Science.gov

Sample records for cfr rrna methyltransferase

  1. The Cfr rRNA Methyltransferase Confers Resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A Antibiotics

    PubMed Central

    Long, Katherine S.; Poehlsgaard, Jacob; Kehrenberg, Corinna; Schwarz, Stefan; Vester, Birte

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and recently shown to encode a methyltransferase that modifies 23S rRNA at A2503. Antimicrobial susceptibility testing shows that S. aureus and E. coli strains expressing the cfr gene exhibit elevated MICs to a number of chemically unrelated drugs. The phenotype is named PhLOPSA for resistance to the following drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind to overlapping sites at the peptidyl transferase center that abut nucleotide A2503, is perturbed upon Cfr-mediated methylation. Decreased drug binding to Cfr-methylated ribosomes has been confirmed by footprinting analysis. No other rRNA methyltransferase is known to confer resistance to five chemically distinct classes of antimicrobials. In addition, the findings described in this study represent the first report of a gene conferring transferable resistance to pleuromutilins and oxazolidinones. PMID:16801432

  2. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  3. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  4. Properties of small rRNA methyltransferase RsmD: Mutational and kinetic study

    PubMed Central

    Sergeeva, Olga V.; Prokhorova, Irina V.; Ordabaev, Yerdos; Tsvetkov, Philipp O.; Sergiev, Petr V.; Bogdanov, Alexey A.; Makarov, Alexander A.; Dontsova, Olga A.

    2012-01-01

    Ribosomal RNA modification is accomplished by a variety of enzymes acting on all stages of ribosome assembly. Among rRNA methyltransferases of Escherichia coli, RsmD deserves special attention. Despite its minimalistic domain architecture, it is able to recognize a single target nucleotide G966 of the 16S rRNA. RsmD acts late in the assembly process and is able to modify a completely assembled 30S subunit. Here, we show that it possesses superior binding properties toward the unmodified 30S subunit but is unable to bind a 30S subunit modified at G966. RsmD is unusual in its ability to withstand multiple amino acid substitutions of the active site. Such efficiency of RsmD may be useful to complete the modification of a 30S subunit ahead of the 30S subunit’s involvement in translation. PMID:22535590

  5. Functional Specialization of Domains Tandemly Duplicated Witin 16S rRNA Methyltransferase RsmC

    SciTech Connect

    Sunita,S.; Purta, E.; Durawa, M.; Tkaczuk, K.; Swaathi, J.; Bujnicki, J.; Sivaraman, J.

    2007-01-01

    RNA methyltransferases (MTases) are important players in the biogenesis and regulation of the ribosome, the cellular machine for protein synthesis. RsmC is a MTase that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to G1207 of 16S rRNA. Mutations of G1207 have dominant lethal phenotypes in Escherichia coli, underscoring the significance of this modified nucleotide for ribosome function. Here we report the crystal structure of E. coli RsmC refined to 2.1 Angstroms resolution, which reveals two homologous domains tandemly duplicated within a single polypeptide. We characterized the function of the individual domains and identified key residues involved in binding of rRNA and SAM, and in catalysis. We also discovered that one of the domains is important for the folding of the other. Domain duplication and subfunctionalization by complementary degeneration of redundant functions (in particular substrate binding versus catalysis) has been reported for many enzymes, including those involved in RNA metabolism. Thus, RsmC can be regarded as a model system for functional streamlining of domains accompanied by the development of dependencies concerning folding and stability.

  6. Multi-site-specific 16S rRNA Methyltransferase RsmF from Thermus thermophilus

    SciTech Connect

    Demirci, H.; Larsen, L; Hansen, T; Rasmussen, A; Cadambi, A; Gregory, S; Kirpekar, F; Jogl, G

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m{sup 5}C) modifications in 16S rRNA of Thermus thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m{sup 5}C967. In contrast to E. coli RsmF, which introduces a single m{sup 5}C1407 modification, T. thermophilus RsmF modifies three positions, generating m{sup 5}C1400 and m{sup 5}C1404 in addition to m{sup 5}C1407. These three residues are clustered near the decoding site of the ribosome, but are situated in distinct structural contexts, suggesting a requirement for flexibility in the RsmF active site that is absent from the E. coli enzyme. Two of these residues, C1400 and C1404, are sufficiently buried in the mature ribosome structure so as to require extensive unfolding of the rRNA to be accessible to RsmF. In vitro, T. thermophilus RsmF methylates C1400, C1404, and C1407 in a 30S subunit substrate, but only C1400 and C1404 when naked 16S rRNA is the substrate. The multispecificity of T. thermophilus RsmF is potentially explained by three crystal structures of the enzyme in a complex with cofactor S-adenosyl-methionine at up to 1.3 {angstrom} resolution. In addition to confirming the overall structural similarity to E. coli RsmF, these structures also reveal that key segments in the active site are likely to be dynamic in solution, thereby expanding substrate recognition by T. thermophilus RsmF.

  7. Structural insights into the function of aminoglycoside-resistance A1408 16S rRNA methyltransferases from antibiotic-producing and human pathogenic bacteria

    PubMed Central

    Macmaster, Rachel; Zelinskaya, Natalia; Savic, Miloje; Rankin, C. Robert; Conn, Graeme L.

    2010-01-01

    X-ray crystal structures were determined of the broad-spectrum aminoglycoside-resistance A1408 16S rRNA methyltransferases KamB and NpmA, from the aminoglycoside-producer Streptoalloteichus tenebrarius and human pathogenic Escherichia coli, respectively. Consistent with their common function, both are Class I methyltransferases with additional highly conserved structural motifs that embellish the core SAM-binding fold. In overall structure, the A1408 rRNA methyltransferase were found to be most similar to a second family of Class I methyltransferases of distinct substrate specificity (m7G46 tRNA). Critical residues for A1408 rRNA methyltransferase activity were experimentally defined using protein mutagenesis and bacterial growth assays with kanamycin. Essential residues for SAM coenzyme binding and an extended protein surface that likely interacts with the 30S ribosomal subunit were thus revealed. The structures also suggest potential mechanisms of A1408 target nucleotide selection and positioning. We propose that a dynamic extended loop structure that is positioned adjacent to both the bound SAM and a functionally critical structural motif may mediate concerted conformational changes in rRNA and protein that underpin the specificity of target selection and activation of methyltransferase activity. These new structures provide important new insights that may provide a starting point for strategies to inhibit these emerging causes of pathogenic bacterial resistance to aminoglycosides. PMID:20639535

  8. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  9. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    PubMed Central

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  10. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates.

    PubMed

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Chujo, Takeshi; Ishigami, Yuma; Chemla, Yonatan; Blumberg, Amit; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-09-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  11. Aminoglycoside resistance 16S rRNA methyltransferases block endogenous methylation, affect translation efficiency and fitness of the host

    PubMed Central

    Lioy, Virginia S.; Goussard, Sylvie; Guerineau, Vincent; Yoon, Eun-Jeong; Courvalin, Patrice; Galimand, Marc; Grillot-Courvalin, Catherine

    2014-01-01

    In Gram-negative bacteria, acquired 16S rRNA methyltransferases ArmA and NpmA confer high-level resistance to all clinically useful aminoglycosides by modifying, respectively, G1405 and A1408 in the A-site. These enzymes must coexist with several endogenous methyltransferases that are essential for fine-tuning of the decoding center, such as RsmH and RsmI in Escherichia coli, which methylate C1402 and RsmF C1407. The resistance methyltransferases have a contrasting distribution—ArmA has spread worldwide, whereas a single clinical isolate producing NpmA has been reported. The rate of dissemination of resistance depends on the fitness cost associated with its expression. We have compared ArmA and NpmA in isogenic Escherichia coli harboring the corresponding structural genes and their inactive point mutants cloned under the control of their native constitutive promoter in the stable plasmid pGB2. Growth rate determination and competition experiments showed that ArmA had a fitness cost due to methylation of G1405, whereas NpmA conferred only a slight disadvantage to the host due to production of the enzyme. MALDI MS indicated that ArmA impeded one of the methylations at C1402 by RsmI, and not at C1407 as previously proposed, whereas NpmA blocked the activity of RsmF at C1407. A dual luciferase assay showed that methylation at G1405 and A1408 and lack of methylation at C1407 affect translation accuracy. These results indicate that resistance methyltransferases impair endogenous methylation with different consequences on cell fitness. PMID:24398977

  12. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  13. Functional dichotomy in the 16S rRNA (m1A1408) methyltransferase family and control of catalytic activity via a novel tryptophan mediated loop reorganization.

    PubMed

    Witek, Marta A; Conn, Graeme L

    2016-01-01

    Methylation of the bacterial small ribosomal subunit (16S) rRNA on the N1 position of A1408 confers exceptionally high-level resistance to a broad spectrum of aminoglycoside antibiotics. Here, we present a detailed structural and functional analysis of the Catenulisporales acidiphilia 16S rRNA (m(1)A1408) methyltransferase ('CacKam'). The apo CacKam structure closely resembles other m(1)A1408 methyltransferases within its conserved SAM-binding fold but the region linking core β strands 6 and 7 (the 'β6/7 linker') has a unique, extended structure that partially occludes the putative 16S rRNA binding surface, and sequesters the conserved and functionally critical W203 outside of the CacKam active site. Substitution of conserved residues in the SAM binding pocket reveals a functional dichotomy in the 16S rRNA (m(1)A1408) methyltransferase family, with two apparently distinct molecular mechanisms coupling cosubstrate/ substrate binding to catalytic activity. Our results additionally suggest that CacKam exploits the W203-mediated remodeling of the β6/7 linker as a novel mechanism to control 30S substrate recognition and enzymatic turnover.

  14. Structural Basis for the Methylation of G1405 in 16S rRNA by Aminoglycoside Resistance Methyltransferase Sgm from an Antibiotic Producer: a Diversity of Active Sites in m7G Methyltransferases

    SciTech Connect

    Husain, N.; Tkaczuk, K; Tulsidas, S; Kaminska, K; Cubrilo, S; Maravic -Vlahovicek, G; Bujnicki, J; Sivaraman, J

    2010-01-01

    Sgm (Sisomicin-gentamicin methyltransferase) from antibiotic-producing bacterium Micromonospora zionensis is an enzyme that confers resistance to aminoglycosides like gentamicin and sisomicin by specifically methylating G1405 in bacterial 16S rRNA. Sgm belongs to the aminoglycoside resistance methyltransferase (Arm) family of enzymes that have been recently found to spread by horizontal gene transfer among disease-causing bacteria. Structural characterization of Arm enzymes is the key to understand their mechanism of action and to develop inhibitors that would block their activity. Here we report the structure of Sgm in complex with cofactors S-adenosylmethionine (AdoMet) and S-adenosylhomocysteine (AdoHcy) at 2.0 and 2.1 {angstrom} resolution, respectively, and results of mutagenesis and rRNA footprinting, and protein-substrate docking. We propose the mechanism of methylation of G1405 by Sgm and compare it with other m{sup 7}G methyltransferases, revealing a surprising diversity of active sites and binding modes for the same basic reaction of RNA modification. This analysis can serve as a stepping stone towards developing drugs that would specifically block the activity of Arm methyltransferases and thereby re-sensitize pathogenic bacteria to aminoglycoside antibiotics.

  15. Structural basis for the methylation of G1405 in 16S rRNA by aminoglycoside resistance methyltransferase Sgm from an antibiotic producer: a diversity of active sites in m7G methyltransferases

    PubMed Central

    Husain, Nilofer; Tkaczuk, Karolina L.; Tulsidas, Shenoy Rajesh; Kaminska, Katarzyna H.; Čubrilo, Sonja; Sivaraman, J.

    2010-01-01

    Sgm (Sisomicin-gentamicin methyltransferase) from antibiotic-producing bacterium Micromonospora zionensis is an enzyme that confers resistance to aminoglycosides like gentamicin and sisomicin by specifically methylating G1405 in bacterial 16S rRNA. Sgm belongs to the aminoglycoside resistance methyltransferase (Arm) family of enzymes that have been recently found to spread by horizontal gene transfer among disease-causing bacteria. Structural characterization of Arm enzymes is the key to understand their mechanism of action and to develop inhibitors that would block their activity. Here we report the structure of Sgm in complex with cofactors S-adenosylmethionine (AdoMet) and S-adenosylhomocysteine (AdoHcy) at 2.0 and 2.1 Å resolution, respectively, and results of mutagenesis and rRNA footprinting, and protein-substrate docking. We propose the mechanism of methylation of G1405 by Sgm and compare it with other m7G methyltransferases, revealing a surprising diversity of active sites and binding modes for the same basic reaction of RNA modification. This analysis can serve as a stepping stone towards developing drugs that would specifically block the activity of Arm methyltransferases and thereby re-sensitize pathogenic bacteria to aminoglycoside antibiotics. PMID:20194115

  16. Structural and functional insights into the molecular mechanism of rRNA m6A methyltransferase RlmJ.

    PubMed

    Punekar, Avinash S; Liljeruhm, Josefine; Shepherd, Tyson R; Forster, Anthony C; Selmer, Maria

    2013-11-01

    RlmJ catalyzes the m(6)A2030 methylation of 23S rRNA during ribosome biogenesis in Escherichia coli. Here, we present crystal structures of RlmJ in apo form, in complex with the cofactor S-adenosyl-methionine and in complex with S-adenosyl-homocysteine plus the substrate analogue adenosine monophosphate (AMP). RlmJ displays a variant of the Rossmann-like methyltransferase (MTase) fold with an inserted helical subdomain. Binding of cofactor and substrate induces a large shift of the N-terminal motif X tail to make it cover the cofactor binding site and trigger active-site changes in motifs IV and VIII. Adenosine monophosphate binds in a partly accommodated state with the target N6 atom 7 Å away from the sulphur of AdoHcy. The active site of RlmJ with motif IV sequence 164DPPY167 is more similar to DNA m(6)A MTases than to RNA m(6)2A MTases, and structural comparison suggests that RlmJ binds its substrate base similarly to DNA MTases T4Dam and M.TaqI. RlmJ methylates in vitro transcribed 23S rRNA, as well as a minimal substrate corresponding to helix 72, demonstrating independence of previous modifications and tertiary interactions in the RNA substrate. RlmJ displays specificity for adenosine, and mutagenesis experiments demonstrate the critical roles of residues Y4, H6, K18 and D164 in methyl transfer. PMID:23945937

  17. Structural Insights into the Methylation of C1402 in 16S rRNA by Methyltransferase RsmI

    PubMed Central

    Liu, Guangfeng; Wang, Li; Wang, Jian; Gao, Zengqiang; Dong, Yuhui; Zhang, Linbo; Gong, Yong

    2016-01-01

    RsmI and RsmH are conserved S-Adenosylmethionine (AdoMet)-dependent methyltransferases (MTases) that are responsible for the 2′-O-methylation and N4-methylation of C1402 in bacterial 16S rRNA, respectively. Methylation of m4Cm1402 plays a role in fine-tuning the shape and functions of the P-site to increase the decoding fidelity, and was recently found to contribute to the virulence of Staphylococcus aureus in host animals. Here we report the 2.20-Å crystal structure of homodimeric RsmI from Escherichia coli in complex with the cofactor AdoMet. RsmI consists of an N-terminal putative RNA-binding domain (NTD) and a C-terminal catalytic domain (CTD) with a Rossmann-like fold, and belongs to the class III MTase family. AdoMet is specifically bound into a negatively charged deep pocket formed by both domains by making extensive contacts. Structure-based mutagenesis and isothermal titration calorimetry (ITC) assays revealed Asp100 and Ala124 are vital for AdoMet-binding. Although the overall fold of RsmI shows remarkable similarities to the characterized MTases involved in vitamin B12 biosynthesis, it exhibits a distinct charge distribution especially around the AdoMet-binding pocket because of different substrate specificity. The docking model of RsmI-AdoMet-RNA ternary complex suggested a possible base-flipping mechanism of the substrate RNA that has been observed in several known RNA MTases. Our structural and biochemical studies provide novel insights into the catalytic mechanism of C1402 methylation in 16S rRNA. PMID:27711192

  18. Purification, crystallization and preliminary crystallographic analysis of the 16S rRNA methyltransferase RsmI from Escherichia coli.

    PubMed

    Zhao, Mohan; Wang, Li; Zhang, Heng; Dong, Yuhui; Gong, Yong; Zhang, Linbo; Wang, Jian

    2014-09-01

    RsmI and RsmH are AdoMet-dependent methyltransferases that are responsible for the 2'-O-methylation and N(4)-methylation of C1402 of Escherichia coli 16S rRNA, respectively. Modification of this site has been found to play a role in fine-tuning the shape and function of the P-site to increase the decoding fidelity. It is interesting to study the mechanism by which C1402 can be methylated by both RsmI and RsmH. The crystal structure of RsmH in complex with AdoMet and cytidine has recently been determined and provided some implications for N(4)-methylation of this site. Here, the purification and crystallization of RsmI as well as its preliminary crystallographic analysis are reported. Co-crystallization of RsmI with AdoMet was carried out by the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 2.60 Å resolution on beamline 1W2B at BSRF. The crystal contained three molecules per asymmetric unit and belonged to space group C2, with unit-cell parameters a = 121.9, b = 152.5, c = 54.2 Å, β = 93.4°. PMID:25195904

  19. Immunological evaluation of an rsmD-like rRNA methyltransferase from Wolbachia endosymbiont of Brugia malayi.

    PubMed

    Rana, Ajay Kumar; Kushwaha, Susheela; Singh, Prashant Kumar; Misra-Bhattacharya, Shailja

    2016-02-01

    Wolbachia is a wonderful anti-filarial target with many of its enzymes and surface proteins (WSPs) representing potential drug targets and vaccine candidates. Here we report on the immunologic response of a drug target, rsmD-like rRNA methyltransferase from Wolbachia endosymbiont of Brugia malayi. The recombinant protein generated both humoral and cell-mediated response in BALB/c mice but compromised its immunity. The humoral response was transient and endured barely for six months in mice with or without B. Malayi challenge. In splenocytes of mice, the key humoral immunity mediating cytokine IL4 was lowered (IL4↓) while IFNγ, the major cytokine mediating cellular immunity was decreased along with upregulation of IL10 cytokine (IFNγ↓, IL10↑). The finding here indicates that the enzyme has low immunogenicity and triggers lowering of cytokine level in BALB/c mice. Interestingly the overall immune profile can be summed up with equivalent response generated by WSP or whole Wolbachia.

  20. The Pathogen-Derived Aminoglycoside Resistance 16S rRNA Methyltransferase NpmA Possesses Dual m1A1408/m1G1408 Specificity

    PubMed Central

    Zelinskaya, Natalia; Witek, Marta A.

    2015-01-01

    Chemical modification of 16S rRNA can confer exceptionally high-level resistance to a diverse set of aminoglycoside antibiotics. Here, we show that the pathogen-derived enzyme NpmA possesses dual m1A1408/m1G1408 activity, an unexpected property apparently unique among the known aminoglycoside resistance 16S rRNA (m1A1408) methyltransferases. Although the biological significance of this activity remains to be determined, such mechanistic variation in enzymes acquired by pathogens has significant implications for development of inhibitors of these emerging resistance determinants. PMID:26416864

  1. RmtC and RmtF 16S rRNA Methyltransferase in NDM-1–Producing Pseudomonas aeruginosa

    PubMed Central

    Rahman, Mohibur; Pathak, Ashutosh; Pati, Binod Kumar; Singh, Avinash; Ovejero, Cristina M.; Ahmad, Saheem; Gonzalez-Zorn, Bruno

    2015-01-01

    We investigated 16S rRNA methyltransferases in 38 blaNDM-1–positive Pseudomonas aeruginosa isolates and found RmtC in 3 isolates, 1 of which also harbored RmtF. The isolates were clonally unrelated; rmtC and rmtF genes were located on a chromosome with the blaNDM-1 gene. Strategies are needed to limit the spread of such isolates. PMID:26488937

  2. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  3. Structural Rearrangements in the Active Site of the Thermus thermophilus 16S rRNA Methyltransferase KsgA in a Binary Complex with 5'-Methylthioadenosine

    SciTech Connect

    Demirci, H.; Belardinelli, R; Seri, E; Gregory, S; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    Posttranscriptional modification of ribosomal RNA (rRNA) occurs in all kingdoms of life. The S-adenosyl-l-methionine-dependent methyltransferase KsgA introduces the most highly conserved rRNA modification, the dimethylation of A1518 and A1519 of 16S rRNA. Loss of this dimethylation confers resistance to the antibiotic kasugamycin. Here, we report biochemical studies and high-resolution crystal structures of KsgA from Thermus thermophilus. Methylation of 30S ribosomal subunits by T. thermophilus KsgA is more efficient at low concentrations of magnesium ions, suggesting that partially unfolded RNA is the preferred substrate. The overall structure is similar to that of other methyltransferases but contains an additional ?-helix in a novel N-terminal extension. Comparison of the apoenzyme with complex structures with 5?-methylthioadenosine or adenosine bound in the cofactor-binding site reveals novel features when compared with related enzymes. Several mobile loop regions that restrict access to the cofactor-binding site are observed. In addition, the orientation of residues in the substrate-binding site indicates that conformational changes are required for binding two adjacent residues of the substrate rRNA.

  4. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    SciTech Connect

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  5. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China.

    PubMed

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong

    2016-05-30

    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination. PMID:27139028

  6. Persistent spread of the rmtB 16S rRNA methyltransferase gene among Escherichia coli isolates from diseased food-producing animals in China.

    PubMed

    Xia, Jing; Sun, Jian; Cheng, Ke; Li, Liang; Fang, Liang-Xing; Zou, Meng-Ting; Liao, Xiao-Ping; Liu, Ya-Hong

    2016-05-30

    A total of 963 non-duplicate Escherichia coli strains isolated from food-producing animals between 2002 and 2012 were screened for the presence of the 16S rRNA methyltransferase genes. Among the positive isolates, resistance determinants to extended spectrum β-lactamases, plasmid-mediated quinolone resistance genes as well as floR and fosA/A3/C2 were detected using PCR analysis. These isolates were further subjected to antimicrobial susceptibility testing, molecular typing, PCR-based plasmid replicon typing and plasmid analysis. Of the 963 E. coli isolates, 173 (18.0%), 3 (0.3%) and 2 (0.2%) were rmtB-, armA- and rmtE-positive strains, respectively. All the 16S rRNA methyltransferase gene-positive isolates were multidrug resistant and over 90% of them carried one or more type of resistance gene. IncF (especially IncFII) and non-typeable plasmids played the main role in the dissemination of rmtB, followed by the IncN plasmids. Plasmids that harbored rmtB ranged in size from 20kb to 340kb EcoRI-RFLP testing of the 109 rmtB-positive plasmids from different years and different origins suggested that horizontal (among diverse animals) and vertical transfer of IncF, non-typeable and IncN-type plasmids were responsible for the spread of rmtB gene. In summary, our findings highlight that rmtB was the most prevalent 16S rRNA methyltransferase gene, which present persistent spread in food-producing animals in China and a diverse group of plasmids was responsible for rmtB dissemination.

  7. Evidence for an early gene duplication event in the evolution of the mitochondrial transcription factor B family and maintenance of rRNA methyltransferase activity in human mtTFB1 and mtTFB2.

    PubMed

    Cotney, Justin; Shadel, Gerald S

    2006-11-01

    Most metazoans have two nuclear genes encoding orthologues of the well-characterized Saccharomyces cerevisiae mitochondrial transcription factor B (sc-mtTFB). This class of transcription factors is homologous to the bacterial KsgA family of rRNA methyltransferases, which in Escherichia coli dimethylates adjacent adenine residues in a stem-loop of the 16S rRNA. This posttranscriptional modification is conserved in most metazoan cytoplasmic and mitochondrial rRNAs. Homo sapiens mitochondrial transcription factor B1 (h-mtTFB1) possesses this enzymatic activity, implicating it as a dual-function protein involved in mitochondrial transcription and translation. Here we demonstrate that h-mtTFB2 also has rRNA methyltransferase activity but is a less efficient enzyme than h-mtTFB1. In contrast, sc-mtTFB has no detectable rRNA methyltransferase activity, correlating with the lack of the corresponding modification in the mitochondrial rRNA of budding yeast. Based on these results, and reports that Drosophila melanogaster mtTFB1 and mtTFB2 do not have completely overlapping functions, we propose a model for human mtDNA regulation that takes into account h-mtTFB1 and h-mtTFB2 likely having partially redundant transcription factor and rRNA methyltransferase functions. Finally, phylogenetic analyses of this family of proteins strongly suggest that the presence of two mtTFB homologues in metazoans is the result of a gene duplication event that occurred early in eukaryotic evolution prior to the divergence of fungi and metazoans. This model suggests that, after the gene duplication event, differential selective pressures on the rRNA methyltransferase and transcription factor activities of mtTFB genes occurred, with extreme cases culminating in the loss of one of the paralogous genes in certain species.

  8. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes.

    PubMed

    Bueno, Maria Fernanda C; Francisco, Gabriela R; de Oliveira Garcia, Doroti; Doi, Yohei

    2016-01-04

    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6')-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles.

  9. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes

    PubMed Central

    Bueno, Maria Fernanda C.; Francisco, Gabriela R.; de Oliveira Garcia, Doroti

    2016-01-01

    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6′)-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles. PMID:26729503

  10. Molecular Characterization of an rsmD-Like rRNA Methyltransferase from the Wolbachia Endosymbiont of Brugia malayi and Antifilarial Activity of Specific Inhibitors of the Enzyme

    PubMed Central

    Rana, Ajay Kumar; Chandra, Sharat; Siddiqi, Mohammad Imran

    2013-01-01

    The endosymbiotic organism Wolbachia is an attractive antifilarial drug target. Here we report on the cloning and expression of an rsmD-like rRNA methyltransferase from the Wolbachia endosymbiont of Brugia malayi, its molecular properties, and assays for specific inhibitors. The gene was found to be expressed in all the major life stages of B. malayi. The purified enzyme expressed in Escherichia coli was found to be in monomer form in its native state. The activities of the specific inhibitors (heteroaryl compounds) against the enzyme were tested with B. malayi adult and microfilariae for 7 days in vitro at various concentrations, and NSC-659390 proved to be the most potent compound (50% inhibitory concentration [IC50], 0.32 μM), followed by NSC-658343 (IC50, 4.13 μM) and NSC-657589 (IC50, 7.5 μM). On intraperitoneal administration at 5 mg/kg of body weight for 7 days to adult jirds into which B. malayi had been transplanted intraperitoneally, all the compounds killed a significant proportion of the implanted worms. A very similar result was observed in infected mastomys when inhibitors were administered. Docking studies of enzyme and inhibitors and an in vitro tryptophan quenching experiment were also performed to understand the binding mode and affinity. The specific inhibitors of the enzyme showed a higher affinity for the catalytic site of the enzyme than the nonspecific inhibitors and were found to be potent enough to kill the worm (both adults and microfilariae) in vitro as well as in vivo in a matter of days at micromolar concentrations. The findings suggest that these compounds be evaluated against other pathogens possessing a methyltransferase with a DPPY motif and warrant the design and synthesis of more such inhibitors. PMID:23733469

  11. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    PubMed Central

    Almutairi, Mashal M.; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A.; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H.; Mankin, Alexander S.

    2015-01-01

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism. PMID:26438831

  12. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    PubMed

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  13. Elucidation of separate, but collaborative functions of the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 in mitochondrial biogenesis reveals new insight into maternally inherited deafness.

    PubMed

    Cotney, Justin; McKay, Sharen E; Shadel, Gerald S

    2009-07-15

    Mitochondrial biogenesis is controlled by signaling networks that relay information to and from the organelles. However, key mitochondrial factors that mediate such pathways and how they contribute to human disease are not understood fully. Here we demonstrate that the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 are key downstream effectors of mitochondrial biogenesis that perform unique, yet cooperative functions. The primary function of h-mtTFB2 is mtDNA transcription and maintenance, which is independent of its rRNA methyltransferase activity, while that of h-mtTFB1 is mitochondrial 12S rRNA methylation needed for normal mitochondrial translation, metabolism and cell growth. Over-expression of h-mtTFB1 causes 12S rRNA hypermethylation, aberrant mitochondrial biogenesis and increased sorbitol-induced cell death. These phenotypes are recapitulated in cells harboring the pathogenic A1555G mtDNA mutation, implicating a deleterious rRNA methylation-dependent retrograde signal in maternally inherited deafness pathology and shedding significant insight into how h-mtTFB1 acts as a nuclear modifier of this disease.

  14. Elucidation of separate, but collaborative functions of the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 in mitochondrial biogenesis reveals new insight into maternally inherited deafness

    PubMed Central

    Cotney, Justin; McKay, Sharen E.; Shadel, Gerald S.

    2009-01-01

    Mitochondrial biogenesis is controlled by signaling networks that relay information to and from the organelles. However, key mitochondrial factors that mediate such pathways and how they contribute to human disease are not understood fully. Here we demonstrate that the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 are key downstream effectors of mitochondrial biogenesis that perform unique, yet cooperative functions. The primary function of h-mtTFB2 is mtDNA transcription and maintenance, which is independent of its rRNA methyltransferase activity, while that of h-mtTFB1 is mitochondrial 12S rRNA methylation needed for normal mitochondrial translation, metabolism and cell growth. Over-expression of h-mtTFB1 causes 12S rRNA hypermethylation, aberrant mitochondrial biogenesis and increased sorbitol-induced cell death. These phenotypes are recapitulated in cells harboring the pathogenic A1555G mtDNA mutation, implicating a deleterious rRNA methylation-dependent retrograde signal in maternally inherited deafness pathology and shedding significant insight into how h-mtTFB1 acts as a nuclear modifier of this disease. PMID:19417006

  15. Structural basis for the methylation of A1408 in 16S rRNA by a panaminoglycoside resistance methyltransferase NpmA from a clinical isolate and analysis of the NpmA interactions with the 30S ribosomal subunit

    PubMed Central

    Husain, Nilofer; Obranić, Sonja; Koscinski, Lukasz; Seetharaman, J.; Babić, Fedora; Bujnicki, Janusz M.; Maravić-Vlahoviček, Gordana; Sivaraman, J.

    2011-01-01

    NpmA, a methyltransferase that confers resistance to aminoglycosides was identified in an Escherichia coli clinical isolate. It belongs to the kanamycin–apramycin methyltransferase (Kam) family and specifically methylates the 16S rRNA at the N1 position of A1408. We determined the structures of apo-NpmA and its complexes with S-adenosylmethionine (AdoMet) and S-adenosylhomocysteine (AdoHcy) at 2.4, 2.7 and 1.68 Å, respectively. We generated a number of NpmA variants with alanine substitutions and studied their ability to bind the cofactor, to methylate A1408 in the 30S subunit, and to confer resistance to kanamycin in vivo. Residues D30, W107 and W197 were found to be essential. We have also analyzed the interactions between NpmA and the 30S subunit by footprinting experiments and computational docking. Helices 24, 42 and 44 were found to be the main NpmA-binding site. Both experimental and theoretical analyses suggest that NpmA flips out the target nucleotide A1408 to carry out the methylation. NpmA is plasmid-encoded and can be transferred between pathogenic bacteria; therefore it poses a threat to the successful use of aminoglycosides in clinical practice. The results presented here will assist in the development of specific NpmA inhibitors that could restore the potential of aminoglycoside antibiotics. PMID:21062819

  16. Insights into the catalytic mechanism of 16S rRNA methyltransferase RsmE (m³U1498) from crystal and solution structures.

    PubMed

    Zhang, Heng; Wan, Hua; Gao, Zeng-Qiang; Wei, Yong; Wang, Wen-Jia; Liu, Guang-Feng; Shtykova, Eleonora V; Xu, Jian-Hua; Dong, Yu-Hui

    2012-11-01

    RsmE is the founding member of a new RNA methyltransferase (MTase) family responsible for methylation of U1498 in 16S ribosomal RNA in Escherichia coli. It is well conserved across bacteria and plants and may play an important role in ribosomal intersubunit communication. The crystal structure in monomer showed that it consists of two distinct but structurally related domains: the PUA (pseudouridine synthases and archaeosine-specific transglycosylases)-like RNA recognition and binding domain and the conserved MTase domain with a deep trefoil knot. Analysis of small-angle X-ray scattering data revealed that RsmE forms a flexible dimeric conformation that may be essential for substrate binding. The S-adenosyl-l-methionine (AdoMet)-binding characteristic determined by isothermal titration calorimetry suggested that there is only one AdoMet molecule bound in the subunit of the homodimer. In vitro methylation assay of the mutants based on the RsmE-AdoMet-uridylic acid complex model showed key residues involved in substrate binding and catalysis. Comprehensive comparisons of RsmE with closely related MTases, combined with the biochemical experiments, indicated that the MTase domain of one subunit in dimeric RsmE is responsible for binding of one AdoMet molecule and catalytic process while the PUA-like domain in the other subunit is mainly responsible for recognition of one substrate molecule (the ribosomal RNA fragment and ribosomal protein complex). The methylation process is required by collaboration of both subunits, and dimerization is functionally critical for catalysis. In general, our study provides new information on the structure-function relationship of RsmE and thereby suggests a novel catalytic mechanism.

  17. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    SciTech Connect

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin . E-mail: min-xin.guan@chmcc.org

    2006-04-21

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations.

  18. Synthesis of Lysine Methyltransferase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ye, Tao; Hui, Chunngai

    2015-07-01

    Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.

  19. Synthesis of lysine methyltransferase inhibitors

    PubMed Central

    Hui, Chunngai; Ye, Tao

    2015-01-01

    Lysine methyltransferase which catalyze methylation of histone and non-histone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery. PMID:26258118

  20. Heterologous Expression and Functional Characterization of the Exogenously Acquired Aminoglycoside Resistance Methyltransferases RmtD, RmtD2, and RmtG

    PubMed Central

    Corrêa, Laís L.; Witek, Marta A.; Zelinskaya, Natalia; Picão, Renata C.

    2015-01-01

    The exogenously acquired 16S rRNA methyltransferases RmtD, RmtD2, and RmtG were cloned and heterologously expressed in Escherichia coli, and the recombinant proteins were purified to near homogeneity. Each methyltransferase conferred an aminoglycoside resistance profile consistent with m7G1405 modification, and this activity was confirmed by in vitro 30S methylation assays. Analyses of protein structure and interaction with S-adenosyl-l-methionine suggest that the molecular mechanisms of substrate recognition and catalysis are conserved across the 16S rRNA (m7G1405) methyltransferase family. PMID:26552988

  1. The crystal structure of a novel SAM-dependent methyltransferase PH1915 from Pyrococcus horikoshii.

    SciTech Connect

    Sun, W.; Xu, X.; Pavlova, M.; Edwards, A.; Joachimiak, A.; Savchenko, A.; Christendat, D.; Biosciences Division; Univ. of Toronto; Univ. Health Network

    2005-01-01

    The S-adenosyl-L-methionine (SAM)-dependent methyltransferases represent a diverse and biologically important class of enzymes. These enzymes utilize the ubiquitous methyl donor SAM as a cofactor to methylate proteins, small molecules, lipids, and nucleic acids. Here we present the crystal structure of PH1915 from Pyrococcus horikoshii OT3, a predicted SAM-dependent methyltransferase. This protein belongs to the Cluster of Orthologous Group 1092, and the presented crystal structure is the first representative structure of this protein family. Based on sequence and 3D structure analysis, we have made valuable functional insights that will facilitate further studies for characterizing this group of proteins. Specifically, we propose that PH1915 and its orthologs are rRNA- or tRNA-specific methyltransferases.

  2. Selective Inhibitors of Protein Methyltransferases

    PubMed Central

    2015-01-01

    Mounting evidence suggests that protein methyltransferases (PMTs), which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and human diseases. In particular, PMTs have been recognized as major players in regulating gene expression and chromatin state. PMTs are divided into two categories: protein lysine methyltransferases (PKMTs) and protein arginine methyltransferases (PRMTs). There has been a steadily growing interest in these enzymes as potential therapeutic targets and therefore discovery of PMT inhibitors has also been pursued increasingly over the past decade. Here, we present a perspective on selective, small-molecule inhibitors of PMTs with an emphasis on their discovery, characterization, and applicability as chemical tools for deciphering the target PMTs’ physiological functions and involvement in human diseases. We highlight the current state of PMT inhibitors and discuss future directions and opportunities for PMT inhibitor discovery. PMID:25406853

  3. The crystal structure of Nep1 reveals an extended SPOUT-class methyltransferase fold and a pre-organized SAM-binding site

    PubMed Central

    Taylor, Alexander B.; Meyer, Britta; Leal, Belinda Z.; Kötter, Peter; Schirf, Virgil; Demeler, Borries; Hart, P. John; Entian, Karl-Dieter; Wöhnert, Jens

    2008-01-01

    Ribosome biogenesis in eukaryotes requires the participation of a large number of ribosome assembly factors. The highly conserved eukaryotic nucleolar protein Nep1 has an essential but unknown function in 18S rRNA processing and ribosome biogenesis. In Saccharomyces cerevisiae the malfunction of a temperature-sensitive Nep1 protein (nep1-1ts) was suppressed by the addition of S-adenosylmethionine (SAM). This suggests the participation of Nep1 in a methyltransferase reaction during ribosome biogenesis. In addition, yeast Nep1 binds to a 6-nt RNA-binding motif also found in 18S rRNA and facilitates the incorporation of ribosomal protein Rps19 during the formation of pre-ribosomes. Here, we present the X-ray structure of the Nep1 homolog from the archaebacterium Methanocaldococcus jannaschii in its free form (2.2 Å resolution) and bound to the S-adenosylmethionine analog S-adenosylhomocysteine (SAH, 2.15 Å resolution) and the antibiotic and general methyltransferase inhibitor sinefungin (2.25 Å resolution). The structure reveals a fold which is very similar to the conserved core fold of the SPOUT-class methyltransferases but contains a novel extension of this common core fold. SAH and sinefungin bind to Nep1 at a preformed binding site that is topologically equivalent to the cofactor-binding site in other SPOUT-class methyltransferases. Therefore, our structures together with previous genetic data suggest that Nep1 is a genuine rRNA methyltransferase. PMID:18208838

  4. Bud23 methylates G1575 of 18S rRNA and is required for efficient nuclear export of pre-40S subunits.

    PubMed

    White, Joshua; Li, Zhihua; Sardana, Richa; Bujnicki, Janusz M; Marcotte, Edward M; Johnson, Arlen W

    2008-05-01

    BUD23 was identified from a bioinformatics analysis of Saccharomyces cerevisiae genes involved in ribosome biogenesis. Deletion of BUD23 leads to severely impaired growth, reduced levels of the small (40S) ribosomal subunit, and a block in processing 20S rRNA to 18S rRNA, a late step in 40S maturation. Bud23 belongs to the S-adenosylmethionine-dependent Rossmann-fold methyltransferase superfamily and is related to small-molecule methyltransferases. Nevertheless, we considered that Bud23 methylates rRNA. Methylation of G1575 is the only mapped modification for which the methylase has not been assigned. Here, we show that this modification is lost in bud23 mutants. The nuclear accumulation of the small-subunit reporters Rps2-green fluorescent protein (GFP) and Rps3-GFP, as well as the rRNA processing intermediate, the 5' internal transcribed spacer 1, indicate that bud23 mutants are defective for small-subunit export. Mutations in Bud23 that inactivated its methyltransferase activity complemented a bud23Delta mutant. In addition, mutant ribosomes in which G1575 was changed to adenosine supported growth comparable to that of cells with wild-type ribosomes. Thus, Bud23 protein, but not its methyltransferase activity, is important for biogenesis and export of the 40S subunit in yeast.

  5. Structural insight into the functional mechanism of Nep1/Emg1 N1-specific pseudouridine methyltransferase in ribosome biogenesis

    PubMed Central

    Thomas, Seth R.; Keller, Christopher A.; Szyk, Agnieszka; Cannon, Joe R.; LaRonde-LeBlanc, Nicole A.

    2011-01-01

    Nucleolar Essential Protein 1 (Nep1) is required for small subunit (SSU) ribosomal RNA (rRNA) maturation and is mutated in Bowen–Conradi Syndrome. Although yeast (Saccharomyces cerevisiae) Nep1 interacts with a consensus sequence found in three regions of SSU rRNA, the molecular details of the interaction are unknown. Nep1 is a SPOUT RNA methyltransferase, and can catalyze methylation at the N1 of pseudouridine. Nep1 is also involved in assembly of Rps19, an SSU ribosomal protein. Mutations in Nep1 that result in decreased methyl donor binding do not result in lethality, suggesting that enzymatic activity may not be required for function, and RNA binding may play a more important role. To study these interactions, the crystal structures of the scNep1 dimer and its complexes with RNA were determined. The results demonstrate that Nep1 recognizes its RNA site via base-specific interactions and stabilizes a stem-loop in the bound RNA. Furthermore, the RNA structure observed contradicts the predicted structures of the Nep1-binding sites within mature rRNA, suggesting that the Nep1 changes rRNA structure upon binding. Finally, a uridine base is bound in the active site of Nep1, positioned for a methyltransfer at the C5 position, supporting its role as an N1-specific pseudouridine methyltransferase. PMID:21087996

  6. Evolutionary and sequence-based relationships in bacterial AdoMet-dependent non-coding RNA methyltransferases

    PubMed Central

    2014-01-01

    Background RNA post-transcriptional modification is an exciting field of research that has evidenced this editing process as a sophisticated epigenetic mechanism to fine tune the ribosome function and to control gene expression. Although tRNA modifications seem to be more relevant for the ribosome function and cell physiology as a whole, some rRNA modifications have also been seen to play pivotal roles, essentially those located in central ribosome regions. RNA methylation at nucleobases and ribose moieties of nucleotides appear to frequently modulate its chemistry and structure. RNA methyltransferases comprise a superfamily of highly specialized enzymes that accomplish a wide variety of modifications. These enzymes exhibit a poor degree of sequence similarity in spite of using a common reaction cofactor and modifying the same substrate type. Results Relationships and lineages of RNA methyltransferases have been extensively discussed, but no consensus has been reached. To shed light on this topic, we performed amino acid and codon-based sequence analyses to determine phylogenetic relationships and molecular evolution. We found that most Class I RNA MTases are evolutionarily related to protein and cofactor/vitamin biosynthesis methyltransferases. Additionally, we found that at least nine lineages explain the diversity of RNA MTases. We evidenced that RNA methyltransferases have high content of polar and positively charged amino acid, which coincides with the electrochemistry of their substrates. Conclusions After studying almost 12,000 bacterial genomes and 2,000 patho-pangenomes, we revealed that molecular evolution of Class I methyltransferases matches the different rates of synonymous and non-synonymous substitutions along the coding region. Consequently, evolution on Class I methyltransferases selects against amino acid changes affecting the structure conformation. PMID:25012753

  7. Interethnic difference in thiopurine methyltransferase activity.

    PubMed

    Klemetsdal, B; Tollefsen, E; Loennechen, T; Johnsen, K; Utsi, E; Gisholt, K; Wist, E; Aarbakke, J

    1992-01-01

    A number of metabolic pathways are subject to both genetic polymorphism and interethnic differences. A catabolic pathway of 6-mercaptopurine, red blood cell (RBC) thiopurine methyltransferase (TPMT) activity showed genetic polymorphism in Caucasians, but variation according to ethnicity has not been studied. We investigated if red blood cell thiopurine methyltransferase was subject to interethnic variation in a Saami (Lappish; n = 36) and a Caucasian population (n = 50). The Saami population sample had 29% higher thiopurine methyltransferase activity, 17.0 +/- 3.3 U/ml red blood cell compared with the Caucasian population sample, 13.1 +/- 2.9 U/ml red blood cell (p much less than 0.001). Probit plots and frequency distribution histograms supported bimodality consistent with genetic polymorphism in both study populations. Differences in chronic diseases, drug consumption, age, or gender could not explain the interethnic difference in red blood cell thiopurine methyltransferase activity. The higher red blood cell thiopurine methyltransferase activity in the Saami population group indicates that these subjects may require higher dosages of thiopurine drugs than Caucasians.

  8. Genetic environment and stability of cfr in methicillin-resistant Staphylococcus aureus CM05.

    PubMed

    Locke, Jeffrey B; Rahawi, Shahad; Lamarre, Jacqueline; Mankin, Alexander S; Shaw, Karen Joy

    2012-01-01

    The Cfr methyltransferase confers resistance to many 50S ribosomal subunit-targeted antibiotics, including linezolid (LZD), via methylation of the 23S rRNA base A2503 in the peptidyl transferase center. Methicillin-resistant Staphylococcus aureus strain CM05 is the first clinical isolate documented to carry cfr. While cfr is typically plasmid borne, in CM05 it is located on the chromosome and is coexpressed with ermB as part of the mlr operon. Here we evaluated the chromosomal locus, association with mobile genetic elements, and stability of the cfr insertion region in CM05. The cfr-containing mlr operon is located within a 15.5-kb plasmid-like insertion into 23S rRNA allele 4. The region surrounding the cfr gene has a high degree of sequence similarity to the broad-host-range toxin/antitoxin multidrug resistance plasmid pSM19035, including a second ermB gene downstream of the mlr locus and istAS-istBS. Analysis of several individual CM05 colonies revealed two distinct populations for which LZD MICs were either 8 or 2 μg/ml. In the LZD(s) colonies (designated CM05Δ), a recombination event involving the two ermB genes had occurred, resulting in the deletion of cfr and the 3' flanking region (cfr-istAS-istBS-ermB). The fitness advantage of CM05Δ over CM05 (though not likely due to the cfr deletion itself) results in the predominance of CM05Δ in the absence of selective pressure. Minicircles resulting from the ermB recombination event and the novel association of cfr with the pSM19035 plasmid system support the potential for the continued dissemination of cfr.

  9. DNA methyltransferases and epigenetic regulation in bacteria.

    PubMed

    Adhikari, Satish; Curtis, Patrick D

    2016-09-01

    Epigenetics is a change in gene expression that is heritable without a change in DNA sequence itself. This phenomenon is well studied in eukaryotes, particularly in humans for its role in cellular differentiation, X chromosome inactivation and diseases like cancer. However, comparatively little is known about epigenetic regulation in bacteria. Bacterial epigenetics is mainly present in the form of DNA methylation where DNA methyltransferases add methyl groups to nucleotides. This review focuses on two methyltransferases well characterized for their roles in gene regulation: Dam and CcrM. Dam methyltransferase in Escherichia coli is important for expression of certain genes such as the pap operon, as well as other cellular processes like DNA replication initiation and DNA repair. In Caulobacter crescentus and other Alphaproteobacteria, the methyltransferase CcrM is cell cycle regulated and is involved in the cell-cycle-dependent regulation of several genes. The diversity of regulatory targets as well as regulatory mechanisms suggests that gene regulation by methylation could be a widespread and potent method of regulation in bacteria. PMID:27476077

  10. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  11. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  12. Chicken rRNA Gene Cluster Structure

    PubMed Central

    Dyomin, Alexander G.; Koshel, Elena I.; Kiselev, Artem M.; Saifitdinova, Alsu F.; Galkina, Svetlana A.; Fukagawa, Tatsuo; Kostareva, Anna A.

    2016-01-01

    Ribosomal RNA (rRNA) genes, whose activity results in nucleolus formation, constitute an extremely important part of genome. Despite the extensive exploration into avian genomes, no complete description of avian rRNA gene primary structure has been offered so far. We publish a complete chicken rRNA gene cluster sequence here, including 5’ETS (1836 bp), 18S rRNA gene (1823 bp), ITS1 (2530 bp), 5.8S rRNA gene (157 bp), ITS2 (733 bp), 28S rRNA gene (4441 bp) and 3’ETS (343 bp). The rRNA gene cluster sequence of 11863 bp was assembled from raw reads and deposited to GenBank under KT445934 accession number. The assembly was validated through in situ fluorescent hybridization analysis on chicken metaphase chromosomes using computed and synthesized specific probes, as well as through the reference assembly against de novo assembled rRNA gene cluster sequence using sequenced fragments of BAC-clone containing chicken NOR (nucleolus organizer region). The results have confirmed the chicken rRNA gene cluster validity. PMID:27299357

  13. COBALAMIN- AND COBAMIDE-DEPENDENT METHYLTRANSFERASES

    PubMed Central

    Matthews, Rowena G.; Koutmos, Markos; Datta, Supratim

    2008-01-01

    Methyltransferases that employ cobalamin cofactors, or their analogues the cobamides, as intermediates in catalysis of methyl transfer play vital roles in energy generation in anaerobic unicellular organisms. In a broader range of organisms they are involved in the conversion of homocysteine to methionine. Although the individual methyl transfer reactions catalyzed are simple SN2 displacements, the required change in coordination at the cobalt of the cobalamin or cobamide cofactors and the lability of the reduced Co+1 intermediates introduces the necessity for complex conformational changes during the catalytic cycle. Recent spectroscopic and structural studies on several of these methyltransferases have helped to reveal the strategies by which these conformational changes are facilitated and controlled. PMID:19059104

  14. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  15. Crystal Structure of Human DNA Methyltransferase 1.

    PubMed

    Zhang, Zhi-Min; Liu, Shuo; Lin, Krystal; Luo, Youfu; Perry, John Jefferson; Wang, Yinsheng; Song, Jikui

    2015-07-31

    DNMT1 (DNA methyltransferase 1) is responsible for propagating the DNA methylation patterns during DNA replication. DNMT1 contains, in addition to a C-terminal methyltransferase domain, a large N-terminal regulatory region that is composed of an RFTS (replication foci targeting sequence) domain, a CXXC zinc finger domain and a pair of BAH (bromo adjacent homology) domains. The regulatory domains of DNMT1 mediate a network of protein-protein and protein-DNA interactions to control the recruitment and enzymatic activity of DNMT1. Here we report the crystal structure of human DNMT1 with all the structural domains (hDNMT1, residues 351-1600) in complex with S-adenosyl-l-homocysteine at 2.62Å resolution. The RFTS domain directly associates with the methyltransferase domain, thereby inhibiting the substrate binding of hDNMT1. Through structural analysis, mutational, biochemical and enzymatic studies, we further identify that a linker sequence between the CXXC and BAH1 domains, aside from its role in the CXXC domain-mediated DNMT1 autoinhibition, serves as an important regulatory element in the RFTS domain-mediated autoinhibition. In comparison with the previously determined structure of mouse DNMT1, this study also reveals a number of distinct structural features that may underlie subtle functional diversity observed for the two orthologues. In addition, this structure provides a framework for understanding the functional consequence of disease-related hDNMT1 mutations.

  16. Synthesis and Assays of Inhibitors of Methyltransferases.

    PubMed

    Cai, X-C; Kapilashrami, K; Luo, M

    2016-01-01

    Epigenetic regulation requires site-specific modification of the genome and is involved in multiple physiological processes and disease etiology. Methyltransferases, which catalyze the transfer of a methyl group from S-adenosyl-l-methionine (SAM) to various substrates, are critical components of the epigenetic machinery. This group of enzymes can methylate diverse substrates including DNA, RNA, proteins, and small-molecule metabolites. Their dysregulation has also been implicated in multiple disease states such as cancer, neurological, and cardiovascular disorders. Developing potent and selective small-molecule inhibitors of methyltransferases is valuable not only for therapeutic intervention but also for investigating the roles of these enzymes in disease progression. In this chapter, we will discuss the strategies of designing and synthesizing methyltransferases inhibitors based on the SAM scaffold. Following the section of inhibitor design, we will briefly review representative assays that are available to evaluate the potency of these inhibitors along with a detailed description of the most commonly used radiometric assay. PMID:27423865

  17. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA.

    PubMed

    Mundus, Julie; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2499 reported. Using homology search, we identified the open reading frame DR_0049 as the primary candidate gene for the methyltransferase that modifies cytidine 2499. Mass spectrometric analysis demonstrated that recombinantly expressed DR0049 protein methylates E. coli cytidine 2499 both in vitro and in vivo. We also inactivated the DR_0049 gene in D. radiodurans through insertion of a chloramphenicol resistance cassette. This resulted in complete absence of the cytidine 2499 methylation, which all together demonstrates that DR_0049 encodes the methyltransferase producing m(5)C2499 in D. radiodurans 23S rRNA. Growth experiments disclosed that inactivation of DR_0049 is associated with a severe growth defect, but available ribosome structures show that cytidine 2499 is positioned very similar in D. radiodurans harbouring the modification and E. coli without the modification. Hence there is no obvious structure-based explanation for the requirement for the C2499 posttranscriptional modification in D. radiodurans.

  18. Overexpression of the mitochondrial methyltransferase TFB1M in the mouse does not impact mitoribosomal methylation status or hearing.

    PubMed

    Lee, Seungmin; Rose, Simon; Metodiev, Metodi D; Becker, Lore; Vernaleken, Alexandra; Klopstock, Thomas; Gailus-Durner, Valerie; Fuchs, Helmut; Hrabě De Angelis, Martin; Douthwaite, Stephen; Larsson, Nils-Göran

    2015-12-20

    Mitochondrial dysfunction is a well-established cause of sensorineural deafness, but the pathophysiological events are poorly understood. Non-syndromic deafness and predisposition to aminoglycoside-induced deafness can be caused by specific mutations in the 12S rRNA gene of mtDNA and are thus maternally inherited traits. The pathophysiology induced by mtDNA mutations has traditionally been attributed to deficient oxidative phosphorylation, which causes energy crisis with functional impairment of multiple cellular processes. In contrast, it was recently reported that signaling induced by 'hypermethylation' of two conserved adenosines of 12S rRNA in the mitoribosome is of key pathophysiological importance in sensorineural deafness. In support for this concept, it was reported that overexpression of the essential mitochondrial methyltransferase TFB1M in the mouse was sufficient to induce mitoribosomal hypermethylation and deafness. At variance with this model, we show here that 12S rRNA is near fully methylated in vivo in the mouse and thus cannot be further methylated to any significant extent. Furthermore, bacterial artificial chromosome transgenic mice overexpressing TFB1M have no increase of 12S rRNA methylation levels and hear normally. We thus conclude that therapies directed against mitoribosomal methylation are unlikely to be beneficial to patients with sensorineural hearing loss or other types of mitochondrial disease.

  19. Identification of methylated proteins in the yeast small ribosomal subunit: a role for SPOUT methyltransferases in protein arginine methylation.

    PubMed

    Young, Brian D; Weiss, David I; Zurita-Lopez, Cecilia I; Webb, Kristofor J; Clarke, Steven G; McBride, Anne E

    2012-06-26

    We have characterized the posttranslational methylation of Rps2, Rps3, and Rps27a, three small ribosomal subunit proteins in the yeast Saccharomyces cerevisiae, using mass spectrometry and amino acid analysis. We found that Rps2 is substoichiometrically modified at arginine-10 by the Rmt1 methyltransferase. We demonstrated that Rps3 is stoichiometrically modified by ω-monomethylation at arginine-146 by mass spectrometric and site-directed mutagenic analyses. Substitution of alanine for arginine at position 146 is associated with slow cell growth, suggesting that the amino acid identity at this site may influence ribosomal function and/or biogenesis. Analysis of the three-dimensional structure of Rps3 in S. cerevisiae shows that arginine-146 makes contacts with the small subunit rRNA. Screening of deletion mutants encoding potential yeast methyltransferases revealed that the loss of the YOR021C gene results in the absence of methylation of Rps3. We demonstrated that recombinant Yor021c catalyzes ω-monomethylarginine formation when incubated with S-adenosylmethionine and hypomethylated ribosomes prepared from a YOR021C deletion strain. Interestingly, Yor021c belongs to the family of SPOUT methyltransferases that, to date, have only been shown to modify RNA substrates. Our findings suggest a wider role for SPOUT methyltransferases in nature. Finally, we have demonstrated the presence of a stoichiometrically methylated cysteine residue at position 39 of Rps27a in a zinc-cysteine cluster. The discovery of these three novel sites of protein modification within the small ribosomal subunit will now allow for an analysis of their functional roles in translation and possibly other cellular processes.

  20. Characterization of prenylated protein methyltransferase in Leishmania.

    PubMed Central

    Hasne, M P; Lawrence, F

    1999-01-01

    Prenylated protein methyltransferase, an enzyme involved in the post-translational modification of many signalling proteins, has been characterized in a parasitic flagellated protozoan, Leishmania donovani. The activity of this enzyme was monitored by the methylation of an artificial substrate, an S-prenylated cysteine analogue, with S-adenosyl-l-[methyl-(3)H]methionine as methyl donor. More than 85% of the methyltransferase activity was associated with membranes. The enzyme methylates N-acetyl-S-trans, trans-farnesyl-l-cysteine and N-acetyl-S-all-trans-geranylgeranyl-l-cysteine, but N-acetyl-S-trans, trans-geranyl-l-cysteine only very weakly. In contrast with the enzyme from mammals, the leishmanial enzyme had a greater affinity for the farnesylated substrate than for the geranylgeranylated one. Activity in vitro was not modulated by cAMP, protein kinase C activator or guanosine 5'-[gamma-thio]triphosphate. An analysis of the endogenous substrates showed that the carboxymethylated proteins were also isoprenylated. The main carboxymethylated proteins have molecular masses of 95, 68, 55, 46, 34-23, 18 and less than 14 kDa. Treatment of cells with N-acetyl-S-trans,trans-farnesyl-l-cysteine decreased the carboxymethylation level, whereas treatment with guanosine 5'-[gamma-thio]triphosphate increased the carboxymethylation of various proteins, particularly those of molecular masses 30-20 kDa. PMID:10477261

  1. Mutational analysis of basic residues in the N-terminus of the rRNA:m6A methyltransferase ErmC'.

    PubMed

    Maravić, G; Bujnicki, J M; Flögel, M

    2004-01-01

    Erm methyltransferases mediate the resistance to the macrolide-lincosamide-streptogramin B antibiotics via dimethylation of a specific adenine residue in 23S rRNA. The role of positively charged N-terminal residues of the ErmC' methyltransferase in RNA binding and/or catalysis was determined. Mutational analysis of amino acids K4 and K7 was performed and the mutants were characterized in in vivo and in vitro experiments. The K4 and K7 residues were suggested not to be essential for the enzyme activity but to provide a considerable support for the catalytic step of the reaction, probably by maintaining the optimum conformation of the transition state through interactions with the phosphate backbone of RNA. PMID:15114858

  2. Mutational analysis of basic residues in the N-terminus of the rRNA:m6A methyltransferase ErmC'.

    PubMed

    Maravić, G; Bujnicki, J M; Flögel, M

    2004-01-01

    Erm methyltransferases mediate the resistance to the macrolide-lincosamide-streptogramin B antibiotics via dimethylation of a specific adenine residue in 23S rRNA. The role of positively charged N-terminal residues of the ErmC' methyltransferase in RNA binding and/or catalysis was determined. Mutational analysis of amino acids K4 and K7 was performed and the mutants were characterized in in vivo and in vitro experiments. The K4 and K7 residues were suggested not to be essential for the enzyme activity but to provide a considerable support for the catalytic step of the reaction, probably by maintaining the optimum conformation of the transition state through interactions with the phosphate backbone of RNA.

  3. Evolution of novel O-methyltransferases from the Vanilla planifolia caffeic acid O-methyltransferase.

    PubMed

    Li, Huaijun Michael; Rotter, David; Hartman, Thomas G; Pak, Fulya E; Havkin-Frenkel, Daphna; Belanger, Faith C

    2006-06-01

    The biosynthesis of many plant secondary compounds involves the methylation of one or more hydroxyl groups, catalyzed by O-methyltransferases (OMTs). Here, we report the characterization of two OMTs, Van OMT-2 and Van OMT-3, from the orchid Vanilla planifolia Andrews. These enzymes catalyze the methylation of a single outer hydroxyl group in substrates possessing a 1,2,3-trihydroxybenzene moiety, such as methyl gallate and myricetin. This is a substrate requirement not previously reported for any OMTs. Based on sequence analysis these enzymes are most similar to caffeic acid O-methyltransferases (COMTs), but they have negligible activity with typical COMT substrates. Seven of 12 conserved substrate-binding residues in COMTs are altered in Van OMT-2 and Van OMT-3. Phylogenetic analysis of the sequences suggests that Van OMT-2 and Van OMT-3 evolved from the V. planifolia COMT. These V. planifolia OMTs are new instances of COMT-like enzymes with novel substrate preferences.

  4. A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase.

    PubMed

    Ticak, Tomislav; Kountz, Duncan J; Girosky, Kimberly E; Krzycki, Joseph A; Ferguson, Donald J

    2014-10-28

    COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptors such as nitrate or fumarate, producing dimethylglycine and CO2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. In addition, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. They are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health.

  5. A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase

    PubMed Central

    Ticak, Tomislav; Kountz, Duncan J.; Girosky, Kimberly E.; Krzycki, Joseph A.; Ferguson, Donald J.

    2014-01-01

    COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptors such as nitrate or fumarate, producing dimethylglycine and CO2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. In addition, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. They are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health. PMID:25313086

  6. Structures of NS5 Methyltransferase from Zika Virus.

    PubMed

    Coloma, Javier; Jain, Rinku; Rajashankar, Kanagalaghatta R; García-Sastre, Adolfo; Aggarwal, Aneel K

    2016-09-20

    The Zika virus (ZIKV) poses a major public health emergency. To aid in the development of antivirals, we present two high-resolution crystal structures of the ZIKV NS5 methyltransferase: one bound to S-adenosylmethionine (SAM) and the other bound to SAM and 7-methyl guanosine diphosphate (7-MeGpp). We identify features of ZIKV NS5 methyltransferase that lend to structure-based antiviral drug discovery. Specifically, SAM analogs with functionalities on the Cβ atom of the methionine portion of the molecules that occupy the RNA binding tunnel may provide better specificity relative to human RNA methyltransferases.

  7. Structures of NS5 Methyltransferase from Zika Virus.

    PubMed

    Coloma, Javier; Jain, Rinku; Rajashankar, Kanagalaghatta R; García-Sastre, Adolfo; Aggarwal, Aneel K

    2016-09-20

    The Zika virus (ZIKV) poses a major public health emergency. To aid in the development of antivirals, we present two high-resolution crystal structures of the ZIKV NS5 methyltransferase: one bound to S-adenosylmethionine (SAM) and the other bound to SAM and 7-methyl guanosine diphosphate (7-MeGpp). We identify features of ZIKV NS5 methyltransferase that lend to structure-based antiviral drug discovery. Specifically, SAM analogs with functionalities on the Cβ atom of the methionine portion of the molecules that occupy the RNA binding tunnel may provide better specificity relative to human RNA methyltransferases. PMID:27633330

  8. Role of several histone lysine methyltransferases in tumor development

    PubMed Central

    LI, JIFU; ZHU, SHUNQIN; KE, XIAO-XUE; CUI, HONGJUAN

    2016-01-01

    The field of cancer epigenetics has been evolving rapidly in recent decades. Epigenetic mechanisms include DNA methylation, histone modifications and microRNAs. Histone modifications are important markers of function and chromatin state. Aberrant histone methylation frequently occurs in tumor development and progression. Multiple studies have identified that histone lysine methyltransferases regulate gene transcription through the methylation of histone, which affects cell proliferation and differentiation, cell migration and invasion, and other biological characteristics. Histones have variant lysine sites for different levels of methylation, catalyzed by different lysine methyltransferases, which have numerous effects on human cancers. The present review focused on the most recent advances, described the key function sites of histone lysine methyltransferases, integrated significant quantities of data to introduce several compelling histone lysine methyltransferases in various types of human cancers, summarized their role in tumor development and discussed their potential mechanisms of action. PMID:26998265

  9. Monolignol 4-O-methyltransferases and uses thereof

    SciTech Connect

    Liu, Chang-Jun; Bhuiya, Mohammad-Wadud; Zhang, Kewei

    2014-11-18

    Modified (iso)eugenol 4-O-methyltransferase enzymes having novel capacity for methylation of monolignols and reduction of lignin polymerization in plant cell wall are disclosed. Sequences encoding the modified enzymes are disclosed.

  10. Monomethylioarsenicals are substratres for human arsenic (+3 oxidation state) methyltransferase

    EPA Science Inventory

    Monomethylthioarsenicals are substrates for human arsenic (+3 oxida1tion state) methyltransferase Methylated thioarsenicals are structural analogs of methylated oxyarsenic in which one or more oxygen atom bound t...

  11. Biosynthesis of caffeine underlying the diversity of motif B' methyltransferase.

    PubMed

    Nakayama, Fumiyo; Mizuno, Kouichi; Kato, Misako

    2015-05-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are well-known purine alkaloids in Camellia, Coffea, Cola, Paullinia, Ilex, and Theobroma spp. The caffeine biosynthetic pathway depends on the substrate specificity of N-methyltransferases, which are members of the motif B' methyl-transferase family. The caffeine biosynthetic pathways in purine alkaloid-containing plants might have evolved in parallel with one another, consistent with different catalytic properties of the enzymes involved in these pathways. PMID:26058161

  12. Biosynthesis of caffeine underlying the diversity of motif B' methyltransferase.

    PubMed

    Nakayama, Fumiyo; Mizuno, Kouichi; Kato, Misako

    2015-05-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are well-known purine alkaloids in Camellia, Coffea, Cola, Paullinia, Ilex, and Theobroma spp. The caffeine biosynthetic pathway depends on the substrate specificity of N-methyltransferases, which are members of the motif B' methyl-transferase family. The caffeine biosynthetic pathways in purine alkaloid-containing plants might have evolved in parallel with one another, consistent with different catalytic properties of the enzymes involved in these pathways.

  13. Two distinct O-methyltransferases in aflatoxin biosynthesis.

    PubMed

    Yabe, K; Ando, Y; Hashimoto, J; Hamasaki, T

    1989-09-01

    The substances belonging to the sterigmatocystin group bear a close structural relationship to aflatoxins. When demethylsterigmatocystin (DMST) was fed to Aspergillus parasiticus NIAH-26, which endogenously produces neither aflatoxins nor precursors in YES medium, aflatoxins B1 and G1 were produced. When dihydrodemethylsterigmatocystin (DHDMST) was fed to this mutant, aflatoxins B2 and G2 were produced. Results of the cell-free experiment with S-adenosyl-[methyl-3H]methionine showed that first the C-6-OH groups of DMST and DHDMST are methylated to produce sterigmatocystin and dihydrosterigmatocystin (O-methyltransferase I) and then the C-7-OH groups are methylated to produce O-methylsterigmatocystin (OMST) and dihydro-O-methylsterigmatocystin (DHOMST) (O-methyltransferase II). However, no methyltransferase activity was observed when either OMST, DHOMST, 5,6-dimethoxysterigmatocystin, 5-methoxysterigmatocystin, or sterigmatin was incubated with the cell extract. Treatment of the cell extract with N-ethylmaleimide inhibited O-methyltransferase I activity but not that of O-methyltransferase II. Furthermore, these O-methyltransferases were different in their protein molecules and were involved in both the reactions from DMST to OMST and DHDMST to DHOMST. The reactions described in this paper were not observed when the same mold had been cultured in YEP medium.

  14. Functional characterization of a rice de novo DNA methyltransferase, OsDRM2, expressed in Escherichia coli and yeast

    SciTech Connect

    Pang, Jinsong; Dong, Mingyue; Li, Ning; Zhao, Yanli; Liu, Bao

    2013-03-01

    Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo and maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA

  15. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  16. Crystal structure of MboIIA methyltransferase.

    SciTech Connect

    Osipiuk, J.; Walsh, M. A.; Joachimiak, A.; Biosciences Division; Univ. of Gdansk; Medical Research Council France

    2003-09-15

    DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 {angstrom} resolution the crystal structure of a {beta}-class DNA MTase MboIIA (M {center_dot} MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M {center_dot} MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules in the asymmetric unit which we propose to resemble the dimer when M {center_dot} MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M {center_dot} RsrI. However, the cofactor-binding pocket in M {center_dot} MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.

  17. Isolation of DNA methyltransferase from plants

    SciTech Connect

    Ehrlich, K.; Malbroue, C.

    1987-05-01

    DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitable material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.

  18. DNA Methyltransferase Activity Assays: Advances and Challenges

    PubMed Central

    Poh, Wan Jun; Wee, Cayden Pang Pee; Gao, Zhiqiang

    2016-01-01

    DNA methyltransferases (MTases), a family of enzymes that catalyse the methylation of DNA, have a profound effect on gene regulation. A large body of evidence has indicated that DNA MTase is potentially a predictive biomarker closely associated with genetic disorders and genetic diseases like cancer. Given the attention bestowed onto DNA MTases in molecular biology and medicine, highly sensitive detection of DNA MTase activity is essential in determining gene regulation, epigenetic modification, clinical diagnosis and therapeutics. Conventional techniques such as isotope labelling are effective, but they often require laborious sample preparation, isotope labelling, sophisticated equipment and large amounts of DNA, rendering them unsuitable for uses at point-of-care. Simple, portable, highly sensitive and low-cost assays are urgently needed for DNA MTase activity screening. In most recent technological advances, many alternative DNA MTase activity assays such as fluorescent, electrochemical, colorimetric and chemiluminescent assays have been proposed. In addition, many of them are coupled with nanomaterials and/or enzymes to significantly enhance their sensitivity. Herein we review the progress in the development of DNA MTase activity assays with an emphasis on assay mechanism and performance with some discussion on challenges and perspectives. It is hoped that this article will provide a broad coverage of DNA MTase activity assays and their latest developments and open new perspectives toward the development of DNA MTase activity assays with much improved performance for uses in molecular biology and clinical practice. PMID:26909112

  19. DNA Methyltransferase Activity Assays: Advances and Challenges.

    PubMed

    Poh, Wan Jun; Wee, Cayden Pang Pee; Gao, Zhiqiang

    2016-01-01

    DNA methyltransferases (MTases), a family of enzymes that catalyse the methylation of DNA, have a profound effect on gene regulation. A large body of evidence has indicated that DNA MTase is potentially a predictive biomarker closely associated with genetic disorders and genetic diseases like cancer. Given the attention bestowed onto DNA MTases in molecular biology and medicine, highly sensitive detection of DNA MTase activity is essential in determining gene regulation, epigenetic modification, clinical diagnosis and therapeutics. Conventional techniques such as isotope labelling are effective, but they often require laborious sample preparation, isotope labelling, sophisticated equipment and large amounts of DNA, rendering them unsuitable for uses at point-of-care. Simple, portable, highly sensitive and low-cost assays are urgently needed for DNA MTase activity screening. In most recent technological advances, many alternative DNA MTase activity assays such as fluorescent, electrochemical, colorimetric and chemiluminescent assays have been proposed. In addition, many of them are coupled with nanomaterials and/or enzymes to significantly enhance their sensitivity. Herein we review the progress in the development of DNA MTase activity assays with an emphasis on assay mechanism and performance with some discussion on challenges and perspectives. It is hoped that this article will provide a broad coverage of DNA MTase activity assays and their latest developments and open new perspectives toward the development of DNA MTase activity assays with much improved performance for uses in molecular biology and clinical practice.

  20. Melatonin biosynthesis requires N-acetylserotonin methyltransferase activity of caffeic acid O-methyltransferase in rice

    PubMed Central

    Byeon, Yeong; Choi, Geun-Hee; Lee, Hyoung Yool; Back, Kyoungwhan

    2015-01-01

    Caffeic acid O-methyltransferase (COMT) methylates N-acetylserotonin into melatonin; that is, it has N-acetylserotonin O-methyltransferase (ASMT) activity. The ASMT activity of COMT was first detected in Arabidopsis thaliana COMT (AtCOMT). To confirm the involvement of COMT on melatonin synthesis in other plant species, the ASMT activity of a COMT from rice (Oryza sativa) (OsCOMT) was evaluated. Purified recombinant OsCOMT protein from Escherichia coli was used to validate the high ASMT activity of OsCOMT, similar to that of AtCOMT. The K m and V max values for the ASMT activity of OsCOMT were 243 µM and 2400 pmol min−1 mg protein−1, which were similar to those of AtCOMT. Similar to AtCOMT, OsCOMT was localized in the cytoplasm. In vitro ASMT activity was significantly inhibited by either caffeic acid or quercetin in a dose-dependent manner. Analogously, in vivo production of melatonin was significantly inhibited by quercetin in 4-week-old detached rice leaves. Lastly, the transgenic rice plants overexpressing rice COMT showed an increase in melatonin levels whereas transgenic rice plants suppressing the rice COMT had a significant decrease on melatonin levels, suggestive of the direct role of COMT in melatonin biosynthesis in plants. PMID:26276868

  1. Melatonin biosynthesis requires N-acetylserotonin methyltransferase activity of caffeic acid O-methyltransferase in rice.

    PubMed

    Byeon, Yeong; Choi, Geun-Hee; Lee, Hyoung Yool; Back, Kyoungwhan

    2015-11-01

    Caffeic acid O-methyltransferase (COMT) methylates N-acetylserotonin into melatonin; that is, it has N-acetylserotonin O-methyltransferase (ASMT) activity. The ASMT activity of COMT was first detected in Arabidopsis thaliana COMT (AtCOMT). To confirm the involvement of COMT on melatonin synthesis in other plant species, the ASMT activity of a COMT from rice (Oryza sativa) (OsCOMT) was evaluated. Purified recombinant OsCOMT protein from Escherichia coli was used to validate the high ASMT activity of OsCOMT, similar to that of AtCOMT. The K m and V max values for the ASMT activity of OsCOMT were 243 µM and 2400 pmol min(-1) mg protein(-1), which were similar to those of AtCOMT. Similar to AtCOMT, OsCOMT was localized in the cytoplasm. In vitro ASMT activity was significantly inhibited by either caffeic acid or quercetin in a dose-dependent manner. Analogously, in vivo production of melatonin was significantly inhibited by quercetin in 4-week-old detached rice leaves. Lastly, the transgenic rice plants overexpressing rice COMT showed an increase in melatonin levels whereas transgenic rice plants suppressing the rice COMT had a significant decrease on melatonin levels, suggestive of the direct role of COMT in melatonin biosynthesis in plants.

  2. Clostridium difficile Isolates with High Linezolid MICs Harbor the Multiresistance Gene cfr

    PubMed Central

    Martín, Adoración; Alcalá, Luis; Cercenado, Emilia; Iglesias, Cristina; Reigadas, Elena; Bouza, Emilio

    2014-01-01

    We studied the molecular mechanisms of linezolid resistance in 9 isolates of toxigenic Clostridium difficile with high linezolid MICs. The activity of linezolid was determined against 891 clinical isolates of toxigenic C. difficile. The MIC50 and MIC90 of linezolid were 0.75 μg/ml and 1.5 μg/ml, respectively. Nine strains (1%) showed high linezolid MICs (6 μg/ml to 16 μg/ml) and also were resistant to clindamycin, erythromycin, and chloramphenicol. These strains were selected for molecular studies: sequencing of domain V of the 23 rRNA gene, detection of the cfr methyltransferase gene, and sequencing of the ribosomal protein genes rplC and rplD. Molecular relatedness between strains was assessed using PCR ribotyping and MLVA (multilocus variable-number tandem-repeat analysis) typing. The strains belonged to ribotypes 001 (2/9), 017 (6/9), and 078 (1/9). MLVA showed that strains of ribotype 001 and 017 belonged to the same clonal complex in each ribotype. We did not detect mutations in the 23S rRNA gene. The cfr gene was detected in 7 of 9 strains. Sequencing of cfr amplicons revealed a similarity of 100% to a fragment of transposon Tn6218 of C. difficile, which was annotated as a putative chloramphenicol/florfenicol resistance protein. We were unable to detect mechanisms of resistance to linezolid in the 2 strains belonging to ribotype 001. While the relevance of our results lies in the detection of the cfr gene as a possible mechanism of resistance to linezolid in C. difficile, our findings should be assessed by further investigations to characterize these possible cfr genes and their contribution to linezolid resistance. PMID:25385106

  3. DNA Methyltransferases Inhibitors from Natural Sources.

    PubMed

    Zwergel, Clemens; Valente, Sergio; Mai, Antonello

    2016-01-01

    DNA methyltransferases (DNMTs) catalyze the methylation at cytosine-C5 mainly in a CpG dinucleotide context. Although DNA methylation is essential for fundamental processes like embryonic development or differentiation, aberrant expression and/or activities of DNMTs are involved in several pathologies, from neurodegeneration to cancer. DNMTs inhibition can arrest tumor growth, cells invasiveness and induce differentiation, whereas their increased expression is shown in numerous cancer types. Moreover, hypermethylated promoters of tumor suppressor genes lead to their silencing. Hence, the use of specific inhibitors of DNMT might reactivate those genes and stop or even reverse the aberrant cell processes. To date, the only approved DNMTs inhibitors for therapy belong to the nucleoside-based family of drugs, but they display relevant side effects as well as high chemical instability. Thus, there is a keen interest actually exists to develop novel, potent and safe inhibitors possessing a nonnucleoside structure. Increasing literature evidence is highlighting that natural sources could help the researchers to achieve this goal. Indeed, several polyphenols, flavonoids, antraquinones, and others are described able to inhibit DNMTs activity and/or expression, thus decreasing the methylation/silencing of different genes involved in tumorigenesis. These events can lead to re-expression of such genes and to cell death in diverse cancer cell lines. Epigallocatechin-3-gallate (1) and laccaic acid A (11) resulted the most effective DNMT1 inhibitors with submicromolar IC50 values, acting as competitive inhibitors. Compound 1 and 11 both displayed gene demethylation and re-activation in several cancers. However, all of the natural compounds described in this review showed important results, from gene reactivation to cell growth inhibition. Moreover, some of them displayed interesting activity even in rodent cancer models and very recently entered clinical trials. PMID:26303417

  4. Characterization of a multifunctional methyltransferase from the orchid Vanilla planifolia.

    PubMed

    Pak, F E; Gropper, S; Dai, W D; Havkin-Frenkel, D; Belanger, F C

    2004-07-01

    The final enzymatic step in the synthesis of the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) is believed to be methylation of 3,4-dihydroxybenzaldehyde. We have isolated and functionally characterized a cDNA that encodes a multifunctional methyltransferase from Vanilla planifolia tissue cultures that can catalyze the conversion of 3,4-dihydroxybenzaldehyde to vanillin, although 3,4-dihydroxybenzaldehyde is not the preferred substrate. The higher catalytic efficiency of the purified recombinant enzyme with the substrates caffeoyl aldehyde and 5-OH-coniferaldehyde, and its tissue distribution, suggest this methyltransferase may primarily function in lignin biosynthesis. However, since the enzyme characterized here does have 3,4-dihydroxybenzaldehyde-O-methyltransferase activity, it may be useful in engineering strategies for the synthesis of natural vanillin from alternate sources.

  5. Catalytic promiscuity of a bacterial α-N-methyltransferase

    PubMed Central

    Zhang, Qi; van der Donk, Wilfred A.

    2012-01-01

    The posttranslational methylation of N-terminal α-amino groups (α-N-methylation) is a ubiquitous reaction found in all domains of life. Although this modification usually occurs on protein substrates, recent studies have shown that it also takes place on ribosomally synthesized natural products. Here we report an investigation of the bacterial α-N-methyltransferase CypM involved in the biosynthesis of the peptide antibiotic cypemycin. We demonstrate that CypM has low substrate selectivity and methylates a variety of oligopeptides, cyclic peptides such as nisin and haloduracin, and the ε-amino group of lysine. Hence it may have potential for enzyme engineering and combinatorial biosynthesis. Bayesian phylogenetic inference of bacterial α-N-methyltransferases suggests that they have not evolved as a specific group based on the chemical transformations they catalyze, but that they have been acquired from various other methyltransferase classes during evolution. PMID:22841713

  6. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  7. Dietary Flavones as Dual Inhibitors of DNA Methyltransferases and Histone Methyltransferases

    PubMed Central

    Kanwal, Rajnee; Datt, Manish; Liu, Xiaoqi; Gupta, Sanjay

    2016-01-01

    Methylation of DNA and histone proteins are mutually involved in the epigenetic regulation of gene expression mediated by DNA methyltransferases (DNMTs) and histone methyltransferases (HMTs). DNMTs methylate cytosine residues within gene promoters, whereas HMTs catalyze the transfer of methyl groups to lysine and arginine residues of histone proteins, thus causing chromatin condensation and transcriptional repression, which play an important role in the pathogenesis of cancer. The potential reversibility of epigenetic alterations has encouraged the development of dual pharmacologic inhibitors of DNA and histone methylation as anticancer therapeutics. Dietary flavones can affect epigenetic modifications that accumulate over time and have shown anticancer properties, which are undefined. Through DNA binding and in silico protein-ligand docking studies with plant flavones viz. Apigenin, Chrysin and Luteolin, the effect of flavones on DNA and histone methylation was assessed. Spectroscopic analysis of flavones with calf-thymus DNA revealed intercalation as the dominant binding mode, with specific binding to a GC-rich sequence in the DNA duplex. A virtual screening approach using a model of the catalytic site of DNMT and EZH2 demonstrated that plant flavones are tethered at both ends inside the catalytic pocket of DNMT and EZH2 by means of hydrogen bonding. Epigenetic studies performed with flavones exhibited a decrease in DNMT enzyme activity and a reversal of the hypermethylation of cytosine bases in the DNA and prevented cytosine methylation in the GC-rich promoter sequence incubated with the M.SssI enzyme. Furthermore, a marked decrease in HMT activity and a decrease in EZH2 protein expression and trimethylation of H3K27 were noted in histones isolated from cancer cells treated with plant flavones. Our results suggest that dietary flavones can alter DNMT and HMT activities and the methylation of DNA and histone proteins that regulate epigenetic modifications, thus

  8. Cloning and expresion of cDNA for rat O6-methylguanine-DNA methyltransferase.

    PubMed

    Sakumi, K; Shiraishi, A; Hayakawa, H; Sekiguchi, M

    1991-10-25

    cDNA for O6-methylguanine-DNA methyltransferase was isolated by screening rat liver cDNA libraries, using as a probe the human cDNA sequence for methyltransferase. The rat cDNA encodes a protein with 209 amino acid residues. The predicted amino acid sequence of the rat methyltransferase exhibits considerable homology with those of the human, yeast and bacterial enzymes, especially around putative methyl acceptor sites. When the cDNA was placed under control of the lac promoter and expressed in methyltransferase-deficient Escherichia coli (ada-, ogt-) cells, a characteristic methyltransferase protein was produced. The rat DNA methyltransferase thus expressed could complement the biological defects of the E. coli cell caused by lack of its own DNA methyltransferases; e.g. increased sensitivity to alkylating agents in terms of both cell death and mutation induction.

  9. Characterization of DNA methyltransferase genes in Brassica rapa.

    PubMed

    Fujimoto, Ryo; Sasaki, Taku; Nishio, Takeshi

    2006-08-01

    DNA methylation is essential for normal development and plays important roles in regulating gene expression in plants. Analysis of the key enzymes catalyzing DNA methylation is important to understand epigenetic phenomena. In this study, three putative methyltransferase genes, BrMET1a, BrMET1b, and BrCMT, were isolated from a genome library of Brassica rapa. Structural conservation of the amino acid sequence between BrMET1a/BrMET1b and AtMET1 and that between BrCMT and AtCMT3 suggests that they may function as DNA methyltransferase. BrMET1a was expressed in vegetative and reproductive organs, while BrMET1b was expressed only in pistils, indicating that these two genes have different functions. BrCMT was expressed especially in stamens at the stage of 2-4 days before anthesis. We isolated three DNA methyltransferase genes in Brassica rapa and indicated differences of expression patterns of these DNA methyltransferase genes and expression levels in different tissues and developmental stages, suggesting that these genes might play important roles in epigenetic gene regulation in B. rapa.

  10. IDENTIFYING CRITICAL CYSTEINE RESIDUES IN ARSENIC (+3 OXIDATION STATE) METHYLTRANSFERASE

    EPA Science Inventory

    Arsenic (+3 oxidation state) methyltransferase (AS3MT) catalyzes methylation of inorganic arsenic to mono, di, and trimethylated arsenicals. Orthologous AS3MT genes in genomes ranging from simple echinoderm to human predict a protein with five conserved cysteine (C) residues. In ...

  11. Diversity in mechanism and function of tRNA methyltransferases

    PubMed Central

    Swinehart, William E; Jackman, Jane E

    2015-01-01

    tRNA molecules undergo extensive post-transcriptional processing to generate the mature functional tRNA species that are essential for translation in all organisms. These processing steps include the introduction of numerous specific chemical modifications to nucleotide bases and sugars; among these modifications, methylation reactions are by far the most abundant. The tRNA methyltransferases comprise a diverse enzyme superfamily, including members of multiple structural classes that appear to have arisen independently during evolution. Even among closely related family members, examples of unusual substrate specificity and chemistry have been observed. Here we review recent advances in tRNA methyltransferase mechanism and function with a particular emphasis on discoveries of alternative substrate specificities and chemistry associated with some methyltransferases. Although the molecular function for a specific tRNA methylation may not always be clear, mutations in tRNA methyltransferases have been increasingly associated with human disease. The impact of tRNA methylation on human biology is also discussed. PMID:25626150

  12. Convergent Mechanistic Features between the Structurally Diverse N- and O-Methyltransferases: Glycine N-Methyltransferase and Catechol O-Methyltransferase.

    PubMed

    Zhang, Jianyu; Klinman, Judith P

    2016-07-27

    Although an enormous and still growing number of biologically diverse methyltransferases have been reported and identified, a comprehensive understanding of the enzymatic methyl transfer mechanism is still lacking. Glycine N-methyltransferase (GNMT), a member of the family that acts on small metabolites as the substrate, catalyzes methyl transfer from S-adenosyl-l-methionine (AdoMet) to glycine to form S-adenosyl-l-homocysteine and sarcosine. We report primary carbon ((12)C/(14)C) and secondary ((1)H3/(3)H3) kinetic isotope effects at the transferred methyl group, together with (1)H3/(3)H3 binding isotope effects for wild-type GNMT and a series of Tyr21 mutants. The data implicate a compaction effect in the methyl transfer step that is conferred by the protein structure. Furthermore, a remarkable similarity of properties is observed between GNMT and catechol O-methyltransferase, despite significant differences between these enzymes with regard to their active site structures and catalyzed reactions. We attribute these results to a catalytically relevant reduction in the methyl donor-acceptor distance that is dependent on a tyrosine side chain positioned behind the methyl-bearing sulfur of AdoMet. PMID:27355841

  13. Structure and Function of Flavivirus NS5 Methyltransferase

    SciTech Connect

    Zhou,Y.; Ray, D.; Zhao, Y.; Dong, H.; Ren, S.; Li, Z.; Guo, Y.; Bernard, K.; Shi, P.; Li, H.

    2007-01-01

    The plus-strand RNA genome of flavivirus contains a 5' terminal cap 1 structure (m{sup 7}GpppAmG). The flaviviruses encode one methyltransferase, located at the N-terminal portion of the NS5 protein, to catalyze both guanine N-7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus methyltransferases from dengue, yellow fever, and West Nile virus (WNV) sequentially generate GpppA {yields} m{sup 7}GpppA {yields} m{sup 7}GpppAm. The 2'-O methylation can be uncoupled from the N-7 methylation, since m{sup 7}GpppA-RNA can be readily methylated to m{sup 7}GpppAm-RNA. Despite exhibiting two distinct methylation activities, the crystal structure of WNV methyltransferase at 2.8 {angstrom} resolution showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. Therefore, substrate GpppA-RNA should be repositioned to accept the N-7 and 2'-O methyl groups from SAM during the sequential reactions. Electrostatic analysis of the WNV methyltransferase structure showed that, adjacent to the SAM-binding pocket, is a highly positively charged surface that could serve as an RNA binding site during cap methylations. Biochemical and mutagenesis analyses show that the N-7 and 2'-O cap methylations require distinct buffer conditions and different side chains within the K{sub 61}-D{sub 146}-K{sub 182}-E{sub 218} motif, suggesting that the two reactions use different mechanisms. In the context of complete virus, defects in both methylations are lethal to WNV; however, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N-7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel target for flavivirus therapy.

  14. Engineering Monolignol 4-O-Methyltransferases to Modulate Lignin Biosynthesis

    SciTech Connect

    Bhuiya, M.W.; Liu, C.

    2010-01-01

    Lignin is a complex polymer derived from the oxidative coupling of three classical monolignols. Lignin precursors are methylated exclusively at the meta-positions (i.e. 3/5-OH) of their phenyl rings by native O-methyltransferases, and are precluded from substitution of the para-hydroxyl (4-OH) position. Ostensibly, the para-hydroxyls of phenolics are critically important for oxidative coupling of phenoxy radicals to form polymers. Therefore, creating a 4-O-methyltransferase to substitute the para-hydroxyl of monolignols might well interfere with the synthesis of lignin. The phylogeny of plant phenolic O-methyltransferases points to the existence of a batch of evolutionarily 'plastic' amino acid residues. Following one amino acid at a time path of directed evolution, and using the strategy of structure-based iterative site-saturation mutagenesis, we created a novel monolignol 4-O-methyltransferase from the enzyme responsible for methylating phenylpropenes. We show that two plastic residues in the active site of the parental enzyme are vital in dominating substrate discrimination. Mutations at either one of these separate the evolutionarily tightly linked properties of substrate specificity and regioselective methylation of native O-methyltransferase, thereby conferring the ability for para-methylation of the lignin monomeric precursors, primarily monolignols. Beneficial mutations at both sites have an additive effect. By further optimizing enzyme activity, we generated a triple mutant variant that may structurally constitute a novel phenolic substrate binding pocket, leading to its high binding affinity and catalytic efficiency on monolignols. The 4-O-methoxylation of monolignol efficiently impairs oxidative radical coupling in vitro, highlighting the potential for applying this novel enzyme in managing lignin polymerization in planta.

  15. A cluster of methylations in the domain IV of 25S rRNA is required for ribosome stability

    PubMed Central

    Gigova, Andriana; Duggimpudi, Sujitha; Pollex, Tim; Schaefer, Matthias

    2014-01-01

    In all three domains of life ribosomal RNAs are extensively modified at functionally important sites of the ribosome. These modifications are believed to fine-tune the ribosome structure for optimal translation. However, the precise mechanistic effect of modifications on ribosome function remains largely unknown. Here we show that a cluster of methylated nucleotides in domain IV of 25S rRNA is critical for integrity of the large ribosomal subunit. We identified the elusive cytosine-5 methyltransferase for C2278 in yeast as Rcm1 and found that a combined loss of cytosine-5 methylation at C2278 and ribose methylation at G2288 caused dramatic ribosome instability, resulting in loss of 60S ribosomal subunits. Structural and biochemical analyses revealed that this instability was caused by changes in the structure of 25S rRNA and a consequent loss of multiple ribosomal proteins from the large ribosomal subunit. Our data demonstrate that individual RNA modifications can strongly affect structure of large ribonucleoprotein complexes. PMID:25125595

  16. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly.

    PubMed

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-08-25

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2'-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2'-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  17. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly

    PubMed Central

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-01-01

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2′-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2′-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  18. The structure of the RNA m5C methyltransferase YebU from Escherichia coli reveals a C-terminal RNA-recruiting PUA domain.

    PubMed

    Hallberg, B Martin; Ericsson, Ulrika B; Johnson, Kenneth A; Andersen, Niels Møller; Douthwaite, Stephen; Nordlund, Pär; Beuscher, Albert E; Erlandsen, Heidi

    2006-07-21

    Nucleotide methylations are the most common type of rRNA modification in bacteria, and are introduced post-transcriptionally by a wide variety of site-specific enzymes. Three 5-methylcytidine (m(5)C) bases are found in the rRNAs of Escherichia coli and one of these, at nucleotide 1407 in 16 S rRNA, is the modification product of the methyltransferase (MTase) YebU (also called RsmF). YebU requires S-adenosyl-l-methionine (SAM) and methylates C1407 within assembled 30 S subunits, but not in naked 16 S rRNA or within tight-couple 70 S ribosomes. Here, we describe the three-dimensional structure of YebU determined by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including RsmB and PH1374. The C-terminal one-third of YebU contains a domain similar to that in pseudouridine synthases and archaeosine-specific transglycosylases (PUA-domain), which was not predicted by sequence alignments. Furthermore, YebU is predicted to contain extended regions of positive electrostatic potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU.

  19. Transfer RNA methyltransferases from yellow lupin seeds: purification and properties.

    PubMed Central

    Wierzbicka, H; Jakubowski, H; Pawelkiewicz

    1975-01-01

    tRNA methyltransferases from extract of yellow lupin seeds were purified over 300-fold by the methods based on hydrophobic and affinity chromatography. However, in the most active fractions the methylating enzymes were over 2000 purified. The purified enzyme fractions catalysed the formation of 1-methyladenine and 5-methylcytosine using E. coli B and B. subtilis tRNAs as substrates and S-adenosylmethionine as the methyl donor. They were unable to methylate their own endogenous tRNA but they were capable of methylating tRNA of some other lupinus species. Whereas the patterns of methylated constituents of tRNA of some other lupinus and B. subtilis were quite similar, they differed considerably from those obtained with lupin species tRNAs. Some properties of purified methyltransferases from yellow lupin seeds have been described. PMID:236549

  20. [Bioinformatics analysis and expressed level of histone methyltransferase genes in Lonicera japonica].

    PubMed

    Qi, Lin-jie; Yuan, Yuan; Huang, Lu-qi; Long, Ping; Zha, Liang-ping; Wang, Yao-long

    2015-06-01

    Twenty-three histone methyltransferase genes were obtained from transcriptome dataset of Lonicera japonica. The nucleotide and proteins characteristics, subcellular localization, senior structural domains and conservative forecasting were analyzed. The result of phylogenetic tree showed that 23 histone methyltransferases were mainly divided into two groups: lysine methyltransferase and arginine methyltransferases. The result of gene expression showed that 23 histone methyltransferases showed preference in terms of interspecies and organs. They were more expressed in buds of L. japonica than in L. japonica var. chinensis and lower in leaves of L. japonica than in L. japonica var. chinensis. Eight genes were specific expressed in flower. These results provided basis for further understanding the function of histone methyltransferase and epigenetic regulation of active ingredients of L. japonica. PMID:26552158

  1. Plant isoflavone and isoflavanone O-methyltransferase genes

    DOEpatents

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  2. An Arabidopsis thaliana methyltransferase Capable of Methylating Farnesoic Acid

    SciTech Connect

    Yang,Y.; Yuan, J.; Ross, J.; Noel, J.; Pichersky, E.

    2006-01-01

    We previously reported the identification of a new family of plant methyltransferases (MTs), named the SABATH family, that use S-adenosyl-l-methionine (SAM) to methylate a carboxyl moiety or a nitrogen-containing functional group on a diverse array of plant compounds. The Arabidopsis genome alone contains 24 distinct SABATH genes. To identify the catalytic specificities of members of this protein family in Arabidopsis, we screened recombinantly expressed and purified enzymes with a large number of potential substrates. Here, we report that the Arabidopsis thaliana gene At3g44860 encodes a protein with high catalytic specificity towards farnesoic acid (FA). Under steady-state conditions, this farnesoic acid carboxyl methyltransferase (FAMT) exhibits K{sub M} values of 41 and 71 {mu}M for FA and SAM, respectively. A three-dimensional model of FAMT constructed based upon similarity to the experimentally determined structure of Clarkia breweri salicylic acid methyltransferase (SAMT) suggests a reasonable model for FA recognition in the FAMT active site. In plants, the mRNA levels of At3g44860 increase in response to the exogenous addition of several compounds previously shown to induce plant defense responses at the transcriptional level. Although methyl farnesoate (MeFA) has not yet been detected in Arabidopsis, the presence of a FA-specific carboxyl methyltransferase in Arabidopsis capable of producing MeFA, an insect juvenile hormone made by some plants as a presumed defense against insect herbivory, suggests that MeFA or chemically similar compounds are likely to serve as new specialized metabolites in Arabidopsis.

  3. rmtD2, a New Allele of a 16S rRNA Methylase Gene, Has Been Present in Enterobacteriaceae Isolates from Argentina for More than a Decade ▿

    PubMed Central

    Tijet, Nathalie; Andres, Patricia; Chung, Catherine; Lucero, Celeste; Low, Donald E.; Galas, Marcelo; Corso, Alejandra; Petroni, Alejandro; Melano, Roberto G.

    2011-01-01

    The first allele of a 16S rRNA methyltransferase gene, rmtD2, conferring very high resistance to all clinically available aminoglycosides, was detected in 7/1,064 enterobacteria collected in 2007. rmtD2 was located on a conjugative plasmid in a Tn2670-like element inside a structure similar to that of rmtD1 but probably having an independent assembly. rmtD2 has been found since 1996 to 1998 mainly in Enterobacter and Citrobacter isolates, suggesting a possible reservoir in these genera. This presumption deserves monitoring by continuous surveillance. PMID:21078935

  4. Structural characterization of the mitomycin 7-O-methyltransferase

    SciTech Connect

    Singh, Shanteri; Chang, Aram; Goff, Randal D.; Bingman, Craig A.; Grüschow, Sabine; Sherman, David H.; Phillips, Jr., George N.; Thorson, Jon S.

    2014-10-02

    Mitomycins are quinone-containing antibiotics, widely used as antitumor drugs in chemotherapy. Mitomycin-7-O-methyltransferase (MmcR), a key tailoring enzyme involved in the biosynthesis of mitomycin in Streptomyces lavendulae, catalyzes the 7-O-methylation of both C9{beta}- and C9{alpha}-configured 7-hydroxymitomycins. We have determined the crystal structures of the MmcR-S-adenosylhomocysteine (SAH) binary complex and MmcR-SAH-mitomycin A (MMA) ternary complex at resolutions of 1.9 and 2.3 {angstrom}, respectively. The study revealed MmcR to adopt a common S-adenosyl-L-methionine-dependent O-methyltransferase fold and the presence of a structurally conserved active site general acid-base pair is consistent with a proton-assisted methyltransfer common to most methyltransferases. Given the importance of C7 alkylation to modulate mitomycin redox potential, this study may also present a template toward the future engineering of catalysts to generate uniquely bioactive mitomycins.

  5. Endothelial transcriptome in response to pharmacological methyltransferase inhibition.

    PubMed

    Okabe, Jun; Fernandez, Ana Z; Ziemann, Mark; Keating, Samuel T; Balcerczyk, Aneta; El-Osta, Assam

    2014-08-01

    The enzymatic activities of protein methyltransferases serve to write covalent modifications on histone and non-histone proteins in the control of gene transcription. Here, we describe gene expression changes in human endothelial cells caused by treatment with methyltransferase inhibitors 7,7'-carbonylbis (azanediyl) bis(4-hydroxynaphthalene-2 -sulfonic acid (AMI-1) and disodium-2-(2,4,5,7- tetrabromo-3-oxido-6-oxoxanthen-9-yl) benzoate trihydrate (AMI-5). Deep sequencing of mRNA indicated robust change on transcription following AMI-5 treatment compared with AMI-1. Functional annotation analysis revealed that both compounds suppress the expression of genes associated with translational regulation, suggesting arginine methylation by protein arginine methyltransferases (PRMTs) could be associated with regulation of this pathway. Interestingly, AMI-5 but not AMI-1 was found to decrease methylation of H3 histones at lysine 4 and down-regulate gene expression associated with interleukin-6 (IL-6) and activator protein-1 (AP-1) signaling pathways. These results imply that inhibition of protein methylation by AMI-1 and AMI-5 can differentially regulate specific pathways with potential to interrupt pathological signaling in the vascular endothelium. PMID:24850797

  6. Endothelial transcriptome in response to pharmacological methyltransferase inhibition.

    PubMed

    Okabe, Jun; Fernandez, Ana Z; Ziemann, Mark; Keating, Samuel T; Balcerczyk, Aneta; El-Osta, Assam

    2014-08-01

    The enzymatic activities of protein methyltransferases serve to write covalent modifications on histone and non-histone proteins in the control of gene transcription. Here, we describe gene expression changes in human endothelial cells caused by treatment with methyltransferase inhibitors 7,7'-carbonylbis (azanediyl) bis(4-hydroxynaphthalene-2 -sulfonic acid (AMI-1) and disodium-2-(2,4,5,7- tetrabromo-3-oxido-6-oxoxanthen-9-yl) benzoate trihydrate (AMI-5). Deep sequencing of mRNA indicated robust change on transcription following AMI-5 treatment compared with AMI-1. Functional annotation analysis revealed that both compounds suppress the expression of genes associated with translational regulation, suggesting arginine methylation by protein arginine methyltransferases (PRMTs) could be associated with regulation of this pathway. Interestingly, AMI-5 but not AMI-1 was found to decrease methylation of H3 histones at lysine 4 and down-regulate gene expression associated with interleukin-6 (IL-6) and activator protein-1 (AP-1) signaling pathways. These results imply that inhibition of protein methylation by AMI-1 and AMI-5 can differentially regulate specific pathways with potential to interrupt pathological signaling in the vascular endothelium.

  7. Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing.

    PubMed

    Falaleeva, Marina; Pages, Amadis; Matuszek, Zaneta; Hidmi, Sana; Agranat-Tamir, Lily; Korotkov, Konstantin; Nevo, Yuval; Eyras, Eduardo; Sperling, Ruth; Stamm, Stefan

    2016-03-22

    C/D box small nucleolar RNAs (SNORDs) are small noncoding RNAs, and their best-understood function is to target the methyltransferase fibrillarin to rRNA (for example, SNORD27 performs 2'-O-methylation of A27 in 18S rRNA). Unexpectedly, we found a subset of SNORDs, including SNORD27, in soluble nuclear extract made under native conditions, where fibrillarin was not detected, indicating that a fraction of the SNORD27 RNA likely forms a protein complex different from canonical snoRNAs found in the insoluble nuclear fraction. As part of this previously unidentified complex,SNORD27 regulates the alternative splicing of the transcription factor E2F7p re-mRNA through direct RNA-RNA interaction without methylating the RNA, likely by competing with U1 small nuclear ribonucleoprotein (snRNP). Furthermore, knockdown of SNORD27 activates previously "silent" exons in several other genes through base complementarity across the entire SNORD27 sequence, not just the antisense boxes. Thus, some SNORDs likely function in both rRNA and pre-mRNA processing, which increases the repertoire of splicing regulators and links both processes. PMID:26957605

  8. Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing

    PubMed Central

    Falaleeva, Marina; Pages, Amadis; Matuszek, Zaneta; Hidmi, Sana; Agranat-Tamir, Lily; Korotkov, Konstantin; Nevo, Yuval; Sperling, Ruth; Stamm, Stefan

    2016-01-01

    C/D box small nucleolar RNAs (SNORDs) are small noncoding RNAs, and their best-understood function is to target the methyltransferase fibrillarin to rRNA (for example, SNORD27 performs 2′-O-methylation of A27 in 18S rRNA). Unexpectedly, we found a subset of SNORDs, including SNORD27, in soluble nuclear extract made under native conditions, where fibrillarin was not detected, indicating that a fraction of the SNORD27 RNA likely forms a protein complex different from canonical snoRNAs found in the insoluble nuclear fraction. As part of this previously unidentified complex, SNORD27 regulates the alternative splicing of the transcription factor E2F7 pre-mRNA through direct RNA–RNA interaction without methylating the RNA, likely by competing with U1 small nuclear ribonucleoprotein (snRNP). Furthermore, knockdown of SNORD27 activates previously “silent” exons in several other genes through base complementarity across the entire SNORD27 sequence, not just the antisense boxes. Thus, some SNORDs likely function in both rRNA and pre-mRNA processing, which increases the repertoire of splicing regulators and links both processes. PMID:26957605

  9. Promoter of the Mycoplasma pneumoniae rRNA operon.

    PubMed Central

    Hyman, H C; Gafny, R; Glaser, G; Razin, S

    1988-01-01

    RNA transcripts starting from the 5' end of the single Mycoplasma pneumoniae rRNA operon were analyzed by several methods. By primer extension analysis a start site was found 62 nucleotides upstream from the start site of the 16S rRNA. This site was preceded by a putative Pribnow box; however, a defined -35 recognition region was absent. The cloned rRNA operon was transcribed in vitro by using purified RNA polymerase of Escherichia coli. A single start site could be demonstrated within a few nucleotides of the start site found by primer extension analysis of M. pneumoniae transcripts. When fragments from the cloned operon were used as hybridization probes, S1 nuclease mapping yielded a single transcript extending approximately 193 nucleotides upstream from the 16S rRNA start site. The region surrounding this endpoint did not resemble any known promoter sequence. Dot blot hybridization of M. pneumoniae RNA to three oligonucleotides consisting of nucleotides -5 to -21, -38 to -54, and -112 to -132 (from the start of the 16S rRNA gene) indicated that most rRNA transcripts were processed at the stem site preceding the 16S rRNA gene. The majority of the longer precursor transcripts, extending beyond this point, did not extend further upstream to an oligonucleotide consisting of nucleotides -112 to -132. It was concluded that transcription of the rRNA operon of M. pneumoniae is initiated by a single promoter. The nucleotide sequence of the region is presented. Images PMID:2838465

  10. Transferable Resistance to Aminoglycosides by Methylation of G1405 in 16S rRNA and to Hydrophilic Fluoroquinolones by QepA-Mediated Efflux in Escherichia coli▿

    PubMed Central

    Périchon, Bruno; Courvalin, Patrice; Galimand, Marc

    2007-01-01

    Plasmid pIP1206 was detected in Escherichia coli strain 1540 during the screening of clinical isolates of Enterobacteriaceae for high-level resistance to aminoglycosides. The sequence of this IncFI conjugative plasmid of ca. 100 kb was partially determined. pIP1206 carried the rmtB gene for a ribosome methyltransferase that was shown to modify the N7 position of nucleotide G1405, located in the A site of 16S rRNA. It also contained the qepA (quinolone efflux pump) gene that encodes a 14-transmembrane-segment putative efflux pump belonging to the major facilitator superfamily of proton-dependent transporters. Disruption of membrane proton potential by the efflux pump inhibitor carbonyl cyanide m-chlorophenylhydrazone in a transconjugant harboring the qepA gene resulted in elevation of norfloxacin accumulation. The transporter conferred resistance to the hydrophilic quinolones norfloxacin and ciprofloxacin. PMID:17470656

  11. Structural Biology of Human H3K9 Methyltransferases

    SciTech Connect

    Wu, H.; Min, J; Lunin, V; Antoshenko, T; Dombrovsk, L; Zeng, H; Allali-Hassani, A; Campagna-Slater, V; Vedadi, M; et. al.

    2010-01-01

    SET domain methyltransferases deposit methyl marks on specific histone tail lysine residues and play a major role in epigenetic regulation of gene transcription. We solved the structures of the catalytic domains of GLP, G9a, Suv39H2 and PRDM2, four of the eight known human H3K9 methyltransferases in their apo conformation or in complex with the methyl donating cofactor, and peptide substrates. We analyzed the structural determinants for methylation state specificity, and designed a G9a mutant able to tri-methylate H3K9. We show that the I-SET domain acts as a rigid docking platform, while induced-fit of the Post-SET domain is necessary to achieve a catalytically competent conformation. We also propose a model where long-range electrostatics bring enzyme and histone substrate together, while the presence of an arginine upstream of the target lysine is critical for binding and specificity. Post-translational modifications of histone proteins regulate chromatin compaction, mediate epigenetic regulation of transcription, and control cellular differentiation in health and disease. Methylation of histone tails is one of the fundamental events of epigenetic signaling. Tri-methylation of lysine 9 of histone 3 (H3K9) mediates chromatin recruitment of HP1, heterochromatin condensation and gene silencing. Similarly, methylation of H3K27 and H4K20 are associated with a repressed state of chromatin, whereas expressed genes are methylated at H3K4, H3K36 and H3K79. Histone methyltransferases are divided into protein arginine methyltransferases (PRMTs) and histone lysine methyltransferases (HKMTs). HKMTs catalyze the transfer of a methyl group from the co-factor S-adenosyl-L-methionine (SAM) to a substrate lysine and, with the exception of DOT1L, are all organized around a canonical SET domain. The structures of a number of HKMTs have been reported, including ternary complexes of human orthologs with co-factor and substrate peptides (SETD7-H3K4, SETD8-H4K20 and MLL1-H3K4), as well

  12. Conserved plant genes with similarity to mammalian de novo DNA methyltransferases

    PubMed Central

    Cao, Xiaofeng; Springer, Nathan M.; Muszynski, Michael G.; Phillips, Ronald L.; Kaeppler, Shawn; Jacobsen, Steven E.

    2000-01-01

    DNA methylation plays a critical role in controlling states of gene activity in most eukaryotic organisms, and it is essential for proper growth and development. Patterns of methylation are established by de novo methyltransferases and maintained by maintenance methyltransferase activities. The Dnmt3 family of de novo DNA methyltransferases has recently been characterized in animals. Here we describe DNA methyltransferase genes from both Arabidopsis and maize that show a high level of sequence similarity to Dnmt3, suggesting that they encode plant de novo methyltransferases. Relative to all known eukaryotic methyltransferases, these plant proteins contain a novel arrangement of the motifs required for DNA methyltransferase catalytic activity. The N termini of these methyltransferases contain a series of ubiquitin-associated (UBA) domains. UBA domains are found in several ubiquitin pathway proteins and in DNA repair enzymes such as Rad23, and they may be involved in ubiquitin binding. The presence of UBA domains provides a possible link between DNA methylation and ubiquitin/proteasome pathways. PMID:10781108

  13. Functional Identification of Triterpene Methyltransferases from Botryococcus braunii Race B*

    PubMed Central

    Niehaus, Tom D.; Kinison, Scott; Okada, Shigeru; Yeo, Yun-soo; Bell, Stephen A.; Cui, Ping; Devarenne, Timothy P.; Chappell, Joe

    2012-01-01

    Botryococcus braunii race B is a colony-forming, green algae that accumulates triterpene oils in excess of 30% of its dry weight. The composition of the triterpene oils is dominated by dimethylated to tetramethylated forms of botryococcene and squalene. Although unusual mechanisms for the biosynthesis of botryococcene and squalene were recently described, the enzyme(s) responsible for decorating these triterpene scaffolds with methyl substituents were unknown. A transcriptome of B. braunii was screened computationally assuming that the triterpene methyltransferases (TMTs) might resemble the S-adenosyl methionine-dependent enzymes described for methylating the side chain of sterols. Six sterol methyltransferase-like genes were isolated and functionally characterized. Three of these genes when co-expressed in yeast with complementary squalene synthase or botryococcene synthase expression cassettes resulted in the accumulation of mono- and dimethylated forms of both triterpene scaffolds. Surprisingly, TMT-1 and TMT-2 exhibited preference for squalene as the methyl acceptor substrate, whereas TMT-3 showed a striking preference for botryococcene as its methyl acceptor substrate. These in vivo preferences were confirmed with in vitro assays utilizing microsomal preparations from yeast overexpressing the respective genes, which encode for membrane-associated enzymes. Structural examination of the in vivo yeast generated mono- and dimethylated products by NMR identified terminal carbons, C-3 and C-22/C-20, as the atomic acceptor sites for the methyl additions to squalene and botryococcene, respectively. These sites are identical to those previously reported for the triterpenes extracted from the algae. The availability of closely related triterpene methyltransferases exhibiting distinct substrate selectivity and successive catalytic activities provides important tools for investigating the molecular mechanisms responsible for the specificities exhibited by these unique

  14. A SABATH Methyltransferase from the moss Physcomitrella patens catalyzes

    SciTech Connect

    Zhao, Nan; Ferrer, Jean-Luc; Moon, Hong S; Kapteyn, Jeremy; Zhuang, Xiaofeng; Hasebe, Mitsuyasu; Stewart, Neal C.; Gang, David R.; Chen, Feng

    2012-01-01

    Known SABATH methyltransferases, all of which were identified from seed plants, catalyze methylation of either the carboxyl group of a variety of low molecular weight metabolites or the nitrogen moiety of precursors of caffeine. In this study, the SABATH family from the bryophyte Physcomitrella patens was identified and characterized. Four SABATH-like sequences (PpSABATH1, PpSABATH2, PpSABATH3, and PpSABATH4) were identified from the P. patens genome. Only PpSABATH1 and PpSABATH2 showed expression in the leafy gametophyte of P. patens. Full-length cDNAs of PpSABATH1 and PpSABATH2 were cloned and expressed in soluble form in Escherichia coli. Recombinant PpSABATH1 and PpSABATH2 were tested for methyltransferase activity with a total of 75 compounds. While showing no activity with carboxylic acids or nitrogen-containing compounds, PpSABATH1 displayed methyltransferase activity with a number of thiols. PpSABATH2 did not show activity with any of the compounds tested. Among the thiols analyzed, PpSABATH1 showed the highest level of activity with thiobenzoic acid with an apparent Km value of 95.5 lM, which is comparable to those of known SABATHs. Using thiobenzoic acid as substrate, GC MS analysis indicated that the methylation catalyzed by PpSABATH1 is on the sulfur atom. The mechanism for S-methylation of thiols catalyzed by PpSABATH1 was partially revealed by homology-based structural modeling. The expression of PpSABATH1 was induced by the treatment of thiobenzoic acid. Further transgenic studies showed that tobacco plants overexpressing PpSABATH1 exhibited enhanced tolerance to thiobenzoic acid, suggesting that PpSABATH1 have a role in the detoxification of xenobiotic thiols.

  15. Multimethylation of Rickettsia OmpB Catalyzed by Lysine Methyltransferases*

    PubMed Central

    Abeykoon, Amila; Wang, Guanghui; Chao, Chien-Chung; Chock, P. Boon; Gucek, Marjan; Ching, Wei-Mei; Yang, David C. H.

    2014-01-01

    Methylation of rickettsial OmpB (outer membrane protein B) has been implicated in bacterial virulence. Rickettsial methyltransferases RP789 and RP027-028 are the first biochemically characterized methyltransferases to catalyze methylation of outer membrane protein (OMP). Methylation in OMP remains poorly understood. Using semiquantitative integrated liquid chromatography-tandem mass spectroscopy, we characterize methylation of (i) recombinantly expressed fragments of Rickettsia typhi OmpB exposed in vitro to trimethyltransferases of Rickettsia prowazekii RP027-028 and of R. typhi RT0101 and to monomethyltransferases of R. prowazekii RP789 and of R. typhi RT0776, and (ii) native OmpBs purified from R. typhi and R. prowazekii strains Breinl, RP22, and Madrid E. We found that in vitro trimethylation occurs at relatively specific locations in OmpB with consensus motifs, KX(G/A/V/I)N and KT(I/L/F), whereas monomethylation is pervasive throughout OmpB. Native OmpB from virulent R. typhi contains mono- and trimethyllysines at locations well correlated with methylation in recombinant OmpB catalyzed by methyltransferases in vitro. Native OmpBs from highly virulent R. prowazekii strains Breinl and RP22 contain multiple clusters of trimethyllysine in contrast to a single cluster in OmpB from mildly virulent R. typhi. Furthermore, OmpB from the avirulent strain Madrid E contains mostly monomethyllysine and no trimethyllysine. The native OmpB from Madrid E was minimally trimethylated by RT0101 or RP027-028, consistent with a processive mechanism of trimethylation. This study provides the first in-depth characterization of methylation of an OMP at the molecular level and may lead to uncovering the link between OmpB methylation and rickettsial virulence. PMID:24497633

  16. Characterization of Phenylpropene O-Methyltransferases from Sweet Basil

    PubMed Central

    Gang, David R.; Lavid, Noa; Zubieta, Chloe; Chen, Feng; Beuerle, Till; Lewinsohn, Efraim; Noel, Joseph P.; Pichersky, Eran

    2002-01-01

    Some basil varieties are able to convert the phenylpropenes chavicol and eugenol to methylchavicol and methyleugenol, respectively. Chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) cDNAs were isolated from the sweet basil variety EMX-1 using a biochemical genomics approach. These cDNAs encode proteins that are 90% identical to each other and very similar to several isoflavone O-methyltransferases such as IOMT, which catalyzes the 4′-O-methylation of 2,7,4′-trihydroxyisoflavanone. On the other hand, CVOMT1 and EOMT1 are related only distantly to (iso)eugenol OMT from Clarkia breweri, indicating that the eugenol O-methylating enzymes in basil and C. breweri evolved independently. Transcripts for CVOMT1 and EOMT1 were highly expressed in the peltate glandular trichomes on the surface of the young basil leaves. The CVOMT1 and EOMT1 cDNAs were expressed in Escherichia coli, and active proteins were produced. CVOMT1 catalyzed the O-methylation of chavicol, and EOMT1 also catalyzed the O-methylation of chavicol with equal efficiency to that of CVOMT1, but it was much more efficient in O-methylating eugenol. Molecular modeling, based on the crystal structure of IOMT, suggested that a single amino acid difference was responsible for the difference in substrate discrimination between CVOMT1 and EOMT1. This prediction was confirmed by site-directed mutagenesis, in which the appropriate mutants of CVOMT1 (F260S) and EOMT1 (S261F) were produced that exhibited the opposite substrate preference relative to the respective native enzyme. PMID:11884690

  17. Electrochemical strategy for sensing DNA methylation and DNA methyltransferase activity.

    PubMed

    Wang, Gang Lin; Zhou, Long Yin; Luo, Hong Qun; Li, Nian Bing

    2013-03-20

    The present work demonstrates a novel signal-off electrochemical method for the determination of DNA methylation and the assay of methyltransferase activity using the electroactive complex [Ru(NH3)6](3+) (RuHex) as a signal transducer. The assay exploits the electrostatic interactions between RuHex and DNA strands. Thiolated single strand DNA1 was firstly self-assembled on a gold electrode via Au-S bonding, followed by hybridization with single strand DNA2 to form double strand DNA containing specific recognition sequence of DNA adenine methylation MTase and methylation-responsive restriction endonuclease Dpn I. The double strand DNA may adsorb lots of electrochemical species ([Ru(NH3)6](3+)) via the electrostatic interaction, thus resulting in a high electrochemical signal. In the presence of DNA adenine methylation methyltransferase and S-adenosyl-l-methionine, the formed double strand DNA was methylated by DNA adenine methylation methyltransferase, then the double strand DNA can be cleaved by methylation-responsive restriction endonuclease Dpn I, leading to the dissociation of a large amount of signaling probes from the electrode. As a result, the adsorption amount of RuHex reduced, resulting in a decrease in electrochemical signal. Thus, a sensitive electrochemical method for detection of DNA methylation is proposed. The proposed method yielded a linear response to concentration of Dam MTase ranging from 0.25 to 10UmL(-1) with a detection limit of 0.18UmL(-1) (S/N=3), which might promise this method as a good candidate for monitoring DNA methylation in the future. PMID:23473252

  18. Do cholinephosphotransferase and phosphatidylethanolamine methyltransferase synthesize different species of phosphatidylcholine

    SciTech Connect

    Shin, S.H.; Moore, T.S.

    1986-04-01

    Two pathways exist for phosphatidylcholine (PC) synthesis in castor bean endosperm. The major pathway utilizes the reaction; (CDPcholine + diacylglycerol ..-->.. PC + CMP) while the other is through (PE + 3 S-Adenosylmethioninie ..-->.. PC + 3 homocysteine). The reason for two pathways is not clear. In an effort to determine if they produce two different products, radioactive precursors (SAM and CDPcholine) were administered to isolated endoplasmic reticulum from the castor bean endosperm. The products were extracted, chromatographed on TLC, and the PC classes separated by argentation chromatography. The radioactivity was determined by a RTLC Scanner. By these methods, it has been determined that there are differences between the PC products of the methyltransferase and the cholinephosphotransferase.

  19. Catalytic site remodelling of the DOT1L methyltransferase by selective inhibitors

    SciTech Connect

    Yu, Wenyu; Chory, Emma J.; Wernimont, Amy K.; Tempel, Wolfram; Scopton, Alex; Federation, Alexander; Marineau, Jason J.; Qi, Jun; Barsyte-Lovejoy, Dalia; Yi, Joanna; Marcellus, Richard; Iacob, Roxana E.; Engen, John R.; Griffin, Carly; Aman, Ahmed; Wienholds, Erno; Li, Fengling; Pineda, Javier; Estiu, Guillermina; Shatseva, Tatiana; Hajian, Taraneh; Al-awar, Rima; Dick, John E.; Vedadi, Masoud; Brown, Peter J.; Arrowsmith, Cheryl H.; Bradner, James E.; Schapira, Matthieu

    2012-12-18

    Selective inhibition of protein methyltransferases is a promising new approach to drug discovery. An attractive strategy towards this goal is the development of compounds that selectively inhibit binding of the cofactor, S-adenosylmethionine, within specific protein methyltransferases. Here we report the three-dimensional structure of the protein methyltransferase DOT1L bound toEPZ004777, the first S-adenosylmethionine-competitive inhibitor of a protein methyltransferase with in vivo efficacy. This structure and those of four new analogues reveal remodelling of the catalytic site. EPZ004777 and a brominated analogue, SGC0946, inhibit DOT1L in vitro and selectively kill mixed lineage leukaemia cells, in which DOT1L is aberrantly localized via interaction with an oncogenic MLL fusion protein. These data provide important new insight into mechanisms of cell-active S-adenosylmethionine-competitive protein methyltransferase inhibitors, and establish a foundation for the further development of drug-like inhibitors of DOT1L for cancer therapy.

  20. Electrochemical Assay for the Signal-on Detection of Human DNA Methyltransferase Activity

    PubMed Central

    Muren, Natalie B.; Barton, Jacqueline K.

    2013-01-01

    Strategies to detect human DNA methyltransferases are needed, given that aberrant methylation by these enzymes is associated with cancer initiation and progression. Here we describe a non-radioactive, antibody-free, electrochemical assay in which methyltransferase activity on DNA-modified electrodes confers protection from restriction for signal-on detection. We implement this assay with a multiplexed chip platform and show robust detection of both bacterial (SssI) and human (Dnmt1) methyltransferase activity. Essential to work with human methyltransferases, our unique assay design allows activity measurements on both unmethylated and hemimethylated DNA substrates. We validate this assay by comparison with a conventional radioactive method. The advantages of electrochemistry over radioactivity and fluorescence make this assay an accessible and promising new approach for the sensitive, label-free detection of human methyltransferase activity. PMID:24164112

  1. Phylogenomic analysis of 16S rRNA:(guanine-N2) methyltransferases suggests new family members and reveals highly conserved motifs and a domain structure similar to other nucleic acid amino-methyltransferases.

    PubMed

    Bujnicki, J M

    2000-11-01

    The sequences of known Escherichia coli 16S rRNA:m2G1207 methyltransferase (MTase) RsmC and hypothetical 16S rRNA:m2G966 MTase encoded by the ygjo open reading frame were used to carry out a database search of other putative m2G-generating enzymes in finished and unfinished genomic sequences. Sequence comparison and phylogenetic analysis of 21 close homologs of RsmC and YgjO revealed the presence of the third paralogous lineage in E. coli and other gamma-Proteobacteria, which might correspond to the subfamily of MTases specific for G1516 in 16S rRNA. In addition, the comparative sequence analysis supported by sequence/structure threading suggests that rRNA:m2G MTases are very closely related to RNA and DNA:m6A MTases and that these two enzyme families share common architecture of the active site and presumably a similar mechanism of methyl group transfer onto the exocyclic amino group of their target bases. PMID:11053259

  2. Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

    PubMed

    Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

    2015-01-01

    We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

  3. Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

    PubMed Central

    Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

    2015-01-01

    We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

  4. Dynamics and reactivity in Thermus aquaticus N6-adenine methyltransferase.

    PubMed

    Aranda, Juan; Zinovjev, Kirill; Roca, Maite; Tuñón, Iñaki

    2014-11-19

    M.TaqI is a DNA methyltransferase from Thermus aquaticus that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine to the N6 position of an adenine, a process described only in prokaryotes. We have used full atomistic classical molecular dynamics simulations to explore the protein-SAM-DNA ternary complex where the target adenine is flipped out into the active site. Key protein-DNA interactions established by the target adenine in the active site are described in detail. The relaxed structure was used for a combined quantum mechanics/molecular mechanics exploration of the reaction mechanism using the string method. According to our free energy calculations the reaction takes place through a stepwise mechanism where the methyl transfer precedes the abstraction of the proton from the exocyclic amino group. The methyl transfer is the rate-determining step, and the obtained free energy barrier is in good agreement with the value derived from the experimental rate constant. Two possible candidates to extract the leftover proton have been explored: a water molecule found in the active site and Asn105, a residue activated by the hydrogen bonds formed through the amide hydrogens. The barrier for the proton abstraction is smaller when Asn105 acts as a base. The reaction mechanisms can be different in other N6-DNA-methyltransferases, as determined from the exploration of the reaction mechanism in the Asn105Asp M.TaqI mutant. PMID:25347783

  5. Redox Control of Protein Arginine Methyltransferase 1 (PRMT1) Activity*

    PubMed Central

    Morales, Yalemi; Nitzel, Damon V.; Price, Owen M.; Gui, Shanying; Li, Jun; Qu, Jun; Hevel, Joan M.

    2015-01-01

    Elevated levels of asymmetric dimethylarginine (ADMA) correlate with risk factors for cardiovascular disease. ADMA is generated by the catabolism of proteins methylated on arginine residues by protein arginine methyltransferases (PRMTs) and is degraded by dimethylarginine dimethylaminohydrolase. Reports have shown that dimethylarginine dimethylaminohydrolase activity is down-regulated and PRMT1 protein expression is up-regulated under oxidative stress conditions, leading many to conclude that ADMA accumulation occurs via increased synthesis by PRMTs and decreased degradation. However, we now report that the methyltransferase activity of PRMT1, the major PRMT isoform in humans, is impaired under oxidative conditions. Oxidized PRMT1 displays decreased activity, which can be rescued by reduction. This oxidation event involves one or more cysteine residues that become oxidized to sulfenic acid (-SOH). We demonstrate a hydrogen peroxide concentration-dependent inhibition of PRMT1 activity that is readily reversed under physiological H2O2 concentrations. Our results challenge the unilateral view that increased PRMT1 expression necessarily results in increased ADMA synthesis and demonstrate that enzymatic activity can be regulated in a redox-sensitive manner. PMID:25911106

  6. Lipid substrate specificity of phosphatidylethanolamine N-methyltransferase of Tetrahymena

    SciTech Connect

    Smith, J.D.

    1986-05-01

    The ciliate protozoan Tetrahymena thermophila forms about 60% of its phosphatidylcholine by methylation of phosphatidylethanolamine with S-adenosylmethionine using the enzyme phosphatidylethanolamine N-methyltransferase. Analogues of ethanolamine or of ethanolamine phosphate are incorporated into the phospholipids of Tetrahymena when cells are cultured in their presence. These compounds, 3-amino-1-propanol, 2-aminoethylphosphonate, 3-aminopropylphosphonate and N,N-dimethylaminoethylphosphonate replace from 50 to 75% of the ethanolamine phosphate in phosphatidylethanolamine. However, analysis of the phospholipids of lipid-altered Tetrahymena showed that none of the phosphatidylethanolamine analogues had been converted to the corresponding phosphatidylcholine analogue. No incorration of (/sup 14/C-CH/sub 3/)methionine into the phosphatidylcholine analogues could be demonstrated in vivo, nor was label from (/sup 3/H-CH/sub 3/)S-adenosylmethionine incorporated in virto. Thus, only phosphatidylethanolamine and its monomethyl and dimethyl derivatives have been found to be substrates for the phosphatidylethanoiamine N-methyltransferase. The enzyme therefore requires a phospholipid substrate containing an ester linkage between the alkylamine and phosphorus, with the amino group required to be ..beta.. to the alcohol.

  7. An allosteric inhibitor of protein arginine methyltransferase 3.

    PubMed

    Siarheyeva, Alena; Senisterra, Guillermo; Allali-Hassani, Abdellah; Dong, Aiping; Dobrovetsky, Elena; Wasney, Gregory A; Chau, Irene; Marcellus, Richard; Hajian, Taraneh; Liu, Feng; Korboukh, Ilia; Smil, David; Bolshan, Yuri; Min, Jinrong; Wu, Hong; Zeng, Hong; Loppnau, Peter; Poda, Gennadiy; Griffin, Carly; Aman, Ahmed; Brown, Peter J; Jin, Jian; Al-Awar, Rima; Arrowsmith, Cheryl H; Schapira, Matthieu; Vedadi, Masoud

    2012-08-01

    PRMT3, a protein arginine methyltransferase, has been shown to influence ribosomal biosynthesis by catalyzing the dimethylation of the 40S ribosomal protein S2. Although PRMT3 has been reported to be a cytosolic protein, it has been shown to methylate histone H4 peptide (H4 1-24) in vitro. Here, we report the identification of a PRMT3 inhibitor (1-(benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-cyclohexenylethyl)urea; compound 1) with IC50 value of 2.5 μM by screening a library of 16,000 compounds using H4 (1-24) peptide as a substrate. The crystal structure of PRMT3 in complex with compound 1 as well as kinetic analysis reveals an allosteric mechanism of inhibition. Mutating PRMT3 residues within the allosteric site or using compound 1 analogs that disrupt interactions with allosteric site residues both abrogated binding and inhibitory activity. These data demonstrate an allosteric mechanism for inhibition of protein arginine methyltransferases, an emerging class of therapeutic targets.

  8. Diamidine Compounds for Selective Inhibition of Protein Arginine Methyltransferase 1

    PubMed Central

    2015-01-01

    Protein arginine methylation is a posttranslational modification critical for a variety of biological processes. Misregulation of protein arginine methyltransferases (PRMTs) has been linked to many pathological conditions. Most current PRMT inhibitors display limited specificity and selectivity, indiscriminately targeting many methyltransferase enzymes that use S-adenosyl-l-methionine as a cofactor. Here we report diamidine compounds for specific inhibition of PRMT1, the primary type I enzyme. Docking, molecular dynamics, and MM/PBSA analysis together with biochemical assays were conducted to understand the binding modes of these inhibitors and the molecular basis of selective inhibition for PRMT1. Our data suggest that 2,5-bis(4-amidinophenyl)furan (1, furamidine, DB75), one leading inhibitor, targets the enzyme active site and is primarily competitive with the substrate and noncompetitive toward the cofactor. Furthermore, cellular studies revealed that 1 is cell membrane permeable and effectively inhibits intracellular PRMT1 activity and blocks cell proliferation in leukemia cell lines with different genetic lesions. PMID:24564570

  9. Purification of phospholipid methyltransferase from rat liver microsomal fraction.

    PubMed Central

    Pajares, M A; Villalba, M; Mato, J M

    1986-01-01

    Phospholipid methyltransferase, the enzyme that converts phosphatidylethanolamine into phosphatidylcholine with S-adenosyl-L-methionine as the methyl donor, was purified to apparent homogeneity from rat liver microsomal fraction. When analysed by SDS/polyacrylamide-gel electrophoresis only one protein, with molecular mass about 50 kDa, is detected. This protein could be phosphorylated at a single site by incubation with [alpha-32P]ATP and the catalytic subunit of cyclic AMP-dependent protein kinase. A less-purified preparation of the enzyme is mainly composed of two proteins, with molecular masses about 50 kDa and 25 kDa, the 50 kDa form being phosphorylated at the same site as the homogeneous enzyme. After purification of both proteins by electro-elution, the 25 kDa protein forms a dimer and migrates on SDS/polyacrylamide-gel electrophoresis with molecular mass about 50 kDa. Peptide maps of purified 25 kDa and 50 kDa proteins are identical, indicating that both proteins are formed by the same polypeptide chain(s). It is concluded that rat liver phospholipid methyltransferase can exist in two forms, as a monomer of 25 kDa and as a dimer of 50 kDa. The dimer can be phosphorylated by cyclic AMP-dependent protein kinase. Images Fig. 3. Fig. 4. Fig. 6. PMID:3800912

  10. A Histone Methyltransferase ESET Is Critical for T Cell Development.

    PubMed

    Takikita, Shoichi; Muro, Ryunosuke; Takai, Toshiyuki; Otsubo, Takeshi; Kawamura, Yuki I; Dohi, Taeko; Oda, Hiroyo; Kitajima, Masayuki; Oshima, Kenshiro; Hattori, Masahira; Endo, Takaho A; Toyoda, Tetsuro; Weis, John; Shinkai, Yoichi; Suzuki, Harumi

    2016-09-15

    ESET/SETDB1, one of the major histone methyltransferases, catalyzes histone 3 lysine 9 (H3K9) trimethylation. ESET is critical for suppressing expression of retroviral elements in embryonic stem cells; however, its role in the immune system is not known. We found that thymocyte-specific deletion of ESET caused impaired T cell development, with CD8 lineage cells being most severely affected. Increased apoptosis of CD8 single-positive cells was observed, and TCR-induced ERK activation was severely inhibited in ESET(-/-) thymocytes. Genome-wide comprehensive analysis of mRNA expression and H3K9 trimethylation revealed that ESET regulates expression of numerous genes in thymocytes. Among them, FcγRIIB, whose signaling can inhibit ERK activation, was strongly and ectopically expressed in ESET(-/-) thymocytes. Indeed, genetic depletion of FcγRIIB in ESET(-/-) thymocytes rescued impaired ERK activation and partially restored defective positive selection in ESET(-/-) mice. Therefore, impaired T cell development in ESET(-/-) mice is partly due to the aberrant expression of FcγRIIB. Collectively, to our knowledge, we identify ESET as the first trimethylated H3K9 histone methyltransferase playing a crucial role in T cell development. PMID:27511731

  11. Detection of DNA methyltransferase activity using allosteric molecular beacons.

    PubMed

    Zhang, Weiting; Zu, Xiaolong; Song, Yanling; Zhu, Zhi; Yang, Chaoyong James

    2016-01-21

    Abnormal DNA methylation patterns caused by altered DNA methyltransferase (MTase) activity are closely associated with cancer. Herein, using DNA adenine methylation methyltransferase (Dam MTase) as a model analyte, we designed an allosteric molecular beacon (aMB) for sensitive detection of Dam MTase activity. When the specific site in an aMB is methylated by Dam MTase, the probe can be cut by the restriction nuclease DpnI to release a fluorophore labeled aptamer specific for streptavidin (SA) which will bind to SA beads to generate highly fluorescent beads for easy signal readout by a microscope or flow cytometer. However, aMBs maintain a hairpin structure without the binding ability to SA beads in the absence of Dam MTase, leading to weakly fluorescent SA beads. Unlike the existing signal amplified assays, our method is simpler and more convenient. The high performance of the aptamer and the easy bead separation process make this probe superior to other methods for the detection of MTase in complex biological systems. Overall, the proposed method with a detection limit of 0.57 U mL(-1) for Dam MTase shows great potential for further applications in the detection of other MTases, screening of MTase inhibitors, and early diagnosis of cancer.

  12. In Vitro Assay to Measure Phosphatidylethanolamine Methyltransferase Activity

    PubMed Central

    Zufferey, Rachel

    2016-01-01

    Phosphatidylethanolamine methyltransferases are biosynthetic enzymes that catalyze the transfer of one or more methyl group(s) from S-adenosyl-L-methionine onto phosphatidylethanolamine, monomethyl-phosphatidylethanolamine, or dimethyl-phosphatidylethanolamine to give either monomethyl-phosphatidylethanolamine, dimethyl-phosphatidylethanolamine or phosphatidylcholine. These enzymes are ubiquitous in animal cells, fungi, and are also found in approximately 10% of bacteria. They fulfill various important functions in cell physiology beyond their direct role in lipid metabolism such as in insulin resistance, diabetes, atherosclerosis, cell growth, or virulence. The present manuscript reports on a simple cell-free enzymatic assay that measures the transfer of tritiated methyl group(s) from S-[Methyl-3H]adenosyl-L-methionine onto phosphatidylethanolamine using whole cell extracts as an enzyme source. The resulting methylated forms of phosphatidylethanolamine are hydrophobic and thus, can be separated from water soluble S-[Methyl-3H]adenosyl-L-methionine by organic extraction. This assay can potentially be applied to any other cell types and used to test inhibitors/drugs specific to a phosphatidylethanolamine methyltransferase of interest without the need to purify the enzyme. PMID:26780155

  13. Experimental Approaches for Target Profiling of RNA Cytosine Methyltransferases.

    PubMed

    Khoddami, Vahid; Yerra, Archana; Cairns, Bradley R

    2015-01-01

    RNA cytosine methyltransferases (m(5)C-RMTs) constitute an important class of RNA-modifying enzymes, methylating specific cytosines within particular RNA targets in both coding and noncoding RNAs. Almost all organisms express at least one m(5)C-RMT, and vertebrates often express different types or variants of m(5)C-RMTs in different cell types. Deletion or mutation of particular m(5)C-RMTs is connected to severe pathological manifestations ranging from developmental defects to infertility and mental retardation. Some m(5)C-RMTs show spatiotemporal patterns of expression and activity requiring careful experimental design for their analysis in order to capture their context-dependent targets. An essential step for understanding the functions of both the enzymes and the modified cytosines is defining the one-to-one connection between particular m(5)C-RMTs and their target cytosines. Recent technological and methodological advances have provided researchers with new tools to comprehensively explore RNA cytosine methylation and methyltransferases. Here, we describe three complementary approaches applicable for both discovery and validation of candidate target sites of specific m(5)C-RMTs.

  14. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase.

    PubMed

    Ping, Xiao-Li; Sun, Bao-Fa; Wang, Lu; Xiao, Wen; Yang, Xin; Wang, Wen-Jia; Adhikari, Samir; Shi, Yue; Lv, Ying; Chen, Yu-Sheng; Zhao, Xu; Li, Ang; Yang, Ying; Dahal, Ujwal; Lou, Xiao-Min; Liu, Xi; Huang, Jun; Yuan, Wei-Ping; Zhu, Xiao-Fan; Cheng, Tao; Zhao, Yong-Liang; Wang, Xinquan; Rendtlew Danielsen, Jannie M; Liu, Feng; Yang, Yun-Gui

    2014-02-01

    The methyltransferase like 3 (METTL3)-containing methyltransferase complex catalyzes the N6-methyladenosine (m6A) formation, a novel epitranscriptomic marker; however, the nature of this complex remains largely unknown. Here we report two new components of the human m6A methyltransferase complex, Wilms' tumor 1-associating protein (WTAP) and methyltransferase like 14 (METTL14). WTAP interacts with METTL3 and METTL14, and is required for their localization into nuclear speckles enriched with pre-mRNA processing factors and for catalytic activity of the m6A methyltransferase in vivo. The majority of RNAs bound by WTAP and METTL3 in vivo represent mRNAs containing the consensus m6A motif. In the absence of WTAP, the RNA-binding capability of METTL3 is strongly reduced, suggesting that WTAP may function to regulate recruitment of the m6A methyltransferase complex to mRNA targets. Furthermore, transcriptomic analyses in combination with photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) illustrate that WTAP and METTL3 regulate expression and alternative splicing of genes involved in transcription and RNA processing. Morpholino-mediated knockdown targeting WTAP and/or METTL3 in zebrafish embryos caused tissue differentiation defects and increased apoptosis. These findings provide strong evidence that WTAP may function as a regulatory subunit in the m6A methyltransferase complex and play a critical role in epitranscriptomic regulation of RNA metabolism. PMID:24407421

  15. Methylation of translation-associated proteins in Saccharomyces cerevisiae: Identification of methylated lysines and their methyltransferases.

    PubMed

    Couttas, Timothy A; Raftery, Mark J; Padula, Matthew P; Herbert, Ben R; Wilkins, Marc R

    2012-04-01

    This study aimed to identify sites of lysine methylation in Saccharomyces cerevisiae and the associated methyltransferases. Hexapeptide ligand affinity chromatography was used to normalize the abundance levels of proteins in whole cell lysate. MS/MS, in association with antibody-based detection, was then used to identify lysine methylated proteins and the precise sites of modification. Lysine methylation was found on the proteins elongation factor (EF) 1-α, 2, and 3A, as well as ribosomal proteins 40S S18-A/B, 60S L11-A/B, L18-A/B, and L42-A/B. Precise sites were mapped in all cases. Single-gene knockouts of known and putative methyltransferase(s), in association with MS/MS, showed that EF1-α is monomethylated by Efm1 at lysin 30 and dimethylated by See1 at lysine 316. Methyltransferase Rkm1 was found to monomethylate 40S ribosomal protein S18-A/B at lysine 48. Knockout analysis also revealed that putative methyltransferase YBR271W affects the methylation of proteins EF2 and 3A; this was detected by Western blotting and immunodetection. This methyltransferase shows strong interspecies conservation and a tryptophan-containing motif associated with its active site. We suggest that enzyme YBR271W is named EF methyltransferase 2 (Efm2), in line with the recent naming of YHL039W as Efm1. PMID:22522802

  16. Quantitative Northern Blot Analysis of Mammalian rRNA Processing.

    PubMed

    Wang, Minshi; Pestov, Dimitri G

    2016-01-01

    Assembly of eukaryotic ribosomes is an elaborate biosynthetic process that begins in the nucleolus and requires hundreds of cellular factors. Analysis of rRNA processing has been instrumental for studying the mechanisms of ribosome biogenesis and effects of stress conditions on the molecular milieu of the nucleolus. Here, we describe the quantitative analysis of the steady-state levels of rRNA precursors, applicable to studies in mammalian cells and other organisms. We include protocols for gel electrophoresis and northern blotting of rRNA precursors using procedures optimized for the large size of these RNAs. We also describe the ratio analysis of multiple precursors, a technique that facilitates the accurate assessment of changes in the efficiency of individual pre-rRNA processing steps. PMID:27576717

  17. The terminal balls characteristic of eukaryotic rRNA transcription units in chromatin spreads are rRNA processing complexes.

    PubMed

    Mougey, E B; O'Reilly, M; Osheim, Y; Miller, O L; Beyer, A; Sollner-Webb, B

    1993-08-01

    When spread chromatin is visualized by electron microscopy, active rRNA genes have a characteristic Christmas tree appearance: From a DNA "trunk" extend closely packed "branches" of nascent transcripts whose ends are decorated with terminal "balls." These terminal balls have been known for more than two decades, are shown in most biology textbooks, and are reported in hundreds of papers, yet their nature has remained elusive. Here, we show that a rRNA-processing signal in the 5'-external transcribed spacer (ETS) of the Xenopus laevis ribosomal primary transcript forms a large, processing-related complex with factors of the Xenopus oocyte, analogous to 5' ETS processing complexes found in other vertebrate cell types. Using mutant rRNA genes, we find that the same rRNA residues are required for this biochemically defined complex formation and for terminal ball formation, analyzed electron microscopically after injection of these cloned genes into Xenopus oocytes. This, plus other presented evidence, implies that rRNA terminal balls in Xenopus, and by inference, also in the multitude of other species where they have been observed, are the ultrastructural visualization of an evolutionarily conserved 5' ETS processing complex that forms on the nascent rRNA.

  18. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  19. Backbone resonance assignments for the SET domain of the human methyltransferase NSD2.

    PubMed

    Bobby, Romel; Peciak, Karolina; Milbradt, Alexander G

    2016-10-01

    Aberrant NSD2 methyltransferase activity is implicated as the oncogenic driver in multiple myeloma, suggesting opportunities for novel therapeutic intervention. The methyltransferase activity of NSD2 resides in its catalytic SET domain, which is conserved among most lysine methyltransferases. Here we report the backbone [Formula: see text], N, C[Formula: see text], [Formula: see text] and side-chain [Formula: see text] assignments of a 25 kDa NSD2 SET domain construct, spanning residues 991-1203. A chemical shift analysis of C[Formula: see text], [Formula: see text] and [Formula: see text] resonances predicts a secondary structural pattern that is in agreement with homology models.

  20. Histone lysine methyltransferases as anti-cancer targets for drug discovery

    PubMed Central

    Liu, Qing; Wang, Ming-wei

    2016-01-01

    Post-translational epigenetic modification of histones is controlled by a number of histone-modifying enzymes. Such modification regulates the accessibility of DNA and the subsequent expression or silencing of a gene. Human histone methyltransferases (HMTs)constitute a large family that includes histone lysine methyltransferases (HKMTs) and histone/protein arginine methyltransferases (PRMTs). There is increasing evidence showing a correlation between HKMTs and cancer pathogenesis. Here, we present an overview of representative HKMTs, including their biological and biochemical properties as well as the profiles of small molecule inhibitors for a comprehensive understanding of HKMTs in drug discovery. PMID:27397541

  1. Emerging Diversity of the Cobalamin-Dependent Methyltransferases Involving Radical-Based Mechanisms.

    PubMed

    Ding, Wei; Li, Qien; Jia, Youli; Ji, Xinjian; Qianzhu, Haocheng; Zhang, Qi

    2016-07-01

    Cobalamins comprise a group of cobalt-containing organometallic cofactors that play important roles in cellular metabolism. Although many cobalamin-dependent methyltransferases (e.g., methionine synthase MetH) have been extensively studied, a new group of methyltransferases that are cobalamin-dependent and utilize radical chemistry in catalysis is just beginning to be appreciated. In this Concept article, we summarize recent advances in the understanding of the radical-based and cobalamin-dependent methyltransferases and discuss the functional and mechanistic diversity of this emerging class of enzymes. PMID:27028019

  2. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    NASA Astrophysics Data System (ADS)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  3. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter

    2016-01-01

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  4. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.

    PubMed

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter

    2016-05-19

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes.

  5. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    PubMed

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  6. Histone methyltransferases: novel targets for tumor and developmental defects

    PubMed Central

    Yi, Xin; Jiang, Xue-Jun; Li, Xiao-Yan; Jiang, Ding-Sheng

    2015-01-01

    Histone lysine methylation plays a critical role in epigenetic regulation of eukaryotes. To date, studies have shown that lysine residues of K4, K9, K27, K36 and K79 in histone H3 and K20 in histone H4 can be modified by histone methyltransferases (HMTs). Such histone methylation can specifically activate or repress the transcriptional activity to play a key role in gene expression/regulation and biological genetics. Importantly, abnormities of patterns or levels of histone methylation in higher eukaryotes may result in tumorigenesis and developmental defects, suggesting histone methylation will be one of the important targets or markers for treating these diseases. This review will outline the structural characteristics, active sites and specificity of HMTs, correlation between histone methylation and human diseases and lay special emphasis on the progress of the research on H3K36 methylation. PMID:26807165

  7. Novel Broad Spectrum Inhibitors Targeting the Flavivirus Methyltransferase

    PubMed Central

    Liu, Binbin; Banavali, Nilesh K.; Jones, Susan A.; Zhang, Jing; Li, Zhong; Kramer, Laura D.; Li, Hongmin

    2015-01-01

    The flavivirus methyltransferase (MTase) is an essential enzyme that sequentially methylates the N7 and 2’-O positions of the viral RNA cap, using S-adenosyl-L-methionine (SAM) as a methyl donor. We report here that small molecule compounds, which putatively bind to the SAM-binding site of flavivirus MTase and inhibit its function, were identified by using virtual screening. In vitro methylation experiments demonstrated significant MTase inhibition by 13 of these compounds, with the most potent compound displaying sub-micromolar inhibitory activity. The most active compounds showed broad spectrum activity against the MTase proteins of multiple flaviviruses. Two of these compounds also exhibited low cytotoxicity and effectively inhibited viral replication in cell-based assays, providing further structural insight into flavivirus MTase inhibition. PMID:26098995

  8. Clinical utility of thiopurine S-methyltransferase genotyping.

    PubMed

    Corominas, Hèctor; Baiget, Montserrat

    2004-01-01

    Thiopurine S-methyltransferase (TPMT) is a cytosolic enzyme that plays a major role in the metabolism of thiopurine drugs such as mercaptopurine and azathioprine. The interindividual differences in response to thiopurine administration is in part due to the presence of genetic polymorphisms in the gene that regulates TPMT activity. TPMT genotype correlates well with the in vivo enzyme activity within erythrocytes. Patients with genetically determined decreased TPMT activity develop severe myelosuppression when treated with standard doses of thiopurine drugs because an excess of thioguanine nucleotides accumulates in hematopoietic tissues. TPMT genotyping provides clinicians with a reliable method for identifying TPMT-deficient patients who can benefit from low doses of thiopurine drugs in order to reduce the risk of developing adverse effects. Moreover, the administration of higher doses of the drug could improve therapeutic response in patients in whom the TPMT genotyping demonstrates the absence of mutated alleles.

  9. Arginine methyltransferase CARM1/PRMT4 regulates endochondral ossification

    PubMed Central

    Ito, Tatsuo; Yadav, Neelu; Lee, Jaeho; Furumatsu, Takayuki; Yamashita, Satoshi; Yoshida, Kenji; Taniguchi, Noboru; Hashimoto, Megumi; Tsuchiya, Megumi; Ozaki, Toshifumi; Lotz, Martin; Bedford, Mark T; Asahara, Hiroshi

    2009-01-01

    Background Chondrogenesis and subsequent endochondral ossification are processes tightly regulated by the transcription factor Sox9 (SRY-related high mobility group-Box gene 9), but molecular mechanisms underlying this activity remain unclear. Here we report that coactivator-associated arginine methyltransferase 1 (CARM1) regulates chondrocyte proliferation via arginine methylation of Sox9. Results CARM1-null mice display delayed endochondral ossification and decreased chondrocyte proliferation. Conversely, cartilage development of CARM1 transgenic mice was accelerated. CARM1 specifically methylates Sox9 at its HMG domain in vivo and in vitro. Arg-methylation of Sox9 by CARM1 disrupts interaction of Sox9 with beta-catenin, regulating Cyclin D1 expression and cell cycle progression of chondrocytes. Conclusion These results establish a role for CARM1 as an important regulator of chondrocyte proliferation during embryogenesis. PMID:19725955

  10. RNA methyltransferase NSUN2 promotes stress-induced HUVEC senescence

    PubMed Central

    Tang, Hao; Hu, Han; Pang, Lijun; Xing, Junyue; Liu, Zhenyun; Luo, Yuhong; Jiang, Bin; Liu, Te; Gorospe, Myriam; Chen, Chuan; Wang, Wengong

    2016-01-01

    The tRNA methyltransferase NSUN2 delays replicative senescence by regulating the translation of CDK1 and CDKN1B mRNAs. However, whether NSUN2 influences premature cellular senescence remains untested. Here we show that NSUN2 methylates SHC mRNA in vitro and in cells, thereby enhancing the translation of the three SHC proteins, p66SHC, p52SHC, and p46SHC. Our results further show that the elevation of SHC expression by NSUN2-mediated mRNA methylation increased the levels of ROS, activated p38MAPK, thereby accelerating oxidative stress- and high-glucose-induced senescence of human vascular endothelial cells (HUVEC). Our findings highlight the critical impact of NSUN2-mediated mRNA methylation in promoting premature senescence. PMID:26992231

  11. Low catechol-O-methyltransferase activity in a Saami population.

    PubMed

    Klemetsdal, B; Straume, B; Giverhaug, T; Aarbakke, J

    1994-01-01

    Catechol-O-methyltransferase (COMT) catalyzes the O-methylation of catechol hormones, neurotransmitters and certain drugs. It is subject to genetic polymorphism and ethnic differences. High red blood cell (RBC) COMT activity has been correlated with a poor response to levodopa treatment in Parkinson's disease. RBC COMT was determined in a Norwegian population (n = 213) of whom 115 were Saami (Laaps). The Saami had 16.5% lower RBC COMT activity compared to a non-Saami population sample from the northern part of Norway (n = 50), 13.9 vs. 16.4 units/ml RBC (U) (P = 0.04). This is the first report of any population with lower RBC COMT activity than a Caucasian population. A wide range of RBC COMT activities was found in the entire population examined (1.3-38.3 U).

  12. DNA Electrochemistry Shows DNMT1 Methyltransferase Hyperactivity in Colorectal Tumors.

    PubMed

    Furst, Ariel L; Barton, Jacqueline K

    2015-07-23

    DNMT1, the most abundant human methyltransferase, is responsible for translating the correct methylation pattern during DNA replication, and aberrant methylation by DNMT1 has been linked to tumorigenesis. We have developed a sensitive signal-on electrochemical assay for the measurement of DNMT1 activity in crude tissue lysates. We have further analyzed ten tumor sets and have found a direct correlation between DNMT1 hyperactivity and tumorous tissue. In the majority of samples analyzed, the tumorous tissue has significantly higher DNMT1 activity than the healthy adjacent tissue. No such correlation is observed in measurements of DNMT1 expression by qPCR, DNMT1 protein abundance by western blotting, or DNMT1 activity using a radiometric DNA labeling assay. DNMT1 hyperactivity can result from both protein overexpression and enzyme hyperactivity. DNMT1 activity measured electrochemically provides a direct measure of activity in cell lysates and, as a result, provides a sensitive and early indication of cancerous transformation.

  13. RNA methyltransferases involved in 5′ cap biosynthesis

    PubMed Central

    Byszewska, Magdalena; Śmietański, Mirosław; Purta, Elżbieta; Bujnicki, Janusz M

    2014-01-01

    In eukaryotes and viruses that infect them, the 5′ end of mRNA molecules, and also many other functionally important RNAs, are modified to form a so-called cap structure that is important for interactions of these RNAs with many nuclear and cytoplasmic proteins. The RNA cap has multiple roles in gene expression, including enhancement of RNA stability, splicing, nucleocytoplasmic transport, and translation initiation. Apart from guanosine addition to the 5′ end in the most typical cap structure common to transcripts produced by RNA polymerase II (in particular mRNA), essentially all cap modifications are due to methylation. The complexity of the cap structure and its formation can range from just a single methylation of the unprocessed 5′ end of the primary transcript, as in mammalian U6 and 7SK, mouse B2, and plant U3 RNAs, to an elaborate m7Gpppm6,6AmpAmpCmpm3Um structure at the 5′ end of processed RNA in trypanosomes, which are formed by as many as 8 methylation reactions. While all enzymes responsible for methylation of the cap structure characterized to date were found to belong to the same evolutionarily related and structurally similar Rossmann Fold Methyltransferase superfamily, that uses the same methyl group donor, S-adenosylmethionine; the enzymes also exhibit interesting differences that are responsible for their distinct functions. This review focuses on the evolutionary classification of enzymes responsible for cap methylation in RNA, with a focus on the sequence relationships and structural similarities and dissimilarities that provide the basis for understanding the mechanism of biosynthesis of different caps in cellular and viral RNAs. Particular attention is paid to the similarities and differences between methyltransferases from human cells and from human pathogens that may be helpful in the development of antiviral and antiparasitic drugs. PMID:25626080

  14. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  15. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  16. Photoaffinity labelling of methyltransferase enzymes with S-adenosylmethionine: effects of methyl acceptor substrates.

    PubMed

    Hurst, J H; Billingsley, M L; Lovenberg, W

    1984-07-31

    Radioactivity from 3H-[methyl]-S-adenosyl-L-methionine (AdoMet) was covalently bound to protein-O-carboxylmethyltransferase and phenylethanolamine N-methyltransferase following 10-15 min irradiation by short-wave ultraviolet light. This photoaffinity binding of 3H-[methyl]-AdoMet was blocked by S-adenosylhomocysteine and sinefungin, but was not affected by 5 mM dithiothreitol. The binding was also inhibited by including methyl acceptors such as calmodulin (protein-O-carboxylmethyltransferase) or phenylethanolamine (phenylethanolamine N-methyltransferase) in the photoaffinity incubation. Staphlococcus V8 protease digests of 3H-[methyl]-AdoMet/enzyme complexes revealed that the primary structure around the AdoMet binding site is different in these two enzymes. Thus, protein-O-carboxylmethyltransferase, a large molecule methyltransferase, can covalently bind 3H-[methyl]-AdoMet in a manner similar to that of phenylethanolamine-N-methyltransferase.

  17. Drosophila arginine methyltransferase 1 (DART1) is an ecdysone receptor co-repressor

    SciTech Connect

    Kimura, Shuhei; Sawatsubashi, Shun; Ito, Saya; Kouzmenko, Alexander; Suzuki, Eriko; Zhao, Yue; Yamagata, Kaoru; Tanabe, Masahiko; Ueda, Takashi; Fujiyama, Sari; Murata, Takuya; Matsukawa, Hiroyuki; Takeyama, Ken-ichi; Yaegashi, Nobuo

    2008-07-11

    Histone arginine methylation is an epigenetic marker that regulates gene expression by defining the chromatin state. Arginine methyltransferases, therefore, serve as transcriptional co-regulators. However, unlike other transcriptional co-regulators, the physiological roles of arginine methyltransferases are poorly understood. Drosophila arginine methyltransferase 1 (DART1), the mammalian PRMT1 homologue, methylates the arginine residue of histone H4 (H4R3me2). Disruption of DART1 in Drosophila by imprecise P-element excision resulted in low viability during metamorphosis in the pupal stages. In the pupal stage, an ecdysone hormone signal is critical for developmental progression. DART1 interacted with the nuclear ecdysone receptor (EcR) in a ligand-dependent manner, and co-repressed EcR in intact flies. These findings suggest that DART1, a histone arginine methyltransferase, is a co-repressor of EcR that is indispensable for normal pupal development in the intact fly.

  18. *Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate ciona intestinalis

    EPA Science Inventory

    Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+3 oxidation state) methyltransferase (As3mt) , yielding mono-, di-, and trimethylated arsenicals. A comparative genomic approach focused on Ciona intestinaJis, an invertebrate chordate, was u...

  19. Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate Ciona intestinalis

    EPA Science Inventory

    Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+3 oxidation state) methyltransferase (As3mt), yielding mono- , di- , and trimethylated arsenicals. To investigate the evolution of molecular mechanisms that mediate arsenic biotransformation,...

  20. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells.

    PubMed Central

    Wu, J; Issa, J P; Herman, J; Bassett, D E; Nelkin, B D; Baylin, S B

    1993-01-01

    Abnormal regional increases in DNA methylation, which have potential for causing gene inactivation and chromosomal instability, are consistently found in immortalized and tumorigenic cells. Increased DNA methyltransferase activity, which is also a characteristic of such cells, is a candidate to mediate these abnormal DNA methylation patterns. We now show that, in NIH 3T3 mouse fibroblasts, constitutive overexpression of an exogenous mouse DNA methyltransferase gene results in a marked increase in overall DNA methylation which is accompanied by tumorigenic transformation. These transformation changes can also be elicited by dexamethasone-inducible expression of an exogenous DNA methyltransferase gene. Our findings provide strong evidence that the increase in DNA methyltransferase activity associated with tumor progression could be a key step in carcinogenesis and provide a model system that can be used to further study this possibility. Images Fig. 1 Fig. 2 PMID:8415627

  1. Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate Ciona intestinalis

    EPA Science Inventory

    The biotransformation of inorganic arsenic (iAs) involves methylation by an arsenic (+3 oxidation state) methyltransferase (AS3MT), yielding methyl arsenic (MA), dimethyl arsenic (DMA), and trimethylarsenic (TMA). To identify molecular mechanisms that coordinate arsenic biotra...

  2. Widespread occurrence of bacterial thiol methyltransferases and the biogenic emission of methylated sulfur gases.

    PubMed Central

    Drotar, A; Burton, G A; Tavernier, J E; Fall, R

    1987-01-01

    A majority of heterotrophic bacteria isolated from soil, water, sediment, vegetation, and marine algae cultures methylated sulfide, producing methanethiol. This was demonstrated with intact cells by measuring the emission of methanethiol with a sulfur-selective chemiluminescence detector, and in cell extracts by detection of sulfide-dependent thiol methyltransferase activity. Extracts of two Pseudomonas isolates were fractionated by gel-filtration and ion-exchange chromatography, and with sulfide as the substrate a single peak of thiol methyltransferase activity was seen in each case. Extracts of several bacterial strains also contained thiol methyltransferase activity with organic thiols as substrates. Thus, S-adenosylmethionine-dependent thiol methyltransferase activities are widespread in bacteria and may contribute to biogenic emissions of methylated sulfur gases and to the production of methyl thioethers. PMID:3662509

  3. Gold nanorods-based FRET assay for ultrasensitive detection of DNA methylation and DNA methyltransferase activity.

    PubMed

    Wang, Gang Lin; Luo, Hong Qun; Li, Nian Bing

    2014-09-21

    A fluorescence method for the detection of DNA methylation and the assay of methyltransferase activity is proposed using gold nanorods as a fluorescence quencher on the basis of fluorescence resonance energy transfer. It is demonstrated that this method is capable of detecting methyltransferase with a detection limit of 0.25 U mL(-1), which might make this method a good candidate for monitoring DNA methylation in the future. PMID:25028809

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  5. Crystal structure of dengue virus methyltransferase without S-adenosyl-L-methionine.

    PubMed

    Noble, Christian G; Li, Shi-Hua; Dong, Hongping; Chew, Sock Hui; Shi, Pei-Yong

    2014-11-01

    Flavivirus methyltransferase is a genetically-validated antiviral target. Crystal structures of almost all available flavivirus methyltransferases contain S-adenosyl-L-methionine (SAM), the methyl donor molecule that co-purifies with the enzymes. This raises a possibility that SAM is an integral structural component required for the folding of dengue virus (DENV) methyltransferase. Here we exclude this possibility by solving the crystal structure of DENV methyltransferase without SAM. The SAM ligand was removed from the enzyme through a urea-mediated denaturation-and-renaturation protocol. The crystal structure of the SAM-depleted enzyme exhibits a vacant SAM-binding pocket, with a conformation identical to that of the SAM-enzyme co-crystal structure. Functionally, equivalent enzymatic activities (N-7 methylation, 2'-O methylation, and GMP-enzyme complex formation) were detected for the SAM-depleted and SAM-containing recombinant proteins. These results clearly indicate that the SAM molecule is not an essential component for the correct folding of DENV methyltransferase. Furthermore, the results imply a potential antiviral approach to search for inhibitors that can bind to the SAM-binding pocket and compete against SAM binding. To demonstrate this potential, we have soaked crystals of DENV methyltransferase without a bound SAM with the natural product Sinefungin and show that preformed crystals are capable of binding ligands in this pocket. PMID:25241250

  6. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation.

  7. Protein kinase C catalyses the phosphorylation and activation of rat liver phospholipid methyltransferase.

    PubMed Central

    Villalba, M; Pajares, M A; Renart, M F; Mato, J M

    1987-01-01

    When a partially purified rat liver phospholipid methyltransferase is incubated with [gamma-32P]ATP and rat brain protein kinase C, phospholipid methyltransferase (Mr 50,000, pI 4.75) becomes phosphorylated. Phosphorylation of the enzyme showed Ca2+/lipid-dependency. Protein kinase C-dependent phosphorylation of phospholipid methyltransferase was accompanied by an approx. 2-fold activation of the enzyme activity. Activity changes and enzyme phosphorylation showed the same time course. Activation of the enzyme also showed Ca2+/lipid-dependency. Protein kinase C mediates phosphorylation of predominantly serine residues of the methyltransferase. One major peak of phosphorylation was identified by analysis of tryptic phosphopeptides by isoelectrofocusing. This peak (pI 5.2) differs from that phosphorylated by the cyclic AMP-dependent protein kinase (pI 7.2), demonstrating the specificity of phosphorylation of protein kinase C. Tryptic-peptide mapping by h.p.l.c. of the methyltransferase phosphorylated by protein kinase C revealed one major peak of radioactivity, which could be resolved into two labelled phosphopeptides by t.l.c. The significance of protein kinase C-mediated phosphorylation of phospholipid methyltransferase is discussed. Images Fig. 1. Fig. 4. PMID:3593229

  8. Mutational analysis defines the roles of conserved amino acid residues in the predicted catalytic pocket of the rRNA:m6A methyltransferase ErmC'.

    PubMed

    Maravić, Gordana; Feder, Marcin; Pongor, Sándor; Flögel, Mirna; Bujnicki, Janusz M

    2003-09-01

    Methyltransferases (MTases) from the Erm family catalyze S-adenosyl-L-methionine-dependent modification of a specific adenine residue in bacterial 23S rRNA, thereby conferring resistance to clinically important macrolide, lincosamide and streptogramin B antibiotics. Despite the available structural data and functional analyses on the level of the RNA substrate, still very little is known about the mechanism of rRNA:adenine-N(6) methylation. Only predictions regarding various aspects of this reaction have been made based on the analysis of the crystal structures of methyltransferase ErmC' (without the RNA) and their comparison with the crystallographic and biochemical data for better studied DNA:m(6)A MTases. To validate the structure-based predictions of presumably essential residues in the catalytic pocket of ErmC', we carried out the site-directed mutagenesis and studied the function of the mutants in vitro and in vivo. Our results indicate that the active site of rRNA:m(6)A MTases is much more tolerant to amino acid substitutions than the active site of DNA:m(6)A MTases. Only the Y104 residue implicated in stabilization of the target base was found to be indispensable. Remarkably, the N101 residue from the "catalytic" motif IV and two conserved residues that form the floor (F163) and one of the walls (N11) of the base-binding site are not essential for catalysis in ErmC'. This somewhat surprising result is discussed in the light of the available structural data and in the phylogenetic context of the Erm family. PMID:12946350

  9. Mutational analysis defines the roles of conserved amino acid residues in the predicted catalytic pocket of the rRNA:m6A methyltransferase ErmC'.

    PubMed

    Maravić, Gordana; Feder, Marcin; Pongor, Sándor; Flögel, Mirna; Bujnicki, Janusz M

    2003-09-01

    Methyltransferases (MTases) from the Erm family catalyze S-adenosyl-L-methionine-dependent modification of a specific adenine residue in bacterial 23S rRNA, thereby conferring resistance to clinically important macrolide, lincosamide and streptogramin B antibiotics. Despite the available structural data and functional analyses on the level of the RNA substrate, still very little is known about the mechanism of rRNA:adenine-N(6) methylation. Only predictions regarding various aspects of this reaction have been made based on the analysis of the crystal structures of methyltransferase ErmC' (without the RNA) and their comparison with the crystallographic and biochemical data for better studied DNA:m(6)A MTases. To validate the structure-based predictions of presumably essential residues in the catalytic pocket of ErmC', we carried out the site-directed mutagenesis and studied the function of the mutants in vitro and in vivo. Our results indicate that the active site of rRNA:m(6)A MTases is much more tolerant to amino acid substitutions than the active site of DNA:m(6)A MTases. Only the Y104 residue implicated in stabilization of the target base was found to be indispensable. Remarkably, the N101 residue from the "catalytic" motif IV and two conserved residues that form the floor (F163) and one of the walls (N11) of the base-binding site are not essential for catalysis in ErmC'. This somewhat surprising result is discussed in the light of the available structural data and in the phylogenetic context of the Erm family.

  10. [Dnmt2 is the Most Evolutionary Conserved and Enigmatic Cytosine DNA Methyltransferase in Eukaryotes].

    PubMed

    Ashapkin, V V; Kutueva, L I; Vanyushin, B F

    2016-03-01

    Dnmt2 is the most strongly conserved cytosine DNA methyltransferase in eukaryotes. It has been found in all organisms possessing methyltransferases of the Dnmt1 and Dnmt3 families, whereas in many others Dnmt2 is the sole cytosine DNA methyltransferase. The Dnmt2 molecule contains all conserved motifs of cytosine DNA methyltransferases. It forms 3D complexes with DNA very similar to those of bacterial DNA methyltransferases and performs cytosine methylation by a catalytic mechanism common to all cytosine DNA methyltransferases. Catalytic activity of the purified Dnmt2 with DNA substrates is very low and could hardly be detected in direct biochemical assays. Dnmt2 is the sole cytosine DNA methyltransferase in Drosophila and other dipteran insects. Its overexpression as a transgene leads to DNA hypermethylation in all sequence contexts and to an extended life span. On the contrary, a null-mutation of the Dnmt2 gene leads to a diminished life span, though no evident anomalies in development are observed. Dnmt2 is also the sole cytosine DNA methyltransferase in several protists. Similar to Drosophila these protists have a very low level of DNA methylation. Some limited genome compartments, such as transposable sequences, are probably the methylation targets in these organisms. Dnmt2 does not participate in genome methylation in mammals, but seems to be an RNA methyltransferase modifying the 38th cytosine residue in anticodon loop of certain tRNAs. This modification enhances stability of tRNAs, especially in stressful conditions. Dnmt2 is the only enzyme known to perform RNA methylation by a catalytic mechanism characteristic of DNA methyltransferases. The Dnmt2 activity has been shown in mice to be necessary for paramutation establishment, though the precise mechanisms of its participation in this form of epigenetic heredity are unknown. It seems likely, that either of the two Dnmt2 activities could become a predominant one during the evolution of different species

  11. Intraspecific 16S rRNA gene diversity among clinical isolates of Neisseria species.

    PubMed

    Mechergui, Arij; Achour, Wafa; Hassen, Assia Ben

    2014-05-01

    In the present work, nearly the entire 16S rRNA gene sequences of 46 clinical samples of Neisseria spp. were determined, and the aligned sequences were analyzed to investigate the diversity of 16S rRNA genes in each commensal Neisseria species. Two 16S rRNA types were identified in two Neisseria sicca strains, three 16S rRNA types in five Neisseria macacae strains, fourteen 16S rRNA types in twenty Neisseria flavescens isolates, and fourteen 16S rRNA types in nineteen Neisseria mucosa isolates. The number of nucleotides that were different between 16S rRNA sequences within specie ranged from 1 to 15. We found high intraspecific sequence variation in 16S rRNA genes of Neisseria spp. strains.

  12. Two protein lysine methyltransferases methylate outer membrane protein B from Rickettsia.

    PubMed

    Abeykoon, Amila H; Chao, Chien-Chung; Wang, Guanghui; Gucek, Marjan; Yang, David C H; Ching, Wei-Mei

    2012-12-01

    Rickettsia prowazekii, the etiologic agent of epidemic typhus, is a potential biological threat agent. Its outer membrane protein B (OmpB) is an immunodominant antigen and plays roles as protective envelope and as adhesins. The observation of the correlation between methylation of lysine residues in rickettsial OmpB and bacterial virulence has suggested the importance of an enzymatic system for the methylation of OmpB. However, no rickettsial lysine methyltransferase has been characterized. Bioinformatic analysis of genomic DNA sequences of Rickettsia identified putative lysine methyltransferases. The genes of the potential methyltransferases were synthesized, cloned, and expressed in Escherichia coli, and expressed proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography. The methyltransferase activities of the purified proteins were analyzed by methyl incorporation of radioactively labeled S-adenosylmethionine into recombinant fragments of OmpB. Two putative recombinant methyltransferases (rRP789 and rRP027-028) methylated recombinant OmpB fragments. The specific activity of rRP789 is 10- to 30-fold higher than that of rRP027-028. Western blot analysis using specific antibodies against trimethyl lysine showed that both rRP789 and rRP027-028 catalyzed trimethylation of recombinant OmpB fragments. Liquid chromatography-tandem mass spectrometry (LC/MS-MS) analysis showed that rRP789 catalyzed mono-, di-, and trimethylation of lysine, while rRP027-028 catalyzed exclusively trimethylation. To our knowledge, rRP789 and rRP027-028 are the first biochemically characterized lysine methyltransferases of outer membrane proteins from Gram-negative bacteria. The production and characterization of rickettsial lysine methyltransferases provide new tools to investigate the mechanism of methylation of OmpB, effects of methylation on the structure and function of OmpB, and development of methylated OmpB-based diagnostic assays and vaccine candidates.

  13. Euchromatin histone methyltransferase 1 regulates cortical neuronal network development

    PubMed Central

    Bart Martens, Marijn; Frega, Monica; Classen, Jessica; Epping, Lisa; Bijvank, Elske; Benevento, Marco; van Bokhoven, Hans; Tiesinga, Paul; Schubert, Dirk; Nadif Kasri, Nael

    2016-01-01

    Heterozygous mutations or deletions in the human Euchromatin histone methyltransferase 1 (EHMT1) gene cause Kleefstra syndrome, a neurodevelopmental disorder that is characterized by autistic-like features and severe intellectual disability (ID). Neurodevelopmental disorders including ID and autism may be related to deficits in activity-dependent wiring of brain circuits during development. Although Kleefstra syndrome has been associated with dendritic and synaptic defects in mice and Drosophila, little is known about the role of EHMT1 in the development of cortical neuronal networks. Here we used micro-electrode arrays and whole-cell patch-clamp recordings to investigate the impact of EHMT1 deficiency at the network and single cell level. We show that EHMT1 deficiency impaired neural network activity during the transition from uncorrelated background action potential firing to synchronized network bursting. Spontaneous bursting and excitatory synaptic currents were transiently reduced, whereas miniature excitatory postsynaptic currents were not affected. Finally, we show that loss of function of EHMT1 ultimately resulted in less regular network bursting patterns later in development. These data suggest that the developmental impairments observed in EHMT1-deficient networks may result in a temporal misalignment between activity-dependent developmental processes thereby contributing to the pathophysiology of Kleefstra syndrome. PMID:27767173

  14. Mapping the conformational space accessible to catechol-O-methyltransferase.

    PubMed

    Ehler, Andreas; Benz, Jörg; Schlatter, Daniel; Rudolph, Markus G

    2014-08-01

    Methylation catalysed by catechol-O-methyltransferase (COMT) is the main pathway of catechol neurotransmitter deactivation in the prefrontal cortex. Low levels of this class of neurotransmitters are held to be causative of diseases such as schizophrenia, depression and Parkinson's disease. Inhibition of COMT may increase neurotransmitter levels, thus offering a route for treatment. Structure-based drug design hitherto seems to be based on the closed enzyme conformation. Here, a set of apo, semi-holo, holo and Michaelis form crystal structures are described that define the conformational space available to COMT and that include likely intermediates along the catalytic pathway. Domain swaps and sizeable loop movements around the active site testify to the flexibility of this enzyme, rendering COMT a difficult drug target. The low affinity of the co-substrate S-adenosylmethionine and the large conformational changes involved during catalysis highlight significant energetic investment to achieve the closed conformation. Since each conformation of COMT is a bona fide target for inhibitors, other states than the closed conformation may be promising to address. Crystallographic data for an alternative avenue of COMT inhibition, i.e. locking of the apo state by an inhibitor, are presented. The set of COMT structures may prove to be useful for the development of novel classes of inhibitors.

  15. Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity

    PubMed Central

    Pan, Yanchun; Daito, Takuji; Sasaki, Yo; Chung, Yong Hee; Xing, Xiaoyun; Pondugula, Santhi; Swamidass, S. Joshua; Wang, Ting; Kim, Albert H.; Yano, Hiroko

    2016-01-01

    Although epigenetic abnormalities have been described in Huntington’s disease (HD), the causal epigenetic mechanisms driving neurodegeneration in HD cortex and striatum remain undefined. Using an epigenetic pathway-targeted drug screen, we report that inhibitors of DNA methyltransferases (DNMTs), decitabine and FdCyd, block mutant huntingtin (Htt)-induced toxicity in primary cortical and striatal neurons. In addition, knockdown of DNMT3A or DNMT1 protected neurons against mutant Htt-induced toxicity, together demonstrating a requirement for DNMTs in mutant Htt-triggered neuronal death and suggesting a neurodegenerative mechanism based on DNA methylation-mediated transcriptional repression. Inhibition of DNMTs in HD model primary cortical or striatal neurons restored the expression of several key genes, including Bdnf, an important neurotrophic factor implicated in HD. Accordingly, the Bdnf promoter exhibited aberrant cytosine methylation in mutant Htt-expressing cortical neurons. In vivo, pharmacological inhibition of DNMTs in HD mouse brains restored the mRNA levels of key striatal genes known to be downregulated in HD. Thus, disturbances in DNA methylation play a critical role in mutant Htt-induced neuronal dysfunction and death, raising the possibility that epigenetic strategies targeting abnormal DNA methylation may have therapeutic utility in HD. PMID:27516062

  16. Identification and functional characterization of lysine methyltransferases of Entamoeba histolytica.

    PubMed

    Borbolla-Vázquez, Jessica; Orozco, Esther; Medina-Gómez, Christian; Martínez-Higuera, Aarón; Javier-Reyna, Rosario; Chávez, Bibiana; Betanzos, Abigail; Rodríguez, Mario A

    2016-07-01

    Lysine methylation of histones, a posttranslational modification catalyzed by lysine methyltransferases (HKMTs), plays an important role in the epigenetic regulation of transcription. Lysine methylation of non-histone proteins also impacts the biological function of proteins. Previously it has been shown that lysine methylation of histones of Entamoeba histolytica, the protozoan parasite that infects 50 million people worldwide each year and causing up to 100,000 deaths annually, is implicated in the epigenetic machinery of this microorganism. However, the identification and characterization of HKMTs in this parasite had not yet been determined. In this work we identified four HKMTs in E. histolytica (EhHKMT1 to EhHKMT4) that are expressed by trophozoites. Enzymatic assays indicated that all of them are able to transfer methyl groups to commercial histones. EhHKMT1, EhHKMT2 and EhHKMT4 were detected in nucleus and cytoplasm of trophozoites. In addition EhHKMT2 and EhHKMT4 were located in vesicles containing ingested cells during phagocytosis, and they co-immunoprecipitated with EhADH, a protein involved in the phagocytosis of this parasite. Results suggest that E. histolytica uses its HKMTs to regulate transcription by epigenetic mechanisms, and at least two of them could also be implicated in methylation of proteins that participate in phagocytosis. PMID:27062489

  17. Protein lysine methylation by seven-β-strand methyltransferases.

    PubMed

    Falnes, Pål Ø; Jakobsson, Magnus E; Davydova, Erna; Ho, Angela; Małecki, Jędrzej

    2016-07-15

    Methylation of biomolecules is a frequent biochemical reaction within the cell, and a plethora of highly specific methyltransferases (MTases) catalyse the transfer of a methyl group from S-adenosylmethionine (AdoMet) to various substrates. The posttranslational methylation of lysine residues, catalysed by numerous lysine (K)-specific protein MTases (KMTs), is a very common and important protein modification, which recently has been subject to intense studies, particularly in the case of histone proteins. The majority of KMTs belong to a class of MTases that share a defining 'SET domain', and these enzymes mostly target lysines in the flexible tails of histones. However, the so-called seven-β-strand (7BS) MTases, characterized by a twisted beta-sheet structure and certain conserved sequence motifs, represent the largest MTase class, and these enzymes methylate a wide range of substrates, including small metabolites, lipids, nucleic acids and proteins. Until recently, the histone-specific Dot1/DOT1L was the only identified eukaryotic 7BS KMT. However, a number of novel 7BS KMTs have now been discovered, and, in particular, several recently characterized human and yeast members of MTase family 16 (MTF16) have been found to methylate lysines in non-histone proteins. Here, we review the status and recent progress on the 7BS KMTs, and discuss these enzymes at the levels of sequence/structure, catalytic mechanism, substrate recognition and biological significance. PMID:27407169

  18. DNA methyltransferase inhibitor CDA-II inhibits myogenic differentiation

    SciTech Connect

    Chen, Zirong; Jin, Guorong; Lin, Shuibin; Lin, Xiumei; Gu, Yumei; Zhu, Yujuan; Hu, Chengbin; Zhang, Qingjiong; Wu, Lizi; Shen, Huangxuan

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer CDA-II inhibits myogenic differentiation in a dose-dependent manner. Black-Right-Pointing-Pointer CDA-II repressed expression of muscle transcription factors and structural proteins. Black-Right-Pointing-Pointer CDA-II inhibited proliferation and migration of C2C12 myoblasts. -- Abstract: CDA-II (cell differentiation agent II), isolated from healthy human urine, is a DNA methyltransferase inhibitor. Previous studies indicated that CDA-II played important roles in the regulation of cell growth and certain differentiation processes. However, it has not been determined whether CDA-II affects skeletal myogenesis. In this study, we investigated effects of CDA-II treatment on skeletal muscle progenitor cell differentiation, migration and proliferation. We found that CDA-II blocked differentiation of murine myoblasts C2C12 in a dose-dependent manner. CDA-II repressed expression of muscle transcription factors, such as Myogenin and Mef2c, and structural proteins, such as myosin heavy chain (Myh3), light chain (Mylpf) and MCK. Moreover, CDA-II inhibited C1C12 cell migration and proliferation. Thus, our data provide the first evidence that CDA-II inhibits growth and differentiation of muscle progenitor cells, suggesting that the use of CDA-II might affect skeletal muscle functions.

  19. Sequence specificity of mRNA N6-adenosine methyltransferase.

    PubMed

    Csepany, T; Lin, A; Baldick, C J; Beemon, K

    1990-11-25

    The sequence specificity of chicken mRNA N6-adenosine methyltransferase has been investigated in vivo. Localization of six new N6-methyladenosine sites on Rous sarcoma virus (RSV) virion RNA has confirmed our extended consensus sequence for methylation: RGACU, where R is usually a G (7/12). We have also observed A (2/12) and U (3/12) at the -2 position (relative to m6A at +1) but never a C. At the +3 position, the U was observed 10/12 times; an A and a C were observed once each in weakly methylated sequences. The extent of methylation varied between the different sites up to a maximum of about 90%. To test the significance of this consensus sequence, it was altered by site-specific mutagenesis, and methylation was assayed after transfection of mutated RSV DNA into chicken embryo fibroblasts. We found that changing the G at -1 or the U at +3 to any other residue inhibited methylation. However, inhibition of methylation at all four of the major sites in the RSV src gene did not detectably alter the steady-state levels of the three viral RNA species or viral infectivity. Additional mutants that inactivated the src protein kinase activity produced less virus and exhibited relatively less src mRNA in infected cells. PMID:2173695

  20. Catechol-O-methyltransferase as a target for melanoma destruction?

    PubMed

    Smit, N P; Latter, A J; Naish-Byfield, S; Westerhof, W; Pavel, S; Riley, P A

    1994-08-17

    Catechols may interfere in melanogenesis by causing increased levels of toxic quinones. Several catechols and known inhibitors of the enzyme catechol-O-methyltransferase (COMT) were therefore tested for their toxicity towards a pigmented melanoma cell line, UCLA-SO-(M14). The inhibition of thymidine incorporation as a result of exposure to the compounds was measured. All agents were compared to 4-hydroxyanisole (4HA), a depigmenting agent extensively studied as an antimelanoma drug. The compounds were also tested on the epithelial cell line, CNCM-I-(221) in the presence and absence of tyrosinase. All the compounds were more effective than 4HA towards the M14-cells at either 10(-4) M or 10(-5) M. The toxicity of 4HA towards the 221-cells was shown to be completely dependent on the presence of tyrosinase. Effects of the test agents on the 221-cells were also observed in the absence of tyrosinase. Although some of them were shown to be good substrates for tyrosinase only small changes in toxicity were observed as a result of the presence of the enzyme in comparison with 4HA. No direct correlation of the toxicity of the agents and COMT inhibition was observed. The possible mode of action of the compounds through inhibition of COMT and interference in melanogenesis is discussed together with other possibilities and factors involved.

  1. The Role of Protein Arginine Methyltransferases in Inflammatory Responses

    PubMed Central

    Kim, Ji Hye; Yoo, Byong Chul; Yang, Woo Seok; Kim, Eunji; Hong, Sungyoul

    2016-01-01

    Protein arginine methyltransferases (PRMTs) mediate the methylation of a number of protein substrates of arginine residues and serve critical functions in many cellular responses, including cancer development, progression, and aggressiveness, T-lymphocyte activation, and hepatic gluconeogenesis. There are nine members of the PRMT family, which are divided into 4 types (types I–IV). Although most PRMTs do not require posttranslational modification (PTM) to be activated, fine-tuning modifications, such as interactions between cofactor proteins, subcellular compartmentalization, and regulation of RNA, via micro-RNAs, seem to be required. Inflammation is an essential defense reaction of the body to eliminate harmful stimuli, including damaged cells, irritants, or pathogens. However, chronic inflammation can eventually cause several types of diseases, including some cancers, atherosclerosis, rheumatoid arthritis, and periodontitis. Therefore, inflammation responses should be well modulated. In this review, we briefly discuss the role of PRMTs in the control of inflammation. More specifically, we review the roles of four PRMTs (CARM1, PRMT1, PRMT5, and PRMT6) in modulating inflammation responses, particularly in terms of modulating the transcriptional factors or cofactors related to inflammation. Based on the regulatory roles known so far, we propose that PRMTs should be considered one of the target molecule groups that modulate inflammatory responses. PMID:27041824

  2. DNA methyltransferase inhibition restores erythropoietin production in fibrotic murine kidneys.

    PubMed

    Chang, Yu-Ting; Yang, Ching-Chin; Pan, Szu-Yu; Chou, Yu-Hsiang; Chang, Fan-Chi; Lai, Chun-Fu; Tsai, Ming-Hsuan; Hsu, Huan-Lun; Lin, Ching-Hung; Chiang, Wen-Chih; Wu, Ming-Shiou; Chu, Tzong-Shinn; Chen, Yung-Ming; Lin, Shuei-Liong

    2016-02-01

    Renal erythropoietin-producing cells (REPCs) remain in the kidneys of patients with chronic kidney disease, but these cells do not produce sufficient erythropoietin in response to hypoxic stimuli. Treatment with HIF stabilizers rescues erythropoietin production in these cells, but the mechanisms underlying the decreased response of REPCs in fibrotic kidneys to anemic stimulation remain elusive. Here, we show that fibroblast-like FOXD1+ progenitor-derived kidney pericytes, which are characterized by the expression of α1 type I collagen and PDGFRβ, produce erythropoietin through HIF2α regulation but that production is repressed when these cells differentiate into myofibroblasts. DNA methyltransferases and erythropoietin hypermethylation are upregulated in myofibroblasts. Exposure of myofibroblasts to nanomolar concentrations of the demethylating agent 5-azacytidine increased basal expression and hypoxic induction of erythropoietin. Mechanistically, the profibrotic factor TGF-β1 induced hypermethylation and repression of erythropoietin in pericytes; these effects were prevented by 5-azacytidine treatment. These findings shed light on the molecular mechanisms underlying erythropoietin repression in kidney myofibroblasts and demonstrate that clinically relevant, nontoxic doses of 5-azacytidine can restore erythropoietin production and ameliorate anemia in the setting of kidney fibrosis in mice.

  3. Methyltransferase and demethylase profiling studies during brown adipocyte differentiation

    PubMed Central

    Son, Min Jeong; Kim, Won Kon; Oh, Kyoung-Jin; Park, Anna; Lee, Da Som; Han, Baek Soo; Lee, Sang Chul; Bae, Kwang-Hee

    2016-01-01

    Although brown adipose tissue is important with regard to energy balance, the molecular mechanism of brown adipocyte differentiation has not been extensively studied. Specifically, regulation factors at the level of protein modification are largely unknown. In this study, we examine the changes in the expression level of enzymes which are involved in protein lysine methylation during brown adipocyte differentiation. Several enzymes, in this case SUV420H2, PRDM9, MLL3 and JHDM1D, were found to be up-regulated. On the other hand, Set7/9 was significantly down-regulated. In the case of SUV420H2, the expression level increased sharply during brown adipocyte differentiation, whereas the expression of SUV420H2 was marginally enhanced during the white adipocyte differentiation. The knock-down of SUV420H2 caused the suppression of brown adipocyte differentiation, as compared to a scrambled control. These results suggest that SUV420H2, a methyltransferase, is involved in brown adipocyte differentiation, and that the methylation of protein lysine is important in brown adipocyte differentiation. [BMB Reports 2016; 49(7): 388-393] PMID:27157542

  4. Erythrocyte thiopurine methyltransferase activity in a Korean population.

    PubMed

    Jang, I J; Shin, S G; Lee, K H; Yim, D S; Lee, M S; Koo, H H; Kim, H K; Sohn, D R

    1996-11-01

    Thiopurine methyltransferase (TPMT) is the enzyme responsible for the S-methylation of thiopurine drugs. The enzyme, present in human red blood cells (RBC), is known to exhibit genetic polymorphism and interethnic differences in its activity have been demonstrated. We have studied the role of TPMT polymorphism in Koreans and compared enzyme activity between this and other ethnic groups. In a population of 360 unrelated healthy Korean subjects TPMT activity showed a large interindividual variation ranging from 3.2 to 22.9 nmol ml-1 packed RBC h-1 with a median value of 12.0 and mode of 11.0 nmol ml-1 packed RBC h-1. The enzyme activity was higher in male subjects than that in female (median values; 12.2 vs 11.2, 95% confidence interval of the difference; -2.1, 4.0 nmol ml-1 packed RBC h-1). All subjects had detectable TPMT activity, but contrary to previous reports in other ethnic groups, this was distributed unimodally. The median RBC TPMT activity was very similar to values found in Caucasian populations, higher than in Floridian blacks and lower than that of a Norwegian Saami population.

  5. Kinetic Mechanism of Protein N-terminal Methyltransferase 1*

    PubMed Central

    Richardson, Stacie L.; Mao, Yunfei; Zhang, Gang; Hanjra, Pahul; Peterson, Darrell L.; Huang, Rong

    2015-01-01

    The protein N-terminal methyltransferase 1 (NTMT1) catalyzes the transfer of the methyl group from the S-adenosyl-l-methionine to the protein α-amine, resulting in formation of S-adenosyl-l-homocysteine and α-N-methylated proteins. NTMT1 is an interesting potential anticancer target because it is overexpressed in gastrointestinal cancers and plays an important role in cell mitosis. To gain insight into the biochemical mechanism of NTMT1, we have characterized the kinetic mechanism of recombinant NTMT1 using a fluorescence assay and mass spectrometry. The results of initial velocity, product, and dead-end inhibition studies indicate that methylation by NTMT1 proceeds via a random sequential Bi Bi mechanism. In addition, our processivity studies demonstrate that NTMT1 proceeds via a distributive mechanism for multiple methylations. Together, our studies provide new knowledge about the kinetic mechanism of NTMT1 and lay the foundation for the development of mechanism-based inhibitors. PMID:25771539

  6. Mapping the conformational space accessible to catechol-O-methyltransferase.

    PubMed

    Ehler, Andreas; Benz, Jörg; Schlatter, Daniel; Rudolph, Markus G

    2014-08-01

    Methylation catalysed by catechol-O-methyltransferase (COMT) is the main pathway of catechol neurotransmitter deactivation in the prefrontal cortex. Low levels of this class of neurotransmitters are held to be causative of diseases such as schizophrenia, depression and Parkinson's disease. Inhibition of COMT may increase neurotransmitter levels, thus offering a route for treatment. Structure-based drug design hitherto seems to be based on the closed enzyme conformation. Here, a set of apo, semi-holo, holo and Michaelis form crystal structures are described that define the conformational space available to COMT and that include likely intermediates along the catalytic pathway. Domain swaps and sizeable loop movements around the active site testify to the flexibility of this enzyme, rendering COMT a difficult drug target. The low affinity of the co-substrate S-adenosylmethionine and the large conformational changes involved during catalysis highlight significant energetic investment to achieve the closed conformation. Since each conformation of COMT is a bona fide target for inhibitors, other states than the closed conformation may be promising to address. Crystallographic data for an alternative avenue of COMT inhibition, i.e. locking of the apo state by an inhibitor, are presented. The set of COMT structures may prove to be useful for the development of novel classes of inhibitors. PMID:25084335

  7. DNA methyltransferase inhibition restores erythropoietin production in fibrotic murine kidneys.

    PubMed

    Chang, Yu-Ting; Yang, Ching-Chin; Pan, Szu-Yu; Chou, Yu-Hsiang; Chang, Fan-Chi; Lai, Chun-Fu; Tsai, Ming-Hsuan; Hsu, Huan-Lun; Lin, Ching-Hung; Chiang, Wen-Chih; Wu, Ming-Shiou; Chu, Tzong-Shinn; Chen, Yung-Ming; Lin, Shuei-Liong

    2016-02-01

    Renal erythropoietin-producing cells (REPCs) remain in the kidneys of patients with chronic kidney disease, but these cells do not produce sufficient erythropoietin in response to hypoxic stimuli. Treatment with HIF stabilizers rescues erythropoietin production in these cells, but the mechanisms underlying the decreased response of REPCs in fibrotic kidneys to anemic stimulation remain elusive. Here, we show that fibroblast-like FOXD1+ progenitor-derived kidney pericytes, which are characterized by the expression of α1 type I collagen and PDGFRβ, produce erythropoietin through HIF2α regulation but that production is repressed when these cells differentiate into myofibroblasts. DNA methyltransferases and erythropoietin hypermethylation are upregulated in myofibroblasts. Exposure of myofibroblasts to nanomolar concentrations of the demethylating agent 5-azacytidine increased basal expression and hypoxic induction of erythropoietin. Mechanistically, the profibrotic factor TGF-β1 induced hypermethylation and repression of erythropoietin in pericytes; these effects were prevented by 5-azacytidine treatment. These findings shed light on the molecular mechanisms underlying erythropoietin repression in kidney myofibroblasts and demonstrate that clinically relevant, nontoxic doses of 5-azacytidine can restore erythropoietin production and ameliorate anemia in the setting of kidney fibrosis in mice. PMID:26731474

  8. Identification of functional modules of AKMT, a novel lysine methyltransferase regulating the motility of Toxoplasma gondii

    PubMed Central

    Sivagurunathan, Senthilkumar; Heaslip, Aoife; Liu, Jun; Hu, Ke

    2013-01-01

    The intracellular parasite Toxoplasma gondii is a leading cause of congenital neurological defects. To cause disease, it must reiterate its lytic cycle through host cell invasion, replication,and parasite egress. This requires the parasite to sense changes in its environment and switch between the non-motile (for replication) and motile (for invasion and egress) states appropriately. Recently, we discovered a previously unknown mechanism of motility regulation in T. gondii, mediated by a lysine methyltransferase, AKMT (for Apical complex lysine (K) methyltransferase). When AKMT is absent, activation of motility is inhibited, which compromises parasite invasion and egress, and thus severely impairs the lytic cycle. Although the methyltransferase activity of AKMT has been established, the phylogenetic relationship of AKMT with other better studied lysine methyltransferases (KMTs) was not known. Also unknown was the functional relationships between different domains of AKMT. In this work we carried out phylogenetic analyses, which show that AKMT orthologs form a new subfamily of KMTs. We systematically generated truncation mutants of AKMT, and discovered that the predicted enzymatic domain alone is a very poor enzyme and cannot complement the function of AKMT in vivo. Interestingly, the N- and C-terminal domains of the AKMT have drastically different impacts on its enzyme activity, localization as well as in vivo function. Our results thus reveal that AKMT is an unusual, parasite-specific enzyme and identified regions and interactions within this novel lysine methyltransferase that can be used as drug targets. PMID:23685344

  9. Conservation and Functional Importance of Carbon-Oxygen Hydrogen Bonding in AdoMet-Dependent Methyltransferases

    SciTech Connect

    Horowitz, Scott; Dirk, Lynnette M.A.; Yesselman, Joseph D.; Nimtz, Jennifer S.; Adhikari, Upendra; Mehl, Ryan A.; Scheiner, Steve; Houtz, Robert L.; Al-Hashimi, Hashim M.; Trievel, Raymond C.

    2013-09-06

    S-Adenosylmethionine (AdoMet)-based methylation is integral to metabolism and signaling. AdoMet-dependent methyltransferases belong to multiple distinct classes and share a catalytic mechanism that arose through convergent evolution; however, fundamental determinants underlying this shared methyl transfer mechanism remain undefined. A survey of high-resolution crystal structures reveals that unconventional carbon–oxygen (CH···O) hydrogen bonds coordinate the AdoMet methyl group in different methyltransferases irrespective of their class, active site structure, or cofactor binding conformation. Corroborating these observations, quantum chemistry calculations demonstrate that these charged interactions formed by the AdoMet sulfonium cation are stronger than typical CH···O hydrogen bonds. Biochemical and structural studies using a model lysine methyltransferase and an active site mutant that abolishes CH···O hydrogen bonding to AdoMet illustrate that these interactions are important for high-affinity AdoMet binding and transition-state stabilization. Further, crystallographic and NMR dynamics experiments of the wild-type enzyme demonstrate that the CH···O hydrogen bonds constrain the motion of the AdoMet methyl group, potentially facilitating its alignment during catalysis. Collectively, the experimental findings with the model methyltransferase and structural survey imply that methyl CH···O hydrogen bonding represents a convergent evolutionary feature of AdoMet-dependent methyltransferases, mediating a universal mechanism for methyl transfer.

  10. Conservation and functional importance of carbon-oxygen hydrogen bonding in AdoMet-dependent methyltransferases.

    PubMed

    Horowitz, Scott; Dirk, Lynnette M A; Yesselman, Joseph D; Nimtz, Jennifer S; Adhikari, Upendra; Mehl, Ryan A; Scheiner, Steve; Houtz, Robert L; Al-Hashimi, Hashim M; Trievel, Raymond C

    2013-10-16

    S-adenosylmethionine (AdoMet)-based methylation is integral to metabolism and signaling. AdoMet-dependent methyltransferases belong to multiple distinct classes and share a catalytic mechanism that arose through convergent evolution; however, fundamental determinants underlying this shared methyl transfer mechanism remain undefined. A survey of high-resolution crystal structures reveals that unconventional carbon-oxygen (CH···O) hydrogen bonds coordinate the AdoMet methyl group in different methyltransferases irrespective of their class, active site structure, or cofactor binding conformation. Corroborating these observations, quantum chemistry calculations demonstrate that these charged interactions formed by the AdoMet sulfonium cation are stronger than typical CH···O hydrogen bonds. Biochemical and structural studies using a model lysine methyltransferase and an active site mutant that abolishes CH···O hydrogen bonding to AdoMet illustrate that these interactions are important for high-affinity AdoMet binding and transition-state stabilization. Further, crystallographic and NMR dynamics experiments of the wild-type enzyme demonstrate that the CH···O hydrogen bonds constrain the motion of the AdoMet methyl group, potentially facilitating its alignment during catalysis. Collectively, the experimental findings with the model methyltransferase and structural survey imply that methyl CH···O hydrogen bonding represents a convergent evolutionary feature of AdoMet-dependent methyltransferases, mediating a universal mechanism for methyl transfer.

  11. Geographic distribution of methyltransferases of Helicobacter pylori: evidence of human host population isolation and migration

    PubMed Central

    2009-01-01

    Background Helicobacter pylori colonizes the human stomach and is associated with gastritis, peptic ulcer, and gastric cancer. This ubiquitous association between H. pylori and humans is thought to be present since the origin of modern humans. The H. pylori genome encodes for an exceptional number of restriction and modifications (R-M) systems. To evaluate if R-M systems are an adequate tool to determine the geographic distribution of H. pylori strains, we typed 221 strains from Africa, America, Asia, and Europe, and evaluated the expression of different 29 methyltransferases. Results Independence tests and logistic regression models revealed that ten R-M systems correlate with geographical localization. The distribution pattern of these methyltransferases may have been originated by co-divergence of regional H. pylori after its human host migrated out of Africa. The expression of specific methyltransferases in the H. pylori population may also reflect the genetic and cultural background of its human host. Methyltransferases common to all strains, M. HhaI and M. NaeI, are likely conserved in H. pylori, and may have been present in the bacteria genome since the human diaspora out of Africa. Conclusion This study indicates that some methyltransferases are useful geomarkers, which allow discrimination of bacterial populations, and that can be added to our tools to investigate human migrations. PMID:19737407

  12. Weaver Syndrome‐Associated EZH2 Protein Variants Show Impaired Histone Methyltransferase Function In Vitro

    PubMed Central

    Yap, Damian B.; Lewis, M.E. Suzanne; Chijiwa, Chieko; Ramos‐Arroyo, Maria A.; Tkachenko, Natália; Milano, Valentina; Fradin, Mélanie; McKinnon, Margaret L.; Townsend, Katelin N.; Xu, Jieqing; Van Allen, M.I.; Ross, Colin J.D.; Dobyns, William B.; Weaver, David D.; Gibson, William T.

    2016-01-01

    ABSTRACT Weaver syndrome (WS) is a rare congenital disorder characterized by generalized overgrowth, macrocephaly, specific facial features, accelerated bone age, intellectual disability, and susceptibility to cancers. De novo mutations in the enhancer of zeste homolog 2 (EZH2) have been shown to cause WS. EZH2 is a histone methyltransferase that acts as the catalytic agent of the polycomb‐repressive complex 2 (PRC2) to maintain gene repression via methylation of lysine 27 on histone H3 (H3K27). Functional studies investigating histone methyltransferase activity of mutant EZH2 from various cancers have been reported, whereas WS‐associated mutations remain poorly characterized. To investigate the role of EZH2 in WS, we performed functional studies using artificially assembled PRC2 complexes containing mutagenized human EZH2 that reflected the codon changes predicted from patients with WS. We found that WS‐associated amino acid alterations reduce the histone methyltransferase function of EZH2 in this in vitro assay. Our results support the hypothesis that WS is caused by constitutional mutations in EZH2 that alter the histone methyltransferase function of PRC2. However, histone methyltransferase activities of different EZH2 variants do not appear to correlate directly with the phenotypic variability between WS patients and individuals with a common c.553G>C (p.Asp185His) polymorphism in EZH2. PMID:26694085

  13. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.

    PubMed

    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A

    2008-01-01

    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels. PMID:19048493

  14. Catechol-O-methyltransferase association with hemoglobin A1c

    PubMed Central

    Hall, Kathryn T.; Jablonski, Kathleen A.; Chen, Ling; Harden, Maegan; Tolkin, Benjamin R.; Kaptchuk, Ted J.; Bray, George A.; Ridker, Paul M.; Florez, Jose C.; Chasman, Daniel I.

    2016-01-01

    Aims Catecholamines have metabolic effects on blood pressure, insulin sensitivity and blood glucose. Genetic variation in catechol-O-methyltransferase (COMT), an enzyme that degrades catecholamines, is associated with cardiometabolic risk factors and incident cardiovascular disease (CVD). Here we examined COMT effects on glycemic function and type 2 diabetes. Methods We tested whether COMT polymorphisms were associated with baseline HbA1c in the Women’s Genome Health Study (WGHS), and Meta-Analyses of Glucose and Insulin-related traits Consortium (MAGIC), and with susceptibility to type 2 diabetes in WGHS, DIAbetes Genetics Replication And Meta-analysis consortium (DIAGRAM), and the Diabetes Prevention Program (DPP). Given evidence that COMT modifies some drug responses, we examined association with type 2 diabetes and randomized metformin and aspirin treatment. Results COMT rs4680 high-activity G-allele was associated with lower HbA1c in WGHS (β = −0.032% [0.012], p = 0.008) and borderline significant in MAGIC (β = −0.006% [0.003], p = 0.07). Combined COMT per val allele effects on type 2 diabetes were significant (OR = 0.98 [0.96–0.998], p = 0.03) in fixed-effects analyses across WGHS, DIAGRAM, and DPP. Similar results were obtained for 2 other COMT SNPs rs4818 and rs4633. In the DPP, the rs4680 val allele was borderline associated with lower diabetes incidence among participants randomized to metformin (HR = 0.81 [0.65–1.00], p = 0.05). Conclusions COMT rs4680 high-activity G-allele was associated with lower HbA1c and modest protection from type 2 diabetes. The directionality of COMT associations was concordant with those previously observed for cardiometabolic risk factors and CVD. PMID:27282867

  15. O-Methyltransferases involved in biphenyl and dibenzofuran biosynthesis.

    PubMed

    Khalil, Mohammed N A; Brandt, Wolfgang; Beuerle, Till; Reckwell, Dennis; Groeneveld, Josephine; Hänsch, Robert; Gaid, Mariam M; Liu, Benye; Beerhues, Ludger

    2015-07-01

    Biphenyls and dibenzofurans are the phytoalexins of the Malinae involving apple and pear. Biosynthesis of the defence compounds includes two O-methylation reactions. cDNAs encoding the O-methyltransferase (OMT) enzymes were isolated from rowan (Sorbus aucuparia) cell cultures after treatment with an elicitor preparation from the scab-causing fungus, Venturia inaequalis. The preferred substrate for SaOMT1 was 3,5-dihydroxybiphenyl, supplied by the first pathway-specific enzyme, biphenyl synthase (BIS). 3,5-Dihydroxybiphenyl underwent a single methylation reaction in the presence of S-adenosyl-l-methionine (SAM). The second enzyme, SaOMT2, exhibited its highest affinity for noraucuparin, however the turnover rate was greater with 5-hydroxyferulic acid. Both substrates were only methylated at the meta-positioned hydroxyl group. The substrate specificities of the OMTs and the regiospecificities of their reactions were rationalized by homology modeling and substrate docking. Interaction of the substrates with SAM also took place at a position other than the sulfur group. Expression of SaOMT1, SaOMT2 and SaBIS3 was transiently induced in rowan cell cultures by the addition of the fungal elicitor. While the immediate SaOMT1 products were not detectable in elicitor-treated cell cultures, noraucuparin and noreriobofuran accumulated transiently, followed by increasing levels of the SaOMT2 products aucuparin and eriobofuran. SaOMT1, SaOMT2 and SaBIS3 were N- and C-terminally fused with the super cyan fluorescent protein and a modified yellow fluorescent protein, respectively. All the fluorescent reporter fusions were localized to the cytoplasm of Nicotiana benthamiana leaf epidermis cells. A revised biosynthetic pathway of biphenyls and dibenzofurans in the Malinae is presented.

  16. O-Methyltransferases involved in biphenyl and dibenzofuran biosynthesis.

    PubMed

    Khalil, Mohammed N A; Brandt, Wolfgang; Beuerle, Till; Reckwell, Dennis; Groeneveld, Josephine; Hänsch, Robert; Gaid, Mariam M; Liu, Benye; Beerhues, Ludger

    2015-07-01

    Biphenyls and dibenzofurans are the phytoalexins of the Malinae involving apple and pear. Biosynthesis of the defence compounds includes two O-methylation reactions. cDNAs encoding the O-methyltransferase (OMT) enzymes were isolated from rowan (Sorbus aucuparia) cell cultures after treatment with an elicitor preparation from the scab-causing fungus, Venturia inaequalis. The preferred substrate for SaOMT1 was 3,5-dihydroxybiphenyl, supplied by the first pathway-specific enzyme, biphenyl synthase (BIS). 3,5-Dihydroxybiphenyl underwent a single methylation reaction in the presence of S-adenosyl-l-methionine (SAM). The second enzyme, SaOMT2, exhibited its highest affinity for noraucuparin, however the turnover rate was greater with 5-hydroxyferulic acid. Both substrates were only methylated at the meta-positioned hydroxyl group. The substrate specificities of the OMTs and the regiospecificities of their reactions were rationalized by homology modeling and substrate docking. Interaction of the substrates with SAM also took place at a position other than the sulfur group. Expression of SaOMT1, SaOMT2 and SaBIS3 was transiently induced in rowan cell cultures by the addition of the fungal elicitor. While the immediate SaOMT1 products were not detectable in elicitor-treated cell cultures, noraucuparin and noreriobofuran accumulated transiently, followed by increasing levels of the SaOMT2 products aucuparin and eriobofuran. SaOMT1, SaOMT2 and SaBIS3 were N- and C-terminally fused with the super cyan fluorescent protein and a modified yellow fluorescent protein, respectively. All the fluorescent reporter fusions were localized to the cytoplasm of Nicotiana benthamiana leaf epidermis cells. A revised biosynthetic pathway of biphenyls and dibenzofurans in the Malinae is presented. PMID:26017378

  17. Epigenetic regulation of macrophage polarization by DNA methyltransferase 3b.

    PubMed

    Yang, Xiaosong; Wang, Xianfeng; Liu, Dongxu; Yu, Liqing; Xue, Bingzhong; Shi, Hang

    2014-04-01

    Adipose tissue macrophages (ATMs) undergo a phenotypic switch from alternatively activated antiinflammatory M2 macrophages in lean individuals to classically activated proinflammatory M1 macrophages in obese subjects. However, the molecular mechanism underlying this process remains unclear. In this study we aim to determine whether DNA methyltransferase 3b (DNMT3b) regulates macrophage polarization and inflammation. We found that the expression of DNMT3b was significantly induced in macrophages exposed to the saturated fatty acid stearate, was higher in ATMs isolated from obese mice, but was significantly lower in alternatively activated M2 vs classically activated M1 ATMs, suggesting a role for DNMT3b in regulation of macrophage polarization and inflammation in obesity. DNMT3b knockdown promoted macrophage polarization to alternatively activated M2 phenotype and suppressed macrophage inflammation, whereas overexpressing DNMT3b did the opposite. Importantly, in a macrophage-adipocyte coculture system, we found that DNMT3b knockdown significantly improved adipocyte insulin signaling. The promoter of peroxisome proliferator activated receptor (PPAR)γ1, a key transcriptional factor that regulates macrophage polarization, is enriched with CpG sites. Chromatin immunoprecipitation assays showed that DNMT3b bound to the methylation region at PPARγ1 promoter, which was further enhanced by stearate. Moreover, pyrosequencing analysis revealed that stearate increased DNA methylation at PPARγ1, which was prevented by DNMT3b deficiency. Therefore, our data demonstrate that DNMT3b plays an important role in regulating macrophage polarization through epigenetic mechanisms. In obesity, elevated saturated fatty acids enhance DNMT3b expression, leading to DNA methylation at the PPARγ1 promoter, which may contribute to deregulated adipose tissue macrophage polarization, inflammation, and insulin resistance.

  18. Reaction mechanism of guanidinoacetate methyltransferase, concerted or step-wise

    PubMed Central

    Zhang, Xiaodong; Bruice, Thomas C.

    2006-01-01

    We describe a quantum mechanics/molecular mechanics investigation of the guanidinoacetate methyltransferase catalyzed reaction, which shows that proton transfer from guanidinoacetate (GAA) to Asp-134 and methyl transfer from S-adenosyl-l-methionine (AdoMet) to GAA are concerted. By self-consistent-charge density functional tight binding/molecular mechanics, the bond lengths in the concerted mechanism's transition state are 1.26 Å for both the OD1 (Asp-134)–HE (GAA) and HE (GAA)–NE (GAA) bonds, and 2.47 and 2.03 Å for the S8 (AdoMet)–C9 (AdoMet) and C9 (AdoMet)–NE (GAA) bonds, respectively. The potential-energy barrier (ΔE‡) determined by single-point B3LYP/6–31+G*//MM is 18.9 kcal/mol. The contributions of the entropy (−TΔS‡) and zero-point energy corrections Δ(ZPE)‡ by normal mode analysis are 2.3 kcal/mol and −1.7 kcal/mol, respectively. Thus, the activation enthalpy of this concerted mechanism is predicted to be ΔH‡ = ΔE‡ + Δ(ZPE)‡ = 17.2 kcal/mol. The calculated free-energy barrier for the concerted mechanism is ΔG‡ = 19.5 kcal/mol, which is in excellent agreement with the value of 19.0 kcal/mol calculated from the experimental rate constant (3.8 ± 0.2·min−1). PMID:17053070

  19. DNA Methyltransferases: A Novel Target for Prevention and Therapy

    PubMed Central

    Subramaniam, Dharmalingam; Thombre, Ravi; Dhar, Animesh; Anant, Shrikant

    2013-01-01

    Cancer is the second leading cause of death in US. Despite the emergence of new, targeted agents, and the use of various therapeutic combinations, none of the available treatment options are curative in patients with advanced cancer. Epigenetic alterations are increasingly recognized as valuable targets for the development of cancer therapies. DNA methylation at the 5-position of cytosine, catalyzed by DNA methyltransferases (DNMTs), is the predominant epigenetic modification in mammals. DNMT1, the major enzyme responsible for maintenance of the DNA methylation pattern is located at the replication fork and methylates newly biosynthesized DNA. DNMT2 or TRDMT1, the smallest mammalian DNMT is believed to participate in the recognition of DNA damage, DNA recombination, and mutation repair. It is composed solely of the C-terminal domain, and does not possess the regulatory N-terminal region. The levels of DNMTs, especially those of DNMT3B, DNMT3A, and DNMT3L, are often increased in various cancer tissues and cell lines, which may partially account for the hypermethylation of promoter CpG-rich regions of tumor suppressor genes in a variety of malignancies. Moreover, it has been shown to function in self-renewal and maintenance of colon cancer stem cells and need to be studied in several cancers. Inhibition of DNMTs has demonstrated reduction in tumor formation in part through the increased expression of tumor suppressor genes. Hence, DNMTs can potentially be used as anti-cancer targets. Dietary phytochemicals also inhibit DNMTs and cancer stem cells; this represents a promising approach for the prevention and treatment of many cancers. PMID:24822169

  20. Mechanistic studies on transcriptional coactivator protein arginine methyltransferase 1.

    PubMed

    Rust, Heather L; Zurita-Lopez, Cecilia I; Clarke, Steven; Thompson, Paul R

    2011-04-26

    Protein arginine methyltransferases (PRMTs) catalyze the transfer of methyl groups from S-adenosylmethionine (SAM) to the guanidinium group of arginine residues in a number of important cell signaling proteins. PRMT1 is the founding member of this family, and its activity appears to be dysregulated in heart disease and cancer. To begin to characterize the catalytic mechanism of this isozyme, we assessed the effects of mutating a number of highly conserved active site residues (i.e., Y39, R54, E100, E144, E153, M155, and H293), which are believed to play key roles in SAM recognition, substrate binding, and catalysis. The results of these studies, as well as pH-rate studies, and the determination of solvent isotope effects (SIEs) indicate that M155 plays a critical role in both SAM binding and the processivity of the reaction but is not responsible for the regiospecific formation of asymmetrically dimethylated arginine (ADMA). Additionally, mutagenesis studies on H293, combined with pH studies and the lack of a normal SIE, do not support a role for this residue as a general base. Furthermore, the lack of a normal SIE with either the wild type or catalytically impaired mutants suggests that general acid/base catalysis is not important for promoting methyl transfer. This result, combined with the fact that the E144A/E153A double mutant retains considerably more activity then the single mutants alone, suggests that the PRMT1-catalyzed reaction is primarily driven by bringing the substrate guanidinium into the proximity of the S-methyl group of SAM and that the prior deprotonation of the substrate guanidinium is not required for methyl transfer.

  1. Interactions of aminoglycoside antibiotics with rRNA.

    PubMed

    Trylska, Joanna; Kulik, Marta

    2016-08-15

    Aminoglycoside antibiotics are protein synthesis inhibitors applied to treat infections caused mainly by aerobic Gram-negative bacteria. Due to their adverse side effects they are last resort antibiotics typically used to combat pathogens resistant to other drugs. Aminoglycosides target ribosomes. We describe the interactions of aminoglycoside antibiotics containing a 2-deoxystreptamine (2-DOS) ring with 16S rRNA. We review the computational studies, with a focus on molecular dynamics (MD) simulations performed on RNA models mimicking the 2-DOS aminoglycoside binding site in the small ribosomal subunit. We also briefly discuss thermodynamics of interactions of these aminoglycosides with their 16S RNA target. PMID:27528743

  2. Growth rate regulation of rRNA content of a marine Synechococcus (cyanobacterium) strain

    SciTech Connect

    Binder, B.J.; Liu, Y.C.

    1998-09-01

    The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells. The relationship between growth rate and cellular rRNA content comprised three phases: (1) at low growth rates, rRNA cell{sup {minus}1} remained approximately constant; (2) at intermediate rates, rRNA cell{sup {minus}1} increased proportionally with growth rate; and (3) at the highest, light-saturated rates, rRNA cell{sup {minus}1} dropped abruptly. Total cellular RNA was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration were related to growth rate in a manner similar to rRNA cell{sup {minus}1}, although the overall magnitude linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.

  3. Activation and inactivation of methanol: 2-mercaptoethanesulfonic acid methyltransferase from Methanosarcina barkeri.

    PubMed Central

    van der Meijden, P; Heythuysen, H J; Sliepenbeek, H T; Houwen, F P; van der Drift, C; Vogels, G D

    1983-01-01

    Methanol is converted to methane by crude extracts of Methanosarcina barkeri. The first reaction involved in this process, is catalyzed by methanol:2-mercaptoethanesulfonic acid methyltransferase (EC 2.1.1.-). The methyltransferase has an optimum at pH 6.5 and is not inhibited by 2-bromoethanesulfonic acid. Pyridoxal-5'-phosphate acts as an inhibitor (Ki = 0.30 mM). The methyltransferase was tested in the presence of 2-bromoethanesulfonic acid, which inhibits the conversion of 2-(methylthio)ethanesulfonic acid to methane. The reaction is subject to activation and inactivation. Inactivation is brought about by the presence of oxygen, flavin mononucleotide, flavin adenine dinucleotide, and 2-(methylthio)ethanesulfonic acid, the product of the reaction. Activation of the system requires the presence of ATP and Mg2+ and of hydrogen. Hydrogen can be replaced by enzymatic systems, such as pyruvate dehydrogenase, which deliver free hydrogen. PMID:6294063

  4. Discovery of a Potent Class I Protein Arginine Methyltransferase Fragment Inhibitor.

    PubMed

    Ferreira de Freitas, Renato; Eram, Mohammad S; Szewczyk, Magdalena M; Steuber, Holger; Smil, David; Wu, Hong; Li, Fengling; Senisterra, Guillermo; Dong, Aiping; Brown, Peter J; Hitchcock, Marion; Moosmayer, Dieter; Stegmann, Christian M; Egner, Ursula; Arrowsmith, Cheryl; Barsyte-Lovejoy, Dalia; Vedadi, Masoud; Schapira, Matthieu

    2016-02-11

    Protein methyltransferases (PMTs) are a promising target class in oncology and other disease areas. They are composed of SET domain methyltransferases and structurally unrelated Rossman-fold enzymes that include protein arginine methyltransferases (PRMTs). In the absence of a well-defined medicinal chemistry tool-kit focused on PMTs, most current inhibitors were identified by screening large and diverse libraries of leadlike molecules. So far, no successful fragment-based approach was reported against this target class. Here, by deconstructing potent PRMT inhibitors, we find that chemical moieties occupying the substrate arginine-binding site can act as efficient fragment inhibitors. Screening a fragment library against PRMT6 produced numerous hits, including a 300 nM inhibitor (ligand efficiency of 0.56) that decreased global histone 3 arginine 2 methylation in cells, and can serve as a warhead for the development of PRMT chemical probes.

  5. Studies on N5-methyltetrahydrofolate-homocystein methyltransferase in normal and leukemia leukocytes.

    PubMed

    Peytremann, R; Thorndike, J; Beck, W S

    1975-11-01

    A cobalamin-dependent N5-methyltetra-hydrofolate-homocysteine methyltransferase (methyl-transferase) was demonstrated in unfractioned extracts of human normal and leukemia leukocytes. Activity was substantially reduced in the absence of an added cobalamin derivative. Presumably, this residual activity reflects the endogeneous level of holoenzyme. Enzyme activity was notably higher in lymphoid cells than in myeloid cells. Thus, mean specific activities (+/-SD) were: chronic lymphocytic leukemia lymphocytes, 2.15+/-1.16; normal lymphocytes, 0.91+/-0.59; normal mature granulocytes, 0.15+/-0.10; chronic myelocytic leukemia granulocytes, barely detectable activity. Properties of leukocytes enzymes resembled those of methyltransferases previously studied in bacteria and other animal cells. Granulocytes and chronic myelocytic leukemia cells contain a factor or factors that inhibits Escherichia coli enzyme. The data suggest that the prominence of this cobalamin-dependent enzyme in lymphocytes and other mononuclear cell types may be related to their potential for cell division.

  6. Studies on N5-methyltetrahydrofolate-homocystein methyltransferase in normal and leukemia leukocytes.

    PubMed Central

    Peytremann, R; Thorndike, J; Beck, W S

    1975-01-01

    A cobalamin-dependent N5-methyltetra-hydrofolate-homocysteine methyltransferase (methyl-transferase) was demonstrated in unfractioned extracts of human normal and leukemia leukocytes. Activity was substantially reduced in the absence of an added cobalamin derivative. Presumably, this residual activity reflects the endogeneous level of holoenzyme. Enzyme activity was notably higher in lymphoid cells than in myeloid cells. Thus, mean specific activities (+/-SD) were: chronic lymphocytic leukemia lymphocytes, 2.15+/-1.16; normal lymphocytes, 0.91+/-0.59; normal mature granulocytes, 0.15+/-0.10; chronic myelocytic leukemia granulocytes, barely detectable activity. Properties of leukocytes enzymes resembled those of methyltransferases previously studied in bacteria and other animal cells. Granulocytes and chronic myelocytic leukemia cells contain a factor or factors that inhibits Escherichia coli enzyme. The data suggest that the prominence of this cobalamin-dependent enzyme in lymphocytes and other mononuclear cell types may be related to their potential for cell division. PMID:1184750

  7. UPF0586 Protein C9orf41 Homolog Is Anserine-producing Methyltransferase*

    PubMed Central

    Drozak, Jakub; Piecuch, Maria; Poleszak, Olga; Kozlowski, Piotr; Chrobok, Lukasz; Baelde, Hans J.; de Heer, Emile

    2015-01-01

    Anserine (β-alanyl-N(Pi)-methyl-l-histidine), a methylated derivative of carnosine (β-alanyl-l-histidine), is an abundant constituent of vertebrate skeletal muscles. Although it has been suggested to serve as a proton buffer and radical scavenger, its physiological function remains mysterious. The formation of anserine is catalyzed by carnosine N-methyltransferase, recently identified in chicken as histamine N-methyltransferase-like (HNMT-like) protein. Although the HNMT-like gene is absent in mammalian genomes, the activity of carnosine N-methyltransferase was reported in most mammalian species. In the present investigation, we purified carnosine N-methyltransferase from rat muscles about 2600-fold. Three polypeptides of ∼45, 50, and 70 kDa coeluting with the enzyme activity were identified in the preparation. Mass spectrometry analysis of these polypeptides resulted in the identification of UPF0586 protein C9orf41 homolog as the only meaningful candidate. Rat UPF0586 and its yeast, chicken, and human orthologs were expressed in COS-7 cells and purified to homogeneity. Although all recombinant proteins catalyzed the formation of anserine, as confirmed by chromatographic and mass spectrometry analysis, rat UPF0586 was more active on carnosine than other orthologs. Confocal microscopy of HeLa cells expressing recombinant UPF5086 proteins revealed their presence in both cytosol and nucleus. Carnosine and Gly-His were the best substrates for all UPF0586 orthologs studied, although the enzymes also methylated other l-histidine-containing di- and tripeptides. Finally, cotransfection of COS-7 cells with rat or human UPF0586 and carnosine synthase transformed the cells into efficient anserine producers. We conclude that UPF0586 is mammalian carnosine N-methyltransferase and hypothesize that it may also serve as a peptide or protein methyltransferase in eukaryotes. PMID:26001783

  8. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    PubMed

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  9. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules

    PubMed Central

    McDonald, James E.; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J.; Hall, Neil; McCarthy, Alan J.; Allison, Heather E.

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, ‘universal’ SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by ‘universal’ primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  10. Cloning, expression, purification and crystallization of Schizosaccharomyces pombe Set7, a putative histone methyltransferase.

    PubMed

    Mevius, Damiaan E H F; Shen, Yunpeng; Morishita, Masayo; di Luccio, Eric

    2016-04-01

    Dysfunction of histone-modifying enzymes affects chromatin regulation and is involved in carcinogenesis, tumour progression and other diseases. Histone methyltransferases are a family of key histone-modifying enzymes, but their structures, functions and mechanisms are incompletely understood, thus constraining drug-design efforts. Here, preliminary steps towards structure-function studies of Schizosaccharomyces pombe Set7, a putative histone methyltransferase and the first yeast full-length SET-domain-containing protein to be studied using X-ray crystallography, are reported. The methods from cloning to X-ray diffraction and phasing are discussed and the results will aid in prospective studies of histone-modifying enzymes.

  11. The RNA–Methyltransferase Misu (NSun2) Poises Epidermal Stem Cells to Differentiate

    PubMed Central

    Blanco, Sandra; Kurowski, Agata; Nichols, Jennifer; Watt, Fiona M.; Benitah, Salvador Aznar; Frye, Michaela

    2011-01-01

    Homeostasis of most adult tissues is maintained by balancing stem cell self-renewal and differentiation, but whether post-transcriptional mechanisms can regulate this process is unknown. Here, we identify that an RNA methyltransferase (Misu/Nsun2) is required to balance stem cell self-renewal and differentiation in skin. In the epidermis, this methyltransferase is found in a defined sub-population of hair follicle stem cells poised to undergo lineage commitment, and its depletion results in enhanced quiescence and aberrant stem cell differentiation. Our results reveal that post-transcriptional RNA methylation can play a previously unappreciated role in controlling stem cell fate. PMID:22144916

  12. Higher-order structure of rRNA

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Woese, C. R.

    1986-01-01

    A comparative search for phylogenetically covarying basepair replacements within potential helices has been the only reliable method to determine the correct secondary structure of the 3 rRNAs, 5S, 16S, and 23S. The analysis of 16S from a wide phylogenetic spectrum, that includes various branches of the eubacteria, archaebacteria, eucaryotes, in addition to the mitochondria and chloroplast, is beginning to reveal the constraints on the secondary structures of these rRNAs. Based on the success of this analysis, and the assumption that higher order structure will also be phylogenetically conserved, a comparative search was initiated for positions that show co-variation not involved in secondary structure helices. From a list of potential higher order interactions within 16S rRNA, two higher-order interactions are presented. The first of these interactions involves positions 570 and 866. Based on the extent of phylogenetic covariation between these positions while maintaining Watson-Crick pairing, this higher-order interaction is considered proven. The other interaction involves a minimum of six positions between the 1400 and 1500 regions of the 16S rRNA. Although these patterns of covariation are not as striking as the 570/866 interaction, the fact that they all exist in an anti-parallel fashion and that experimental methods previously implicated these two regions of the molecule in tRNA function suggests that these interactions be given serious consideration.

  13. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  14. Radiometric assay for phenylethanolamine N-methyltransferase and catechol O-methyltransferase in a single tissue sample: application to rat hypothalamic nuclei, pineal gland, and heart

    SciTech Connect

    Culman, J.; Torda, T.; Weise, V.K.

    1987-08-01

    A simple and highly sensitive method for simultaneous assay of phenylethanolamine N-methyltransferase (PNMT) and catechol O-methyltransferase (COMT) is described. These enzymes are determined in a single tissue homogenate using S-(methyl-/sup 3/H) adenosyl-L-methionine as methyl donor and sequentially incubating with the substrates phenylethanolamine and epinephrine. The radioactive products of the enzymatic reactions, N-methylphenylethanolamine and metanephrine, are extracted and then separated by thin-layer chromatography. The identity of the reaction products has been established chromatographically and the conditions for both enzymatic reactions in the assay procedure have been defined. Measurement of PNMT activity in the rat pineal gland or in minute fragments of other tissues (e.g., brain nuclei) has not been possible using previously described methods. Activities of PNMT and COMT in the rat pineal gland, various hypothalamic nuclei, and the auricular and ventricular myocardia are herein reported.

  15. Protein-arginine methyltransferase 1 (PRMT1) methylates Ash2L, a shared component of mammalian histone H3K4 methyltransferase complexes.

    PubMed

    Butler, Jill S; Zurita-Lopez, Cecilia I; Clarke, Steven G; Bedford, Mark T; Dent, Sharon Y R

    2011-04-01

    Multiple enzymes and enzymatic complexes coordinately regulate the addition and removal of post-translational modifications on histone proteins. The oncoprotein Ash2L is a component of the mixed lineage leukemia (MLL) family members 1-4, Setd1A, and Setd1B mammalian histone H3K4 methyltransferase complexes and is essential to maintain global trimethylation of histone H3K4. However, regulation of these complexes at the level of expression and activity remains poorly understood. In this report, we demonstrate that Ash2L is methylated on arginine residues both in vitro and in cells. We found that both protein-arginine methyltransferases 1 and 5 methylate Arg-296 within Ash2L. These findings are the first to demonstrate that post-translational modifications occur on the Ash2L protein and provide a novel example of cross-talk between chromatin-modifying enzyme complexes. PMID:21285357

  16. Properly substituted analogues of BIX-01294 lose inhibition of G9a histone methyltransferase and gain selective anti-DNA methyltransferase 3A activity.

    PubMed

    Rotili, Dante; Tarantino, Domenico; Marrocco, Biagina; Gros, Christina; Masson, Véronique; Poughon, Valérie; Ausseil, Fréderic; Chang, Yanqi; Labella, Donatella; Cosconati, Sandro; Di Maro, Salvatore; Novellino, Ettore; Schnekenburger, Michael; Grandjenette, Cindy; Bouvy, Celine; Diederich, Marc; Cheng, Xiaodong; Arimondo, Paola B; Mai, Antonello

    2014-01-01

    Chemical manipulations performed on the histone H3 lysine 9 methyltransferases (G9a/GLP) inhibitor BIX-01294 afforded novel desmethoxyquinazolines able to inhibit the DNA methyltransferase DNMT3A at low micromolar levels without any significant inhibition of DNMT1 and G9a. In KG-1 cells such compounds, when tested at sub-toxic doses, induced the luciferase re-expression in a stable construct controlled by a cytomegalovirus (CMV) promoter silenced by methylation (CMV-luc assay). Finally, in human lymphoma U-937 and RAJI cells, the N-(1-benzylpiperidin-4-yl)-2-(4-phenylpiperazin-1-yl)quinazolin-4-amine induced the highest proliferation arrest and cell death induction starting from 10 µM, in agreement with its DNMT3A inhibitory potency. PMID:24810902

  17. Structural and functional studies of Bud23-Trm112 reveal 18S rRNA N7-G1575 methylation occurs on late 40S precursor ribosomes.

    PubMed

    Létoquart, Juliette; Huvelle, Emmeline; Wacheul, Ludivine; Bourgeois, Gabrielle; Zorbas, Christiane; Graille, Marc; Heurgué-Hamard, Valérie; Lafontaine, Denis L J

    2014-12-23

    The eukaryotic small ribosomal subunit carries only four ribosomal (r) RNA methylated bases, all close to important functional sites. N(7)-methylguanosine (m(7)G) introduced at position 1575 on 18S rRNA by Bud23-Trm112 is at a ridge forming a steric block between P- and E-site tRNAs. Here we report atomic resolution structures of Bud23-Trm112 in the apo and S-adenosyl-L-methionine (SAM)-bound forms. Bud23 and Trm112 interact through formation of a β-zipper involving main-chain atoms, burying an important hydrophobic surface and stabilizing the complex. The structures revealed that the coactivator Trm112 undergoes an induced fit to accommodate its methyltransferase (MTase) partner. We report important structural similarity between the active sites of Bud23 and Coffea canephora xanthosine MTase, leading us to propose and validate experimentally a model for G1575 coordination. We identify Bud23 residues important for Bud23-Trm112 complex formation and recruitment to pre-ribosomes. We report that though Bud23-Trm112 binds precursor ribosomes at an early nucleolar stage, m(7)G methylation occurs at a late step of small subunit biogenesis, implying specifically delayed catalytic activation. Finally, we show that Bud23-Trm112 interacts directly with the box C/D snoRNA U3-associated DEAH RNA helicase Dhr1 supposedly involved in central pseudoknot formation; this suggests that Bud23-Trm112 might also contribute to controlling formation of this irreversible and dramatic structural reorganization essential to overall folding of small subunit rRNA. Our study contributes important new elements to our understanding of key molecular aspects of human ribosomopathy syndromes associated with WBSCR22 (human Bud23) malfunction.

  18. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  19. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  20. Guanidinoacetate Methyltransferase (GAMT) Deficiency: Late Onset of Movement Disorder and Preserved Expressive Language

    ERIC Educational Resources Information Center

    O'Rourke, Declan J.; Ryan, Stephanie; Salomons, Gajja; Jakobs, Cornelis; Monavari, Ahmad; King, Mary D.

    2009-01-01

    Guanidinoacetate methyltransferase (GAMT) deficiency is a disorder of creatine biosynthesis, characterized by early-onset learning disability and epilepsy in most affected children. Severe expressive language delay is a constant feature even in the mildest clinical phenotypes. We report the clinical, biochemical, imaging, and treatment data of two…

  1. CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC (III) METHYLTRANSFERASE (CYT19)

    EPA Science Inventory

    CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE (cyt19)

    Stephen B. Waters1 , Felicia Walton1 , Miroslav Styblo1 , Karen Herbin-Davis2, and David J. Thomas2 1 School of Medicine, University of North Carolina at Chape...

  2. CLONING, EXPRESSION, AND MUTATIONAL ANALYSIS OF RAT S-ADENOSYL-1-METHIONINE: ARSENIC (III) METHYLTRANSFERASE

    EPA Science Inventory

    CLONING, EXPRESSION, AND MUTATIONAL ANALYSIS OF RAT
    S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE

    Stephen B. Waters, Ph.D., Miroslav Styblo, Ph.D., Melinda A. Beck, Ph.D., University of North Carolina at Chapel Hill; David J. Thomas, Ph.D., U.S. Environmental...

  3. CHARACTERIZATION OF HUMAN URINARY BLADDER CELL LINE UROTSA TRANSDUCED WITH RAT ASLLL-METHYLTRANSFERASE

    EPA Science Inventory


    In humans, the biomethylation of arsenic (As) is catalyzed by an As(III)-methyltransferase (Cyt19) and yields pentavalent and trivalent methylated arsenicals. Cyt19 activity and expression levels vary among tissues. For example, Cyt19 mRNA is not detected in UROtsa cells, a h...

  4. Functional characterization of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lignin is a significant recalcitrant in the conversion of plant biomass to bioethanol. Cinnamyl alcohol dehydrogenase (CAD) and caffeic acid O-methyltransferase (COMT) catalyze key steps in the pathway of lignin monomer biosynthesis. Brown midrib mutants in Zea mays and Sorghum bicolor with impaired...

  5. SABATH Methyltransferases from White Spruce (Picea glauca [Moench] Voss): Gene Cloning, Functional Characterization and Structural Analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Known members of the plant SABATH family of methyltransferases have important biological functions by methylating hormones, signaling molecules and other metabolites. While all previously characterized SABATH genes were isolated from angiosperms, in this article, we report on the isolation and funct...

  6. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

  7. Accidental Amplification and Inactivation of a Methyltransferase Gene Eliminates Cytosine Methylation in Mycosphaerella Graminicola

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A de novo search for repetitive elements in the genome sequence of the wheat pathogen Mycosphaerella graminicola identified a family of repeats containing a DNA methyltransferase sequence (MgDNMT), which is a homologue of the Neurospora crassa Dim-2 gene. A total of 28 MgDNMT sequences was identifie...

  8. A label-free electrochemical strategy for highly sensitive methyltransferase activity assays.

    PubMed

    Zhou, Jiawan; Zhang, Xiaohua; Xiong, Erhu; Yu, Peng; Chen, Jinhua

    2015-03-25

    A new electrochemical strategy for the simple and ultrasensitive evaluation of DNA methyltransferase (MTase) activity was developed based on electrocatalytic oxidation of ascorbic acid by graphene. In addition, the suitability of this sensing platform for MTase inhibitor screening was also demonstrated.

  9. A NOVEL S-ADENOSYL-L-METHIONINE: ARSENIC (III) METHYLTRANSFERASE FROM RAT LIVER CYTOSOL

    EPA Science Inventory

    A Novel S-Adenosyl-L-methionine: Arsenic(III) Methyltransferase from Rat Liver Cytosol
    Shan Lin, Qing Shi, F. Brent Nix, Miroslav Styblo, Melinda A. Beck, Karen M. Herbin-Davis, Larry L. Hall, Josef B. Simeonsson, and David J. Thomas
    S-adenosyl-L-methionine (AdoMet): ar...

  10. Mutational analysis of the N-methyltransferase domain of the multifunctional enzyme enniatin synthetase.

    PubMed

    Hacker, C; Glinski, M; Hornbogen, T; Doller, A; Zocher, R

    2000-10-01

    N-Methylcyclopeptides like cyclosporins and enniatins are synthesized by multifunctional enzymes representing hybrid systems of peptide synthetases and S-adenosyl-l-methionine (AdoMet)-dependent N-methyltransferases. The latter constitute a new family of N-methyltransferases sharing high homology within procaryotes and eucaryotes. Here we describe the mutational analysis of the N-methyltransferase domain of enniatin synthetase from Fusarium scirpi to gain insight into the assembly of the AdoMet-binding site. The role of four conserved motifs (I, (2085)VLEIGTGSGMIL; II/Y, (2105)SYVGLDPS; IV, (2152)DLVVFNSVVQYFTPPEYL; and V, (2194)ATNGHFLAARA) in cofactor binding as measured by photolabeling was studied. Deletion of the first 21 N-terminal amino acid residues of the N-methyltransferase domain did not affect AdoMet binding. Further shortening close to motif I resulted in loss of binding activity. Truncation of 38 amino acids from the C terminus and also internal deletions containing motif V led to complete loss of AdoMet-binding activity. Point mutations converting the conserved Tyr(223) (corresponding to position 2106 in enniatin synthetase) in motif II/Y (close to motif I) into Val, Ala, and Ser, respectively, strongly diminished AdoMet binding, whereas conversion of this residue to Phe restored AdoMet-binding activity to approximately 70%, indicating that Tyr(223) is important for AdoMet binding and that the aromatic Tyr(223) may be crucial for AdoMet binding in N-methylpeptide synthetases.

  11. rmtA, encoding a putative anginine methyltransferase, regulates secondary metabolism and development in Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus is found colonizing numerous oil seed crops such as corn, peanuts, sorghum, treenuts and cotton worldwide, contaminating them with aflatoxin and other harmful potent toxins. In the phylogenetically related model fungus Aspergillus nidulans, the methyltransferase, RmtA, has been de...

  12. Association of Catechol-O-Methyltransferase (COMT) Polymorphism and Academic Achievement in a Chinese Cohort

    ERIC Educational Resources Information Center

    Yeh, Ting-Kuang; Chang, Chun-Yen; Hu, Chung-Yi; Yeh, Ting-Chi; Lin, Ming-Yeh

    2009-01-01

    Catechol-O-methyltransferase (COMT) is a methylation enzyme that catalyzes the degradation pathway and inactivation of dopamine. It is accepted widely as being involved in the modulation of dopaminergic physiology and prefrontal cortex (PFC) function. The COMT Val158Met polymorphism is associated with variation in COMT activity. COMT 158Met allele…

  13. Catechol-O-methyltransferase: a method for autoradiographic visualization of isozymes in cellogel

    SciTech Connect

    Brahe, C.; Crosti, N.; Meera Khan, P.; Serra, A.

    1984-02-01

    An electrophoretic procedure for separating the molecular forms of catechol-O-methyltransferase in cellulose acetate gel is described; the zones of enzyme activity were revealed by autoradiography. The electrophoretic patterns of the enzyme in several tissues and cell lines derived from four different species are presented.

  14. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  15. Genomic Survey, Gene Expression Analysis and Structural Modeling Suggest Diverse Roles of DNA Methyltransferases in Legumes

    PubMed Central

    Garg, Rohini; Kumari, Romika; Tiwari, Sneha; Goyal, Shweta

    2014-01-01

    DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases), namely Methyltransferase (MET), Chromomethylase (CMT) and Domains Rearranged Methyltransferase (DRM), which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2) subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA) MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes. PMID:24586452

  16. Floral benzenoid carboxyl methyltransferases: From in vitro to in planta function

    PubMed Central

    Effmert, Uta; Saschenbrecker, Sandra; Ross, Jeannine; Negre, Florence; Fraser, Chris M.; Noel, Joseph P.; Dudareva, Natalia; Piechulla, Birgit

    2010-01-01

    Benzenoid carboxyl methyltransferases synthesize methyl esters (e.g., methyl benzoate and methyl salicylate), which are constituents of aromas and scents of many plant species and play important roles in plant communication with the surrounding environment. Within the past five years, eleven such carboxyl methyltransferases were isolated and most of them were comprehensively investigated at the biochemical, molecular and structural level. Two types of enzymes can be distinguished according to their substrate preferences: the SAMT-type enzymes isolated from Clarkia breweri, Stephanotis floribunda, Antirrhinum majus, Hoya carnosa, and Petunia hybrida, which have a higher catalytic efficiency and preference for salicylic acid, while BAMT-type enzymes from A. majus, Arabidopsis thaliana, Arabidopsis lyrata, and Nicotiana suaveolens prefer benzoic acid. The elucidation of C. breweri SAMT’s three-dimensional structure allowed a detailed modelling of the active sites of the carboxyl methyltransferases and revealed that the SAM binding pocket is highly conserved among these enzymes while the methyl acceptor binding site exhibits some variability, allowing a classification into SAMT-type and BAMT-type enzymes. The analysis of expression patterns coupled with biochemical characterization showed that these carboxyl methyltransferases are involved either in floral scent biosynthesis or in plant defense responses. While the latter can be induced by biotic or abiotic stress, the genes responsible for floral scent synthesis exhibit developmental and rhythmic expression pattern. The nature of the product and efficiency of its formation in planta depend on the availability of substrates, the catalytic efficiency of the enzyme toward benzoic acid and/or salicylic acid, and the transcriptional, translational, and post-translational regulation at the enzyme level. The biochemical properties of benzenoid carboxyl methyltransferases suggest that the genes involved in plant defenses

  17. Floral Benzenoid Carboxyl Methyltransferases: From in Vitro to in Planta Function

    SciTech Connect

    Effmert,U.; Saschenbrecker, S.; Ross, J.; Negre, F.; Fraser, C.; Noel, J.; Dudareva, N.; Piechulla, B.

    2005-01-01

    Benzenoid carboxyl methyltransferases synthesize methyl esters (e.g., methyl benzoate and methyl salicylate), which are constituents of aromas and scents of many plant species and play important roles in plant communication with the surrounding environment. Within the past five years, eleven such carboxyl methyltransferases were isolated and most of them were comprehensively investigated at the biochemical, molecular and structural level. Two types of enzymes can be distinguished according to their substrate preferences: the SAMT-type enzymes isolated from Clarkia breweri, Stephanotis floribunda, Antirrhinum majus, Hoya carnosa, and Petunia hybrida, which have a higher catalytic efficiency and preference for salicylic acid, while BAMT-type enzymes from A. majus, Arabidopsis thaliana, Arabidopsis lyrata, and Nicotiana suaveolens prefer benzoic acid. The elucidation of C. breweri SAMT's three-dimensional structure allowed a detailed modelling of the active sites of the carboxyl methyltransferases and revealed that the SAM binding pocket is highly conserved among these enzymes while the methyl acceptor binding site exhibits some variability, allowing a classification into SAMT-type and BAMT-type enzymes. The analysis of expression patterns coupled with biochemical characterization showed that these carboxyl methyltransferases are involved either in floral scent biosynthesis or in plant defense responses. While the latter can be induced by biotic or abiotic stress, the genes responsible for floral scent synthesis exhibit developmental and rhythmic expression pattern. The nature of the product and efficiency of its formation in plants depend on the availability of substrates, the catalytic efficiency of the enzyme toward benzoic acid and/or salicylic acid, and the transcriptional, translational, and post-translational regulation at the enzyme level. The biochemical properties of benzenoid carboxyl methyltransferases suggest that the genes involved in plant defenses

  18. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  19. A conformational switch in the active site of BT_2972, a methyltransferase from an antibiotic resistant pathogen B. thetaiotaomicron.

    PubMed

    Kumar, Veerendra; Sivaraman, J

    2011-01-01

    Methylation is one of the most common biochemical reactions involved in cellular and metabolic functions and is catalysed by the action of methyltransferases. Bacteroides thetaiotaomicron is an antibiotic-resistant bacterium that confers resistance through methylation, and as yet, there is no report on the structure of methyltransferases from this bacterium. Here, we report the crystal structure of an AdoMet-dependent methyltransferase, BT_2972 and its complex with AdoMet and AdoHcy for B. thetaiotaomicron VPI-5482 strain along with isothermal titration calorimetric assessment of the binding affinities. Comparison of the apo and complexed BT_2972 structures reveals a significant conformational change between open and closed forms of the active site that presumably regulates the association with cofactors and may aid interaction with substrate. Together, our analysis suggests that BT_2972 is a small molecule methyltransferase and might catalyze two O-methylation reaction steps involved in the ubiquinone biosynthesis pathway. PMID:22140448

  20. Mouse arsenic (+3 oxidation state) methyltransferase genotype affects metabolism and tissue dosimetry of arsenicals after arsenite administration in drinking water

    EPA Science Inventory

    Arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes methylation of inorganic arsenic producing a number of methylated arsenic metabolites. Although methylation has been commonly considered a pathway for detoxification of arsenic, some highly reactive methylated ars...

  1. New archaeal methyltransferases forming 1-methyladenosine or 1-methyladenosine and 1-methylguanosine at position 9 of tRNA

    PubMed Central

    Kempenaers, Morgane; Roovers, Martine; Oudjama, Yamina; Tkaczuk, Karolina L.; Bujnicki, Janusz M.; Droogmans, Louis

    2010-01-01

    Two archaeal tRNA methyltransferases belonging to the SPOUT superfamily and displaying unexpected activities are identified. These enzymes are orthologous to the yeast Trm10p methyltransferase, which catalyses the formation of 1-methylguanosine at position 9 of tRNA. In contrast, the Trm10p orthologue from the crenarchaeon Sulfolobus acidocaldarius forms 1-methyladenosine at the same position. Even more surprisingly, the Trm10p orthologue from the euryarchaeon Thermococcus kodakaraensis methylates the N1-atom of either adenosine or guanosine at position 9 in different tRNAs. This is to our knowledge the first example of a tRNA methyltransferase with a broadened nucleoside recognition capability. The evolution of tRNA methyltransferases methylating the N1 atom of a purine residue is discussed. PMID:20525789

  2. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

    PubMed

    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

    2010-09-20

    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer. PMID:20015628

  3. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  4. Tetrathiobacter kashmirensis Strain CA-1 16S rRNA gene complete sequence.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study used 1326 base pair 16S rRNA gene sequence methods to confirm the identification of a bacterium as Tetrathiobacter kashmirensis. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification of the bacterium. The isolate...

  5. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  6. Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations.

    PubMed

    Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes

    2015-10-01

    The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci.

  7. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  8. Nucleolar Assembly of the Rrna Processing Machinery in Living Cells

    PubMed Central

    Savino, Tulia Maria; Gébrane-Younès, Jeannine; De Mey, Jan; Sibarita, Jean-Baptiste; Hernandez-Verdun, Danièle

    2001-01-01

    To understand how nuclear machineries are targeted to accurate locations during nuclear assembly, we investigated the pathway of the ribosomal RNA (rRNA) processing machinery towards ribosomal genes (nucleolar organizer regions [NORs]) at exit of mitosis. To follow in living cells two permanently transfected green fluorescence protein–tagged nucleolar proteins, fibrillarin and Nop52, from metaphase to G1, 4-D time-lapse microscopy was used. In early telophase, fibrillarin is concentrated simultaneously in prenucleolar bodies (PNBs) and NORs, whereas PNB-containing Nop52 forms later. These distinct PNBs assemble at the chromosome surface. Analysis of PNB movement does not reveal the migration of PNBs towards the nucleolus, but rather a directional flow between PNBs and between PNBs and the nucleolus, ensuring progressive delivery of proteins into nucleoli. This delivery appeared organized in morphologically distinct structures visible by electron microscopy, suggesting transfer of large complexes. We propose that the temporal order of PNB assembly and disassembly controls nucleolar delivery of these proteins, and that accumulation of processing complexes in the nucleolus is driven by pre-rRNA concentration. Initial nucleolar formation around competent NORs appears to be followed by regroupment of the NORs into a single nucleolus 1 h later to complete the nucleolar assembly. This demonstrates the formation of one functional domain by cooperative interactions between different chromosome territories. PMID:11381093

  9. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  10. Sulfur-Oxygen Chalcogen Bonding Mediates AdoMet Recognition in the Lysine Methyltransferase SET7/9.

    PubMed

    Fick, Robert J; Kroner, Grace M; Nepal, Binod; Magnani, Roberta; Horowitz, Scott; Houtz, Robert L; Scheiner, Steve; Trievel, Raymond C

    2016-03-18

    Recent studies have demonstrated that carbon-oxygen (CH···O) hydrogen bonds have important roles in S-adenosylmethionine (AdoMet) recognition and catalysis in methyltransferases. Here, we investigate noncovalent interactions that occur between the AdoMet sulfur cation and oxygen atoms in methyltransferase active sites. These interactions represent sulfur-oxygen (S···O) chalcogen bonds in which the oxygen atom donates a lone pair of electrons to the σ antibonding orbital of the AdoMet sulfur atom. Structural, biochemical, and computational analyses of an asparagine mutation in the lysine methyltransferase SET7/9 that abolishes AdoMet S···O chalcogen bonding reveal that this interaction enhances substrate binding affinity relative to the product S-adenosylhomocysteine. Corroborative quantum mechanical calculations demonstrate that sulfonium systems form strong S···O chalcogen bonds relative to their neutral thioether counterparts. An inspection of high-resolution crystal structures reveals the presence of AdoMet S···O chalcogen bonding in different classes of methyltransferases, illustrating that these interactions are not limited to SET domain methyltransferases. Together, these results demonstrate that S···O chalcogen bonds contribute to AdoMet recognition and can enable methyltransferases to distinguish between substrate and product.

  11. Herbivore-Induced SABATH Methyltransferases of Maize That Methylate Anthranilic Acid Using S-Adenosyl-l-Methionine1[W

    PubMed Central

    Köllner, Tobias G.; Lenk, Claudia; Zhao, Nan; Seidl-Adams, Irmgard; Gershenzon, Jonathan; Chen, Feng; Degenhardt, Jörg

    2010-01-01

    Volatile methyl esters are common constituents of plant volatiles with important functions in plant defense. To study the biosynthesis of these compounds, especially methyl anthranilate and methyl salicylate, we identified a group of methyltransferases that are members of the SABATH enzyme family in maize (Zea mays). In vitro biochemical characterization after bacterial expression revealed three S-adenosyl-l-methionine-dependent methyltransferases with high specificity for anthranilic acid as a substrate. Of these three proteins, Anthranilic Acid Methyltransferase1 (AAMT1) appears to be responsible for most of the S-adenosyl-l-methionine-dependent methyltransferase activity and methyl anthranilate formation observed in maize after herbivore damage. The enzymes may also be involved in the formation of low amounts of methyl salicylate, which are emitted from herbivore-damaged maize. Homology-based structural modeling combined with site-directed mutagenesis identified two amino acid residues, designated tyrosine-246 and glutamine-167 in AAMT1, which are responsible for the high specificity of AAMTs toward anthranilic acid. These residues are conserved in each of the three main clades of the SABATH family, indicating that the carboxyl methyltransferases are functionally separated by these clades. In maize, this gene family has diversified especially toward benzenoid carboxyl methyltransferases that accept anthranilic acid and benzoic acid. PMID:20519632

  12. Strategies used by pathogenic and nonpathogenic mycobacteria to synthesize rRNA.

    PubMed Central

    Gonzalez-y-Merchand, J A; Garcia, M J; Gonzalez-Rico, S; Colston, M J; Cox, R A

    1997-01-01

    One rRNA operon of all mycobacteria studied so far is located downstream from a gene thought to code for the enzyme UDP-N-acetylglucosamine carboxyvinyl transferase (UNAcGCT), which is important to cell wall synthesis. This operon has been designated rrnAf for fast-growing mycobacteria and rrnAs for slow growers. We have investigated the upstream sequences and promoter activities of rrnA operons of typical fast growers which also possess a second rrn (rrnBf) operon and of the rrnA operons of the fast growers Mycobacterium abscessus and Mycobacterium chelonae, which each have a single rrn operon per genome. These fast growers have a common strategy for increasing the efficiency of transcription of their rrnA operons, thereby increasing the cells' potential for ribosome synthesis. This strategy involves the use of multiple (three to five) promoters which may have arisen through successive duplication events. Thus we have identified a hypervariable multiple promoter region (HMPR) located between the UNAcGCT gene and the 16S rRNA coding region. Two promoters, P1 and PCL1, appear to play pivotal roles in mycobacterial rRNA synthesis; they are present in all of the species examined and are the only promoters used for rRNA synthesis by the pathogenic slow growers. P1 is located within the coding region of the UNAcGCT gene, and PCL1 has a characteristic sequence that is related to but distinct from that of the additional promoters. In fast-growing species, P1 and PCL1 produce less than 10% of rRNA transcripts, so the additional promoters found in the HMPR are important in increasing the potential for rRNA synthesis during rapid growth. In contrast, rrnB operons appear to be regulated by a single promoter; because less divergence has taken place, rrnB appears to be younger than rrnA. PMID:9371439

  13. Crystallization and preliminary X-ray diffraction studies of a catechol-O-methyltransferase/inhibitor complex

    SciTech Connect

    Rodrigues, M. L.; Bonifácio, M. J.; Soares-da-Silva, P.; Carrondo, M. A.; Archer, M.

    2005-01-01

    Catechol-O-methyltransferase has been co-crystallized with a novel inhibitor, which has potential therapeutic application in the Parkinson’s disease therapy. Inhibitors of the enzyme catechol-O-methyltransferase (COMT) are used as co-adjuvants in the therapy of Parkinson’s disease. A recombinant form of the soluble cytosolic COMT from rat has been co-crystallized with a new potent inhibitor, BIA 8-176 [(3,4-dihydroxy-2-nitrophenyl)phenylmethanone], by the vapour-diffusion method using PEG 6K as precipitant. Crystals diffract to 1.6 Å resolution on a synchrotron-radiation source and belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 52.77, b = 79.63, c = 61.54 Å, β = 91.14°.

  14. Biochemical Studies of Mycobacterial Fatty Acid Methyltransferase: A Catalyst for the Enzymatic Production of Biodiesel.

    PubMed

    Petronikolou, Nektaria; Nair, Satish K

    2015-11-19

    Transesterification of fatty acids yields the essential component of biodiesel, but current processes are cost-prohibitive and generate waste. Recent efforts make use of biocatalysts that are effective in diverting products from primary metabolism to yield fatty acid methyl esters in bacteria. These biotransformations require the fatty acid O-methyltransferase (FAMT) from Mycobacterium marinum (MmFAMT). Although this activity was first reported in the literature in 1970, the FAMTs have yet to be biochemically characterized. Here, we describe several crystal structures of MmFAMT, which highlight an unexpected structural conservation with methyltransferases that are involved in plant natural product metabolism. The determinants for ligand recognition are analyzed by kinetic analysis of structure-based active-site variants. These studies reveal how an architectural fold employed in plant natural product biosynthesis is used in bacterial fatty acid O-methylation.

  15. Biochemical Studies of Mycobacterial Fatty Acid Methyltransferase: A Catalyst for the Enzymatic Production of Biodiesel.

    PubMed

    Petronikolou, Nektaria; Nair, Satish K

    2015-11-19

    Transesterification of fatty acids yields the essential component of biodiesel, but current processes are cost-prohibitive and generate waste. Recent efforts make use of biocatalysts that are effective in diverting products from primary metabolism to yield fatty acid methyl esters in bacteria. These biotransformations require the fatty acid O-methyltransferase (FAMT) from Mycobacterium marinum (MmFAMT). Although this activity was first reported in the literature in 1970, the FAMTs have yet to be biochemically characterized. Here, we describe several crystal structures of MmFAMT, which highlight an unexpected structural conservation with methyltransferases that are involved in plant natural product metabolism. The determinants for ligand recognition are analyzed by kinetic analysis of structure-based active-site variants. These studies reveal how an architectural fold employed in plant natural product biosynthesis is used in bacterial fatty acid O-methylation. PMID:26526103

  16. DNA methylation by wheat cytosine DNA methyltransferase: modulation by protease inhibitor E-64.

    PubMed

    Vlasova, T I; Vanyushin, B F

    1998-06-01

    Cytosine DNA methyltransferase isolated from wheat seedlings and purified in the presence of metalloprotease and serine protease inhibitors has molecular mass and specific activity equal to about 85 kDa and 250 units/mg protein, respectively. Apparent K(m) for AdoMet and [I]50 for AdoHcy values are about 6 microM and 12 microM, respectively. The enzyme is active in wide pH range (pH 5.5-8.5) and is inhibited by NaCl. The enzyme rapidly loses its methyltransferase activity in the absence of substrates. Using the cysteine protease inhibitor E-64 it has been shown that rapid enzyme inactivation is caused by disappearance of essential enzyme SH-groups but is not due to proteolytic enzyme cleavage. PMID:9635138

  17. Enzymatic production of oroxylin A and hispidulin using a liverwort flavone 6-O-methyltransferase.

    PubMed

    Zhang, Yu-Ying; Xu, Rui-Xue; Gao, Shuai; Cheng, Ai-Xia

    2016-08-01

    Oroxylin A and hispidulin, compounds which are abundant in both Scutellaria and liverwort species, are important lead compounds for the treatment of ischemic cerebrovascular disease. Their enzymatic synthesis requires an O-methyltransferase able to interact with the related flavonoid's 6-OH group, but such an enzyme has yet to be identified in plants. Here, the gene encoding an O-methyltransferase (designated PaF6OMT) was isolated from the liverwort species Plagiochasma appendiculatum. A test of alternative substrates revealed that its strongest preferences were baicalein and scutellarein, which were converted into, respectively, oroxylin A and hispidulin. Allowed a sufficient reaction time, the conversion rate of these two substrates was, respectively, 90% and 100%. PaF6OMT offers an enzymatic route to the synthesis of oroxylin A and hispidulin. PMID:27432544

  18. DNA G-quadruplexes show strong interaction with DNA methyltransferases in vitro.

    PubMed

    Cree, Simone L; Fredericks, Rayleen; Miller, Allison; Pearce, F Grant; Filichev, Vyacheslav; Fee, Conan; Kennedy, Martin A

    2016-09-01

    The DNA methyltransferase enzymes (DNMTs) catalyzing cytosine methylation do so at specific locations of the genome, although with some level of redundancy. The de novo methyltransferases DNMT3A and 3B play a vital role in methylating the genome of the developing embryo in regions devoid of methylation marks. The ability of DNMTs to colocalize at sites of DNA damage is suggestive that recognition of mispaired bases and unusual structures is inherent to the function of these proteins. We provide evidence for G-quadruplex formation within imprinted gene promoters, and report high-affinity binding of recombinant human DNMTs to such DNA G-quadruplexes in vitro. These observations suggest a potential interaction of G-quadruplexes with the DNA methylation machinery, which may be of epigenetic and biological significance. PMID:27468168

  19. Characterization of the sugar-O-methyltransferase LobS1 in lobophorin biosynthesis.

    PubMed

    Xiao, Ji; Zhang, Qingbo; Zhu, Yiguang; Li, Sumei; Zhang, Guangtao; Zhang, Haibo; Saurav, Kumar; Zhang, Changsheng

    2013-10-01

    Lobophorins A (1) and B (2) belong to a large group of spirotetronate natural products with potent antibacterial and antitumor activities. The cloning of the lobophorin biosynthesis gene cluster from the deep-sea-derived Streptomyces sp. SCSIO 01127 identified a sugar-O-methyltransferase-encoding gene lobS1. The lobS1 inactivation mutant accumulated two new lobophorin analogs 3 and 4, different from 1 and 2 by lacking the 4-methyl group at the terminal L-digitoxose, respectively. Biochemical experiments verified that LobS1 was a SAM-dependent sugar-O-methyltransferase that required divalent metal ions for better activity. Antibacterial assays revealed compounds 3 and 4 were generally less potent than compounds 1 and 2. These findings suggest that the methylation on the terminal digitoxose by LobS1 tailors lobophorin biosynthesis and highlights the importance of this methylation for antibacterial potence.

  20. Effect of site-specific modification on restriction endonucleases and DNA modification methyltransferases.

    PubMed Central

    McClelland, M; Nelson, M; Raschke, E

    1994-01-01

    Restriction endonucleases have site-specific interactions with DNA that can often be inhibited by site-specific DNA methylation and other site-specific DNA modifications. However, such inhibition cannot generally be predicted. The empirically acquired data on these effects are tabulated for over 320 restriction endonucleases. In addition, a table of known site-specific DNA modification methyltransferases and their specificities is presented along with EMBL database accession numbers for cloned genes. PMID:7937074

  1. Identification and biochemical characterization of four wood-associated glucuronoxylan methyltransferases in Populus.

    PubMed

    Yuan, Youxi; Teng, Quincy; Zhong, Ruiqin; Ye, Zheng-Hua

    2014-01-01

    Wood is one of the promising bioenergy feedstocks for lignocellulosic biofuel production. Understanding how wood components are synthesized will help us design strategies for better utilization of wood for biofuel production. One of the major wood components is xylan, in which about 10% of xylosyl residues are substituted with glucuronic acid (GlcA) side chains. All the GlcA side chains of xylan in wood of Populus trichocarpa are methylated, which is different from Arabidopsis xylan in which about 60% of GlcA side chains are methylated. Genes responsible for methylation of GlcA side chains in Populus xylan have not been identified. Here, we report genetic and biochemical analyses of four DUF579 domain-containing proteins, PtrGXM1, PtrGXM2, PtrGXM3 and PtrGXM4, from Populus trichocarpa and their roles in GlcA methylation in xylan. The PtrGXM genes were found to be highly expressed in wood-forming cells and their encoded proteins were shown to be localized in the Golgi. When overexpressed in the Arabidopsis gxm1/2/3 triple mutant, PtrGXMs were able to partially complement the mutant phenotypes including defects in glucuronoxylan methyltransferase activity and GlcA methylation in xylan, indicating that PtrGXMs most likely function as glucuronoxylan methyltransferases. Direct evidence was provided by enzymatic analysis of recombinant PtrGXM proteins showing that they possessed a methyltransferase activity capable of transferring the methyl group onto GlcA-substituted xylooligomers. Kinetic analysis showed that PtrGXMs exhibited differential affinities toward the GlcA-substituted xylooligomer acceptor with PtrGXM3 and PtrGXM4 having 10 times higher K m values than PtrGXM1 and PtrGXM2. Together, these findings indicate that PtrGXMs are methyltransferases mediating GlcA methylation in Populus xylan during wood formation.

  2. O6-methylguanine-DNA methyltransferase activities in biopsies of human melanoma tumours.

    PubMed Central

    Egyházi, S.; Hansson, J.; Ringborg, U.

    1995-01-01

    Tumour samples obtained from one primary melanoma and several lymph node and skin metastases were analysed for O6-methylguanine-DNA methyltransferase (MGMT) activity. While lymph node and skin metastases had similar average MGMT activity, the variance was significantly higher in lymph node metastases. Variability in MGMT activity was frequently observed in different metastases in the same individual and to a lesser extent within metastases. PMID:7819045

  3. Characterization of selenocysteine methyltransferases from Astragalus species with contrasting selenium accumulation capacity.

    PubMed

    Sors, Thomas G; Martin, Catherine P; Salt, David E

    2009-07-01

    A group of selenium (Se)-hyperaccumulating species belonging to the genus Astragalus are known for their capacity to accumulate up to 0.6% of their foliar dry weight as Se, with most of this Se being in the form of Se-methylselenocysteine (MeSeCys). Here, we report the isolation and molecular characterization of the gene that encodes a putative selenocysteine methyltransferase (SMT) enzyme from the non-accumulator Astragalus drummondii and biochemically compare it with an authentic SMT enzyme from the Se-hyperaccumulator Astragalus bisulcatus, a related species that lives within the same native habitat. The non-accumulator enzyme (AdSMT) shows a high degree of homology with the accumulator enzyme (AbSMT) but lacks the selenocysteine methyltransferase activity in vitro, explaining why little or no detectable levels of MeSeCys accumulation are observed in the non-accumulator plant. The insertion of mutations on the coding region of the non-accumulator AdSMT enzyme to better resemble enzymes that originate from Se accumulator species results in increased selenocysteine methyltransferase activity, but these mutations were not sufficient to fully gain the activity observed in the AbSMT accumulator enzyme. We demonstrate that SMT is localized predominantly within the chloroplast in Astragalus, the principal site of Se assimilation in plants. By using a site-directed mutagenesis approach, we show that an Ala to Thr amino acid mutation at the predicted active site of AbSMT results in a new enzymatic capacity to methylate homocysteine. The mutated AbSMT enzyme exhibited a sixfold higher capacity to methylate selenocysteine, thereby establishing the evolutionary relationship of SMT and homocysteine methyltransferase enzymes in plants.

  4. Three-dimensional culture sensitizes epithelial ovarian cancer cells to EZH2 methyltransferase inhibition

    PubMed Central

    Amatangelo, Michael D.; Garipov, Azat; Li, Hua; Conejo-Garcia, Jose R.; Speicher, David W.; Zhang, Rugang

    2013-01-01

    Inhibitors of EZH2 methyltransferase activity have been demonstrated to selectively suppress the growth of diffused large B cell lymphoma (DLBCL) cells with gain-of-function mutations in EZH2, while exhibiting very limited effects on the growth of DLBCL cells with wild-type EZH2. Given that EZH2 is often overexpressed but not mutated in solid tumors, it is important to investigate the determinants of sensitivity of solid tumor cells to EZH2 inhibitors. In the current study, we show that three-dimensional (3D) culture of epithelial ovarian cancer (EOC) cells that overexpress EZH2 sensitizes these cells to EZH2 methyltransferase inhibition. Treatment of EOC cells with GSK343, a specific inhibitor of EZH2 methyltransferase, decreases the level of H3K27Me3, the product of EZH2’s enzymatic activity. However, GSK343 exhibited limited effects on the growth of EOC cells in conventional two-dimensional (2D) culture. In contrast, GSK343 significantly suppressed the growth of EOC cells cultured in 3D matrigel extracellular matrix (ECM), which more closely mimics the tumor microenvironment in vivo. Notably, GSK343 induces apoptosis of EOC cells in 3D but not 2D culture. In addition, GSK343 significantly inhibited the invasion of EOC cells. In summary, we show that the 3D ECM sensitizes EOC cells to EZH2 methyltransferase inhibition, which suppresses cell growth, induces apoptosis and inhibits invasion. Our findings imply that in EZH2 wild-type solid tumors, the ECM tumor microenvironment plays an important role in determining sensitivity to EZH2 inhibition and suggest that targeting the ECM represents a novel strategy for enhancing EZH2 inhibitor efficacy. PMID:23759589

  5. A glutamate/aspartate switch controls product specificity in a protein arginine methyltransferase

    PubMed Central

    Debler, Erik W.; Jain, Kanishk; Warmack, Rebeccah A.; Feng, You; Clarke, Steven G.; Blobel, Günter; Stavropoulos, Pete

    2016-01-01

    Trypanosoma brucei PRMT7 (TbPRMT7) is a protein arginine methyltransferase (PRMT) that strictly monomethylates various substrates, thus classifying it as a type III PRMT. However, the molecular basis of its unique product specificity has remained elusive. Here, we present the structure of TbPRMT7 in complex with its cofactor product S-adenosyl-l-homocysteine (AdoHcy) at 2.8 Å resolution and identify a glutamate residue critical for its monomethylation behavior. TbPRMT7 comprises the conserved methyltransferase and β-barrel domains, an N-terminal extension, and a dimerization arm. The active site at the interface of the N-terminal extension, methyltransferase, and β-barrel domains is stabilized by the dimerization arm of the neighboring protomer, providing a structural basis for dimerization as a prerequisite for catalytic activity. Mutagenesis of active-site residues highlights the importance of Glu181, the second of the two invariant glutamate residues of the double E loop that coordinate the target arginine in substrate peptides/proteins and that increase its nucleophilicity. Strikingly, mutation of Glu181 to aspartate converts TbPRMT7 into a type I PRMT, producing asymmetric dimethylarginine (ADMA). Isothermal titration calorimetry (ITC) using a histone H4 peptide showed that the Glu181Asp mutant has markedly increased affinity for monomethylated peptide with respect to the WT, suggesting that the enlarged active site can favorably accommodate monomethylated peptide and provide sufficient space for ADMA formation. In conclusion, these findings yield valuable insights into the product specificity and the catalytic mechanism of protein arginine methyltransferases and have important implications for the rational (re)design of PRMTs. PMID:26858449

  6. Analysis of 23S rRNA genes in metagenomes - a case study from the Global Ocean Sampling Expedition.

    PubMed

    Yilmaz, Pelin; Kottmann, Renzo; Pruesse, Elmar; Quast, Christian; Glöckner, Frank Oliver

    2011-09-01

    As an evolutionary marker, 23S ribosomal RNA (rRNA) offers more diagnostic sequence stretches and greater sequence variation than 16S rRNA. However, 23S rRNA is still not as widely used. Based on 80 metagenome samples from the Global Ocean Sampling (GOS) Expedition, the usefulness and taxonomic resolution of 23S rRNA were compared to those of 16S rRNA. Since 23S rRNA is approximately twice as large as 16S rRNA, twice as many 23S rRNA gene fragments were retrieved from the GOS reads than 16S rRNA gene fragments, with 23S rRNA gene fragments being generally about 100bp longer. Datasets for 16S and 23S rRNA sequences revealed similar relative abundances for major marine bacterial and archaeal taxa. However, 16S rRNA sequences had a better taxonomic resolution due to their significantly larger reference database. Reevaluation of the specificity of previously published PCR amplification primers and group specific fluorescence in situ hybridization probes on this metagenomic set of non-amplified 23S rRNA sequences revealed that out of 16 primers investigated, only two had more than 90% target group coverage. Evaluations of two probes, BET42a and GAM42a, were in accordance with previous evaluations, with a discrepancy in the target group coverage of the GAM42a probe when evaluated against the GOS metagenomic dataset.

  7. EVI1 recruits the histone methyltransferase SUV39H1 for transcription repression.

    PubMed

    Cattaneo, Francesca; Nucifora, Giuseppina

    2008-10-01

    EVI1 is an oncoprotein inappropriately expressed in acute myeloid leukemia and myelodysplastic syndrome cells. In vitro studies indicate that diverse biological properties can be attributed to this protein. Its role in leukemogenesis is still unclear but it is thought that overall EVI1 can act mostly as a transcription repressor through its interaction with a subset of histone deacetylases. Studies with histone deacetylase inhibitors have however indicated that EVI1-mediated repression can be only partially rescued by deacetylase inhibitor drugs, suggesting that additional chromosomal modifications might occur to induce gene repression by EVI1. To investigate whether histone methylation contributes to the repressive potential of EVI1, we examined a potential association between EVI1, the histone methyltransferase (HMT) SUV39H1, and methyltransferase activity in vitro. We find that EVI1 directly interacts with SUV39H1 and that the proteins form an active complex with methyltransferase activity in vitro. Our data indicate that SUV39H1 enhances the transcription repressive potential of EVI1 in vivo. We suggest that EVI1 affects promoters' activity in two different pathways, by association with histone deacetylases and by recruiting chromatin-modifying enzymes to impose a heterochromatin-like structure establishing a lasting transcription repression.

  8. Preliminary characterization of (nucleoside-2′-O-)-methyltransferase crystals from Meaban and Yokose flaviviruses

    SciTech Connect

    Mastrangelo, Eloise; Bollati, Michela; Milani, Mario; Lamballeire, Xavier de; Brisbare, Nadege; Dalle, Karen; Lantez, Violaine; Egloff, Marie-Pierre; Coutard, Bruno; Canard, Bruno; Gould, Ernest; Forrester, Naomi; Bolognesi, Martino

    2006-08-01

    Two methyltransferases from flaviviruses (Meaban and Yokose viruses) have been overexpressed and crystallized. Diffraction data and characterization of the two crystal forms are presented, together with a preliminary molecular-replacement solution for both enzymes. Viral methyltranferases (MTase) are involved in the third step of the mRNA-capping process, transferring a methyl group from S-adenosyl-l-methionine (SAM) to the capped mRNA. MTases are classified into two groups: (guanine-N7)-methyltransferases (N7MTases), which add a methyl group onto the N7 atom of guanine, and (nucleoside-2′-O-)-methyltransferases (2′OMTases), which add a methyl group to a ribose hydroxyl. The MTases of two flaviviruses, Meaban and Yokose viruses, have been overexpressed, purified and crystallized in complex with SAM. Characterization of the crystals together with details of preliminary X-ray diffraction data collection (at 2.8 and 2.7 Å resolution, respectively) are reported here. The sequence homology relative to Dengue virus 2′OMTase and the structural conservation of specific residues in the putative active sites suggest that both enzymes belong to the 2′OMTase subgroup.

  9. Structural insights into mechanisms of the small RNA methyltransferase HEN1

    SciTech Connect

    Huang, Ying; Ji, Lijuan; Huang, Qichen; Vassylyev, Dmitry G.; Chen, Xuemei; Ma, Jin-Biao

    2010-02-22

    RNA silencing is a conserved regulatory mechanism in fungi, plants and animals that regulates gene expression and defence against viruses and transgenes. Small silencing RNAs of {approx}20-30 nucleotides and their associated effector proteins, the Argonaute family proteins, are the central components in RNA silencing. A subset of small RNAs, such as microRNAs and small interfering RNAs (siRNAs) in plants, Piwi-interacting RNAs in animals and siRNAs in Drosophila, requires an additional crucial step for their maturation; that is, 2'-O-methylation on the 3' terminal nucleotide. A conserved S-adenosyl-L-methionine-dependent RNA methyltransferase, HUA ENHANCER 1 (HEN1), and its homologues are responsible for this specific modification. Here we report the 3.1 {angstrom} crystal structure of full-length HEN1 from Arabidopsis in complex with a 22-nucleotide small RNA duplex and cofactor product S-adenosyl-L-homocysteine. Highly cooperative recognition of the small RNA substrate by multiple RNA binding domains and the methyltransferase domain in HEN1 measures the length of the RNA duplex and determines the substrate specificity. Metal ion coordination by both 2' and 3' hydroxyls on the 3'-terminal nucleotide and four invariant residues in the active site of the methyltransferase domain suggests a novel Mg{sup 2+}-dependent 2'-O-methylation mechanism.

  10. Identification of Protein Arginine Methyltransferase 5 as a Regulator for Encystation of Acanthamoeba

    PubMed Central

    Moon, Eun-Kyung; Hong, Yeonchul; Chung, Dong-Il; Goo, Youn-Kyoung; Kong, Hyun-Hee

    2016-01-01

    Encystation is an essential process for Acanthamoeba survival under nutrient-limiting conditions and exposure to drugs. The expression of several genes has been observed to increase or decrease during encystation. Epigenetic processes involved in regulation of gene expression have been shown to play a role in several pathogenic parasites. In the present study, we identified the protein arginine methyltransferase 5 (PRMT5), a known epigenetic regulator, in Acanthamoeba castellanii. PRMT5 of A. castellanii (AcPRMT5) contained domains found in S-adenosylmethionine-dependent methyltransferases and in PRMT5 arginine-N-methyltransferase. Expression levels of AcPRMT5 were increased during encystation of A. castellanii. The EGFP-PRMT5 fusion protein was mainly localized in the nucleus of trophozoites. A. castellanii transfected with siRNA designed against AcPRMT5 failed to form mature cysts. The findings of this study lead to a better understanding of epigenetic mechanisms behind the regulation of encystation in cyst-forming pathogenic protozoa. PMID:27180570

  11. Near-isogenic lines for measuring phenotypic effects of DIMBOA-Glc methyltransferase activity in maize.

    PubMed

    Mijares, Valeria; Meihls, Lisa N; Jander, Georg; Tzin, Vered

    2013-10-01

    Three O-methyltransferases (BX10a, b, c) catalyze the conversion of 2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one glucoside (DIM BOA-Glc) to 2-hydroxy-4,7-dimethoxy-1,4-benzoxazin-3-one glucoside (HDMBOA -Glc) in maize (Zea mays). Variation in benzoxazinoid accumulation and resistance to Rhopalosiphum maidis (corn leaf aphid) was attributed to a natural CACTA family transposon insertion that inactivates Bx10c. Whereas maize inbred line B73 has this transposon insertion, line CM L277 does not. To characterize the phenotypic effects of DIM BOA-Glc methyltransferase activity, we created near-isogenic lines derived from B73 and CM L277 that do or do not contain the transposon insertion. Bx10c inactivation causes high DIM BOA -Glc, low HDMBOA-Glc, and decreased aphid reproduction relative to near-isogenic lines that have a functional Bx10c gene. These results confirm the importance of this locus in maize aphid resistance. The availability of Bx10c near-isogenic lines will facilitate further research on the function of different benzoxazinoids and DIM BOA-Glc methyltransferase activity in maize defense against herbivores and pathogens.

  12. A novel methyltransferase (Hmt1p) modifies poly(A)+-RNA-binding proteins.

    PubMed Central

    Henry, M F; Silver, P A

    1996-01-01

    RNA-binding proteins play many essential roles in the metabolism of nuclear pre-mRNA. As such, they demonstrate a myriad of dynamic behaviors and modifications. In particular, heterogeneous nuclear ribonucleoproteins (hnRNPs) contain the bulk of methylated arginine residues in eukaryotic cells. We have identified the first eukaryotic hnRNP-specific methyltransferase via a genetic screen for proteins that interact with an abundant poly(A)+-RNA-binding protein termed Npl3p. We have previously shown that npl3-1 mutants are temperature sensitive for growth and defective for export of mRNA from the nucleus. New mutants in interacting genes were isolated by their failure to survive in the presence of the npl3-1 allele. Four alleles of the same gene were identified in this manner. Cloning of the cognate gene revealed an encoded protein with similarity to methyltransferases that was termed HMT1 for hnRNP methyltransferase. HMT1 is not required for normal cell viability except when NPL3 is also defective. The Hmt1 protein is located in the nucleus. We demonstrate that Npl3p is methylated by Hmt1p both in vivo and in vitro. These findings now allow further exploration of the function of this previously uncharacterized class of enzymes. PMID:8668183

  13. Identification and characterization of the arsenite methyltransferase from a protozoan, Tetrahymena pyriformis.

    PubMed

    Ye, Jun; Chang, Yue; Yan, Yu; Xiong, Jie; Xue, Xi-Mei; Yuan, Dongxia; Sun, Guo-Xin; Zhu, Yong-Guan; Miao, Wei

    2014-04-01

    Arsenic (As) methylation in aquatic microbes plays a major role in the biogeochemistry of As. Protozoa, especially the free-living freshwater species, are important players in aquatic ecological health. In this study, an arsenite (As(III)) methyltransferase, TpyArsM, was identified and characterized in a free-living protozoan, Tetrahymena pyriformis. In order to confirm its function, TpyarsM gene was knocked-out in Tetrahymena and was also heterologously expressed in hypersensitive E. coli; these events resulted in expected decreases in As tolerance and methylation ability, respectively. In-vitro tests revealed that purified TpyArsM protein methylated inorganic As to mono- and di- methylarsenate, and also had the novel property of producing trimethylarsenite (TMA(III)) and dimethylarsine (Me2AsH) gases. This new methyltransferase gene, identified in a species near the base of the food web, has enriched our knowledge of As methyltransferases and has great potential for bioremediation of As-contaminated environments.

  14. Methylated nucleosides in tRNA and tRNA methyltransferases

    PubMed Central

    Hori, Hiroyuki

    2014-01-01

    To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s). Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon-anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed. PMID:24904644

  15. MtrA of the sodium ion pumping methyltransferase binds cobalamin in a unique mode

    PubMed Central

    Wagner, Tristan; Ermler, Ulrich; Shima, Seigo

    2016-01-01

    In the three domains of life, vitamin B12 (cobalamin) is primarily used in methyltransferase and isomerase reactions. The methyltransferase complex MtrA–H of methanogenic archaea has a key function in energy conservation by catalysing the methyl transfer from methyl-tetrahydromethanopterin to coenzyme M and its coupling with sodium-ion translocation. The cobalamin-binding subunit MtrA is not homologous to any known B12-binding proteins and is proposed as the motor of the sodium-ion pump. Here, we present crystal structures of the soluble domain of the membrane-associated MtrA from Methanocaldococcus jannaschii and the cytoplasmic MtrA homologue/cobalamin complex from Methanothermus fervidus. The MtrA fold corresponds to the Rossmann-type α/β fold, which is also found in many cobalamin-containing proteins. Surprisingly, the cobalamin-binding site of MtrA differed greatly from all the other cobalamin-binding sites. Nevertheless, the hydrogen-bond linkage at the lower axial-ligand site of cobalt was equivalently constructed to that found in other methyltransferases and mutases. A distinct polypeptide segment fixed through the hydrogen-bond linkage in the relaxed Co(III) state might be involved in propagating the energy released upon corrinoid demethylation to the sodium-translocation site by a conformational change. PMID:27324530

  16. MtrA of the sodium ion pumping methyltransferase binds cobalamin in a unique mode.

    PubMed

    Wagner, Tristan; Ermler, Ulrich; Shima, Seigo

    2016-01-01

    In the three domains of life, vitamin B12 (cobalamin) is primarily used in methyltransferase and isomerase reactions. The methyltransferase complex MtrA-H of methanogenic archaea has a key function in energy conservation by catalysing the methyl transfer from methyl-tetrahydromethanopterin to coenzyme M and its coupling with sodium-ion translocation. The cobalamin-binding subunit MtrA is not homologous to any known B12-binding proteins and is proposed as the motor of the sodium-ion pump. Here, we present crystal structures of the soluble domain of the membrane-associated MtrA from Methanocaldococcus jannaschii and the cytoplasmic MtrA homologue/cobalamin complex from Methanothermus fervidus. The MtrA fold corresponds to the Rossmann-type α/β fold, which is also found in many cobalamin-containing proteins. Surprisingly, the cobalamin-binding site of MtrA differed greatly from all the other cobalamin-binding sites. Nevertheless, the hydrogen-bond linkage at the lower axial-ligand site of cobalt was equivalently constructed to that found in other methyltransferases and mutases. A distinct polypeptide segment fixed through the hydrogen-bond linkage in the relaxed Co(III) state might be involved in propagating the energy released upon corrinoid demethylation to the sodium-translocation site by a conformational change. PMID:27324530

  17. Cooperativity between DNA Methyltransferases in the Maintenance Methylation of Repetitive Elements

    PubMed Central

    Liang, Gangning; Chan, Matilda F.; Tomigahara, Yoshitaka; Tsai, Yvonne C.; Gonzales, Felicidad A.; Li, En; Laird, Peter W.; Jones, Peter A.

    2002-01-01

    We used mouse embryonic stem (ES) cells with systematic gene knockouts for DNA methyltransferases to delineate the roles of DNA methyltransferase 1 (Dnmt1) and Dnmt3a and -3b in maintaining methylation patterns in the mouse genome. Dnmt1 alone was able to maintain methylation of most CpG-poor regions analyzed. In contrast, both Dnmt1 and Dnmt3a and/or Dnmt3b were required for methylation of a select class of sequences which included abundant murine LINE-1 promoters. We used a novel hemimethylation assay to show that even in wild-type cells these sequences contain high levels of hemimethylated DNA, suggestive of poor maintenance methylation. We showed that Dnmt3a and/or -3b could restore methylation of these sequences to pretreatment levels following transient exposure of cells to 5-aza-CdR, whereas Dnmt1 by itself could not. We conclude that ongoing de novo methylation by Dnmt3a and/or Dnmt3b compensates for inefficient maintenance methylation by Dnmt1 of these endogenous repetitive sequences. Our results reveal a previously unrecognized degree of cooperativity among mammalian DNA methyltransferases in ES cells. PMID:11756544

  18. Expression of Sindbis virus nsP1 and methyltransferase activity in Escherichia coli.

    PubMed

    Mi, S; Stollar, V

    1991-09-01

    We have constructed two plasmids, pSR5-42 and pSR5-Toto, which under lac control expressed the SVLM21 and the SVToto forms, respectively, of the Sindbis virus nonstructural protein, nsP1. The induced protein, which was the major protein made following induction with IPTG, had an apparent molecular weight of 60,000 and an amino terminal sequence in agreement with that expected for nsP1. Following induction with IPTG, cells carrying pSR5-42 (which contains the SVLM21 gene sequence) generated much higher RNA methyltransferase activity than cells carrying pSR5-Toto (which contains the SVToto gene sequence). This result is in agreement with what is observed when methyltransferase is measured in cells infected with SVLM21 and SVSTD (or SVToto), respectively. These results provide strong evidence that nsP1 has methyltransferase activity in the absence of any other viral nonstructural proteins. PMID:1831311

  19. The H3K9 methyltransferase Setdb1 regulates TLR4-mediated inflammatory responses in macrophages

    PubMed Central

    Hachiya, Rumi; Shiihashi, Takuya; Shirakawa, Ibuki; Iwasaki, Yorihiro; Matsumura, Yoshihiro; Oishi, Yumiko; Nakayama, Yukiteru; Miyamoto, Yoshihiro; Manabe, Ichiro; Ochi, Kozue; Tanaka, Miyako; Goda, Nobuhito; Sakai, Juro; Suganami, Takayoshi; Ogawa, Yoshihiro

    2016-01-01

    Proinflammatory cytokine production in macrophages involves multiple regulatory mechanisms, which are affected by environmental and intrinsic stress. In particular, accumulating evidence has suggested epigenetic control of macrophage differentiation and function mainly in vitro. SET domain, bifurcated 1 (Setdb1, also known as Eset) is a histone 3 lysine 9 (H3K9)-specific methyltransferase and is essential for early development of embryos. Here we demonstrate that Setdb1 in macrophages potently suppresses Toll-like receptor 4 (TLR4)-mediated expression of proinflammatory cytokines including interleukin-6 through its methyltransferase activity. As a molecular mechanism, Setdb1-deficiency decreases the basal H3K9 methylation levels and augments TLR4-mediated NF-κB recruitment on the proximal promoter region of interleukin-6, thereby accelerating interleukin-6 promoter activity. Moreover, macrophage-specific Setdb1-knockout mice exhibit higher serum interleukin-6 concentrations in response to lipopolysaccharide challenge and are more susceptible to endotoxin shock than wildtype mice. This study provides evidence that the H3K9 methyltransferase Setdb1 is a novel epigenetic regulator of proinflammatory cytokine expression in macrophages in vitro and in vivo. Our data will shed insight into the better understanding of how the immune system reacts to a variety of conditions. PMID:27349785

  20. Changes in tRNA methyltransferase activity and cellular S-adenosylmethionine content following methionine deprivation.

    PubMed

    Tisdale, M J

    1980-09-19

    Although homocysteine was unable to support growth of Walker carcinoma in media lacking methionine it did enable some proliferation of TLX5 lymphoma. In both cell lines there was an increase in growth rate in the presence of homocysteine at limiting methionine concentrations. The proliferation rate of Walker carcinoma was proportional to the methionine concentraion of the medium down to 0.5 microgram/ml, whereas growth of TLX5 lymphoma was only slightly reduced at such methionine concentrations. The difference in proliferative ability between the two cell lines was reflected in the level of S-adenosyl-L-methionine under conditions of methionine deprivation. In both cases transferance to a media in which methionine was growth limiting caused a rapid increase in the activity of tRNA methyltransferases to levels six to seven-fold greater than the control. The initial increase in methylase activity was not prevented by cycloheximide, although after 4 h there was a progressive decrease in activity which approached control values within 24 h. The increase in tRNA methyltransferase activity on removal of the normal level of methionine in the medium was also seen with human embryonic fibroblasts, which are able to proliferate normally in methionine-deficient, homocysteine-supplemented media. These results suggest that methyltransferase activity may be regulated in part by the S-adenosyl-methionine content of the cell.

  1. A novel methyltransferase from the intracellular pathogen Plasmodiophora brassicae methylates salicylic acid.

    PubMed

    Ludwig-Müller, Jutta; Jülke, Sabine; Geiß, Kathleen; Richter, Franziska; Mithöfer, Axel; Šola, Ivana; Rusak, Gordana; Keenan, Sandi; Bulman, Simon

    2015-05-01

    The obligate biotrophic pathogen Plasmodiophora brassicae causes clubroot disease in Arabidopsis thaliana, which is characterized by large root galls. Salicylic acid (SA) production is a defence response in plants, and its methyl ester is involved in systemic signalling. Plasmodiophora brassicae seems to suppress plant defence reactions, but information on how this is achieved is scarce. Here, we profile the changes in SA metabolism during Arabidopsis clubroot disease. The accumulation of SA and the emission of methylated SA (methyl salicylate, MeSA) were observed in P. brassicae-infected Arabidopsis 28 days after inoculation. There is evidence that MeSA is transported from infected roots to the upper plant. Analysis of the mutant Atbsmt1, deficient in the methylation of SA, indicated that the Arabidopsis SA methyltransferase was not responsible for alterations in clubroot symptoms. We found that P. brassicae possesses a methyltransferase (PbBSMT) with homology to plant methyltransferases. The PbBSMT gene is maximally transcribed when SA production is highest. By heterologous expression and enzymatic analyses, we showed that PbBSMT can methylate SA, benzoic and anthranilic acids.

  2. Identification of Aquifex aeolicus tRNA (m2(2G26) methyltransferase gene.

    PubMed

    Takeda, Hiroshi; Hori, Hiroyuki; Endo, Yaeta

    2002-01-01

    The modifications of N2,N2-dimethylguanine (m2(2)G) are found in tRNAs and rRNAs from eukarya and archaea. In tRNAs, modification at position G26 is generated by tRNA (m2(2)G26) methyltransferase, which is encoded by the corresponding gene, trm1. This enzyme catalyzes the methyl-transfer from S-adenosyl-L-methionine to the semi-conserved residue, G26, via the intermediate modified base, m2G26. Recent genome sequencing project has been reported that the putative trm1 is encoded in the genome of Aquifex aeolicus, a hyper-thermophilic eubacterium as only one exception among eubacteria. In order to confirm whether this bacterial trm1 gene product is a real tRNA (m2(2)G26) methyltransferase or not, we expressed this protein by wheat germ in vitro cell-free translation system. Our biochemical analysis clearly showed that this gene product possessed tRNA (m2(2)G26) methyltransferase activity.

  3. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  4. Trans-splicing and RNA editing of LSU rRNA in Diplonema mitochondria

    PubMed Central

    Valach, Matus; Moreira, Sandrine; Kiethega, Georgette N.; Burger, Gertraud

    2014-01-01

    Mitochondrial ribosomal RNAs (rRNAs) often display reduced size and deviant secondary structure, and sometimes are fragmented, as are their corresponding genes. Here we report a mitochondrial large subunit rRNA (mt-LSU rRNA) with unprecedented features. In the protist Diplonema, the rnl gene is split into two pieces (modules 1 and 2, 534- and 352-nt long) that are encoded by distinct mitochondrial chromosomes, yet the rRNA is continuous. To reconstruct the post-transcriptional maturation pathway of this rRNA, we have catalogued transcript intermediates by deep RNA sequencing and RT-PCR. Gene modules are transcribed separately. Subsequently, transcripts are end-processed, the module-1 transcript is polyuridylated and the module-2 transcript is polyadenylated. The two modules are joined via trans-splicing that retains at the junction ∼26 uridines, resulting in an extent of insertion RNA editing not observed before in any system. The A-tail of trans-spliced molecules is shorter than that of mono-module 2, and completely absent from mitoribosome-associated mt-LSU rRNA. We also characterize putative antisense transcripts. Antisense-mono-modules corroborate bi-directional transcription of chromosomes. Antisense-mt-LSU rRNA, if functional, has the potential of guiding concomitantly trans-splicing and editing of this rRNA. Together, these findings open a window on the investigation of complex regulatory networks that orchestrate multiple and biochemically diverse post-transcriptional events. PMID:24259427

  5. Direct detection of 16S rRNA in soil extracts by using oligonucleotide microarrays.

    PubMed

    Small, J; Call, D R; Brockman, F J; Straub, T M; Chandler, D P

    2001-10-01

    We report on the development and validation of a simple microarray method for the direct detection of intact 16S rRNA from unpurified soil extracts. Total RNAs from Geobacter chapellei and Desulfovibrio desulfuricans were hybridized to an oligonucleotide array consisting of universal and species-specific 16S rRNA probes. PCR-amplified products from Geobacter and Desulfovibrio were easily and specifically detected under a range of hybridization times, temperatures, and buffers. However, reproducible, specific hybridization and detection of intact rRNA could be accomplished only by using a chaperone-detector probe strategy. With this knowledge, assay conditions were developed for rRNA detection using a 2-h hybridization time at room temperature. Hybridization specificity and signal intensity were enhanced using fragmented RNA. Formamide was required in the hybridization buffer in order to achieve species-specific detection of intact rRNA. With the chaperone detection strategy, we were able to specifically hybridize and detect G. chapellei 16S rRNA directly from a total-RNA soil extract, without further purification or removal of soluble soil constituents. The detection sensitivity for G. chapellei 16S rRNA in soil extracts was at least 0.5 microg of total RNA, representing approximately 7.5 x 10(6) Geobacter cell equivalents of RNA. These results suggest that it is now possible to apply microarray technology to the direct detection of microorganisms in environmental samples, without using PCR. PMID:11571176

  6. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  7. Sequence arrangement of the rRNA genes of the dipteran Sarcophaga bullata.

    PubMed

    French, C K; Fouts, D L; Manning, J E

    1981-06-11

    Velocity sedimentation studies of RNA of Sarcophaga bullata show that the major rRNA species have sedimentation values of 26S and 18S. Analysis of the rRNA under denaturing conditions indicates that there is a hidden break centrally located in the 26S rRNA species. Saturation hybridization studies using total genomic DNA and rRNA show that 0.08% of the nuclear DNA is occupied by rRNA coding sequences and that the average repetition frequency of these coding sequences is approximately 144. The arrangement of the rRNA genes and their spacer sequences on long strands of purified rDNA was determined by the examination of the structure of rRNa:DNA hybrids in the electron microscope. Long DNA strands contain several gene sets (18S + 26S) with one repeat unit containing the following sequences in order given: (a) An 18S gene of length 2.12 kb, (b) an internal transcribed spacer of length 2.01 kb, which contains a short sequence that may code for a 5.8S rRNA, (c) A 26S gene of length 4.06 kb which, in 20% of the cases, contains an intron with an average length of 5.62 kb, and (d) an external spacer of average length of 9.23 kb.

  8. Selecting rRNA binding sites for the ribosomal proteins L4 and L6 from randomly fragmented rRNA: application of a method called SERF.

    PubMed

    Stelzl, U; Spahn, C M; Nierhaus, K H

    2000-04-25

    Two-thirds of the 54 proteins of the Escherichia coli ribosome interact directly with the rRNAs, but the rRNA binding sites of only a very few proteins are known. We present a method (selection of random RNA fragments; SERF) that can identify the minimal binding region for proteins within ribonucleo-protein complexes such as the ribosome. The power of the method is exemplified with the ribosomal proteins L4 and L6. Binding sequences are identified for both proteins and characterized by phosphorothioate footprinting. Surprisingly, the binding region of L4, a 53-nt rRNA fragment of domain I of 23S rRNA, can simultaneously and independently bind L24, one of the two assembly initiator proteins of the large subunit.

  9. Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to determine phylogenetic relationships of Bacillus cereus group.

    SciTech Connect

    Bayvkin, S. G.; Lysov, Y. P.; Zakhariev, V.; Kelly, J. J.; Jackman, J.; Stahl, D. A.; Cherni, A.; Engelhardt Inst. of Molecular Biology; Loyola Univ.; Johns Hopkins Univ.; Univ. of Washington

    2004-08-01

    In order to determine if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30 gyrB sequences for B. cereus group strains with published 16S rRNA sequences. Our findings indicated that the three most common species of the B. cereus group, B. cereus, Bacillus thuringiensis, and Bacillus mycoides, were each heterogeneous in all three gene sequences, while all analyzed strains of Bacillus anthracis were found to be homogeneous. Based on analysis of 16S and 23S rRNA sequence variations, the microorganisms within the B. cereus group were divided into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, and these seven subgroups were further organized into two distinct clusters. This classification of the B. cereus group conflicts with current taxonomic groupings, which are based on phenotypic traits. The presence of B. cereus strains in six of the seven subgroups and the presence of B. thuringiensis strains in three of the subgroups do not support the proposed unification of B. cereus and B. thuringiensis into one species. Analysis of the available phenotypic data for the strains included in this study revealed phenotypic traits that may be characteristic of several of the subgroups. Finally, our results demonstrated that rRNA and gyrB sequences may be used for discriminating B. anthracis from other microorganisms in the B. cereus group.

  10. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  11. Development of a dual-internal-reference technique to improve accuracy when determining bacterial 16S rRNA:16S rRNA gene ratio with application to Escherichia coli liquid and aerosol samples.

    PubMed

    Zhen, Huajun; Krumins, Valdis; Fennell, Donna E; Mainelis, Gediminas

    2015-10-01

    Accurate enumeration of rRNA content in microbial cells, e.g. by using the 16S rRNA:16S rRNA gene ratio, is critical to properly understand its relationship to microbial activities. However, few studies have considered possible methodological artifacts that may contribute to the variability of rRNA analysis results. In this study, a technique utilizing genomic DNA and 16S rRNA from an exogenous species (Pseudomonas fluorescens) as dual internal references was developed to improve accuracy when determining the 16S rRNA:16S rRNA gene ratio of a target organism, Escherichia coli. This technique was able to adequately control the variability in sample processing and analysis procedures due to nucleic acid (DNA and RNA) losses, inefficient reverse transcription of RNA, and inefficient PCR amplification. The measured 16S rRNA:16S rRNA gene ratio of E. coli increased by 2-3 fold when E. coli 16S rRNA gene and 16S rRNA quantities were normalized to the sample-specific fractional recoveries of reference (P. fluorescens) 16S rRNA gene and 16S rRNA, respectively. In addition, the intra-sample variation of this ratio, represented by coefficients of variation from replicate samples, decreased significantly after normalization. This technique was applied to investigate the temporal variation of 16S rRNA:16S rRNA gene ratio of E. coli during its non-steady-state growth in a complex liquid medium, and to E. coli aerosols when exposed to particle-free air after their collection on a filter. The 16S rRNA:16S rRNA gene ratio of E. coli increased significantly during its early exponential phase of growth; when E. coli aerosols were exposed to extended filtration stress after sample collection, the ratio also increased. In contrast, no significant temporal trend in E. coli 16S rRNA:16S rRNA gene ratio was observed when the determined ratios were not normalized based on the recoveries of dual references. The developed technique could be widely applied in studies of relationship between

  12. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  13. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  14. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.

    PubMed

    Coleman, Annette W

    2015-03-01

    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  15. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.

  16. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    PubMed Central

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  17. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications.

    PubMed

    Herzog, M; Maroteaux, L

    1986-11-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  18. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    PubMed

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. PMID:23850855

  19. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  20. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  1. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications.

  2. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  3. Overexpression of DNA methyltransferase 1 (DNMT1) protein in astrocytic tumour and its correlation with O6-methylguanine-DNA methyltransferase (MGMT) expression

    PubMed Central

    Rahman, Wan Faiziah Wan Abdul; Rahman, Khairul Shakir Ab; Nafi, Siti Norasikin Mohd; Fauzi, Mohd Hashairi; Jaafar, Hasnan

    2015-01-01

    Background: The relationship between DNA methyltransferase (DNMT) and O6-methylguanine-DNA methyltransferase (MGMT) in mediating tumorigenesis is still poorly understood. This study was carried out to investigate a correlation between DNMT1 and MGMT immunoexpression in astrocytic tumour samples. Methods: Formalin-fixed paraffin embedded tissues of astrocytic tumour patients was obtained from an observational study conducted in Hospital Universiti Sains Malaysia (USM), which was performed from January 1997 until May 2012. Patient’s histological information was retrieved from the accessible Pathology Registry. Immunohistochemistry (IHC) staining was performed to assess DNMT1 and MGMT expressions in patients’ tumours. Results: Our data showed that DNMT1 was highly expressed in high grade astrocytic tumours. A multiple regression analysis demonstrated a significant association of DNMT1 overexpression with tumour grade III and IV (GIII: OR=5.802; 95% CI: 1.059, 31.785; p value=0.043; GIV: OR=40.663; 95% CI=4.069, 406.347; p value=0.002). The MGMT protein was downregulated in tumours with higher grade as evident by a reduction mean H-score for MGMT expression from GI to GIV [28.36 ± 43.88, 28.08 ± 33.67, 26.00 ± 48.70 and 16.20 ± 35.61]. However, a good negative correlation was observed between DNMT1 and MGMT in high grade tumour [Spearman correlation test: r=-0.561, p value≤0.001 in percentage expression and r=-0.576, p value≤0.001 in H score]. Conclusion: DNMT1 overexpression was seen correlated with a reduction of MGMT protein expression in high grade astrocytic tumour. Understanding the role of these markers could be important to overcome astrocytic tumour aggresiveness. PMID:26261487

  4. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B' methyltransferase family in Coffea arabica.

    PubMed

    Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako

    2014-10-01

    Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-(14)C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or with any of the typical substrates of B'-MTs. It was concluded that CTgSs have strict substrate specificity. The K(m) values of CTgS1 and CTgS2 were 121 and 184μM with nicotinic acid as a substrate, and 68 and 120μM with S-adenosyl-L-methionine as a substrate, respectively.

  5. Selenium-Based S-Adenosylmethionine Analog Reveals the Mammalian Seven-Beta-Strand Methyltransferase METTL10 to Be an EF1A1 Lysine Methyltransferase

    PubMed Central

    Shimazu, Tadahiro; Barjau, Joaquin; Sohtome, Yoshihiro; Sodeoka, Mikiko; Shinkai, Yoichi

    2014-01-01

    Lysine methylation has been extensively studied in histones, where it has been shown to provide specific epigenetic marks for the regulation of gene expression; however, the molecular mechanism and physiological function of lysine methylation in proteins other than histones remains to be fully addressed. To better understand the substrate diversity of lysine methylation, S-adenosylmethionine (SAM) derivatives with alkyne-moieties have been synthesized. A selenium-based SAM analog, propargylic Se-adenosyl-l-selenomethionine (ProSeAM), has a wide spectrum of reactivity against various lysine methyltransferases (KMTs) with sufficient stability to support enzymatic reactions in vitro. By using ProSeAM as a chemical probe for lysine methylation, we identified substrates for two seven-beta-strand KMTs, METTL21A and METTL10, on a proteomic scale in mammalian cells. METTL21A has been characterized as a heat shock protein (HSP)-70 methyltransferase. Mammalian METTL10 remains functionally uncharacterized, although its ortholog in yeast, See1, has been shown to methylate the translation elongation factor eEF1A. By using ProSeAM-mediated alkylation followed by purification and quantitative MS analysis, we confirmed that METTL21A labels HSP70 family proteins. Furthermore, we demonstrated that METTL10 also methylates the eukaryotic elongation factor EF1A1 in mammalian cells. Subsequent biochemical characterization revealed that METTL10 specifically trimethylates EF1A1 at lysine 318 and that siRNA-mediated knockdown of METTL10 decreases EF1A1 methylation levels in vivo. Thus, our study emphasizes the utility of the synthetic cofactor ProSeAM as a chemical probe for the identification of non-histone substrates of KMTs. PMID:25144183

  6. Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA

    PubMed Central

    Suenaga, Hikaru; Liu, Rui; Shiramasa, Yuko; Kanagawa, Takahiro

    2005-01-01

    We developed a novel method for the quantitative detection of the 16S rRNA of a specific bacterial species in the microbial community by using deoxyribozyme (DNAzyme), which possesses the catalytic function to cleave RNA in a sequence-specific manner. A mixture of heterogeneous 16S rRNA containing the target 16S rRNA was incubated with a species-specific DNAzyme. The cleaved target 16S rRNA was separated from the intact 16S rRNA by electrophoresis, and then their amounts were compared for the quantitative detection of target 16S rRNA. This method was used to determine the abundance of the 16S rRNA of a filamentous bacterium, Sphaerotilus natans, in activated sludge, which is a microbial mixture used in wastewater treatment systems. The result indicated that this DNAzyme-based approach would be applicable to actual microbial communities. PMID:16085888

  7. 7-Methylxanthine methyltransferase of coffee plants. Gene isolation and enzymatic properties.

    PubMed

    Ogawa, M; Herai, Y; Koizumi, N; Kusano, T; Sano, H

    2001-03-16

    Caffeine is synthesized through sequential three-step methylation of xanthine derivatives at positions 7-N, 3-N, and 1-N. However, controversy exists as to the number and properties of the methyltransferases involved. Using primers designed on the basis of conserved amino acid regions of tea caffeine synthase and Arabidopsis hypothetical proteins, a particular DNA fragment was amplified from an mRNA population of coffee plants. Subsequently, this fragment was used as a probe, and four independent clones were isolated from a cDNA library derived from coffee young leaves. Upon expression in Escherichia coli, one of them was found to encode a protein possessing 7-methylxanthine methyltransferase activity and was designated as CaMXMT. It consists of 378 amino acids with a relative molecular mass of 42.7 kDa and shows similarity to tea caffeine synthase (35.8%) and salicylic acid methyltransferase (34.1%). The bacterially expressed protein exhibited an optimal pH for activity ranging between 7 and 9 and methylated almost exclusively 7-methylxanthine with low activity toward paraxanthine, indicating a strict substrate specificity regarding the 3-N position of the purine ring. K(m) values were estimated to be 50 and 12 microM for 7-methylxanthine and S-adenosyl-l-methionine, respectively. Transcripts of CaMXMT could be shown to accumulate in young leaves and stems containing buds, and green fluorescent protein fusion protein assays indicated localization in cytoplasmic fractions. The results suggest that, in coffee plants, caffeine is synthesized through three independent methylation steps from xanthosine, in which CaMXMT catalyzes the second step to produce theobromine.

  8. Polypeptide substrate specificity of PsLSMT. A set domain protein methyltransferase.

    PubMed

    Magnani, Roberta; Nayak, Nihar R; Mazarei, Mitra; Dirk, Lynnette M A; Houtz, Robert L

    2007-09-21

    Rubisco large subunit methyltransferase (PsLSMT) is a SET domain protein responsible for the trimethylation of Lys-14 in the large subunit of Rubisco. The polypeptide substrate specificity determinants for pea Rubisco large subunit methyltransferase were investigated using a fusion protein construct between the first 23 amino acids from the large subunit of Rubisco and human carbonic anhydrase II. A total of 40 conservative and non-conservative amino acid substitutions flanking the target Lys-14 methylation site (positions P(-3) to P(+3)) were engineered in the fusion protein. The catalytic efficiency (k(cat)/K(m)) of PsLSMT was determined using each of the substitutions and a polypeptide consensus recognition sequence deduced from the results. The consensus sequence, represented by X-(Gly/Ser)-(Phe/Tyr)-Lys-(Ala/Lys/Arg)-(Gly/Ser)-pi, where X is any residue, Lys is the methylation site, and pi is any aromatic or hydrophobic residue, was used to predict potential alternative substrates for PsLSMT. Four chloroplast-localized proteins were identified including gamma-tocopherol methyltransferase (gamma-TMT). In vitro methylation assays using PsLSMT and a bacterially expressed form of gamma-TMT from Perilla frutescens confirmed recognition and methylation of gamma-TMT by PsLSMT in vitro. RNA interference-mediated knockdown of the PsLSMT homologue (NtLSMT) in transgenic tobacco plants resulted in a 2-fold decrease of alpha-tocopherol, the product of gamma-TMT. The results demonstrate the efficacy of consensus sequence-driven identification of alternative substrates for PsLSMT as well as identification of functional attributes of protein methylation catalyzed by LSMT.

  9. Biochemical and molecular characterization of the homocysteine S-methyltransferase from broccoli (Brassica oleracea var. italica).

    PubMed

    Lyi, Sangbom M; Zhou, Xin; Kochian, Leon V; Li, Li

    2007-04-01

    Plants are known for their unique ability to synthesize methionine from S-methylmethionine (SMM) and homocysteine using the enzyme SMM: homocysteine S-methyltransferase (HMT) in the SMM cycle. Two cDNAs exhibiting HMT activity were cloned from broccoli and functionally expressed in E. coli. One cDNA, that encodes an enzyme with high substrate specificity for homocysteine, was designated as BoHMT1. The other cDNA was the BoSMT gene that we previously characterized and encodes a selenocysteine methyltransferase (Lyi, S.M., Heller, L.I., Rutzke, M., Welch, R.M., Kochian, L.V., Li, L., 2005. Molecular and biochemical characterization of the selenocysteine Se-methyltransferase gene and Se-methylselenocysteine synthesis in broccoli. Plant Physiol. 138, 409-420). Both exist as single gene sequences in the broccoli genome. While BoSMT expression was extremely low or undetectable in broccoli plants unless the plants were exposed to selenium, the BoHMT1 mRNA accumulated in most tissues of the plant except older leaves. In contrast to BoSMT whose expression was dramatically upregulated by treating plants with selenate, the transcript levels of BoHMT1 were not markedly affected in plants exposed to selenium. BoHMT1 expression responded significantly to changes in plant sulfur status. However, its expression was not dramatically affected in plants treated with methionine, SMM, homocysteine, or the heavy metal, cadmium. The differences in the substrate specificity and gene expression in response to changes in plant sulfur and selenium status between BoHMT1 and BoSMT suggest that the enzymes encoded by these two genes play distinct roles in sulfur and selenium metabolism in broccoli.

  10. Specific potassium ion interactions facilitate homocysteine binding to betaine-homocysteine S-methyltransferase.

    PubMed

    Mládková, Jana; Hladílková, Jana; Diamond, Carrie E; Tryon, Katherine; Yamada, Kazuhiro; Garrow, Timothy A; Jungwirth, Pavel; Koutmos, Markos; Jiráček, Jiří

    2014-10-01

    Betaine-homocysteine S-methyltransferase (BHMT) is a zinc-dependent methyltransferase that uses betaine as the methyl donor for the remethylation of homocysteine to form methionine. This reaction supports S-adenosylmethionine biosynthesis, which is required for hundreds of methylation reactions in humans. Herein we report that BHMT is activated by potassium ions with an apparent K(M) for K⁺ of about 100 µM. The presence of potassium ions lowers the apparent K(M) of the enzyme for homocysteine, but it does not affect the apparent K(M) for betaine or the apparent k(cat) for either substrate. We employed molecular dynamics (MD) simulations to theoretically predict and protein crystallography to experimentally localize the binding site(s) for potassium ion(s). Simulations predicted that K⁺ ion would interact with residues Asp26 and/or Glu159. Our crystal structure of BHMT bound to homocysteine confirms these sites of interaction and reveals further contacts between K⁺ ion and BHMT residues Gly27, Gln72, Gln247, and Gly298. The potassium binding residues in BHMT partially overlap with the previously identified DGG (Asp26-Gly27-Gly28) fingerprint in the Pfam 02574 group of methyltransferases. Subsequent biochemical characterization of several site-specific BHMT mutants confirmed the results obtained by the MD simulations and crystallographic data. Together, the data herein indicate that the role of potassium ions in BHMT is structural and that potassium ion facilitates the specific binding of homocysteine to the active site of the enzyme.

  11. Glycine N-methyltransferase is a mediator of cytochrome P4501A1 gene expression.

    PubMed

    Raha, A; Joyce, T; Gusky, S; Bresnick, E

    1995-10-01

    Cytochrome P4501A1, the isozyme most closely approximating aryl hydrocarbon hydroxylase activity under conditions of induction, is thought to be regulated by several trans-acting factors, including the 4S polycyclic aromatic hydrocarbon-binding protein; this protein has recently been identified as glycine N-methyltransferase (Raha et al. (1994) J. Biol. Chem. 269, 5750-5756). Previous studies had shown that partially purified liver preparations containing the 4S binding protein interacted with 5'-flanking regions of the cytochrome P4501A1 gene. Consequently, the ability of the 4S binding protein to serve as a mediator in the regulation of the cytochrome P4501A1 gene was investigated further. Introduction of an antisense 24-mer oligonucleotide to glycine N-methyltransferase cDNA into rat hepatoma H4IIE cells by lipofectin resulted in a 60% reduction in the benzo(a)pyrene-mediated induction of ethoxyresorufin-O-deethylase activity and protein over the sense and scrambled antisense oligonucleotide controls. In addition, the antisense oligonucleotide caused a marked reduction in the steady-state level of cytochrome P4501A1 mRNA; no such effect was observed with the sense oligonucleotide. Introduction of GNMT polyclonal antibodies into H4IIE cells by a streptolysin-O permeabilization technique markedly reduced both benzo(a)pyrene-binding and benzo(a)-pyrene-induced ethoxyresorufin-O-deethylase activities, but had no effect on 2,3,7,8-tetrachlorodibenzo-p-dioxin induction. Collectively, these findings suggest that, in addition to the Ah (dioxin) receptor, glycine N-methyltransferase appears to be both a polycyclic aromatic hydrocarbon-binding protein and a mediator of the induction of the cytochrome P4501A1 gene by polycyclic hydrocarbons such as benzo(a)pyrene. PMID:7574713

  12. The Structure and Catalytic Mechanism of Sorghum bicolor Caffeoyl-CoA O-Methyltransferase.

    PubMed

    Walker, Alexander M; Sattler, Steven A; Regner, Matt; Jones, Jeffrey P; Ralph, John; Vermerris, Wilfred; Sattler, Scott E; Kang, ChulHee

    2016-09-01

    Caffeoyl-coenzyme A 3-O-methyltransferase (CCoAOMT) is an S-adenosyl methionine (SAM)-dependent O-methyltransferase responsible for methylation of the meta-hydroxyl group of caffeoyl-coenzyme A (CoA) on the pathway to monolignols, with their ring methoxylation status characteristic of guaiacyl or syringyl units in lignin. In order to better understand the unique class of type 2 O-methyltransferases from monocots, we have characterized CCoAOMT from sorghum (Sorghum bicolor; SbCCoAOMT), including the SAM binary complex crystal structure and steady-state enzyme kinetics. Key amino acid residues were validated with site-directed mutagenesis. Isothermal titration calorimetry data indicated a sequential binding mechanism for SbCCoAOMT, wherein SAM binds prior to caffeoyl-CoA, and the enzyme showed allosteric behavior with respect to it. 5-Hydroxyferuloyl-CoA was not a substrate for SbCCoAOMT. We propose a catalytic mechanism in which lysine-180 acts as a catalytic base and deprotonates the reactive hydroxyl group of caffeoyl-CoA. This deprotonation is facilitated by the coordination of the reactive hydroxyl group by Ca(2+) in the active site, lowering the pKa of the 3'-OH group. Collectively, these data give a new perspective on the catalytic mechanism of CCoAOMTs and provide a basis for the functional diversity exhibited by type 2 plant OMTs that contain a unique insertion loop (residues 208-231) conferring affinity for phenylpropanoid-CoA thioesters. The structural model of SbCCoAOMT can serve as the basis for protein engineering approaches to enhance the nutritional, agronomic, and industrially relevant properties of sorghum. PMID:27457122

  13. Molecular Evolution of the Substrate Specificity of Chloroplastic Aldolases/Rubisco Lysine Methyltransferases in Plants.

    PubMed

    Ma, Sheng; Martin-Laffon, Jacqueline; Mininno, Morgane; Gigarel, Océane; Brugière, Sabine; Bastien, Olivier; Tardif, Marianne; Ravanel, Stéphane; Alban, Claude

    2016-04-01

    Rubisco and fructose-1,6-bisphosphate aldolases (FBAs) are involved in CO2 fixation in chloroplasts. Both enzymes are trimethylated at a specific lysine residue by the chloroplastic protein methyltransferase LSMT. Genes coding LSMT are present in all plant genomes but the methylation status of the substrates varies in a species-specific manner. For example, chloroplastic FBAs are naturally trimethylated in both Pisum sativum and Arabidopsis thaliana, whereas the Rubisco large subunit is trimethylated only in the former species. The in vivo methylation status of aldolases and Rubisco matches the catalytic properties of AtLSMT and PsLSMT, which are able to trimethylate FBAs or FBAs and Rubisco, respectively. Here, we created chimera and site-directed mutants of monofunctional AtLSMT and bifunctional PsLSMT to identify the molecular determinants responsible for substrate specificity. Our results indicate that the His-Ala/Pro-Trp triad located in the central part of LSMT enzymes is the key motif to confer the capacity to trimethylate Rubisco. Two of the critical residues are located on a surface loop outside the methyltransferase catalytic site. We observed a strict correlation between the presence of the triad motif and the in vivo methylation status of Rubisco. The distribution of the motif into a phylogenetic tree further suggests that the ancestral function of LSMT was FBA trimethylation. In a recent event during higher plant evolution, this function evolved in ancestors of Fabaceae, Cucurbitaceae, and Rosaceae to include Rubisco as an additional substrate to the archetypal enzyme. Our study provides insight into mechanisms by which SET-domain protein methyltransferases evolve new substrate specificity. PMID:26785049

  14. Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity

    SciTech Connect

    Song, Yuan; Wu, Keqiang; Dhaubhadel, Sangeeta; An, Lizhe; Tian, Lining

    2010-05-28

    DNA methyltransferase2 (DNMT2) is always deemed to be enigmatic, because it contains highly conserved DNA methyltransferase motifs but lacks the DNA methylation catalytic capability. Here we show that Arabidopsis DNA methyltransferase2 (AtDNMT2) is localized in nucleus and associates with histone deacetylation. Bimolecular fluorescence complementation and pull-down assays show AtDNMT2 interacts with type-2 histone deacetylases (AtHD2s), a unique type of histone deacetylase family in plants. Through analyzing the expression of AtDNMT2: ss-glucuronidase (GUS) fusion protein, we demonstrate that AtDNMT2 has the ability to repress gene expression at transcription level. Meanwhile, the expression of AtDNMT2 gene is altered in athd2c mutant plants. We propose that AtDNMT2 possibly involves in the activity of histone deacetylation and plant epigenetic regulatory network.

  15. Coordination of stress signals by the lysine methyltransferase SMYD2 promotes pancreatic cancer.

    PubMed

    Reynoird, Nicolas; Mazur, Pawel K; Stellfeld, Timo; Flores, Natasha M; Lofgren, Shane M; Carlson, Scott M; Brambilla, Elisabeth; Hainaut, Pierre; Kaznowska, Ewa B; Arrowsmith, Cheryl H; Khatri, Purvesh; Stresemann, Carlo; Gozani, Or; Sage, Julien

    2016-04-01

    Pancreatic ductal adenocarcinoma (PDAC) is a lethal form of cancer with few therapeutic options. We found that levels of the lysine methyltransferase SMYD2 (SET and MYND domain 2) are elevated in PDAC and that genetic and pharmacological inhibition of SMYD2 restricts PDAC growth. We further identified the stress response kinase MAPKAPK3 (MK3) as a new physiologic substrate of SMYD2 in PDAC cells. Inhibition of MAPKAPK3 impedes PDAC growth, identifying a potential new kinase target in PDAC. Finally, we show that inhibition of SMYD2 cooperates with standard chemotherapy to treat PDAC cells and tumors. These findings uncover a pivotal role for SMYD2 in promoting pancreatic cancer.

  16. Synthesis and Evaluation of Heterocyclic Catechol Mimics as Inhibitors of Catechol-O-methyltransferase (COMT)

    PubMed Central

    2015-01-01

    3-Hydroxy-4-pyridinones and 5-hydroxy-4-pyrimidinones were identified as inhibitors of catechol-O-methyltransferase (COMT) in a high-throughput screen. These heterocyclic catechol mimics exhibit potent inhibition of the enzyme and an improved toxicity profile versus the marketed nitrocatechol inhibitors tolcapone and entacapone. Optimization of the series was aided by X-ray cocrystal structures of the novel inhibitors in complex with COMT and cofactors SAM and Mg2+. The crystal structures suggest a mechanism of inhibition for these heterocyclic inhibitors distinct from previously disclosed COMT inhibitors. PMID:25815153

  17. Discovery of A-893, A New Cell-Active Benzoxazinone Inhibitor of Lysine Methyltransferase SMYD2

    PubMed Central

    2015-01-01

    A lack of useful small molecule tools has precluded thorough interrogation of the biological function of SMYD2, a lysine methyltransferase with known tumor-suppressor substrates. Systematic exploration of the structure–activity relationships of a previously known benzoxazinone compound led to the synthesis of A-893, a potent and selective SMYD2 inhibitor (IC50: 2.8 nM). A cocrystal structure reveals the origin of enhanced potency, and effective suppression of p53K370 methylation is observed in a lung carcinoma (A549) cell line. PMID:26101576

  18. An easy-to-perform photometric assay for methyltransferase activity measurements.

    PubMed

    Schäberle, Till F; Siba, Christian; Höver, Thomas; König, Gabriele M

    2013-01-01

    Methyltransferases (MTs) catalyze the transfer of a methyl group from S-adenosylmethionine (SAM) to a suitable substrate. Such methylations are important modifications in secondary metabolisms, especially on natural products produced by polyketide synthases and nonribosomal peptide synthetases, many of which are of special interest due to their prominent pharmacological activities (e.g., lovastatin, cyclosporin). To gain basic biochemical knowledge on the methylation process, it is of immense relevance to simplify methods concerning experimental problems caused by a large variety in substrates. Here, we present a photometric method to analyze MT activity by measuring SAM consumption in a coupled enzyme assay.

  19. Crystal structure of phosphoethanolamine methyltransferase from Plasmodium falciparum in complex with amodiaquine

    SciTech Connect

    Lee, Soon Goo; Alpert, Tara D.; Jez, Joseph M.

    2012-07-17

    Phosphoethanolamine N-methyltransferase (PMT) is essential for phospholipid biogenesis in the malarial parasite Plasmodium falciparum. PfPMT catalyzes the triple methylation of phosphoethanolamine to produce phosphocholine, which is then used for phosphatidylcholine synthesis. Here we describe the 2.0 {angstrom} resolution X-ray crystal structure of PfPMT in complex with amodiaquine. To better characterize inhibition of PfPMT by amodiaquine, we determined the IC{sub 50} values of a series of aminoquinolines using a direct radiochemical assay. Both structural and functional analyses provide a possible approach for the development of new small molecule inhibitors of PfPMT.

  20. Regioselectivity of catechol O-methyltransferase confers enhancement of catalytic activity

    NASA Astrophysics Data System (ADS)

    Tsao, Douglas; Liu, Shubin; Dokholyan, Nikolay V.

    2011-04-01

    Catechol O-methyltransferase (COMT) metabolizes catechol moieties by methylating a single hydroxyl group at the meta- or para- hydroxyl position. Hydrophobic amino acids near the active site of COMT influence the regioselectivity of this reaction. Our sequence analysis highlights their importance by showing that these residues are highly conserved throughout evolution. Reaction barriers calculated in the gas phase reveal a lower barrier during methylation at the meta- position, suggesting that the observed meta-regioselectivity of COMT can be attributed to the substrate itself, and that COMT has evolved residues to orient the substrate in a manner that increases the rate of catalysis.

  1. Queen pheromones modulate DNA methyltransferase activity in bee and ant workers.

    PubMed

    Holman, Luke; Trontti, Kalevi; Helanterä, Heikki

    2016-01-01

    DNA methylation is emerging as an important regulator of polyphenism in the social insects. Research has concentrated on differences in methylation between queens and workers, though we hypothesized that methylation is involved in mediating other flexible phenotypes, including pheromone-dependent changes in worker behaviour and physiology. Here, we find that exposure to queen pheromone affects the expression of two DNA methyltransferase genes in Apis mellifera honeybees and in two species of Lasius ants, but not in Bombus terrestris bumblebees. These results suggest that queen pheromones influence the worker methylome, pointing to a novel proximate mechanism for these key social signals. PMID:26814223

  2. Keeping them all together: β-propeller domains in histone methyltransferase complexes.

    PubMed

    Bergamin, Elisa; Blais, Alexandre; Couture, Jean-François

    2014-10-01

    Histone methyltransferases (HKMTs) residing in multi-subunit protein complexes frequently require the presence of β-propeller proteins to achieve their biological functions. Recent biochemical studies have highlighted the functional diversity of these scaffolding proteins in maintaining the integrity of the complexes, allosterically regulating HKMT enzymatic activity and acting as "histone tethering devices" to facilitate the interaction between HKMTs and their substrates. Structural studies have revealed that, while β-propeller domain proteins share structural similarity, they employ divergent mechanisms to achieve their functions. This review focuses on the progress made in the last decade to identify the biochemical determinants underlying the functions of these important proteins.

  3. Identification of Potent, Selective, Cell-Active Inhibitors of the Histone Lysine Methyltransferase EZH2.

    PubMed

    Verma, Sharad K; Tian, Xinrong; LaFrance, Louis V; Duquenne, Céline; Suarez, Dominic P; Newlander, Kenneth A; Romeril, Stuart P; Burgess, Joelle L; Grant, Seth W; Brackley, James A; Graves, Alan P; Scherzer, Daryl A; Shu, Art; Thompson, Christine; Ott, Heidi M; Aller, Glenn S Van; Machutta, Carl A; Diaz, Elsie; Jiang, Yong; Johnson, Neil W; Knight, Steven D; Kruger, Ryan G; McCabe, Michael T; Dhanak, Dashyant; Tummino, Peter J; Creasy, Caretha L; Miller, William H

    2012-12-13

    The histone H3-lysine 27 (H3K27) methyltransferase EZH2 plays a critical role in regulating gene expression, and its aberrant activity is linked to the onset and progression of cancer. As part of a drug discovery program targeting EZH2, we have identified highly potent, selective, SAM-competitive, and cell-active EZH2 inhibitors, including GSK926 (3) and GSK343 (6). These compounds are small molecule chemical tools that would be useful to further explore the biology of EZH2. PMID:24900432

  4. Isolation and characterization of site-specific DNA-methyltransferases from Bacillus coagulans K.

    PubMed

    Svadbina, I V; Zelinskaya, N V; Kovalevskaya, N P; Zheleznaya, L A; Matvienko, N I

    2004-03-01

    Two site-specific DNA methyltransferases, M.BcoKIA and M.BcoKIB, were isolated from the thermophilic strain Bacillus coagulans K. Each of the methylases protects the recognition site 5'-CTCTTC-3'/5'-GAAGAG-3' from cleavage with the cognate restriction endonuclease BcoKI. It is shown that M.BcoKIB is an N6-adenine specific methylase and M.BcoKIA is an N4-cytosine specific methylase. According to bisulfite mapping, M.BcoKIA methylates the first cytosine in the sequence 5'-CTCTTC-3'. PMID:15061697

  5. The determination of DNA methyltransferase activity by quenching of tris(2,2'-bipyridine)ruthenium electrogenerated chemiluminescence with ferrocene.

    PubMed

    Luo, Xiaoe; Li, Yan; Zheng, Jianbin; Qi, Honglan; Liang, Zhenxing; Ning, Xiaohui

    2015-06-11

    An electrogenerated chemiluminescence (ECL) biosensing method for the determination of DNA methyltransferase activity is developed by the quenching of tris(2,2'-bipyridine)ruthenium ECL by ferrocene, and it is demonstrated that the ECL biosensing method measures DNA adenine methylation methyltransferase over a dynamic concentration range (0.1 U mL(-1)-100 U mL(-1)) with an extremely low detection limit of 0.03 U mL(-1), using gold nanoparticles and a quenching ECL signal produced by a chemical quencher such as ferrocene.

  6. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence

    PubMed Central

    Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  7. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  8. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  9. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.

    PubMed

    Jagannathan, Indu; Culver, Gloria M

    2004-01-30

    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  10. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  11. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    PubMed

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  12. Molecular cloning and characterization of an rRNA operon in Streptomyces lividans TK21.

    PubMed Central

    Suzuki, Y; Ono, Y; Nagata, A; Yamada, T

    1988-01-01

    The number of rRNA genes in Streptomyces lividans was examined by Southern hybridization. Randomly labeled 23 and 16S rRNAs were hybridized with BamHI, BglII, PstI, SalI, or XhoI digests of S. lividans TK21 DNA. BamHi, BglII, SalI and XhoI digests yielded six radioactive bands each for the 23 and 16S rRNAs, whereas PstI digests gave one band for the 23S rRNA and one high-intensity band and six low-density bands for the 16S rRNA. The 7.4-kilobase-pair BamHI fragment containing one of the rRNA gene clusters was cloned into plasmid pBR322. The hybrid plasmid, pSLTK1, was characterized by physical mapping, Southern hybridization, and electron microscopic analysis of the R loops formed between pSLTK1 and the 23 and 16S rRNAs. There were at least six rRNA genes in S. lividans TK21. The 16 and 23S rRNA genes were estimated to be about 1.40 and 3.17 kilobase pairs, respectively. The genes for the rRNAs were aligned in the sequence 16S-23S-5S. tRNA genes were not found in the spacer region or in the context of the rRNA genes. The G + C content of the spacer region was calculated to be approximately 58%, in contrast to 73% for the chromosome as a whole. Images PMID:2832372

  13. Performance of 18S rRNA in littorinid phylogeny (Gastropoda: Caenogastropoda).

    PubMed

    Winnepenninckx, B M; Reid, D G; Backeljau, T

    1998-11-01

    In the past, 18S rRNA sequences have proved to be very useful for tracing ancient divergences but were rarely used for resolving more recent ones. Moreover, it was suggested that the molecule does not contain useful information to resolve divergences which took place during less than 40 Myr. The present paper takes littorinid phylogeny as a case study to reevaluate the utility of the molecule for resolving recent divergences. Two data sets for nine species of the snail family Littorinidae were analyzed, both separately and combined. One data set comprised 7 new complete 18S rRNA sequences aligned with 2 published littorinid sequences; the other comprised 12 morphological, 1 biochemical, and 2 18S rRNA secondary structure characters. On the basis of its ability to confirm generally accepted relationships and the congruence of results derived from the different data sets, it is concluded that 18S rRNA sequences do contain information to resolve "rapid" cladogenetic events, provided that they occurred in the not too distant past. 18S rRNA sequences yielded support for (1) the branching order (L. littorea, (L. obtusata, (L. saxatilis, L. compressa))) and (2) the basal position of L. striata in the Littorina clade. PMID:9797409

  14. Decreases in average bacterial community rRNA operon copy number during succession

    PubMed Central

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-01-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  15. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  16. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  17. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  18. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  19. 18S rRNA secondary structure and phylogenetic position of Peloridiidae (Insecta, hemiptera).

    PubMed

    Ouvrard, D; Campbell, B C; Bourgoin, T; Chan, K L

    2000-09-01

    A secondary structure model for 18S rRNA of peloridiids, relict insects with a present-day circumantarctic distribution, is constructed using comparative sequence analysis, thermodynamic folding, a consensus method using 18S rRNA models of other taxa, and support of helices based on compensatory substitutions. Results show that probable in vivo configuration of 18S rRNA is not predictable using current free-energy models to fold the entire molecule concurrently. This suggests that refinements in free-energy minimization algorithms are needed. Molecular phylogenetic datasets were created using 18S rRNA nucleotide alignments produced by CLUSTAL and rigorous interpretation of homologous position based on certain secondary substructures. Phylogenetic analysis of a hemipteran data matrix of 18S rDNA sequences placed peloridiids sister to Heteroptera. Resolution of affiliations between the three main euhemipteran lineages was unresolved. The peloridiid 18S RNA model presented here provides the most accurate template to date for aligning homologous nucleotides of hemipteran taxa. Using folded 18S rRNA to infer homology of character as morpho-molecular structures or nucleotides and scoring particular sites or substructures is discussed. PMID:10991793

  20. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  1. Decreases in average bacterial community rRNA operon copy number during succession.

    PubMed

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution. PMID:26565722

  2. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    PubMed

    Orsi, William; Biddle, Jennifer F; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  3. Novel essential gene Involved in 16S rRNA processing in Escherichia coli.

    PubMed

    Kurata, Tatsuaki; Nakanishi, Shinobu; Hashimoto, Masayuki; Taoka, Masato; Yamazaki, Yukiko; Isobe, Toshiaki; Kato, Jun-ichi

    2015-02-27

    Biogenesis of ribosomes is a complex process mediated by many factors. While its transcription proceeds, ribosomal RNA (rRNA) folds itself into a characteristic three-dimensional structure through interaction with ribosomal proteins, during which its ends are processed. Here, we show that the essential protein YqgF, a RuvC family protein with an RNase-H-like motif, is involved in the processing of pre-16S rRNA during ribosome maturation. Indeed, pre-16S rRNA accumulated in cells of a temperature-sensitive yqgF mutant (yqgF(ts)) cultured at a non-permissive temperature. In addition, purified YqgF was shown to process the 5' end of pre-16S rRNA within 70S ribosomes in vitro. Mass spectrometry analysis of the total proteins in the yqgF(ts) mutant cells showed that the expression of genes containing multiple Shine-Dalgarno-like sequences was observed to be lower than in wild type. These results are interpreted to indicate that YqgF is involved in a novel enzymic activity necessary for the processing of pre-16S rRNA, thereby affecting elongation of translation.

  4. Sequence and phylogenetic analysis of SSU rRNA gene of five microsporidia.

    PubMed

    Dong, ShiNan; Shen, ZhongYuan; Xu, Li; Zhu, Feng

    2010-01-01

    The complete small subunit rRNA (SSU rRNA) gene sequences of five microsporidia including Nosema heliothidis, and four novel microsporidia isolated from Pieris rapae, Phyllobrotica armta, Hemerophila atrilineata, and Bombyx mori, respectively, were obtained by PCR amplification, cloning, and sequencing. Two phylogenetic trees based on SSU rRNA sequences had been constructed by using Neighbor-Joining of Phylip software and UPGMA of MEGA4.0 software. The taxonomic status of four novel microsporidia was determined by analysis of phylogenetic relationship, length, G+C content, identity, and divergence of the SSU rRNA sequences. The results showed that the microsporidia isolated from Pieris rapae, Phyllobrotica armta, and Hemerophila atrilineata have close phylogenetic relationship with the Nosema, while another microsporidium isolated from Bombyx mori is closely related to the Endoreticulatus. So, we temporarily classify three novel species of microsporidia to genus Nosema, as Nosema sp. PR, Nosema sp. PA, Nosema sp. HA. Another is temporarily classified into genus Endoreticulatus, as Endoreticulatus sp. Zhenjiang. The result indicated as well that it is feasible and valuable to elucidate phylogenetic relationships and taxonomic status of microsporidian species by analyzing information from SSU rRNA sequences of microsporidia. PMID:19768503

  5. Deep Sequencing of Subseafloor Eukaryotic rRNA Reveals Active Fungi across Marine Subsurface Provinces

    PubMed Central

    Orsi, William; Biddle, Jennifer F.; Edgcomb, Virginia

    2013-01-01

    The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC), nitrate, sulfide, and dissolved inorganic carbon (DIC). These correlations are supported by terminal restriction length polymorphism (TRFLP) analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface. PMID:23418556

  6. Novel Function of Lysine Methyltransferase G9a in the Regulation of Sox2 Protein Stability

    PubMed Central

    Lee, Jae-Young; Lee, Se-Hwan; Heo, Sun-Hee; Kim, Kwang-Soo; Kim, Changhoon; Kim, Dae-Kwan; Ko, Jeong-Jae; Park, Kyung-Soon

    2015-01-01

    G9a is a lysine methyltransferase (KMTase) for histone H3 lysine 9 that plays critical roles in a number of biological processes. Emerging evidence suggests that aberrant expression of G9a contributes to tumor metastasis and maintenance of a malignant phenotype in cancer by inducing epigenetic silencing of tumor suppressor genes. Here, we show that G9a regulates Sox2 protein stability in breast cancer cells. When G9a lysine methyltransferase activity was chemically inhibited in the ER(+) breast cancer cell line MCF7, Sox2 protein levels were decreased. In addition, ectopic overexpression of G9a induced accumulation of Sox2. Changes in cell migration, invasion, and mammosphere formation by MCF7 cells were correlated with the activity or expression level of G9a. Ectopic expression of G9a also increased Sox2 protein levels in another ER(+) breast cancer cell line, ZR-75-1, whereas it did not affect Sox2 expression in MDA-MB-231 cells, an ER(-) breast cancer cell line, or in glioblastoma cell lines. Furthermore, treatment of mouse embryonic stem cells with a KMT inhibitor, BIX-01294, resulted in a rapid reduction in Sox2 protein expression despite increased Sox2 transcript levels. This finding suggests that G9a has a novel function in the regulation of Sox2 protein stability in a cell type-dependent manner. PMID:26492085

  7. Biochemical characterization of maintenance DNA methyltransferase DNMT-1 from silkworm, Bombyx mori.

    PubMed

    Mitsudome, Takumi; Mon, Hiroaki; Xu, Jian; Li, Zhiqing; Lee, Jae Man; Patil, Anandrao Ashok; Masuda, Atsushi; Iiyama, Kazuhiro; Morokuma, Daisuke; Kusakabe, Takahiro

    2015-03-01

    DNA methylation is an important epigenetic mechanism involved in gene expression of vertebrates and invertebrates. In general, DNA methylation profile is established by de novo DNA methyltransferases (DNMT-3A, -3B) and maintainance DNA methyltransferase (DNMT-1). DNMT-1 has a strong substrate preference for hemimethylated DNA over the unmethylated one. Because the silkworm genome lacks an apparent homologue of de novo DNMT, it is still unclear that how silkworm chromosome establishes and maintains its DNA methylation profile. As the first step to unravel this enigma, we purified recombinant BmDNMT-1 using baculovirus expression system and characterized its DNA-binding and DNA methylation activity. We found that the BmDNMT-1 preferentially methylates hemimethylated DNA despite binding to both unmethylated and hemimethylated DNA. Interestingly, BmDNMT-1 formed a complex with DNA in the presence or absence of methyl group donor, S-Adenosylmethionine (AdoMet) and the AdoMet-dependent complex formation was facilitated by Zn(2+) and Mn(2+). Our results provide clear evidence that BmDNMT-1 retained the function as maintenance DNMT but its sensitivity to metal ions is different from mammalian DNMT-1.

  8. A single point mutation leading to loss of catalytic activity in human thiopurine S-methyltransferase.

    PubMed Central

    Krynetski, E Y; Schuetz, J D; Galpin, A J; Pui, C H; Relling, M V; Evans, W E

    1995-01-01

    Thiopurine S-methyltransferase (TPMT; S-adenosyl-L-methionine:thiopurine S-methyltransferase, EC 2.1.1.67) activity exhibits genetic polymorphism, with approximately 0.33% of Caucasians and African-Americans inheriting TPMT deficiency as an autosomal recessive trait. To determine the molecular genetic basis for this polymorphism, we cloned the TPMT cDNA from a TPMT-deficient patient who had developed severe hematopoietic toxicity during mercaptopurine therapy. Northern blot analysis of RNA isolated from leukocytes of the deficient patient demonstrated the presence of TPMT mRNAs of comparable size to that in subjects with high TPMT activity. Sequencing of the mutant TPMT cDNA revealed a single point mutation (G238-->C), leading to an amino acid substitution at codon 80 (Ala80-->Pro). When assessed in a yeast heterologous expression system, this mutation led to a 100-fold reduction in TPMT catalytic activity relative to the wild-type cDNA, despite a comparable level of mRNA expression. A mutation-specific PCR amplification method was developed and used to detect the G238-->C mutation in genomic DNA of the propositus and her mother. This inactivating mutation in the human TPMT gene provides insights into the genetic basis for this inherited polymorphism in drug metabolism. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:7862671

  9. Comparative Analysis of DNA Methyltransferase Gene Family in Fungi: A Focus on Basidiomycota

    PubMed Central

    Huang, Ruirui; Ding, Qiangqiang; Xiang, Yanan; Gu, Tingting; Li, Yi

    2016-01-01

    DNA methylation plays a crucial role in the regulation of gene expression in eukaryotes. Mushrooms belonging to the phylum Basidiomycota are highly valued for both nutritional and pharmaceutical uses. A growing number of studies have demonstrated the significance of DNA methylation in the development of plants and animals. However, our understanding of DNA methylation in mushrooms is limited. In this study, we identified and conducted comprehensive analyses on DNA methyltransferases (DNMtases) in representative species from Basidiomycota and Ascomycota, and obtained new insights into their classification and characterization in fungi. Our results revealed that DNMtases in basidiomycetes can be divided into two classes, the Dnmt1 class and the newly defined Rad8 class. We also demonstrated that the fusion event between the characteristic domains of the DNMtases family and Snf2 family in the Rad8 class is fungi-specific, possibly indicating a functional novelty of Rad8 DNMtases in fungi. Additionally, expression profiles of DNMtases in the edible mushroom Pleurotus ostreatus revealed diverse expression patterns in various organs and developmental stages. For example, DNMtase genes displayed higher expression levels in dikaryons than in monokaryons. Consistent with the expression profiles, we found that dikaryons are more susceptible to the DNA methyltransferase inhibitor 5-azacytidine. Taken together, our findings pinpoint an important role of DNA methylation during the growth of mushrooms and provide a foundation for understanding of DNMtases in basidiomycetes.

  10. The DmtA methyltransferase contributes to Aspergillus flavus conidiation, sclerotial production, aflatoxin biosynthesis and virulence

    PubMed Central

    Yang, Kunlong; Liang, Linlin; Ran, Fanlei; Liu, Yinghang; Li, Zhenguo; Lan, Huahui; Gao, Peili; Zhuang, Zhenhong; Zhang, Feng; Nie, Xinyi; Kalayu Yirga, Shimuye; Wang, Shihua

    2016-01-01

    DNA methylation is essential for epigenetic regulation of gene transcription and development in many animals, plants and fungi. We investigated whether DNA methylation plays a role in the development and secondary metabolism of Aspergillus flavus, identified the DmtA methyltransferase from A. flavus, and produced a dmtA knock-out mutant by replacing the dmtA coding sequence with the pyrG selectable marker. The A. flavus dmtA null mutant lines produced white fluffy mycelium in liquid medium, and displayed a slightly flavescent conidial pigmentation compared with the normal yellow of the wild-type strain when grown on agar. The ΔdmtA lines exhibited decreased conidiation and aflatoxin (AF) biosynthesis, compared with the wild-type line, suggesting that the DmtA knock-out affected the transcriptional level of genes in the AF cluster. In particular, sclerotia development and host colonization were altered in the dmtA null mutants. Green fluorescent protein tagging at the C-terminus of DmtA showed that DmtA localized to the nucleus and cytoplasm. DNA methylation content measurements in the dmtA mutants revealed no widespread DNA methylation in the mutants or wild-type lines. Thus, our findings suggest that DmtA, apart from being a C-5 cytosine methyltransferase in A. flavus, contributes to asexual development, aflatoxin biosynthesis, sclerotial production and virulence. PMID:26979781

  11. Structure and Mechanism of the Rebeccamycin Sugar 4'-O-Methyltransferase RebM

    SciTech Connect

    Singh, Shanteri; McCoy, Jason G.; Zhang, Changsheng; Bingman, Craig A.; Phillips, Jr., George N.; Thorson, Jon S.

    2008-12-12

    The 2.65-{angstrom} crystal structure of the rebeccamycin 4'-O-methyltransferase RebM in complex with S-adenosyl-l-homocysteine revealed RebM to adopt a typical S-adenosylmethionine-binding fold of small molecule O-methyltransferases (O-MTases) and display a weak dimerization domain unique to MTases. Using this structure as a basis, the RebM substrate binding model implicated a predominance of nonspecific hydrophobic interactions consistent with the reported ability of RebM to methylate a wide range of indolocarbazole surrogates. This model also illuminated the three putative RebM catalytic residues (His{sup 140/141} and Asp{sup 166}) subsequently found to be highly conserved among sequence-related natural product O-MTases from GC-rich bacteria. Interrogation of these residues via site-directed mutagenesis in RebM demonstrated His{sup 140} and Asp{sup 166} to be most important for catalysis. This study reveals RebM to be a member of the general acid/base-dependent O-MTases and, as the first crystal structure for a sugar O-MTase, may also present a template toward the future engineering of natural product MTases for combinatorial applications.

  12. Physcomitrella patens DNA methyltransferase 2 is required for recovery from salt and osmotic stress.

    PubMed

    Arya, Deepshikha; Kapoor, Sanjay; Kapoor, Meenu

    2016-02-01

    DNA methyltransferase 2 (DNMT2) unlike other members of the cytosine DNA methyltransferase gene family has dual substrate specificity and it methylates cytosines in both the DNA and transfer RNA (tRNA). Its role in plants, however, has remained obscure to date. In this study, we demonstrate that DNMT2 from Physcomitrella patens accumulates in a temporal manner under salt and osmotic stress showing maximum accumulation during recovery, i.e. 24 h after plants are transferred to normal growth medium. Therefore, to study its role in stress tolerance, we generated PpDNMT2 targeted knockout plants (ppdnmt2ko). Mutant plants show increased sensitivity to salt and osmotic stress and are unable to recover even after 21 days of growth on optimal growth media. ppdnmt2ko, however, accumulate normal levels of dehydrin-like and small heat shock protein encoding transcripts under stress but show dramatic reduction in levels of tRNA(A) (sp-) (GUC) . The levels of tRNA(A) (sp-) (GUC) , in contrast, increase ~ 25-30-fold in ppdnmt2ko under non-stress conditions and > 1200-fold in wild-type plants under stress. The role of PpDNMT2 in modulating biogenesis/stability of tRNA(A) (sp-) (GUC) under salt and osmotic stress is discussed in the light of these observations. PMID:26639858

  13. Bacteriophage adenine methyltransferase: a life cycle regulator? Modelled using Vibrio harveyi myovirus like.

    PubMed

    Bochow, S; Elliman, J; Owens, L

    2012-11-01

    The adenine methyltransferase (DAM) gene methylates GATC sequences that have been demonstrated in various bacteria to be a powerful gene regulator functioning as an epigenetic switch, particularly with virulence gene regulation. However, overproduction of DAM can lead to mutations, giving rise to variability that may be important for adaptation to environmental change. While most bacterial hosts carry a DAM gene, not all bacteriophage carry this gene. Currently, there is no literature regarding the role DAM plays in life cycle regulation of bacteriophage. Vibrio campbellii strain 642 carries the bacteriophage Vibrio harveyi myovirus like (VHML) that has been proven to increase virulence. The complete genome sequence of VHML bacteriophage revealed a putative adenine methyltransferase gene. Using VHML, a new model of phage life cycle regulation, where DAM plays a central role between the lysogenic and lytic states, will be hypothesized. In short, DAM methylates the rha antirepressor gene and once methylation is removed, homologous CI repressor protein becomes repressed and non-functional leading to the switching to the lytic cycle. Greater understanding of life cycle regulation at the genetic level can, in the future, lead to the genesis of chimeric bacteriophage with greater control over their life cycle for their safe use as probiotics within the aquaculture industry. PMID:22681538

  14. Characterisation of the androgen regulation of glycine N-methyltransferase in prostate cancer cells

    PubMed Central

    Ottaviani, Silvia; Brooke, Greg N; O'Hanlon-Brown, Ciara; Waxman, Jonathan; Ali, Simak; Buluwela, Laki

    2013-01-01

    The development and growth of prostate cancer is dependent on androgens; thus, the identification of androgen-regulated genes in prostate cancer cells is vital for defining the mechanisms of prostate cancer development and progression and developing new markers and targets for prostate cancer treatment. Glycine N-methyltransferase (GNMT) is a S-adenosylmethionine-dependent methyltransferase that has been recently identified as a novel androgen-regulated gene in prostate cancer cells. Although the importance of this protein in prostate cancer progression has been extensively addressed, little is known about the mechanism of its androgen regulation. Here, we show that GNMT expression is stimulated by androgen in androgen receptor (AR) expressing cells and that the stimulation occurs at the mRNA and protein levels. We have identified an androgen response element within the first exon of the GNMT gene and demonstrated that AR binds to this element in vitro and in vivo. Together, these studies identify GNMT as a direct transcriptional target of the AR. As this is an evolutionarily conserved regulatory element, this highlights androgen regulation as an important feature of GNMT regulation. PMID:23997240

  15. DNA methyltransferases and TETs in the regulation of differentiation and invasiveness of extra-villous trophoblasts

    PubMed Central

    Logan, Philip C.; Mitchell, Murray D.; Lobie, Peter E.

    2013-01-01

    Specialized cell types of trophoblast cells form the placenta in which each cell type has particular properties of proliferation and invasion. The placenta sustains the growth of the fetus throughout pregnancy and any aberrant trophoblast differentiation or invasion potentially affects the future health of the child and adult. Recently, the field of epigenetics has been applied to understand differentiation of trophoblast lineages and embryonic stem cells (ESC), from fertilization of the oocyte onward. Each trophoblast cell-type has a distinctive epigenetic profile and we will concentrate on the epigenetic mechanism of DNA methyltransferases and TETs that regulate DNA methylation. Environmental factors affecting the mother potentially regulate the DNA methyltransferases in trophoblasts, and so do steroid hormones, cell cycle regulators, such as p53, and cytokines, especially interlukin-1β. There are interesting questions of why trophoblast genomes are globally hypomethylated yet specific genes can be suppressed by hypermethylation (in general, tumor suppressor genes, such as E-cadherin) and how invasive cell-types are liable to have condensed chromatin, as in metastatic cancer cells. Future work will attempt to understand the interactive nature of all epigenetic mechanisms together and their effect on the complex biological system of trophoblast differentiation and invasion in normal as well as pathological conditions. PMID:24363660

  16. Functional insights from structures of coactivator-associated arginine methyltransferase 1 domains.

    PubMed

    Troffer-Charlier, Nathalie; Cura, Vincent; Hassenboehler, Pierre; Moras, Dino; Cavarelli, Jean

    2007-10-17

    Coactivator-associated arginine methyltransferase 1 (CARM1), a protein arginine methyltransferase recruited by several transcription factors, methylates a large variety of proteins and plays a critical role in gene expression. We report, in this paper, four crystal structures of isolated modules of CARM1. The 1.7 A crystal structure of the N-terminal domain of CARM1 reveals an unexpected PH domain, a scaffold frequently found to regulate protein-protein interactions in a large variety of biological processes. Three crystal structures of the CARM1 catalytic module, two free and one cofactor-bound forms (refined at 2.55 A, 2.4 A and 2.2 A, respectively) reveal large structural modifications including disorder to order transition, helix to strand transition and active site modifications. The N-terminal and the C-terminal end of CARM1 catalytic module contain molecular switches that may inspire how CARM1 regulates its biological activities by protein-protein interactions.

  17. Identification and expression profiling of DNA methyltransferases during development and stress conditions in Solanaceae.

    PubMed

    Kumar, Rahul; Chauhan, Pankaj Kumar; Khurana, Ashima

    2016-09-01

    DNA methyltransferase (DMTase) enzymes contribute to plant development and stress responses by de novo establishment and subsequent maintenance of DNA methylation during replication. However, the molecular mechanism underlying this activity remains obscure, especially in crop species. Using DMTase homolog complement in six Solanaceae species, we demonstrated here that their number remained conserved in Solanum lineage, whereas it was expanded in both pepper and Nicotiana benthamiana. Non-synonymous vs synonymous (Ka/Ks) substitution ratio revealed that most of the Solanaceous DMTase homologs undergo purifying selection. The genomic sequences of tomato DMT homologs in its wild relative, Solanum pennellii, remained highly conserved in their exons and methyltransferase domains. Structure analysis further revealed highly similar folding of DMTase homologs and conservation in the residues participating in protein-protein interaction in Solanum lineage, whereas a considerable diversification was observed of pepper homologs. Transcript profiling of DMTases highlighted both similar and distinct expression patterns of tomato homologs in other species during fruit development and stress responses. Overall, our analysis provides a strong basis for in-depth exploration of both conserved as well as distinct functions of tomato DMTase homologs in other economically important Solanaceae species. PMID:27380018

  18. Structure and expression of the lignin O-methyltransferase gene from Zea mays L.

    PubMed

    Collazo, P; Montoliu, L; Puigdomènech, P; Rigau, J

    1992-12-01

    The isolation and characterization of cDNA and homologous genomic clones encoding the lignin O-methyltransferase (OMT) from maize is reported. The cDNA clone has been isolated by differential screening of maize root cDNA library. Southern analysis indicates that a single gene codes for this protein. The genomic sequence contains a single 916 bp intron. The deduced protein sequence from DNA shares significant homology with the recently reported lignin-bispecific caffeic acid/5-hydroxyferulic OMTs from alfalfa and aspen. It also shares homology with OMTs from bovine pineal glands and a purple non-sulfur photosynthetic bacterium. The mRNA of this gene is present at different levels in distinct organs of the plant with the highest accumulation detected in the elongation zone of roots. Bacterial extracts from clones containing the maize OMT cDNA show an activity in methylation of caffeic acid to ferulic acid comparable to that existing in the plant extracts. These results indicate that the described gene encodes the caffeic acid 3-O-methyltransferase (COMT) involved in the lignin bio-synthesis of maize. PMID:1463825

  19. DNA Methyltransferase protein synthesis is reduced in CXXC finger protein 1-deficient embryonic stem cells.

    PubMed

    Butler, Jill S; Palam, Lakshmi R; Tate, Courtney M; Sanford, Jeremy R; Wek, Ronald C; Skalnik, David G

    2009-05-01

    CXXC finger protein 1 (CFP1) binds to unmethylated CpG dinucleotides and is required for embryogenesis. CFP1 is also a component of the Setd1A and Setd1B histone H3K4 methyltransferase complexes. Murine embryonic stem (ES) cells lacking CFP1 fail to differentiate, and exhibit a 70% reduction in global genomic cytosine methylation and a 50% reduction in DNA methyltransferase (DNMT1) protein and activity. This study investigated the underlying mechanism for reduced DNMT1 expression in CFP1-deficient ES cells. DNMT1 transcript levels were significantly elevated in ES cells lacking CFP1, despite the observed reduction in DNMT1 protein levels. To address the posttranscriptional mechanisms by which CFP1 regulates DNMT1 protein activity, pulse/chase analyses were carried out, demonstrating a modest reduction in DNMT1 protein half-life in CFP1-deficient ES cells. Additionally, global protein synthesis was decreased in ES cells lacking CFP1, contributing to a reduction in the synthesis of DNMT1 protein. ES cells lacking CFP1 were found to contain elevated levels of phosphorylated eIF2alpha, and an accompanying reduction in translation initiation as revealed by a lower level of polyribosomes. These results reveal a novel role for CFP1 in the regulation of translation initiation, and indicate that loss of CFP1 function leads to decreased DNMT1 protein synthesis and half-life. PMID:19388845

  20. Structure and Mechanism of the Rebeccamycin Sugar 4′-O-Methyltransferase RebM*S⃞

    PubMed Central

    Singh, Shanteri; McCoy, Jason G.; Zhang, Changsheng; Bingman, Craig A.; Phillips, George N.; Thorson, Jon S.

    2008-01-01

    The 2.65-Å crystal structure of the rebeccamycin 4′-O-methyltransferase RebM in complex with S-adenosyl-l-homocysteine revealed RebM to adopt a typical S-adenosylmethionine-binding fold of small molecule O-methyltransferases (O-MTases) and display a weak dimerization domain unique to MTases. Using this structure as a basis, the RebM substrate binding model implicated a predominance of nonspecific hydrophobic interactions consistent with the reported ability of RebM to methylate a wide range of indolocarbazole surrogates. This model also illuminated the three putative RebM catalytic residues (His140/141 and Asp166) subsequently found to be highly conserved among sequence-related natural product O-MTases from GC-rich bacteria. Interrogation of these residues via site-directed mutagenesis in RebM demonstrated His140 and Asp166 to be most important for catalysis. This study reveals RebM to be a member of the general acid/base-dependent O-MTases and, as the first crystal structure for a sugar O-MTase, may also present a template toward the future engineering of natural product MTases for combinatorial applications. PMID:18502766

  1. N-methylation of the amide bond by methyltransferase asm10 in ansamitocin biosynthesis.

    PubMed

    Wu, Yingying; Kang, Qianjin; Shang, Guangdong; Spiteller, Peter; Carroll, Brian; Yu, Tin-Wein; Su, Wenjin; Bai, Linquan; Floss, Heinz G

    2011-07-25

    Ansamitocins are potent antitumor agents produced by Actinosynnema pretiosum. As deduced from their structures, an N-methylation on the amide bond is required among the various modifications. The protein encoded by asm10 belongs to the SAM-dependent methyltransferase family. Through gene inactivation and complementation, asm10 was proved to be responsible for the N-methylation of ansamitocins. Asm10 is a 33.0 kDa monomer, as determined by gel filtration. By using N-desmethyl-ansamitocin P-3 as substrate, the optimal temperature and pH for Asm10 catalysis were determined to be 32 °C and 10.0, respectively. Asm10 also showed broad substrate flexibility toward other N-desmethyl-ansamycins and synthetic indolin-2-ones. Through site-directed mutagenesis, Asp154 and Leu155 of Asm10 were confirmed to be essential for its catalysis, possibly through the binding of SAM. The characterization of this unique N-methyltransferase has enriched the toolbox for engineering N-methylated derivatives from both natural and synthetic compounds; this will allow known potential drugs to be modified.

  2. Arginine methyltransferase PRMT5 is essential for sustaining normal adult hematopoiesis

    PubMed Central

    Liu, Fan; Cheng, Guoyan; Hamard, Pierre-Jacques; Greenblatt, Sarah; Wang, Lan; Man, Na; Perna, Fabiana; Xu, Haiming; Tadi, Madhavi; Luciani, Luisa; Nimer, Stephen D.

    2015-01-01

    Epigenetic regulators play critical roles in normal hematopoiesis, and the activity of these enzymes is frequently altered in hematopoietic cancers. The major type II protein arginine methyltransferase PRMT5 catalyzes the formation of symmetric dimethyl arginine and has been implicated in various cellular processes, including pluripotency and tumorigenesis. Here, we generated Prmt5 conditional KO mice to evaluate the contribution of PRMT5 to adult hematopoiesis. Loss of PRMT5 triggered an initial but transient expansion of hematopoietic stem cells (HSCs); however, Prmt5 deletion resulted in a concurrent loss of hematopoietic progenitor cells (HPCs), leading to fatal BM aplasia. PRMT5-specific effects on hematopoiesis were cell intrinsic and depended on PRMT5 methyltransferase activity. We found that PRMT5-deficient hematopoietic stem and progenitor cells exhibited severely impaired cytokine signaling as well as upregulation of p53 and expression of its downstream targets. Together, our results demonstrate that PRMT5 plays distinct roles in the behavior of HSCs compared with HPCs and is essential for the maintenance of adult hematopoietic cells. PMID:26258414

  3. The Ca2+-induced methyltransferase xPRMT1b controls neural fate in amphibian embryo.

    PubMed

    Batut, Julie; Vandel, Laurence; Leclerc, Catherine; Daguzan, Christiane; Moreau, Marc; Néant, Isabelle

    2005-10-18

    We have previously shown that an increase in intracellular Ca2+ is both necessary and sufficient to commit ectoderm to a neural fate in Xenopus embryos. However, the relationship between this Ca2+ increase and the expression of early neural genes has yet to be defined. Using a subtractive cDNA library between untreated and caffeine-treated animal caps, i.e., control ectoderm and ectoderm induced toward a neural fate by a release of Ca2+, we have isolated the arginine N-methyltransferase, xPRMT1b, a Ca2+-induced target gene, which plays a pivotal role in this process. First, we show in embryo and in animal cap that xPRMT1b expression is Ca2+-regulated. Second, overexpression of xPRMT1b induces the expression of early neural genes such as Zic3. Finally, in the whole embryo, antisense approach with morpholino oligonucleotide against xPRMT1b impairs neural development and in animal caps blocks the expression of neural markers induced by a release of internal Ca2+. Our results implicate an instructive role of an enzyme, an arginine methyltransferase protein, in the embryonic choice of determination between epidermal and neural fate. The results presented provide insights by which a Ca2+ increase induces neural fate.

  4. Human catechol-O-methyltransferase: Cloning and expression of the membrane-associated form

    SciTech Connect

    Bertocci, B.; Miggiano, V.; Da Prada, M.; Dembic, Z.; Lahm, H.W.; Malherbe, P. )

    1991-02-15

    A cDNA clone for human catechol-O-methyltransferase was isolated from a human hepatoma cell line (Hep G2) cDNA library by hybridization screening with a porcine cDNA probe. The cDNA clone was sequenced and found to have an insert of 1226 nucleotides. The deduced primary structure of hCOMT is composed of 271 amino acid residues with the predicted molecular mass of 30 kDa. At its N terminus it has a hydrophobic segment of 21 amino acid residues that may be responsible for insertion of hCOMT into the endoplasmic reticulum membrane. The primary structure of hCOMT exhibits high homology to the porcine partial cDNA sequence (93%). The deduced amino acid sequence contains two tryptic peptide sequences (T-22, T-33) found in porcine liver catechol-O-methyltransferase (CEMT). The coding region of hCOMT cDNA was placed under the control of the cytomegalovirus promoter to transfect human kidney 293 cells. The recombinant hCOMT was shown by immunoblot analysis to be mainly associated with the membrane fraction. RNA blot analysis revealed one COMT mRNA transcript of 1.4 kilobases in Hep G2 poly(A){sup +} RNA.

  5. O-Methyltransferases Involved in the Biosynthesis of Volatile Phenolic Derivatives in Rose Petals1

    PubMed Central

    Lavid, Noa; Wang, Jihong; Shalit, Moshe; Guterman, Inna; Bar, Einat; Beuerle, Till; Menda, Naama; Shafir, Sharoni; Zamir, Dani; Adam, Zach; Vainstein, Alexander; Weiss, David; Pichersky, Eran; Lewinsohn, Efraim

    2002-01-01

    Rose (Rosa hybrida) flowers produce and emit a diverse array of volatiles, characteristic to their unique scent. One of the most prominent compounds in the floral volatiles of many rose varieties is the methoxylated phenolic derivative 3,5-dimethoxytoluene (orcinol dimethyl ether). Cell-free extracts derived from developing rose petals displayed O-methyltransferase (OMT) activities toward several phenolic substrates, including 3,5-dihydroxytoluene (orcinol), 3-methoxy,5-hydroxytoluene (orcinol monomethyl ether), 1-methoxy, 2-hydroxy benezene (guaiacol), and eugenol. The activity was most prominent in rose cv Golden Gate, a variety that produces relatively high levels of orcinol dimethyl ether, as compared with rose cv Fragrant Cloud, an otherwise scented variety but which emits almost no orcinol dimethyl ether. Using a functional genomics approach, we have identified and characterized two closely related cDNAs from a rose petal library that each encode a protein capable of methylating the penultimate and immediate precursors (orcinol and orcinol monomethyl ether, respectively) to give the final orcinol dimethyl ether product. The enzymes, designated orcinol OMTs (OOMT1 and OOMT2), are closely related to other plant methyltransferases whose substrates range from isoflavones to phenylpropenes. The peak in the levels of OOMT1 and OOMT2 transcripts in the flowers coincides with peak OMT activity and with the emission of orcinol dimethyl ether. PMID:12177504

  6. Structural origins for the product specificity of SET domain protein methyltransferases.

    SciTech Connect

    Couture, Jean-Francois; Dirk, Lynnette M.A.; Brunzelle, Joseph S.; Houtz, Robert L.; Trievel, Raymond C.

    2009-02-19

    SET domain protein lysine methyltransferases (PKMTs) regulate transcription and other cellular functions through site-specific methylation of histones and other substrates. PKMTs catalyze the formation of monomethylated, dimethylated, or trimethylated products, establishing an additional hierarchy with respect to methyllysine recognition in signaling. Biochemical studies of PKMTs have identified a conserved position within their active sites, the Phe/Tyr switch, that governs their respective product specificities. To elucidate the mechanism underlying this switch, we have characterized a Phe/Tyr switch mutant of the histone H4 Lys-20 (H4K20) methyltransferase SET8, which alters its specificity from a monomethyltransferase to a dimethyltransferase. The crystal structures of the SET8 Y334F mutant bound to histone H4 peptides bearing unmodified, monomethyl, and dimethyl Lys-20 reveal that the phenylalanine substitution attenuates hydrogen bonding to a structurally conserved water molecule adjacent to the Phe/Tyr switch, facilitating its dissociation. The additional space generated by the solvent's dissociation enables the monomethyllysyl side chain to adopt a conformation that is catalytically competent for dimethylation and furnishes sufficient volume to accommodate the dimethyl {epsilon}-ammonium product. Collectively, these results indicate that the Phe/Tyr switch regulates product specificity through altering the affinity of an active-site water molecule whose dissociation is required for lysine multiple methylation.

  7. Partial purification of a 6-methyladenine mRNA methyltransferase which modifies internal adenine residues.

    PubMed Central

    Tuck, M T

    1992-01-01

    Two forms of a 6-methyladenine mRNA methyltransferase have been partially purified using a T7 transcript coding for mouse dihydrofolate reductase as an RNA substrate. Both enzyme forms modify internal adenine residues within the RNA substrate. The enzymes were purified 357- and 37-fold respectively from nuclear salt extracts prepared from HeLa cells using DEAE-cellulose and phosphocellulose chromatography. The activity of the first form of the enzyme eluted from DEAE-cellulose (major form) was at least 3-fold greater than that of the second (minor form). H.p.l.c. analysis of the hydrolysed, methylated mRNA substrates demonstrated that both forms of the enzyme produced only 6-methyladenine. The two forms of the enzyme differed in their RNA substrate specificity as well as in the dependence for a 5' cap structure. The 6-methyladenine mRNA methyltransferase activity was found to be elevated in HeLa nuclei as compared with nuclear extracts from rat kidney and brain. Enzymic activity could not be detected in nuclei from either normal rat liver or regenerating rat liver. In the case of the HeLa cell, activity could only be detected in nuclear extracts, with a small amount in the ribosomal fraction. Other HeLa subcellular fractions were void of activity. PMID:1445268

  8. Molecular characterization of O-methyltransferases involved in isoquinoline alkaloid biosynthesis in Coptis japonica

    PubMed Central

    MORISHIGE, Takashi; TAMAKOSHI, Masanori; TAKEMURA, Tomoya; SATO, Fumihiko

    2010-01-01

    O-Methyltransferases, which catalyze the production of small molecules in plants, play a crucial role in determining biosynthetic pathways in secondary metabolism because of their strict substrate specificity. Using three O-methyltransferase (OMT) cDNAs that are involved in berberine biosynthesis, we investigated the structure that was essential for this substrate specificity and the possibility of creating a chimeric enzyme with novel substrate specificity. Since each OMT has a relatively well-conserved C-terminal putative S-adenosyl-L-methionine-binding domain, we first exchanged the N-terminal halves of different OMTs. Among the 6 combinations that we tested for creating chimeric OMTs, 5 constructs produced detectable amounts of recombinant proteins, and only one of these with an N-terminal half of 6-OMT and a C-terminal half of 4′-OMT (64′-OMT) showed methylation activity with isoquinoline alkaloids as a substrate. Further enzymological analysis of 64′-OMT reaction product indicated that 64′-OMT retained the regio-specificity of 6-OMT. Further examination of the N-terminal region of 64′-OMT showed that about 90 amino acid residues in the N-terminal half were critical for reaction specificity. The creation of OMTs with novel reactivity is discussed. PMID:20689233

  9. Physcomitrella patens DNA methyltransferase 2 is required for recovery from salt and osmotic stress.

    PubMed

    Arya, Deepshikha; Kapoor, Sanjay; Kapoor, Meenu

    2016-02-01

    DNA methyltransferase 2 (DNMT2) unlike other members of the cytosine DNA methyltransferase gene family has dual substrate specificity and it methylates cytosines in both the DNA and transfer RNA (tRNA). Its role in plants, however, has remained obscure to date. In this study, we demonstrate that DNMT2 from Physcomitrella patens accumulates in a temporal manner under salt and osmotic stress showing maximum accumulation during recovery, i.e. 24 h after plants are transferred to normal growth medium. Therefore, to study its role in stress tolerance, we generated PpDNMT2 targeted knockout plants (ppdnmt2ko). Mutant plants show increased sensitivity to salt and osmotic stress and are unable to recover even after 21 days of growth on optimal growth media. ppdnmt2ko, however, accumulate normal levels of dehydrin-like and small heat shock protein encoding transcripts under stress but show dramatic reduction in levels of tRNA(A) (sp-) (GUC) . The levels of tRNA(A) (sp-) (GUC) , in contrast, increase ~ 25-30-fold in ppdnmt2ko under non-stress conditions and > 1200-fold in wild-type plants under stress. The role of PpDNMT2 in modulating biogenesis/stability of tRNA(A) (sp-) (GUC) under salt and osmotic stress is discussed in the light of these observations.

  10. The putative protein methyltransferase LAE1 controls cellulase gene expression in Trichoderma reesei.

    PubMed

    Seiboth, Bernhard; Karimi, Razieh Aghcheh; Phatale, Pallavi A; Linke, Rita; Hartl, Lukas; Sauer, Dominik G; Smith, Kristina M; Baker, Scott E; Freitag, Michael; Kubicek, Christian P

    2012-06-01

    Trichoderma reesei is an industrial producer of enzymes that degrade lignocellulosic polysaccharides to soluble monomers, which can be fermented to biofuels. Here we show that the expression of genes for lignocellulose degradation are controlled by the orthologous T. reesei protein methyltransferase LAE1. In a lae1 deletion mutant we observed a complete loss of expression of all seven cellulases, auxiliary factors for cellulose degradation, β-glucosidases and xylanases were no longer expressed. Conversely, enhanced expression of lae1 resulted in significantly increased cellulase gene transcription. Lae1-modulated cellulase gene expression was dependent on the function of the general cellulase regulator XYR1, but also xyr1 expression was LAE1-dependent. LAE1 was also essential for conidiation of T. reesei. Chromatin immunoprecipitation followed by high-throughput sequencing ('ChIP-seq') showed that lae1 expression was not obviously correlated with H3K4 di- or trimethylation (indicative of active transcription) or H3K9 trimethylation (typical for heterochromatin regions) in CAZyme coding regions, suggesting that LAE1 does not affect CAZyme gene expression by directly modulating H3K4 or H3K9 methylation. Our data demonstrate that the putative protein methyltransferase LAE1 is essential for cellulase gene expression in T. reesei through mechanisms that remain to be identified.

  11. Regulation of DNA replication and chromosomal polyploidy by the MLL-WDR5-RBBP5 methyltransferases

    PubMed Central

    Lu, Fei; Wu, Xiaojun; Yin, Feng; Chia-Fang Lee, Christina; Yu, Min; Mihaylov, Ivailo S.; Yu, Jiekai; Sun, Hong

    2016-01-01

    ABSTRACT DNA replication licensing occurs on chromatin, but how the chromatin template is regulated for replication remains mostly unclear. Here, we have analyzed the requirement of histone methyltransferases for a specific type of replication: the DNA re-replication induced by the downregulation of either Geminin, an inhibitor of replication licensing protein CDT1, or the CRL4CDT2 ubiquitin E3 ligase. We found that siRNA-mediated reduction of essential components of the MLL-WDR5-RBBP5 methyltransferase complexes including WDR5 or RBBP5, which transfer methyl groups to histone H3 at K4 (H3K4), suppressed DNA re-replication and chromosomal polyploidy. Reduction of WDR5/RBBP5 also prevented the activation of H2AX checkpoint caused by re-replication, but not by ultraviolet or X-ray irradiation; and the components of MLL complexes co-localized with the origin recognition complex (ORC) and MCM2-7 replicative helicase complexes at replication origins to control the levels of methylated H3K4. Downregulation of WDR5 or RBBP5 reduced the methylated H3K4 and suppressed the recruitment of MCM2-7 complexes onto replication origins. Our studies indicate that the MLL complexes and H3K4 methylation are required for DNA replication but not for DNA damage repair. PMID:27744293

  12. Improved radioenzymatic assay for plasma norepinephrine using purified phenylethanolamine n-methyltransferase

    SciTech Connect

    Bowsher, R.R.; Henry, D.P.

    1986-03-01

    Radioenzymatic assays have been developed for catecholamines using either catechol O-methyltransferase (COMT) or phenylethanolamine N-methyltransferase (PNMT). Assays using PNMT are specific for norepinephrine (NE) and require minimal manipulative effort but until now have been less sensitive than the more complex procedures using COMT. The authors report an improved purification scheme for bovine PNMT which has permitted development of an NE assay with dramatically improved sensitivity (0.5 pg), specificity and reproducibility (C.V. < 5%). PNMT was purified by sequential pH 5.0 treatment and dialysis and by column chromatographic procedures using DEAE-Sephacel, Sepharcryl S-200 and Phenyl-Boronate Agarose. Recovery of PNMT through the purification scheme was 50%, while blank recovery was <.001%. NE can be directly quantified in 25 ul of human plasma and an 80 tube assay can be completed within 4 h. The capillary to venous plasma NE gradient was examined in 8 normotensive male subjects. Capillary plasma (NE (211.2 +/- 61.3 pg/ml)) was lower than venous plasma NE (366.6 +/- 92.5 pg/ml) in all subjects (p < 0.005). This difference suggests that capillary (NE) may be a unique indicator of sympathetic nervous system activity in vivo. In conclusion, purification of PNMT has facilitated development of an improved radioenzymatic for NE with significantly improved sensitivity.

  13. Regulatory T Cell DNA Methyltransferase Inhibition Accelerates Resolution of Lung Inflammation

    PubMed Central

    Singer, Benjamin D.; Mock, Jason R.; Aggarwal, Neil R.; Garibaldi, Brian T.; Sidhaye, Venkataramana K.; Florez, Marcus A.; Chau, Eric; Gibbs, Kevin W.; Mandke, Pooja; Tripathi, Ashutosh; Yegnasubramanian, Srinivasan; King, Landon S.

    2015-01-01

    Acute respiratory distress syndrome (ARDS) is a common and often fatal inflammatory lung condition without effective targeted therapies. Regulatory T cells (Tregs) resolve lung inflammation, but mechanisms that enhance Tregs to promote resolution of established damage remain unknown. DNA demethylation at the forkhead box protein 3 (Foxp3) locus and other key Treg loci typify the Treg lineage. To test how dynamic DNA demethylation affects lung injury resolution, we administered the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) to wild-type (WT) mice beginning 24 hours after intratracheal LPS-induced lung injury. Mice that received DAC exhibited accelerated resolution of their injury. Lung CD4+CD25hiFoxp3+ Tregs from DAC-treated WT mice increased in number and displayed enhanced Foxp3 expression, activation state, suppressive phenotype, and proliferative capacity. Lymphocyte-deficient recombinase activating gene-1–null mice and Treg-depleted (diphtheria toxin-treated Foxp3DTR) mice did not resolve their injury in response to DAC. Adoptive transfer of 2 × 105 DAC-treated, but not vehicle-treated, exogenous Tregs rescued Treg-deficient mice from ongoing lung inflammation. In addition, in WT mice with influenza-induced lung inflammation, DAC rescue treatment facilitated recovery of their injury and promoted an increase in lung Treg number. Thus, DNA methyltransferase inhibition, at least in part, augments Treg number and function to accelerate repair of experimental lung injury. Epigenetic pathways represent novel manipulable targets for the treatment of ARDS. PMID:25295995

  14. Identification and Characterization of a Novel Human Methyltransferase Modulating Hsp70 Protein Function through Lysine Methylation*

    PubMed Central

    Jakobsson, Magnus E.; Moen, Anders; Bousset, Luc; Egge-Jacobsen, Wolfgang; Kernstock, Stefan; Melki, Ronald; Falnes, Pål Ø.

    2013-01-01

    Hsp70 proteins constitute an evolutionarily conserved protein family of ATP-dependent molecular chaperones involved in a wide range of biological processes. Mammalian Hsp70 proteins are subject to various post-translational modifications, including methylation, but for most of these, a functional role has not been attributed. In this study, we identified the methyltransferase METTL21A as the enzyme responsible for trimethylation of a conserved lysine residue found in several human Hsp70 (HSPA) proteins. This enzyme, denoted by us as HSPA lysine (K) methyltransferase (HSPA-KMT), was found to catalyze trimethylation of various Hsp70 family members both in vitro and in vivo, and the reaction was stimulated by ATP. Furthermore, we show that HSPA-KMT exclusively methylates 70-kDa proteins in mammalian protein extracts, demonstrating that it is a highly specific enzyme. Finally, we show that trimethylation of HSPA8 (Hsc70) has functional consequences, as it alters the affinity of the chaperone for both the monomeric and fibrillar forms of the Parkinson disease-associated protein α-synuclein. PMID:23921388

  15. Highly sensitive detection of M.SssI DNA methyltransferase activity using a personal glucose meter.

    PubMed

    Deng, Huimin; Peng, Si Ying; Gao, Zhiqiang

    2016-08-01

    A simple method for highly sensitive and selective detection of M.SssI CpG methyltransferase (M.SssI MTase) activity is developed, leveraging on the portability and ease of use of a personal glucose meter (PGM). Briefly, DNA-invertase conjugates are hybridized with their complementary DNA strands pre-immobilized on magnetic beads. The 5'-CCGG-3' sequence present in the DNA duplexes serves as the recognition site for both Hpa II restriction enzyme and M.SssI MTase (5'-CG-3'). Hpa II restriction enzyme specifically cleaves at unmethylated 5'-CCGG-3' sequence, and the invertase that remains on the methylated DNA catalyzes the hydrolysis of sucrose to glucose and fructose. It is found that the amount of glucose is proportional to the M.SssI MTase methylation activity in the range of 0.5 to 80 U/mL with a detection limit of 0.37 U/mL. Due to the specific recognition sequence present in the DNA strands, this method also shows high selectivity for M.SssI MTase. In addition, inhibition studies with 5'-azacytidine demonstrate the capability of inhibition screening using this method. Graphical abstract Deteciton of M.SssI DNA methyltransferase activity by a personal glucose meter. PMID:27311957

  16. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    SciTech Connect

    Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako

    2014-10-03

    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or

  17. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  18. A Picrinine N-Methyltransferase Belongs to a New Family of γ-Tocopherol-Like Methyltransferases Found in Medicinal Plants That Make Biologically Active Monoterpenoid Indole Alkaloids1[OPEN

    PubMed Central

    Levac, Dylan; Cázares, Paulo; Yu, Fang

    2016-01-01

    Members of the Apocynaceae plant family produce a large number of monoterpenoid indole alkaloids (MIAs) with different substitution patterns that are responsible for their various biological activities. A novel N-methyltransferase involved in the vindoline pathway in Catharanthus roseus showing distinct similarity to γ-tocopherol C-methyltransferases was used in a bioinformatic screen of transcriptomes from Vinca minor, Rauvolfia serpentina, and C. roseus to identify 10 γ-tocopherol-like N-methyltransferases from a large annotated transcriptome database of different MIA-producing plant species (www.phytometasyn.ca). The biochemical function of two members of this group cloned from V. minor (VmPiNMT) and R. serpentina (RsPiNMT) have been characterized by screening their biochemical activities against potential MIA substrates harvested from the leaf surfaces of MIA-accumulating plants. The approach was validated by identifying the MIA picrinine from leaf surfaces of Amsonia hubrichtii as a substrate of VmPiNMT and RsPiNMT. Recombinant proteins were shown to have high substrate specificity and affinity for picrinine, converting it to N-methylpicrinine (ervincine). Developmental studies with V. minor and R. serpentina showed that RsPiNMT and VmPiNMT gene expression and biochemical activities were highest in younger leaf tissues. The assembly of at least 150 known N-methylated MIAs within members of the Apocynaceae family may have occurred as a result of the evolution of the γ-tocopherol-like N-methyltransferase family from γ-tocopherol methyltransferases. PMID:26848097

  19. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  20. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  1. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  2. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  3. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis.

    PubMed

    Fenwick, Michael K; Philmus, Benjamin; Begley, Tadhg P; Ealick, Steven E

    2016-05-17

    Toxoflavin is a major virulence factor of the rice pathogen Burkholderia glumae. The tox operon of B. glumae contains five putative toxoflavin biosynthetic genes toxABCDE. ToxA is a predicted S-adenosylmethionine-dependent methyltransferase, and toxA knockouts of B. glumae are less virulent in plant infection models. In this study, we show that ToxA performs two consecutive methylations to convert the putative azapteridine intermediate, 1,6-didemethyltoxoflavin, to toxoflavin. In addition, we report a series of crystal structures of ToxA complexes that reveals the molecular basis of the dual methyltransferase activity. The results suggest sequential methylations with initial methylation at N6 of 1,6-didemethyltoxoflavin followed by methylation at N1. The two azapteridine orientations that position N6 or N1 for methylation are coplanar with a 140° rotation between them. The structure of ToxA contains a class I methyltransferase fold having an N-terminal extension that either closes over the active site or is largely disordered. The ordered conformation places Tyr7 at a position of a structurally conserved tyrosine site of unknown function in various methyltransferases. Crystal structures of ToxA-Y7F consistently show a closed active site, whereas structures of ToxA-Y7A consistently show an open active site, suggesting that the hydroxyl group of Tyr7 plays a role in opening and closing the active site during the multistep reaction. PMID:27070241

  4. Characterization of cytosine methylated regions and 5-cytosine DNA methyltransferase (Ehmeth) in the protozoan parasite Entamoeba histolytica.

    PubMed

    Fisher, Ohad; Siman-Tov, Rama; Ankri, Serge

    2004-01-01

    The DNA methylation status of the protozoan parasite Entamoeba histolytica was heretofore unknown. In the present study, we developed a new technique, based on the affinity of methylated DNA to 5-methylcytosine antibodies, to identify methylated DNA in this parasite. Ribosomal DNA and ribosomal DNA circles were isolated by this method and we confirmed the validity of our approach by sodium bisulfite sequencing. We also report the identification and the characterization of a gene, Ehmeth, encoding a DNA methyltransferase strongly homologous to the human DNA methyltransferase 2 (Dnmt2). Immunofluorescence microscopy using an antibody raised against a recombinant Ehmeth showed that Ehmeth is concentrated in the nuclei of trophozoites. The recombinant Ehmeth has a weak but significant methyltransferase activity when E.histolytica genomic DNA is used as substrate. 5-Azacytidine (5-AzaC), an inhibitor of DNA methyltransferase, was used to study in vivo the role of DNA methylation in E.histolytica. Genomic DNA of trophozoites grown with 5-AzaC (23 microM) was undermethylated and the ability of 5-AzaC-treated trophozoites to kill mammalian cells or to cause liver abscess in hamsters was strongly impaired.

  5. Screening of commercial cyclic peptide as inhibitor NS5 methyltransferase of Dengue virus through Molecular Docking and Molecular Dynamics Simulation

    PubMed Central

    Tambunan, Usman Sumo Friend; Zahroh, Hilyatuz; Utomo, Bimo Budi; Parikesit, Arli Aditya

    2014-01-01

    Dengue has become a major global health threat, especially in tropical and subtropical regions. The development of antiviral agent targeting viral replication is really needed at this time. NS5 methyltransferase presents as a novel antiviral target. This enzyme plays an important role in the methylation of 5'-cap mRNA. Inhibition of the NS5 methyltransferase could inhibit dengue virus replication. In this research, two sites of NS5 methyltransferase (S-Adenosyl methionine/SAM binding site and RNA-cap site) were used as targets for inhibition. As much as 300 commercial cyclic peptides were screened to these target sites by means of molecular docking. Analysis of ligand-enzyme binding free energy and pharmacological prediction revealed two best ligands, namely [Tyr123] Prepro Endothelin (110-130), amide, human and Urotensin II, human. According to molecular dynamic simulation, both ligands maintain a stable complex conformation between enzyme and ligand at temperature 310 K and 312 K. Hence, Urotensin II, human is more reactive at 312 K than at 310 K. However, both ligands can be used as potential inhibitor candidates against NS5 methyltransferase of dengue virus with Urotensin II, human exposes more promising activity at 312 K. PMID:24516322

  6. Impaired Homocysteine Transmethylation and Protein-Methyltransferase Activity Reduce Expression of Selenoprotein P: Implications for Obesity and Metabolic Syndrome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity causes Metabolic Syndrome and Type-II Diabetes, disrupting hepatic function, methionine (Met)/homocysteine (Hcy) transmethylation and methyltransferase (PRMT) activities. Selenoprotein P (SEPP1), exported from the liver, is the predominate form of plasma selenium (Se) and the physiological S...

  7. Molecular analysis of the dmpM gene encoding an O-demethyl puromycin O-methyltransferase from Streptomyces alboniger.

    PubMed

    Lacalle, R A; Ruiz, D; Jiménez, A

    1991-12-20

    The nucleotide (nt) sequence of a 1332-bp fragment of Streptomyces alboniger DNA containing the gene (dmpM), which encodes an O-demethyl puromycin O-methyltransferase (DMPM), has been determined. The dmpM gene contains a 1131-nt open reading frame which encodes a polypeptide of Mr 40,303; this is consistent with the 44 +/- 2.5- and 160-kDa sizes of the DMPM monomer and its native form, respectively. The ATG start codon of dmpM is 50 bp downstream from the coding sequence of the gene (pac), which determines a puromycin N-acetyltransferase. S1 mapping experiments indicate that pac and dmpM are transcribed on a single transcript, which ends at least 500 nt downstream from the dmpM stop codon. The deduced amino acid sequence of DMPM shows significant similarities to those of a hydroxyindole O-methyltransferase, which is involved in the biosynthesis of melatonin by bovine pineal glands [Ishida et al., J. Biol. Chem. 262 (1987) 2895-2899], a hydroxyneurosporene methyltransferase, which is involved in carotenoid biosynthesis in the purple nonsulfur bacterium, Rhodobacter capsulatus [Armstrong et al., Mol. Gen. Genet. 216 (1989) 254-268] and two O-methyltransferases of the tetracenomycin biosynthesis pathway from Streptomyces glaucescens.

  8. Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

  9. Comparative Distribution and Retention of Arsenic in Arsenic (+3 Oxidation State) Methyltransferase Knockout and Wild Type Mice

    EPA Science Inventory

    The mouse arsenic (+3 oxidation state) methyltransferase (As3mt) gene encodes a ~ 43 kDa protein that catalyzes conversion of inorganic arsenic into methylated products. Heterologous expression of AS3MT or its silencing by RNA interference controls arsenic methylation phenotypes...

  10. Arsenic (+3 oxidation state) methyltransferase genotype affects steady-state distribution and clearance of arsenic in arsenate-treated mice

    EPA Science Inventory

    Arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes formation of mono-, di-, and tri-methylated metabolites of inorganic arsenic. Distribution and retention of arsenic were compared in adult female As3mt knockout mice and wild-type C57BL/6 mice using a regimen in whi...

  11. METABOLISM AND TOXICITY OF AS IN HUMAN UROTHELIAL CELLS EXPRESSING RAT ARSENIC (+3 OXIDATION STATE)-METHYLTRANSFERASE

    EPA Science Inventory

    The enzymatic methylation of inorganic As (iAs) is catalyzed by As(+3 oxidation state)-methyltransferase (AS3MT). AS3MT is expressed in rat liver and in human hepatocytes However, AS3MT is not expressed in UROtsa, human urothelial cells that do not methylate iAs. Thus, UROtsa ce...

  12. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.

    PubMed Central

    Battles, J K; Williamson, J C; Pike, K M; Gorelick, P L; Ward, J M; Gonda, M A

    1995-01-01

    Conserved primers were used to PCR amplify 95% of the Helicobacter hepaticus 16S rRNA gene. Its sequence was determined and aligned to those of related bacteria, enabling the selection of primers to highly diverged regions of the 16S rRNA gene and an oligonucleotide probe for the development of a PCR-liquid hybridization assay. This assay was shown to be both sensitive and specific for H. hepaticus 16S rRNA gene sequences. PMID:7542270

  13. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  14. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    PubMed

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  15. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    PubMed Central

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  16. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  17. Novel N-terminal and Lysine Methyltransferases That Target Translation Elongation Factor 1A in Yeast and Human.

    PubMed

    Hamey, Joshua J; Winter, Daniel L; Yagoub, Daniel; Overall, Christopher M; Hart-Smith, Gene; Wilkins, Marc R

    2016-01-01

    Eukaryotic elongation factor 1A (eEF1A) is an essential, highly methylated protein that facilitates translational elongation by delivering aminoacyl-tRNAs to ribosomes. Here, we report a new eukaryotic protein N-terminal methyltransferase, Saccharomyces cerevisiae YLR285W, which methylates eEF1A at a previously undescribed high-stoichiometry N-terminal site and the adjacent lysine. Deletion of YLR285W resulted in the loss of N-terminal and lysine methylation in vivo, whereas overexpression of YLR285W resulted in an increase of methylation at these sites. This was confirmed by in vitro methylation of eEF1A by recombinant YLR285W. Accordingly, we name YLR285W as elongation factor methyltransferase 7 (Efm7). This enzyme is a new type of eukaryotic N-terminal methyltransferase as, unlike the three other known eukaryotic N-terminal methyltransferases, its substrate does not have an N-terminal [A/P/S]-P-K motif. We show that the N-terminal methylation of eEF1A is also present in human; this conservation over a large evolutionary distance suggests it to be of functional importance. This study also reports that the trimethylation of Lys(79) in eEF1A is conserved from yeast to human. The methyltransferase responsible for Lys(79) methylation of human eEF1A is shown to be N6AMT2, previously documented as a putative N(6)-adenine-specific DNA methyltransferase. It is the direct ortholog of the recently described yeast Efm5, and we show that Efm5 and N6AMT2 can methylate eEF1A from either species in vitro. We therefore rename N6AMT2 as eEF1A-KMT1. Including the present work, yeast eEF1A is now documented to be methylated by five different methyltransferases, making it one of the few eukaryotic proteins to be extensively methylated by independent enzymes. This implies more extensive regulation of eEF1A by this posttranslational modification than previously appreciated.

  18. Refolding of a fully functional flavivirus methyltransferase revealed that S-adenosyl methionine but not S-adenosyl homocysteine is copurified with flavivirus methyltransferase.

    PubMed

    Brecher, Matthew B; Li, Zhong; Zhang, Jing; Chen, Hui; Lin, Qishan; Liu, Binbin; Li, Hongmin

    2015-01-01

    Methylation of flavivirus RNA is vital for its stability and translation in the infected host cell. This methylation is mediated by the flavivirus methyltransferase (MTase), which methylates the N7 and 2'-O positions of the viral RNA cap by using S-adenosyl-l-methionine (SAM) as a methyl donor. In this report, we demonstrate that SAM, in contrast to the reaction by-product S-adenosyl-l-homocysteine, which was assumed previously, is copurified with the Dengue (DNV) and West Nile virus MTases produced in Escherichia coli (E. coli). This endogenous SAM can be removed by denaturation and refolding of the MTase protein. The refolded MTase of DNV serotype 3 (DNV3) displays methylation activity comparable to native enzyme, and its crystal structure at 2.1 Å is almost identical to that of native MTase. We characterized the binding of Sinefungin (SIN), a previously described SAM-analog inhibitor of MTase function, to the native and refolded DNV3 MTase by isothermal titration calorimetry, and found that SIN binds to refolded MTase with more than 16 times the affinity of SIN binding to the MTase purified natively. Moreover, we show that SAM is also copurified with other flavivirus MTases, indicating that purification by refolding may be a generally applicable tool for studying flavivirus MTase inhibition.

  19. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  20. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  1. The Ether-Cleaving Methyltransferase System of the Strict Anaerobe Acetobacterium dehalogenans: Analysis and Expression of the Encoding Genes▿

    PubMed Central

    Schilhabel, Anke; Studenik, Sandra; Vödisch, Martin; Kreher, Sandra; Schlott, Bernhard; Pierik, Antonio Y.; Diekert, Gabriele

    2009-01-01

    Anaerobic O-demethylases are inducible multicomponent enzymes which mediate the cleavage of the ether bond of phenyl methyl ethers and the transfer of the methyl group to tetrahydrofolate. The genes of all components (methyltransferases I and II, CP, and activating enzyme [AE]) of the vanillate- and veratrol-O-demethylases of Acetobacterium dehalogenans were sequenced and analyzed. In A. dehalogenans, the genes for methyltransferase I, CP, and methyltransferase II of both O-demethylases are clustered. The single-copy gene for AE is not included in the O-demethylase gene clusters. It was found that AE grouped with COG3894 proteins, the function of which was unknown so far. Genes encoding COG3894 proteins with 20 to 41% amino acid sequence identity with AE are present in numerous genomes of anaerobic microorganisms. Inspection of the domain structure and genetic context of these orthologs predicts that these are also reductive activases for corrinoid enzymes (RACEs), such as carbon monoxide dehydrogenase/acetyl coenzyme A synthases or anaerobic methyltransferases. The genes encoding the O-demethylase components were heterologously expressed with a C-terminal Strep-tag in Escherichia coli, and the recombinant proteins methyltransferase I, CP, and AE were characterized. Gel shift experiments showed that the AE comigrated with the CP. The formation of other protein complexes with the O-demethylase components was not observed under the conditions used. The results point to a strong interaction of the AE with the CP. This is the first report on the functional heterologous expression of acetogenic phenyl methyl ether-cleaving O-demethylases. PMID:19011025

  2. Arsenic Methyltransferase

    EPA Science Inventory

    The metalloid arsenic enters the environment by natural processes (volcanic activity, weathering of rocks) and by human activity (mining, smelting, herbicides and pesticides). Although arsenic has been exploited for homicidal and suicidal purposes since antiquity, its significan...

  3. Sequence-specific labeling of nucleic acids and proteins with methyltransferases and cofactor analogues.

    PubMed

    Hanz, Gisela Maria; Jung, Britta; Giesbertz, Anna; Juhasz, Matyas; Weinhold, Elmar

    2014-11-22

    S-Adenosyl-l-methionine (AdoMet or SAM)-dependent methyltransferases (MTase) catalyze the transfer of the activated methyl group from AdoMet to specific positions in DNA, RNA, proteins and small biomolecules. This natural methylation reaction can be expanded to a wide variety of alkylation reactions using synthetic cofactor analogues. Replacement of the reactive sulfonium center of AdoMet with an aziridine ring leads to cofactors which can be coupled with DNA by various DNA MTases. These aziridine cofactors can be equipped with reporter groups at different positions of the adenine moiety and used for Sequence-specific Methyltransferase-Induced Labeling of DNA (SMILing DNA). As a typical example we give a protocol for biotinylation of pBR322 plasmid DNA at the 5'-ATCGAT-3' sequence with the DNA MTase M.BseCI and the aziridine cofactor 6BAz in one step. Extension of the activated methyl group with unsaturated alkyl groups results in another class of AdoMet analogues which are used for methyltransferase-directed Transfer of Activated Groups (mTAG). Since the extended side chains are activated by the sulfonium center and the unsaturated bond, these cofactors are called double-activated AdoMet analogues. These analogues not only function as cofactors for DNA MTases, like the aziridine cofactors, but also for RNA, protein and small molecule MTases. They are typically used for enzymatic modification of MTase substrates with unique functional groups which are labeled with reporter groups in a second chemical step. This is exemplified in a protocol for fluorescence labeling of histone H3 protein. A small propargyl group is transferred from the cofactor analogue SeAdoYn to the protein by the histone H3 lysine 4 (H3K4) MTase Set7/9 followed by click labeling of the alkynylated histone H3 with TAMRA azide. MTase-mediated labeling with cofactor analogues is an enabling technology for many exciting applications including identification and functional study of MTase substrates as

  4. Identification of an S-adenosylmethionine (SAM) dependent arsenic methyltransferase in Danio rerio

    SciTech Connect

    Hamdi, Mohamad; Yoshinaga, Masafumi; Packianathan, Charles; Qin, Jie; Hallauer, Janell; McDermott, Joseph R.; Yang, Hung-Chi; Tsai, Kan-Jen; Liu, Zijuan

    2012-07-15

    Arsenic methylation is an important cellular metabolic process that modulates arsenic toxicity and carcinogenicity. Biomethylation of arsenic produces a series of mono-, di- and tri-methylated arsenic metabolites that can be detected in tissues and excretions. Here we report that zebrafish exposed to arsenite (As{sup III}) produces organic arsenicals, including MMA{sup III}, MMA{sup V} and DMA{sup V} with characteristic tissue ratios, demonstrating that an arsenic methylation pathway exists in zebrafish. In mammals, cellular inorganic arsenic is methylated by a SAM-dependent arsenic methyltransferase, AS3MT. A zebrafish arsenic methyltransferase homolog, As3mt, was identified by sequence alignment. Western blotting analysis showed that As3mt was universally expressed in zebrafish tissues. Prominent expression in liver and intestine correlated with methylated arsenic metabolites detected in those tissues. As3mt was expressed in and purified from Escherichia coli for in vitro functional studies. Our results demonstrated that As3mt methylated As{sup III} to DMA{sup V} as an end product and produced MMA{sup III} and MMA{sup V} as intermediates. The activity of As3mt was inhibited by elevated concentrations of the substrate As{sup III} as well as the metalloid selenite, which is a well-known antagonistic micronutrient of arsenic toxicity. The activity As3mt was abolished by substitution of either Cys160 or Cys210, which corresponds to conserved cysteine residues in AS3MT homologs, suggesting that they are involved in catalysis. Expression in zebrafish of an enzyme that has a similar function to human and rodent orthologs in catalyzing intracellular arsenic biomethylation validates the applicability of zebrafish as a valuable vertebrate model for understanding arsenic-associated diseases in humans. -- Highlights: ► Zebrafish methylated As{sup III} to MMA{sup III}, MMA{sup V} and DMA{sup V}. ► A zebrafish arsenic methyltransferase (As3mt) was purified in E. coli.

  5. Atypical processing in domain III of 23S rRNA of Rhizobium leguminosarum ATCC 10004(T) at a position homologous to an rRNA fragmentation site in protozoa.

    PubMed

    Klein, Franziska; Samorski, Regina; Klug, Gabriele; Evguenieva-Hackenberg, Elena

    2002-06-01

    For still unknown reasons, the 23S rRNA of many alpha-Proteobacteria shows a unique fragmentation pattern compared to other bacteria. The 23S rRNA processing involves RNase III and additional, yet unidentified enzymes. The alpha-proteobacterium Rhizobium leguminosarum ATCC 10004(T) possesses two fragmentation sites in its 23S rRNA. The first one harbors an intervening sequence in helix 9 which is cleaved by RNase III. We demonstrate that the mature 5' end of the resulting 2.6-kb rRNA fragment is generated by additional removal of helix 10. A fraction of the 2.6-kb rRNA is further processed in domain III, giving rise to two 1.3-kb rRNA fragments. We mapped the domain III fragmentation site and found it to be at a position which has only been reported for trypanosomatid protozoa. This fragmentation site is also unique in that it lacks an intervening sequence. We found that the simultaneous occurrence of 2.6-kb and 1.3-kb rRNA fragments is not due to interoperonal sequence differences but rather reflects slow processing. The different characteristics of the two fragmentation sites in the 23S rRNA suggest that they are processed by different mechanisms. Interestingly, the amount of 2.6-kb rRNA varies during culture growth. We observed a transient increase in the relative amount of 2.6-kb rRNA fragments during the first hours after inoculation, which points to changes in the ratio of rRNA synthesis rate to domain III processing rate during the growth of a culture.

  6. Molecular Diagnosis of Actinomadura madurae Infection by 16S rRNA Deep Sequencing

    PubMed Central

    SenGupta, Dhruba J.; Hoogestraat, Daniel R.; Cummings, Lisa A.; Bryant, Bronwyn H.; Natividad, Catherine; Thielges, Stephanie; Monsaas, Peter W.; Chau, Mimosa; Barbee, Lindley A.; Rosenthal, Christopher; Cookson, Brad T.; Hoffman, Noah G.

    2013-01-01

    Next-generation DNA sequencing can be used to catalog individual organisms within complex, polymicrobial specimens. Here, we utilized deep sequencing of 16S rRNA to implicate Actinomadura madurae as the cause of mycetoma in a diabetic patient when culture and conventional molecular methods were overwhelmed by overgrowth of other organisms. PMID:24108607

  7. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples. PMID:25343859

  8. Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.

    PubMed

    Yi, Hana; Cho, Yong-Joon; Won, Sungho; Lee, Jong-Eun; Jin Yu, Hyung; Kim, Sujin; Schroth, Gary P; Luo, Shujun; Chun, Jongsik

    2011-11-01

    Next-generation sequencing has great potential for application in bacterial transcriptomics. However, unlike eukaryotes, bacteria have no clear mechanism to select mRNAs over rRNAs; therefore, rRNA removal is a critical step in sequencing-based transcriptomics. Duplex-specific nuclease (DSN) is an enzyme that, at high temperatures, degrades duplex DNA in preference to single-stranded DNA. DSN treatment has been successfully used to normalize the relative transcript abundance in mRNA-enriched cDNA libraries from eukaryotic organisms. In this study, we demonstrate the utility of this method to remove rRNA from prokaryotic total RNA. We evaluated the efficacy of DSN to remove rRNA by comparing it with the conventional subtractive hybridization (Hyb) method. Illumina deep sequencing was performed to obtain transcriptomes from Escherichia coli grown under four growth conditions. The results clearly showed that our DSN treatment was more efficient at removing rRNA than the Hyb method was, while preserving the original relative abundance of mRNA species in bacterial cells. Therefore, we propose that, for bacterial mRNA-seq experiments, DSN treatment should be preferred to Hyb-based methods.

  9. Occurrence of fragmented 16S rRNA in an obligate bacterial endosymbiont of Paramecium caudatum.

    PubMed Central

    Springer, N; Ludwig, W; Amann, R; Schmidt, H J; Görtz, H D; Schleifer, K H

    1993-01-01

    The phylogenetic position of Caedibacter caryophila, a so far noncultured killer symbiont of Paramecium caudatum, was elucidated by comparative sequence analysis of in vitro amplified 16S rRNA genes (rDNA). C. caryophila is a member of the alpha subclass of the Proteobacteria phylum. Within this subclass C. caryophila is moderately related to Holospora obtusa, which is another obligate endosymbiont of Paramecium caudatum, and to Rickettsia. A 16S rRNA targeted specific hybridization probe was designed and used for in situ detection of C. caryophila within its host cell. Comparison of the 16S rDNA primary structure of C. caryophila with homologous sequences from other bacteria revealed an unusual insertion of 194 base pairs within the 5'-terminal part of the corresponding gene. The intervening sequence is not present in mature 16S rRNA of C. caryophila. It was demonstrated that C. caryophila contained fragmented 16S rRNA. Images Fig. 5 Fig. 6 PMID:8234331

  10. Bacterial metabarcoding by 16S rRNA gene ion torrent amplicon sequencing.

    PubMed

    Fantini, Elio; Gianese, Giulio; Giuliano, Giovanni; Fiore, Alessia

    2015-01-01

    Ion Torrent is a next generation sequencing technology based on the detection of hydrogen ions produced during DNA chain elongation; this technology allows analyzing and characterizing genomes, genes, and species. Here, we describe an Ion Torrent procedure applied to the metagenomic analysis of 16S rRNA gene amplicons to study the bacterial diversity in food and environmental samples.

  11. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    PubMed

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  12. Unequal Crossing over at the Rrna Tandon as a Source of Quantitative Genetic Variation in Drosophila

    PubMed Central

    Frankham, R.; Briscoe, D. A.; Nurthen, R. K.

    1980-01-01

    Abdominal bristle selection lines (three high and three low) and controls were founded from a marked homozygous line to measure the contribution of sex-linked "mutations" to selection response. Two of the low lines exhibited a period of rapid response to selection in females, but not in males. There were corresponding changes in female variance, in heritabilities in females, in the sex ratio (a deficiency of females) and in fitness, as well as the appearance of a mutant phenotype in females of one line. All of these changes were due to bb alleles (partial deficiencies for the rRNA tandon) in the X chromosomes of these lines, while the Y chromosomes remained wild-type bb+. We argue that the bb alleles arose by unequal crossing over in the rRNA tandon.—A prediction of this hypothesis is that further changes can occur in the rRNA tandon as selection is continued. This has now been shown to occur.—Our minimum estimate of the rate of occurrence of changes at the rRNA tandon is 3 x 10-4. As this is substantially higher than conventional mutation rates, the questions of the mechanisms and rates of origin of new quantitative genetic variation require careful re-examination. PMID:7439683

  13. Quantitative Analysis of rRNA Modifications Using Stable Isotope Labeling and Mass Spectrometry

    PubMed Central

    2015-01-01

    Post-transcriptional RNA modifications that are introduced during the multistep ribosome biogenesis process are essential for protein synthesis. The current lack of a comprehensive method for a fast quantitative analysis of rRNA modifications significantly limits our understanding of how individual modification steps are coordinated during biogenesis inside the cell. Here, an LC-MS approach has been developed and successfully applied for quantitative monitoring of 29 out of 36 modified residues in the 16S and 23S rRNA from Escherichia coli. An isotope labeling strategy is described for efficient identification of ribose and base methylations, and a novel metabolic labeling approach is presented to allow identification of MS-silent pseudouridine modifications. The method was used to measure relative abundances of modified residues in incomplete ribosomal subunits compared to a mature 15N-labeled rRNA standard, and a number of modifications in both 16S and 23S rRNA were present in substoichiometric amounts in the preribosomal particles. The RNA modification levels correlate well with previously obtained profiles for the ribosomal proteins, suggesting that RNA is modified in a schedule comparable to the association of the ribosomal proteins. Importantly, this study establishes an efficient workflow for a global monitoring of ribosomal modifications that will contribute to a better understanding of mechanisms of RNA modifications and their impact on intracellular processes in the future. PMID:24422502

  14. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    PubMed

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  15. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  16. Distribution of rRNA introns in the three-dimensional structure of the ribosome.

    PubMed

    Jackson, Scott; Cannone, Jamie; Lee, Jung; Gutell, Robin; Woodson, Sarah

    2002-10-11

    More than 1200 introns have been documented at over 150 unique sites in the small and large subunit ribosomal RNA genes (as of February 2002). Nearly all of these introns are assigned to one of four main types: group I, group II, archaeal and spliceosomal. This sequence information has been organized into a relational database that is accessible through the Comparative RNA Web Site (http://www.rna.icmb.utexas.edu/) While the rRNA introns are distributed across the entire tree of life, the majority of introns occur within a few phylogenetic groups. We analyzed the distributions of rRNA introns within the three-dimensional structures of the 30S and 50S ribosomes. Most sites in rRNA genes that contain introns contain only one type of intron. While the intron insertion sites occur at many different coordinates, the majority are clustered near conserved residues that form tRNA binding sites and the subunit interface. Contrary to our expectations, many of these positions are not accessible to solvent in the mature ribosome. The correlation between the frequency of intron insertions and proximity of the insertion site to functionally important residues suggests an association between intron evolution and rRNA function.

  17. Reviving the RNA World: An Insight into the Appearance of RNA Methyltransferases

    PubMed Central

    Rana, Ajay K.; Ankri, Serge

    2016-01-01

    RNA, the earliest genetic and catalytic molecule, has a relatively delicate and labile chemical structure, when compared to DNA. It is prone to be damaged by alkali, heat, nucleases, or stress conditions. One mechanism to protect RNA or DNA from damage is through site-specific methylation. Here, we propose that RNA methylation began prior to DNA methylation in the early forms of life evolving on Earth. In this article, the biochemical properties of some RNA methyltransferases (MTases), such as 2′-O-MTases (Rlml/RlmN), spOUT MTases and the NSun2 MTases are dissected for the insight they provide on the transition from an RNA world to our present RNA/DNA/protein world. PMID:27375676

  18. Structural and Functional Profiling of the Human Histone Methyltransferase SMYD3

    SciTech Connect

    Foreman, Kenneth W.; Brown, Mark; Park, Frances; Emtage, Spencer; Harriss, June; Das, Chhaya; Zhu, Li; Crew, Andy; Arnold, Lee; Shaaban, Salam; Tucker, Philip

    2012-10-23

    The SET and MYND Domain (SMYD) proteins comprise a unique family of multi-domain SET histone methyltransferases that are implicated in human cancer progression. Here we report an analysis of the crystal structure of the full length human SMYD3 in a complex with an analog of the S-adenosyl methionine (SAM) methyl donor cofactor. The structure revealed an overall compact architecture in which the 'split-SET' domain adopts a canonical SET domain fold and closely assembles with a Zn-binding MYND domain and a C-terminal superhelical 9 ?-helical bundle similar to that observed for the mouse SMYD1 structure. Together, these structurally interlocked domains impose a highly confined binding pocket for histone substrates, suggesting a regulated mechanism for its enzymatic activity. Our mutational and biochemical analyses confirm regulatory roles of the unique structural elements both inside and outside the core SET domain and establish a previously undetected preference for trimethylation of H4K20.

  19. Structural Basis for Binding of RNA and Cofactor by a KsgA Methyltransferase

    SciTech Connect

    Tu, Chao; Tropea, Joseph E.; Austin, Brian P.; Court, Donald L.; Waugh, David S.; Ji, Xinhua

    2009-03-27

    Among methyltransferases, KsgA and the reaction it catalyzes are conserved throughout evolution. However, the specifics of substrate recognition by the enzyme remain unknown. Here we report structures of Aquifex aeolicus KsgA, in its ligand-free form, in complex with RNA, and in complex with both RNA and S-adenosylhomocysteine (SAH, reaction product of cofactor S-adenosylmethionine), revealing critical structural information on KsgA-RNA and KsgA-SAH interactions. Moreover, the structures show how conformational changes that occur upon RNA binding create the cofactor-binding site. There are nine conserved functional motifs (motifs IVIII and X) in KsgA. Prior to RNA binding, motifs I and VIII are flexible, each exhibiting two distinct conformations. Upon RNA binding, the two motifs become stabilized in one of these conformations, which is compatible with the binding of SAH. Motif X, which is also stabilized upon RNA binding, is directly involved in the binding of SAH.

  20. Histone acetyltransferase p300 promotes MKL1-mediated transactivation of catechol-O-methyltransferase gene.

    PubMed

    Liu, Zhipeng; Luo, Xuegang; Liu, Lei; Zhao, Wenwen; Guo, Shu; Guo, Yu; Wang, Nan; He, Hongpeng; Liao, Xinghua; Ma, Wenjian; Zhou, Hao; Zhang, Tongcun

    2013-12-01

    Previous studies have revealed that histone acetyltransferase p300 is recruited to the promoters of certain cardiac and smooth muscle specific genes to enhance the transactivation activity of myocardin, which is a master regulator in cardiovascular differentiation and development. Here, we found that the gene encoding catechol-O-methyltransferase (COMT), an important metabolic enzyme catalyzing the conversion of estrogen, is also a target gene of myocardin-related transcription factors (MRTFs). Megakaryoblastic leukemia 1 (MKL1, also named MRTF-A) and p300 could synergistically augment the expression of COMT gene, increase the metabolic rate of estrogen, and thus reduce the proliferation of MCF-7 breast cancer cells stimulated by estrogen. PMID:24096006

  1. Mechanistic and biological significance of DNA methyltransferase 1 upregulated by growth factors in human hepatocellular carcinoma.

    PubMed

    Fang, Qin-Liang; Yin, Yi-Rui; Xie, Cheng-Rong; Zhang, Sheng; Zhao, Wen-Xiu; Pan, Chao; Wang, Xiao-Min; Yin, Zhen-Yu

    2015-02-01

    Dysregulation of growth factor signaling plays a pivotal role in controlling the malignancy phenotype and progression of hepatocellular carcinoma (HCC). However, the precise oncogenic mechanisms underlying transcription regulation of certain tumor suppressor genes (TSGs) by growth factors are poorly understood. In the present study, we report a novel insulin-like growth factor 1 (IGF1) pathway that mediates de novo DNA methylation and TSG (such as DLC1 and CHD5) silencing by upregulation of the DNA methyltransferase 1 (DNMT1) via an AKT/β-transducin repeat-containing protein (βTrCP)-mediated ubiquitin-proteasome pathway in HCC. Analysis of DNA methylation in CpG islands of target genes revealed high co-localization of DNMT1 and DNMT3B on the promoters of TSGs associated with enhanced CpG hypermethylation. Our results point to a novel epigenetic mechanism for growth factor-mediated repression of TSG transcription that involves DNA methylation. PMID:25420499

  2. Chronic ethanol consumption alters the selective usage of phosphatidylethanolamine molecular species by methyltransferases

    SciTech Connect

    Ellingson, J.S.; Pukys, T.; Rubin, E. )

    1992-01-01

    The authors have examined the effects of chronic ethanol consumption on phospholipid methyltransferases, which may play a special role by synthesizing phosphatidylcholine (PC) molecules containing predominantly polyunsaturated fatty acids. Rat liver microsomes from adenosylmethionine to convert endogenous phoshatidylethanolamine (PE) to radiolabeled PC, which was separated into its individual molecular species by reversed-phase HPLC. To assess the selective usage of PE molecular species for methylation, the authors determined the mole % of the PE molecular species in microsomes from control and ethanol-fed rats. Chronic ethanol consumption increased the selective usage of phospholipid molecular species containing palmitic acid combined with arachidonic acid or docosahexaenoic acid, whereas it did not affect the use of the corresponding stearic acid species. These results suggest that the long term interference with cellular physiology by altering the metabolism of a specific metabolic pool of molecular species is a mechanism by which chronic ethanol consumption could exert adverse effects of the liver.

  3. Nucleosome Binding Alters the Substrate Bonding Environment of Histone H3 Lysine 36 Methyltransferase NSD2.

    PubMed

    Poulin, Myles B; Schneck, Jessica L; Matico, Rosalie E; Hou, Wangfang; McDevitt, Patrick J; Holbert, Marc; Schramm, Vern L

    2016-06-01

    Nuclear receptor-binding SET domain protein 2 (NSD2) is a histone H3 lysine 36 (H3K36)-specific methyltransferase enzyme that is overexpressed in a number of cancers, including multiple myeloma. NSD2 binds to S-adenosyl-l-methionine (SAM) and nucleosome substrates to catalyze the transfer of a methyl group from SAM to the ε-amino group of histone H3K36. Equilibrium binding isotope effects and density functional theory calculations indicate that the SAM methyl group is sterically constrained in complex with NSD2, and that this steric constraint is released upon nucleosome binding. Together, these results show that nucleosome binding to NSD2 induces a significant change in the chemical environment of enzyme-bound SAM. PMID:27183271

  4. Ash2 acts as an ecdysone receptor coactivator by stabilizing the histone methyltransferase Trr.

    PubMed

    Carbonell, Albert; Mazo, Alexander; Serras, Florenci; Corominas, Montserrat

    2013-02-01

    The molting hormone ecdysone triggers chromatin changes via histone modifications that are important for gene regulation. On hormone activation, the ecdysone receptor (EcR) binds to the SET domain-containing histone H3 methyltransferase trithorax-related protein (Trr). Methylation of histone H3 at lysine 4 (H3K4me), which is associated with transcriptional activation, requires several cofactors, including Ash2. We find that ash2 mutants have severe defects in pupariation and metamorphosis due to a lack of activation of ecdysone-responsive genes. This transcriptional defect is caused by the absence of the H3K4me3 marks set by Trr in these genes. We present evidence that Ash2 interacts with Trr and is required for its stabilization. Thus we propose that Ash2 functions together with Trr as an ecdysone receptor coactivator.

  5. Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase*

    PubMed Central

    Dong, Hongping; Liu, Lihui; Zou, Gang; Zhao, Yiwei; Li, Zhong; Lim, Siew Pheng; Shi, Pei-Yong; Li, Hongmin

    2010-01-01

    The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2′-O positions of the viral RNA cap (GpppA-RNA → m7GpppA-RNA → m7GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-Å resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus, SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase. PMID:20685660

  6. Brain Histamine N-Methyltransferase As a Possible Target of Treatment for Methamphetamine Overdose

    PubMed Central

    Kitanaka, Junichi; Kitanaka, Nobue; Hall, F. Scott; Uhl, George R.; Takemura, Motohiko

    2016-01-01

    Stereotypical behaviors induced by methamphetamine (METH) overdose are one of the overt symptoms of METH abuse, which can be easily assessed in animal models. Currently, there is no successful treatment for METH overdose. There is increasing evidence that elevated levels of brain histamine can attenuate METH-induced behavioral abnormalities, which might therefore constitute a novel therapeutic treatment for METH abuse and METH overdose. In mammals, histamine N-methyltransferase (HMT) is the sole enzyme responsible for degrading histamine in the brain. Metoprine, one of the most potent HMT inhibitors, can cross the blood–brain barrier and increase brain histamine levels by inhibiting HMT. Consequently, this compound can be a candidate for a prototype of drugs for the treatment of METH overdose. PMID:26966348

  7. Brain Histamine N-Methyltransferase As a Possible Target of Treatment for Methamphetamine Overdose.

    PubMed

    Kitanaka, Junichi; Kitanaka, Nobue; Hall, F Scott; Uhl, George R; Takemura, Motohiko

    2016-01-01

    Stereotypical behaviors induced by methamphetamine (METH) overdose are one of the overt symptoms of METH abuse, which can be easily assessed in animal models. Currently, there is no successful treatment for METH overdose. There is increasing evidence that elevated levels of brain histamine can attenuate METH-induced behavioral abnormalities, which might therefore constitute a novel therapeutic treatment for METH abuse and METH overdose. In mammals, histamine N-methyltransferase (HMT) is the sole enzyme responsible for degrading histamine in the brain. Metoprine, one of the most potent HMT inhibitors, can cross the blood-brain barrier and increase brain histamine levels by inhibiting HMT. Consequently, this compound can be a candidate for a prototype of drugs for the treatment of METH overdose. PMID:26966348

  8. Miniaturization of High-Throughput Epigenetic Methyltransferase Assays with Acoustic Liquid Handling.

    PubMed

    Edwards, Bonnie; Lesnick, John; Wang, Jing; Tang, Nga; Peters, Carl

    2016-02-01

    Epigenetics continues to emerge as an important target class for drug discovery and cancer research. As programs scale to evaluate many new targets related to epigenetic expression, new tools and techniques are required to enable efficient and reproducible high-throughput epigenetic screening. Assay miniaturization increases screening throughput and reduces operating costs. Echo liquid handlers can transfer compounds, samples, reagents, and beads in submicroliter volumes to high-density assay formats using only acoustic energy-no contact or tips required. This eliminates tip costs and reduces the risk of reagent carryover. In this study, we demonstrate the miniaturization of a methyltransferase assay using Echo liquid handlers and two different assay technologies: AlphaLISA from PerkinElmer and EPIgeneous HTRF from Cisbio.

  9. Elucidation of the methyl transfer mechanism catalyzed by chalcone O-methyltransferase: a density functional study.

    PubMed

    Cui, Feng-Chao; Pan, Xiao-Liang; Liu, Wei; Liu, Jing-Yao

    2011-11-15

    The mechanism of the methyl transfer catalyzed by chalcone O-methyltransferase has been computationally investigated by employing the hybrid functional B3LYP. Two models are constructed based on the two conformations of the substrate isoliquiritigenin in the X-ray structure. Our calculations show that the overall reaction is divided into two elementary steps: the water-assisted deprotonation of the substrate by His278 as a catalytic base, followed by the methyl transfer from S-adenosyl-L-methionine (SAM) to the substrate. The calculated rate-limiting barriers for the methyl-transfer step indicate that the catalytic reactions are energetically feasible for both conformations adopted by the substrate. PMID:21815175

  10. Strategy to target the substrate binding site of SET domain protein methyltransferases.

    PubMed

    Nguyen, Kong T; Li, Fengling; Poda, Gennadiy; Smil, David; Vedadi, Masoud; Schapira, Matthieu

    2013-03-25

    Protein methyltransferases (PMTs) are a novel gene family of therapeutic relevance involved in chromatin-mediated signaling and other biological mechanisms. Most PMTs are organized around the structurally conserved SET domain that catalyzes the methylation of a substrate lysine. A few potent chemical inhibitors compete with the protein substrate, and all are anchored in the channel recruiting the methyl-accepting lysine. We propose a novel strategy to design focused chemical libraries targeting the substrate binding site, where a limited number of warheads each occupying the lysine-channel of multiple enzymes would be decorated by different substituents. A variety of sequence and structure-based approaches used to analyze the diversity of the lysine channel of SET domain PMTs support the relevance of this strategy. We show that chemical fragments derived from published inhibitors are valid warheads that can be used in the design of novel focused libraries targeting other PMTs.

  11. Structural Basis of Allele Variation of Human Thiopurine-S-Methyltransferase

    PubMed Central

    Wu, Hong; Horton, John R.; Battaile, Kevin; Allali-Hassani, Abdellah; Martin, Fernando; Zeng, Hong; Loppnau, Peter; Vedadi, Masoud; Bochkarev, Alexey; Plotnikov, Alexander N.; Cheng, Xiaodong

    2009-01-01

    Human thiopurine S-methyltransferase (TPMT) exhibits considerable person-to-person variation in activity to thiopurine drugs. We have produced an N-terminal truncation of human TPMT protein, crystallized the protein in complex with the methyl donor product S-adenosyl-L-homocysteine, and determined the atomic structure to the resolution of 1.58 and 1.89 Å, respectively, for the seleno-methionine incorporated and wild type proteins. The structure of TPMT indicates that the naturally occurring amino acid polymorphisms scatter throughout the structure, and that the amino acids whose alteration have the most influence on function are those that form intra-molecular stabilizing interactions (mainly van der Waals contacts). Furthermore, we have produced four TPMT mutant proteins containing variant alleles of TPMT*2, *3A, *3B, and *3C and examined the structure-function relationship of the mutant proteins based on their expression and solubility in bacteria and their thermostability profile. PMID:17243178

  12. Coordination of stress signals by the lysine methyltransferase SMYD2 promotes pancreatic cancer

    PubMed Central

    Reynoird, Nicolas; Mazur, Pawel K.; Stellfeld, Timo; Flores, Natasha M.; Lofgren, Shane M.; Carlson, Scott M.; Brambilla, Elisabeth; Hainaut, Pierre; Kaznowska, Ewa B.; Arrowsmith, Cheryl H.; Khatri, Purvesh; Stresemann, Carlo; Gozani, Or; Sage, Julien

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is a lethal form of cancer with few therapeutic options. We found that levels of the lysine methyltransferase SMYD2 (SET and MYND domain 2) are elevated in PDAC and that genetic and pharmacological inhibition of SMYD2 restricts PDAC growth. We further identified the stress response kinase MAPKAPK3 (MK3) as a new physiologic substrate of SMYD2 in PDAC cells. Inhibition of MAPKAPK3 impedes PDAC growth, identifying a potential new kinase target in PDAC. Finally, we show that inhibition of SMYD2 cooperates with standard chemotherapy to treat PDAC cells and tumors. These findings uncover a pivotal role for SMYD2 in promoting pancreatic cancer. PMID:26988419

  13. ESET histone methyltransferase regulates osteoblastic differentiation of mesenchymal stem cells during postnatal bone development

    PubMed Central

    Lawson, Kevin A.; Teteak, Colin J.; Gao, Jidi; Li, Ning; Hacquebord, Jacques; Ghatan, Andrew; Zielinska-Kwiatkowska, Anna; Song, Guangchun; Chansky, Howard A.; Yang, Liu

    2014-01-01

    To investigate the effects of histone methyltransferase ESET (also known as SETDB1) on bone metabolism, we analyzed osteoblasts and osteoclasts in ESET knockout animals, and performed osteogenesis assays using ESET-null mesenchymal stem cells. We found that ESET deletion severely impairs osteoblast differentiation but has no effect on osteoclastogenesis, that co-transfection of ESET represses Runx2-mediated luciferase reporter while siRNA knockdown of ESET activates the luciferase reporter in mesenchymal cells, and that ESET is required for postnatal expression of Indian hedgehog protein in the growth plate. As the bone phenotype in ESET-null mice is 100% penetrant, these results support ESET as a critical regulator of osteoblast differentiation during bone development. PMID:24188826

  14. Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase

    SciTech Connect

    H Dong; L Liu; G Zou; Y Zhao; Z Li; S Lim; P Shi; H Li

    2011-12-31

    The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2'-O positions of the viral RNA cap (GpppA-RNA {yields} m(7)GpppA-RNA {yields} m(7)GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-{angstrom} resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus, SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase.

  15. Hijacked in cancer: the MLL/KMT2 family of methyltransferases

    PubMed Central

    Rao, Rajesh C.; Dou, Yali

    2015-01-01

    Preface Lysine methyltransferase 2 family (KMT2) proteins methylate lysine 4 on the histone H3 tail at important regulatory regions in the genome and thus impart critical functions through modulating chromatin structures and DNA accessibility. While the human KMT2 family was initially named the mixed lineage leukemia (MLL) family, due to the role of the founding member KMT2A (also called MLL, MLL1, ALL-1, HRX) in this disease, recent exome-sequencing studies revealed KMT2 genes to be among the most frequently mutated genes in many types of human cancers. Efforts to integrate the molecular mechanisms of KMT2 with its roles in tumorigenesis have led to the development of first-generation inhibitors of KMT2 function, which could become novel cancer therapies. PMID:25998713

  16. Identification of factors regulating thiopurine methyltransferase activity in a Norwegian population.

    PubMed

    Klemetsdal, B; Straume, B; Wist, E; Aarbakke, J

    1993-01-01

    Red blood cell (RBC) thiopurine methyltransferase (TPMT), an inactivating pathway of 6-mercaptopurine, is controlled by genetic polymorphism and is subject to ethnic variation. RBC TPMT is a good predictor of clinical outcome in children with acute lymphoblastic leukemia. RBC TPMT activity was determined in 226 patients, 176 of them living in northern Norway (of which 123 were Saami (Lapps)). Demographic variables, use of drugs and presence of chronic diseases were evaluated as possible predictors of RBC TPMT activity by a multiple regression model. Men had higher RBC TPMT activity compared to women. Living in the northernmost county of Norway was associated with increased RBC TPMT activity irrespective of ethnicity. The use of diuretics was associated with increased RBC TPMT activity. The gender difference in RBC TPMT activity may indicate a need to treat male subjects more aggressively with thiopurine drugs compared to female subjects.

  17. Thiopurine S-methyltransferase testing for averting drug toxicity in patients receiving thiopurines: a systematic review

    PubMed Central

    Roy, Lilla M; Zur, Richard M; Uleryk, Elizabeth; Carew, Chris; Ito, Shinya; Ungar, Wendy J

    2016-01-01

    Aim Thiopurine S-methyltransferase (TPMT) testing is used in patients receiving thiopurines to identify enzyme deficiencies and risk for adverse drug reactions. It is uncertain whether genotyping is superior to phenotyping. The objectives were to conduct a systematic review of TPMT-test performance studies. Materials & methods Electronic and grey literature sources were searched for studies reporting test performance compared with a reference standard. Sixty-six eligible studies were appraised for quality. Results Thirty phenotype–genotype and six phenotype–phenotype comparisons were of high quality. The calculated sensitivity and specificity for genotyping to identify a homozygous mutation ranged from 0.0–100.0% and from 97.8–100.0%, respectively. Conclusion Clinical decision-makers require high-quality evidence of clinical validity and clinical utility of TPMT genotyping to ensure appropriate use in patients. PMID:27020704

  18. Using ‘biased-privileged’ scaffolds to identify lysine methyltransferase inhibitors

    PubMed Central

    Kashyap, Sudhir; Sandler, Joel; Martinez, Eduardo J.; Kapoor, Tarun M.

    2014-01-01

    Methylation of histones by lysine methyltransferases (KMTases) plays important roles in regulating chromatin function. It is also now clear that improper KMTases activity is linked to human diseases, such as cancer. We report an approach that employs drug-like ‘privileged’ scaffolds biased with motifs present in S-adenosyl methionine, the cofactor used by KMTases, to efficiently generate inhibitors for Set7, a biochemically well-characterized KMTase. Setin-1, the most potent inhibitor of Set7 we have developed also inhibits the KMTase G9a. Together these data suggest that these inhibitors should provide good starting points to generate useful probes for KMTase biology and guide the design of KMTase inhibitors with drug-like properties. PMID:24650704

  19. Reviving the RNA World: An Insight into the Appearance of RNA Methyltransferases.

    PubMed

    Rana, Ajay K; Ankri, Serge

    2016-01-01

    RNA, the earliest genetic and catalytic molecule, has a relatively delicate and labile chemical structure, when compared to DNA. It is prone to be damaged by alkali, heat, nucleases, or stress conditions. One mechanism to protect RNA or DNA from damage is through site-specific methylation. Here, we propose that RNA methylation began prior to DNA methylation in the early forms of life evolving on Earth. In this article, the biochemical properties of some RNA methyltransferases (MTases), such as 2'-O-MTases (Rlml/RlmN), spOUT MTases and the NSun2 MTases are dissected for the insight they provide on the transition from an RNA world to our present RNA/DNA/protein world. PMID:27375676

  20. H3K36 methyltransferases as cancer drug targets: rationale and perspectives for inhibitor development.

    PubMed

    Rogawski, David S; Grembecka, Jolanta; Cierpicki, Tomasz

    2016-09-01

    Methylation at histone 3, lysine 36 (H3K36) is a conserved epigenetic mark regulating gene transcription, alternative splicing and DNA repair. Genes encoding H3K36 methyltransferases (KMTases) are commonly overexpressed, mutated or involved in chromosomal translocations in cancer. Molecular biology studies have demonstrated that H3K36 KMTases regulate oncogenic transcriptional programs. Structural studies of the catalytic SET domain of H3K36 KMTases have revealed intriguing opportunities for design of small molecule inhibitors. Nevertheless, potent inhibitors for most H3K36 KMTases have not yet been developed, underlining the challenges associated with this target class. As we now have strong evidence linking H3K36 KMTases to cancer, drug development efforts are predicted to yield novel compounds in the near future. PMID:27548565

  1. Molecular basis for oncohistone H3 recognition by SETD2 methyltransferase.

    PubMed

    Yang, Shuang; Zheng, Xiangdong; Lu, Chao; Li, Guo-Min; Allis, C David; Li, Haitao

    2016-07-15

    High-frequency point mutations of genes encoding histones have been identified recently as novel drivers in a number of tumors. Specifically, the H3K36M/I mutations were shown to be oncogenic in chondroblastomas and undifferentiated sarcomas by inhibiting H3K36 methyltransferases, including SETD2. Here we report the crystal structures of the SETD2 catalytic domain bound to H3K36M or H3K36I peptides with SAH (S-adenosylhomocysteine). In the complex structure, the catalytic domain adopts an open conformation, with the K36M/I peptide snuggly positioned in a newly formed substrate channel. Our structural and biochemical data reveal the molecular basis underying oncohistone recognition by and inhibition of SETD2. PMID:27474439

  2. Detection and quantification of flavivirus NS5 methyl-transferase activities.

    PubMed

    Lim, Siew Pheng; Bodenreider, Christophe; Shi, Pei-Yong

    2013-01-01

    Flavivirus NS5 is the most conserved protein amongst the flavivirus proteins and is an essential enzyme for viral mRNA capping and replication. It encodes a methyl-transferase (MTase) domain at its N-terminal region which carries out sequential N7 and 2'-O methylation, resulting in the formation of the cap1 structure on its viral RNA genome. Two key methods have been established to measure these activities in vitro: thin-layer chromatography (TLC) and scintillation proximity assays (SPA). TLC offers the advantage of direct visualization of the amounts and types of cap structures formed whilst the SPA assay is more sensitive and quantitative. It is also amenable to high-throughput compound screening. The drawback of both assays is the need for radioisotope usage. We further describe the adaptation of a nonradioactive immune-competitive fluorescence polarization assay for detection of dengue virus MTase activity. PMID:23821274

  3. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  4. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  5. Characterization of the Thermotoga maritima Chemotaxis Methylation System that Lacks Methyltransferase CheR:MCP Tethering

    PubMed Central

    Perez, Eduardo; Stock, Ann M.

    2013-01-01

    Summary Sensory adaptation in bacterial chemotaxis is mediated by covalent modifications of specific glutamate and glutamine residues within the cytoplasmic domains of methyl-accepting proteins (MCPs). In Escherichia coli and Salmonella enterica, efficient methylation of MCPs depends on the localization of methyltransferase CheR to MCP clusters through an interaction between the CheR β-subdomain and a pentapeptide sequence (NWETF or NWESF) at the C terminus of the MCP. In vitro methylation analyses utilizing S. enterica and Thermotoga maritima CheR proteins and MCPs indicate that MCP methylation in T. maritima occurs independently of a pentapeptide-binding motif. Kinetic and binding measurements demonstrate that despite efficient methylation, the interaction between T. maritima CheR and T. maritima MCPs is of relatively low affinity. Comparative protein sequence analyses of CheR β-subdomains from organisms having MCPs that contain and/or lack pentapeptide-binding motifs identified key similarities and differences in residue conservation, suggesting the existence of two distinct classes of CheR proteins: pentapeptide-dependent and pentapeptide-independent methyltransferases. Analysis of MCP C-terminal ends showed that only ~10% of MCPs contain a putative C-terminal binding motif, the majority of which are restricted to the different proteobacteria classes (α, β, γ, δ). These findings suggest that tethering of CheR to MCPs is a relatively recent event in evolution and that the pentapeptide-independent methylation system is more common than the well characterized pentapeptide-dependent methylation system. PMID:17163981

  6. Coordinated expression of H3K9 histone methyltransferases during tooth development in mice.

    PubMed

    Kamiunten, Taichi; Ideno, Hisashi; Shimada, Akemi; Nakamura, Yoshiki; Kimura, Hiroshi; Nakashima, Kazuhisa; Nifuji, Akira

    2015-03-01

    Tissue-specific gene expression is subjected to epigenetic and genetic regulation. Posttranslational modifications of histone tails alter the accessibility of nuclear proteins to DNA, thus affecting the activity of the regulatory complex of nuclear proteins. Methylation at histone 3 lysine 9 (H3K9) is a crucial modification that affects gene expression and cell differentiation. H3K9 is known to have 0-3 methylation states, and these four methylated states are determined by the expression of sets of histone methyltransferases. During development, teeth are formed through mutual interactions between the mesenchyme and epithelium via a process that is subjected to the epigenetic regulation. In this study, we examined the expression of all H3K9 methyltransferases (H3K9MTases) during mouse tooth development. We found that four H3K9MTases-G9a, Glp, Prdm2, and Suv39h1-were highly expressed in the tooth germ, with expression peaks at around embryonic days 16.5 and 17.5 in mice. Immunohistochemical and in situ hybridization analyses revealed that all four H3K9MTases were enriched in the mesenchyme more than in the epithelium. Substrates of H3K9MTases, H3K9me1, H3K9me2, and H3K9me3 were also enriched in the mesenchyme. Taken together, these data suggested that coordinated expression of four H3K9MTases in the dental mesenchyme might play important roles in tooth development.

  7. The PRMT5 arginine methyltransferase: many roles in development, cancer and beyond.

    PubMed

    Stopa, Nicole; Krebs, Jocelyn E; Shechter, David

    2015-06-01

    Post-translational arginine methylation is responsible for regulation of many biological processes. The protein arginine methyltransferase 5 (PRMT5, also known as Hsl7, Jbp1, Skb1, Capsuleen, or Dart5) is the major enzyme responsible for mono- and symmetric dimethylation of arginine. An expanding literature demonstrates its critical biological function in a wide range of cellular processes. Histone and other protein methylation by PRMT5 regulate genome organization, transcription, stem cells, primordial germ cells, differentiation, the cell cycle, and spliceosome assembly. Metazoan PRMT5 is found in complex with the WD-repeat protein MEP50 (also known as Wdr77, androgen receptor coactivator p44, or Valois). PRMT5 also directly associates with a range of other protein factors, including pICln, Menin, CoPR5 and RioK1 that may alter its subcellular localization and protein substrate selection. Protein substrate and PRMT5-MEP50 post-translation modifications induce crosstalk to regulate PRMT5 activity. Crystal structures of C. elegans PRMT5 and human and frog PRMT5-MEP50 complexes provide substantial insight into the mechanisms of substrate recognition and procession to dimethylation. Enzymological studies of PRMT5 have uncovered compelling insights essential for future development of specific PRMT5 inhibitors. In addition, newly accumulating evidence implicates PRMT5 and MEP50 expression levels and their methyltransferase activity in cancer tumorigenesis, and, significantly, as markers of poor clinical outcome, marking them as potential oncogenes. Here, we review the substantial new literature on PRMT5 and its partners to highlight the significance of understanding this essential enzyme in health and disease.

  8. Enhanced memory persistence is blocked by a DNA methyltransferase inhibitor in the snail Lymnaea stagnalis.

    PubMed

    Lukowiak, Ken; Heckler, Benjamin; Bennett, Thomas E; Schriner, Ellen K; Wyrick, Kathryn; Jewett, Cynthia; Todd, Ryan P; Sorg, Barbara A

    2014-08-15

    Lymnaea stagnalis provides an excellent model system for studying memory because these snails have a well-described set of neurons, a single one of which controls expression of long-term memory of operantly conditioned respiratory behavior. We have shown that several different manipulations, including pre-training exposure to serotonin (5-HT) or methamphetamine, submersion of snails after training to prevent memory interference, and exposure to effluent from predatory crayfish (CE), enhance memory persistence. Changes in DNA methylation underlie formation of strong memories in mammals and 5-HT-enhanced long-term facilitation in Aplysia. Here we determined the impact of the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (5-AZA; 87 μmol l(-1)), on enhanced memory persistence by all four manipulations. We found that 5-HT (100 μmol l(-1)) enhanced memory persistence, which was blocked by 5-AZA pretreatment. Snails pre-exposed to 3.3 μmol l(-1) Meth 4 h prior to training demonstrated memory 72 h later, which was not present in controls. This memory-enhancing effect was blocked by pre-treatment with 87 μmol l(-1) 5-AZA. Similarly, submersion to prevent interference learning as well as training in CE produced memory that was not present in controls, and these effects were blocked by pre-treatment with 87 μmol l(-1) 5-AZA. In contrast, 5-AZA injection did not alter expression of normal (non-enhanced) memory, suggesting that these four stimuli enhance memory persistence by increasing DNA methyltransferase activity, which, in turn, increases expression of memory-enhancing genes and/or inhibits memory suppressor genes. These studies lay important groundwork for delineating gene methylation changes that are common to persistent memory produced by different stimuli.

  9. SABATH methyltransferases from white spruce (Picea glauca): gene cloning, functional characterization and structural analysis.

    PubMed

    Zhao, Nan; Boyle, Brian; Duval, Isabelle; Ferrer, Jean-Luc; Lin, Hong; Seguin, Armand; MacKay, John; Chen, Feng

    2009-07-01

    Known members of the plant SABATH family of methyltransferases have important biological functions by methylating hormones, signalling molecules and other metabolites. While all previously characterized SABATH genes were isolated from angiosperms, in this article, we report on the isolation and functional characterization of SABATH genes from white spruce (Picea glauca [Moench] Voss), a gymnosperm. Through EST database search, three genes that encode proteins significantly homologous to known SABATH proteins were identified from white spruce. They were named PgSABATH1, PgSABATH2 and PgSABATH3, respectively. Full length cDNAs of these three genes were cloned and expressed in Escherichia coli. The E. coli-expressed recombinant proteins were tested for methyltransferase activity with a large number of compounds. While no activity was detected for PgSABATH2 and PgSABATH3, PgSABATH1 displayed the highest level of catalytic activity with indole-3-acetic acid (IAA). PgSABATH1 was, therefore, renamed PgIAMT1. Under steady-state conditions, PgIAMT1 exhibited apparent Km values of 18.2 microM for IAA. Homology-based structural modelling of PgIAMT1 revealed that the active site of PgIAMT1 is highly similar to other characterized IAMTs from angiosperms. PgIAMT1 showed expression in multiple tissues, with the highest level of expression detected in embryonic tissues. During somatic embryo maturation, a significant reduction in PgIAMT1 transcript levels was observed when developing cotyledons become apparent which is indicative of mature embryos. The biological roles of white spruce SABATH genes, especially those of PgIAMT1, and the evolution of the SABATH family are discussed.

  10. Substrate Specificity of the HEMK2 Protein Glutamine Methyltransferase and Identification of Novel Substrates.

    PubMed

    Kusevic, Denis; Kudithipudi, Srikanth; Jeltsch, Albert

    2016-03-18

    Bacterial HEMK2 homologs initially had been proposed to be involved in heme biogenesis or to function as adenine DNA methyltransferase. Later it was shown that this family of enzymes has protein glutamine methyltransferase activity, and they methylate the glutamine residue in the GGQ motif of ribosomal translation termination factors. The murine HEMK2 enzyme methylates Gln(185) of the eukaryotic translation termination factor eRF1. We have employed peptide array libraries to investigate the peptide sequence recognition specificity of murine HEMK2. Our data show that HEMK2 requires a GQX3R motif for methylation activity. In addition, amino acid preferences were observed between the -3 and +7 positions of the peptide substrate (considering the target glutamine as 0), including a preference for Ser, Arg, and Gly at the +1 and a preference for Arg at the +7 position. Based on our specificity profile, we identified several human proteins that contain putative HEMK2 methylation sites and show that HEMK2 methylates 58 novel peptide substrates. After cloning, expression, and purification of the corresponding protein domains, we confirmed methylation for 11 of them at the protein level. Transfected CHD5 (chromodomain helicase DNA-binding protein 5) and NUT (nuclear protein in testis) were also demonstrated to be methylated by HEMK2 in human HEK293 cells. Our data expand the range of proteins potentially subjected to glutamine methylation significantly, but further investigation will be required to understand the function of HEMK2-mediated methylation in proteins other than eRF1. PMID:26797129

  11. Expression of a functional jasmonic acid carboxyl methyltransferase is negatively correlated with strawberry fruit development.

    PubMed

    Preuß, Anja; Augustin, Christiane; Figueroa, Carlos R; Hoffmann, Thomas; Valpuesta, Victoriano; Sevilla, José F; Schwab, Wilfried

    2014-09-15

    The volatile metabolite methyl jasmonate (MeJA) plays an important role in intra- and interplant communication and is involved in diverse biological processes. In this study, we report the cloning and functional characterization of a S-adenosyl-l-methionine:jasmonic acid carboxyl methyltransferase (JMT) from Fragaria vesca and Fragaria×ananassa. Biochemical assays and comprehensive transcript analyses showed that JMT has been erroneously annotated as gene fusion with a carboxyl methyltransferase (CMT) (gene15184) in the first published genome sequence of F. vesca. Recombinant FvJMT catalyzed the formation of MeJA with KM value of 22.3μM while FvCMT and the fusion protein were almost inactive. Activity of JMT with benzoic acid and salicylic acid as substrates was less than 1.5% of that with JA. Leucine at position 245, an amino acid missing in other JMT sequences is essential for activity of FvJMT. In accordance with MeJA levels, JMT transcript levels decreased steadily during strawberry fruit ripening, as did the expression levels of JA biosynthesis and regulatory genes. It appears that CMT has originated by a recent duplication of JMT and lost its enzymatic activity toward JA. In the newest version of the strawberry genome sequence (June 2014) CMT and JMT are annotated as separate genes in accordance with differential temporal and spatial expression patterns of both genes in Fragaria sp. In conclusion, MeJA, the inactive derivative of JA, is probably involved in early steps of fruit development by modulating the levels of the active plant hormone JA.

  12. Computational Investigation of the Interplay of Substrate Positioning and Reactivity in Catechol O-Methyltransferase

    PubMed Central

    Patra, Niladri; Ioannidis, Efthymios I.

    2016-01-01

    Catechol O-methyltransferase (COMT) is a SAM- and Mg2+-dependent methyltransferase that regulates neurotransmitters through methylation. Simulations and experiments have identified divergent catecholamine substrate orientations in the COMT active site: molecular dynamics simulations have favored a monodentate coordination of catecholate substrates to the active site Mg2+, and crystal structures instead preserve bidentate coordination along with short (2.65 Å) methyl donor-acceptor distances. We carry out longer dynamics (up to 350 ns) to quantify interconversion between bidentate and monodentate binding poses. We provide a systematic determination of the relative free energy of the monodentate and bidentate structures in order to identify whether structural differences alter the nature of the methyl transfer mechanism and source of enzymatic rate enhancement. We demonstrate that the bidentate and monodentate binding modes are close in energy but separated by a 7 kcal/mol free energy barrier. Analysis of interactions in the two binding modes reveals that the driving force for monodentate catecholate orientations in classical molecular dynamics simulations is derived from stronger electrostatic stabilization afforded by alternate Mg2+ coordination with strongly charged active site carboxylates. Mixed semi-empirical-classical (SQM/MM) substrate C-O distances (2.7 Å) for the bidentate case are in excellent agreement with COMT X-ray crystal structures, as long as charge transfer between the substrates, Mg2+, and surrounding ligands is permitted. SQM/MM free energy barriers for methyl transfer from bidentate and monodentate catecholate configurations are comparable at around 21–22 kcal/mol, in good agreement with experiment (18–19 kcal/mol). Overall, the work suggests that both binding poses are viable for methyl transfer, and accurate descriptions of charge transfer and electrostatics are needed to provide balanced relative barriers when multiple binding poses are

  13. Isolation and Characterization of O-methyltransferases Involved in the Biosynthesis of Glaucine in Glaucium flavum.

    PubMed

    Chang, Limei; Hagel, Jillian M; Facchini, Peter J

    2015-10-01

    Transcriptome resources for the medicinal plant Glaucium flavum were searched for orthologs showing identity with characterized O-methyltransferases (OMTs) involved in benzylisoquinoline alkaloid biosynthesis. Seven recombinant proteins were functionally tested using the signature alkaloid substrates for six OMTs: norlaudanosoline 6-OMT, 6-O-methyllaudanosoline 4'-OMT, reticuline 7-OMT, norreticuline 7-OMT, scoulerine 9-OMT, and tetrahydrocolumbamine OMT. A notable alkaloid in yellow horned poppy (G. flavum [GFL]) is the aporphine alkaloid glaucine, which displays C8-C6' coupling and four O-methyl groups at C6, C7, C3', and C4' as numbered on the 1-benzylisoquinoline scaffold. Three recombinant enzymes accepted 1-benzylisoquinolines with differential substrate and regiospecificity. GFLOMT2 displayed the highest amino acid sequence identity with norlaudanosoline 6-OMT, showed a preference for the 6-O-methylation of norlaudanosoline, and O-methylated the 3' and 4' hydroxyl groups of certain alkaloids. GFLOMT1 showed the highest sequence identity with 6-O-methyllaudanosoline 4'OMT and catalyzed the 6-O-methylation of norlaudanosoline, but more efficiently 4'-O-methylated the GFLOMT2 reaction product 6-O-methylnorlaudanosoline and its N-methylated derivative 6-O-methyllaudanosoline. GFLOMT1 also effectively 3'-O-methylated both reticuline and norreticuline. GFLOMT6 was most similar to scoulerine 9-OMT and efficiently catalyzed both 3'- and 7'-O-methylations of several 1-benzylisoquinolines, with a preference for N-methylated substrates. All active enzymes accepted scoulerine and tetrahydrocolumbamine. Exogenous norlaudanosoline was converted to tetra-O-methylated laudanosine using combinations of Escherichia coli producing (1) GFLOMT1, (2) either GFLOMT2 or GFLOMT6, and (3) coclaurine N-methyltransferase from Coptis japonica. Expression profiles of GFLOMT1, GFLOMT2, and GFLOMT6 in different plant organs were in agreement with the O-methylation patterns of alkaloids in

  14. Functional Characterisation of Three O-methyltransferases Involved in the Biosynthesis of Phenolglycolipids in Mycobacterium tuberculosis

    PubMed Central

    Simeone, Roxane; Huet, Gaëlle; Constant, Patricia; Malaga, Wladimir; Lemassu, Anne; Laval, Françoise; Daffé, Mamadou; Guilhot, Christophe; Chalut, Christian

    2013-01-01

    Phenolic glycolipids are produced by a very limited number of slow-growing mycobacterial species, most of which are pathogen for humans. In Mycobacterium tuberculosis, the etiologic agent of tuberculosis, these molecules play a role in the pathogenicity by modulating the host immune response during infection. The major variant of phenolic glycolipids produced by M. tuberculosis, named PGL-tb, consists of a large lipid core terminated by a glycosylated aromatic nucleus. The carbohydrate part is composed of three sugar residues, two rhamnosyl units and a terminal fucosyl residue, which is per-O-methylated, and seems to be important for pathogenicity. While most of the genes responsible for the synthesis of the lipid core domain and the saccharide appendage of PGL-tb have been characterized, the enzymes involved in the O-methylation of the fucosyl residue of PGL-tb remain unknown. In this study we report the identification and characterization of the methyltransferases required for the O-methylation of the terminal fucosyl residue of PGL-tb. These enzymes are encoded by genes Rv2954c, Rv2955c and Rv2956. Mutants of M. tuberculosis harboring deletion within these genes were constructed. Purification and analysis of the phenolglycolipids produced by these strains, using a combination of mass spectrometry and NMR spectroscopy, revealed that Rv2954c, Rv2955c and Rv2956 encode the methyltransferases that respectively catalysed the O-methylation of the hydroxyl groups located at positions 3, 4 and 2 of the terminal fucosyl residue of PGL-tb. Our data also suggest that methylation at these positions is a sequential process, starting with position 2, followed by positions 4 and 3. PMID:23536839

  15. Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

    SciTech Connect

    Kanno, Yuichiro Inajima, Jun; Kato, Sayaka; Matsumoto, Maika; Tokumoto, Chikako; Kure, Yuki; Inouye, Yoshio

    2015-03-27

    The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.

  16. Characterization of three O-methyltransferases involved in noscapine biosynthesis in opium poppy.

    PubMed

    Dang, Thu-Thuy T; Facchini, Peter J

    2012-06-01

    Noscapine is a benzylisoquinoline alkaloid produced in opium poppy (Papaver somniferum) and other members of the Papaveraceae. It has been used as a cough suppressant and more recently was shown to possess anticancer activity. However, the biosynthesis of noscapine in opium poppy has not been established. A proposed pathway leading from (S)-reticuline to noscapine includes (S)-scoulerine, (S)-canadine, and (S)-N-methylcanadine as intermediates. Stem cDNA libraries and latex extracts of eight opium poppy cultivars displaying different alkaloid profiles were subjected to massively parallel pyrosequencing and liquid chromatography-tandem mass spectrometry, respectively. Comparative transcript and metabolite profiling revealed the occurrence of three cDNAs encoding O-methyltransferases designated as SOMT1, SOMT2, and SOMT3 that correlated with the accumulation of noscapine in the eight cultivars. SOMT transcripts were detected in all opium poppy organs but were most abundant in aerial organs, where noscapine primarily accumulates. SOMT2 and SOMT3 showed strict substrate specificity and regiospecificity as 9-O-methyltransferases targeting (S)-scoulerine. In contrast, SOMT1 was able to sequentially 9- and 2-O-methylate (S)-scoulerine, yielding (S)-tetrahydropalmatine. SOMT1 also sequentially 3'- and 7-O-methylated both (S)-norreticuline and (S)-reticuline with relatively high substrate affinity, yielding (S)-tetrahydropapaverine and (S)-laudanosine, respectively. The metabolic functions of SOMT1, SOMT2, and SOMT3 were investigated in planta using virus-induced gene silencing. Reduction of SOMT1 or SOMT2 transcript levels resulted in a significant decrease in noscapine accumulation. Reduced SOMT1 transcript levels also caused a decrease in papaverine accumulation, confirming the selective roles for these enzymes in the biosynthesis of both alkaloids in opium poppy. PMID:22535422

  17. Computational Investigation of the Interplay of Substrate Positioning and Reactivity in Catechol O-Methyltransferase.

    PubMed

    Patra, Niladri; Ioannidis, Efthymios I; Kulik, Heather J

    2016-01-01

    Catechol O-methyltransferase (COMT) is a SAM- and Mg2+-dependent methyltransferase that regulates neurotransmitters through methylation. Simulations and experiments have identified divergent catecholamine substrate orientations in the COMT active site: molecular dynamics simulations have favored a monodentate coordination of catecholate substrates to the active site Mg2+, and crystal structures instead preserve bidentate coordination along with short (2.65 Å) methyl donor-acceptor distances. We carry out longer dynamics (up to 350 ns) to quantify interconversion between bidentate and monodentate binding poses. We provide a systematic determination of the relative free energy of the monodentate and bidentate structures in order to identify whether structural differences alter the nature of the methyl transfer mechanism and source of enzymatic rate enhancement. We demonstrate that the bidentate and monodentate binding modes are close in energy but separated by a 7 kcal/mol free energy barrier. Analysis of interactions in the two binding modes reveals that the driving force for monodentate catecholate orientations in classical molecular dynamics simulations is derived from stronger electrostatic stabilization afforded by alternate Mg2+ coordination with strongly charged active site carboxylates. Mixed semi-empirical-classical (SQM/MM) substrate C-O distances (2.7 Å) for the bidentate case are in excellent agreement with COMT X-ray crystal structures, as long as charge transfer between the substrates, Mg2+, and surrounding ligands is permitted. SQM/MM free energy barriers for methyl transfer from bidentate and monodentate catecholate configurations are comparable at around 21-22 kcal/mol, in good agreement with experiment (18-19 kcal/mol). Overall, the work suggests that both binding poses are viable for methyl transfer, and accurate descriptions of charge transfer and electrostatics are needed to provide balanced relative barriers when multiple binding poses are

  18. Characterization of three O-methyltransferases involved in noscapine biosynthesis in opium poppy.

    PubMed

    Dang, Thu-Thuy T; Facchini, Peter J

    2012-06-01

    Noscapine is a benzylisoquinoline alkaloid produced in opium poppy (Papaver somniferum) and other members of the Papaveraceae. It has been used as a cough suppressant and more recently was shown to possess anticancer activity. However, the biosynthesis of noscapine in opium poppy has not been established. A proposed pathway leading from (S)-reticuline to noscapine includes (S)-scoulerine, (S)-canadine, and (S)-N-methylcanadine as intermediates. Stem cDNA libraries and latex extracts of eight opium poppy cultivars displaying different alkaloid profiles were subjected to massively parallel pyrosequencing and liquid chromatography-tandem mass spectrometry, respectively. Comparative transcript and metabolite profiling revealed the occurrence of three cDNAs encoding O-methyltransferases designated as SOMT1, SOMT2, and SOMT3 that correlated with the accumulation of noscapine in the eight cultivars. SOMT transcripts were detected in all opium poppy organs but were most abundant in aerial organs, where noscapine primarily accumulates. SOMT2 and SOMT3 showed strict substrate specificity and regiospecificity as 9-O-methyltransferases targeting (S)-scoulerine. In contrast, SOMT1 was able to sequentially 9- and 2-O-methylate (S)-scoulerine, yielding (S)-tetrahydropalmatine. SOMT1 also sequentially 3'- and 7-O-methylated both (S)-norreticuline and (S)-reticuline with relatively high substrate affinity, yielding (S)-tetrahydropapaverine and (S)-laudanosine, respectively. The metabolic functions of SOMT1, SOMT2, and SOMT3 were investigated in planta using virus-induced gene silencing. Reduction of SOMT1 or SOMT2 transcript levels resulted in a significant decrease in noscapine accumulation. Reduced SOMT1 transcript levels also caused a decrease in papaverine accumulation, confirming the selective roles for these enzymes in the biosynthesis of both alkaloids in opium poppy.

  19. Dynamic patterns of histone H3 lysine 4 methyltransferases and demethylases during mouse preimplantation development.

    PubMed

    Shao, Gen-Bao; Chen, Jun-Chao; Zhang, Liu-Ping; Huang, Pan; Lu, Hong-Yan; Jin, Jie; Gong, Ai-Hua; Sang, Jian-Rong

    2014-08-01

    Extensive and dynamic chromatin remodeling occurs after fertilization, including DNA methylation and histone modifications. These changes underlie the transition from gametic to embryonic chromatin and are thought to facilitate early embryonic development. Histone H3 lysine 4 methylation (H3K4me) is an important epigenetic mechanism that associates with gene-specific activation and functions in development. However, dynamic regulation of H3K4me during early embryonic development remains unclear. Herein, the authors examined the dynamic changes of H3K4me and its key regulators (Ash1l, Ash2l, Kmt2a, Kmt2b, Kmt2c, Setd1a, Setd7, Kdm1a, Kdm1b, Kdm5a, Kdm5b, Kdm5c, and Kdm5d) in mouse oocytes and preimplantation embryos. An increase in levels of H3K4me2 and me3 was observed at the one- to two-cell stages (P < 0.05), corresponding to the period of embryonic genome activation (EGA). Subsequently, the H3K4me2 level dramatically decreased at the four-cell stage and remained at low level until the blastocyst stage (P < 0.05), whereas the H3K4me3 level transiently decreased in the four-cell embryos but steadily increased to the peak in the blastocysts (P < 0.05). The high level of H3K4me2 during the EGA was coinciding with a peak expression of its methyltransferase, ASH2L, which may stabilize this methylation level during this period. Correspondingly, a concomitant decrease in levels of its demethylases, KDM5B and KDM1A, was observed. H3K4me3 was correlated to the expression of its methyltransferase (KMT2B) and demethylase (KDM5A). Thus, these enzymes may function for the EGA and the first lineage segregation in preimplantation mouse embryos. PMID:24619213

  20. Functional characterization of a plastidal cation-dependent O-methyltransferase from the liverwort Plagiochasma appendiculatum.

    PubMed

    Xu, Rui-Xue; Zhao, Yu; Gao, Shuai; Zhang, Yu-Ying; Li, Dan-Dan; Lou, Hong-Xiang; Cheng, Ai-Xia

    2015-10-01

    Caffeoyl CoA O-methyltransferases (CCoAOMTs), known to be involved in phenylpropanoid metabolism and lignin synthesis, have been characterized from several higher plant species, which also harbor CCoAOMT-like enzymes responsible for methylation of a variety of flavonoids, anthocyanins, coumarins and phenylpropanoids. Here, a gene encoding a CCoAOMT (PaOMT1) was isolated from a sequenced cDNA library of the liverwort species Plagiochasma appendiculatum, a species belonging to the Family Aytoniaceae. The full-length cDNA sequence of PaOMT1 contains 909 bp, and is predicted to encode a protein with 302 amino acids. The gene products were 40-50% identical to CCoAOMT sequences of other plants. Experiments based on recombinant PaOMT1 showed that the enzyme was able to methylate phenylpropanoids, flavonoids and coumarins, with a preference for the flavonoid quercetin (19). Although the substrate selectivity and biochemical feature of PaOMT1 is similar to CCoAOMT-like enzymes, the sequence alignment results indicated PaOMT1 is closer to true CCoAOMT enzymes. A phylogenetic analysis indicated that PaOMT1 is intermediate between true CCoAOMTs and CCoAOMT-like enzymes. The transient expression of a PaOMT1-GFP fusion in tobacco demonstrated that PaOMT1 is directed to the plastids. PaOMT1 may represent an ancestral form of higher plant true CCoAOMT and CCoAOMT-like enzymes. This is the first time an O-methyltransferase was characterized in liverworts. PMID:26277769

  1. The PRMT5 arginine methyltransferase: many roles in development, cancer and beyond

    PubMed Central

    Stopa, Nicole

    2015-01-01

    Post-translational arginine methylation is responsible for regulation of many biological processes. The protein arginine methyltransferase 5 (PRMT5, also known as Hsl7, Jbp1, Skb1, Capsuleen, or Dart5) is the major enzyme responsible for mono- and symmetric dimethylation of arginine. An expanding literature demonstrates its critical biological function in a wide range of cellular processes. Histone and other protein methylation by PRMT5 regulate genome organization, transcription, stem cells, primordial germ cells, differentiation, the cell cycle, and spliceosome assembly. Metazoan PRMT5 is found in complex with the WD-repeat protein MEP50 (also known as Wdr77, androgen receptor coactivator p44, or Valois). PRMT5 also directly associates with a range of other protein factors, including pICln, Menin, CoPR5 and RioK1 that may alter its subcellular localization and protein substrate selection. Protein substrate and PRMT5–MEP50 post-translation modifications induce crosstalk to regulate PRMT5 activity. Crystal structures of C. elegans PRMT5 and human and frog PRMT5–MEP50 complexes provide substantial insight into the mechanisms of substrate recognition and procession to dimethylation. Enzymo-logical studies of PRMT5 have uncovered compelling insights essential for future development of specific PRMT5 inhibitors. In addition, newly accumulating evidence implicates PRMT5 and MEP50 expression levels and their methyltransferase activity in cancer tumorigenesis, and, significantly, as markers of poor clinical outcome, marking them as potential oncogenes. Here, we review the substantial new literature on PRMT5 and its partners to highlight the significance of understanding this essential enzyme in health and disease. PMID:25662273

  2. Expression of a functional jasmonic acid carboxyl methyltransferase is negatively correlated with strawberry fruit development.

    PubMed

    Preuß, Anja; Augustin, Christiane; Figueroa, Carlos R; Hoffmann, Thomas; Valpuesta, Victoriano; Sevilla, José F; Schwab, Wilfried

    2014-09-15

    The volatile metabolite methyl jasmonate (MeJA) plays an important role in intra- and interplant communication and is involved in diverse biological processes. In this study, we report the cloning and functional characterization of a S-adenosyl-l-methionine:jasmonic acid carboxyl methyltransferase (JMT) from Fragaria vesca and Fragaria×ananassa. Biochemical assays and comprehensive transcript analyses showed that JMT has been erroneously annotated as gene fusion with a carboxyl methyltransferase (CMT) (gene15184) in the first published genome sequence of F. vesca. Recombinant FvJMT catalyzed the formation of MeJA with KM value of 22.3μM while FvCMT and the fusion protein were almost inactive. Activity of JMT with benzoic acid and salicylic acid as substrates was less than 1.5% of that with JA. Leucine at position 245, an amino acid missing in other JMT sequences is essential for activity of FvJMT. In accordance with MeJA levels, JMT transcript levels decreased steadily during strawberry fruit ripening, as did the expression levels of JA biosynthesis and regulatory genes. It appears that CMT has originated by a recent duplication of JMT and lost its enzymatic activity toward JA. In the newest version of the strawberry genome sequence (June 2014) CMT and JMT are annotated as separate genes in accordance with differential temporal and spatial expression patterns of both genes in Fragaria sp. In conclusion, MeJA, the inactive derivative of JA, is probably involved in early steps of fruit development by modulating the levels of the active plant hormone JA. PMID:25046752

  3. Functional characterization of a plastidal cation-dependent O-methyltransferase from the liverwort Plagiochasma appendiculatum.

    PubMed

    Xu, Rui-Xue; Zhao, Yu; Gao, Shuai; Zhang, Yu-Ying; Li, Dan-Dan; Lou, Hong-Xiang; Cheng, Ai-Xia

    2015-10-01

    Caffeoyl CoA O-methyltransferases (CCoAOMTs), known to be involved in phenylpropanoid metabolism and lignin synthesis, have been characterized from several higher plant species, which also harbor CCoAOMT-like enzymes responsible for methylation of a variety of flavonoids, anthocyanins, coumarins and phenylpropanoids. Here, a gene encoding a CCoAOMT (PaOMT1) was isolated from a sequenced cDNA library of the liverwort species Plagiochasma appendiculatum, a species belonging to the Family Aytoniaceae. The full-length cDNA sequence of PaOMT1 contains 909 bp, and is predicted to encode a protein with 302 amino acids. The gene products were 40-50% identical to CCoAOMT sequences of other plants. Experiments based on recombinant PaOMT1 showed that the enzyme was able to methylate phenylpropanoids, flavonoids and coumarins, with a preference for the flavonoid quercetin (19). Although the substrate selectivity and biochemical feature of PaOMT1 is similar to CCoAOMT-like enzymes, the sequence alignment results indicated PaOMT1 is closer to true CCoAOMT enzymes. A phylogenetic analysis indicated that PaOMT1 is intermediate between true CCoAOMTs and CCoAOMT-like enzymes. The transient expression of a PaOMT1-GFP fusion in tobacco demonstrated that PaOMT1 is directed to the plastids. PaOMT1 may represent an ancestral form of higher plant true CCoAOMT and CCoAOMT-like enzymes. This is the first time an O-methyltransferase was characterized in liverworts.

  4. Characterizing DNA methyltransferases with an ultrasensitive luciferase-linked continuous assay.

    PubMed

    Hemeon, Ivan; Gutierrez, Jemy A; Ho, Meng-Chiao; Schramm, Vern L

    2011-06-15

    DNA (cytosine-5)-methyltransferases (DNMTs) catalyze the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to the 5-position of cytosine residues and thereby silence transcription of regulated genes. DNMTs are important epigenetic targets. However, isolated DNMTs are weak catalysts and are difficult to assay. We report an ultrasensitive luciferase-linked continuous assay that converts the S-adenosyl-L-homocysteine product of DNA methylation to a quantifiable luminescent signal. Results with this assay are compared with the commonly used DNA labeling from [methyl-(3)H]AdoMet. A 5'-methylthioadenosine-adenosylhomocysteine nucleosidase is used to hydrolyze AdoHcy to adenine. Adenine phosphoribosyl transferase converts adenine to AMP and pyruvate orthophosphate dikinase converts AMP to ATP. Firefly luciferase gives a stable luminescent signal that results from continuous AMP recycling to ATP. This assay exhibits a broad dynamic range (0.1-1000 pmol of AdoHcy). The rapid response time permits continuous assays of DNA methylation detected by light output. The assay is suitable for high-throughput screening of chemical libraries for DNMT inhibition activity. The kinetic properties of human and bacterial CpG methyltransferases are characterized using this assay. Human catalytic domain DNMT3b activation by DNMT3L is shown to involve two distinct kinetic states that alter k(cat) but not K(m) for AdoMet. The assay is shown to be robust in the presence of high concentrations of the pyrimidine analogues 5-azacytidine and 5-azacytosine.

  5. Molecular and biochemical characterization of the jasmonic acid methyltransferase gene from black cottonwood (Populus trichocarpa)

    SciTech Connect

    Zhao, Nan; Yao, Jianzhuang; Chaiprasongsuk, Minta; Li, Guanglin; Guan, Ju; Tschaplinski, Timothy J; Guo, Hong; Chen, Feng

    2013-01-01

    Methyl jasmonate is a metabolite known to be produced by many plants and has roles in diverse biological processes. It is biosynthesized by the action of S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase (JMT), which belongs to the SABATH family of methyltransferases. Herein is reported the isolation and biochemical characterization of a JMT gene from black cottonwood (Populus trichocarpa). The genome of P. trichocarpa contains 28 SABATH genes (PtSABATH1 to PtSABATH28). Recombinant PtSABATH3 expressed in Escherichia coli showed the highest level of activity with jasmonic acid (JA) among carboxylic acids tested. It was therefore renamed PtJMT1. PtJMT1 also displayed activity with benzoic acid (BA), with which the activity was about 22% of that with JA. PtSABATH2 and PtSABATH4 were most similar to PtJMT1 among all PtSABATHs. However, neither of them had activity with JA. The apparent Km values of PtJMT1 using JA and BA as substrate were 175 lM and 341 lM, respectively. Mutation of Ser-153 and Asn-361, two residues in the active site of PtJMT1, to Tyr and Ser respectively, led to higher specific activity with BA than with JA. Homology-based structural modeling indicated that substrate alignment, in which Asn-361 is involved, plays a role in determining the substrate specificity of PtJMT1. In the leaves of young seedlings of black cottonwood, the expression of PtJMT1 was induced by plant defense signal molecules methyl jasmonate and salicylic acid and a fungal elicitor alamethicin, suggesting that PtJMT1 may have a role in plant defense against biotic stresses. Phylogenetic analysis suggests that PtJMT1 shares a common ancestor with the Arabidopsis JMT, and functional divergence of these two apparent JMT orthologs has occurred since the split of poplar and Arabidopsis lineages.

  6. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode.

    PubMed

    Lin, Jingyu; Mazarei, Mitra; Zhao, Nan; Zhu, Junwei J; Zhuang, Xiaofeng; Liu, Wusheng; Pantalone, Vincent R; Arelli, Prakash R; Stewart, Charles N; Chen, Feng

    2013-12-01

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in soybean defence against soybean cyst nematode (Heterodera glycines Ichinohe, SCN). GmSAMT1 was identified as a candidate SCN defence-related gene in our previous analysis of soybean defence against SCN using GeneChip microarray experiments. The current study started with the isolation of the full-length cDNAs of GmSAMT1 from a SCN-resistant soybean line and from a SCN-susceptible soybean line. The two cDNAs encode proteins of identical sequences. The GmSAMT1 cDNA was expressed in Escherichia coli. Using in vitro enzyme assays, E. coli-expressed GmSAMT1 was confirmed to function as salicylic acid methyltransferase. The apparent Km value of GmSAMT1 for salicylic acid was approximately 46 μM. To determine the role of GmSAMT1 in soybean defence against SCN, transgenic hairy roots overexpressing GmSAMT1 were produced and tested for SCN resistance. Overexpression of GmSAMT1 in SCN-susceptible backgrounds significantly reduced the development of SCN, indicating that overexpression of GmSAMT1 in the transgenic hairy root system could confer resistance to SCN. Overexpression of GmSAMT1 in transgenic hairy roots was also found to affect the expression of selected genes involved in salicylic acid biosynthesis and salicylic acid signal transduction.

  7. Arabidopsis Protein Repair L-Isoaspartyl Methyltransferases: Predominant Activities at Lethal Temperatures.

    PubMed

    Villa, Sarah T; Xu, Qilong; Downie, A Bruce; Clarke, Steven G

    2006-12-01

    Protein L-isoaspartyl (D-aspartyl) O-methyltransferases (EC 2.1.1.77; PIMT or PCMT) are enzymes that initiate the full or partial repair of damaged L-aspartyl and L-asparaginyl residues, respectively. These enzymes are found in most organisms and maintain a high degree of sequence conservation. Arabidopsis thaliana (Arabidopsis L. Heynh.) is unique among eukaryotes in that it contains two genes, rather than one, that encode PIMT isozymes. We describe a novel Arabidopsis PIMT isozyme, designated AtPIMT2αω, encoded by the PIMT2 gene (At5g50240). We characterized the enzymatic activity of the recombinant AtPIMT2αω in comparison to the other AtPIMT2 isozymes, AtPIMT1, and to the human PCMT ortholog, to better understand its role in Arabidopsis. All Arabidopsis PIMT isozymes are active over a relatively wide pH range. For AtPIMT2αω maximal activity is observed at 50 °C (a lethal temperature for Arabidopsis); this activity is almost ten times greater than the activity at the growth temperature of 25 °C. Interestingly, enzyme activity decreases after pre-incubation at temperatures above 30°C. A similar situation is found for the recombinant AtPIMT2ψ and the AtPIMT2ω isozymes, as well as for the AtPIMT1 and human PCMT1 enzymes. These results suggest that the short-term ability of these methyltransferases to initiate repair under extreme temperature conditions may be a common feature of both the plant and animal species.

  8. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R

    1991-01-01

    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  9. Evidence for autophagy-dependent pathways of rRNA turnover in Arabidopsis.

    PubMed

    Floyd, Brice E; Morriss, Stephanie C; MacIntosh, Gustavo C; Bassham, Diane C

    2015-01-01

    Ribosomes account for a majority of the cell's RNA and much of its protein and represent a significant investment of cellular resources. The turnover and degradation of ribosomes has been proposed to play a role in homeostasis and during stress conditions. Mechanisms for the turnover of rRNA and ribosomal proteins have not been fully elucidated. We show here that the RNS2 ribonuclease and autophagy participate in RNA turnover in Arabidopsis thaliana under normal growth conditions. An increase in autophagosome formation was seen in an rns2-2 mutant, and this increase was dependent on the core autophagy genes ATG9 and ATG5. Autophagosomes and autophagic bodies in rns2-2 mutants contain RNA and ribosomes, suggesting that autophagy is activated as an attempt to compensate for loss of rRNA degradation. Total RNA accumulates in rns2-2, atg9-4, atg5-1, rns2-2 atg9-4, and rns2-2 atg5-1 mutants, suggesting a parallel role for autophagy and RNS2 in RNA turnover. rRNA accumulates in the vacuole in rns2-2 mutants. Vacuolar accumulation of rRNA was blocked by disrupting autophagy via an rns2-2 atg5-1 double mutant but not by an rns2-2 atg9-4 double mutant, indicating that ATG5 and ATG9 function differently in this process. Our results suggest that autophagy and RNS2 are both involved in homeostatic degradation of rRNA in the vacuole.

  10. Label-free molecular beacon-based quadratic isothermal exponential amplification: a simple and sensitive one-pot method to detect DNA methyltransferase activity.

    PubMed

    Xue, Qingwang; Wang, Lei; Jiang, Wei

    2015-09-11

    We developed a one-pot label-free molecular beacon-mediated quadratic isothermal exponential amplification strategy (LFMB-QIEA) for simple, rapid and sensitive DNA methyltransferase (MTase) activity detection.

  11. Discovery and characterization of new O-methyltransferase from the genome of the lignin-degrading fungus Phanerochaete chrysosporium for enhanced lignin degradation.

    PubMed

    Thanh Mai Pham, Le; Kim, Yong Hwan

    2016-01-01

    Using bioinformatic homology search tools, this study utilized sequence phylogeny, gene organization and conserved motifs to identify members of the family of O-methyltransferases from lignin-degrading fungus Phanerochaete chrysosporium. The heterologous expression and characterization of O-methyltransferases from P. chrysosporium were studied. The expressed protein utilized S-(5'-adenosyl)-L-methionine p-toluenesulfonate salt (SAM) and methylated various free-hydroxyl phenolic compounds at both meta and para site. In the same motif, O-methyltransferases were also identified in other white-rot fungi including Bjerkandera adusta, Ceriporiopsis (Gelatoporia) subvermispora B, and Trametes versicolor. As free-hydroxyl phenolic compounds have been known as inhibitors for lignin peroxidase, the presence of O-methyltransferases in white-rot fungi suggested their biological functions in accelerating lignin degradation in white-rot basidiomycetes by converting those inhibitory groups into non-toxic methylated phenolic ones. PMID:26672450

  12. Expression of DNA methyltransferases is influenced by growth hormone in the long-living Ames dwarf mouse in vivo and in vitro.

    PubMed

    Armstrong, Vanessa L; Rakoczy, Sharlene; Rojanathammanee, Lalida; Brown-Borg, Holly M

    2014-08-01

    Methyltransferase expression and DNA methylation are linked to aging and age-related disease. We utilized 3-, 12-, and 24-month-old Ames dwarf and their wild-type siblings to examine the genotype and age-related differences in the expression of methyltransferase enzymes related to DNA methylation in the liver, glycine-N-methyltransferase and DNA methyltransferase (DNMT). We found that DNMT proteins and transcripts are differentially expressed in dwarf mice compared with wild-type siblings that can be attributed to age and/or genotype. However, DNMT1 protein expression is drastically reduced compared with wild-type controls at every age. DNMT3a protein levels coincide with differences observed in DNMT activity. Growth hormone appears to modulate expression of DNMT1 and 3a in dwarf liver tissue and primary hepatocytes. Therefore, growth hormone may contribute to age-related processes, DNA methylation, and, ultimately, longevity.

  13. Expression of DNA methyltransferases is influenced by growth hormone in the long-living Ames dwarf mouse in vivo and in vitro.

    PubMed

    Armstrong, Vanessa L; Rakoczy, Sharlene; Rojanathammanee, Lalida; Brown-Borg, Holly M

    2014-08-01

    Methyltransferase expression and DNA methylation are linked to aging and age-related disease. We utilized 3-, 12-, and 24-month-old Ames dwarf and their wild-type siblings to examine the genotype and age-related differences in the expression of methyltransferase enzymes related to DNA methylation in the liver, glycine-N-methyltransferase and DNA methyltransferase (DNMT). We found that DNMT proteins and transcripts are differentially expressed in dwarf mice compared with wild-type siblings that can be attributed to age and/or genotype. However, DNMT1 protein expression is drastically reduced compared with wild-type controls at every age. DNMT3a protein levels coincide with differences observed in DNMT activity. Growth hormone appears to modulate expression of DNMT1 and 3a in dwarf liver tissue and primary hepatocytes. Therefore, growth hormone may contribute to age-related processes, DNA methylation, and, ultimately, longevity. PMID:24201695

  14. Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    PubMed Central

    Pontvianne, Frédéric; Abou-Ellail, Mohamed; Douet, Julien; Comella, Pascale; Matia, Isabel; Chandrasekhara, Chinmayi; DeBures, Anne; Blevins, Todd; Cooke, Richard; Medina, Francisco J.; Tourmente, Sylvette; Pikaard, Craig S.; Sáez-Vásquez, Julio

    2010-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1). Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre–rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis. PMID:21124873

  15. Structure and mechanism of a nonhaem-iron SAM-dependent C-methyltransferase and its engineering to a hydratase and an O-methyltransferase.

    PubMed

    Zou, Xiao-Wei; Liu, Yu-Chen; Hsu, Ning-Shian; Huang, Chuen-Jiuan; Lyu, Syue-Yi; Chan, Hsiu-Chien; Chang, Chin-Yuan; Yeh, Hsien-Wei; Lin, Kuan-Hung; Wu, Chang-Jer; Tsai, Ming-Daw; Li, Tsung-Lin

    2014-06-01

    In biological systems, methylation is most commonly performed by methyltransferases (MTs) using the electrophilic methyl source S-adenosyl-L-methionine (SAM) via the S(N)2 mechanism. (2S,3S)-β-Methylphenylalanine, a nonproteinogenic amino acid, is a building unit of the glycopeptide antibiotic mannopeptimycin. The gene product of mppJ from the mannopeptimycin-biosynthetic gene cluster is the MT that methylates the benzylic C atom of phenylpyruvate (Ppy) to give βMePpy. Although the benzylic C atom of Ppy is acidic, how its nucleophilicity is further enhanced to become an acceptor for C-methylation has not conclusively been determined. Here, a structural approach is used to address the mechanism of MppJ and to engineer it for new functions. The purified MppJ displays a turquoise colour, implying the presence of a metal ion. The crystal structures reveal MppJ to be the first ferric ion SAM-dependent MT. An additional four structures of binary and ternary complexes illustrate the molecular mechanism for the metal ion-dependent methyltransfer reaction. Overall, MppJ has a nonhaem iron centre that bind, orients and activates the α-ketoacid substrate and has developed a sandwiched bi-water device to avoid the formation of the unwanted reactive oxo-iron(IV) species during the C-methylation reaction. This discovery further prompted the conversion of the MT into a structurally/functionally unrelated new enzyme. Through stepwise mutagenesis and manipulation of coordination chemistry, MppJ was engineered to perform both Lewis acid-assisted hydration and/or O-methyltransfer reactions to give stereospecific new compounds. This process was validated by six crystal structures. The results reported in this study will facilitate the development and design of new biocatalysts for difficult-to-synthesize biochemicals. PMID:24914966

  16. Structure and mechanism of a nonhaem-iron SAM-dependent C-methyltransferase and its engineering to a hydratase and an O-methyltransferase.

    PubMed

    Zou, Xiao-Wei; Liu, Yu-Chen; Hsu, Ning-Shian; Huang, Chuen-Jiuan; Lyu, Syue-Yi; Chan, Hsiu-Chien; Chang, Chin-Yuan; Yeh, Hsien-Wei; Lin, Kuan-Hung; Wu, Chang-Jer; Tsai, Ming-Daw; Li, Tsung-Lin

    2014-06-01

    In biological systems, methylation is most commonly performed by methyltransferases (MTs) using the electrophilic methyl source S-adenosyl-L-methionine (SAM) via the S(N)2 mechanism. (2S,3S)-β-Methylphenylalanine, a nonproteinogenic amino acid, is a building unit of the glycopeptide antibiotic mannopeptimycin. The gene product of mppJ from the mannopeptimycin-biosynthetic gene cluster is the MT that methylates the benzylic C atom of phenylpyruvate (Ppy) to give βMePpy. Although the benzylic C atom of Ppy is acidic, how its nucleophilicity is further enhanced to become an acceptor for C-methylation has not conclusively been determined. Here, a structural approach is used to address the mechanism of MppJ and to engineer it for new functions. The purified MppJ displays a turquoise colour, implying the presence of a metal ion. The crystal structures reveal MppJ to be the first ferric ion SAM-dependent MT. An additional four structures of binary and ternary complexes illustrate the molecular mechanism for the metal ion-dependent methyltransfer reaction. Overall, MppJ has a nonhaem iron centre that bind, orients and activates the α-ketoacid substrate and has developed a sandwiched bi-water device to avoid the formation of the unwanted reactive oxo-iron(IV) species during the C-methylation reaction. This discovery further prompted the conversion of the MT into a structurally/functionally unrelated new enzyme. Through stepwise mutagenesis and manipulation of coordination chemistry, MppJ was engineered to perform both Lewis acid-assisted hydration and/or O-methyltransfer reactions to give stereospecific new compounds. This process was validated by six crystal structures. The results reported in this study will facilitate the development and design of new biocatalysts for difficult-to-synthesize biochemicals.

  17. RamA, a Protein Required for Reductive Activation of Corrinoid-dependent Methylamine Methyltransferase Reactions in Methanogenic Archaea*S⃞

    PubMed Central

    Ferguson, Tsuneo; Soares, Jitesh A.; Lienard, Tanja; Gottschalk, Gerhard; Krzycki, Joseph A.

    2009-01-01

    Archaeal methane formation from methylamines is initiated by distinct methyltransferases with specificity for monomethylamine, dimethylamine, or trimethylamine. Each methylamine methyltransferase methylates a cognate corrinoid protein, which is subsequently demethylated by a second methyltransferase to form methyl-coenzyme M, the direct methane precursor. Methylation of the corrinoid protein requires reduction of the central cobalt to the highly reducing and nucleophilic Co(I) state. RamA, a 60-kDa monomeric iron-sulfur protein, was isolated from Methanosarcina barkeri and is required for in vitro ATP-dependent reductive activation of methylamine:CoM methyl transfer from all three methylamines. In the absence of the methyltransferases, highly purified RamA was shown to mediate the ATP-dependent reductive activation of Co(II) corrinoid to the Co(I) state for the monomethylamine corrinoid protein, MtmC. The ramA gene is located near a cluster of genes required for monomethylamine methyltransferase activity, including MtbA, the methylamine-specific CoM methylase and the pyl operon required for co-translational insertion of pyrrolysine into the active site of methylamine methyltransferases. RamA possesses a C-terminal ferredoxin-like domain capable of binding two tetranuclear iron-sulfur proteins. Mutliple ramA homologs were identified in genomes of methanogenic Archaea, often encoded near methyltrophic methyltransferase genes. RamA homologs are also encoded in a diverse selection of bacterial genomes, often located near genes for corrinoid-dependent methyltransferases. These results suggest that RamA mediates reductive activation of corrinoid proteins and that it is the first functional archetype of COG3894, a family of redox proteins of unknown function. PMID:19043046

  18. Active community profiling via capillary electrophoresis single-strand conformation polymorphism analysis of amplified 16S rRNA and 16S rRNA genes.

    PubMed

    Hiibel, Sage R; Pruden, Amy; Crimi, Barbara; Reardon, Kenneth F

    2010-12-01

    Here, we report the validation and advancement of a high-throughput method for fingerprinting the active members of a microbial community. This method, termed active community profiling (ACP), provides information about both the composition and the activity of mixed microbial cultures via comparative measurements of amplified 16S rRNA (RNA) and 16S rRNA genes (DNA). Capillary electrophoresis is used to resolve single-strand conformation polymorphisms of polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products, producing electropherograms representative of the community structure. Active members of the community are distinguished by elevated RNA:DNA peak area ratios. Chemostat experiments with defined populations were conducted to validate the ACP approach. Using a pure culture of Escherichia coli, a direct correlation was found between the growth rate and the RNA:DNA peak ratio. In a second validation experiment, a binary culture of E. coli and Pseudomonas putida was subjected to a controlled environmental change consisting of a shift to anaerobic conditions. ACP revealed the expected cessation of growth of P. putida, an obligate aerobe, while the corresponding DNA-only analysis indicated no change in the culture. Finally, ACP was applied to a complex microbial community, and a novel binning approach was demonstrated for integrating the RNA and DNA electropherograms. ACP thus represents a significant advance from traditional DNA-based profiling techniques, which do not distinguish active from inactive or dead cells, and is well suited for high-throughput community analysis.

  19. A SAM-dependent methyltransferase cotranscribed with arsenate reductase alters resistance to peptidyl transferase center-binding antibiotics in Azospirillum brasilense Sp7.

    PubMed

    Singh, Sudhir; Singh, Chhaya; Tripathi, Anil Kumar

    2014-05-01

    The genome of Azospirillum brasilense harbors a gene encoding S-adenosylmethionine-dependent methyltransferase, which is located downstream of an arsenate reductase gene. Both genes are cotranscribed and translationally coupled. When they were cloned and expressed individually in an arsenate-sensitive strain of Escherichia coli, arsenate reductase conferred tolerance to arsenate; however, methyltransferase failed to do so. Sequence analysis revealed that methyltransferase was more closely related to a PrmB-type N5-glutamine methyltransferase than to the arsenate detoxifying methyltransferase ArsM. Insertional inactivation of prmB gene in A. brasilense resulted in an increased sensitivity to chloramphenicol and resistance to tiamulin and clindamycin, which are known to bind at the peptidyl transferase center (PTC) in the ribosome. These observations suggested that the inability of prmB:km mutant to methylate L3 protein might alter hydrophobicity in the antibiotic-binding pocket of the PTC, which might affect the binding of chloramphenicol, clindamycin, and tiamulin differentially. This is the first report showing the role of PrmB-type N5-glutamine methyltransferases in conferring resistance to tiamulin and clindamycin in any bacterium.

  20. Probing the S-adenosylmethionine-binding site of rat guanidinoacetate methyltransferase. Effect of site-directed mutagenesis of residues that are conserved across mammalian non-nucleic acid methyltransferases.

    PubMed Central

    Hamahata, A; Takata, Y; Gomi, T; Fujioka, M

    1996-01-01

    Most mammalian non-nucleic acid methyltransferases share three sequence motifs. To gain insight into the S-adenosyl-methionine (AdoMet)-binding site of guanidinoacetate methyltransferase, we mutated several conserved residues that are found in or near motifs I and II. Conversion of either of two glycine residues of motif I (Gly67 and Gly69) to an alanine resulted in an inactive enzyme. These enzymes, although having UV absorption, fluorescence and far-UV CD spectra virtually identical with those of the wild-type enzyme, seem to be conformationally different from the wild-type enzyme as judged by near-UV CD spectra and the extent of urea denaturation, and are apparently not capable of binding AdoMet. Mutation of Tyr136 of motif II to a valine resulted in a decrease in Kcat/Km values for substrates. Changing this residue to a phenylalanine caused only a minor change in Kcat/Km for AdoMet. This suggests that the aromatic side chain stabilizes the binding of AdoMet. Mutagenic changes of Glu89, which is the residue corresponding to the conserved acidic residue on the C-terminal side of motif I, indicated its contribution to AdoMet binding. These results are consistent with the idea that both motifs I and II are crucial in forming the AdoMet binding site of guanidinoacetate methyltransferase. PMID:8694756

  1. (Accumulation of methyl-deficient rat liver messenger ribonucleic acid on ethionine administration). Progress report. [Methyltransferase activity in Ehrlich ascites tumor cells and effects of phorbol ester on methyltransferase activity

    SciTech Connect

    Borek, E.

    1980-01-01

    Enzyme fractions were isolated from Ehrlich ascites cells which introduced methyl groups into methyl deficient rat liver mRNA and unmethylated vaccinia mRNA. The methyl groups were incorporated at the 5' end into cap 1 structures by the viral enzyme, whereas both cap 0 and cap 1 structures were formed by the Ehrlich ascites cell enzymes. Preliminary results indicate the presence of adenine N/sup 6/-methyltransferase activity in Ehrlich ascites cells. These results indicate that mRNA deficient in 5'-cap methylation and in internal methylation of adenine accumulated in rats on exposure to ethionine. The methyl-deficient mRNA isolated from the liver of ethionine-fed rats differed in its translational properties from mRNA isolated from control animals. Preliminary experiments indicate that single topical application of 17n moles of TPA to mouse skin altered tRNA methyltransferases. The extent of methylation was increased over 2-fold in mouse skin treated with TPA for 48 hours. These changes have been observed as early as 12 hours following TPA treatment. In contrast, the application of initiating dose of DMBA had no effect on these enzymes. It should be emphasized that the changes in tRNA methyltransferases produced by TPA are not merely an increase of the concentration of the enzyme, rather that they represent alterations of specificity of a battery of enzymes. In turn the change in enzyme specificity can produce alterations in the structure of tRNA. (ERB)

  2. Crystallization and preliminary crystallographic analysis of tRNA (m(7)G46) methyltransferase from Escherichia coli.

    PubMed

    Liu, Qi; Gao, Yang; Yang, Weili; Zhou, Huihao; Gao, Yongxiang; Zhang, Xiao; Teng, Maikun; Niu, Liwen

    2008-08-01

    Transfer RNA (tRNA) (m(7)G46) methyltransferase (TrmB) belongs to the Rossmann-fold methyltransferase (RFM) family and uses S-adenosyl-L-methionine (SAM) as the methyl-group donor to catalyze the formation of N(7)-methylguanosine (m(7)G) at position 46 in the variable loop of tRNAs. After attempts to crystallize full-length Escherichia coli TrmB (EcTrmB) failed, a truncated protein lacking the first 32 residues of the N-terminus but with an additional His(6) tag at the C-terminus was crystallized by the hanging-drop vapour-diffusion method using polyethylene glycol 3350 (PEG 3350) as precipitant at 283 K. An X-ray diffraction data set was collected using a single flash-cooled crystal that belonged to space group P2(1).

  3. Crystallization and preliminary crystallographic analysis of tRNA (m7G46) methyltransferase from Escherichia coli

    PubMed Central

    Liu, Qi; Gao, Yang; Yang, Weili; Zhou, Huihao; Gao, Yongxiang; Zhang, Xiao; Teng, Maikun; Niu, Liwen

    2008-01-01

    Transfer RNA (tRNA) (m7G46) methyltransferase (TrmB) belongs to the Rossmann-fold methyltransferase (RFM) family and uses S-adenosyl-l-methionine (SAM) as the methyl-group donor to catalyze the formation of N 7-­methylguanosine (m7G) at position 46 in the variable loop of tRNAs. After attempts to crystallize full-length Escherichia coli TrmB (EcTrmB) failed, a truncated protein lacking the first 32 residues of the N-terminus but with an additional His6 tag at the C-terminus was crystallized by the hanging-drop vapour-diffusion method using polyethylene glycol 3350 (PEG 3350) as precipitant at 283 K. An X-ray diffraction data set was collected using a single flash-cooled crystal that belonged to space group P21. PMID:18678947

  4. Loop dynamics of thymidine diphosphate-rhamnose 3'-O-methyltransferase (CalS11), an enzyme in calicheamicin biosynthesis.

    PubMed

    Han, Lu; Singh, Shanteri; Thorson, Jon S; Phillips, George N

    2016-01-01

    Structure analysis and ensemble refinement of the apo-structure of thymidine diphosphate (TDP)-rhamnose 3'-O-methyltransferase reveal a gate for substrate entry and product release. TDP-rhamnose 3'-O-methyltransferase (CalS11) catalyses a 3'-O-methylation of TDP-rhamnose, an intermediate in the biosynthesis of enediyne antitumor antibiotic calicheamicin. CalS11 operates at the sugar nucleotide stage prior to glycosylation step. Here, we present the crystal structure of the apo form of CalS11 at 1.89 Å resolution. We propose that the L2 loop functions as a gate facilitating and/or providing specificity for substrate entry or promoting product release. Ensemble refinement analysis slightly improves the crystallographic refinement statistics and furthermore provides a compelling way to visualize the dynamic model of loop L2, supporting the understanding of its proposed role in catalysis. PMID:26958582

  5. A female adnexal tumor of probable Wolffian origin showing positive O-6-methylguanine-DNA methyltransferase methylation.

    PubMed

    Kwon, Min Jung; Yun, Min Jeong; Kim, Min Kyu

    2016-07-01

    Female adnexal tumor of probable Wolffian origin (FATWO) is a rare disease entity that arises from the mesonephric duct system. FATWO is different than other gynecological cancers in terms of embryology. Here, we describe the case of a 52-year-old woman with malignant FATWO. The patient underwent explorative laparotomy and surgical staging after a frozen section revealed malignancy. Detailed examination of the pathologic findings were consistent with FATWO. Counseling and further testing were provided to the patient to assess the risk of germline mutation and epigenetic change. An O-6-methylguanine-DNA methyltransferase gene methylation test was positive, and all other tests were normal. This is the first study to report a case of O-6-methylguanine-DNA methyltransferase methylation with FATWO in Korea. PMID:27462603

  6. The ankyrin repeats of G9a and GLP histone methyltransferases are mono- and dimethyllysine binding modules

    SciTech Connect

    Collins, Robert E.; Northrop, Jeffrey P.; Horton, John R.; Lee, David Y.; Zhang, Xing; Stallcup, Michael R.; Cheng, Xiaodong

    2008-03-19

    Histone modifications have important roles in transcriptional control, mitosis and heterochromatin formation. G9a and G9a-like protein (GLP) are euchromatin-associated methyltransferases that repress transcription by mono- and dimethylating histone H3 at Lys9 (H3K9). Here we demonstrate that the ankyrin repeat domains of G9a and GLP bind with strong preference to N-terminal H3 peptides containing mono- or dimethyl K9. X-ray crystallography revealed the basis for recognition of the methylated lysine by a partial hydrophobic cage with three tryptophans and one acidic residue. Substitution of key residues in the cage eliminated the H3 tail interaction. Hence, G9a and GLP contain a new type of methyllysine binding module (the ankyrin repeat domains) and are the first examples of protein (histone) methyltransferases harboring in a single polypeptide the activities that generate and read the same epigenetic mark.

  7. Identification of Small-Molecule Enhancers of Arginine Methylation Catalyzed by Coactivator-Associated Arginine Methyltransferase 1

    PubMed Central

    Castellano, Sabrina; Spannhoff, Astrid; Milite, Ciro; Dal Piaz, Fabrizio; Cheng, Donghang; Tosco, Alessandra; Viviano, Monica; Yamani, Abdellah; Cianciulli, Agostino; Sala, Marina; Cura, Vincent; Cavarelli, Jean; Novellino, Ettore; Mai, Antonello; Bedford, Mark T.; Sbardella, Gianluca

    2012-01-01

    Arginine methylation is a common post-translational modification that is crucial in modulating gene expression at multiple critical levels. The arginine methyltransferases (PRMTs) are envisaged as promising druggable targets but their role in physiological and pathological pathways is far from being clear, due to the limited number of modulators reported to date. In this effort, enzyme activators can be invaluable tools useful as gain-of-function reagents to interrogate the biological roles in cells and in vivo of PRMTs. Yet the identification of such molecules is rarely pursued. Herein we describe a series of aryl ureido acetamido indole carboxylates (dubbed “uracandolates”), able to increase the methylation of histone- (H3) or non-histone (polyadenylate-binding protein 1, PABP1) substrates induced by coactivator-associated arginine methyltransferase 1 (CARM1), both in in vitro and cellular settings. To the best of our knowledge, this is the first report of compounds acting as CARM1 activators. PMID:23095008

  8. A female adnexal tumor of probable Wolffian origin showing positive O-6-methylguanine-DNA methyltransferase methylation

    PubMed Central

    Kwon, Min Jung; Yun, Min Jeong

    2016-01-01

    Female adnexal tumor of probable Wolffian origin (FATWO) is a rare disease entity that arises from the mesonephric duct system. FATWO is different than other gynecological cancers in terms of embryology. Here, we describe the case of a 52-year-old woman with malignant FATWO. The patient underwent explorative laparotomy and surgical staging after a frozen section revealed malignancy. Detailed examination of the pathologic findings were consistent with FATWO. Counseling and further testing were provided to the patient to assess the risk of germline mutation and epigenetic change. An O-6-methylguanine-DNA methyltransferase gene methylation test was positive, and all other tests were normal. This is the first study to report a case of O-6-methylguanine-DNA methyltransferase methylation with FATWO in Korea. PMID:27462603

  9. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed Central

    Stelzl, U; Nierhaus, K H

    2001-01-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied. PMID:11345438

  10. A short fragment of 23S rRNA containing the binding sites for two ribosomal proteins, L24 and L4, is a key element for rRNA folding during early assembly.

    PubMed

    Stelzl, U; Nierhaus, K H

    2001-04-01

    Previously we described an in vitro selection variant abbreviated SERF (in vitro selection from random rRNA fragments) that identifies protein binding sites within large RNAs. With this method, a small rRNA fragment derived from the 23S rRNA was isolated that binds simultaneously and independently the ribosomal proteins L4 and L24 from Escherichia coli. Until now the rRNA structure within the ternary complex L24-rRNA-L4 could not be studied due to the lack of an appropriate experimental strategy. Here we tackle the issue by separating the various complexes via native gel-electrophoresis and analyzing the rRNA structure by in-gel iodine cleavage of phosphorothioated RNA. The results demonstrate that during the transition from either the L4 or L24 binary complex to the ternary complex the structure of the rRNA fragment changes significantly. The identified protein binding sites are in excellent agreement with the recently reported crystal structure of the 50S subunit. Because both proteins play a prominent role in early assembly of the large subunit, the results suggest that the identified rRNA fragment is a key element for the folding of the 23S RNA during early assembly. The introduced in-gel cleavage method should be useful when an RNA structure within mixed populations of different but related complexes should be studied.

  11. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  12. MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells | Office of Cancer Genomics

    Cancer.gov

    The discovery of cancer dependencies has the potential to inform therapeutic strategies and to identify putative drug targets. Integrating data from comprehensive genomic profiling of cancer cell lines and from functional characterization of cancer cell dependencies, we discovered that loss of the enzyme methylthioadenosine phosphorylase (MTAP) confers a selective dependence on protein arginine methyltransferase 5 (PRMT5) and its binding partner WDR77. MTAP is frequently lost due to its proximity to the commonly deleted tumor suppressor gene, CDKN2A.

  13. Molecular phylogenetics and comparative modeling of HEN1, a methyltransferase involved in plant microRNA biogenesis

    PubMed Central

    Tkaczuk, Karolina L; Obarska, Agnieszka; Bujnicki, Janusz M

    2006-01-01

    Background Recently, HEN1 protein from Arabidopsis thaliana was discovered as an essential enzyme in plant microRNA (miRNA) biogenesis. HEN1 transfers a methyl group from S-adenosylmethionine to the 2'-OH or 3'-OH group of the last nucleotide of miRNA/miRNA* duplexes produced by the nuclease Dicer. Previously it was found that HEN1 possesses a Rossmann-fold methyltransferase (RFM) domain and a long N-terminal extension including a putative double-stranded RNA-binding motif (DSRM). However, little is known about the details of the structure and the mechanism of action of this enzyme, and about its phylogenetic origin. Results Extensive database searches were carried out to identify orthologs and close paralogs of HEN1. Based on the multiple sequence alignment a phylogenetic tree of the HEN1 family was constructed. The fold-recognition approach was used to identify related methyltransferases with experimentally solved structures and to guide the homology modeling of the HEN1 catalytic domain. Additionally, we identified a La-like predicted RNA binding domain located C-terminally to the DSRM domain and a domain with a peptide prolyl cis/trans isomerase (PPIase) fold, but without the conserved PPIase active site, located N-terminally to the catalytic domain. Conclusion The bioinformatics analysis revealed that the catalytic domain of HEN1 is not closely related to any known RNA:2'-OH methyltransferases (e.g. to the RrmJ/fibrillarin superfamily), but rather to small-molecule methyltransferases. The structural model was used as a platform to identify the putative active site and substrate-binding residues of HEN and to propose its mechanism of action. PMID:16433904

  14. S-adenosylmethionine-dependent protein methylation in mammalian cytosol via tyrphostin modification by catechol-O-methyltransferase.

    PubMed

    Lipson, Rebecca S; Clarke, Steven G

    2007-10-19

    It has previously been shown that incubation of mammalian cell cytosolic extracts with the protein kinase inhibitor tyrphostin A25 results in enhanced transfer of methyl groups from S-adenosyl-[methyl-3H]methionine to proteins. These findings were interpreted as demonstrating tyrphostin stimulation of a novel type of protein carboxyl methyltransferase. We find here, however, that tyrphostin A25 addition to mouse heart cytosol incubated with S-adenosyl-[methyl-3H]methionine or S-adenosyl-[methyl-14C]methionine stimulates the labeling of small molecules in addition to proteins. Base treatment of both protein and small molecule fractions releases volatile radioactivity, suggesting labile ester-like linkages of the labeled methyl group. Production of both the base-volatile product and labeled protein occurs with tyrphostins A25, A47, and A51, but not with thirteen other tyrphostin family members. These active tyrphostins all contain a catechol moiety and are good substrates for recombinant and endogenous catechol-O-methyltransferase. Inhibition of catechol-O-methyltransferase activity with tyrphostin AG1288 prevents both base-volatile product formation and protein labeling from methyl-labeled S-adenosylmethionine in heart, kidney, and liver, but not in testes or brain extracts. These results suggest that the incorporation of methyl groups into protein follows a complex pathway initiated by the methylation of select tyrphostins by endogenous catechol-O-methyltransferase. We suggest that the methylated tyrphostins are further modified in the cell extract and covalently attached to cellular proteins. The presence of endogenous catechols in cells suggests that similar reactions can also occur in vivo.

  15. Microarray-based resonance light scattering assay for detecting DNA methylation and human DNA methyltransferase simultaneously with high sensitivity.

    PubMed

    Ma, Lan; Su, Min; Li, Tao; Wang, Zhenxin

    2014-07-21

    A microarray-based resonance light scattering assay, with the combination of methylation-sensitive endonuclease and gold nanoparticle (GNP) probes, has been proposed to sensitively distinguish the DNA methylation level as low as 0.01% (10 pM methylated DNA in 100 nM total DNA) and detect human DNA methyltransferase 1 (Dnmt1) down to 0.1 U mL(-1).

  16. Genome-Wide Identification and Comparative Analysis of Cytosine-5 DNA Methyltransferase and Demethylase Families in Wild and Cultivated Peanut

    PubMed Central

    Wang, Pengfei; Gao, Chao; Bian, Xiaotong; Zhao, Shuzhen; Zhao, Chuanzhi; Xia, Han; Song, Hui; Hou, Lei; Wan, Shubo; Wang, Xingjun

    2016-01-01

    DNA methylation plays important roles in genome protection, regulation of gene expression and is associated with plants development. Plant DNA methylation pattern was mediated by cytosine-5 DNA methyltransferase and demethylase. Although the genomes of AA and BB wild peanuts have been fully sequenced, these two gene families have not been studied. In this study we report the identification and analysis of putative cytosine-5 DNA methyltransferases (C5-MTases) and demethylases in AA and BB wild peanuts. Cytosine-5 DNA methyltransferases in AA and BB wild peanuts could be classified in MET, CMT, and DRM2 groups based on their domain organization. This result was supported by the gene and protein structural characteristics and phylogenetic analysis. We found that some wild peanut DRM2 members didn't contain UBA domain which was different from other plants such as Arabidopsis, maize and soybean. Five DNA demethylase encoding genes were found in AA genome and five in BB genome. The selective pressure analysis showed that wild peanut C5-MTase genes mainly underwent purifying selection but many positive selection sites can be detected. Conversely, DNA demethylase genes mainly underwent positive selection during evolution. Additionally, the expression dynamic of cytosine-5 DNA methyltransferase and demethylase genes in different cultivated peanut tissues were analyzed. Expression result showed that cold, heat or PEG stress could influence the expression level of C5-MTase and DNA demethylase genes in cultivated peanut. These results are useful for better understanding the complexity of these two gene families, and will facilitate epigenetic studies in peanut in the future. PMID:26870046

  17. Genome-Wide Identification and Comparative Analysis of Cytosine-5 DNA Methyltransferase and Demethylase Families in Wild and Cultivated Peanut.

    PubMed

    Wang, Pengfei; Gao, Chao; Bian, Xiaotong; Zhao, Shuzhen; Zhao, Chuanzhi; Xia, Han; Song, Hui; Hou, Lei; Wan, Shubo; Wang, Xingjun

    2016-01-01

    DNA methylation plays important roles in genome protection, regulation of gene expression and is associated with plants development. Plant DNA methylation pattern was mediated by cytosine-5 DNA methyltransferase and demethylase. Although the genomes of AA and BB wild peanuts have been fully sequenced, these two gene families have not been studied. In this study we report the identification and analysis of putative cytosine-5 DNA methyltransferases (C5-MTases) and demethylases in AA and BB wild peanuts. Cytosine-5 DNA methyltransferases in AA and BB wild peanuts could be classified in MET, CMT, and DRM2 groups based on their domain organization. This result was supported by the gene and protein structural characteristics and phylogenetic analysis. We found that some wild peanut DRM2 members didn't contain UBA domain which was different from other plants such as Arabidopsis, maize and soybean. Five DNA demethylase encoding genes were found in AA genome and five in BB genome. The selective pressure analysis showed that wild peanut C5-MTase genes mainly underwent purifying selection but many positive selection sites can be detected. Conversely, DNA demethylase genes mainly underwent positive selection during evolution. Additionally, the expression dynamic of cytosine-5 DNA methyltransferase and demethylase genes in different cultivated peanut tissues were analyzed. Expression result showed that cold, heat or PEG stress could influence the expression level of C5-MTase and DNA demethylase genes in cultivated peanut. These results are useful for better understanding the complexity of these two gene families, and will facilitate epigenetic studies in peanut in the future.

  18. The Histone Methyltransferase Inhibitor A-366 Uncovers a Role for G9a/GLP in the Epigenetics of Leukemia

    PubMed Central

    He, Yupeng; Ferguson, Debra; Jagadeeswaran, Sujatha; Osterling, Donald J.; Gao, Wenqing; Spence, Julie K.; Pliushchev, Marina; Sweis, Ramzi F.; Buchanan, Fritz G.; Michaelides, Michael R.; Shoemaker, Alexander R.; Tse, Chris; Chiang, Gary G.

    2015-01-01

    Histone methyltransferases are epigenetic regulators that modify key lysine and arginine residues on histones and are believed to play an important role in cancer development and maintenance. These epigenetic modifications are potentially reversible and as a result this class of enzymes has drawn great interest as potential therapeutic targets of small molecule inhibitors. Previous studies have suggested that the histone lysine methyltransferase G9a (EHMT2) is required to perpetuate malignant phenotypes through multiple mechanisms in a variety of cancer types. To further elucidate the enzymatic role of G9a in cancer, we describe herein the biological activities of a novel peptide-competitive histone methyltransferase inhibitor, A-366, that selectively inhibits G9a and the closely related GLP (EHMT1), but not other histone methyltransferases. A-366 has significantly less cytotoxic effects on the growth of tumor cell lines compared to other known G9a/GLP small molecule inhibitors despite equivalent cellular activity on methylation of H3K9me2. Additionally, the selectivity profile of A-366 has aided in the discovery of a potentially important role for G9a/GLP in maintenance of leukemia. Treatment of various leukemia cell lines in vitro resulted in marked differentiation and morphological changes of these tumor cell lines. Furthermore, treatment of a flank xenograft leukemia model with A-366 resulted in growth inhibition in vivo consistent with the profile of H3K9me2 reduction observed. In summary, A-366 is a novel and highly selective inhibitor of G9a/GLP that has enabled the discovery of a role for G9a/GLP enzymatic activity in the growth and differentiation status of leukemia cells. PMID:26147105

  19. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  20. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    PubMed

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.