation in the operating room, and 87 underwent a staged implantation where a previously inserted tunneled central venous catheter was used for guidewire access for the venous outflow component. Within the staged implantation group, 32 were performed via an existing tunneled hemodialysis catheter (incidentally staged), and 55 were performed via a tunneled catheter inserted across a central venous occlusion in an interventional radiology suite specifically for HeRO implantation (intentionally staged). Early infection was defined as episodes of bacteremia or HeRO infection requiring resection ≤30 days of HeRO implantation. For staged HeRO implantations, the median interval between tunneled catheter insertion and conversion to a HeRO graft was 42 days. The overall HeRO-related infection rate ≤30 days of implantation was 8.6% for primary HeRO implantation and 2.3% for staged implantations (P = .12). The rates of early bacteremia and HeRO resection requiring surgical resection were not significantly different between groups (P = .19 and P = .065, respectively), nor were age, gender, laterality, anastomosis to an existing arteriovenous access, human immunodeficiency virus status, diabetes, steroids, chemotherapy, body mass index, or graft location. None of the patient variables, techniques, or graft-related variables correlated significantly with the early infection rate. The staged HeRO implantation strategy did not result in an increased early infection risk compared with conventional primary implantation and is thus a reasonable strategy for HeRO insertion in hemodialysis patients with complex central venous disease. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Transoesophageal echocardiographic evaluation of central venous catheter positioning using Peres' formula or a radiological landmark-based approach: a prospective randomized single-centre study.

PubMed

Ahn, J H; Kim, I S; Yang, J H; Lee, I G; Seo, D H; Kim, S P

2017-02-01

The lower superior vena cava (SVC), near its junction with the right atrium (RA), is considered the ideal location for the central venous catheter tip to ensure proper function and prevent injuries. We determined catheter insertion depth with a new formula using the sternoclavicular joint and the carina as radiological landmarks, with a 1.5 cm safety margin. The accuracy of tip positioning with the radiological landmark-based technique (R) and Peres' formula (P) was compared using transoesophageal echocardiography. Real-time ultrasound-guided central venous catheter insertion was done through the right internal jugular or subclavian vein. Patients were randomly assigned to either the P group (n=93) or the R group (n=95). Optimal catheter tip position was considered to be within 2 cm above and 1 cm below the RA-SVC junction. Catheter tip position, abutment, angle to the vascular wall, and flow stream were evaluated on a bicaval view. The distance from the skin insertion point to the RA-SVC junction and determined depth of catheter insertion were more strongly correlated in the R group [17.4 (1.2) and 16.7 (1.5) cm; r=0.821, P<0.001] than in the P group [17.3 (1.2) and 16.4 (1.1) cm; r=0.517, P<0.001], with z=3.96 (P<0.001). More tips were correctly positioned in the R group than in the P group (74 vs 93%, P=0.001). Abutment, tip angle to the lateral wall >40°, and disrupted flow stream were comparable. Catheter tip position was more accurate with a radiological landmark-based technique than with Peres' formula. Clinical Trial Registry of Korea: https://cris.nih.go.kr/cris/index.jsp KCT0001937. © The Author 2017. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Cost-effectiveness of a quality improvement programme to reduce central line-associated bloodstream infections in intensive care units in the USA

PubMed Central

Herzer, Kurt R; Niessen, Louis; Constenla, Dagna O; Ward, William J; Pronovost, Peter J

2014-01-01

Objective To assess the cost-effectiveness of a multifaceted quality improvement programme focused on reducing central line-associated bloodstream infections in intensive care units. Design Cost-effectiveness analysis using a decision tree model to compare programme to non-programme intensive care units. Setting USA. Population Adult patients in the intensive care unit. Costs Economic costs of the programme and of central line-associated bloodstream infections were estimated from the perspective of the hospital and presented in 2013 US dollars. Main outcome measures Central line-associated bloodstream infections prevented, deaths averted due to central line-associated bloodstream infections prevented, and incremental cost-effectiveness ratios. Probabilistic sensitivity analysis was performed. Results Compared with current practice, the programme is strongly dominant and reduces bloodstream infections and deaths at no additional cost. The probabilistic sensitivity analysis showed that there was an almost 80% probability that the programme reduces bloodstream infections and the infections’ economic costs to hospitals. The opportunity cost of a bloodstream infection to a hospital was the most important model parameter in these analyses. Conclusions This multifaceted quality improvement programme, as it is currently implemented by hospitals on an increasingly large scale in the USA, likely reduces the economic costs of central line-associated bloodstream infections for US hospitals. Awareness among hospitals about the programme's benefits should enhance implementation. The programme's implementation has the potential to substantially reduce morbidity, mortality and economic costs associated with central line-associated bloodstream infections. PMID:25256190

Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

PubMed

Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

2017-03-01

Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

Quickly Removable Valve

NASA Technical Reports Server (NTRS)

Robbins, John S.

1988-01-01

Unit removed with minimal disturbance. Valve inlet and outlet ports adjacent to each other on same side of valve body. Ports inserted into special manifold on fluid line. Valve body attached to manifold by four bolts or, alternatively, by toggle clamps. Electromechanical actuator moves in direction parallel to fluid line to open and close valve. When necessary to clean valve, removed simply by opening bolts or toggle clamps. No need to move or separate ports of fluid line. Valve useful where disturbance of fluid line detrimental or where fast maintenance essential - in oil and chemical industries, automotive vehicles, aircraft, and powerplants.

MEMS, Ka-Band Single-Pole Double-Throw (SPDT) Switch for Switched Line Phase Shifters

NASA Technical Reports Server (NTRS)

Scardelletti, Maximilian C.; Ponchak, George E.; Varaljay, Nicholas C.

2002-01-01

Ka-band MEMS doubly anchored cantilever beam capacitive shunt devices are used to demonstrate a MEMS SPDT switch fabricated on high resistivity silicon (HRS) utilizing finite ground coplanar waveguide (FGC) transmission lines. The SPDT switch has an insertion loss (IL), return loss (RL), and isolation of 0.3dB, 40dB, and 30 dB, respectively at Ka-band.

Using real-time problem solving to eliminate central line infections.

PubMed

Shannon, Richard P; Frndak, Diane; Grunden, Naida; Lloyd, Jon C; Herbert, Cheryl; Patel, Bhavin; Cummins, Daniel; Shannon, Alexander H; O'Neill, Paul H; Spear, Steven J

2006-09-01

An estimated 200,000 Americans suffer central line-associated bloodstream infections (CLABs) each year, with 15%-20% mortality. Two intensive care units (ICUs) redefined the processes of care through system redesign to deliver reliable outcomes free of the variations that created the breeding ground for infection. The ICUs, comprising 28 beds at Allegheny General Hospital, employed the principles of the Toyota Production System adapted to health care--Perfecting Patient Care--and applied them to central line placement and maintenance. Intensive observations, which revealed multiple variances from established practices, and root cause analyses of all CLABs empowered the workers to implement countermeasures designed to eliminate the defects in the processes of central line placement and maintenance. New processes were implemented within 90 days. Within a year CLABs decreased from 49 to 6 (10.5 to 1.2 infections/1,000 line-days), and mortalities from 19 to 1 (51% to 16%), despite an increase in the use of central lines and number of line-days. These results were sustained during a 34-month period. CLABs are not an inevitable product of complex ICU care but the result of highly variable and therefore unreliable care delivery that predisposes to infection.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Evaluation of dual-tip micromanometers during 21-day implantation in goats

NASA Technical Reports Server (NTRS)

Reister, C. A.; Koenig, S. C.; Schaub, J. D.; Ewert, D. L.; Swope, R. D.; Latham, R. D.; Fanton, J. W.; Convertino, V. A. (Principal Investigator)

1998-01-01

Investigative research efforts using a cardiovascular model required the determination of central circulatory haemodynamic and arterial system parameters for the evaluation of cardiovascular performance. These calculations required continuous beat-to-beat measurement of pressure within the four chambers of the heart and great vessels. Sensitivity and offset drift, longevity, and sources of error for eight 3F dual-tipped micromanometers were determined during 21 days of implantation in goats. Subjects were instrumented with pairs of chronically implanted fluid-filled access catheters in the left and right ventricles, through which dual-tipped (test) micromanometers were chronically inserted and single-tip (standard) micromanometers were acutely inserted. Acutely inserted sensors were calibrated daily and measured pressures were compared in vivo to the chronically inserted sensors. Comparison of the pre- and post-gain calibration of the chronically inserted sensors showed a mean sensitivity drift of 1.0 +/- 0.4% (99% confidence, n = 9 sensors) and mean offset drift of 5.0 +/- 1.5 mmHg (99% confidence, n = 9 sensors). Potential sources of error for these drifts were identified, and included measurement system inaccuracies, temperature drift, hydrostatic column gradients, and dynamic pressure changes. Based upon these findings, we determined that these micromanometers may be chronically inserted in high-pressure chambers for up to 17 days with an acceptable error, but should be limited to acute (hours) insertions in low-pressure applications.

77 FR 11776 - Fisheries of the Exclusive Economic Zone Off Alaska; Pacific Cod by Catcher/Processors Using Hook...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-28

.../Processors Using Hook-and-Line Gear in the Central Regulatory Area of the Gulf of Alaska AGENCY: National... (C/Ps) using hook-and-line gear in the Central Regulatory Area of the Gulf of Alaska (GOA). This... catch apportioned to C/Ps using hook-and-line gear in the Central Regulatory Area of the GOA. DATES...

Elastic and viscoelastic mechanical properties of brain tissues on the implanting trajectory of sub-thalamic nucleus stimulation.

PubMed

Li, Yan; Deng, Jianxin; Zhou, Jun; Li, Xueen

2016-11-01

Corresponding to pre-puncture and post-puncture insertion, elastic and viscoelastic mechanical properties of brain tissues on the implanting trajectory of sub-thalamic nucleus stimulation are investigated, respectively. Elastic mechanical properties in pre-puncture are investigated through pre-puncture needle insertion experiments using whole porcine brains. A linear polynomial and a second order polynomial are fitted to the average insertion force in pre-puncture. The Young's modulus in pre-puncture is calculated from the slope of the two fittings. Viscoelastic mechanical properties of brain tissues in post-puncture insertion are investigated through indentation stress relaxation tests for six interested regions along a planned trajectory. A linear viscoelastic model with a Prony series approximation is fitted to the average load trace of each region using Boltzmann hereditary integral. Shear relaxation moduli of each region are calculated using the parameters of the Prony series approximation. The results show that, in pre-puncture insertion, needle force almost increases linearly with needle displacement. Both fitting lines can perfectly fit the average insertion force. The Young's moduli calculated from the slope of the two fittings are worthy of trust to model linearly or nonlinearly instantaneous elastic responses of brain tissues, respectively. In post-puncture insertion, both region and time significantly affect the viscoelastic behaviors. Six tested regions can be classified into three categories in stiffness. Shear relaxation moduli decay dramatically in short time scales but equilibrium is never truly achieved. The regional and temporal viscoelastic mechanical properties in post-puncture insertion are valuable for guiding probe insertion into each region on the implanting trajectory.

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Reprogramming triggers endogenous L1 and Alu retrotransposition in human induced pluripotent stem cells.

PubMed

Klawitter, Sabine; Fuchs, Nina V; Upton, Kyle R; Muñoz-Lopez, Martin; Shukla, Ruchi; Wang, Jichang; Garcia-Cañadas, Marta; Lopez-Ruiz, Cesar; Gerhardt, Daniel J; Sebe, Attila; Grabundzija, Ivana; Merkert, Sylvia; Gerdes, Patricia; Pulgarin, J Andres; Bock, Anja; Held, Ulrike; Witthuhn, Anett; Haase, Alexandra; Sarkadi, Balázs; Löwer, Johannes; Wolvetang, Ernst J; Martin, Ulrich; Ivics, Zoltán; Izsvák, Zsuzsanna; Garcia-Perez, Jose L; Faulkner, Geoffrey J; Schumann, Gerald G

2016-01-08

Human induced pluripotent stem cells (hiPSCs) are capable of unlimited proliferation and can differentiate in vitro to generate derivatives of the three primary germ layers. Genetic and epigenetic abnormalities have been reported by Wissing and colleagues to occur during hiPSC derivation, including mobilization of engineered LINE-1 (L1) retrotransposons. However, incidence and functional impact of endogenous retrotransposition in hiPSCs are yet to be established. Here we apply retrotransposon capture sequencing to eight hiPSC lines and three human embryonic stem cell (hESC) lines, revealing endogenous L1, Alu and SINE-VNTR-Alu (SVA) mobilization during reprogramming and pluripotent stem cell cultivation. Surprisingly, 4/7 de novo L1 insertions are full length and 6/11 retrotransposition events occurred in protein-coding genes expressed in pluripotent stem cells. We further demonstrate that an intronic L1 insertion in the CADPS2 gene is acquired during hiPSC cultivation and disrupts CADPS2 expression. These experiments elucidate endogenous retrotransposition, and its potential consequences, in hiPSCs and hESCs.

Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

PubMed

Yokozaki, H; Tahara, H; Oue, N; Tahara, E

2000-01-01

A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

Reprogramming triggers endogenous L1 and Alu retrotransposition in human induced pluripotent stem cells

PubMed Central

Klawitter, Sabine; Fuchs, Nina V.; Upton, Kyle R.; Muñoz-Lopez, Martin; Shukla, Ruchi; Wang, Jichang; Garcia-Cañadas, Marta; Lopez-Ruiz, Cesar; Gerhardt, Daniel J.; Sebe, Attila; Grabundzija, Ivana; Merkert, Sylvia; Gerdes, Patricia; Pulgarin, J. Andres; Bock, Anja; Held, Ulrike; Witthuhn, Anett; Haase, Alexandra; Sarkadi, Balázs; Löwer, Johannes; Wolvetang, Ernst J.; Martin, Ulrich; Ivics, Zoltán; Izsvák, Zsuzsanna; Garcia-Perez, Jose L.; Faulkner, Geoffrey J.; Schumann, Gerald G.

2016-01-01

Human induced pluripotent stem cells (hiPSCs) are capable of unlimited proliferation and can differentiate in vitro to generate derivatives of the three primary germ layers. Genetic and epigenetic abnormalities have been reported by Wissing and colleagues to occur during hiPSC derivation, including mobilization of engineered LINE-1 (L1) retrotransposons. However, incidence and functional impact of endogenous retrotransposition in hiPSCs are yet to be established. Here we apply retrotransposon capture sequencing to eight hiPSC lines and three human embryonic stem cell (hESC) lines, revealing endogenous L1, Alu and SINE-VNTR-Alu (SVA) mobilization during reprogramming and pluripotent stem cell cultivation. Surprisingly, 4/7 de novo L1 insertions are full length and 6/11 retrotransposition events occurred in protein-coding genes expressed in pluripotent stem cells. We further demonstrate that an intronic L1 insertion in the CADPS2 gene is acquired during hiPSC cultivation and disrupts CADPS2 expression. These experiments elucidate endogenous retrotransposition, and its potential consequences, in hiPSCs and hESCs. PMID:26743714

Bilateral Pneumothoraces Following Central Venous Cannulation

PubMed Central

Pazos, F.; Masterson, K.; Inan, C.; Robert, J.; Walder, B.

2009-01-01

We report the occurrence of a bilateral pneumothoraces after unilateral central venous catheterization of the right subclavian vein in a 70-year-old patient. The patient had no history of pulmonary or pleural disease and no history of cardiothoracic surgery. Two days earlier, she had a median laparotomy under general and epidural anaesthesia. Prior to the procedure, the patient was hemodynamically stable and her transcutaneous oxygen saturation was 97% in room air. We punctured the right pleural space before cannulation of the right subclavian vein. After the procedure, the patient slowly became hemodynamically instable with respiratory distress. A chest radiograph revealed a complete left-side pneumothorax and a mild right-side pneumothorax. The right-side pneumothorax became under tension after left chest tube insertion. The symptoms finally resolved after insertion of a right chest tube. After a diagnostic work-up, we suspect a congenital “Buffalo chests” explaining bilateral pneumothoraces and a secondary tension pneumothorax. PMID:19901997

[Evaluation of practices for the prevention and control of bloodstream infections in a government hospital].

PubMed

Jardim, Jaquelline Maria; Lacerda, Rúbia Aparecida; Soares, Naury de Jesus Danzi; Nunes, Bruna Kosar

2013-02-01

The aim of this study was to observe clinical procedures in order to evaluate the practices used for the control and prevention of bloodstream infections associated with short-term central venous catheters (BSI-ACVC). The study data came from 5877 assessments distributed among selected practices. The results revealed the following adherence rates among the practices selected: 91.6% for recording the indication and permanence time of the CVC, 51.5% for adhering to the care and maintenance of the dressing at the CVC insertion site and its devices, 10.7% for hand hygiene practices while performing procedures related to the CVC, and 0.0% for the practices related to the insertion of the central venous catheter (CVC). The results demonstrate the need for further elaboration of strategies that ensure sustainable compliance practices for prevention and control BSI-ACVC in the institution being assessed.

Air embolism after central venous catheterization.

PubMed

Kashuk, J L; Penn, I

1984-09-01

Air embolism--the most dangerous complication of central venous catheterization--may occur in several ways. The most frequent is from disconnection of the catheter from the related intravenous tubing. An embolism may present with a sucking sound, tachypnea, air hunger, wheezing, hypotension and a "mill wheel" murmur. A later manifestation is severe pulmonary edema. In a review of 24 patients, the mortality was 50 per cent. Among the survivors, five (42 per cent) had neurologic damage. Immediate treatment includes placing the patient in the left lateral and Trendelenberg positions, administration of oxygen and aspiration of air from the heart. Cardiac massage and emergency cardiopulmonary bypass may be necessary. Most instances can be prevented by inserting the cannula with the patient in the Trendelenberg position, occluding the cannula hub except briefly while the catheter is inserted, fixation of the catheter hub to its connections and occlusive dressing over the track after removal of the catheter.

Amide I SFG Spectral Line Width Probes the Lipid-Peptide and Peptide-Peptide Interactions at Cell Membrane In Situ and in Real Time.

PubMed

Zhang, Baixiong; Tan, Junjun; Li, Chuanzhao; Zhang, Jiahui; Ye, Shuji

2018-06-13

The balance of lipid-peptide and peptide-peptide interactions at cell membrane is essential to a large variety of cellular processes. In this study, we have experimentally demonstrated for the first time that sum frequency generation vibrational spectroscopy can be used to probe the peptide-peptide and lipid-peptide interactions in cell membrane in situ and in real time by determination of the line width of amide I band of protein backbone. Using a "benchmark" model of α-helical WALP23, it is found that the dominated lipid-peptide interaction causes a narrow line width of the amide I band, whereas the peptide-peptide interaction can markedly broaden the line width. When WALP23 molecules insert into the lipid bilayer, a quite narrow line width of the amide I band is observed because of the lipid-peptide interaction. In contrast, when the peptide lies down on the bilayer surface, the line width of amide I band becomes very broad owing to the peptide-peptide interaction. In terms of the real-time change in the line width, the transition from peptide-peptide interaction to lipid-peptide interaction is monitored during the insertion of WALP23 into 1,2-dipalmitoyl- sn-glycero-3-phospho-(1'- rac-glycerol) (DPPG) lipid bilayer. The dephasing time of a pure α-helical WALP23 in 1-palmitoyl-2-oleoyl- sn-glycero-3-phospho-(1'- rac-glycerol) and DPPG bilayer is determined to be 2.2 and 0.64 ps, respectively. The peptide-peptide interaction can largely accelerate the dephasing time.

A randomized controlled comparison of flushing protocols in home care patients with peripherally inserted central catheters.

PubMed

Lyons, Margaret G; Phalen, Ann G

2014-01-01

Research has failed to demonstrate an optimal flushing solution or frequency for central catheters. In a 2002 study of 50 000 home care patients, catheter dysfunction with loss of patency was the most common complication and occurred in 29% of the peripherally inserted central catheters (PICCs) tracked. With the advent of the Affordable Care Act and the promise of expanded home care services, this study offers evidence as to a preferred flushing protocol to prevent catheter patency complications for home infusion patients with PICCs. This prospective, randomized, 1-way, single-blinded posttest with control group study was performed to compare 3 commonly used flushing protocols in home infusion patients with PICCs. The independent variable was the flushing protocol, and dependent variables included the development of patency-related complications and other significant issues such as sluggishness, occlusion, missed medication doses, catheter replacement, additional nursing visits, and the use of alteplase (Cathflo Activase). Each of the study groups had patients who experienced 1 or more patency-related complications. Additional factors that may affect catheter function, including patient age, gender, diagnosis, therapy type, frequency of catheter use, catheter brand/size/number of lumens, concomitant use of anticoagulant medications, and whether PICCs were used for routine lab testing, were analyzed, and no statistical significance was determined. Catheter dwell time (catheter days) was statistically significant (p = .003, confidence interval = 95%; assuming equal variance) and confirmed the assumption that the longer a home care patient's catheter was in place, the more complications occurred. There were no cases of heparin allergy, heparin-induced thrombocytopenia, or line infection. The data provide some evidence to support the elimination of heparin flushing in home care patients with PICCs, although data in the saline-only group that related to additional registered nurse visits to assess PICC patency and the use of alteplase (Cathflo Activase) were trending toward significance because this group experienced a higher incidence of these complications than both the heparin groups. These findings should not be translated to home care patients with cancer or pregnancy diagnoses because these populations were excluded from this study. More studies of this topic area should be initiated. Please see video abstract, Supplemental Digital Content 1, for more information (http://links.lww.com/JIN/A3).

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

PubMed

Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

2014-05-27

We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

4. INTERIOR VIEW OF BASEMENT. CENTRAL LINE SHAFTING RUNNING NORTHSOUTH ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. INTERIOR VIEW OF BASEMENT. CENTRAL LINE SHAFTING RUNNING NORTH-SOUTH IS IN PLACE; AT RIGHT IS A PRESS FOR WORKING THE ALUMINUM SHEETS; E. W. BLISS CO. OF BROOKLYN, NEW YORK, MANUFACTURED THE PRESS. MACHINERY ORIGINALLY POWERED BY OVERHEAD BELTS CONNECTED TO CENTRAL LINE SHAFTS; BY ABOUT THE 1940s THE MACHINERY WAS ELECTRICALLY POWERED. - Illinois Pure Aluminum Company, 109 Holmes Street, Lemont, Cook County, IL

Endogenous Retroviral Insertions Indicate a Secondary Introduction of Domestic Sheep Lineages to the Caucasus and Central Asia between the Bronze and Iron Age

PubMed Central

Schroeder, Oskar; Benecke, Norbert; Frölich, Kai; Peng, Zuogang; Kaniuth, Kai; Sverchkov, Leonid; Reinhold, Sabine; Belinskiy, Andrey; Ludwig, Arne

2017-01-01

Sheep were one of the first livestock species domesticated by humans. After initial domestication in the Middle East they were spread across Eurasia. The modern distribution of endogenous Jaagsiekte sheep retrovirus insertions in domestic sheep breeds suggests that over the course of millennia, successive introductions of improved lineages and selection for wool quality occurred in the Mediterranean region and most of Asia. Here we present a novel ancient DNA approach using data of endogenous retroviral insertions in Bronze and Iron Age domestic sheep from the Caucasus and Pamir mountain areas. Our findings support a secondary introduction of wool sheep from the Middle East between the Late Bronze Age and Iron Age into most areas of Eurasia. PMID:28632161

Endogenous Retroviral Insertions Indicate a Secondary Introduction of Domestic Sheep Lineages to the Caucasus and Central Asia between the Bronze and Iron Age.

PubMed

Schroeder, Oskar; Benecke, Norbert; Frölich, Kai; Peng, Zuogang; Kaniuth, Kai; Sverchkov, Leonid; Reinhold, Sabine; Belinskiy, Andrey; Ludwig, Arne

2017-06-20

Sheep were one of the first livestock species domesticated by humans. After initial domestication in the Middle East they were spread across Eurasia. The modern distribution of endogenous Jaagsiekte sheep retrovirus insertions in domestic sheep breeds suggests that over the course of millennia, successive introductions of improved lineages and selection for wool quality occurred in the Mediterranean region and most of Asia. Here we present a novel ancient DNA approach using data of endogenous retroviral insertions in Bronze and Iron Age domestic sheep from the Caucasus and Pamir mountain areas. Our findings support a secondary introduction of wool sheep from the Middle East between the Late Bronze Age and Iron Age into most areas of Eurasia.

A feasibility study of a PET/MRI insert detector using strip-line and waveform sampling data acquisition.

PubMed

Kim, H; Chen, C-T; Eclov, N; Ronzhin, A; Murat, P; Ramberg, E; Los, S; Wyrwicz, Alice M; Li, Limin; Kao, C-M

2015-06-01

We are developing a time-of-flight Positron Emission Tomography (PET) detector by using silicon photo-multipliers (SiPM) on a strip-line and high speed waveform sampling data acquisition. In this design, multiple SiPMs are connected on a single strip-line and signal waveforms on the strip-line are sampled at two ends of the strip to reduce readout channels while fully exploiting the fast time response of SiPMs. In addition to the deposited energy and time information, the position of the hit SiPM along the strip-line is determined by the arrival time difference of the waveform. Due to the insensitivity of the SiPMs to magnetic fields and the compact front-end electronics, the detector approach is highly attractive for developing a PET insert system for a magnetic resonance imaging (MRI) scanner to provide simultaneous PET/MR imaging. To investigate the feasibility, experimental tests using prototype detector modules have been conducted inside a 9.4 Tesla small animal MRI scanner (Bruker BioSpec 94/30 imaging spectrometer). On the prototype strip-line board, 16 SiPMs (5.2 mm pitch) are installed on two strip-lines and coupled to 2 × 8 LYSO scintillators (5.0 × 5.0 × 10.0 mm 3 with 5.2 mm pitch). The outputs of the strip-line boards are connected to a Domino-Ring-Sampler (DRS4) evaluation board for waveform sampling. Preliminary experimental results show that the effect of interference on the MRI image due to the PET detector is negligible and that PET detector performance is comparable with the results measured outside the MRI scanner.

Cost-effectiveness of a quality improvement programme to reduce central line-associated bloodstream infections in intensive care units in the USA.

PubMed

Herzer, Kurt R; Niessen, Louis; Constenla, Dagna O; Ward, William J; Pronovost, Peter J

2014-09-25

To assess the cost-effectiveness of a multifaceted quality improvement programme focused on reducing central line-associated bloodstream infections in intensive care units. Cost-effectiveness analysis using a decision tree model to compare programme to non-programme intensive care units. USA. Adult patients in the intensive care unit. Economic costs of the programme and of central line-associated bloodstream infections were estimated from the perspective of the hospital and presented in 2013 US dollars. Central line-associated bloodstream infections prevented, deaths averted due to central line-associated bloodstream infections prevented, and incremental cost-effectiveness ratios. Probabilistic sensitivity analysis was performed. Compared with current practice, the programme is strongly dominant and reduces bloodstream infections and deaths at no additional cost. The probabilistic sensitivity analysis showed that there was an almost 80% probability that the programme reduces bloodstream infections and the infections' economic costs to hospitals. The opportunity cost of a bloodstream infection to a hospital was the most important model parameter in these analyses. This multifaceted quality improvement programme, as it is currently implemented by hospitals on an increasingly large scale in the USA, likely reduces the economic costs of central line-associated bloodstream infections for US hospitals. Awareness among hospitals about the programme's benefits should enhance implementation. The programme's implementation has the potential to substantially reduce morbidity, mortality and economic costs associated with central line-associated bloodstream infections. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Central line-associated venous late effects in children without prior history of thrombosis.

PubMed

Ruud, Ellen; Holmstrøm, Henrik; Hopp, Einar; Wesenberg, Finn

2006-09-01

The frequency of asymptomatic central line-associated thromboses is high and well recognized among children with cancer, while the long-term consequences are mainly unknown. In a cross-sectional study, we evaluated clinical and radiological venous outcome in children with previous long-standing intravascular catheters. The study enrolled 71 children previously treated for malignant or haematological diseases, 4-180 (median 37) mo after removal of their central lines. Inclusion criteria were a prior central line in a jugular vein for a minimum of 6 mo and no previous history of thrombosis. The children had clinical examination for post-thrombotic syndrome (PTS) and Doppler ultrasonography of the central neck veins. Twelve children had additional venous magnetic resonance imaging (MRI). But no kind of venography was performed in the remaining. We observed mild PTS with increased superficial collaterals in four children (6%), but no cases of more severe PTS. None complained of symptoms related to venous late effects. By ultrasonography, post-thrombotic venous alterations were detected in 17 children (24%), and five of these had complete occlusion of the veins. The sensitivity for pathologically increased collaterals to identify occlusive thrombosis was 0.6, while the specificity was 0.98. Occlusive venous thromboembolism was associated with the total number of central venous lines (CVLs; p=0.002), previous severe CVL-associated infections (p=0.001) and duration of central line in place (p=0.042). In spite of no prior history of thrombosis, children with previous long-term jugular lines frequently had local thrombotic sequelae, while clinical symptoms of PTS were rare.

REcanalisation and Balloon-Oriented Puncture for Re-Insertion of Dialysis Catheter in Nonpatent Central Veins (REBORN)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Too, Chow Wei, E-mail: toochowwei@gmail.com; Sayani, Raza; Lim, Elvin Yuan Ting

PurposeTo describe a technique involving REcanalisation and Balloon-Oriented puncture for Re-insertion of dialysis catheter in Nonpatent central veins (REBORN) and to report long-term results.Materials and MethodsThis is a retrospective study of ten subjects in whom dialysis catheters were inserted using the REBORN technique from March 2012 to October 2014 and followed up till April 2016. Data on the duration of catheter usage, complications and reasons for removal were obtained. Seven patients had partially occluded lower internal jugular veins (IJV) recanalised in an antegrade fashion via a more cranial puncture. The balloon was then inflated at usual puncture site with anmore » 18G needle. The collapsed balloon was cannulated with a guide wire, and both balloon and guide wire were advanced together into the superior vena cava. This was followed by tunnelled catheter placement using standard techniques. Two patients had catheters placed in the subclavian vein using a similar antegrade technique, and one patient had catheter placed via the left IJV following retrograde recanalisation from a right femoral puncture.ResultsMean duration of catheter use was 278 days (range 32–503). Three catheters were removed due to matured arteriovenous accesses. Four patients had successful catheter change over the same subcutaneous track due to catheter malfunction. One catheter was removed after 7 months because of sepsis. No complications were reported.ConclusionThe REBORN technique allows for the preservation of central veins for future haemodialysis access, which can be challenging in patients requiring long-term dialysis.« less

Silicon photonics plasma-modulators with advanced transmission line design.

PubMed

Merget, Florian; Azadeh, Saeed Sharif; Mueller, Juliana; Shen, Bin; Nezhad, Maziar P; Hauck, Johannes; Witzens, Jeremy

2013-08-26

We have investigated two novel concepts for the design of transmission lines in travelling wave Mach-Zehnder interferometer based Silicon Photonics depletion modulators overcoming the analog bandwidth limitations arising from cross-talk between signal lines in push-pull modulators and reducing the linear losses of the transmission lines. We experimentally validate the concepts and demonstrate an E/O -3 dBe bandwidth of 16 GHz with a 4V drive voltage (in dual drive configuration) and 8.8 dB on-chip insertion losses. Significant bandwidth improvements result from suppression of cross-talk. An additional bandwidth enhancement of ~11% results from a reduction of resistive transmission line losses. Frequency dependent loss models for loaded transmission lines and E/O bandwidth modeling are fully verified.

A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

DTIC Science & Technology

2014-06-01

rescue the locomotion defects of Drosophila larvae caused by the expression of human torsinAΔE. These results demonstrated that human torsinA can... Drosophila dtorsin∆D transgenic lines dtorsin∆E and dtorsin∆D cDNA constructs were made from the wild type dtorsin cDNA using QuikChange II XL Site...After confirming mutated sequences , the insert was again cut out with EcoRI and NotI and inserted between EcoRI and NotI sites of pUAST [2] to produce

Catheter Embolization

MedlinePlus

... to assess your condition. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Varicocele Embolization

MedlinePlus

... you will be admitted. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Venous Sampling

MedlinePlus

... on an outpatient basis. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Percutaneous Abscess Drainage

MedlinePlus

... of the radiology department. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Catheter-Directed Thrombolysis

MedlinePlus

... in the operating room. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Peritoneal Ports

MedlinePlus

... to help prevent infection. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Peripherally inserted central catheter - flushing

MedlinePlus

... on a pair of sterile gloves. Remove the cap on the saline syringe and set the cap down on the paper towel. DO NOT let ... It is a good idea to change the caps at the end of your catheter (called the " ...

Dissipationless conductance in a topological coaxial cable

NASA Astrophysics Data System (ADS)

Schuster, Thomas; Iadecola, Thomas; Chamon, Claudio; Jackiw, Roman; Pi, So-Young

2016-09-01

We present a dynamical mechanism leading to dissipationless conductance, whose quantized value is controllable in a (3+1)-dimensional electronic system. The mechanism is exemplified by a theory of Weyl fermions coupled to a Higgs field, also known as an axion insulator. We show that the insertion of an axial gauge flux can induce vortex lines in the Higgs field, similar to the development of vortices in a superconductor upon the insertion of magnetic flux. We further show that the necessary axial gauge flux can be generated using Rashba spin-orbit coupling or a magnetic field. Vortex lines in the Higgs field are known to bind chiral fermionic modes, each of which serves as a one-way channel for electric charge with conductance e2/h . Combining these elements, we present a physical picture, the "topological coaxial cable," illustrating how the value of the quantized conductance could be controlled in such an axion insulator.

A new FPGA architecture suitable for DSP applications

NASA Astrophysics Data System (ADS)

Liyun, Wang; Jinmei, Lai; Jiarong, Tong; Pushan, Tang; Xing, Chen; Xueyan, Duan; Liguang, Chen; Jian, Wang; Yuan, Wang

2011-05-01

A new FPGA architecture suitable for digital signal processing applications is presented. DSP modules can be inserted into FPGA conveniently with the proposed architecture, which is much faster when used in the field of digital signal processing compared with traditional FPGAs. An advanced 2-level MUX (multiplexer) is also proposed. With the added SLEEP MODE PASS to traditional 2-level MUX, static leakage is reduced. Furthermore, buffers are inserted at early returns of long lines. With this kind of buffer, the delay of the long line is improved by 9.8% while the area increases by 4.37%. The layout of this architecture has been taped out in standard 0.13 μm CMOS technology successfully. The die size is 6.3 × 4.5 mm2 with the QFP208 package. Test results show that performances of presented classical DSP cases are improved by 28.6%-302% compared with traditional FPGAs.

Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

PubMed

Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

2017-10-03

A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

A comparison of central lines in pediatric oncology patients: Early removal and patient centered outcomes.

PubMed

Mangum, David Spencer; Verma, Anupam; Weng, Cindy; Sheng, Xiaoming; Larsen, Ryan; Kirchhoff, Anne C; Druzgal, Colleen; Fluchel, Mark

2013-11-01

While there is increasing evidence supporting the choice of subcutaneous ports (SPs) over external venous catheters (EVCs) in pediatric oncology patients, prior conflicting studies exist and little data have been gathered as to which type of central line is preferred from the patient/family perspective. We performed a single institution, 10 years, retrospective analysis of central lines in pediatric oncology patients (n = 878) to evaluate unplanned early removal and cause of removal while simultaneously obtaining a cross sectional survey of 143 of the primary caretakers/parents of these patients to evaluate their overall satisfaction with the line. EVCs have significantly higher odds of unplanned early removal in comparison to SPs (6.7% of SPs vs. 27.3% of EVCs, odds ratio (OR) = 6.3, P < 0.0001 when controlling for age and diagnosis) secondary to increased infection, malfunction and patient preference. Patients with SPs felt like their central line was easier to care for, had less daily impact in their life, and were overall more satisfied with their central line compared to patients with EVCs, even when controlling for early removal (P < 0.0001 for all). SP patients were much more likely to state that they would choose the same type of line again (OR = 15, P < 0.0001) than EVC patients. SPs demonstrated lower removal rates and greater patient satisfaction than EVCs. These data should be considered when choosing a central line for pediatric cancer patients. Copyright © 2013 Wiley Periodicals, Inc.

Flat midsubstance of the anterior cruciate ligament with tibial "C"-shaped insertion site.

PubMed

Siebold, Rainer; Schuhmacher, Peter; Fernandez, Francis; Śmigielski, Robert; Fink, Christian; Brehmer, Axel; Kirsch, Joachim

2015-11-01

This anatomical cadaver study was performed to investigate the flat appearance of the midsubstance shape of the anterior cruciate ligament (ACL) and its tibial "C"-shaped insertion site. The ACL midsubstance and the tibial ACL insertion were dissected in 20 cadaveric knees (n = 6 fresh frozen and n = 14 paraffined). Magnifying spectacles were used for all dissections. Morphometric measurements were performed using callipers and on digital photographs. In all specimens, the midsubstance of the ACL was flat with a mean width of 9.9 mm, thickness of 3.9 mm and cross-sectional area of 38.7 mm(2). The "direct" "C"-shaped tibial insertion runs from along the medial tibial spine to the anterior aspect of the lateral meniscus. The mean width (length) of the "C" was 12.6 mm, its thickness 3.3 mm and area 31.4 mm(2). The centre of the "C" was the bony insertion of the anterior root of the lateral meniscus overlayed by fat and crossed by the ACL. No posterolateral (PL) inserting ACL fibres were found. Together with the larger "indirect" part (area 79.6 mm(2)), the "direct" one formed a "duck-foot"-shaped footprint. The tibial ACL midsubstance and tibial "C"-shaped insertion are flat and are resembling a "ribbon". The centre of the "C" is the bony insertion of the anterior root of the lateral meniscus. There are no central or PL inserting ACL fibres. Anatomical ACL reconstruction may therefore require a flat graft and a "C"-shaped tibial footprint reconstruction with an anteromedial bone tunnel for single bundle and an additional posteromedial bone tunnel for double bundle.

An in-line optical image translator with applications in x-ray videography.

PubMed

Picot, P A; Cardinal, H N; Fenster, A

1990-01-01

Many applications in radiography require, or would benefit from, the ability to translate, i.e. move, an optical image in the detector plane. In this paper, we describe the design and characterization of a prism-based optical image translator for insertion into existing XRII-video imaging systems. A pair of prisms rotatable about the optical axis form a very compact in-line optical image translator for installation in the parallel light path between an x-ray image intensifier and its video camera. Rotation of the prisms translates the XRII optical image on the camera target. With the addition of x-ray and light collimators to limit the image to a single video line, x-ray streak images may be acquired. By rotating an object in the x-ray beam during a streak, a complete computed tomography (CT) data set may be acquired. This image translator can translate an image anywhere in the focal plane of a 50-mm-output lens within a 40-mm-diam circle. The prisms have an aperture of 50 mm, permitting an optical speed of F/2 with a 50-mm output lens. The design is insensitive to angular alignment errors. This image translator is achromatic, since the spectral width of the output phosphorus of image intensifiers is sufficient to introduce blurring in a nonacrhomatic design. A prism-based image translator introduces image distortion, since the prisms do not operate at minimum deviation. The distortion is less than 4% over all parts of a typical detector area, and less than 1% in the central region of the image.(ABSTRACT TRUNCATED AT 250 WORDS)

Clinical guidelines on central venous catheterisation. Swedish Society of Anaesthesiology and Intensive Care Medicine.

PubMed

Frykholm, P; Pikwer, A; Hammarskjöld, F; Larsson, A T; Lindgren, S; Lindwall, R; Taxbro, K; Oberg, F; Acosta, S; Akeson, J

2014-05-01

Safe and reliable venous access is mandatory in modern health care, but central venous catheters (CVCs) are associated with significant morbidity and mortality, This paper describes current Swedish guidelines for clinical management of CVCs The guidelines supply updated recommendations that may be useful in other countries as well. Literature retrieval in the Cochrane and Pubmed databases, of papers written in English or Swedish and pertaining to CVC management, was done by members of a task force of the Swedish Society of Anaesthesiology and Intensive Care Medicine. Consensus meetings were held throughout the review process to allow all parts of the guidelines to be embraced by all contributors. All of the content was carefully scored according to criteria by the Oxford Centre for Evidence-Based Medicine. We aimed at producing useful and reliable guidelines on bleeding diathesis, vascular approach, ultrasonic guidance, catheter tip positioning, prevention and management of associated trauma and infection, and specific training and follow-up. A structured patient history focused on bleeding should be taken prior to insertion of a CVCs. The right internal jugular vein should primarily be chosen for insertion of a wide-bore CVC. Catheter tip positioning in the right atrium or lower third of the superior caval vein should be verified for long-term use. Ultrasonic guidance should be used for catheterisation by the internal jugular or femoral veins and may also be used for insertion via the subclavian veins or the veins of the upper limb. The operator inserting a CVC should wear cap, mask, and sterile gown and gloves. For long-term intravenous access, tunnelled CVC or subcutaneous venous ports are preferred. Intravenous position of the catheter tip should be verified by clinical or radiological methods after insertion and before each use. Simulator-assisted training of CVC insertion should precede bedside training in patients. Units inserting and managing CVC should have quality assertion programmes for implementation and follow-up of routines, teaching, training and clinical outcome. Clinical guidelines on a wide range of relevant topics have been introduced, based on extensive literature retrieval, to facilitate effective and safe management of CVCs. © 2014 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Mobile Interspersed Repeats Are Major Structural Variants in the Human Genome

PubMed Central

Huang, Cheng Ran Lisa; Schneider, Anna M.; Lu, Yunqi; Niranjan, Tejasvi; Shen, Peilin; Robinson, Matoya A.; Steranka, Jared P.; Valle, David; Civin, Curt I.; Wang, Tao; Wheelan, Sarah J.; Ji, Hongkai; Boeke, Jef D.; Burns, Kathleen H.

2010-01-01

Summary Characterizing structural variants in the human genome is of great importance, but a genome wide analysis to detect interspersed repeats has not been done. Thus, the degree to which mobile DNAs contribute to genetic diversity, heritable disease, and oncogenesis remains speculative. We perform transposon insertion profiling by microarray (TIP-chip) to map human L1(Ta) retrotransposons (LINE-1 s) genome-wide. This identified numerous novel human L1(Ta) insertional polymorphisms with highly variant allelic frequencies. We also explored TIP-chip's usefulness to identify candidate alleles associated with different phenotypes in clinical cohorts. Our data suggest that the occurrence of new insertions is twice as high as previously estimated, and that these repeats are under-recognized as sources of human genomic and phenotypic diversity. We have just begun to probe the universe of human L1(Ta) polymorphisms, and as TIP-chip is applied to other insertions such as Alu SINEs, it will expand the catalog of genomic variants even further. PMID:20602999

Regional fibrocartilage variations in human anterior cruciate ligament tibial insertion: a histological three-dimensional reconstruction.

PubMed

Dai, Can; Guo, Lin; Yang, Liu; Wu, Yi; Gou, Jingyue; Li, Bangchun

2015-02-01

We studied anterior cruciate ligament (ACL) tibial insertion architecture in humans and investigated regional differences that could suggest unequal force transmission from ligament to bone. ACL tibial insertions were processed histologically. With Photoshop software, digital images taken from the histological slides were collaged, contour lines were drawn, and different gray values were filled based on the structure. The data were exported to Amira software for three-dimensional reconstruction. The uncalcified fibrocartilage (UF) layer was divided into three regions: lateral, medial and posterior according to the architecture. The UF zone was significantly thicker laterally than medially or posteriorly (p < 0.05). Similarly, the calcified fibrocartilage (CF) thickness was significantly greater in the lateral part of the enthesis compared to the medial and posterior parts (p < 0.05). The UF quantity (more UF laterally) corresponding to the CF quantity (more CF laterally) at the ACL tibial insertion provides further evidence suggesting that the load transferred from the ACL to the tibia was greater laterally than medially and posteriorly.

Modeling and characterization of partially inserted electrical connector faults

NASA Astrophysics Data System (ADS)

Tokgöz, ćaǧatay; Dardona, Sameh; Soldner, Nicholas C.; Wheeler, Kevin R.

2016-03-01

Faults within electrical connectors are prominent in avionics systems due to improper installation, corrosion, aging, and strained harnesses. These faults usually start off as undetectable with existing inspection techniques and increase in magnitude during the component lifetime. Detection and modeling of these faults are significantly more challenging than hard failures such as open and short circuits. Hence, enabling the capability to locate and characterize the precursors of these faults is critical for timely preventive maintenance and mitigation well before hard failures occur. In this paper, an electrical connector model based on a two-level nonlinear least squares approach is proposed. The connector is first characterized as a transmission line, broken into key components such as the pin, socket, and connector halves. Then, the fact that the resonance frequencies of the connector shift as insertion depth changes from a fully inserted to a barely touching contact is exploited. The model precisely captures these shifts by varying only two length parameters. It is demonstrated that the model accurately characterizes a partially inserted connector.

Simulation improves procedural protocol adherence during central venous catheter placement: a randomized-controlled trial

PubMed Central

Peltan, Ithan D.; Shiga, Takashi; Gordon, James A.; Currier, Paul F.

2015-01-01

Background Simulation training may improve proficiency at and reduces complications from central venous catheter (CVC) placement, but the scope of simulation’s effect remains unclear. This randomized controlled trial evaluated the effects of a pragmatic CVC simulation program on procedural protocol adherence, technical skill, and patient outcomes. Methods Internal medicine interns were randomized to standard training for CVC insertion or standard training plus simulation-based mastery training. Standard training involved a lecture, a video-based online module, and instruction by the supervising physician during actual CVC insertions. Intervention-group subjects additionally underwent supervised training on a venous access simulator until they demonstrated procedural competence. Raters evaluated interns’ performance during internal jugular CVC placement on actual patients in the medical intensive care unit. Generalized estimating equations were used to account for outcome clustering within trainees. Results We observed 52 interns place 87 CVCs. Simulation-trained interns exhibited better adherence to prescribed procedural technique than interns who received only standard training (p=0.024). There were no significant differences detected in first-attempt or overall cannulation success rates, mean needle passes, global assessment scores or complication rates. Conclusions Simulation training added to standard training improved protocol adherence during CVC insertion by novice practitioners. This study may have been too small to detect meaningful differences in venous cannulation proficiency and other clinical outcomes, highlighting the difficulty of patient-centered simulation research in settings where poor outcomes are rare. For high-performing systems, where protocol deviations may provide an important proxy for rare procedural complications, simulation may improve CVC insertion quality and safety. PMID:26154250

High aspect ratio catalytic reactor and catalyst inserts therefor

DOEpatents

Lin, Jiefeng; Kelly, Sean M.

2018-04-10

The present invention relates to high efficient tubular catalytic steam reforming reactor configured from about 0.2 inch to about 2 inch inside diameter high temperature metal alloy tube or pipe and loaded with a plurality of rolled catalyst inserts comprising metallic monoliths. The catalyst insert substrate is formed from a single metal foil without a central supporting structure in the form of a spiral monolith. The single metal foil is treated to have 3-dimensional surface features that provide mechanical support and establish open gas channels between each of the rolled layers. This unique geometry accelerates gas mixing and heat transfer and provides a high catalytic active surface area. The small diameter, high aspect ratio tubular catalytic steam reforming reactors loaded with rolled catalyst inserts can be arranged in a multi-pass non-vertical parallel configuration thermally coupled with a heat source to carry out steam reforming of hydrocarbon-containing feeds. The rolled catalyst inserts are self-supported on the reactor wall and enable efficient heat transfer from the reactor wall to the reactor interior, and lower pressure drop than known particulate catalysts. The heat source can be oxygen transport membrane reactors.

Comparison between orogastric tube/bougie and a suction calibration system for effects on operative duration, staple-line corkscrewing, and esophageal perforation during laparoscopic sleeve gastrectomy.

PubMed

Gagner, Michel; Huang, Rose Y

2016-04-01

Placement of a bougie for sleeve sizing during laparoscopic sleeve gastrectomy (LSG) is recommended. We compared this standard with a suction calibration system (SCS) that performs all functions with one insertion, and measured each step's duration. Primary LSG was performed using a bougie and SCS in alternating order. Number of tube movements to achieve optimal placement, durations of decompression, leak testing, and overall operative time, and remnant linear measurements were obtained. LSG was performed in 26 patients (15 women, 11 men; mean age 36.8 years; mean BMI 45.3 kg/m(2)). The mean number of tube movements was significantly greater for the bougie than for the SCS (8.13 vs. 3.58; p < 0.0001). Percent reductions achieved using the SCS were: time to full decompression of the stomach, 62% (21 vs. 8 s; p < 0.138); tube placement, 51% (101 vs. 49 s; p < 0.0001); leak testing, 78% (119 vs. 26 s; p < 0.0003); and mean operative duration (from tube insertion to end of stapling), 21% (875 vs. 697 s; p < 0.019). Variance of the staple-line distance, measured from the greater curvature to the staple line, was 1.64 and 0.92 for the bougie and SCS, respectively, indicating a reduction in corkscrewing, for a 43.9% straighter sleeve. SCS maintained the gastric wall in place, thereby preventing corkscrewing, and reducing total operating time. Reducing the number of tube insertions may prevent esophageal damage and accidental tube stapling.

Functional neuroanatomy of the insular lobe.

PubMed

Stephani, C; Fernandez-Baca Vaca, G; Maciunas, R; Koubeissi, M; Lüders, H O

2011-06-01

The insula is the fifth lobe of the brain and it is the least known. Hidden under the temporal, frontal and parietal opercula, as well as under dense arterial and venous vessels, its accessibility is particularly restricted. Functional data on this region in humans, therefore, are scarce and the existing evidence makes conclusions on its functional and somatotopic organization difficult. 5 patients with intractable epilepsy underwent an invasive presurgical evaluation with implantation of diagnostic invasive-depth electrodes, including insular electrodes that were inserted using a mesiocaudodorsal to laterorostroventral approach. Altogether 113 contacts were found to be in the insula and were stimulated with alternating currents during preoperative monitoring. Different viscerosensitive and somatosensory phenomena were elicited by stimulation of these electrodes. A relatively high density of electrode contacts enabled us to delineate several functionally distinct areas within the insula. We found somatosensory symptoms to be restricted to the posterior insula and a subgroup of warmth or painful sensations in the dorsal posterior insula. Viscerosensory symptoms were elicited by more anterior electrode contacts with a subgroup of gustatory symptoms occurring after stimulation of electrode contacts in the central part of the insula. The anterior insula did not show reproducible responses to stimulation. In line with previous studies, we found evidence for somato- and viscerosensory cortex in the insula. In addition, our results suggest that there is a predominantly posterior and central distribution of these functions in the insular lobe.

Angioplasty and Vascular Stenting

MedlinePlus

... in the operating room. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Uterine Fibroid Embolization (UFE)

MedlinePlus

... in the operating room. You will be positioned on the examining table. You may be connected to monitors that track your heart rate, blood pressure and pulse during the procedure. A nurse or technologist will insert an intravenous (IV) line into a ...

Large-scale aeroacoustic research feasibility and conceptual design of test-section inserts for the Ames 80- by 120-foot wind tunnel

NASA Technical Reports Server (NTRS)

Soderman, Paul T.; Olsen, Larry E.

1990-01-01

An engineering feasibility study was made of aeroacoustic inserts designed for large-scale acoustic research on aircraft models in the 80 by 120 foot Wind Tunnel at NASA Ames Research Center. The advantages and disadvantages of likely designs were analyzed. Results indicate that the required maximum airspeed leads to the design of a particular insert. Using goals of 200, 150, and 100 knots airspeed, the analysis indicated a 30 x 60 ft open-jet test section, a 40 x 80 ft open jet test section, and a 70 x 100 ft closed test section with enhanced wall lining, respectively. The open-jet inserts would be composed of a nozzle, collector, diffuser, and acoutic wedges incorporated in the existing 80 x 120 test section. The closed test section would be composed of approximately 5 ft acoustic wedges covered by a porous plate attached to the test section walls of the existing 80 x 120. All designs would require a double row of acoustic vanes between the test section and fan drive to attenuate fan noise and, in the case of the open-jet designs, to control flow separation at the diffuser downstream end. The inserts would allow virtually anechoic acoustic studies of large helicopter models, jets, and V/STOL aircraft models in simulated flight. Model scale studies would be necessary to optimize the aerodynamic and acoustic performance of any of the designs. In all designs studied, the existing structure would have to be reinforced. Successful development of acoustically transparent walls, though not strictly necessary to the project, would lead to a porous-wall test section that could be substituted for any of the open-jet designs, and thereby eliminate many aerodynamic and acoustic problems characteristic of open-jet shear layers. The larger size of the facility would make installation and removal of the insert components difficult. Consequently, scheduling of the existing 80 x 120 aerodynamic test section and scheduling of the open-jet test section would likely be made on an annual or longer basis. The enhanced wall-lining insert would likely be permanent. Although the modifications are technically feasible, the economic practicality of the project was not evaluated.

Previous PICC Placement May Be Associated With Catheter-Related Infections in Hemodialysis Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Butler, Philip J., E-mail: philip.butler@yale.edu; Sood, Shreya; Mojibian, Hamid

2011-02-15

Background: Catheter-related infections (CRIs) are a significant source of morbidity and mortality in hemodialysis patients. The identification of novel, modifiable risk factors for CRIs may lead to improved outcomes in this population. Peripherally inserted central catheters (PICCs) have been hypothesized to compromise vascular access due to vascular damage and venous thrombosis, whereas venous thrombosis has been linked to the development of CRIs. Here we examine the association between PICC placement and CRIs. Methods: A retrospective review was performed of all chronic hemodialysis catheter placements and exchanges performed at a large university hospital from September 2003 to September 2008. History ofmore » PICC line use was determined by examining hospital radiologic records from December 1993 to September 2008. Catheter-related complications were assessed and correlated with PICC line history. Results: One hundred eighty-five patients with 713 chronic tunneled hemodialysis catheter placements were identified. Thirty-eight of those patients (20.5%) had a history of PICC placement; these patients were more likely to have CRIs (odds ratio = 2.46, 95% confidence interval = 1.71-3.53, p < .001) compared with patients without a history of PICC placement. There was no difference between the two groups in age or number of catheters placed. Conclusion: Previous PICC placement may be associated with catheter-related infections in hemodialysis patients.« less

Compliance with Prevention Practices and their Association with Central Line-Associated Blood Stream Infections in Neonatal Intensive Care Units

PubMed Central

Zachariah, Philip; Furuya, E. Yoko; Edwards, Jeffrey; Dick, Andrew; Liu, Hangsheng; Herzig, Carolyn; Pogorzelska-Maziarz, Monika; Stone, Patricia W.; Saiman, Lisa

2014-01-01

Background Bundles and checklists have been shown to decrease CLABSIs, but implementation of these practices and association with CLABSI rates have not been described nationally. We describe implementation and levels of compliance with prevention practices in a sample of US Neonatal ICUs and assess their association with CLABSI rates. Methods An online survey assessing infection prevention practices was sent to hospitals participating in National Healthcare Safety Network CLABSI surveillance in October 2011. Participating hospitals permitted access to their NICU CLABSI rates. Multivariable regressions were used to test the association between compliance with NICU specific CLABSI prevention practices and corresponding CLABSI rates. Results Overall, 190 Level II/III and Level III NICUs participated. The majority of NICUs had written policies (84%-93%) and monitored compliance with bundles and checklists (88% - 91%). Reporting ≥ 95% compliance for any of the practices ranged from 50%- 63%. Reporting ≥ 95% compliance with insertion checklist and assessment of daily line necessity were significantly associated with lower CLABSI rates (p<0.05). Conclusions Most NICUs in this national sample have instituted CLABSI prevention policies and monitor compliance, although reporting compliance ≥ 95% was suboptimal. Reporting ≥ 95% compliance with select CLABSI prevention practices was associated with lower CLABSI rates. Further studies should focus on identifying and improving compliance with effective CLABSI prevention practices in neonates. PMID:25087136

Phosphorylation Affects DNA-Binding of the Senescence-Regulating bZIP Transcription Factor GBF1

PubMed Central

Smykowski, Anja; Fischer, Stefan M.; Zentgraf, Ulrike

2015-01-01

Massive changes in the transcriptome of Arabidopsis thaliana during onset and progression of leaf senescence imply a central role for transcription factors. While many transcription factors are themselves up- or down-regulated during senescence, the bZIP transcription factor G-box-binding factor 1 (GBF1/bZIP41) is constitutively expressed in Arabidopsis leaf tissue but at the same time triggers the onset of leaf senescence, suggesting posttranscriptional mechanisms for senescence-specific GBF1 activation. Here we show that GBF1 is phosphorylated by the threonine/serine CASEIN KINASE II (CKII) in vitro and that CKII phosphorylation had a negative effect on GBF1 DNA-binding to G-boxes of two direct target genes, CATALASE2 and RBSCS1a. Phosphorylation mimicry at three serine positions in the basic region of GBF1 also had a negative effect on DNA-binding. Kinase assays revealed that CKII phosphorylates at least one serine in the basic domain but has additional phosphorylation sites outside this domain. Two different ckII α subunit1 and one α subunit2 T-DNA insertion lines showed no visible senescence phenotype, but in all lines the expression of the senescence marker gene SAG12 was remarkably diminished. A model is presented suggesting that senescence-specific GBF1 activation might be achieved by lowering the phosphorylation of GBF1 by CKII. PMID:27135347

Catheter-Salvage in Home Infusion Patients with Central Line-Associated Bloodstream Infection

PubMed Central

Caroff, Daniel A.; Norris, Anne H.; Keller, Sara; Vinnard, Christopher; Zeitler, Kristen E.; Lukaszewicz, Jennifer; Zborowski, Kristine A.; Linkin, Darren R.

2014-01-01

In a retrospective study of home infusion patients with central line-associated bloodstream infection, use of a central venous port, cancer diagnosis, and the absence of systemic inflammatory response syndrome were associated with use of catheter-salvage. Relapse of infection was uncommon. PMID:25465266

Sound attenuation of fiberglass lined ventilation ducts

NASA Astrophysics Data System (ADS)

Albright, Jacob

Sound attenuation is a crucial part of designing any HVAC system. Most ventilation systems are designed to be in areas occupied by one or more persons. If these systems do not adequately attenuate the sound of the supply fan, compressor, or any other source of sound, the affected area could be subject to an array of problems ranging from an annoying hum to a deafening howl. The goals of this project are to quantify the sound attenuation properties of fiberglass duct liner and to perform a regression analysis to develop equations to predict insertion loss values for both rectangular and round duct liners. The first goal was accomplished via insertion loss testing. The tests performed conformed to the ASTM E477 standard. Using the insertion loss test data, regression equations were developed to predict insertion loss values for rectangular ducts ranging in size from 12-in x 18-in to 48-in x 48-in in lengths ranging from 3ft to 30ft. Regression equations were also developed to predict insertion loss values for round ducts ranging in diameters from 12-in to 48-in in lengths ranging from 3ft to 30ft.

A multi-landing pad DNA integration platform for mammalian cell engineering

PubMed Central

Gaidukov, Leonid; Wroblewska, Liliana; Teague, Brian; Nelson, Tom; Zhang, Xin; Liu, Yan; Jagtap, Kalpana; Mamo, Selamawit; Tseng, Wen Allen; Lowe, Alexis; Das, Jishnu; Bandara, Kalpanie; Baijuraj, Swetha; Summers, Nevin M; Zhang, Lin; Weiss, Ron

2018-01-01

Abstract Engineering mammalian cell lines that stably express many transgenes requires the precise insertion of large amounts of heterologous DNA into well-characterized genomic loci, but current methods are limited. To facilitate reliable large-scale engineering of CHO cells, we identified 21 novel genomic sites that supported stable long-term expression of transgenes, and then constructed cell lines containing one, two or three ‘landing pad’ recombination sites at selected loci. By using a highly efficient BxB1 recombinase along with different selection markers at each site, we directed recombinase-mediated insertion of heterologous DNA to selected sites, including targeting all three with a single transfection. We used this method to controllably integrate up to nine copies of a monoclonal antibody, representing about 100 kb of heterologous DNA in 21 transcriptional units. Because the integration was targeted to pre-validated loci, recombinant protein expression remained stable for weeks and additional copies of the antibody cassette in the integrated payload resulted in a linear increase in antibody expression. Overall, this multi-copy site-specific integration platform allows for controllable and reproducible insertion of large amounts of DNA into stable genomic sites, which has broad applications for mammalian synthetic biology, recombinant protein production and biomanufacturing. PMID:29617873

76 FR 15970 - Central Ferry to Lower Monumental 500-kilovolt Transmission Line Project

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-22

...-kilovolt Transmission Line Project AGENCY: Bonneville Power Administration (BPA), Department of Energy (DOE... Project in Garfield, Columbia, and Walla Walla counties, Washington. BPA has decided to implement the... consists of constructing a new 500-kV single- circuit transmission line from BPA's new Central Ferry...

The effect of peripherally inserted central catheter (PICC) valve technology on catheter occlusion rates--the 'ELeCTRiC' study.

PubMed

Johnston, Andrew J; Streater, Carmel T; Noorani, Remy; Crofts, Joanne L; Del Mundo, Aldwin B; Parker, Richard A

2012-01-01

Peripherally Inserted Central Catheters (PICCs) are increasingly being used to provide short to medium-term central venous access. The current study was designed to test the hypothesis that PICC valve technology does not influence PICC occlusion rates. Intensive care unit (ICU) patients who required a PICC were randomized to one of three types of dual lumen PICC (open ended non-valved, Groshong valve, PASV valve). PICC occlusions were recorded and managed with a protocol that used urokinase. A total of 102 patients were recruited to the study. The overall risk of occlusion per catheter was 35% (95% CI 26% to 44%). The overall rate of occlusion was 76 occlusions per 1000 catheter days (95% CI 61 to 95). Presence or type of valve did not significantly influence this rate (open-ended non-valved PICC 38% of catheters, 79 occlusions per 1000 catheter days; Groshong 38% of catheters, 60 occlusions per 1000 catheter days; PASV 27% of catheters, 99 occlusions per 1000 catheter days). The dose of urokinase required to treat PICC occlusions did not significantly differ between PICC types. Valved PICCs do not appear to influence PICC occlusion rates.

International Meeting on Simulation in Healthcare 2007

DTIC Science & Technology

2007-03-01

Research Abstract : 32  Simulation­based Training in Ultrasound Assisted  Central   Venous   Catheterization .  Pamela Andreatta 1 , Rajani Mangrulkar 2...vascular access skill training for  central   venous   catheterization , and basic and difficult airway management skill training with infant/pediatric/adult task...Office of Clinical  Affairs, University of Michigan Health System Background: More than 5 million central venous catheters (CVCs) are inserted in the

The insertional history of an active family of L1 retrotransposons in humans.

PubMed

Boissinot, Stéphane; Entezam, Ali; Young, Lynn; Munson, Peter J; Furano, Anthony V

2004-07-01

As humans contain a currently active L1 (LINE-1) non-LTR retrotransposon family (Ta-1), the human genome database likely provides only a partial picture of Ta-1-generated diversity. We used a non-biased method to clone Ta-1 retrotransposon-containing loci from representatives of four ethnic populations. We obtained 277 distinct Ta-1 loci and identified an additional 67 loci in the human genome database. This collection represents approximately 90% of the Ta-1 population in the individuals examined and is thus more representative of the insertional history of Ta-1 than the human genome database, which lacked approximately 40% of our cloned Ta-1 elements. As both polymorphic and fixed Ta-1 elements are as abundant in the GC-poor genomic regions as in ancestral L1 elements, the enrichment of L1 elements in GC-poor areas is likely due to insertional bias rather than selection. Although the chromosomal distribution of Ta-1 inserts is generally a function of chromosomal length and gene density, chromosome 4 significantly deviates from this pattern and has been much more hospitable to Ta-1 insertions than any other chromosome. Also, the intra-chromosomal distribution of Ta-1 elements is not uniform. Ta-1 elements tend to cluster, and the maximal gaps between Ta-1 inserts are larger than would be expected from a model of uniform random insertion. Copyright 2004 Cold Spring Harbor Laboratory Press ISSN

Experimental Evaluation of a SiPM-Based Scintillation Detector for MR-Compatible SPECT Systems

NASA Astrophysics Data System (ADS)

Busca, Paolo; Occhipinti, Michele; Trigilio, Paolo; Cozzi, Giulia; Fiorini, Carlo; Piemonte, Claudio; Ferri, Alessandro; Gola, Alberto; Nagy, Kálmán; Bükki, Tamás; Rieger, Jan

2015-10-01

In the present work we briefly describe the architecture of a photo-detection module, designed in the framework of the INSERT (INtegrated SPECT/MRI for Enhanced Stratification in Radio-chemoTherapy) project, supported by the European Community. We focus on two main elements of the module: the SiPM photo-detector unit and the multi-channel ASIC. These two components have been investigated with dedicated and independent setups to assess preliminary performance of INSERT architecture. In details, we designed a 25.30 mm ×25.85 mm tile, comprising 9 pixels, each one with an 8 mm ×8 mm active area. We developed an Anger camera to characterize the tile coupled to a CsI:Tl scintillator (6 mm thick). We measured an average spatial resolution (FWHM) of 2 mm in the central region of the Field of View and a 15.3% energy resolution using a 57Co source (122 keV), when the tile is cooled down to 0 ° C to reduce the impact of the dark count rate. Furthermore, we developed ANGUS, a 36-channels 0.35 μm CMOS technology ASIC designed to cope with input capacitance up to 5 nF, typical of large area SiPM pixels. The spectroscopic capability of single readout channels were evaluated by coupling an 8 mm ×8 mm pixel with a cylindrical CsI:Tl scintillator (8 mm diameter, 10 mm thickness). Energy resolution at room temperature provided values between 13% and 13.5% (FWHM) at the 122 keV line for the nine pixels.

Frequent accesses to totally implanted vascular ports in pediatric oncology patients are associated with higher infection rates.

PubMed

Gapany, Christophe; Tercier, Stéphane; Diezi, Manuel; Clement, Chantal; Lemay, Katy; Joseph, Jean-Marc

2011-01-01

Totally implanted vascular (TIVA) ports are used in children for repeated blood samples or intravenous treatments. We have recently published a prospective evaluation of surgical incidents and early complications associated with these devices. This work is the final part of the same study, assessing late complications over a follow-up of 2 yrs. From January 2006 to January 2008, children older than 1 yr of age with a diagnosis of solid or blood cell malignancy were included. Insertion technique and care of the device were standardized. Every manipulation was prospectively recorded by specialized nurses. Obstruction was documented clinically. When bacteremia was suspected, routine central and peripheral blood cultures were drawn. Forty-five consecutive patients were enrolled in the study. Mean age at the time of the procedure was 8.5 yrs. There was no catheter-related infection within the first 4 weeks post-surgery. No device had to be removed because of infection or obstruction during follow-up. Frequent accesses to the port (=3 per day over a 10-day period) were associated with an 8-fold risk of infection. Insertion and use of TIVA devices were frequently associated with complications. No device had to be removed because of infection or obstruction over the follow-up period, although no prophylactic antibiotic agent was used. Restrictive use of antibiotics may prevent opportunistic infection. Frequent access to the device was significantly associated with line infection (odds ratio=8.43). No risk factor was identified for obstruction which occurred at a rate of 5.3 per 10,000 accesses.

Human Transposon Tectonics

PubMed Central

Burns, Kathleen H.; Boeke, Jef D.

2012-01-01

Mobile DNAs have had a central role in shaping our genome. More than half of our DNA is comprised of interspersed repeats resulting from replicative copy and paste events of retrotransposons. Although most are fixed, incapable of templating new copies, there are important exceptions to retrotransposon quiescence. De novo insertions cause genetic diseases and cancers, though reliably detecting these occurrences has been difficult. New technologies aimed at uncovering polymorphic insertions reveal that mobile DNAs provide a substantial and dynamic source of structural variation. Key questions going forward include the how and how much new transposition events affect human health and disease. PMID:22579280

Ti6Al4V laser surface preparation and functionalization using hydroxyapatite for biomedical applications.

PubMed

Faria, D; Abreu, C S; Buciumeanu, M; Dourado, N; Carvalho, O; Silva, F S; Miranda, G

2018-05-01

This work presents a novel texture design for implants surface functionalization, through the creation of line-shaped textures on Ti6Al4V surfaces and subsequent sintering of hydroxyapatite (HAp) powder into the designated locations. HAp-rich locations were designed to avoid HAp detachment during insertion, thus guaranteeing an effective osseointegration. This process starts by creating textured lines using a Nd:YAG laser, filling these lines with HAp powder and sintering HAp using a CO 2 laser. The adhesion of HAp is known to be influenced by HAp sintering parameters, especially laser power and scanning speed and also by the textured lines manufacturing. Different laser parameters combinations were used to assess the sintering and adhesion of HAp to the textured lines. HAp adhesion was assessed by performing high energy ultrasonic cavitation tests and sliding tests mimicking an implant insertion, with Ti6Al4V/HAp specimens sliding against animal bone. The HAp content retained after these tests was measured and results showed that an excellent HAp sintering and adhesion was achieved when using a scan speed of 1 mm/s and laser power between 9 and 9.6 W. It is important to emphasize that results indicated that the HAp bioactivity was maintained when using these conditions, validating this functionalization process for the production of hip prosthesis with improved bioactivity. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 1534-1545, 2018. © 2017 Wiley Periodicals, Inc.

Exome sequencing of a colorectal cancer family reveals shared mutation pattern and predisposition circuitry along tumor pathways.

PubMed

Suleiman, Suleiman H; Koko, Mahmoud E; Nasir, Wafaa H; Elfateh, Ommnyiah; Elgizouli, Ubai K; Abdallah, Mohammed O E; Alfarouk, Khalid O; Hussain, Ayman; Faisal, Shima; Ibrahim, Fathelrahamn M A; Romano, Maurizio; Sultan, Ali; Banks, Lawrence; Newport, Melanie; Baralle, Francesco; Elhassan, Ahmed M; Mohamed, Hiba S; Ibrahim, Muntaser E

2015-01-01

The molecular basis of cancer and cancer multiple phenotypes are not yet fully understood. Next Generation Sequencing promises new insight into the role of genetic interactions in shaping the complexity of cancer. Aiming to outline the differences in mutation patterns between familial colorectal cancer cases and controls we analyzed whole exomes of cancer tissues and control samples from an extended colorectal cancer pedigree, providing one of the first data sets of exome sequencing of cancer in an African population against a background of large effective size typically with excess of variants. Tumors showed hMSH2 loss of function SNV consistent with Lynch syndrome. Sets of genes harboring insertions-deletions in tumor tissues revealed, however, significant GO enrichment, a feature that was not seen in control samples, suggesting that ordered insertions-deletions are central to tumorigenesis in this type of cancer. Network analysis identified multiple hub genes of centrality. ELAVL1/HuR showed remarkable centrality, interacting specially with genes harboring non-synonymous SNVs thus reinforcing the proposition of targeted mutagenesis in cancer pathways. A likely explanation to such mutation pattern is DNA/RNA editing, suggested here by nucleotide transition-to-transversion ratio that significantly departed from expected values (p-value 5e-6). NFKB1 also showed significant centrality along with ELAVL1, raising the suspicion of viral etiology given the known interaction between oncogenic viruses and these proteins.

Shoe inserts and orthotics for sport and physical activities.

PubMed

Nigg, B M; Nurse, M A; Stefanyshyn, D J

1999-07-01

The purposes of this paper were to discuss the perceived benefits of inserts and orthotics for sport activities and to propose a new concept for inserts and orthotics. There is evidence that inserts or orthotics reduce or prevent movement-related injuries. However, there is limited knowledge about the specific functioning an orthotic or insert provides. The same orthotic or insert is often proposed for different problems. Changes in skeletal movement due to inserts or orthotics seem to be small and not systematic. Based on the results of a study using bone pins, one may question the idea that a major function of orthotics or inserts consists in aligning the skeleton. Impact cushioning with shoe inserts or orthotics is typically below 10%. Such small reductions might not be important for injury reduction. It has been suggested that changes in material properties might produce adjustments in the muscular response of the locomotor system. The foot has various sensors to detect input signals with subject specific thresholds. Subjects with similar sensitivity threshold levels seem to respond in their movement pattern in a similar way. Comfort is an important variable. From a biomechanical point of view, comfort may be related to fit, additional stabilizing muscle work, fatigue, and damping of soft tissue vibrations. Based on the presented evidence, the concept of minimizing muscle work is proposed when using orthotics or inserts. A force signal acts as an input variable on the shoe. The shoe sole acts as a first filter, the insert or orthotic as a second filter, the plantar surface of the foot as a third filter for the force input signal. The filtered information is transferred to the central nervous system that provides a subject specific dynamic response. The subject performs the movement for the task at hand. For a given movement task, the skeleton has a preferred path. If an intervention supports/counteracts the preferred movement path, muscle activity can/must be reduced/increased. Based on this concept, an optimal insert or orthotic would reduce muscle activity, feel comfortable, and should increase performance.

49 CFR 71.7 - Boundary line between central and mountain zones.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 1 2010-10-01 2010-10-01 false Boundary line between central and mountain zones. 71.7 Section 71.7 Transportation Office of the Secretary of Transportation STANDARD TIME ZONE... mountain standard time zone, except Murdo, S. Dak., which is in the central standard time zone. [Amdt. 71...

The ATCA CABB Line Survey on Centaurus A: Properties of the Molecular Gas from the Dust Lanes to the Central Engine

NASA Astrophysics Data System (ADS)

Ott, Juergen; Henkel, Christian; Meier, David; Feain, Ilana; Martin-Pintado, Jesus; Israel, Frank; Impellizzeri, Caterina M. V.

2011-04-01

Centaurus A with its host NGC5128 is the most nearby radio galaxy. Its molecular spectrum exhibits three prominent features: a) gas that is located in the outer disk and dust lanes, b) absorption lines that are supposedly close to the central AGN, and c) gas in emission from the central nucleus. We propose to perform an extensive line survey toward CenA using the exciting new capabilities of CABB. Our multi-band line observations will allow us to derive the exact physical conditions of each component as well as the chemistry involved.

Use of Six Sigma strategies to pull the line on central line-associated bloodstream infections in a neurotrauma intensive care unit.

PubMed

Loftus, Kelli; Tilley, Terry; Hoffman, Jason; Bradburn, Eric; Harvey, Ellen

2015-01-01

The creation of a consistent culture of safety and quality in an intensive care unit is challenging. We applied the Six Sigma Define-Measure-Analyze-Improve-Control (DMAIC) model for quality improvement (QI) to develop a long-term solution to improve outcomes in a high-risk neurotrauma intensive care unit. We sought to reduce central line utilization as a cornerstone in preventing central line-associated bloodstream infections (CLABSIs). This study describes the successful application of the DMAIC model in the creation and implementation of evidence-based quality improvement designed to reduce CLABSIs to below national benchmarks.

Central line-associated blood stream infections in pediatric ICUs: Longitudinal trends and compliance with bundle strategies

PubMed Central

Edwards, Jeffrey D; Herzig, Carolyn TA; Liu, Hangsheng; Pogorzelska-Maziarz, Monika; Zachariah, Philip; Dick, Andrew W; Saiman, Lisa; Stone, Patricia W; Furuya, E Yoko

2015-01-01

Background Knowing the temporal trend central line-associated bloodstream infection (CLABSI) rates among U.S. pediatric intensive care units (PICU), the current extent of CL bundle compliance, and the impact of compliance on rates is necessary to understand what has been accomplished and can be improved in CLABSI prevention. Methods Longitudinal study of PICUs in National Healthcare Safety Network hospitals and a cross-sectional survey of directors/managers of infection prevention & control departments regarding PICU CLABSI prevention practices, including self-reported compliance with elements of central line bundles. Associations between 2011/12 PICU CLABSI rates and infection prevention practices were examined. Results Reported CLABSI rates decreased during the study period, from 5.8 per 1000 line days in 2006 to 1.4 in 2011/12 (P<0.001). While 73% of PICUs had policies for all central line prevention practices, only 35% of those with policies reported ≥95% compliance. PICUs with ≥95% compliance with central line infection prevention policies had lower reported CLABSI rates, but this association was statistically insignificant. Conclusions There was a non-significant trend in decreasing CLABSI rates as PICUs improved bundle policy compliance. Given that few PICUs reported full compliance with these policies, PICUs increasing their efforts to comply with these policies may help reduce CLABSI rates. PMID:25952048

Self-expanding Y stents in the treatment of central airway stenosis: a retrospective analysis.

PubMed

Gompelmann, Daniela; Eberhardt, Ralf; Schuhmann, Maren; Heussel, Claus P; Herth, Felix J F

2013-10-01

Central airway obstruction (CAO) is a life-threatening situation. Stent insertion re-establishes patency of the central airways. Self-expanding metallic Y stents have been available since 2005, widening the spectrum of interventional bronchoscopic techniques. Retrospective analysis of all patients treated for CAO with a self-expanding metallic Y stent at the Thoraxklinik Heidelberg between May 2005 and January 2009. A total of 43 patients aged 26-81 had a metallic Y stent inserted endoscopically for the treatment of CAO; 39 of these patients (90.7%) had CAO due to malignant disease, four patients (9.3%) due to benign disease. In all 43 patients, the Y stent was deployed without any complications. A longitudinal follow up was possible in 32 of the 43 patients. The stents remained in situ for an average of 107.1 days (range 1-640 days). In 29 patients with malignant CAO the stenosis was successfully overcome with a Y stent; 11 of these patients died within 6 weeks following stent insertion. On follow up the remaining 18 patients showed immediate improvement of dyspnoea. Eight out of the 18 patients (44.4%) tolerated the stent without problems, two (11.1%) required further stenting, six (33.3%) had complications such as increased secretions, cough, dyspnoea or granulation tissue formation. The stent was removed in one patient (5.6%) due to increased secretions, and in another (5.6%) as the stent was no longer required due to successful tumour-specific therapy. Placement of Y stents in symptomatic CAO allows for quick relief of symptoms. Severe complications are rare. Stent removal is possible after successful treatment of the primary tumour. However, the prognostic indicator for survival is the underlying malignancy.

Body surface infrared thermometry in patients with central venous cateter-related infections

PubMed Central

Silvah, José Henrique; de Lima, Cristiane Maria Mártires; de Unamuno, Maria do Rosário Del Lama; Schetino, Marco Antônio Alves; Schetino, Luana Pereira Leite; Fassini, Priscila Giácomo; Brandão, Camila Fernanda Costa e Cunha Moraes; Basile, Anibal; da Cunha, Selma Freire Carvalho; Marchini, Julio Sergio

2015-01-01

Objective To evaluate if body surface temperature close to the central venous catheter insertion area is different when patients develop catheter-related bloodstream infections. Methods Observational cross-sectional study. Using a non-contact infrared thermometer, 3 consecutive measurements of body surface temperature were collected from 39 patients with central venous catheter on the following sites: nearby the catheter insertion area or totally implantable catheter reservoir, the equivalent contralateral region (without catheter), and forehead of the same subject. Results A total of 323 observations were collected. Respectively, both in male and female patients, disregarding the occurrence of infection, the mean temperature on the catheter area minus that on the contralateral region (mean ± standard deviation: -0.3±0.6°C versus -0.2±0.5ºC; p=0.36), and the mean temperature on the catheter area minus that on the forehead (mean ± standard deviation: -0.2±0.5°C versus -0.1±0.5ºC; p=0.3) resulted in negative values. Moreover, in infected patients, higher values were obtained on the catheter area (95%CI: 36.6-37.5ºC versus 36.3-36.5ºC; p<0.01) and by temperature subtractions: catheter area minus contralateral region (95%CI: -0.17 - +0.33ºC versus -0.33 - -0.20ºC; p=0.02) and catheter area minus forehead (95%CI: -0.02 - +0.55ºC versus -0.22 - -0.10ºC; p<0.01). Conclusion Using a non-contact infrared thermometer, patients with catheter-related bloodstream infections had higher temperature values both around catheter insertion area and in the subtraction of the temperatures on the contralateral and forehead regions from those on the catheter area. PMID:26466058

Body surface infrared thermometry in patients with central venous cateter-related infections.

PubMed

Silvah, José Henrique; Lima, Cristiane Maria Mártires de; Unamuno, Maria do Rosário Del Lama de; Schetino, Marco Antônio Alves; Schetino, Luana Pereira Leite; Fassini, Priscila Giácomo; Brandão, Camila Fernanda Costa e Cunha Moraes; Basile-Filho, Anibal; Cunha, Selma Freire Carvalho da; Marchini, Julio Sergio

2015-01-01

To evaluate if body surface temperature close to the central venous catheter insertion area is different when patients develop catheter-related bloodstream infections. Observational cross-sectional study. Using a non-contact infrared thermometer, 3 consecutive measurements of body surface temperature were collected from 39 patients with central venous catheter on the following sites: nearby the catheter insertion area or totally implantable catheter reservoir, the equivalent contralateral region (without catheter), and forehead of the same subject. A total of 323 observations were collected. Respectively, both in male and female patients, disregarding the occurrence of infection, the mean temperature on the catheter area minus that on the contralateral region (mean ± standard deviation: -0.3±0.6°C versus-0.2±0.5ºC; p=0.36), and the mean temperature on the catheter area minus that on the forehead (mean ± standard deviation: -0.2±0.5°C versus-0.1±0.5ºC; p=0.3) resulted in negative values. Moreover, in infected patients, higher values were obtained on the catheter area (95%CI: 36.6-37.5ºC versus 36.3-36.5ºC; p<0.01) and by temperature subtractions: catheter area minus contralateral region (95%CI: -0.17 - +0.33ºC versus -0.33 - -0.20ºC; p=0.02) and catheter area minus forehead (95%CI: -0.02 - +0.55ºC versus-0.22 - -0.10ºC; p<0.01). Using a non-contact infrared thermometer, patients with catheter-related bloodstream infections had higher temperature values both around catheter insertion area and in the subtraction of the temperatures on the contralateral and forehead regions from those on the catheter area.

Cost effectiveness of different central venous approaches for port placement and use in adult oncology patients: evidence from a randomized three-arm trial.

PubMed

Biffi, Roberto; Pozzi, Simonetta; Bonomo, Guido; Della Vigna, Paolo; Monfardini, Lorenzo; Radice, Davide; Rotmensz, Nicole; Zampino, Maria Giulia; Fazio, Nicola; Orsi, Franco

2014-11-01

No randomized trials have so far investigated the cost effectiveness of different methods for implantation and use of central venous ports in oncology patients. Overall, 403 patients eligible for receiving intravenous chemotherapy for solid tumours were randomly assigned to implantation of a single type of port, either through a percutaneous landmark access to the internal jugular vein, an ultrasound (US)-guided access to the subclavian vein, or a surgical cut-down access through the cephalic vein at the deltoid-pectoralis groove. Insertion and maintenance costs were estimated by obtaining the charges for an average implant and use, while the costs of the management of complications were analytically assessed. The total cost was defined as the purchase cost plus the insertion cost plus the maintenance cost plus the cost of treatment of the complications, if any. A total of 401 patients were evaluable-132 with the internal jugular vein, 136 with the subclavian vein and 133 with the cephalic vein access. No differences were found for the rate of early complications. The US-guided subclavian insertion site had significantly lower failures. Infections occurred in 1, 3, and 3 patients (internal jugular, subclavian, and cephalic access, respectively; p = 0.464), whereas venous thrombosis was observed in 15, 8, and 11 patients, respectively (p = 0.272). Mean cost for purchase, implantation, diagnosis and treatment of complications in each patient was 2,167.85 for subclavian US-guided, 2,335.87 for cephalic, and 2,384.10 for internal jugular access, respectively (p = 0.0001). US real-time guidance to the subclavian vein resulted in the most cost-effective method of central venous port placement and use.

A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.

PubMed

Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna

2008-03-01

Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.

Development of Multi-Functional Voltage Restore System

NASA Astrophysics Data System (ADS)

Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki

Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.

Measurements by a Vector Network Analyzer at 325 to 508 GHz

NASA Technical Reports Server (NTRS)

Fung, King Man; Samoska, Lorene; Chattopadhyay, Goutam; Gaier, Todd; Kangaslahti, Pekka; Pukala, David; Lau, Yuenie; Oleson, Charles; Denning, Anthony

2008-01-01

Recent experiments were performed in which return loss and insertion loss of waveguide test assemblies in the frequency range from 325 to 508 GHz were measured by use of a swept-frequency two-port vector network analyzer (VNA) test set. The experiments were part of a continuing effort to develop means of characterizing passive and active electronic components and systems operating at ever increasing frequencies. The waveguide test assemblies comprised WR-2.2 end sections collinear with WR-3.3 middle sections. The test set, assembled from commercially available components, included a 50-GHz VNA scattering- parameter test set and external signal synthesizers, augmented with recently developed frequency extenders, and further augmented with attenuators and amplifiers as needed to adjust radiofrequency and intermediate-frequency power levels between the aforementioned components. The tests included line-reflect-line calibration procedures, using WR-2.2 waveguide shims as the "line" standards and waveguide flange short circuits as the "reflect" standards. Calibrated dynamic ranges somewhat greater than about 20 dB for return loss and 35 dB for insertion loss were achieved. The measurement data of the test assemblies were found to substantially agree with results of computational simulations.

Agrobacterium-mediated transformation of maize (Zea mays) with Cre-lox site specific recombination cassettes in BIBAC vectors.

PubMed

Vega, Juan M; Yu, Weichang; Han, Fangpu; Kato, Akio; Peters, Eric M; Zhang, Zhanyuan J; Birchler, James A

2008-04-01

The Cre/loxP site-specific recombination system has been applied in various plant species including maize (Zea mays) for marker gene removal, gene targeting, and functional genomics. A BIBAC vector system was adapted for maize transformation with a large fragment of genetic material including a herbicide resistance marker gene, a 30 kb yeast genomic fragment as a marker for fluorescence in situ hybridization (FISH), and a 35S-lox-cre recombination cassette. Seventy-five transgenic lines were generated from Agrobacterium-mediated transformation of a maize Hi II line with multiple B chromosomes. Eighty-four inserts have been localized among all 10 A chromosome pairs by FISH using the yeast DNA probe together with a karyotyping cocktail. No inserts were found on the B chromosomes; thus a bias against the B chromosomes by the Agrobacterium-mediated transformation was revealed. The expression of a cre gene was confirmed in 68 of the 75 transgenic lines by a reporter construct for cre/lox mediated recombination. The placement of the cre/lox site-specific recombination system in many locations in the maize genome will be valuable materials for gene targeting and chromosome engineering.

Remifentanil for the insertion and removal of long-term central venous access during monitored anesthesia care.

PubMed

Burlacu, Crina L; McKeating, Kevin; McShane, Alan J

2011-06-01

To determine the analgesic efficacy of three different rates of remifentanil infusion in patients undergoing insertion or removal of long-term central venous access devices during monitored anesthesia care and local anesthetic field infiltration. Double-blinded, randomized, controlled study. Operating theatre of an University hospital. 44 unpremedicated, ASA physical status 1 and 2 patients, aged 18-65 years, undergoing insertion or removal of a Port-a-Cath or Hickman catheter. Patients sedated with a propofol target-controlled infusion were randomly allocated to three groups: Group R25 (n = 14), Group R50 (n = 15), and Group R75 (n = 15), to receive remifentanil 0.025, 0.05, and 0.075 μg/kg/min, respectively. Rescue remifentanil 0.5 μg/kg was administered for pain scores > 3. The remifentanil infusion rate was maintained constant unless respiratory and/or cardiovascular unwanted events occurred, whereupon the rate was adjusted in 0.01 μg/kg/min decrements as necessary. Pain scores (primary outcome), sedation, and movement scores (secondary outcomes) were assessed during local anesthetic infiltration of the anterior chest wall and 5 other procedural steps. All infusion rates had equal analgesic efficacy, as shown by comparable pain scores, number of rescue boluses, and number of patients requiring rescue analgesia. Excessive sedation was associated with the highest remifentanil rate such that Group R75 patients were significantly more sedated than Groups R25 or R50 at selective procedural steps (P < 0.05). More Group R75 patients (6/15) required remifentanil rate reduction than did patients from Group R50 (1/15) or Group R25 (0/14), P < 0.01, most commonly because of respiratory depression. For the insertion or removal of long-term central venous access devices, all three remifentanil infusion rates proved to be equally analgesic-efficient. However, the excessive sedation and tendency to respiratory and cardiovascular events associated with the highest remifentanil infusion rate renders such a rate less desirable for this purpose. Copyright © 2011 Elsevier Inc. All rights reserved.

The transverse ligament as a landmark for tibial sagittal insertions of the anterior cruciate ligament: a cadaveric study.

PubMed

Kongcharoensombat, Wirat; Ochi, Mitsuo; Abouheif, Mohamed; Adachi, Nobuo; Ohkawa, Shingo; Kamei, Goki; Okuhara, Atushi; Shibuya, Hoyatoshi; Niimoto, Takuya; Nakasa, Tomoyuki; Nakamae, Atsuo; Deie, Masataka

2011-10-01

The purpose of this study was to determine the relation between the position of the transverse ligament, the anterior edge of the anterior cruciate ligament (ACL) tibial footprint, and the center of the ACL tibial insertion. We used arthroscopy for localization of the anatomic landmarks, followed by insertions of guide pins under direct visualization, and then the position of these guide pins was checked on plain lateral radiographs. The transverse ligament and the anterior aspect of the ACL tibial footprint were identified by arthroscopy in 20 unpaired cadaveric knees (10 left and 10 right). Guide pins were inserted with tibial ACL adapter drill guides under direct observation at the transverse ligament, the anterior aspect of the tibial footprint, and the center of tibial insertion of the ACL. Then, plain lateral radiographs of specimens were taken. The Amis and Jakob line was used to define the attachment of the ACL tibial insertion and the transverse ligament. A sagittal percentage of the location of the insertion point was determined and calculated from the anterior margin of the tibia in the anteroposterior direction. The transverse ligament averaged 21.20% ± 4.1%, the anterior edge of the ACL tibial insertion averaged 21.60% ± 4.0%, and the center of the ACL tibial insertion averaged 40.30% ± 4.8%. There were similar percent variations between the transverse ligament and the anterior edge of the ACL tibial insertion, with no significant difference between them (P = .38). Intraobserver and interobserver reliability was high, with small standard errors of measurement. This study shows that the transverse ligament coincides with the anterior edge of the ACL tibial footprint in the sagittal plane. The transverse ligament can be considered as a new landmark for tibial tunnel positioning during anatomic ACL reconstruction. Copyright © 2011 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

Central venous catheters: legal issues.

PubMed

Gallieni, Maurizio; Martina, Valentina; Rizzo, Maria Antonietta; Gravellone, Luciana; Mobilia, Francesca; Giordano, Antonino; Cusi, Daniele; Genovese, Umberto

2011-01-01

In dialysis patients, both central venous catheter (CVC) insertion and CVC use during the dialysis procedure pose important legal issues, because of potentially severe, even fatal, complications. The first issue is the decision of the kind of vascular access that should be proposed to patients: an arteriovenous (AV) fistula, a graft, or a CVC. The second issue, when choosing the CVC option, is the choice of CVC: nontunneled versus tunneled. Leaving a temporary nontunneled CVC for a prolonged time increases the risk of complications and could raise a liability issue. Even when choosing a long-term tunneled CVC, nephrologists should systematically explain its potential harms, presenting them as "unsafe for long-term use" unless there is a clear contraindication to an AV native or prosthetic access. Another critical issue is the preparation of a complete, informative, and easy-to-understand consent form. The CVC insertion procedure has many aspects of legal interest, including the choice of CVC, the use of ECG monitoring, the use of ultrasound guidance for cannulation, and the use of fluoroscopy for checking the position of the metal guidewire during the procedure as well as the CVC tip before the end of the procedure. Use of insertion devices and techniques that can prevent complications should obviously be encouraged. Complications of CVC use are mainly thrombosis and infection. These are theoretically expected as pure complications (and not as malpractice effects), but legal issues might relate to inappropriate catheter care (in both the inpatient and outpatient settings) rather than to the event per se. Thus, in the individual case it is indeed very difficult to establish malpractice and liability with a catheter-related infection or thrombosis. In conclusion, we cannot avoid complications completely when using CVCs, but reducing them to a minimum and adopting safe approaches to their insertion and use will reduce legal liability.

The Monorail Technique to Overcome Difficult Anatomical Course During Implantation of Central Venous Port via the Left Internal Jugular Vein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eu Hyun, E-mail: doorihyun6@gmail.com; Oh, Jung Suk; Chun, Ho Jong

PurposeThe study aimed to introduce a monorail technique to overcome difficult anatomical course via left internal jugular vein in implantable port insertion.MethodsFrom 2007 to 2016, a total of 9346 patients were referred for implantable port insertion in our interventional unit, among which 79 cases were requested to insert on the left side. Our monorail technique was applied only when the technical challenge of the catheter tip entering the azygos vein instead of the superior vena cava occurred (n = 7). The technique consists of puncturing at the distal tip of the port catheter with a 21-gauge micropuncture needle and advancing a 0.018-in.more » hair-wire to guide and provide support for pre-assembled port.ResultsThe monorail technique was performed in seven patients and all but one case were technically successful, showing a technical success rate of 85.7%. There were no immediate or delayed complications.ConclusionsThe monorail technique is helpful to overcome the difficult anatomical course via left internal jugular vein in implantable port insertion.« less

Investigation of AWG demultiplexer based SOI for CWDM application

NASA Astrophysics Data System (ADS)

Juhari, Nurjuliana; Susthitha Menon, P.; Shaari, Sahbudin; Annuar Ehsan, Abang

2017-11-01

9-channel Arrayed Waveguide Grating (AWG) demultiplexer for conventional and tapered structure were simulated using beam propagation method (BPM) with channel spacing of 20 nm. The AWG demultiplexer was design using high refractive index (n 3.47) material namely silicon-on-insulator (SOI) with rib waveguide structure. The characteristics of insertion loss, adjacent crosstalk and output spectrum response at central wavelength of 1.55 μm for both designs were compared and analyzed. The conventional AWG produced a minimum insertion loss of 6.64 dB whereas the tapered AWG design reduced the insertion loss by 2.66 dB. The lowest adjacent crosstalk value of -16.96 dB was obtained in the conventional AWG design and this was much smaller compared to the tapered AWG design where the lowest crosstalk value is -17.23 dB. Hence, a tapered AWG design significantly reduces the insertion loss but has a slightly higher adjacent crosstalk compared to the conventional AWG design. On the other hand, the output spectrum responses that are obtained from both designs were close to the Coarse Wavelength Division Multiplexing (CWDM) wavelength grid.

The Monorail Technique to Overcome Difficult Anatomical Course During Implantation of Central Venous Port via the Left Internal Jugular Vein.

PubMed

Kim, Eu Hyun; Oh, Jung Suk; Chun, Ho Jong; Lee, Hae Giu; Choi, Byung Gil

2017-03-01

The study aimed to introduce a monorail technique to overcome difficult anatomical course via left internal jugular vein in implantable port insertion. From 2007 to 2016, a total of 9346 patients were referred for implantable port insertion in our interventional unit, among which 79 cases were requested to insert on the left side. Our monorail technique was applied only when the technical challenge of the catheter tip entering the azygos vein instead of the superior vena cava occurred (n = 7). The technique consists of puncturing at the distal tip of the port catheter with a 21-gauge micropuncture needle and advancing a 0.018-in. hair-wire to guide and provide support for pre-assembled port. The monorail technique was performed in seven patients and all but one case were technically successful, showing a technical success rate of 85.7%. There were no immediate or delayed complications. The monorail technique is helpful to overcome the difficult anatomical course via left internal jugular vein in implantable port insertion.

Heat transfer and structure of flow at boiling of refrigerant R134a in channels with inserts in the form of finned twisted tape

NASA Astrophysics Data System (ADS)

Shishkin, A. V.; Tarasevich, S. E.

2018-03-01

The paper presents the results of experimental study of heat transfer for the refrigerant R134a flow in the channels with finned twisted tape inserts at bubble boiling. The flow regimes implemented under the given conditions are shown. The stable cord-like flows appear at boiling in channels with twisted tape inserts and high vapor content when the liquid phase moves in the form of a stream (cord) along the central part of the tape, which is not an active heat exchange surface. At boiling this can lead to an increase in the length required for complete liquid evaporation. Existing geometric modifications of twisted tapes are used in the heat-exchange equipment at forced convection of the coolant and do not solve the problem of cord-like flows elimination. The present work discusses the experimental study of heat transfer at boiling of refrigerant R134a in the channels with twisted tape inserts that have fins on its surface.

Conformational Dynamics inside Amino-Terminal Disease Hotspot of Ryanodine Receptor

PubMed Central

Zhong, Xiaowei; Liu, Ying; Zhu, Li; Meng, Xing; Wang, Ruiwu; Van Petegem, Filip; Wagenknecht, Terence; Wayne Chen, S. R.; Liu, Zheng

2013-01-01

Summary The N-terminal region of both skeletal and cardiac ryanodine receptor is a disease mutation hotspot. Recently, a crystal structure of the RyR1 fragment (residues 1-559) was solved. This N-terminal structure contains three separate domains, A, B, and C, and was docked into a central vestibule in a full-length RyR1 cryo-EM map. Here we reconstructed 3D cryo-EM structures of two GFP-tagged RyR2s with GFP inserted after residue Glu-310 and Ser-437, respectively. The structures of RyR2E310-GFP and RyR2S437-GFP displayed an extra mass on domain B and C, directly validating the predicted docking model. Next, we revealed domain movements in molecular dynamics flexible fitting models in both the closed and open state cryo-EM maps. To further probe the conformational changes, we generated FRET pairs by inserting CFP or YFP in two selected domains, FRET studies of three dual-insertion pairs and three co-expressed single-insertion pairs showed the dynamic structural changes within the N-terminal domains. PMID:24139989

Risk factors associated with catheter-related upper extremity deep vein thrombosis in patients with peripherally inserted central venous catheters: literature review: part 1.

PubMed

Clemence, Bonnie J; Maneval, Rhonda E

2014-01-01

This is part 1 of a 2-part series of articles that report on the results of a prospective observational cohort study designed to examine the risk factors associated with symptomatic upper extremity deep vein thrombosis (UEDVT) in patients with peripherally inserted central catheters. This article provides an extensive review and critique of the literature that serves to explicate what is currently known about risk factors associated with catheter-related UEDVT. Risk factors such as anticoagulant use, cancer, infection, hypertension, catheter tip placement, and catheter size were identified most frequently in the literature as being associated with UEDVT development. Other risk factors--such as obesity, smoking history, surgery, and presence of pain or edema--were examined in a limited number of studies and lacked consistent evidence of their impact on UEDVT development. The subsequent study that evolved from the review of the literature investigates the relationship between identified risk factors and UEDVT development.

Translating research into practice. Implications of the Thunder Project II.

PubMed

Thompson, C L; White, C; Wild, L R; Morris, A B; Perdue, S T; Stanik-Hutt, J; Puntillo, K A

2001-12-01

The Thunder Project II study described procedural pain in a variety of acute and critical care settings. The procedures studied were turning, tracheal suctioning, wound drain removal, nonburn wound dressing change, femoral sheath removal, and central venous catheter insertion. Turning had the highest mean pain intensity, whereas femoral sheath removal and central venous catheter insertion had the least pain intensity in adults. Nonwound dressing change had the highest pain intensity for teenagers. Pain occurred in procedures that are often repeated several times a day as well as in those that may be single events. There is a wide range of pain responses to any of these procedures; as a result, standardized and thoughtful pain, and distress assessments are warranted. Planning of care, including the use of preemptive analgesic interventions, needs to be individualized. Future studies are needed to describe patient responses to other commonly performed nursing procedures and to identify effective interventions for reducing procedural pain and distress.

Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene

PubMed Central

Gonçalves, Ana; Coelho, Teresa; Melo-Pires, Manuel; Sousa, Mário

2017-01-01

A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD. PMID:28972564

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research

PubMed Central

Kockel, Lutz; Huq, Lutfi M.; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E. S.; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M.; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E.; Chisholm, Townley W.; Kim, Seung K.

2016-01-01

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila. However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. PMID:27527793

Characterization of tissue-simulating phantom materials for ultrasound-guided needle procedures

NASA Astrophysics Data System (ADS)

Buchanan, Susan; Moore, John; Lammers, Deanna; Baxter, John; Peters, Terry

2012-02-01

Needle biopsies are standard protocols that are commonly performed under ultrasound (US) guidance or computed tomography (CT)1. Vascular access such as central line insertions, and many spinal needle therapies also rely on US guidance. Phantoms for these procedures are crucial as both training tools for clinicians and research tools for developing new guidance systems. Realistic imaging properties and material longevity are critical qualities for needle guidance phantoms. However, current commercially available phantoms for use with US guidance have many limitations, the most detrimental of which include harsh needle tracks obfuscating US images and a membrane comparable to human skin that does not allow seepage of inner media. To overcome these difficulties, we tested a variety of readily available media and membranes to evaluate optimal materials to fit our current needs. It was concluded that liquid hand soap was the best medium, as it instantly left no needle tracks, had an acceptable depth of US penetration and portrayed realistic imaging conditions, while because of its low leakage, low cost, acceptable durability and transparency, the optimal membrane was 10 gauge vinyl.

Should nurses be trained to use ultrasound for intravenous access to patients with difficult veins?

PubMed

Smith, Claire

2018-06-14

Peripheral venous access is the most common invasive procedure performed on patients in the UK and is traditionally the responsibility of nursing staff. In an emergency, intravenous therapy can be lifesaving. Approximately 11% of adults have difficult venous access and are often subjected to repeated failed attempts, resulting in delayed diagnosis and treatment. Eventually, rescue methods are used by a doctor, but this increases demand on their time and the workflow of emergency departments. This article explores whether training nurses to obtain venous access using ultrasound would have a positive effect on doctors' workload and benefit adult patients with difficult veins. Research indicates that nurses can successfully use ultrasound to reduce the number of attempts, time to access and patient discomfort, and can prevent the insertion of unnecessary central lines. Ultrasound training programmes for nurses demonstrate benefits for patients and clinicians. © 2018 RCN Publishing Company Ltd. All rights reserved. Not to be copied, transmitted or recorded in any way, in whole or part, without prior permission of the publishers.

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research.

PubMed

Kockel, Lutz; Huq, Lutfi M; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E S; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E; Chisholm, Townley W; Kim, Seung K

2016-10-13

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. Copyright © 2016 Kockel et al.

Dielectric Heaters for Testing Spacecraft Nuclear Reactors

NASA Technical Reports Server (NTRS)

Sims, William Herbert; Bitteker, Leo; Godfroy, Thomas

2006-01-01

A document proposes the development of radio-frequency-(RF)-driven dielectric heaters for non-nuclear thermal testing of the cores of nuclear-fission reactors for spacecraft. Like the electrical-resistance heaters used heretofore for such testing, the dielectric heaters would be inserted in the reactors in place of nuclear fuel rods. A typical heater according to the proposal would consist of a rod of lossy dielectric material sized and shaped like a fuel rod and containing an electrically conductive rod along its center line. Exploiting the dielectric loss mechanism that is usually considered a nuisance in other applications, an RF signal, typically at a frequency .50 MHz and an amplitude between 2 and 5 kV, would be applied to the central conductor to heat the dielectric material. The main advantage of the proposal is that the wiring needed for the RF dielectric heating would be simpler and easier to fabricate than is the wiring needed for resistance heating. In some applications, it might be possible to eliminate all heater wiring and, instead, beam the RF heating power into the dielectric rods from external antennas.

Insertion of a solo LTR retrotransposon associates with spur mutations in 'Red Delicious' apple (Malus × domestica).

PubMed

Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun

2017-09-01

Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.

75 FR 73128 - Certain Printing and Imaging Devices and Components Thereof; Notice of Commission Determination...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-29

...'' include any line extending parallel to the central axis of the roller? Or, does this refer to the central... ``a longitudinal direction'' can include any line extending parallel to the central axis of the roller...) The finding that the Taylor reference (``A Telerobot on the World Wide Web'') (RX-281) does not...

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Catheter-related bloodstream infection.

PubMed

Goede, Matthew R; Coopersmith, Craig M

2009-04-01

Catheter-related bloodstream infections (CR-BSIs) are a common, frequently preventable complication of central venous catheterization. CR-BSIs can be prevented by strict attention to insertion and maintenance of central venous catheters and removing unneeded catheters as soon as possible. Antiseptic- or antibiotic-impregnated catheters are also an effective tool to prevent infections. The diagnosis of CR-BSI is made largely based on culture results. CR-BSIs should always be treated with antibiotics, and except in rare circumstances the infected catheter needs to be removed.

The Relationship Between Intrinsic and Extrinsic Factors and Central Venous Catheter Infections in the Acutely Ill Patient

DTIC Science & Technology

1991-01-01

central venous catheter is inserted into the bloodstream, a fibrin sheath forms around the cannula which attracts bacteria . Bacteria can either migrate from...to the fibrin sheath. After colonization of the fibrin sheath, the bacteria replicate and are released into the bloodstream when symptoms may develop...culture." Rose et al. (1988, p. 511) defined catheter site infection as occurring when "cultures at the exit site are identical to bacteria found on

Kinetic measurement of 2-aminopurine X cytosine and 2-aminopurine X thymine base pairs as a test of DNA polymerase fidelity mechanisms.

PubMed Central

Watanabe, S M; Goodman, M F

1982-01-01

Enzyme kinetic measurements are presented showing that Km rather than maximum velocity (Vmax) discrimination governs the frequency of forming 2-aminopurine X cytosine base mispairs by DNA polymerase alpha. An in vitro system is used in which incorporation of dTMP or dCMP occurs opposite a template 2-aminopurine, and values for Km and Vmax are obtained. Results from a previous study in which dTTP and dCTP were competing simultaneously for insertion opposite 2-aminopurine indicated that dTMP is inserted 22 times more frequently than dCMP. We now report that the ratio of Km values KCm/KTm = 25 +/- 6, which agrees quantitatively with the dTMP/dCMP incorporation ratio obtained previously. We also report that VCmax is indistinguishable from VTmax. These Km and Vmax data are consistent with predictions from a model, the Km discrimination model, in which replication fidelity is determined by free energy differences between matched and mismatched base pairs. Central to this model is the prediction that the ratio of Km values for insertion of correct and incorrect nucleotides specifies the insertion fidelity, and the maximum velocities of insertion are the same for both nucleotides. PMID:6959128

Complicated vascular access port removals: incidence, antecedents and avoidance.

PubMed

Teague, Warwick J; Fouad, Dina; Munro, Fraser D; McCabe, Amanda J

2015-09-01

Port removal is usually a straightforward procedure delegated to trainees. However, some port removals are complicated by central venous catheter (CVC) fragmentation, a challenge for even experienced surgeons. This study aimed to determine the incidence of, and risk factors for, complicated port removal in children. A single-centre study assessed the outcome of removal for all paediatric ports inserted from 1996 to 2012. Data were recorded detailing patient, insertion, device and removal characteristics. Risk factors for complicated removals were scrutinised using Chi-square tests; p < 0.05 significant. Of 628 ports inserted from 1996 to 2012, 443 were subsequently removed at the same centre. 8/443 (1.8%) removals were complicated by CVC fragmentation, a median of 3.3 (2.4-3.9) years after insertion. Of complicated cases, 8/8 underwent formal neck dissection, 3/8 intravascular dissection, and 1/8 endovascular retrieval. 2/8 cases have retained intravascular CVC fragments. Risk factors for complication were CVC caliber <6Fr (p < 0.001) and use duration >2 years (p < 0.001). Greatest care and senior supervision should be ensured when removing ports with CVC caliber <6Fr and/or >2 years since insertion. However, complications also occur with larger CVCs or after shorter durations. Therefore, the key to avoiding complicated port removal may simply be: preparation, preparation, neck preparation.

Engaging Frontline Staff in Central Line-Associated Bloodstream Infection Prevention Practice in the Wake of Superstorm Sandy.

PubMed

Rosenberg, Rebecca E; Devins, Lea; Geraghty, Gail; Bock, Steven; Dugan, Christina A; Transou, Marjorie; Phillips, Michael; Lighter-Fisher, Jennifer

2015-10-01

Central venous catheters are crucial devices in the care of hospitalized children, both in and out of critical care units, but the concomitant risk of central line-associated bloodstream infection (CLABSI) affects 15,000 Americans annually. In 2012, CLABSI rates varied among units from 6.8/1,000 to 1.0/1,000 in a 109-bed children's service within NYU Langone Medical Center (NYULMC; New York City), a 1,069-bed tertiary care academic medical center. In response to variation in central line-related practices and infection prevention rates, a CLABSI Prevention Core Team began an effort to standardize central venous catheter (CVC) care across all pediatric units (ICU and non-ICU). Momentum in this quality improvement (QI) work was interrupted when Superstorm Sandy shuttered the flagship hospital, but the relatively decreased clinical load provided a "downtime" opportunity to address CLABSI prevention. The first phase of the collaborative effort, Booster 1, Planning/Initial Phase: Development of a Pediatric Central Venous Catheter Working Group, was followed by Booster 2, Maintenance/Sustaining Phase: Transitioning for Sustainability and Adopting Model for Improvement. Data in the subsequent 21 months after the temporary closure of the facility (January 2013-September 2014) showed an increase in maintenance bundle reliability. The inpatient CLABSI rate for patients<18 years decreased from an annual rate of 2.7/1,000 line days (2012) to 0.6/1,000 line days (2013) to 0.5/1,000 line days as of August 2014. There was a decrease in pediatric CLABSI events and no significant change in line days. Key elements contributing to initial success with evolving QI capacity and resources were likely multi-factorial, including staff and leadership engagement, culture change, consistent guidelines, and accountability by individuals and by our multidisciplinary core team.

Relationship between crown-root angulation (collum angle) of maxillary central incisors in Class II, division 2 malocclusion and lower lip line.

PubMed

Srinivasan, Bhadrinath; Kailasam, Vignesh; Chitharanjan, Arun; Ramalingam, Arthi

2013-01-01

The present study aimed to measure the magnitude of the collum angle (crown-root angulation) of maxillary central incisors present in Class II, division 2 malocclusion and to relate the changes in its magnitude with variations in the lower lip line. A set of 120 conventional lateral cephalograms were selected and divided into three groups of 40 each based on the type of malocclusion presented: Class II, division 2 (group 1); Class II, division 1 (group 2); and Class I (group 3). The collum angle of the maxillary central incisor was measured, and the lower lip line was recorded. Analysis of variance (ANOVA) revealed that the mean collum angle was statistically significantly different in the three groups. The mean collum angle was greatest in Class II, division 2 malocclusion (group 1). The mean collum angles were 3.24 ± 4.69 degrees, 0.95 ± 1.06 degrees, and 1.05 ± 1.50 degrees in groups 1, 2, and 3 respectively. In χ ² test comparison of the location of the lower lip line (incisal, middle, or apical third of the central incisor) among the three groups, the lower lip line was found to contact the middle third of the central incisor most frequently in Class II, division 2 malocclusion. ANOVA followed by Tukey honestly significant difference (HSD) test showed that the mean collum angle is significantly increased when the lower lip is in the middle third (P < .05) of the central incisor. Variations in magnitude of the collum angle with the change in the lower lip line suggest a probable etiologic role of the lower lip line in the development of the collum angle.

A novel biomechanical model assessing continuous orthodontic archwire activation

PubMed Central

Canales, Christopher; Larson, Matthew; Grauer, Dan; Sheats, Rose; Stevens, Clarke; Ko, Ching-Chang

2013-01-01

Objective The biomechanics of a continuous archwire inserted into multiple orthodontic brackets is poorly understood. The purpose of this research was to apply the birth-death technique to simulate insertion of an orthodontic wire and consequent transfer of forces to the dentition in an anatomically accurate model. Methods A digital model containing the maxillary dentition, periodontal ligament (PDL), and surrounding bone was constructed from human computerized tomography data. Virtual brackets were placed on four teeth (central and lateral incisors, canine and first premolar), and a steel archwire (0.019″ × 0.025″) with a 0.5 mm step bend to intrude the lateral incisor was virtually inserted into the bracket slots. Forces applied to the dentition and surrounding structures were simulated utilizing the birth-death technique. Results The goal of simulating a complete bracket-wire system on accurate anatomy including multiple teeth was achieved. Orthodontic force delivered by the wire-bracket interaction was: central incisor 19.1 N, lateral incisor 21.9 N, and canine 19.9 N. Loading the model with equivalent point forces showed a different stress distribution in the PDL. Conclusions The birth-death technique proved to be a useful biomechanical simulation method for placement of a continuous archwire in orthodontic brackets. The ability to view the stress distribution throughout proper anatomy and appliances advances understanding of orthodontic biomechanics. PMID:23374936

Compact High Current Rare-Earth Emitter Hollow Cathode for Hall Effect Thrusters

NASA Technical Reports Server (NTRS)

Goebel, Dan M. (Inventor); Watkins, Ronnie M. (Inventor); Hofer, Richard R. (Inventor)

2012-01-01

An apparatus and method for achieving an efficient central cathode in a Hall effect thruster is disclosed. A hollow insert disposed inside the end of a hollow conductive cathode comprises a rare-earth element and energized to emit electrons from an inner surface. The cathode employs an end opening having an area at least as large as the internal cross sectional area of the rare earth insert to enhance throughput from the cathode end. In addition, the cathode employs a high aspect ratio geometry based on the cathode length to width which mitigates heat transfer from the end. A gas flow through the cathode and insert may be impinged by the emitted electrons to yield a plasma. One or more optional auxiliary gas feeds may also be employed between the cathode and keeper wall and external to the keeper near the outlet.

MMTV insertional mutagenesis identifies genes, gene families and pathways involved in mammary cancer.

PubMed

Theodorou, Vassiliki; Kimm, Melanie A; Boer, Mandy; Wessels, Lodewyk; Theelen, Wendy; Jonkers, Jos; Hilkens, John

2007-06-01

We performed a high-throughput retroviral insertional mutagenesis screen in mouse mammary tumor virus (MMTV)-induced mammary tumors and identified 33 common insertion sites, of which 17 genes were previously not known to be associated with mammary cancer and 13 had not previously been linked to cancer in general. Although members of the Wnt and fibroblast growth factors (Fgf) families were frequently tagged, our exhaustive screening for MMTV insertion sites uncovered a new repertoire of candidate breast cancer oncogenes. We validated one of these genes, Rspo3, as an oncogene by overexpression in a p53-deficient mammary epithelial cell line. The human orthologs of the candidate oncogenes were frequently deregulated in human breast cancers and associated with several tumor parameters. Computational analysis of all MMTV-tagged genes uncovered specific gene families not previously associated with cancer and showed a significant overrepresentation of protein domains and signaling pathways mainly associated with development and growth factor signaling. Comparison of all tagged genes in MMTV and Moloney murine leukemia virus-induced malignancies showed that both viruses target mostly different genes that act predominantly in distinct pathways.

Minos-insertion mutant of the Drosophila GBA gene homologue showed abnormal phenotypes of climbing ability, sleep and life span with accumulation of hydroxy-glucocerebroside.

PubMed

Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio

2017-05-30

Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.

The emerging planetary nebula CRL 618 and its unsettled central star(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balick, B.; Riera, A.; Raga, A.

We report deep long-slit emission-line spectra, the line flux ratios, and Doppler profile shapes of various bright optical lines. The low-ionization lines (primarily [N I], [O I], [S II], and [N II]) originate in shocked knots, as reported by many previous observers. Dust-scattered lines of higher ionization are seen throughout the lobes but do not peak in the knots. Our analysis of these line profiles and the readily discernible stellar continuum shows that (1) the central star is an active symbiotic (whose spectrum resembles the central stars of highly bipolar and young planetary nebulae such as M2-9 and Hen2-437) whosemore » compact companion shows a WC8-type spectrum, (2) extended nebular lines of [O III] and He I originate in the heavily obscured nuclear H II region, and (3) the Balmer lines observed throughout the lobes are dominated by reflected Hα emission from the symbiotic star. Comparing our line ratios with those observed historically shows that (1) the [O III]/Hβ and He I/Hβ ratios have been steadily rising by large amounts throughout the nebula, (2) the Hα/Hβ ratio is steadily decreasing while Hγ/Hβ remains nearly constant, and (3) the low-ionization line ratios formed in the shocked knots have been in decline in different ways at various locations. We show that the first two of these results might be expected if the symbiotic central star has been active and if its bright Hα line has faded significantly in the past 20 years.« less

A descriptive comparison of ultrasound-guided central venous cannulation of the internal jugular vein to landmark-based subclavian vein cannulation.

PubMed

Theodoro, Daniel; Bausano, Brian; Lewis, Lawrence; Evanoff, Bradley; Kollef, Marin

2010-04-01

The safest site for central venous cannulation (CVC) remains debated. Many emergency physicians (EPs) advocate the ultrasound-guided internal jugular (USIJ) approach because of data supporting its efficiency. However, a number of physicians prefer, and are most comfortable with, the subclavian (SC) vein approach. The purpose of this study was to describe adverse event rates among operators using the USIJ approach, and the landmark SC vein approach without US. This was a prospective observational trial of patients undergoing CVC of the SC or internal jugular veins in the emergency department (ED). Physicians performing the procedures did not undergo standardized training in either technique. The primary outcome was a composite of adverse events defined as hematoma, arterial cannulation, pneumothorax, and failure to cannulate. Physicians recorded the anatomical site of cannulation, US assistance, indications, and acute complications. Variables of interest were collected from the pharmacy and ED record. Physician experience was based on a self-reported survey. The authors followed outcomes of central line insertion until device removal or patient discharge. Physicians attempted 236 USIJ and 132 SC cannulations on 333 patients. The overall adverse event rate was 22% with failure to cannulate being the most common. Adverse events occurred in 19% of USIJ attempts, compared to 29% of non-US-guided SC attempts. Among highly experienced operators, CVCs placed at the SC site resulted in more adverse events than those performed using USIJ (relative risk [RR] = 1.89, 95% confidence interval [CI] = 1.05 to 3.39). While limited by observational design, our results suggest that the USIJ technique may result in fewer adverse events compared to the landmark SC approach.

Transposon mediated transgenesis in a marine invertebrate chordate: Ciona intestinalis

PubMed Central

Sasakura, Yasunori; Oogai, Yuichi; Matsuoka, Terumi; Satoh, Nori; Awazu, Satoko

2007-01-01

Achievement of transposon mediated germline transgenesis in a basal chordate, Ciona intestinalis, is discussed. A Tc1/mariner superfamily transposon, Minos, has excision and transposition activities in Ciona. Minos enables the creation of stable transgenic lines, enhancer detection, and insertional mutagenesis. PMID:18047695

49 CFR 192.369 - Service lines: Connections to cast iron or ductile iron mains.

Code of Federal Regulations, 2010 CFR

2010-10-01

... by a mechanical clamp, by drilling and tapping the main, or by another method meeting the requirements of § 192.273. (b) If a threaded tap is being inserted, the requirements of § 192.151 (b) and (c...

48 CFR 4.607 - Solicitation Provisions.

Code of Federal Regulations, 2010 CFR

2010-10-01

..., Central Contractor Registration. (b) Insert the provision at 52.204-5, Women-Owned Business (Other Than Small Business), in all solicitations that— (1) Are not set aside for small business concerns; (2..., Data Universal Numbering System (DUNS) Number, in solicitations that— (1) Are expected to result in a...

48 CFR 4.607 - Solicitation Provisions.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., Central Contractor Registration. (b) Insert the provision at 52.204-5, Women-Owned Business (Other Than Small Business), in all solicitations that— (1) Are not set aside for small business concerns; (2..., Data Universal Numbering System (DUNS) Number, in solicitations that— (1) Are expected to result in a...

48 CFR 4.607 - Solicitation Provisions.

Code of Federal Regulations, 2011 CFR

2011-10-01

..., Central Contractor Registration. (b) Insert the provision at 52.204-5, Women-Owned Business (Other Than Small Business), in all solicitations that— (1) Are not set aside for small business concerns; (2..., Data Universal Numbering System (DUNS) Number, in solicitations that— (1) Are expected to result in a...

Teaching aseptic technique for central venous access under ultrasound guidance: a randomized trial comparing didactic training alone to didactic plus simulation-based training.

PubMed

Latif, Rana K; Bautista, Alexander F; Memon, Saima B; Smith, Elizabeth A; Wang, Chenxi; Wadhwa, Anupama; Carter, Mary B; Akca, Ozan

2012-03-01

Our goal was to determine whether simulation combined with didactic training improves sterile technique during ultrasound (US)-guided central venous catheter (CVC) insertion compared with didactic training alone among novices. We hypothesized that novices who receive combined didactic and simulation-based training would perform similarly to experienced residents in aseptic technique, knowledge, and perception of comfort during US-guided CVC insertion on a simulator. Seventy-two subjects were enrolled in a randomized, controlled trial of an educational intervention. Fifty-four novices were randomized into either the didactic group or the simulation combined with didactic group. Both groups received didactic training but the simulation combined with didactic group also received simulation-based CVC insertion training. Both groups were tested by demonstrating US-guided CVC insertion on a simulator. Aseptic technique was scored on 8 steps as "yes/no" and also using a 7-point Likert scale with 7 being "excellent technique" by a rater blinded to subject randomization. After initial testing, the didactic group was offered simulation-based training and retesting. Both groups also took a pre- and posttraining test of knowledge and rated their comfort with US and CVC insertion pre- and posttraining on a 5-point Likert scale. Subsequently, 18 experienced residents also took the test of knowledge, rated their comfort level, and were scored while performing aseptic US-guided CVC insertion using a simulator. The simulation combined with didactic group achieved a 167% (95% confidence interval [CI] 133%-167%) incremental increase in yes/no scores and 115% (CI 112%-127%) incremental increase in Likert scale ratings on aseptic technique compared with novices in the didactic group. Compared with experienced residents, simulation combined with didactic trained novices achieved an increase in aseptic scores with a 33.3% (CI 16.7%-50%) increase in yes/no ratings and a 20% (CI 13.3%-40%) increase in Likert scaled ratings, and scored 2.5-fold higher on the test of knowledge. There was a 3-fold increase in knowledge and 2-fold increase in comfort level among all novices (P < 0.001) after combined didactic and simulation-based training. Simulation combined with didactic training is superior to didactic training alone for acquisition of clinical skills such as US-guided CVC insertion. After combined didactic and simulation-based training, novices can outperform experienced residents in aseptic technique as well as in measurements of knowledge.

DOE Office of Scientific and Technical Information (OSTI.GOV)

M Severson; M Bissen; M Fisher

SRC has recently commissioned a new Varied Line-Spacing Plane Grating Monochromator (VLS-PGM) utilizing as its source a 1 m long APPLE II insertion device in short-straight-section 9 of the Aladdin storage ring. The insertion device reliably delivers horizontal, vertical, and right and left circularly polarized light to the beamline. Measurements from an in situ polarimeter can be used for undulator corrections to compensate for depolarizing effects of the beamline. The beamline has only three optical elements and covers the energy range from 11.1 to 270 eV using two varied line-spacing gratings. A plane mirror rotates to illuminate the gratings atmore » the correct angle to cancel the defocus term at all photon energies. An exit slit and elliptical-toroid refocusing mirror complete the beamline. Using a 50 {mu}m exit slit, the beamline provides moderate to high resolution, with measured flux in the mid 10{sup 12} (photons/s/200 mA) range, and a spot size of 400 {mu}m horizontal by 30 {mu}m vertical.« less

Noise elimination method using a transmission line for the diagnostics of radio frequency plasma

NASA Astrophysics Data System (ADS)

Shimizu, K.; Hallil, A.; Amemiya, H.

1997-04-01

A filter using a transmission line formed by a cascade connection of inverted L-type networks has been developed to reject the distortion of the probe characteristics by rf (radio-frequency) noise. Each inverse L network consists of two coaxial cables with the same physical constant and length. The filter can remove discrete frequency components including the fundamental and harmonic components, the cut-off frequencies being determined by the distributed circuit constant and the length of the cables. By inserting different kinds of the network in cascade, many noise components associated with the rf frequency can be eliminated at the end section of the filter. Experiments have been performed in rf plasmas by inserting three kinds of inverted L networks with the frequency f (13.56 MHz), 2 f and 4f as the cut-off frequency. Distortion free probe characteristics have been obtained, from which accurate determination of plasma parameter such as the electron energy distribution is possible.

Afatinib and Cetuximab in Four Patients With EGFR Exon 20 Insertion-Positive Advanced NSCLC.

PubMed

van Veggel, Bianca; de Langen, Adrianus J; Hashemi, Sayed M S; Monkhorst, Kim; Heideman, Daniëlle A M; Thunnissen, Erik; Smit, Egbert F

2018-04-24

EGFR exon 20 insertions comprise 4% to 9% of EGFR mutated NSCLC. Despite being an oncogenic driver, they are associated with primary resistance to EGFR tyrosine kinase inhibitors (TKIs). We hypothesized that dual EGFR blockade with afatinib, an irreversible EGFR TKI, and cetuximab, a monoclonal antibody against EGFR, could induce tumor responses. Four patients with EGFR exon 20 insertion-positive NSCLC were treated with afatinib 40 mg once daily and cetuximab 250 mg/m 2 to 500 mg/m 2 every 2 weeks. All patients had stage IV adenocarcinoma of the lung harboring an EGFR exon 20 insertion mutation. Previous lines of treatment consisted of platinum doublet chemotherapy (n = 4) and EGFR TKI (n = 2). Three of four patients showed a partial response according to Response Evaluation Criteria in Solid Tumors (RECIST 1.1). Median progression-free survival was 5.4 months (95% confidence interval: 0.0 - 14.2 months; range 2.7 months - 17.6 months). Toxicity was manageable with appropriate skin management and dose reduction being required in two patients. Dual EGFR blockade with afatinib and cetuximab may induce tumor responses in patients with EGFR exon 20 insertion-positive NSCLC. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

From model to crop: functional analysis of a STAY-GREEN gene in the model legume Medicago truncatula and effective use of the gene for alfalfa improvement.

PubMed

Zhou, Chuanen; Han, Lu; Pislariu, Catalina; Nakashima, Jin; Fu, Chunxiang; Jiang, Qingzhen; Quan, Li; Blancaflor, Elison B; Tang, Yuhong; Bouton, Joseph H; Udvardi, Michael; Xia, Guangmin; Wang, Zeng-Yu

2011-11-01

Medicago truncatula has been developed into a model legume. Its close relative alfalfa (Medicago sativa) is the most widely grown forage legume crop in the United States. By screening a large population of M. truncatula mutants tagged with the transposable element of tobacco (Nicotiana tabacum) cell type1 (Tnt1), we identified a mutant line (NF2089) that maintained green leaves and showed green anthers, central carpels, mature pods, and seeds during senescence. Genetic and molecular analyses revealed that the mutation was caused by Tnt1 insertion in a STAY-GREEN (MtSGR) gene. Transcript profiling analysis of the mutant showed that loss of the MtSGR function affected the expression of a large number of genes involved in different biological processes. Further analyses revealed that SGR is implicated in nodule development and senescence. MtSGR expression was detected across all nodule developmental zones and was higher in the senescence zone. The number of young nodules on the mutant roots was higher than in the wild type. Expression levels of several nodule senescence markers were reduced in the sgr mutant. Based on the MtSGR sequence, an alfalfa SGR gene (MsSGR) was cloned, and transgenic alfalfa lines were produced by RNA interference. Silencing of MsSGR led to the production of stay-green transgenic alfalfa. This beneficial trait offers the opportunity to produce premium alfalfa hay with a more greenish appearance. In addition, most of the transgenic alfalfa lines retained more than 50% of chlorophylls during senescence and had increased crude protein content. This study illustrates the effective use of knowledge gained from a model system for the genetic improvement of an important commercial crop.

From Model to Crop: Functional Analysis of a STAY-GREEN Gene in the Model Legume Medicago truncatula and Effective Use of the Gene for Alfalfa Improvement1[W][OA

PubMed Central

Zhou, Chuanen; Han, Lu; Pislariu, Catalina; Nakashima, Jin; Fu, Chunxiang; Jiang, Qingzhen; Quan, Li; Blancaflor, Elison B.; Tang, Yuhong; Bouton, Joseph H.; Udvardi, Michael; Xia, Guangmin; Wang, Zeng-Yu

2011-01-01

Medicago truncatula has been developed into a model legume. Its close relative alfalfa (Medicago sativa) is the most widely grown forage legume crop in the United States. By screening a large population of M. truncatula mutants tagged with the transposable element of tobacco (Nicotiana tabacum) cell type1 (Tnt1), we identified a mutant line (NF2089) that maintained green leaves and showed green anthers, central carpels, mature pods, and seeds during senescence. Genetic and molecular analyses revealed that the mutation was caused by Tnt1 insertion in a STAY-GREEN (MtSGR) gene. Transcript profiling analysis of the mutant showed that loss of the MtSGR function affected the expression of a large number of genes involved in different biological processes. Further analyses revealed that SGR is implicated in nodule development and senescence. MtSGR expression was detected across all nodule developmental zones and was higher in the senescence zone. The number of young nodules on the mutant roots was higher than in the wild type. Expression levels of several nodule senescence markers were reduced in the sgr mutant. Based on the MtSGR sequence, an alfalfa SGR gene (MsSGR) was cloned, and transgenic alfalfa lines were produced by RNA interference. Silencing of MsSGR led to the production of stay-green transgenic alfalfa. This beneficial trait offers the opportunity to produce premium alfalfa hay with a more greenish appearance. In addition, most of the transgenic alfalfa lines retained more than 50% of chlorophylls during senescence and had increased crude protein content. This study illustrates the effective use of knowledge gained from a model system for the genetic improvement of an important commercial crop. PMID:21957014

Soft J-tipped guide wire-induced cardiac perforation in a patient with right ventricular lipomatosis and wall thinning.

PubMed

Hiroshima, Yuki; Tajima, Katsushi; Shiono, Yousuke; Suzuki, Ikuko; Kohno, Kei; Kato, Yuichi; Shunji, Kawamura; Kato, Takeo

2012-01-01

Cardiac tamponade caused by perforation is a rare but potentially lethal complication of central venous catheter (CVC) insertion. We herein report a case of cardiac perforation associated with the use of a soft J-tipped guide wire. Twenty minutes after the insertion of a CVC, the patient developed unexpected cardiac arrest. An autopsy revealed 400 mL of pericardial blood. The right ventricular wall was 1 mm thick with about 10 myocyte layers, which is one-third that of the normal heart. A histological analysis revealed widespread fatty infiltration of the right ventricular wall (right ventricular lipomatosis).

Coil spring venting arrangement

DOEpatents

McCugh, R.M.

1975-10-21

A simple venting device for trapped gas pockets in hydraulic systems is inserted through a small access passages, operated remotely, and removed completely. The device comprises a small diameter, closely wound coil spring which is pushed through a guide temporarily inserted in the access passage. The guide has a central passageway which directs the coil spring radially upward into the pocket, so that, with the guide properly positioned for depth and properly oriented, the coil spring can be pushed up into the top of the pocket to vent it. By positioning a seal around the free end of the guide, the spring and guide are removed and the passage is sealed.

LINE dancing in the human genome: transposable elements and disease.

PubMed

Belancio, Victoria P; Deininger, Prescott L; Roy-Engel, Astrid M

2009-10-27

Transposable elements (TEs) have been consistently underestimated in their contribution to genetic instability and human disease. TEs can cause human disease by creating insertional mutations in genes, and also contributing to genetic instability through non-allelic homologous recombination and introduction of sequences that evolve into various cis-acting signals that alter gene expression. Other outcomes of TE activity, such as their potential to cause DNA double-strand breaks or to modulate the epigenetic state of chromosomes, are less fully characterized. The currently active human transposable elements are members of the non-LTR retroelement families, LINE-1, Alu (SINE), and SVA. The impact of germline insertional mutagenesis by TEs is well established, whereas the rate of post-insertional TE-mediated germline mutations and all forms of somatic mutations remain less well quantified. The number of human diseases discovered to be associated with non-allelic homologous recombination between TEs, and particularly between Alu elements, is growing at an unprecedented rate. Improvement in the technology for detection of such events, as well as the mounting interest in the research and medical communities in resolving the underlying causes of the human diseases with unknown etiology, explain this increase. Here, we focus on the most recent advances in understanding of the impact of the active human TEs on the stability of the human genome and its relevance to human disease.

Simulation-based medical education training improves short and long-term competency in, and knowledge of central venous catheter insertion: A before and after intervention study.

PubMed

Cartier, Vanessa; Inan, Cigdem; Zingg, Walter; Delhumeau, Cecile; Walder, Bernard; Savoldelli, Georges L

2016-08-01

Multimodal educational interventions have been shown to improve short-term competency in, and knowledge of central venous catheter (CVC) insertion. To evaluate the effectiveness of simulation-based medical education training in improving short and long-term competency in, and knowledge of CVC insertion. Before and after intervention study. University Geneva Hospital, Geneva, Switzerland, between May 2008 and January 2012. Residents in anaesthesiology aware of the Seldinger technique for vascular puncture. Participants attended a half-day course on CVC insertion. Learning objectives included work organization, aseptic technique and prevention of CVC complications. CVC insertion competency was tested pretraining, posttraining and then more than 2 years after training (sustainability phase). The primary study outcome was competency as measured by a global rating scale of technical skills, a hand hygiene compliance score and a checklist compliance score. Secondary outcome was knowledge as measured by a standardised pretraining and posttraining multiple-choice questionnaire. Statistical analyses were performed using paired Student's t test or Wilcoxon signed-rank test. Thirty-seven residents were included; 18 were tested in the sustainability phase (on average 34 months after training). The average global rating of skills was 23.4 points (±SD 4.08) before training, 32.2 (±4.51) after training (P < 0.001 for comparison with pretraining scores) and 26.5 (±5.34) in the sustainability phase (P = 0.040 for comparison with pretraining scores). The average hand hygiene compliance score was 2.8 (±1.0) points before training, 5.0 (±1.04) after training (P < 0.001 for comparison with pretraining scores) and 3.7 (±1.75) in the sustainability phase (P = 0.038 for comparison with pretraining scores). The average checklist compliance was 14.9 points (±2.3) before training, 19.9 (±1.06) after training (P < 0.001 for comparison with pretraining scores) and 17.4 (±1.41) (P = 0.002 for comparison with pretraining scores). The percentage of correct answers in the multiple-choice questionnaire increased from 76.0% (±7.9) before training to 87.7% (±4.4) after training (P < 0.001). Simulation-based medical education training was effective in improving short and long-term competency in, and knowledge of CVC insertion.

Central venous catheter infections in home parenteral nutrition patients: Outcomes from Sustain: American Society for Parenteral and Enteral Nutrition's National Patient Registry for Nutrition Care.

PubMed

Ross, Vicki M; Guenter, Peggi; Corrigan, Mandy L; Kovacevich, Debra; Winkler, Marion F; Resnick, Helaine E; Norris, Tina L; Robinson, Lawrence; Steiger, Ezra

2016-12-01

Home parenteral nutrition (HPN) is a high-cost, complex nutrition support therapy that requires the use of central venous catheters. Central line-associated bloodstream infections (CLABSIs) are among the most serious risks of this therapy. Sustain: American Society for Parenteral and Enteral Nutrition's National Patient Registry for Nutrition Care (Sustain registry) provides the most current and comprehensive data for studying CLABSI among a national cohort of HPN patients in the United States. This is the first Sustain registry report detailing longitudinal data on CLABSI among HPN patients. To describe CLABSI rates for HPN patients followed in the Sustain registry from 2011-2014. Descriptive, χ 2 , and t tests were used to analyze data from the Sustain registry. Of the 1,046 HPN patients from 29 sites across the United States, 112 (10.7%) experienced 194 CLABSI events during 223,493 days of HPN exposure, for an overall CLABSI rate of 0.87 episodes/1,000 parenteral nutrition-days. Although the majority of patients were female (59%), adult (87%), white (75%), and with private insurance or Medicare (69%), CLABSI episodes per 1,000 parenteral nutrition-days were higher for men (0.69 vs 0.38), children (1.17 vs 0.35), blacks (0.91 vs 0.41), and Medicaid recipients (1.0 vs 0.38 or 0.39). Patients with implanted ports or double-lumen catheters also had more CLABSIs than those with peripherally inserted or central catheters or single-lumen catheters. Staphylococci were the most commonly reported pathogens. These data support findings of smaller studies about CLABSI risk for children and by catheter type and identify new potential risk factors, including gender, race, and insurance type. Additional studies are needed to determine effective interventions that will reduce HPN-associated CLABSI. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Endovascular technique using a snare and suture for retrieving a migrated peripherally inserted central catheter in the left pulmonary artery

PubMed Central

Teragawa, Hiroki; Sueda, Takashi; Fujii, Yuichi; Takemoto, Hiroaki; Toyota, Yasushi; Nomura, Shuichi; Nakagawa, Keigo

2013-01-01

We report a successful endovascular technique using a snare with a suture for retrieving a migrated broken peripherally inserted central catheter (PICC) in a chemotherapy patient. A 62-year-old male received monthly chemotherapy through a central venous port implanted into his right subclavian area. The patient completed chemotherapy without complications 1 mo ago; however, he experienced pain in the right subclavian area during his last chemotherapy session. Computed tomography on that day showed migration of a broken PICC in his left pulmonary artery, for which the patient was admitted to our hospital. We attempted to retrieve the ectopic PICC through the right jugular vein using a gooseneck snare, but were unsuccessful because the catheter was lodged in the pulmonary artery wall. Therefore, a second attempt was made through the right femoral vein using a snare with triple loops, but we could not grasp the migrated PICC. Finally, a string was tied to the top of the snare, allowing us to curve the snare toward the pulmonary artery by pulling the string. Finally, the catheter body was grasped and retrieved. The endovascular suture technique is occasionally extremely useful and should be considered by interventional cardiologists for retrieving migrated catheters. PMID:24109502

The role of interventional radiology in management of benign and malignant gynecologic diseases.

PubMed

Yu, Hyeon; Stavas, Joseph M

2013-10-01

This article focuses on the role of interventional radiology in the therapeutic and diagnostic management of benign and malignant gynecologic conditions. The subspecialty of interventional radiology utilizes minimally invasive advanced image-guided percutaneous techniques in gynecology that include central venous catheter placement, fluid aspiration, drainage catheter placement, tissue biopsy, inferior vena cava filter placement, and pelvic arterial embolization. Central venous catheters, such as ports, peripherally inserted central catheters, and tunneled catheters, are placed for intermediate to long-term intravenous chemotherapy or total parental nutrition or antibiotics. Patients with refractory malignant ascites or pleural effusion from seeding of advanced gynecologic cancers may benefit by percutaneous aspiration of fluid collections or placement of drainage catheters. Postoperative fluid collections including abscess, seroma, or lymphocele are managed by percutaneous drainage catheter insertion. Pelvic, peritoneal, or retroperitoneal masses can be sampled by image-guided percutaneous biopsy or aspiration of fluid to determine a pathologic diagnosis. Certain patients are at risk for deep venous thrombosis with pulmonary embolism and may benefit from an inferior vena cava filter. Patients with uncontrolled postoperative or postpartum bleeding can be effectively managed with emergent transarterial pelvic embolization. Each of the aforementioned interventions with indications, expected benefits, and complications is described including a published literature.

Tendon healing in a bone tunnel. Part II: Histologic analysis after biodegradable interference fit fixation in a model of anterior cruciate ligament reconstruction in sheep.

PubMed

Weiler, Andreas; Hoffmann, Reinhard F G; Bail, Hermann J; Rehm, Oliver; Südkamp, Norbert P

2002-02-01

Tendon-to-bone healing of soft-tissue grafts has been described to progress by the development of a fibrous interzone that undergoes a maturation process leading to the development of an indirect type of ligament insertion. Previous studies used extra-articular models or fixation far away from the joint line; thus, no data are available investigating tendon-to-bone healing of a soft-tissue graft fixed anatomically. Therefore, we studied the tendon-to-bone healing of the anatomic soft-tissue graft interference fit fixation in a model of anterior cruciate ligament (ACL) reconstruction in sheep. Animal study. Thirty-five mature sheep underwent ACL reconstruction with an autologous Achilles tendon split graft. Grafts were directly fixed with biodegradable poly-(D,L-lactide) interference screws. Animals were euthanized after 6, 9, 12, 24, and 52 weeks and histologic evaluations were performed. Undecalcified specimens were evaluated under normal and polarized light. Additionally, animals received a polychrome sequential labeling (tetracycline, xylenol orange, and calcein green) to determine bone growth per time under fluorescent light. Intratunnel histologic findings at 6 weeks showed a tendon-bone junction with only a partial fibrous interzone between the graft tissue and the surrounding bone. A mature intratunnel tendon-bone junction with a zone of fibrocartilage was found at 9 to 12 weeks. At the tunnel entrance site a wide regular ligamentous insertion site was seen in all specimens after 24 weeks. This insertion showed regular patterns such as the direct type of insertion of a normal ligament with a dense basophilic transition zone consisting of mineralized cartilage. A fibrous interzone between the graft tissue and the bone tunnel was only partially developed, which is in contrast to all previous studies in which nonanatomic fixation was used. Thus, it is reasonable to assume that the tendon-to-bone healing in the present study may progress partially by direct-contact healing without the development of a fibrous interzone. To our knowledge, this is the first report describing the development of a direct type of ligament insertion after ACL replacement with a soft-tissue graft. This is in contrast to previous studies reporting the development of an indirect type of insertion when using nonanatomic fixation far away from the joint line. Thus, histologic data strongly indicate that anatomic interference fit fixation is beneficial for tendon-to-bone incorporation by leading to the development of a direct type of ligament insertion.

Transitioning from anatomic landmarks to ultrasound guided central venous catheterizations: guidelines applied to clinical practice.

PubMed

Oom, Rodrigo; Casaca, Rui; Barroca, Rita; Carvalhal, Sara; Santos, Catarina; Abecasis, Nuno

2017-07-14

Centrally inserted central catheter (CICC) insertion is a commonly performed procedure that may give rise to different complications. Despite the suggestion of guidelines to use ultrasound guidance (USG) for vascular access, not all centers use it systematically. The aim of this study is to illustrate the experience with ultrasound in CICC placement at a high-volume oncological center, in a country where the landmark technique is standard. Retrospective analysis of a prospective database was performed on CICC placement under USG in the Central Venous Catheter Unit of Instituto Português de Oncologia de Lisboa Francisco Gentil, from 2012 to 2015. Three thousand five hundred and seventy-two procedures were recorded. From 2728 CICC placements, 1187 (43.5%) were done using USG. The majority of CICC placements were successful without immediate complications (96.1%). In 55 cases (4.6%), more than three attempts were necessary to puncture the vein. Pneumothorax occurred in 5 cases (0.4%) and arterial puncture was registered in 41 cases (3.5%). An increasing use of USG for placing CICCs was planned and observed over the years and, in the last year of the study, 67.3% of the CICC placements were with USG. CICC placement with USG is a safe and effective technique. Despite some resistance that is observed, these results support that it is worth following the guidelines that advocate the use of the USG in the placement of CICC.

Regenerable metallic oxide systems for removal of carbon dioxide: A concept

NASA Technical Reports Server (NTRS)

Sutton, J. G.; Heimlich, P. F.; Tepper, E. H.

1972-01-01

Design concepts for portable canisters for removal of carbon dioxide are described. One is screen pack configuration consisting of brazed rectangular canister with four metal oxide packs inserted. Other is radial flow canister with perforated central tube. Methods of production and operating principles are presented.

48 CFR 252.209-7010 - Critical Safety Items.

Code of Federal Regulations, 2014 CFR

2014-10-01

... personal injury or loss of life; or (iii) An uncommanded engine shutdown that jeopardizes safety. Design... personal injury or loss of life. (b) Identification of critical safety items. One or more of the items... control activity: (Insert additional lines as necessary) (c) Heightened quality assurance surveillance...

48 CFR 252.209-7010 - Critical Safety Items.

Code of Federal Regulations, 2013 CFR

2013-10-01

... personal injury or loss of life; or (iii) An uncommanded engine shutdown that jeopardizes safety. Design... personal injury or loss of life. (b) Identification of critical safety items. One or more of the items... control activity: (Insert additional lines as necessary) (c) Heightened quality assurance surveillance...

48 CFR 252.209-7010 - Critical Safety Items.

Code of Federal Regulations, 2012 CFR

2012-10-01

... personal injury or loss of life; or (iii) An uncommanded engine shutdown that jeopardizes safety. Design... personal injury or loss of life. (b) Identification of critical safety items. One or more of the items... control activity: (Insert additional lines as necessary) (c) Heightened quality assurance surveillance...

48 CFR 252.209-7010 - Critical Safety Items.

Code of Federal Regulations, 2011 CFR

2011-10-01

... personal injury or loss of life; or (iii) An uncommanded engine shutdown that jeopardizes safety. Design... personal injury or loss of life. (b) Identification of critical safety items. One or more of the items... control activity: (Insert additional lines as necessary) (c) Heightened quality assurance surveillance...

Accurate measurement of transgene copy number in crop plants using droplet digital PCR

USDA-ARS?s Scientific Manuscript database

Technical abstract: Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently ...

Accurate measure of transgene copy number in crop plants using droplet digital PCR

USDA-ARS?s Scientific Manuscript database

Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

Evaluation of precast patches on U.S. 60 near the New Kent and James City County line.

DOT National Transportation Integrated Search

2006-01-01

This project evaluated the use of precast concrete patches for repairing jointed concrete pavement. Six patches were placed: three had dowels cast into them during fabrication, and three had dowels inserted in place (dowel bar retrofit). Fabrication ...

Endpoint Accuracy in Manual Control of a Steerable Needle.

PubMed

van de Berg, Nick J; Dankelman, Jenny; van den Dobbelsteen, John J

2017-02-01

To study the ability of a human operator to manually correct for errors in the needle insertion path without partial withdrawal of the needle by means of an active, tip-articulated steerable needle. The needle is composed of a 1.32-mm outer-diameter cannula, with a flexure joint near the tip, and a retractable stylet. The bending stiffness of the needle resembles that of a 20-gauge hypodermic needle. The needle functionality was evaluated in manual insertions by steering to predefined targets and a lateral displacement of 20 mm from the straight insertion line. Steering tasks were conducted in 5 directions and 2 tissue simulants under image guidance from a camera. The repeatability in instrument actuations was assessed during 100 mm deep automated insertions with a linear motor. In addition to tip position, tip angles were tracked during the insertions. The targeting error (mean absolute error ± standard deviation) during manual steering to 5 different targets in stiff tissue was 0.5 mm ± 1.1. This variability in manual tip placement (1.1 mm) was less than the variability among automated insertions (1.4 mm) in the same tissue type. An increased tissue stiffness resulted in an increased lateral tip displacement. The tip angle was directly controlled by the user interface, and remained unaffected by the tissue stiffness. This study demonstrates the ability to manually steer needles to predefined target locations under image guidance. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

Ultra-high-speed graphene optical modulator design based on tight field confinement in a slot waveguide

NASA Astrophysics Data System (ADS)

Kovacevic, Goran; Phare, Christopher; Set, Sze Y.; Lipson, Michal; Yamashita, Shinji

2018-06-01

We present a design of an ultra-fast in-line graphene optical modulator on a silicon waveguide with a bandwidth exceeding 100 GHz, very small power consumption below 15 fJ/bit, and insertion loss of 1.5 dB. This is achieved by utilizing the transverse-electric-mode silicon slot to tailor the overlap of graphene electrodes, thus significantly reducing the capacitance of the device while maintaining a low insertion loss and using conservative estimates of the graphene resistance. Our design is substantiated by comprehensive finite-element-method simulations and RC circuit characterization, as well as fabrication feasibility discussion.

Exploring possible relations between optical variability time scales and broad emission line shapes in AGN

NASA Astrophysics Data System (ADS)

Bon, Edi; Jovanović, Predrag; Marziani, Paola; Bon, Nataša; Otašević, Aleksandar

2018-06-01

Here we investigate the connection of broad emission line shapes and continuum light curve variability time scales of type-1 Active Galactic Nuclei (AGN). We developed a new model to describe optical broad emission lines as an accretion disk model of a line profile with additional ring emission. We connect ring radii with orbital time scales derived from optical light curves, and using Kepler's third law, we calculate mass of central supermassive black hole (SMBH). The obtained results for central black hole masses are in a good agreement with other methods. This indicates that the variability time scales of AGN may not be stochastic, but rather connected to the orbital time scales which depend on the central SMBH mass.

Prophylactic antibiotics for preventing Gram positive infections associated with long-term central venous catheters in oncology patients.

PubMed

van de Wetering, Marianne D; van Woensel, Job B M; Lawrie, Theresa A

2013-11-25

This is an updated version of the review which was first published in the Cochrane Database of Systematic Reviews in 2006. Long-term central venous catheters (CVCs), including tunnelled CVCs (TCVCs) and totally implanted devices or ports (TIDs), are increasingly used when treating oncology patients. Despite international guidelines on sterile insertion and appropriate CVC maintenance and use, infection remains a common complication. These infections are mainly caused by Gram positive bacteria. Antimicrobial prevention strategies aimed at these micro-organisms could potentially decrease the majority of CVC infections. The aim of this review was to evaluate the efficacy of antibiotics in the prevention of Gram positive infections in long-term CVCs. To determine the efficacy of administering antibiotics prior to the insertion of long-term CVCs, or flushing or locking long-term CVCs with a combined antibiotic and heparin solution, or both, to prevent Gram positive catheter-related infections in adults and children receiving treatment for cancer. We searched the Cochrane Central Register of Controlled Trials (CENTRAL) (to June 2013) and the MEDLINE and EMBASE databases (1966 to 2013). Randomised controlled trials (RCTs) comparing prophylactic antibiotics given prior to long-term CVC insertion with no antibiotics, RCTs comparing a combined antibiotic and heparin solution with a heparin-only solution to flush or lock newly inserted long-term CVCs, and RCTs comparing a combination of these interventions in adults and children receiving treatment for cancer. Two authors independently selected studies, classified them and extracted data on to a pre-designed data collection form. We pooled data using the RevMan software version 5.2 and used random-effects (RE) model methods for meta-analyses. We included 11 trials with a total of 828 oncology patients (adults and children). We assessed most included studies to be at a low or unclear risk of bias. Five trials compared the use of antibiotics (vancomycin, teicoplanin or ceftazidime) given before the insertion of the long-term CVC with no antibiotics, and six trials compared antibiotics (vancomycin, amikacin or taurolidine) and heparin with a heparin-only solution for flushing or locking the long-term CVC after use. Administering an antibiotic prior to insertion of the CVC did not significantly reduce Gram positive catheter-related sepsis (CRS) (five trials, 360 adults; risk ratio (RR) 0.72, 95% confidence interval (CI) 0.33 to 1.58; I² = 5 2%; P = 0.41).Flushing and locking long-term CVCs with a combined antibiotic and heparin solution significantly reduced the risk of Gram positive catheter-related sepsis compared with a heparin-only solution (468 participants, mostly children; RR 0.47, 95% CI 0.28 to 0.80; I² = 0%; P = 0.005). For a baseline infection rate of 15%, this reduction translated into a number needed to treat (NNT) of 12 (95% CI 9 to 33) to prevent one catheter-related infection. We considered this evidence to be of a moderate quality. There was no benefit to administering antibiotics before the insertion of long-term CVCs to prevent Gram positive catheter-related infections. Flushing or locking long-term CVCs with a combined antibiotic and heparin solution appeared to reduce Gram positive catheter-related sepsis experienced in people at risk of neutropenia through chemotherapy or disease. Due to insufficient data it was not clear whether this applied equally to TCVCs and totally implanted devices (TIDs), or equally to adults and children. The use of a combined antibiotic and heparin solution may increase microbial antibiotic resistance, therefore it should be reserved for high risk people or where baseline CVC infection rates are high (> 15%). Further research is needed to identify high risk groups most likely to benefit.

Surface acoustic wave unidirectional transducers for quantum applications

NASA Astrophysics Data System (ADS)

Ekström, Maria K.; Aref, Thomas; Runeson, Johan; Björck, Johan; Boström, Isac; Delsing, Per

2017-02-01

The conversion efficiency of electric microwave signals into surface acoustic waves in different types of superconducting transducers is studied with the aim of quantum applications. We compare delay lines containing either conventional symmetric transducers (IDTs) or unidirectional transducers (UDTs) at 2.3 GHz and 10 mK. The UDT delay lines improve the insertion loss with 4.7 dB and a directivity of 22 dB is found for each UDT, indicating that 99.4% of the acoustic power goes in the desired direction. The power lost in the undesired direction accounts for more than 90% of the total loss in IDT delay lines, but only ˜3% of the total loss in the floating electrode unidirectional transducer delay lines.

Central line replacement following infection does not improve reinfection rates in pediatric pulmonary hypertension patients receiving intravenous prostanoid therapy.

PubMed

McCarthy, Elisa K; Ogawa, Michelle T; Hopper, Rachel K; Feinstein, Jeffrey A; Gans, Hayley A

2018-01-01

Treatment of pediatric pulmonary hypertension (PH) with IV prostanoids has greatly improved outcomes but requires a central line, posing inherent infection risk. This study examines the types of infections, infection rates, and importantly the effect of line management strategies on reinfection in children receiving IV prostanoids for PH. This study is a retrospective review of all pediatric PH patients receiving intravenous epoprostenol (EPO) or treprostinil (TRE) at one academic tertiary care center between 2000 and 2014. No patients declined participation in the study or were otherwise excluded. Infectious complications were characterized by organism(s), infection rates, time to next infection, and line management decisions (salvage vs. replace). Of the 40 patients followed, 13 sustained 38 infections involving 49 pathogens, with a predominance of gram-positive (GP) organisms (n = 35). The pooled infection rate was 1.06 per 1000 prostanoid days with no difference between EPO and TRE. No significant difference in reinfection rate was observed when comparing line salvage to replacement, regardless of organism type. Both overall and organism-type comparisons suggest longer time between line infections following line salvage compared with line replacement (732 vs. 410 days overall; 793 vs. 363 days for GP; 611 vs. 581 days for gram-negative [GN]; P > 0.05 for all comparisons). Central line replacement following blood stream infections in pediatric PH patients does not improve subsequent infection rates or time to next infection, and may lead to unnecessary risks associated with line replacement, including potential loss of vascular access. A revised approach to central line infections in pediatric PH is proposed.

Preventing central venous catheter-associated primary bloodstream infections: characteristics of practices among hospitals participating in the Evaluation of Processes and Indicators in Infection Control (EPIC) study.

PubMed

Braun, Barbara I; Kritchevsky, Stephen B; Wong, Edward S; Solomon, Steve L; Steele, Lynn; Richards, Cheryl L; Simmons, Bryan P

2003-12-01

To describe the conceptual framework and methodology of the Evaluation of Processes and Indicators in Infection Control (EPIC) study and present results of CVC insertion characteristics and organizational practices for preventing BSIs. The goal of the EPIC study was to evaluate relationships among processes of care, organizational characteristics, and the outcome of BSI. This was a multicenter prospective observational study of variation in hospital practices related to preventing CVC-associated BSIs. Process of care information (eg, barrier use during insertions and experience of the inserting practitioner) was collected for a random sample of approximately 5 CVC insertions per month per hospital during November 1998 to December 1999. Organization demographic and practice information (eg, surveillance activities and staff and ICU nurse staffing levels) was also collected. Medical, surgical, or medical-surgical ICUs from 55 hospitals (41 U.S. and 14 international sites). Process information was obtained for 3,320 CVC insertions with an average of 58.2 (+/- 16.1) insertions per hospital. Fifty-four hospitals provided policy and practice information. Staff spent an average of 13 hours per week in study ICU surveillance. Most patients received nontunneled, multiple lumen CVCs, of which fewer than 25% were coated with antimicrobial material. Regarding barriers, most clinicians wore masks (81.5%) and gowns (76.8%); 58.1% used large drapes. Few hospitals (18.1%) used an intravenous team to manage ICU CVCs. Substantial variation exists in CVC insertion practice and BSI prevention activities. Understanding which practices have the greatest impact on BSI rates can help hospitals better target improvement interventions.

The S-Tunnel for tunnelled dialysis catheter: an alternative approach to the prevention of displacement.

PubMed

Jenkins, Glyndwr W; Kelly, Michael; Anwar, Siddiq; Ahmed, Saeed S

2015-01-01

Vascular access has been described in the literature anywhere from the 'Achilles Heel' to the 'Cornerstone' of haemodialysis. Displacement of a central venous catheter is not an uncommon occurrence. We discuss an alternative method of placement for the tunnelled central venous catheter to prevent displacement in those patients with excess anterior chest wall soft tissue. A new surgical technique for placement of a tunnelled central venous catheter was developed in an attempt to reduce the number of displacements. This involved the creation of a second tunnel at a 90° angle to the original retrograde tunnelled path. The authors have currently placed five 'S-Line' tunnelled central venous catheters with no reports of displacement or line infection over a period of 18 months. The 'S-Line' offers a simple, straightforward and most importantly safe method to reduce the incidence of tunnelled right internal jugular central venous catheter displacement.

Target of Rapamycin Regulates Development and Ribosomal RNA Expression through Kinase Domain in Arabidopsis1[W][OA

PubMed Central

Ren, Maozhi; Qiu, Shuqing; Venglat, Prakash; Xiang, Daoquan; Feng, Li; Selvaraj, Gopalan; Datla, Raju

2011-01-01

Target of rapamycin (TOR) is a central regulator of cell growth, cell death, nutrition, starvation, hormone, and stress responses in diverse eukaryotes. However, very little is known about TOR signaling and the associated functional domains in plants. We have taken a genetic approach to dissect TOR functions in Arabidopsis (Arabidopsis thaliana) and report here that the kinase domain is essential for the role of TOR in embryogenesis and 45S rRNA expression. Twelve new T-DNA insertion mutants, spanning 14.2 kb of TOR-encoding genomic region, have been characterized. Nine of these share expression of defective kinase domain and embryo arrest at 16 to 32 cell stage. However, three T-DNA insertion lines affecting FATC domain displayed normal embryo development, indicating that FATC domain was dispensable in Arabidopsis. Genetic complementation showed that the TOR kinase domain alone in tor-10/tor-10 mutant background can rescue early embryo lethality and restore normal development. Overexpression of full-length TOR or kinase domain in Arabidopsis displayed developmental abnormalities in meristem, leaf, root, stem, flowering time, and senescence. We further show that TOR, especially the kinase domain, plays a role in ribosome biogenesis by activating 45S rRNA production. Of the six putative nuclear localization sequences in the kinase domain, nuclear localization sequence 6 was identified to confer TOR nuclear targeting in transient expression assays. Chromatin immunoprecipitation studies revealed that the HEAT repeat domain binds to 45S rRNA promoter and the 5′ external transcribed spacer elements motif. Together, these results show that TOR controls the embryogenesis, postembryonic development, and 45S rRNA production through its kinase domain in Arabidopsis. PMID:21266656

Laparoendoscopic transgastric histoacryl injection of gastric varices: a new surgical approach.

PubMed

Kassem, Mohamed I; El-Haddad, Hani M; El-Bahrawi, Hassan A

2013-02-01

Gastric varices (GVs) are a common finding in Egyptian patients with portal hypertension due to cirrhosis or schistosomal hepatic fibrosis. These patients present with an acute attack or history of hematemesis. Endoscopic histoacryl injection is the standard treatment in Egypt; however, because of technical difficulties it is possible to inject only a little amount of this material, as it may endanger the channels of the flexible endoscope. We thought of a new surgical laparoendoscopic technique to obviate the need for repeated endoscopies and complete obliteration of GVs. This study was conducted on 20 patients with portal hypertension and GVs. After the patient was placed under general anesthesia, a small gastrostomy was done in the anterior gastric wall through which a 10-mm trocar was inserted for the laparoscopic camera. Injection of GVs was done via a spinal needle or a central venous line needle inserted directly. Injection of an adequate amount of histoacryl was done under direct vision. This study was conducted from July 2009 to August 2011 on 20 patients with GVs. The age range was from 22 to 56 years, with a mean age of 39.8±7.85 years. There were 14 men (70%) and 6 women (30%). Fourteen patients (70%) showed complete obliteration of GVs after one session of treatment, whereas 6 patients (30%) had unsatisfactory results and were subjected to another session. GVs were completely obliterated after the second session in 4 patients. Two cases of recurrence of GVs were operated on. This new technique enabled us to inject GVs with a suitable amount of glue material under direct vision without harming the endoscope. Use of this procedure is recommended in patients fit for surgery and those who had failed endoscopic injection sclerotherapy.

Evaluation of effectiveness of a paediatric simulation course in procedural skills for paediatric residents - A pilot study.

PubMed

AlShammari, Abdullah; Inayah, Aman; Afsar, Nasir Ali; Nurhussen, Akram; Siddiqui, Amna; Anwer, Muhammad Lucman; Obeidat, Sadek; Bakro, Mohammed Khaled; Abu Assale, Tawfik Samer; Almidani, Eyad; Alsonbul, Abdullah; Alhaider, Sami; Hussain, Ibrahim Bin; Khadawardi, Emad; Zafar, Muhammad

2018-02-01

To explore the effects of simulation training on paediatric residents' confidence and skills in managing advanced skills in critical care. The study was conducted at Alfaisal University, Riyadh, Saudi Arabia, from March to June 2016, and comprised junior residents in paediatrics. All paediatric residents (years 1 and 2) were recruited into two workshops, held one week apart. The first workshop covered lumbar puncture/ cerebrospinal fluid interpretation, oral intubation, bone marrow aspiration, and critical airway management. The second workshop covered chest tube insertion, pleural tap, insertion of central line, and arthrocentesis. The participants were surveyed using a 5-point Likert scale survey pre- and post-course, assessing their confidence. Their practical skills were assessed using a pre-objective structured clinical examination on the same day and post-course objective structured clinical examination a week later on selected skills. The outcome measures were: (1) pre-/post-course confidence rating, and (2) pre-/post-course objective structured clinical examination results. Data was analysed using SPSS 20. Of the 16 participants, 8(50%) were boys and 8(50%) girls. Besides, 13(81%) residents were in year-1 and 3(19%) in year-2. Median post-course confidence level ranks for all the skills were higher (p<0.05). There was no improvement in mean pre-objective structured clinical examination scores (2.31±2.66/ 7.46±3.02) and post- objective structured clinical examination scores (22.54±4.39/ 31.85±6.90) in Year 1 residents (p<0.001). Simulation course was significantly successful in improving residents' clinical skills and confidence in performing critical tasks.

Report of two paediatric cases of central line infections caused by species of the genus Kocuria

PubMed Central

Hamula, Camille L.; Dingle, Tanis C.

2016-01-01

Introduction: Species of the genus Kocuria are Gram-positive cocci of the family Micrococcacceae that are ubiquitous in the environment and part of the normal skin and oral flora in humans. A paucity of cases have been reported of Kocuria as human pathogens and there are currently no evidence-based guidelines for managing these uncommon infections. Case presentation: We present two paediatric cases of central line infections with species of the genus Kocuria that required line removal despite antimicrobial therapy. Conclusion: Species of the genus Kocuria are uncommon human pathogens that have rarely been reported to cause opportunistic infections in both adult and paediatric populations. The cases presented here add to the growing body of literature documenting the pathogenicity of these organisms and the possible need for line removal to achieve clinical cure in central line-associated bacteraemia caused by species of the genus Kocuria. PMID:28348760

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

50 CFR 221.52 - What are the requirements for presenting testimony?

Code of Federal Regulations, 2010 CFR

2010-10-01

... testimony? (a) Written direct testimony. Unless otherwise ordered by the ALJ, all direct hearing testimony must be prepared and submitted in written form. (1) Prepared written testimony must: (i) Have line numbers inserted in the left-hand margin of each page; (ii) Be authenticated by an affidavit or...

Lamarck Will Not Lie Down.

ERIC Educational Resources Information Center

Lewin, Roger

1981-01-01

Describes recent research by Edward Steele appearing to support the Lamarckian theory of inheritance. Steele suggests that a mutant somatic cell favored by the environment will undergo clonal expansion. Altered genetic materials from these cells is then picked up by C-type viruses and inserted into the germ line genome. (CS)

[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].

PubMed

Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min

2015-05-01

To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.

Bringing central line-associated bloodstream infection prevention home: CLABSI definitions and prevention policies in home health care agencies.

PubMed

Rinke, Michael L; Bundy, David G; Milstone, Aaron M; Deuber, Kristin; Chen, Allen R; Colantuoni, Elizabeth; Miller, Marlene R

2013-08-01

A study was conducted to investigate health care agency central line-associated bloodstream infection (CLABSI) definitions and prevention policies and pare them to the Joint Commission National Patient Safety Goal (NPSG.07.04.01), the Centers for Disease Control and Prevention (CDC) CLABSI prevention recommendations, and a best-practice central line care bundle for inpatients. A telephone-based survey was conducted in 2011 of a convenience sample of home health care agencies associated with children's hematology/oncology centers. Of the 97 eligible home health care agencies, 57 (59%) completed the survey. No agency reported using all five aspects of the National Healthcare and Safety Network/Association for Professionals in Infection Control and Epidemiology CLABSI definition and adjudication process, and of the 50 agencies that reported tracking CLABSI rates, 20 (40%) reported using none. Only 10 agencies (18%) had policies consistent with all elements of the inpatient-focused NPSG.07.04.01, 10 agencies (18%) were consistent with all elements of the home care targeted CDC CLABSI prevention recommendations, and no agencies were consistent with all elements of the central line care bundle. Only 14 agencies (25%) knew their overall CLABSI rate: mean 0.40 CLABSIs per 1,000 central line days (95% confidence interval [CI], 0.18 to 0.61). Six agencies (11%) knew their agency's pediatric CLABSI rate: mean 0.54 CLABSIs per 1,000 central line days (95% CI, 0.06 to 1.01). The policies of a national sample of home health care agencies varied significantly from national inpatient and home health care agency targeted standards for CLABSI definitions and prevention. Future research should assess strategies for standardizing home health care practices consistent with evidence-based recommendations.

Microwave fiber optics delay line

NASA Astrophysics Data System (ADS)

Slayman, C.; Yen, H. W.

1980-01-01

A microwave delay line is one of the devices used in EW systems for preserving the frequency and phase contents of RF signals. For such applications, delay lines are required to have large dynamic range, wide bandwidth, low insertion loss, and a linear response. The basic components of a fiber-optics delay line are: an optical source, a wideband optical modulator, a spool of single-mode fiber with appropriate length to provide a given microwave signal delay, and a high-speed photodetector with an RF amplifier. This contract program is to study the feasibility of such a fiber-optic delay line in the frequency range of 4.0 to 6.5 GHz. The modulation scheme studied is the direct modulation of injection lasers. The most important issue identified is the frequency response of the injection laser and the photodetector.

The Use of Transcription Terminators to Generate Transgenic Lines of Chinese Hamster Ovary Cells (CHO) with Stable and High Level of Reporter Gene Expression.

PubMed

Gasanov, N B; Toshchakov, S V; Georgiev, P G; Maksimenko, O G

2015-01-01

Mammalian cell lines are widely used to produce recombinant proteins. Stable transgenic cell lines usually contain many insertions of the expression vector in one genomic region. Transcription through transgene can be one of the reasons for target gene repression after prolonged cultivation of cell lines. In the present work, we used the known transcription terminators from the SV40 virus, as well as the human β- and γ-globin genes, to prevent transcription through transgene. The transcription terminators were shown to increase and stabilize the expression of the EGFP reporter gene in transgenic lines of Chinese hamster ovary (CHO) cells. Hence, transcription terminators can be used to create stable mammalian cells with a high and stable level of recombinant protein production.

An investigation into the association between HLA-G 14 bp insertion/deletion polymorphism and multiple sclerosis susceptibility.

PubMed

Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud

2016-01-15

Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.

The Effect Of Hypotensive Resuscitation And Fluid Type On Mortality, Bleeding,Coagulation And Dysfunctional Inflammation In A Swine Grade V Liver Injury Model

DTIC Science & Technology

2012-01-01

Once the swine were anesthetized, left cervical cut downs were performed and a central venous polyethylene catheter was inserted into the external...open and the liver injury will be examined for evidence of re-bleeding. The venous and arterial pressures at which re-bleeding occur will be...Fig. 1) Figure 1. Clamp used for the pig liver injury model The clamp is placed centrally in the liver and it produces laceration of 1

Apparatus for simultaneously disreefing a centrally reefed clustered parachute system

DOEpatents

Johnson, Donald W.

1988-01-01

A single multi-line cutter is connected to each of a cluster of parachutes by a separate short tether line that holds the parachutes, initially reefed by closed loop reefing lines, close to one another. The closed loop reefing lines and tether lines, one from each parachute, are disposed within the cutter to be simultaneously cut by its actuation when a central line attached between the payload and the cutter is stretched upon deployment of the cluster. A pyrotechnic or electronic time delay may be included in the cutter to delay the actual simultaneous cutting of all lines until the clustered parachutes attain a measure of stability prior to being disreefed. A second set of reefing lines and second tether lines may be provided for each parachute, to enable a two-stage, separately timed, step-by-step disreefing.

Apparatus for simultaneously disreefing a centrally reefed clustered parachute system

DOEpatents

Johnson, D.W.

1988-06-21

A single multi-line cutter is connected to each of a cluster of parachutes by a separate short tether line that holds the parachutes, initially reefed by closed loop reefing lines, close to one another. The closed loop reefing lines and tether lines, one from each parachute, are disposed within the cutter to be simultaneously cut by its actuation when a central line attached between the payload and the cutter is stretched upon deployment of the cluster. A pyrotechnic or electronic time delay may be included in the cutter to delay the actual simultaneous cutting of all lines until the clustered parachutes attain a measure of stability prior to being disreefed. A second set of reefing lines and second tether lines may be provided for each parachute, to enable a two-stage, separately timed, step-by-step disreefing. 13 figs.

Large exon size does not limit splicing in vivo.

PubMed

Chen, I T; Chasin, L A

1994-03-01

Exon sizes in vertebrate genes are, with a few exceptions, limited to less than 300 bases. It has been proposed that this limitation may derive from the exon definition model of splice site recognition. In this model, a downstream donor site enhances splicing at the upstream acceptor site of the same exon. This enhancement may require contact between factors bound to each end of the exon; an exon size limitation would promote such contact. To test the idea that proximity was required for exon definition, we inserted random DNA fragments from Escherichia coli into a central exon in a three-exon dihydrofolate reductase minigene and tested whether the expanded exons were efficiently spliced. DNA from a plasmid library of expanded minigenes was used to transfect a CHO cell deletion mutant lacking the dhfr locus. PCR analysis of DNA isolated from the pooled stable cotransfectant populations displayed a range of DNA insert sizes from 50 to 1,500 nucleotides. A parallel analysis of the RNA from this population by reverse transcription followed by PCR showed a similar size distribution. Central exons as large as 1,400 bases could be spliced into mRNA. We also tested individual plasmid clones containing exon inserts of defined sizes. The largest exon included in mRNA was 1,200 bases in length, well above the 300-base limit implied by the survey of naturally occurring exons. We conclude that a limitation in exon size is not part of the exon definition mechanism.

Risk factors associated with catheter-related upper extremity deep vein thrombosis in patients with peripherally inserted central venous catheters: a prospective observational cohort study: part 2.

PubMed

Maneval, Rhonda E; Clemence, Bonnie J

2014-01-01

This is the second part of a 2-part series that reports on the results of a prospective observational cohort study designed to examine risk factors associated with symptomatic upper extremity deep vein thrombosis (UEDVT) in patients with peripherally inserted central catheters (PICCs). Part 1, published in the May/June 2014 issue of the Journal of Infusion Nursing, provided an extensive review and critique of the literature regarding risk factors associated with catheter-related UEDVT and identified 28 suspected risk factors. A study was undertaken to examine each of the risk factors among 203 acute care patients with PICCs, 13 of whom experienced a UEDVT, yielding an incidence of 6.4%. The most common reason for admission was infection (33.5%), and the primary reason for insertion of the PICC was venous access (58.6%). Hypertension (P = .022) and obesity (P = .008), defined as a body mass index ≥30, were associated with UEDVT. The clinical symptoms of edema (P < .001) and a 3-cm or more increase in arm circumference (P < .001) in the PICC arm after PICC placement were associated with UEDVT. All other variables were not statistically significant. The results suggest that patients who are obese and hypertensive may be at greater risk for the development of UEDVT and that the physical finding of edema and increased arm circumference in the PICC arm are possibly suggestive of UEDVT.

Peripherally inserted central catheter thrombosis incidence and risk factors in cancer patients: a double-center prospective investigation

PubMed Central

Liu, Yuxiu; Gao, Yufang; Wei, Lili; Chen, Weifen; Ma, Xiaoyan; Song, Lei

2015-01-01

Background Peripherally inserted central catheters (PICCs) are widely used in chemotherapy, but the reported PICC thrombosis incidence varies greatly, and risks of PICC thrombosis are not well defined. This study was to investigate the incidence and risk factors of PICC-related upper extremity vein thrombosis in cancer patients. Methods This was a prospective study conducted in two tertiary referral hospitals from May 2010 to February 2013. Cancer patients who were subject to PICC placement were enrolled and checked by Doppler ultrasound weekly for at least 1 month. Univariable and multivariable logistic regression analyses were applied for identification of risk factors. Results Three hundred and eleven cancer patients were enrolled in the study. One hundred and sixty (51.4%) developed PICC thrombosis, of which 87 (54.4%) cases were symptomatic. The mean time interval from PICC insertion to thrombosis onset was 11.04±5.538 days. The univariable logistic regression analysis showed that complications (odds ratio [OR] 1.686, P=0.032), less activity (OR 1.476, P=0.006), obesity (OR 3.148, P=0.000), and chemotherapy history (OR 3.405, P=0.030) were associated with PICC thrombosis. Multivariate analysis showed that less activity (OR 9.583, P=0.000) and obesity (OR 3.466, P=0.014) were significantly associated with PICC thrombosis. Conclusions The incidence of PICC thrombosis is relatively high, and nearly half are asymptomatic. Less activity and obesity are risk factors of PICC-related thrombosis. PMID:25673995

Health-related quality of life of cancer patients with peripherally inserted central catheter: a pilot study.

PubMed

Kang, Junren; Chen, Wei; Sun, Wenyan; Ge, Ruibin; Li, Hailong; Ma, Enling; Su, Qingxia; Cheng, Fang; Hong, Jinhua; Zhang, Yuanjuan; Lei, Cheng; Wang, Xinchuan; Jin, Aiyun; Liu, Wanli

2017-09-11

This pilot exploratory study aimed to compare the health-related quality of life (HRQOL) among patients diagnosed with different types of cancer receiving peripherally inserted central catheters (PICCs). A multicenter cross-section study of cancer patients with PICCs was performed from February 1, 2013 to April 24, 2014. The primary objective of this study was to compare HRQOL in different cancer type patients with PICC. HRQOL was examined based on European Organisation for Research and Treatment of Cancer Quality-of-Life Questionnaire-Core 30 (EORTC QLQ-C30). Multiple linear regression models were conducted for coping with potential confounding variables. We also examined PICC-related quality of daily life with a self-made questionnaire. Three hundred and fifty-seven cancer patients with PICC completed the survey in nine teaching hospitals. Lung cancer patients with PICC reported the worst dyspnea. Digestive tract cancer patients reported the worst appetite loss. Patients with hematologic malignancy reported the worst emotional, social function, fatigue and financial impact. Breast cancer patients reported better HRQOL. Baseline variables were proven not significant predictors of EORTC QLQ-C30 global health status. In self-made survey, pain after PICC insertion was null or a little in 98.6% of cancer patients. Limitation of upper extremity activity was null or a little in 94.1% of patients. HRQOL varies in different types of cancer patients with PICC. PICC may have a low impact on cancer patients' HRQOL. Further large sample studies are needed.

Rates of central line-associated bloodstream infection in tertiary care hospitals in 3 Arabian gulf countries: 6-year surveillance study.

PubMed

Balkhy, Hanan H; El-Saed, Aiman; Al-Abri, Seif S; Alsalman, Jameela; Alansari, Huda; Al Maskari, Zaina; El Gammal, Ayman; Al Nasser, Wafa; AlJardani, Amina; Althaqafi, Abdulhakeem

2017-05-01

The objective of this study was to compare central line-associated bloodstream infection (CLABSI) rates in Gulf Cooperation Council (GCC) states with those of the U.S. National Healthcare Safety Network (NHSN) and International Nosocomial Infection Control Consortium (INICC) using pooled data from 6 hospitals in 3 GCC countries. The overall CLABSI rate was 3.1 per 1,000 central line days. After adjusting for differences in intensive care unit types, the risk of CLABSI in GCC hospitals was 146% higher than NHSN hospitals but 33% lower than INICC hospitals. Copyright © 2017. Published by Elsevier Inc.

Leadership line care rounds: Application of the engage, educate, execute, and evaluate improvement model for the prevention of central line-associated bloodstream infections in children with cancer.

PubMed

Owings, Angie; Graves, JoBeth; Johnson, Sherry; Gilliam, Craig; Gipson, Mike; Hakim, Hana

2018-02-01

To prevent central line-associated bloodstream infections (CLABSIs), leadership line care rounds (LLCRs) used the engage, educate, execute, and evaluate improvement model to audit compliance, identify barriers and opportunities, empower patients and families, and engage leadership. Findings of excellence and improvement opportunities were communicated to unit staff and managers. LLCRs contributed to compliance with CLABSI prevention interventions. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.