75 FR 71457 - Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-23
... Division, Technical Services America, Global Parts Supply Chain Group, Including Leased Workers From QFLEX... Division Technical Services America Global Parts Supply Chain Group Including Leased Workers From QFLEX... Enterprise Business Division Technical Services America Global Parts Supply Chain Group Including Leased...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-14
... Packard Company, Enterprise Business Division, Technical Services America, Global Parts Supply Chain Group... Business Division, Technical Services America, Global Parts Supply Chain Group, Including Leased Workers... Supply Chain Group, including leased workers from QFlex, North America Logistics, and UPS, Palo Alto...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-24
... Packard Company, Enterprise Business Division, Technical Services America, Global Parts Supply Chain Group... Business Division, Technical Services America, Global Parts Supply Chain Group, Including Leased Workers... Packard Company, Enterprise Business Division, Technical Services America, Global Parts Supply Chain Group...
Genetic analysis of groups of mid-infrared predicted fatty acids in milk.
Narayana, S G; Schenkel, F S; Fleming, A; Koeck, A; Malchiodi, F; Jamrozik, J; Johnston, J; Sargolzaei, M; Miglior, F
2017-06-01
The objective of this study was to investigate genetic variability of mid-infrared predicted fatty acid groups in Canadian Holstein cattle. Genetic parameters were estimated for 5 groups of fatty acids: short-chain (4 to 10 carbons), medium-chain (11 to 16 carbons), long-chain (17 to 22 carbons), saturated, and unsaturated fatty acids. The data set included 49,127 test-day records from 10,029 first-lactation Holstein cows in 810 herds. The random regression animal test-day model included days in milk, herd-test date, and age-season of calving (polynomial regression) as fixed effects, herd-year of calving, animal additive genetic effect, and permanent environment effects as random polynomial regressions, and random residual effect. Legendre polynomials of the third degree were selected for the fixed regression for age-season of calving effect and Legendre polynomials of the fourth degree were selected for the random regression for animal additive genetic, permanent environment, and herd-year effect. The average daily heritability over the lactation for the medium-chain fatty acid group (0.32) was higher than for the short-chain (0.24) and long-chain (0.23) fatty acid groups. The average daily heritability for the saturated fatty acid group (0.33) was greater than for the unsaturated fatty acid group (0.21). Estimated average daily genetic correlations were positive among all fatty acid groups and ranged from moderate to high (0.63-0.96). The genetic correlations illustrated similarities and differences in their origin and the makeup of the groupings based on chain length and saturation. These results provide evidence for the existence of genetic variation in mid-infrared predicted fatty acid groups, and the possibility of improving milk fatty acid profile through genetic selection in Canadian dairy cattle. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Patterson Road Elementary School Formula Phonics Reading Chain.
ERIC Educational Resources Information Center
Orcutt Union School District, CA.
This program, included in "Effective Reading Programs...," serves 320 students in grades 2-6. The majority of the students are white and come from low- and middle-income homes in the sururbs of a small city. Staggered scheduling allows two ungraded reading chains of 12 groups each to meet 45 minutes daily. Grouping is determined not by…
Delocalized periodic vibrations in nonlinear LC and LCR electrical chains
NASA Astrophysics Data System (ADS)
Chechin, G. M.; Shcherbinin, S. A.
2015-05-01
We consider electrical LC- and LCR-chains consisting of N cells. In the LC-chain each cell contains a linear inductor L and a nonlinear capacitor C, while the cell in the LCR-chain include additionally a resistor R and an voltage source. It is assumed that voltage dependence of capacitors represents an even function. Such capacitors have implemented by some experimental groups studying propagation of electrical signals in the lines constructed on MOS and CMOS substrates. In these chains, we study dynamical regimes representing nonlinear normal modes (NNMs) by Rosenberg. We prove that maximum possible number of symmetry-determined NNMs which can be excited in the considered chains is equal to 5. The stability of these modes for different N is studied with the aid of the group-theoretical method [Physical Review E 73 (2006) 36216] which allows to simplify radically the variational systems appearing in the Floquet stability analysis. For NNMs in LC-chain, the scaling of the voltage stability threshold in the thermodynamic limit (N → ∞) is determined. It is shown that the above group theoretical method can be also used for studying stability of NNMs in the LCR-chains.
Rapid self-assembly of block copolymers to photonic crystals
Xia, Yan; Sveinbjornsson, Benjamin R; Grubbs, Robert H; Weitekamp, Raymond; Miyake, Garret M; Atwater, Harry A; Piunova, Victoria; Daeffler, Christopher Scot; Hong, Sung Woo; Gu, Weiyin; Russell, Thomas P.
2016-07-05
The invention provides a class of copolymers having useful properties, including brush block copolymers, wedge-type block copolymers and hybrid wedge and polymer block copolymers. In an embodiment, for example, block copolymers of the invention incorporate chemically different blocks comprising polymer size chain groups and/or wedge groups that significantly inhibit chain entanglement, thereby enhancing molecular self-assembly processes for generating a range of supramolecular structures, such as periodic nanostructures and microstructures. The present invention also provides useful methods of making and using copolymers, including block copolymers.
Chain decomposition of aqueous triethanolamine. [Gamma Radiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schwarz, H.A.
A radiation-induced chain decomposition of aqueous triethanolamine into acetaldehyde and diethanolamine is reported. Chain lengths over 1000 have been observed, depending on pH, concentration, and radiation intensity. The chain propagation steps include OH group migration in the 2-hydroxy-1-(diethanolamino)ethyl radical and NR/sub 2/ migration in 1-hydroxy-2(diethanolamine)ethyl radical, each producing a 2-hydroxy-2-(diethanolamine)ethyl radical. Free-radical spectra and rate constants are given. Studies of diethanolamine and diethylethanolamine solutions gave similar free-radical spectra but much shorter chains.
NASA Astrophysics Data System (ADS)
Li, Kun; Gu, Boqin
2017-07-01
The present study investigates the physisorption and interfacial interactions between multiwalled carbon nanotubes (MWNTs) with different characteristics, including different numbers of walls and different functional groups, and acrylonitrile-butadiene rubber (NBR) polymer chains based on molecular dynamics simulations performed using modeled MWNT/NBR compound systems. The effects of the initial orientation of NBR chains and their relative distances to nanotubes, number of nanotube layers, and the surface functional groups of nanotubes on nanotube/polymer interactions are examined. Analysis is conducted according to the final configuration obtained in conjunction with the binding energy (Eb), radius of gyration (Rg) and end-to-end distance (h). The results show that the final conformations of NBR chains adsorbed on MWNT surfaces is associated with the initial relative angle of the NBR chains and their distance from the nanotubes. For non-functionalized MWNTs, Eb is almost directly proportional to Rg under equivalent parameters. Moreover, it is observed that functional groups hinder the wrapping of NBR chains on the MWNT surfaces. This indicates that functional groups do not always benefit the macro-mechanical properties of the composites. Moreover, the type of the major interaction force has been dramatically changed into electrostatic force from vdW force because of functionalization.
Synthetic Lectins: New Tools for Detection and Management of Prostate Cancer
2015-09-01
were synthesized on Tentagel resin analogous to those previously described.2 The effectiveness of the coupling was assessed using MALDI-MS in the...protecting groups on the Dab side -chains (where boronic acids are attached). This appeared to be a significant portion of the product, composing up...evaluate our synthetic approach and tried different side -chain amine protecting groups on Dab including alloc and MTT. From these studies, we
Genetic correlations of mid-infrared-predicted milk fatty acid groups with milk production traits.
Fleming, A; Schenkel, F S; Malchiodi, F; Ali, R A; Mallard, B; Sargolzaei, M; Jamrozik, J; Johnston, J; Miglior, F
2018-05-01
The objective of this research was to estimate the genetic correlations between milk mid-infrared-predicted fatty acid groups and production traits in first-parity Canadian Holsteins. Contents of short-chain, medium-chain, long-chain, saturated, and unsaturated fatty acid groupings in milk samples can be predicted using mid-infrared spectral data for cows enrolled in milk recording programs. Predicted fatty acid group contents were obtained for 49,127 test-day milk samples from 10,029 first-parity Holstein cows in 810 herds. Milk yield, fat and protein yield, fat and protein percentage, fat-to-protein ratio, and somatic cell score were also available for these test days. Genetic parameters were estimated for the fatty acid groups and production traits using multiple-trait random regression test day models by Bayesian methods via Gibbs sampling. Three separate 8- or 9-trait analyses were performed, including the 5 fatty acid groups with different combinations of the production traits. Posterior standard deviations ranged from <0.001 to 0.01. Average daily genetic correlations were negative and similar to each other for the fatty acid groups with milk yield (-0.62 to -0.59) and with protein yield (-0.32 to -0.25). Weak and positive average daily genetic correlations were found between somatic cell score and the fatty acid groups (from 0.25 to 0.36). Stronger genetic correlations with fat yield, fat and protein percentage, and fat-to-protein ratio were found with medium-chain and saturated fatty acid groups compared with those with long-chain and unsaturated fatty acid groups. Genetic correlations were very strong between the fatty acid groups and fat percentage, ranging between 0.88 for unsaturated and 0.99 for saturated fatty acids. Daily genetic correlations from 5 to 305 d in milk with milk, protein yield and percentage, and somatic cell score traits showed similar patterns for all fatty acid groups. The daily genetic correlations with fat yield at the beginning of lactation were decreasing for long-chain and unsaturated fatty acid groups and increasing for short-chain fatty acids. Genetic correlations between fat percentage and fatty acids were increasing at the beginning of lactation for short- and medium-chain and saturated fatty acids, but slightly decreasing for long-chain and unsaturated fatty acid groups. These results can be used in defining fatty acid traits and breeding objectives. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
INDUCTION OF RABBIT ANTIBODY WITH MOLECULAR UNIFORMITY AFTER IMMUNIZATION WITH GROUP C STREPTOCOCCI
Eichmann, Klaus; Lackland, Henry; Hood, Leroy; Krause, Richard M.
1970-01-01
Antibodies with uniform properties may occur in rabbits after immunization with Group C streptococci. These precipitating antibodies possess specificity for the group-specific carbohydrate. Not uncommonly, their concentration is between 20 and 40 mg/ml of antiserum. Evidence for molecular uniformity in the case of one of these antibodies, described in detail here, includes: individual antigenic specificity; monodisperse distribution of the light chains by alkaline urea polyacrylamide disc electrophoresis; and a single amino acid in each of the first three N-terminal positions of the light chains. When the amino acid sequence of rabbit antibody b+ light chains (κ type) are aligned against their human κ counterparts, a definite homology is observed between the N-terminus of the human and the rabbit variable region. PMID:5409946
Liakopoulou, Effie; Li, Qiliang; Stamatoyannopoulos, George
2010-01-01
Short-chain fatty acids (C2-C9) induce fetal hemoglobin synthesis in primary cell cultures, primates, and patients. We carried out experiments to test whether relationships exist between chemical structure and the Hb F-inducing potential of several short-chain fatty acid derivatives. BFUe cultures were performed in the presence of propionic and butyric congeners, covering the full spectrum of substitutions of these molecules, including polar and non-polar groups, esters, and double bonds. We found that the fetal hemoglobin inducibility is related to the chemical structure of the inducing compound. This structure–activity relation depends on the length of carbon chain, the nature of the substitutions, and the position of more potent substitutions on the carbon chain. It appears that substitutions enhancing the inducibility of these compounds are (with decreasing potency): methyl > phenyl > hydroxy ≫ amino groups. Placement of these substitutions at a position distal to the carboxyl group enhances γ-globin inducibility. Presence of the carboxyl group is prerequisite for γ-globin inducibility. PMID:12482403
Andelic, Nada; Bautz-Holter, Erik; Ronning, Pal; Olafsen, Kjell; Sigurdardottir, Solrun; Schanke, Anne-Kristine; Sveen, Unni; Tornas, Sveinung; Sandhaug, Maria; Roe, Cecilie
2012-01-01
There are currently no international guidelines regarding treatment in the early rehabilitation phase for persons with severe traumatic brain injury (TBI), and only a few studies have investigated the effect of integrating rehabilitation into acute TBI care. The aim of the study was to evaluate whether a continuous chain of rehabilitation that begins with the acute phase could improve the functional outcome of severe TBI patients, compared to a broken chain of rehabilitation that starts in the sub-acute phase of TBI. A total of 61 surviving patients with severe TBI were included in a quasi-experimental study conducted at the Level I trauma center in Eastern Norway. In the study, 31 patients were in the early rehabilitation group (Group A) and 30 patients were in the delayed rehabilitation group (Group B). The functional outcomes were assessed 12 months post-injury with the Glasgow Outcome Scale Extended (GOSE) and the Disability Rating Scale (DRS). A favorable outcome (GOSE 6-8) occurred in 71% of the patients from Group A versus 37% in Group B (p=0.007). The DRS score was significantly better in Group A (p=0.03). The ordinal logistic regression analysis was used to quantify the relationship between the type of rehabilitation chain and the GOSE. A better GOSE outcome was found in patients from Group A (unadjusted OR 3.25 and adjusted OR 2.78, respectively). These results support the hypothesis that better functional outcome occurs in patients who receive early onset and a continuous chain of rehabilitation.
Lee Chang, Kim Jye; Dunstan, Graeme A; Abell, Guy C J; Clementson, Lesley A; Blackburn, Susan I; Nichols, Peter D; Koutoulis, Anthony
2012-03-01
Heterotrophic growth of thraustochytrids has potential in co-producing a feedstock for biodiesel and long-chain (LC, ≥C(20)) omega-3 oils. Biodiscovery of thraustochytrids from Tasmania (temperate) and Queensland (tropical), Australia, covered a biogeographic range of habitats including fresh, brackish, and marine waters. A total of 36 thraustochytrid strains were isolated and separated into eight chemotaxonomic groups (A-H) based on fatty acid (FA) and sterol composition which clustered closely with four different genera obtained by 18S rDNA molecular identification. Differences in the relative proportions (%FA) of long-chain C(20), C(22), omega-3, and omega-6 polyunsaturated fatty acids (PUFA), including docosahexaenoic acid (DHA), docosapentaenoic acid, arachidonic acid, eicosapentaenoic acid (EPA), and saturated FA, as well as the presence of odd-chain PUFA (OC-PUFA) were the major factors influencing the separation of these groups. OC-PUFA were detected in temperate strains of groups A, B, and C (Schizochytrium and Thraustochytrium). Group D (Ulkenia) had high omega-3 LC-PUFA (53% total fatty acids (TFA)) and EPA up to 11.2% TFA. Strains from groups E and F (Aurantiochytrium) contained DHA levels of 50-61% TFA after 7 days of growth in basal medium at 20 °C. Groups G and H (Aurantiochytrium) strains had high levels of 15:0 (20-30% TFA) and the sum of saturated FA was in the range of 32-51%. β,β-Carotene, canthaxanthin, and astaxanthin were identified in selected strains. Phylogenetic and chemotaxonomic groupings demonstrated similar patterns for the majority of strains. Our results demonstrate the potential of these new Australian thraustochytrids for the production of biodiesel in addition to omega-3 LC-PUFA-rich oils.
Association of immunoglobulin G4 and free light chain with idiopathic pleural effusion.
Murata, Y; Aoe, K; Mimura-Kimura, Y; Murakami, T; Oishi, K; Matsumoto, T; Ueoka, H; Matsunaga, K; Yano, M; Mimura, Y
2017-10-01
The cause of pleural effusion remains uncertain in approximately 15% of patients despite exhaustive evaluation. As recently described immunoglobulin (Ig)G4-related disease is a fibroinflammatory disorder that can affect various organs, including the lungs, we investigate whether idiopathic pleural effusion includes IgG4-associated etiology. Between 2000 and 2012, we collected 830 pleural fluid samples and reviewed 35 patients with pleural effusions undiagnosed after pleural biopsy at Yamaguchi-Ube Medical Center. Importantly, IgG4 immunostaining revealed infiltration of IgG4-positive plasma cells in the pleura of 12 patients (34%, IgG4 + group). The median effusion IgG4 level was 41 mg/dl in the IgG4 + group and 27 mg/dl in the IgG4 - group (P < 0·01). The light and heavy chains of effusion IgG4 antibodies of patients in the IgG4 + group were heterogeneous by two-dimensional electrophoresis, indicating the absence of clonality of the IgG4 antibodies. Interestingly, the κ light chains were more heterogeneous than the λ light chains. The measurement of the κ and λ free light chain (FLC) levels in the pleural fluids showed significantly different κ FLC levels (median: 28·0 versus 9·1 mg/dl, P < 0·01) and κ/λ ratios (median: 2·0 versus 1·2, P < 0·001) between the IgG4 + and IgG4 - groups. Furthermore, the κ/λ ratios were correlated with the IgG4 + /IgG + plasma cell ratios in the pleura of the IgG4 + group. Taken together, these results demonstrate the involvement of IgG4 in certain idiopathic pleural effusions and provide insights into the diagnosis, pathogenesis and therapeutic opportunities of IgG4-associated pleural effusion. © 2017 British Society for Immunology.
2015-01-01
services to the end user across the modes of transport .” As such, the supply chain “may include vendors, manufacturing facilities, logistics providers...sharing them with a group, before ranking each. For more information, see Van De Ven and Delbecq, 1974. 12 “When working through the vulnerability...are cost-effective (Kiser and Cantrell, 2006), avoiding higher production and transportation costs. Figure 2.5 outlines two prevalent supply chain
Singh, J; Thornton, J M
1990-02-05
Automated methods have been developed to determine the preferred packing arrangement between interacting protein groups. A suite of FORTRAN programs, SIRIUS, is described for calculating and analysing the geometries of interacting protein groups using crystallographically derived atomic co-ordinates. The programs involved in calculating the geometries search for interacting pairs of protein groups using a distance criterion, and then calculate the spatial disposition and orientation of the pair. The second set of programs is devoted to analysis. This involves calculating the observed and expected distributions of the angles and assessing the statistical significance of the difference between the two. A database of the geometries of the 400 combinations of side-chain to side-chain interaction has been created. The approach used in analysing the geometrical information is illustrated here with specific examples of interactions between side-chains, peptide groups and particular types of atom. At the side-chain level, an analysis of aromatic-amino interactions, and the interactions of peptide carbonyl groups with arginine residues is presented. At the atomic level the analyses include the spatial disposition of oxygen atoms around tyrosine residues, and the frequency and type of contact between carbon, nitrogen and oxygen atoms. This information is currently being applied to the modelling of protein interactions.
Bansal, Sunil; Durrett, Timothy P
2016-09-01
Acetyl-triacylglycerols (acetyl-TAG) possess an sn-3 acetate group, which confers useful chemical and physical properties to these unusual triacylglycerols (TAG). Current methods for quantification of acetyl-TAG are time consuming and do not provide any information on the molecular species profile. Electrospray ionization mass spectrometry (ESI-MS)-based methods can overcome these drawbacks. However, the ESI-MS signal intensity for TAG depends on the aliphatic chain length and unsaturation index of the molecule. Therefore response factors for different molecular species need to be determined before any quantification. The effects of the chain length and the number of double-bonds of the sn-1/2 acyl groups on the signal intensity for the neutral loss of short chain length sn-3 groups were quantified using a series of synthesized sn-3 specific structured TAG. The signal intensity for the neutral loss of the sn-3 acyl group was found to negatively correlated with the aliphatic chain length and unsaturation index of the sn-1/2 acyl groups. The signal intensity of the neutral loss of the sn-3 acyl group was also negatively correlated with the size of that chain. Further, the position of the group undergoing neutral loss was also important, with the signal from an sn-2 acyl group much lower than that from one located at sn-3. Response factors obtained from these analyses were used to develop a method for the absolute quantification of acetyl-TAG. The increased sensitivity of this ESI-MS-based approach allowed successful quantification of acetyl-TAG in various biological settings, including the products of in vitro enzyme activity assays.
Liu, Zitong; Zhang, Guanxin; Zhang, Deqing
2018-06-19
Organic semiconductors have received increasing attentions in recent years because of their promising applications in various optoelectronic devices. The key performance metric for organic semiconductors is charge carrier mobility, which is governed by the electronic structures of conjugated backbones and intermolecular/interchain π-π interactions and packing in both microscopic and macroscopic levels. For this reason, more efforts have been paid to the design and synthesis of conjugated frameworks for organic semiconductors with high charge mobilities. However, recent studies manifest that appropriate modifications of side chains that are linked to conjugated frameworks can improve the intermolecular/interchain packing order and boost charge mobilities. In this Account, we discuss our research results in context of modification of side chains in organic semiconductors for charge mobility enhancement. These include the following: (i) The lengths of alkyl chains in sulfur-rich thiepin-fused heteroacences can dramatically influence the intermolecular arrangements and orbital overlaps, ushering in different hole mobilities. Inversely, the lamellar stacking modes of alkyl chains in naphthalene diimide (NDI) derivatives with tetrathiafulvalene (TTF) units are affected by the structures of conjugated cores. (ii) The steric hindrances owing to the bulky branching chains can be weakened by partial replacement of the branching alkyl chains with linear ones for diketopyrrolopyrrole (DPP)-based D (donor)-A (acceptor) conjugated polymers. Such modification of side chains makes the polymer backbones more planar and thus interchain packing order and charge mobilities are improved. The incorporation of hydrophilic tri(ethylene glycol) (TEG) chains into the polymers also leads to improved interchain packing order. In particular, the polymer in which TEG side chains are distributed uniformly exhibits relatively high charge mobility without thermal annealing. (iii) The incorporation of urea groups in the side chains induces the polymer chains to pack more orderly and form large domains because of the additional H-bonding among urea groups. Accordingly, thin film mobilities of the conjugated D-A polymers with side chains entailing urea groups are largely boosted in comparison with those of polymers of the same backbones with either branching alkyl chains or branching/linear alkyl chains. (iv) The torsions of branching alkyl chains in conjugated D-A polymers can be inhibited to some extent upon incorporation of tiny amount of NMe 4 I in the thin film. As a result, the polymer thin films with NMe 4 I exhibit improved crystallinity, and charge mobilities can be boosted by more than 20 times. (v) Side chains with functional groups in the conjugated polymers can endow the thin film field-effect transistors (FETs) with sensing functionality. FETs with the conjugated polymer with -COOH groups in the side chains show sensitive, selective, and fast responses toward ammonia and amines, while FETs with the ultrathin films of the polymer containing tetra(ethylene glycol) (TEEG) in the side chains can sense alcohol vapors (in particular ethanol vapor) sensitively and selectively with fast response.
Strong liquid-crystalline polymeric compositions
Dowell, Flonnie
1993-01-01
Strong liquid-crystalline polymeric (LCP) compositions of matter. LCP backbones are combined with liquid crystalline (LC) side chains in a manner which maximizes molecular ordering through interdigitation of the side chains, thereby yielding materials which are predicted to have superior mechanical properties over existing LCPs. The theoretical design of LCPs having such characteristics includes consideration of the spacing distance between side chains along the backbone, the need for rigid sections in the backbone and in the side chains, the degree of polymerization, the length of the side chains, the regularity of the spacing of the side chains along the backbone, the interdigitation of side chains in sub-molecular strips, the packing of the side chains on one or two sides of the backbone to which they are attached, the symmetry of the side chains, the points of attachment of the side chains to the backbone, the flexibility and size of the chemical group connecting each side chain to the backbone, the effect of semiflexible sections in the backbone and the side chains, and the choice of types of dipolar and/or hydrogen bonding forces in the backbones and the side chains for easy alignment.
Tomar, Dheeraj S; Weber, Valéry; Pettitt, B Montgomery; Asthagiri, D
2014-04-17
The hydration thermodynamics of the amino acid X relative to the reference G (glycine) or the hydration thermodynamics of a small-molecule analog of the side chain of X is often used to model the contribution of X to protein stability and solution thermodynamics. We consider the reasons for successes and limitations of this approach by calculating and comparing the conditional excess free energy, enthalpy, and entropy of hydration of the isoleucine side chain in zwitterionic isoleucine, in extended penta-peptides, and in helical deca-peptides. Butane in gauche conformation serves as a small-molecule analog for the isoleucine side chain. Parsing the hydrophobic and hydrophilic contributions to hydration for the side chain shows that both of these aspects of hydration are context-sensitive. Furthermore, analyzing the solute-solvent interaction contribution to the conditional excess enthalpy of the side chain shows that what is nominally considered a property of the side chain includes entirely nonobvious contributions of the background. The context-sensitivity of hydrophobic and hydrophilic hydration and the conflation of background contributions with energetics attributed to the side chain limit the ability of a single scaling factor, such as the fractional solvent exposure of the group in the protein, to map the component energetic contributions of the model-compound data to their value in the protein. But ignoring the origin of cancellations in the underlying components the group-transfer model may appear to provide a reasonable estimate of the free energy for a given error tolerance.
Nursing home financial performance: the role of ownership and chain affiliation.
Weech-Maldonado, Robert; Laberge, Alex; Pradhan, Rohit; Johnson, Christopher E; Yang, Zhou; Hyer, Kathryn
2012-01-01
The nursing home industry serves one of the most vulnerable populations, and its financial sustainability is a matter of public concern. However, limited empirical evidence exists on the impact of ownership and chain affiliation on nursing home financial performance. The aim of this study was to examine the joint effects of ownership and chain affiliation on the financial performance of the nursing home industry for the study period 1999-2004 on a national sample of 11,236 nursing homes per year. Data included the Medicare Cost Reports; the Online Survey, Certification, and Reporting file; and the Area Resource File. Dependent variables included operating and total margins. Independent variables included four ownership/chain affiliation combinations: for-profit chain, for-profit independent, not-for-profit chain, and not-for-profit independent. Random effects generalized least square regressions were performed. Results show that for-profit nursing homes delivered better financial performance than not-for-profit facilities did across both operating and total margins. However, the relationship between chain affiliation and financial performance was more nuanced. In the case of operating margin, chain-affiliated facilities delivered superior financial performance irrespective of ownership type; however, in the case of total margin, independents outperformed chain-affiliated facilities among for-profits. Our findings show an interactive effect of ownership and chain affiliation on nursing home financial performance, suggesting the pursuit of different organizational strategies by different ownership/chain affiliation subgroups (for-profit chain, for-profit independent, not-for-profit chain, and not-for-profit independent), with implications for financial performance. For-profit independent nursing homes managed to be the top performing group in terms of overall financial despite the operating financial advantage of for-profit chain-affiliated nursing homes. Similarly, not-for-profit independent nursing homes and not-for-profit chain homes had comparable overall financial performance despite the operating financial advantage of chain homes.
Roldán, S; Lluch, M D; Navarro Quesada, F J; Hevia, A
1995-01-01
Reference has been made in the literature of the variability in the clinical presentation of deficiency of complex III of the respiratory chain, identifying up to the moment, four groups, the first of which is characterized by hipotonia and wearness starting at variable ages. We report a new case of mitochondrial myopathy due to deficiency of this complex and included within this first group, and consider the importance of defining the clinical and histochemical characteristics of this polymorphous entity.
Villapakkam, Anuradha C; Handke, Luke D; Belitsky, Boris R; Levdikov, Vladimir M; Wilkinson, Anthony J; Sonenshein, Abraham L
2009-11-01
Bacillus subtilis CodY protein is a DNA-binding global transcriptional regulator that responds to branched-chain amino acids (isoleucine, leucine, and valine) and GTP. Crystal structure studies have shown that the N-terminal region of the protein includes a GAF domain that contains a hydrophobic pocket within which isoleucine and valine bind. This region is well conserved in CodY homologs. Site-directed mutagenesis was employed to understand the roles of some of the residues in the GAF domain and hydrophobic pocket in interaction with isoleucine and GTP. The F40A, F71E, and F98A forms of CodY were inactive in vivo. They were activatable by GTP but to a much lesser extent by branched-chain amino acids in vitro. The CodY mutant R61A retained partial repression of target promoters in vivo and was able to respond to GTP in vitro but also responded poorly to branched-chain amino acids in vitro unless GTP was simultaneously present. Thus, the GAF domain includes residues essential for full activation of CodY by branched-chain amino acids, but these residues are not critical for activation by GTP. Binding studies with branched-chain amino acids and their analogs revealed that an amino group at position 2 and a methyl group at position 3 of valine are critical components of the recognition of the amino acids by CodY.
Wang, Shu; Robertson, Megan L
2015-06-10
Vegetable oils and their fatty acids are promising sources for the derivation of polymers. Long-chain poly(n-alkyl acrylates) and poly(n-alkyl methacrylates) are readily derived from fatty acids through conversion of the carboxylic acid end-group to an acrylate or methacrylate group. The resulting polymers contain long alkyl side-chains with around 10-22 carbon atoms. Regardless of the monomer source, the presence of alkyl side-chains in poly(n-alkyl acrylates) and poly(n-alkyl methacrylates) provides a convenient mechanism for tuning their physical properties. The development of structured multicomponent materials, including block copolymers and blends, containing poly(n-alkyl acrylates) and poly(n-alkyl methacrylates) requires knowledge of the thermodynamic interactions governing their self-assembly, typically described by the Flory-Huggins interaction parameter χ. We have investigated the χ parameter between polystyrene and long-chain poly(n-alkyl acrylate) homopolymers and copolymers: specifically we have included poly(stearyl acrylate), poly(lauryl acrylate), and their random copolymers. Lauryl and stearyl acrylate were chosen as model alkyl acrylates derived from vegetable oils and have alkyl side-chain lengths of 12 and 18 carbon atoms, respectively. Polystyrene is included in this study as a model petroleum-sourced polymer, which has wide applicability in commercially relevant multicomponent polymeric materials. Two independent methods were employed to measure the χ parameter: cloud point measurements on binary blends and characterization of the order-disorder transition of triblock copolymers, which were in relatively good agreement with one another. The χ parameter was found to be independent of the alkyl side-chain length (n) for large values of n (i.e., n > 10). This behavior is in stark contrast to the n-dependence of the χ parameter predicted from solubility parameter theory. Our study complements prior work investigating the interactions between polystyrene and short-chain polyacrylates (n ≤ 10). To our knowledge, this is the first study to explore the thermodynamic interactions between polystyrene and long-chain poly(n-alkyl acrylates) with n > 10. This work lays the groundwork for the development of multicomponent structured systems (i.e., blends and copolymers) in this class of sustainable materials.
Stals, Patrick J M; Cheng, Chi-Yuan; van Beek, Lotte; Wauters, Annelies C; Palmans, Anja R A; Han, Songi; Meijer, E W
2016-03-01
A library of water-soluble dynamic single-chain polymeric nanoparticles (SCPN) was prepared using a controlled radical polymerisation technique followed by the introduction of functional groups, including probes at targeted positions. The combined tools of electron paramagnetic resonance (EPR) and Overhauser dynamic nuclear polarization (ODNP) reveal that these SCPNs have structural and surface hydration properties resembling that of enzymes.
Translational vibrations between chains of hydrogen-bonded molecules in solid-state aspirin form I
NASA Astrophysics Data System (ADS)
Takahashi, Masae; Ishikawa, Yoichi
2013-06-01
We perform dispersion-corrected first-principles calculations, and far-infrared (terahertz) spectroscopic experiments at 4 K, to examine translational vibrations between chains of hydrogen-bonded molecules in solid-state aspirin form I. The calculated frequencies and relative intensities reproduce the observed spectrum to accuracy of 11 cm-1 or less. The stronger one of the two peaks assigned to the translational mode includes the stretching vibration of the weak hydrogen bond between the acetyl groups of a neighboring one-dimensional chain. The calculation of aspirin form II performed for comparison gives the stretching vibration of the weak hydrogen bond in one-dimensional chain.
Lust, Kathleen R; Sandrey, Michelle A; Bulger, Sean M; Wilder, Nathan
2009-08-01
With a limited number of outcomes-based studies, only recommendations for strength-training and rehabilitation programs can be made. To determine the extent to which throwing accuracy, core stability, and proprioception improved after completion of a 6-week training program that included open kinetic chain (OKC), closed kinetic chain (CKC), and/or core-stability exercises. A 2 x 3 factorial design. Division III college. 19 healthy baseball athletes with a control group of 15. Two 6-week programs including OKC, CKC, and core-stabilization exercises that were progressed each week. Functional throwing-performance index, closed kinetic chain upper extremity stability test, back-extensor test, 45 degrees abdominal-fatigue test, and right- and left-side bridging test. There was no significant difference between groups. An increase was evident in all pretest-to-posttest results, with improvement ranging from 1.36% to 140%. Both of the 6-week training programs could be used to increase throwing accuracy, core stability, and proprioception in baseball.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nekrasov, Nikita; ITEP, Moscow; Shatashvili, Samson
Supersymmetric vacua of two dimensional N = 4 gauge theories with matter, softly broken by the twisted masses down to N = 2, are shown to be in one-to-one correspondence with the eigenstates of integrable spin chain Hamiltonians. Examples include: the Heisenberg SU(2)XXX spin chain which is mapped to the two dimensional U(N) theory with fundamental hypermultiplets, the XXZ spin chain which is mapped to the analogous three dimensional super-Yang-Mills theory compactified on a circle, the XYZ spin chain and eight-vertex model which are related to the four dimensional theory compactified on T{sup 2}. A consequence of our correspondence ismore » the isomorphism of the quantum cohomology ring of various quiver varieties, such as cotangent bundles to (partial) flag varieties and the ring of quantum integrals of motion of various spin chains. The correspondence extends to any spin group, representations, boundary conditions, and inhomogeneity, it includes Sinh-Gordon and non-linear Schroedinger models as well as the dynamical spin chains like Hubbard model. Compactifications of four dimensional N = 2 theories on a two-sphere lead to the instanton-corrected Bethe equations.« less
Bench press training program with attached chains for female volleyball and basketball athletes.
Burnham, Timothy R; Ruud, Jason D; McGowan, Robert
2010-02-01
Attaching chains to barbells to increase strength and power has become popular for athletes; however, little scientific evidence supports this practice. The present purpose was to compare chain training to traditional training for the bench press. Women collegiate athletes in volleyball and basketball (N = 19) participated in a 16-session bench press program. They were matched into either a Traditional or a Chain training group by 1-repetition maximum (1RM). The Traditional group performed the bench press with conventional equipment, while the Chain group trained with attached chains (5% of weight). Analysis showed a significant increase in 1RM for both groups over 16 sessions, Traditional +11.8% and Chain +17.4%. The difference between the groups was not statistically significant, but suggests the women who trained with attached chains improved their bench press more than the Traditional group.
Polyarylether composition and membrane
Hung, Joyce; Brunelle, Daniel Joseph; Harmon, Marianne Elisabeth; Moore, David Roger; Stone, Joshua James; Zhou, Hongyi; Suriano, Joseph Anthony
2010-11-09
A composition including a polyarylether copolymer is provided. The copolymer includes a polyarylether backbone; and a sulfonated oligomeric group bonded to the polyarylether suitable for use as a cation conducting membrane. Method of bonding a sulfonated oligomeric group to the polyarylether backbone to form a polyarylether copolymer. The membrane may be formed from the polyarylether copolymer composition. The chain length of the sulfonated oligomeric group may be controlled to affect or control the ion conductivity of the membrane.
1990-05-25
INCLUDING ORIENTATIONAL INTERACTIONS BETWEEN CHAIN SEGMENTS B. Deloche, E.T. Samulski (France, USA) CHAIN SEGMENT ORDERING IN STRAINED BIMODAL P-2 PDMS...theory of elastomers is difficult because it requires a detailed study of many body interactions . A theory of elasticity must address the following: (1...a Kirchhoff matrix which describes the connectivity of the network (Kc) or the linear chains (Ku). The nonbonded interactions are handled with the
Light-responsive expansion-contraction of spherical nanoparticle grafted with azopolymers
NASA Astrophysics Data System (ADS)
Fu, Jie; Zhang, Xinghua; Miao, Bing; Yan, Dadong
2017-04-01
Due to the very importance for both fundamental research and technological applications, smart materials with stimuli-responsive properties have been studied intensively. Theoretical investigation contributes to this endeavor through constructing and analyzing a model system which captures main features of the corresponding complex material, wherefrom useful insight can be provided to the trial-and-error experiments. We here report a theoretical study on the smart spherical nanoparticle grafted with light-responsive azobenzene-containing polymers. Utilizing the photoisomerization ability of the azobenzene group, nanoparticles can undergo a light-induced expansion-contraction transition. The wormlike chain based single chain in mean field theory, which has been developed by us recently, is used to investigate this transition in detail. Exploring a large parameter space, our results definitely determine the parameters, including the chain length and effective Kuhn length of grafted chain, nanoparticle radius, grafting density, and position of the azobenzene group along the chain contour, to admit optimum light-responsive behavior of the smart nanoparticle, which provides a guide for experimentalists to design this type of material in a rational manner.
Code of Federal Regulations, 2010 CFR
2010-04-01
... group as one or more chains of includible corporations connected through 80-percent stock ownership with... indirect ownership under § 1.861-11T(d)(6). The Commissioner shall have the authority to disregard trusts...
Prokopy, Max P; Ingersoll, Christopher D; Nordenschild, Edwin; Katch, Frank I; Gaesser, Glenn A; Weltman, Arthur
2008-11-01
Closed-kinetic chain resistance training (CKCRT) of the lower body is superior to open-kinetic chain resistance training (OKCRT) to improve performance parameters (e.g., vertical jump), but the effects of upper-body CKCRT on throwing performance remain unknown. This study compared shoulder strength, power, and throwing velocity changes in athletes training the upper body exclusively with either CKCRT (using a system of ropes and slings) or OKCRT. Fourteen female National Collegiate Athletic Association Division I softball player volunteers were blocked and randomly placed into two groups: CKCRT and OKCRT. Blocking ensured the same number of veteran players and rookies in each training group. Training occurred three times weekly for 12 weeks during the team's supervised off-season program. Olympic, lower-body, core training, and upper-body intensity and volume in OKCRT and CKCRT were equalized between groups. Criterion variables pre- and posttraining included throwing velocity, bench press one-repetition maximum (1RM), dynamic single-leg balance, and isokinetic peak torque and power (PWR) (at 180 degrees x s(-1)) for shoulder flexion, extension, internal rotation, and external rotation (ER). The CKCRT group significantly improved throwing velocity by 2.0 mph (3.4%, p < 0.05), and the OKCRT group improved 0.3 mph (0.5%, NS). A significant interaction was observed (p < 0.05). The CKCRT group improved its 1RM bench press to the same degree (1.9 kg) as the OKCRT group (p < 0.05 within each group). The CKCRT group improved all measures of shoulder strength and power, whereas OKCRT conferred little change in shoulder torque and power scores. Although throwing is an open-chain movement, adaptations from CKCRT may confer benefits to subsequent performance. Strength coaches can incorporate upper-body CKCRT without sacrificing gains in maximal strength or performance criteria associated with an athletic open-chain movement such as throwing.
2015-01-01
The hydration thermodynamics of the amino acid X relative to the reference G (glycine) or the hydration thermodynamics of a small-molecule analog of the side chain of X is often used to model the contribution of X to protein stability and solution thermodynamics. We consider the reasons for successes and limitations of this approach by calculating and comparing the conditional excess free energy, enthalpy, and entropy of hydration of the isoleucine side chain in zwitterionic isoleucine, in extended penta-peptides, and in helical deca-peptides. Butane in gauche conformation serves as a small-molecule analog for the isoleucine side chain. Parsing the hydrophobic and hydrophilic contributions to hydration for the side chain shows that both of these aspects of hydration are context-sensitive. Furthermore, analyzing the solute–solvent interaction contribution to the conditional excess enthalpy of the side chain shows that what is nominally considered a property of the side chain includes entirely nonobvious contributions of the background. The context-sensitivity of hydrophobic and hydrophilic hydration and the conflation of background contributions with energetics attributed to the side chain limit the ability of a single scaling factor, such as the fractional solvent exposure of the group in the protein, to map the component energetic contributions of the model-compound data to their value in the protein. But ignoring the origin of cancellations in the underlying components the group-transfer model may appear to provide a reasonable estimate of the free energy for a given error tolerance. PMID:24650057
Strong liquid-crystalline polymeric compositions
Dowell, F.
1993-12-07
Strong liquid-crystalline polymeric (LCP) compositions of matter are described. LCP backbones are combined with liquid crystalline (LC) side chains in a manner which maximizes molecular ordering through interdigitation of the side chains, thereby yielding materials which are predicted to have superior mechanical properties over existing LCPs. The theoretical design of LCPs having such characteristics includes consideration of the spacing distance between side chains along the backbone, the need for rigid sections in the backbone and in the side chains, the degree of polymerization, the length of the side chains, the regularity of the spacing of the side chains along the backbone, the interdigitation of side chains in sub-molecular strips, the packing of the side chains on one or two sides of the backbone to which they are attached, the symmetry of the side chains, the points of attachment of the side chains to the backbone, the flexibility and size of the chemical group connecting each side chain to the backbone, the effect of semiflexible sections in the backbone and the side chains, and the choice of types of dipolar and/or hydrogen bonding forces in the backbones and the side chains for easy alignment. 27 figures.
Development of structural schemes of parallel structure manipulators using screw calculus
NASA Astrophysics Data System (ADS)
Rashoyan, G. V.; Shalyukhin, K. A.; Gaponenko, EV
2018-03-01
The paper considers the approach to the structural analysis and synthesis of parallel structure robots based on the mathematical apparatus of groups of screws and on a concept of reciprocity of screws. The results are depicted of synthesis of parallel structure robots with different numbers of degrees of freedom, corresponding to the different groups of screws. Power screws are applied with this aim, based on the principle of static-kinematic analogy; the power screws are similar to the orts of axes of not driven kinematic pairs of a corresponding connecting chain. Accordingly, kinematic screws of the outlet chain of a robot are simultaneously determined which are reciprocal to power screws of kinematic sub-chains. Solution of certain synthesis problems is illustrated with practical applications. Closed groups of screws can have eight types. The three-membered groups of screws are of greatest significance, as well as four-membered screw groups [1] and six-membered screw groups. Three-membered screw groups correspond to progressively guiding mechanisms, to spherical mechanisms, and to planar mechanisms. The four-membered group corresponds to the motion of the SCARA robot. The six-membered group includes all possible motions. From the works of A.P. Kotelnikov, F.M. Dimentberg, it is known that closed fifth-order screw groups do not exist. The article presents examples of the mechanisms corresponding to the given groups.
ERIC Educational Resources Information Center
Purrazzella, Kimberly; Mechling, Linda C.
2013-01-01
The study employed a multiple probe design to investigate the effects of computer-based instruction (CBI) and a forward chaining procedure to teach manual spelling of words to three young adults with moderate intellectual disability in a small group arrangement. The computer-based program included a tablet PC whereby students wrote words directly…
Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.
Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine
2018-04-04
Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.
Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme
Marrone, Babetta L.; Simpson, Daniel J.; Unkefer, Clifford J.; Whaley, Thomas W.
1992-01-01
An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.
Optical probe for the cytochrome P-450 cholesterol side chain cleavage enzyme
Marrone, Babetta L.; Simpson, Daniel J.; Unkefer, Clifford J.; Whaley, Thomas W.
1993-01-01
An optical probe enables the study of enzyme activity by absorbance spectroscopy or by sensitive fluorescence methods. In particular, the probe provides the ability to monitor the activity of cytochrome P-450.sub.scc enzyme, the rate limiting enzyme for steroid biosynthesis. Located on the inner mitochondrial membrane, P-450.sub.scc catalyzes the conversion of cholesterol to pregnenolone and isocapraldehyde by sequential oxidations of the cholesterol side chain. The fluorogenic probe includes a cholesterol-like steroid linked to a chromophore through a linking group. The chromophore is selected to have little optical response when linked to the steroid substrate and an enhanced optical response when cleaved from the substrate and linking group. Thus, a fluorescent anion that can be optically detected is generated by the side-chain cleavage reaction during steroidogenesis.
Wiśniewska, Marta; Sobolewski, Emil; Ołdziej, Stanisław; Liwo, Adam; Scheraga, Harold A.; Makowski, Mariusz
2015-01-01
Phosphorylation is a common post-translational modification of the amino-acid side chains (serine, tyrosine, and threonine) that contain hydroxyl groups. The transfer of the negatively charged phosphate group from an ATP molecule to such amino-acid side chains leads to changes in the local conformations of proteins and the pattern of interactions with other amino-acid side-chains. A convenient characteristic of the side chain–side chain interactions in the context of an aqueous environment is the potential of mean force (PMF) in water. A series of umbrella-sampling molecular dynamic (MD) simulations with the AMBER force field were carried out for pairs of O-phosphorylated serine (pSer), threonine (pThr), and tyrosine, (pTyr) with natural amino acids in a TIP3P water model as a solvent at 298 K. The weighted-histogram analysis method was used to calculate the four-dimensional potentials of mean force. The results demonstrate that the positions and depths of the contact minima and the positions and heights of the desolvation maxima, including their dependence on the relative orientation depend on the character of the interacting pairs. More distinct minima are observed for oppositely charged pairs such as, e.g., O-phosphorylated side-chains and positively charged ones, such as the side-chains of lysine and arginine. PMID:26100791
[Nutrition and health--toxic substances in food].
Rietjens, I M; Alink, G M
2003-11-29
With respect to food, the most important factors causing adverse health effects are: an unbalanced diet, resulting in obesity or vitamin deficiencies, overconsumption of alcohol or fat, the presence of microbial contamination and the presence of natural toxins. Two additional factors, the presence of environmental contaminants and products formed on heating food, may also be of importance. It is generally assumed that, when combined, food-related factors contribute to around 35% of overall cancer incidence. The most important groups of health-threatening compounds to be found in the food chain include natural toxins, such as those produced by plants (phytotoxins), fungi (mycotoxins), marine algae (phycotoxins) and by bacteria, and toxins present in animals for human consumption, especially fish. A second important group of toxic compounds in food consists of environmental contaminants, including heavy metals and persistent organic pollutants, such as dioxins and polychlorinated biphenyls, all of which may unintentionally end up in the food chain. A third group of toxins present in food are those substances produced when food is heated, and include polycyclic aromatic hydrocarbons, heterocyclic amines and acrylamide.
The Effect of Surface Chemical Functionality Upon Ice Adhesion
NASA Technical Reports Server (NTRS)
Smith, Joseph G., Jr.; Wohl, Christopher J.; Doss, Jereme; Spence, Destiny; Kreeger, Richard E.; Palacios, Jose; Knuth, Taylor; Hadley, Kevin R.; McDougal, Nicholas D.
2015-01-01
In nature, anti-freeze proteins present in fish utilize specific organic functionalities to disrupt ice crystal formation and propagation. Based on these structures, surfaces with controlled chemical functionality and chain length were evaluated both experimentally and computationally to assess the effect of both parameters in mitigating ice formation. Linear aliphatic dimethylethoxysilanes terminated with methyl or hydroxyl groups were prepared, characterized, and used to coat aluminum. The effect upon icing using a microdroplet freezing apparatus and the Adverse Environment Rotor Test Stand found hydroxyl-terminated materials exhibited a greater propensity for ice formation and adhesion. Molecular dynamics simulations of a silica substrate bearing functionalized species of similar composition were brought into contact with a pre-equilibrated ice crystal. Several parameters including chain mobility were monitored to ascertain the size of a quasi-liquid layer. The studies suggested that chain mobility affected the interface between ice and the surface more than terminal group chemical composition.
Metal-sulfur type cell having improved positive electrode
Dejonghe, Lutgard C.; Visco, Steven J.; Mailhe, Catherine C.; Armand, Michel B.
1989-01-01
An novel metal-sulfur type cell operable at a temperature of 200.degree. C. or less with an energy density of 150 Whrs/Kg or better is disclosed characterized by an organo-sulfur cathode formed from an organic-sulfur compound having the general formula, in its charged state, of (R(S).sub.y).sub.n wherein y=1 to 6; n=2 to 20; and R is one or more different aliphatic or aromatic organic moieties having 1 to 20 carbon atoms, which may include one or more oxygen, sulfur, or nitrogen heteroatoms when R comprisises one of more aromatic rings, or one or more oxygen, sulfur, nitrogen, or fluorine atoms associtated with the chain when R comprises an aliphatic chain, wherein the aliphatic group may be linear or branched, saturated or unsaturated, and wherein either the aliphatic chain or the aromatic ring may have substituted groups thereon.
Metal-sulfur type cell having improved positive electrode
DeJonghe, L.C.; Visco, S.J.; Mailhe, C.C.; Armand, M.B.
1988-03-31
A novel metal-sulfur type cell operable at a temperature of 200/degree/C or less with an energy density of 150 Whrs/Kg or better is disclosed characterized by an organo-sulfur cathode formed from an organic-sulfur compound having the general formula, in its charged state, of (R(S)/sub y/)n wherein y = 1 to 6; n = 2 to 20; and R is one or more different aliphatic or aromatic organic moieties having 1 to 20 carbon atoms, which may include one or more oxygen, sulfur, or nitrogen heteroatoms when R comprises one or more aromatic rings, or one or more oxygen, sulfur, nitrogen, or fluorine atoms associated with the chain when R comprises an aliphatic chain, wherein the aliphatic group may be linear or branched, saturated or unsaturated, and wherein either the aliphatic chain or the aromatic ring may have substituted groups thereon. 4 figs.
2014-01-01
Arsenic-containing lipids (arsenolipids) are natural products present in fish and algae. Because these compounds occur in foods, there is considerable interest in their human toxicology. We report the synthesis and characterization of seven arsenic-containing lipids, including six natural products. The compounds comprise dimethylarsinyl groups attached to saturated long-chain hydrocarbons (three compounds), saturated long-chain fatty acids (two compounds), and monounsaturated long chain fatty acids (two compounds). The arsenic group was introduced through sodium dimethylarsenide or bis(dimethylarsenic) oxide. The latter route provided higher and more reproducible yields, and consequently, this pathway was followed to synthesize six of the seven compounds. Mass spectral properties are described to assist in the identification of these compounds in natural samples. The pure synthesized arsenolipids will be used for in vitro experiments with human cells to test their uptake, biotransformation, and possible toxic effects. PMID:24683287
NASA Astrophysics Data System (ADS)
Macleod, Neil A.; Simons, John P.
2002-10-01
The conformational landscapes of 2-phenoxy ethanol (POX) and its hydrated clusters have been studied in the gas-phase, providing a model for pharmaceutical β-blockers. A combination of experimental techniques, including resonant two-photon ionisation (R2PI), laser-induced-fluorescence (LIF) and resonant ion-dip infra-red spectroscopy (RIDIRS), coupled with high-level ab initio calculations has allowed the assignment of the individually resolved spectral features to discrete conformational and supra-molecular structures. Assignments were made by comparison of experimental vibrational spectra and partially resolved ultra-violet rotational band contours with those predicted from quantum chemical calculations. The isolated molecule displays a solitary structure with an extended geometry of the side-chain which is stabilised by an intramolecular hydrogen-bond between the alcohol (proton donor) and the ether (proton acceptor) groups of the side-chain. In singly hydrated clusters the water molecule is accommodated by insertion into the intramolecular hydrogen-bond. In the doubly hydrated and higher clusters cyclic structures are generated which incorporate both the water molecules and the terminal OH group of the side-chain; additional (weak) hydrogen bonded interactions with the phenoxy group provide a degree of selectivity but essentially, the water 'droplet' forms on the end of the alcohol side-chain.
Bono, James D; Crawford, Stephanie Yvonne
2010-06-01
Although the sustainability of rural pharmacy services is a concern of long standing, the rural marketplace is not monolithic. Enhanced understanding of different experiences, strengths, and potential weaknesses of rural chain and independent pharmacies could help inform health policy debates, legislation, and consideration of disparities and access. This study compared and contrasted experiences by pharmacists in chain and independent community pharmacies during Medicare Part D implementation. The objective was to obtain and describe experiential narratives from rural Illinois pharmacists regarding the implementation of Medicare Part D. Similarities and differences experienced in chain and independent community pharmacies were examined, as well as pharmacists' perceptions about potential implications of the newly implemented Act on the accessibility of rural pharmacy care and services. A semistructured qualitative research approach was used, involving focus groups and telephone interviews, to elicit the subjective experiences of rural Illinois pharmacists. Participants were selected through purposive sampling to include representative perspectives of independent and chain community pharmacists in rural areas across the state. Using a systematic, iterative coding process, recurrent themes were identified in 8 substantive categories. Areas of similarity between the 2 groups included universal criticism of the initial implementation processes, but consensus belief that Medicare patients ultimately benefited if they did not have previous prescription drug coverage. Pharmacists in independent drugstores expressed more concern about their future viability. Corporate communications and infrastructure support were available in chain pharmacies and believed to present them with competitive advantages and a stronger long-term financial position. The findings showed a disparate impact of Medicare Part D on the initial experiences and perceived viability of independent community pharmacies, in comparison with their chain pharmacy counterparts. The long-term implications of changing regulatory environments and customers' pharmacy needs in underserved communities should be carefully considered and monitored. Copyright 2010 Elsevier Inc. All rights reserved.
Fluorinated monomers useful for preparing fluorinated polyquinoline polymers
NASA Technical Reports Server (NTRS)
Hendricks, Neil H. (Inventor)
1994-01-01
A new class of polymers is provided, as well as the monomers used for their preparation. The polymers provided in accordance with practice of the present invention include repeating units comprising one or more quinoline groups, wherein at least a portion of the repeating units includes a hexafluoroisopropylidene (6F) group or a 1-aryl-2,2,2-trifluoroethylidene (3F) group, or both. The hexafluoroisopropylidene group is referred to herein as a 6F group and has the following structure: ##STR1## The 6F group includes a tetravalent carbon atom bound to two trifluoromethyl moieties, with its other two bonds forming linkages in the polymer chain. The 1-aryl-2,2,2-trifluoroethylidene group is referred to herein as a 3F group and has the following structure: ##STR2## wherein Ar' is an aryl group.
Ernst Chain: a great man of science.
Kardos, Nelson; Demain, Arnold L
2013-08-01
This paper is a tribute to the scientific accomplishments of Ernst Chain and the influence he exerted over the fields of industrial microbiology and biotechnology. Chain is the father of the modern antibiotic era and all the benefits that these therapeutic agents have brought, i.e., longer life spans, greater levels of public health, widespread modern surgery, and control of debilitating infectious diseases, including tuberculosis, gonorrhea, syphilis, etc. Penicillin was the first antibiotic to become commercially available, and its use ushered in the age of antibiotics. The discovery of penicillin's bactericidal action had been made by Alexander Fleming in London in 1928. After publishing his observations in 1929, no further progress was made until the work was picked up in 1939 by scientists at Oxford University. The group was headed by Howard Florey, and Chain was the group's lead scientist. Chain was born and educated in Germany, and he fled in 1933 as a Jewish refugee from Nazism to England. Other important members of the Oxford research team were Norman Heatley and Edward Abraham. The team was able to produce and isolate penicillin under conditions of scarce resources and many technical challenges. Sufficient material was collected and tested on mice to successfully demonstrate penicillin's bactericidal action on pathogens, while being nontoxic to mammals. Chain directed the microbiological methods for producing penicillin and the chemical engineering methods to extract the material. This technology was transferred to US government facilities in 1941 for commercial production of penicillin, becoming an important element in the Allied war effort. In 1945, the Nobel Prize for medicine was shared by Fleming, Florey, and Chain in recognition of their work in developing penicillin as a therapeutic agent. After World War II, Chain tried to persuade the British government to fund a new national antibiotic industry with both research and production facilities. As resources were scarce in postwar Britain, the British government declined the project. Chain then took a post in 1948 at Rome's Instituto Superiore di Sanitá, establishing a new biochemistry department with a pilot plant. During that period, his department developed important new antibiotics (including the first semisynthetic antibiotics) as well as improved technological processes to produce a wide variety of important microbial metabolites that are still in wide use today. Chain was also responsible for helping several countries to start up a modern penicillin industry following World War II, including the Soviet Union and the People's Republic of China. In 1964, Chain returned to England to establish a new biochemistry department and industrial scale fermentation pilot plant at Imperial College in London. Imperial College became the preeminent biochemical department in Europe. Chain was also a pioneer in changing the relationship between government, private universities, and private industry for collaboration and funding to support medical research. Ernst Chain has left a lasting impact as a great scientist and internationalist.
Zhou, Shengmin; Wang, Yueqiang; Jiang, Yuanrong; Zhang, Zhongfei; Sun, Xiangjun; Yu, Liangli Lucy
2017-08-01
Three medium- and long-chain triacylglycerols (MLCT) with different contents of medium-chain fatty acids (MCFA) (10% to 30%, w/w) were prepared and evaluated for their anti-obesity potential in C57BL/6J mice. The group fed with a high fat diet of MLCT containing 30% (w/w) MCFA showed significantly decreased body weight and fat mass (P < 0.05) relative to the control mice fed an obesity-inducing high fat rapeseed oil diet. In addition, serum parameters including triacylglycerols, total cholesterol, glucose, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, apolipoprotein A1 and apolipoprotein B in the treatment group fed with 30% (w/w) MCFA were close to those of mice fed with a low fat rapeseed oil diet, but significantly different (P < 0.05) from those of the obesity control group. Moreover, the intake of MLCT with high content of MCFA reduced the size of adipocytes. In addition, the visceral fat and liver weights, as well as the liver triacylglycerol for 3 treatment groups were lower than those of the obesity control group. These results demonstrate the great potential of MLCT with high content of MCFA in weight loss. © 2017 Institute of Food Technologists®.
Wang, H; Zhan, R; Hunter, F; Du, J; Black, D
1996-06-01
The purpose of this study was to determine the effects of dietary fatty acids of varying chain lengths and degrees of saturation on intestinal apolipoprotein (apo) B and A-I expression in the newborn piglet. Two-day-old female piglets received one of three isocaloric formulas containing 48% of total calories (120 kcal/kg/24 h) as medium-chain triglycerides (MCT) from MCT oil, intermediate-chain saturated triglycerides (ICST) from coconut oil, or long-chain polyunsaturated triglycerides (LCPUT) from safflower oil by continuous duodenal infusion for 24 h. After in situ radiolabeling, jejunal and ileal mucosal apo B-48 and A-I were immunoprecipitated, and synthesis was expressed as percentage of total protein synthesis. Mucosal apo B and A-I mass was measured by ELISA as nanograms of apoprotein/microgram of total protein. Fifty percent less apo B jejunal synthesis was present in the ICST group versus the MCT and LCPUT groups (0.67 +/- 0.07, 1.19 +/- 0.20, and 1.25 +/- 0.15, respectively, mean +/- SEM, p < 0.05). Jejunal apo B mass was lower in the MCT group versus the ICST and LCPUT groups (0.10 +/- 0.02, 0.21 +/- 0.03, and 0.16 +/- 0.03, respectively, p < 0.05). Ileal apo B synthesis was lowest in the ICST group. No differences were found in ileal apo B mass. Two-fold higher jejunal apo A-I synthesis was found in the LCPUT group versus the MCT and ICST groups (14.18 +/- 1.69, 7.56 +/- 2.63, and 6.36 +/- 0.58, respectively, p < 0.01). No differences were found for jejunal apo A-I mass. In the ileum, the only difference was a higher apo A-I mass in the LCPUT group (p < 0.05). We conclude that in the newborn piglet intestinal apo B and A-I expression is acutely and differentially regulated by dietary lipid varying in fatty acid chain length and saturation. The patterns of regulation are complex and vary among specific apolipoproteins and regions of the small intestine and include co- and posttranslational mechanisms.
Jones, Margaret T
2014-01-01
Purpose To determine the impact of inclusion of a band or chain compensatory acceleration training (CAT), in a 5-week training phase, on maximal upper body strength during a 14-week off-season strength and conditioning program for collegiate male athletes. Patients and methods Twenty-four National Collegiate Athletic Association (NCAA) collegiate baseball players, who were familiar with the current strength and conditioning program and had a minimum of 1 year of formal collegiate strength and conditioning experience, participated in this off-season training study. None of the men had participated in CAT before. Subjects were matched following a maximal effort (1-repetition maximum [1-RM]) bench press test in week 1, then were randomly assigned into a band-based CAT group or a chain-based CAT group and participated in a 5-week training phase that included bench pressing twice per week. Upper body strength was measured by 1-RM bench press again at week 6. A 2 × 2 mixed factorial (method × time) analysis of variance was calculated to compare differences across groups. The alpha level was set at P<0.05. Results No difference (F1,22=0.04, P=0.84) existed between the band-based CAT and chain-based CAT groups. A significant difference was observed between pre- and posttests of 1-RM bench (F1,22=88.46, P=0.001). Conclusion A 5-week band CAT or chain CAT training program used in conjunction with an off-season strength and conditioning program can increase maximal upper body strength in collegiate baseball athletes. Using band CAT and/or chain CAT as a training modality in the off-season will vary the training stimulus from the traditional and likely help to maintain the athlete’s interest. PMID:25177154
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-11
... include three members from the agriculture-related private sector; two members from institutions of higher... the 2008 Farm Bill. The Act provides for the creation of the Consultative Group. DATES: March 18, 2010... the global supply chains within the agricultural sector or other industries; (b) The roles and...
Effect of Bleaching Mouthwash on Force Decay of Orthodontic Elastomeric Chains.
Behnaz, Mohammad; Namvar, Fatemeh; Sohrabi, Setareh; Parishanian, Mina
2018-02-01
Force decay elastomeric chains are significant, and it is a clinical problem. The aim of this study was to evaluate the effects of bleaching agent in the mouthwash on the force decay of orthodontic chains. In this experimental study, 160 gray closed elastomeric chains were randomly divided into three groups (one control and two test groups). Four loops of chains were stretched for 25 mm on custom-made jig. Control group specimens were immersed in artificial saliva during the test period. Test group specimens were immersed twice a day for 30 seconds in the whitening (LISTERINE® HEALTHY WHITE™) and daily sodium fluoride (LISTERINE® TOTAL CARE ZERO) mouthwashes. All specimens were immersed in artificial saliva at 37°C. Force was measured at different time points (initial, 1, 7, 14, 21, 28 days). Statistical analysis was performed by two-way analysis of variance (ANOVA) and Bonferroni methods (a = 0.05). Force of elastomeric chains was decreased dramatically in all groups during the experiment. After 24 hours, force was decreased by 42.18, 48.34, and 53.38% in control group, daily, and bleaching mouthwash groups respectively. The corresponding numbers after 4 weeks were 66.30, 76.73, and 86.48. The difference between three groups at days 1 and 28 was statistically significant (p < 0.05). Within the limitations of the current in vitro study, bleaching and sodium fluoride mouthwashes could cause force decay of orthodontic elastomeric chains. Whitening mouthwash is more weakening for elastomeric chains. Use of whitening mouthwash by orthodontic patients could decrease the force of elastomeric chains, so it could be recommended to use them for a short time.
Imanari, M; Kadowaki, M; Fujimura, S
2008-05-01
1. The effects of dietary branched-chain amino acids (BCAAs) including leucine (Leu), isoleucine (Ile) and valine (Val) on taste-active components, especially free glutamate (Glu), in meat were investigated. 2. Broiler chickens (28 d old) were given varied dietary BCAA levels for 10 d before marketing. Dietary BCAA content ratios were either 100:100:100 (Low Leu group), 150:100:100 (Control group) or 150:150:150 (High Ile + Val group) for Leu:Ile:Val (% of each BCAA requirement according to NRC, 1994). Taste-related components of meat (free amino acids and ATP metabolites) and sensory scores of meat soup were estimated. 3. Free Glu content, the main taste-active component of meat, was significantly increased by dietary BCAA. Compared to the Control group, free Glu content increased by 30% in the High Ile + Val group. However, the inosine monophosphate (IMP) content in meat did not change among groups. 4. Sensory evaluation of meat soups showed that Control and High Ile + Val groups had different meat flavours. The sensory score of overall taste intensity was significantly higher in the High Ile + Val group. 5. These results suggest that dietary BCAA concentrations regulate free Glu in meat. Increasing dietary Ile + Val induces an increase in free Glu content of meat, improves meat taste and is more effective for increasing free Glu content in meat than decreasing dietary Leu level.
Nomura, Yukinobu; Inui, Kazuo; Yoshino, Junji; Wakabayashi, Takao; Okushima, Kazumu; Kobayashi, Takashi; Miyoshi, Hironao; Nakamura, Yuta
2007-09-01
This study was undertaken to clarify the importance of nutritional status in patients with acute cholecystitis, and also evaluate whether they benefited from enteral nutrition supplementation, including medium-chain triglycerides (MCT), during the convalescent stage. Patients with acute cholecystitis admitted to our hospital between April 1994 and March 2002 were classified into a poor nutrition group (n=40; total serum protein<5.0 g/dl) or a fair nutrition group (n=71; >5.0 g/dl). Patients with poor nutrition were significantly more elderly than those with fair nutrition, and had significantly higher serum C-reactive protein (CRP) concentrations. The two groups did not differ significantly with respect to other laboratory data, gender distribution, or medical treatment. We supplemented ordinary meals with enteral nutrition including MCT in 16 patients during the convalescent stage (MCT group). We compared their length of hospital stay and days required to recovery to pre-admission functional status for activities of daily living (ADL) with the same intervals in 16 patients without supplementation (non-MCT group) selected to match for age, gender, and fair or poor nutritional status from among 111 patients. Hospitalizations were significantly longer in the poor nutrition group (43.0+/-2.2 days) than in the fair nutrition group (27.0+/-8.2 days). Significantly more days were required to recover ADL status in the poor nutrition group (12.0+/-7.2 days) than in the fair group (9.4+/-5.2 days). Hospitalizations were significantly shorter in the MCT group (20.1+/-15 days) than in the non-MCT group (35.4+/-12.8 days). Significantly fewer days were required to recover ADL status in the MCT group (10.9+/-7 days) than in the non-MCT group (13.1+/-6.8 days). Administration of enteral nutrition including MCT during convalescence from acute cholecystitis thus appears to promote functional recovery shorten hospital stay.
Self-Consistent Field Theories for the Role of Large Length-Scale Architecture in Polymers
NASA Astrophysics Data System (ADS)
Wu, David
At large length-scales, the architecture of polymers can be described by a coarse-grained specification of the distribution of branch points and monomer types within a molecule. This includes molecular topology (e.g., cyclic or branched) as well as distances between branch points or chain ends. Design of large length-scale molecular architecture is appealing because it offers a universal strategy, independent of monomer chemistry, to tune properties. Non-linear analogs of linear chains differ in molecular-scale properties, such as mobility, entanglements, and surface segregation in blends that are well-known to impact rheological, dynamical, thermodynamic and surface properties including adhesion and wetting. We have used Self-Consistent Field (SCF) theories to describe a number of phenomena associated with large length-scale polymer architecture. We have predicted the surface composition profiles of non-linear chains in blends with linear chains. These predictions are in good agreement with experimental results, including from neutron scattering, on a range of well-controlled branched (star, pom-pom and end-branched) and cyclic polymer architectures. Moreover, the theory allows explanation of the segregation and conformations of branched polymers in terms of effective surface potentials acting on the end and branch groups. However, for cyclic chains, which have no end or junction points, a qualitatively different topological mechanism based on conformational entropy drives cyclic chains to a surface, consistent with recent neutron reflectivity experiments. We have also used SCF theory to calculate intramolecular and intermolecular correlations for polymer chains in the bulk, dilute solution, and trapped at a liquid-liquid interface. Predictions of chain swelling in dilute star polymer solutions compare favorably with existing PRISM theory and swelling at an interface helps explain recent measurements of chain mobility at an oil-water interface. In collaboration with: Renfeng Hu, Colorado School of Mines, and Mark Foster, University of Akron. This work was supported by NSF Grants No. CBET- 0730692 and No. CBET-0731319.
Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo
2007-06-19
Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.
Zhao, Qian; Wang, Liping; Song, Ping; Li, Feng; Zhou, Xiaogang; Yu, Yaping; An, Zhiming; Wang, Xuli; Zhai, Yongping
2016-04-01
To explore the feature of primary light chain amyloidosis patients treated with high-dose melphalan with auto peripheral blood stem cell transplantation (auto-PBSCT) and bortezomib plus dexamethasone (VD). Thirty-eight patients diagnosed from September 2004 to September 2012 were analyzed retrospectively, including 15 cases received auto-PBSCT, 23 cases exposed with VD. The median follow-up duration for the patients was 34 months (range, 1-112 months), including auto-PBSCT group of 38 months (range, 5-112 months) and VD group of 31 months (range, 1-108 months). The organ response rate in all the patients was 39.5% (15/38), and the organ response rate between these two groups has no significant difference [33.3% (5/15) vs 43.5% (10/23), P=0.532]. However, the median time of organ response was significant difference [6 (3-10) months vs 3 (1-6) months, respectively (P=0.032)]. The 3-year overall survival (OS) rates in the two groups were 72.0% and 66.9%, and their average survival were 84.7 months and 75.9 months, respectively (P=0.683). In the patients with auto-PBSCT, the occurrence of III-IV grade of bone marrow suppression (P<0.001), fever (P<0.001), nausea and infection (P=0.006) were obviously higher than those with VD, but there was no statistically significant difference in pulmonary infection (P=0.069) and bloodstream infection (P=0.059). The preliminary results have presented that primary light chain amyloidosis patients treated with auto-PBSCT or VD had similar organ response rate and survival. However, more adverse events occurred in the group of auto-PBSCT.
Detritus feeding as a buffer to extinction at the end of the Cretaceous
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheehan, P.M.; Hansen, T.A.
1986-10-01
At the end of the Cretaceous the principal animals that became extinct, such as dinosaurs, marine animals that lived in the water column, and benthic filter feeders, were in food chains tied directly to living plant matter. Animal groups less affected by extinction, including marine benthic scavengers and deposit feeders, small insectivorous mammals, and members of stream communities, were in food chains dependent on dead plant material. The proposal that an asteroid or comet impact at the end of the Cretaceous produced a dust cloud that cut off photosynthesis for several months is consistent with this pattern of extinction. Foodmore » chains dependent on living plant matter crashed, while food chains based on detritus were buffered from extinction because there was a food supply adequate for the interval when photosynthesis was halted.« less
Swanson, Basil I.; Song, Xuedong; Unkefer, Clifford; Silks, III, Louis A.; Schmidt, Jurgen G.
2003-09-30
A sensor for the detection of tetrameric multivalent neuraminidase within a sample is disclosed, where a positive detection indicates the presence of a target virus within the sample. Also disclosed is a trifunctional composition of matter including a trifunctional linker moiety with groups bonded thereto including (a) an alkyl chain adapted for attachment to a substrate, (b) a fluorescent moiety capable of generating a fluorescent signal, and (c) a recognition moiety having a spacer group of a defined length thereon, the recognition moiety capable of binding with tetrameric multivalent neuraminidase.
Swanson, Basil I.; Song, Xuedong; Unkefer, Clifford; Silks, III, Louis A.; Schmidt, Jurgen G.
2006-03-28
A sensor for the detection of tetrameric multivalent neuraminidase within a sample is disclosed, where a positive detection indicates the presence of a target virus within the sample. Also disclosed is a trifunctional composition of matter including a trifunctional linker moiety with groups bonded thereto including (a) an alkyl chain adapted for attachment to a substrate, (b) a fluorescent moiety capable of generating a fluorescent signal, and (c) a recognition moiety having a spacer group of a defined length thereon, the recognition moiety capable of binding with tetrameric multivalent neuraminidase.
Swanson, Basil I.; Song, Xuedong; Unkefer, Clifford; Silks, III, Louis A.; Schmidt, Jurgen G.
2005-05-17
A sensor for the detection of tetrameric multivalent neuraminidase within a sample is disclosed, where a positive detection indicates the presence of a target virus within the sample. Also disclosed is a trifunctional composition of matter including a trifunctional linker moiety with groups bonded thereto including (a) an alkyl chain adapted for attachment to a substrate, (b) a fluorescent moiety capable of generating a fluorescent signal, and (c) a recognition moiety having a spacer group of a defined length thereon, the recognition moiety capable of binding with tetrameric multivalent neuraminidase.
Dennis, Ann M; Murillo, Wendy; de Maria Hernandez, Flor; Guardado, Maria Elena; Nieto, Ana Isabel; Lorenzana de Rivera, Ivette; Eron, Joseph J; Paz-Bailey, Gabriela
2013-05-01
HIV in Central America is concentrated among certain groups such as men who have sex with men (MSM) and female sex workers (FSWs). We compared social recruitment chains and HIV transmission clusters from 699 MSM and 787 FSWs to better understand factors contributing to ongoing HIV transmission in El Salvador. Phylogenies were reconstructed using pol sequences from 119 HIV-positive individuals recruited by respondent-driven sampling (RDS) and compared with RDS chains in 3 cities in El Salvador. Transmission clusters with a mean pairwise genetic distance ≤ 0.015 and Bayesian posterior probabilities =1 were identified. Factors associated with cluster membership were evaluated among MSM. Sequences from 34 (43%) MSM and 4 (10%) FSW grouped in 14 transmission clusters. Clusters were defined by risk group (12 MSM clusters) and geographic residence (only 1 spanned separate cities). In 4 MSM clusters (all n = 2), individuals were also members of the same RDS chain, but only 2 had members directly linked through recruitment. All large clusters (n ≥ 3) spanned >1 RDS chain. Among MSM, factors independently associated with cluster membership included recent infection by BED assay (P = 0.02), sex with stable male partners (P = 0.02), and sex with ≥ 3 male partners in the past year (P = 0.04). We found few HIV transmissions corresponding directly with the social recruitment. However, we identified clustering in nearly one-half of MSM suggesting that RDS recruitment was indirectly but successfully uncovering transmission networks, particularly among recent infections. Interrogating RDS chains with phylogenetic analyses may help refine methods for identifying transmission clusters.
Dispersions of polymer ionomers: I.
Capek, Ignác
2004-12-31
The principal subject discussed in the current paper is the effect of ionic functional groups in polymers on the formation of nontraditional polymer materials, polymer blends or polymer dispersions. Ionomers are polymers that have a small amount of ionic groups distributed along a nonionic hydrocarbon chain. Specific interactions between components in a polymer blend can induce miscibility of two or more otherwise immiscible polymers. Such interactions include hydrogen bonding, ion-dipole interactions, acid-base interactions or transition metal complexation. Ion-containing polymers provide a means of modifying properties of polymer dispersions by controlling molecular structure through the utilization of ionic interactions. Ionomers having a relatively small number of ionic groups distributed usually along nonionic organic backbone chains can agglomerate into the following structures: (1) multiplets, consisting of a small number of tightly packed ion pairs; and (2) ionic clusters, larger aggregates than multiplets. Ionomers exhibit unique solid-state properties as a result of strong associations among ionic groups attached to the polymer chains. An important potential application of ionomers is in the area of thermoplastic elastomers, where the associations constitute thermally reversible cross-links. The ionic (anionic, cationic or polar) groups are spaced more or less randomly along the polymer chain. Because in this type of ionomer an anionic group falls along the interior of the chain, it trails two hydrocarbon chain segments, and these must be accommodated sterically within any domain structure into which the ionic group enters. The primary effects of ionic functionalization of a polymer are to increase the glass transition temperature, the melt viscosity and the characteristic relaxation times. The polymer microstructure is also affected, and it is generally agreed that in most ionomers, microphase-separated, ion-rich aggregates form as a result of strong ion-dipole attractions. As a consequence of this new phase, additional relaxation processes are often observed in the viscoelastic behavior of ionomers. Light functionalization of polymers can increase the glass transition temperature and gives rise to two new features in viscoelastic behavior: (1) a rubbery plateau above T(g) and (2) a second loss process at elevated temperatures. The rubbery plateau was due to the formation of a physical network. The major effect of the ionic aggregate was to increase the longer time relaxation processes. This in turn increases the melt viscosity and is responsible for the network-like behavior of ionomers above the glass transition temperature. Ionomers rich in polar groups can fulfill the criteria for the self-assembly formation. The reported phenomenon of surface micelle formation has been found to be very general for these materials.
Abiedalla, Younis; DeRuiter, Jack; Clark, C Randall
2016-07-30
Precursor materials are available to prepare aminoketone drugs containing regioisomeric propyl and isopropyl side-chain groups related to the drug alpha-pyrrovalerone (Flakka) and MDPV (3,4-methylenedioxypyrrovalerone). These compounds yield equivalent regioisomeric iminium cation base peaks in electron ionization mass spectrometry (EI-MS). The propyl and isopropyl side-chain groups related to alpha-pyrrovalerone and MDPV were prepared and evaluated in EI-MS and tandem mass spectrometry (MS/MS) product ion experiments. Deuterium labeling in both the pyrrolidine and alkyl side-chain groups allowed for the confirmation of the structures for the major product ions formed from the regioisomeric EI-MS iminium cation base peaks. These iminium cation base peaks show characteristic product ion spectra which allow differentiation of the side-chain propyl and isopropyl groups in the structure. The n-propyl side chain containing iminium cation base peak (m/z 126) in the EI-MS spectrum yields a major product ion at m/z 84 while the regioisomeric m/z 126 base peak for the isopropyl side chain yields a characteristic product ion at m/z 70. Deuterium labeling in both the pyrrolidine ring and the alkyl side chain confirmed the process for the formation of these major product ions. Product ion fragmentation provides useful data for differentiation of n-propyl and isopropyl side-chain iminium cations from cathinone derivative drugs of abuse. Regioisomeric n-propyl and isopropyl iminium cations of equal mass yield characteristic product ions identifying the alkyl side-chain regioisomers in the pyrrolidine cathinone derivatives. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Tools and approaches to ensure quality of vaccines throughout the cold chain.
Kartoglu, Umit; Milstien, Julie
2014-07-01
The Expanded Program on Immunization was designed 40 years ago for two types of vaccines: those that are heat stable but freeze sensitive and those that are stable to freezing but heat labile. A cold chain was developed for transport and storage of such vaccines and established in all countries, despite limited access to resources and electricity in the poorest areas. However, cold chain problems occur in all countries. Recent changes to vaccines and vaccine handling include development and introduction of new vaccines with a wide range of characteristics, improvement of heat stability of several basic vaccines, observation of vaccine freezing as a real threat, development of regulatory pathways for both vaccine development and the supply chain, and emergence of new temperature monitoring devices that can pinpoint and avoid problems. With such tools, public health groups have now encouraged development of vaccines labeled for use in flexible cold chains and these tools should be considered for future systems.
Joining psychiatric care and faith healing in a prayer camp in Ghana: randomised trial.
Ofori-Atta, A; Attafuah, J; Jack, H; Baning, F; Rosenheck, R
2018-01-01
Care of people with serious mental illness in prayer camps in low-income countries generates human rights concerns and ethical challenges for outcome researchers. Aims To ethically evaluate joining traditional faith healing with psychiatric care including medications (Clinical trials.gov identifier NCT02593734). Residents of a Ghana prayer camp were randomly assigned to receive either indicated medication for schizophrenia or mood disorders along with usual prayer camp activities (prayers, chain restraints and fasting) (n = 71); or the prayer camp activities alone (n = 68). Masked psychologists assessed Brief Psychiatric Rating Scale (BPRS) outcomes at 2, 4 and 6 weeks. Researchers discouraged use of chaining, but chaining decisions remained under the control of prayer camp staff. Total BPRS symptoms were significantly lower in the experimental group (P = 0.003, effect size -0.48). There was no significant difference in days in chains. Joining psychiatric and prayer camp care brought symptom benefits but, in the short-run, did not significantly reduce days spent in chains. Declaration of interest None.
Tools and approaches to ensure quality of vaccines throughout the cold chain
Kartoglu, Umit; Milstien, Julie
2014-01-01
The Expanded Program on Immunization was designed 40 years ago for two types of vaccines: those that are heat stable but freeze sensitive and those that are stable to freezing but heat labile. A cold chain was developed for transport and storage of such vaccines and established in all countries, despite limited access to resources and electricity in the poorest areas. However, cold chain problems occur in all countries. Recent changes to vaccines and vaccine handling include development and introduction of new vaccines with a wide range of characteristics, improvement of heat stability of several basic vaccines, observation of vaccine freezing as a real threat, development of regulatory pathways for both vaccine development and the supply chain, and emergence of new temperature monitoring devices that can pinpoint and avoid problems. With such tools, public health groups have now encouraged development of vaccines labeled for use in flexible cold chains and these tools should be considered for future systems. PMID:24865112
Polyphosphazine-based polymer materials
Fox, Robert V.; Avci, Recep; Groenewold, Gary S.
2010-05-25
Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.
Conformational studies of the capsular polysaccharide produced by Neisseria meningitidis group A.
Foschiatti, Michela; Hearshaw, Meredith; Cescutti, Paola; Ravenscroft, Neil; Rizzo, R
2009-05-12
The effect of different cations on the conformational and morphological properties of the capsular polysaccharide produced by Neisseria meningitidis group A was investigated. Circular dichroism studies showed that the presence of Na(+), NH4+ or Ca(2+) ions induced different local conformations of the polysaccharide chain through interactions with the phosphodiester group bridging the saccharide residues in the polymer chain. Atomic force microscopy experiments confirmed that the morphology of the polysaccharide chains was different depending on the nature of the counterion. Ammonium ions were associated with the presence of single polymer chains in an elongated conformation, whereas sodium ions favored the folding of the chains into a globular conformation. The addition of calcium ions produced the aggregation of a limited number of globular polysaccharide chains to form a 'toroidal-like' structure.
NASA Astrophysics Data System (ADS)
Bolintineanu, Dan S.; Lane, J. Matthew D.; Grest, Gary S.
2013-03-01
We report fully atomistic molecular dynamics simulations of alkanethiol coated gold nanoparticles solvated in water and decane. The structure of the coatings is analyzed as a function of various functional end groups, including amine and carboxyl groups in different neutralization states. We study the effects of charge in the end groups for two different chain lengths (10 and 18 carbons) and different counterions (mono- and divalent). For the longer alkanes we find significant local phase segregation of chains on the nanoparticle surface, which results in highly asymmetric coating structures. In general, the charged end groups attenuate this effect by enhancing the water solubility of the nanoparticles. Based on the coating structures and density profiles, we can qualitatively infer the overall solubility of the nanoparticles. The asymmetry in the alkanethiol coatings is also likely to have a significant effect on aggregation behavior. More importantly, our simulations suggest the ability to modulate end group charge states (e.g. by changing the pH of the solution) in order to control coating structure, and therefore control solubility and aggregation behavior.
NASA Astrophysics Data System (ADS)
Jagvaral, Yesukhei; He, Haiying; Pandey, Ravindra
2018-01-01
Silicene is an emerging 2D material, and an understanding of its interaction with amino acids, the basic building blocks of protein, is of fundamental importance. In this paper, we investigate the nature of adsorption of amino-acid analogues on silicene employing density functional theory and an implicit solvation model. Amino acid analogues are defined as CH3-R molecules, where R is the functional group of the amino acid side chain. The calculated results find three distinct groups within the amino-acid analogues considered: (i) group I, which includes MeCH3 and MeSH, interacts with silicene via the van der Waals dispersive terms leading to physisorbed configurations; (ii) group II strongly interacts with silicene forming Si-O/N chemical bonds in the chemisorbed configurations; and (iii) group III, which consists of the phenyl group, interacts with silicene via π-π interactions leading to physisorbed configurations. The results show that the lateral chains of the amino acids intrinsically determine the interactions between protein and silicene at the interface under the given physiological conditions.
Zamora, Rosario; León, M Mercedes; Hidalgo, Francisco J
2015-09-16
Comparative formation of both 2-phenylethylamine and phenylacetaldehyde as a consequence of phenylalanine degradation by carbonyl compounds was studied in an attempt to understand if the amine/aldehyde ratio can be changed as a function of reaction conditions. The assayed carbonyl compounds were selected because of the presence in the chain of both electron-donating and electron-withdrawing groups and included alkenals, alkadienals, epoxyalkenals, oxoalkenals, and hydroxyalkenals as well as lipid hydroperoxides. The obtained results showed that the 2-phenylethylamine/phenylacetaldehyde ratio depended upon both the carbonyls and the reaction conditions. Thus, it can be increased using electron-donating groups in the chain of the carbonyl compound, small amounts of carbonyl compound, low oxygen content, increasing the pH, or increasing the temperature at pH 6. Opposed conditions (use of electron-withdrawing groups in the chain of the carbonyl compound, large amounts of carbonyl compound, high oxygen contents, low pH values, and increasing temperatures at low pH values) would decrease the 2-phenylethylamine/phenylacetaldehyde ratio, and the formation of aldehydes over amines in amino acid degradations would be favored.
How to polymerize ethylene in a highly controlled fashion?
Kempe, Rhett
2007-01-01
Very fast, reversible, polyethylene (PE) chain transfer or complex-catalysed "Aufbaureaktion" describes a "living" chain-growing process on a main-group metal or zinc atom; this process is catalysed by an organo-transition-metal or lanthanide complex. PE chains are transferred very fast between the two metal sites and chain growth takes place through ethylene insertion into the transition-metal- or lanthanide-carbon bond-coordinative chain-transfer polymerisation (CCTP). The transferred chains "rest" at the main-group or zinc centre, at which chain-termination processes like beta-H transfer/elimination are of low significance. Such protocols can be used to synthesise very narrowly distributed PE materials (M(w)/M(n)<1.1 up to a molecular weight of about 4000 g mol(-1)) with differently functionalised end groups. Higher molecular-weight polymers can be obtained with a slightly increased M(w)/M(n), since diffusion control and precipitation of the polymers influences the chain-transfer process. Recently, a few transition-metal- or lanthanide-based catalyst systems that catalyse such a highly reversible chain-growing process have been described. They are summarised and compared within this contribution.
Wu, Wenfei; Li, Bafang; Hou, Hu; Zhang, Hongwei; Zhao, Xue
2017-12-13
A calcium-chelating peptide is considered to have the ability to improve calcium absorption. In this study, Pacific cod skin gelatin hydrolysates treated with trypsin for 120 min exhibited higher calcium-chelating activity. Sequential chromatography, involving hydroxyapatite affinity chromatography and reversed phase high performance liquid chromatography, was used for the purification of calcium-chelating peptides. Two novel peptides with the typical characteristics of collagen were sequenced as GDKGESGEAGER and GEKGEGGHR based on LC-HRMS/MS, which showed a high affinity to calcium. Calcium-peptide complexation was further characterized by ESI-MS (MS and MS/MS) and FTIR spectroscopy. The results showed that the complexation of the two peptides with calcium was conducted mainly at the ratio of 1 : 1. The amino terminal group and the peptide bond of the peptide backbone as well as the amino group of the lysine side chain and the carboxylate of the glutamate side chain were the possible calcium binding sites for the two peptides. Meanwhile, several amino acid side chain groups, including the hydroxyl (Ser) and carboxylate (Asp) of GDKGESGEAGER and the imine (His) of GEKGEGGHR, were crucial in the complexation. The arginine residue in GEKGEGGHR also participated in the calcium coordination. Additionally, several active fragments with calcium-chelating activity were obtained using MS/MS spectra, including GDKGESGEAGE, GEAGER, GEK, EKG and KGE. This study suggests that gelatin-derived peptides have the potential to be used as a calcium-chelating ingredient to combat calcium deficiency.
Mallik, Abul K; Qiu, Hongdeng; Kuwahara, Yutaka; Takafuji, Makoto; Ihara, Hirotaka
2015-09-28
A double β-alanylated L-glutamide-derived organic phase has been newly designed and synthesized in such a way that integrated H-bonding (interaction) sites make it very suitable for the separation of versatile analytes, including shape-constrained isomers, and nonpolar, polar and basic compounds. The β-alanine residues introduced into two long-chain alkyl group moieties provide ordered polar groups through H-bonding among the amide groups.
Sakai, Yoshiyuki; Iwata, Yoshinori; Enomoto, Hirayuki; Saito, Masaki; Yoh, Kazunori; Ishii, Akio; Takashima, Tomoyuki; Aizawa, Nobuhiro; Ikeda, Naoto; Tanaka, Hironori; Iijima, Hiroko; Nishiguchi, Shuhei
2015-01-01
The usefulness of branched-chain amino acid (BCAA) granules and BCAA-enriched nutrient mixtures for patients with liver cirrhosis is often reported. However, no randomized controlled studies have investigated the usefulness of these supplements in the nutritional intervention of cirrhotic patients receiving endoscopic treatment for esophageal varices. Patients without BCAA before endoscopic treatment were divided into study 1, and those who received BCAA were divided into study 2. In study 1, 44 eligible patients were divided into a control group (n = 13), a general liquid nutrient (snack) group (n = 15), and a BCAA-enriched nutrient mixture (BCAA-EN) group (n = 16). In study 2, 48 eligible patients were divided into a BCAA group (n = 24) and a BCAA-EN group (n = 24). The nutritional status including non-protein respiratory quotient (NPRQ) levels, weight gain, and albumin were evaluated on days 0, 7, and 50. In study 1, the BCAA-EN group showed significant improvement in NPRQ levels on day 7 as compared with the snack group. In study 2, the BCAA-EN group showed significant improvement in NPRQ levels on day 7 and in weight levels on day 50 relative to the BCAA group, while the BCAA group showed improved serum albumin levels on day 7 compared to the BCAA-EN group. The BCAA-enriched nutrient mixture maintained NPRQ and weight in cirrhotic patients. Our findings suggest that supplements including both BCAA and a nutritional energy supplement would be beneficial for cirrhotic patients undergoing endoscopic treatment for esophageal varices.
NASA Technical Reports Server (NTRS)
Beratan, David N. (Inventor)
1991-01-01
Highly conjugated organic polymers typically have large non-resonant electronic susceptibilities, which give the molecules unusual optical properties. To enhance these properties, defects are introduced into the polymer chain. Examples include light doping of the conjugated polymer and synthesis, conjugated polymers which incorporate either electron donating or accepting groups, and conjugated polymers which contain a photoexcitable species capable of reversibly transferring its electron to an acceptor. Such defects in the chain permit enhancement of the second hyperpolarizability by at least an order of magnitude.
De Jonghe, Lutgard C.; Visco, Steven J.; Liu, Meilin; Mailhe, Catherine C.
1990-01-01
A lithium/organosulfur redox cell is disclosed which comprises a solid lium anode, a liquid organosulfur cathode, and a barrier layer formed adjacent a surface of the solid lithium anode facing the liquid organosulfur cathode consisting of a reaction product of the lithium anode with the organosulfur cathode. The organosulfur cathode comprises a material having the formula (R(S).sub.y).sub.N where y=1 to 6, n=2 to 20 and R is one or more different aliphatic or aromatic organic moieties having 1 to 20 carbon atoms, which may include one or more oxygen, sulfur, nitrogen, or fluorine atoms associated with the chain when R comprises an aliphatic chain, wherein the linear chain may be linear or branched, saturated or unsaturated, and wherein either the aliphatic chain or the aromatic ring may have substituted groups thereon.
Xie, Gary; Forst, Christian; Bonner, Carol; Jensen, Roy A
2002-01-01
Tryptophan synthase consists of two subunits, alpha and beta. Two distinct subgroups of beta chain exist. The major group (TrpEb_1) includes the well-studied beta chain of Salmonella typhimurium. The minor group of beta chain (TrpEb_2) is most frequently found in the Archaea. Most of the amino-acid residues important for catalysis are highly conserved between both TrpE subfamilies. Conserved amino-acid residues of TrpEb_1 that make allosteric contact with the TrpEa subunit (the alpha chain) are absent in TrpEb_2. Representatives of Archaea, Bacteria and higher plants all exist that possess both TrpEb_1 and TrpEb_2. In those prokaryotes where two trpEb genes coexist, one is usually trpEb_1 and is adjacent to trpEa, whereas the second is trpEb_2 and is usually unlinked with other tryptophan-pathway genes. TrpEb_1 is nearly always partnered with TrpEa in the tryptophan synthase reaction. However, by default at least six lineages of the Archaea are likely to use TrpEb_2 as the functional beta chain, as TrpEb_1 is absent. The six lineages show a distinctive divergence within the overall TrpEa phylogenetic tree, consistent with the lack of selection for amino-acid residues in TrpEa that are otherwise conserved for interfacing with TrpEb_1. We suggest that the standalone function of TrpEb_2 might be to catalyze the serine deaminase reaction, an established catalytic capability of tryptophan synthase beta chains. A coincident finding of interest is that the Archaea seem to use the citramalate pathway, rather than threonine deaminase (IlvA), to initiate the pathway of isoleucine biosynthesis.
Systems and strippable coatings for decontaminating structures that include porous material
Fox, Robert V [Idaho Falls, ID; Avci, Recep [Bozeman, MT; Groenewold, Gary S [Idaho Falls, ID
2011-12-06
Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Rui; Cheng, Shuang; Baker, Erin Shammel
2016-01-28
Oligoamide 1, consisting of two H-bonding units linked by a trimethylene linker, was previously found to form a very stable, folded dimer. In this work, replacing the side chains and end groups of 1 led to derivatives that show the surprising impact of end groups on the folding and dimer-chain equilibria of the resultant molecules.
Changes in conformational dynamics of basic side chains upon protein–DNA association
Esadze, Alexandre; Chen, Chuanying; Zandarashvili, Levani; Roy, Sourav; Pettitt, B. Montgometry; Iwahara, Junji
2016-01-01
Basic side chains play major roles in recognition of nucleic acids by proteins. However, dynamic properties of these positively charged side chains are not well understood. In this work, we studied changes in conformational dynamics of basic side chains upon protein–DNA association for the zinc-finger protein Egr-1. By nuclear magnetic resonance (NMR) spectroscopy, we characterized the dynamics of all side-chain cationic groups in the free protein and in the complex with target DNA. Our NMR order parameters indicate that the arginine guanidino groups interacting with DNA bases are strongly immobilized, forming rigid interfaces. Despite the strong short-range electrostatic interactions, the majority of the basic side chains interacting with the DNA phosphates exhibited high mobility, forming dynamic interfaces. In particular, the lysine side-chain amino groups exhibited only small changes in the order parameters upon DNA-binding. We found a similar trend in the molecular dynamics (MD) simulations for the free Egr-1 and the Egr-1–DNA complex. Using the MD trajectories, we also analyzed side-chain conformational entropy. The interfacial arginine side chains exhibited substantial entropic loss upon binding to DNA, whereas the interfacial lysine side chains showed relatively small changes in conformational entropy. These data illustrate different dynamic characteristics of the interfacial arginine and lysine side chains. PMID:27288446
Vandecasteele, C M; Hardeman, F; Pauwels, O; Bernaerts, M; Carlé, B; Sombré, L
2005-01-01
In the case of radioactive contamination of the environment with an impact on the food chain, the remediation strategy will not only be based on scientific knowledge and technical experience, but will also be dictated by peculiarities of the country. These characteristics include the agro-industrial structure, the local and international economical contexts and the political configuration including the distribution of responsibilities and competencies. This paper identifies and illustrates the most relevant characteristics of the Belgian agricultural system and political environment; it also describes the past experience with food chain contamination, which is expected to influence the attitude of Belgian stakeholders, who would be involved in the setting up of countermeasure strategies for maintaining agricultural production and food safety. The picture drawn explains why several countermeasures aiming to reduce the contamination in food products, although scientifically sound and technically feasible, are hardly acceptable or even not acceptable at all, to the stakeholders.
Spark Plasma Sintering for Nanostructured Smart Materials
2009-03-02
polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer
Stimulation of insulin secretion by medium-chain triglycerides in patients with cirrhosis 1
McCullough, Frank S.; Tzagournis, Manuel; Greenberger, Norton J.; Linscheer, Willem G.
1971-01-01
Oral medium-chain triglycerides were given to 10 normal volunteers, 12 cirrhotics (group I) without and 28 cirrhotics (group II) with abnormal portal systemic communications (ascites, splenomegaly, oesophageal varices, or surgically-created portacaval shunts). After 30 ml of medium-chain triglyceride oil there was no appreciable change in serum glucose levels in any of the three groups nor in serum insulin levels in the normals and in cirrhotics in group I. However, there was a significant increase in serum insulin levels in the cirrhotic patients in group II. It is suggested that the rise in serum insulin levels after medium-chain triglycerides noted in the cirrhotics with shunts is due to shunting of insulin-containing portal blood around the liver (anatomical shunts) and to a diminished hepatic cell mass capable of extracting insulin (functional shunt). This differential response of serum insulin levels to medium-chain triglycerides may prove to be of value in detecting the presence of abnormal portal systemic communications in cirrhotic patients. PMID:5548559
Garg, Hari G; Mrabat, Hicham; Yu, Lunyin; Hales, Charles A; Li, Boyangzi; Moore, Casey N; Zhang, Fuming; Linhardt, Robert J
2011-08-01
Heparin (HP) inhibits the growth of several cell types in vitro including bovine pulmonary artery (BPA) smooth muscle cells (SMCs). In initial studies we discovered that an O-hexanoylated low-molecular-weight (LMW) HP derivative having acyl groups with 6-carbon chain length was more potent inhibitor of BPA-SMCs than the starting HP. We prepared several O-acylated LMWHP derivatives having 4-, 6-, 8-, 10-, 12-, and 18- carbon acyl chain lengths to determine the optimal acyl chain length for maximum anti-proliferative properties of BPA-SMCs. The starting LMWHP was prepared from unfractionated HP by sodium periodate treatment followed by sodium borohydride reduction. The tri-n-butylammonium salt of this LMWHP was O-acylated with butanoic, hexanoic, octanoic, decanoic, dodecanoic, and stearyl anhydrides separately to give respective O-acylated LMWHP derivatives. Gradient polyacrylamide gel electrophoresis (PAGE) was used to examine the average molecular weights of those O-acylated LMWHP derivatives. NMR analysis indicated the presence of one O-acyl group per disaccharide residue. Measurement of the inhibition of BPA-SMCS as a function of O-acyl chain length shows two optima, at a carbon chain length of 6 (O-hexanoylated LMWHP) and at a carbon chain length 12-18 (O-dodecanoyl and O-stearyl LMWHPs). A solution competition SPR study was performed to test the ability of different O-acylated LMWHP derivatives to inhibit fibroblast growth factor (FGF) 1 and FGF2 binding to surface-immobilized heparin. All the LMWHP derivatives bound to FGF1 and FGF2 but each exhibited slightly different binding affinity.
Solid polymeric electrolytes for lithium batteries
Angell, Charles A.; Xu, Wu; Sun, Xiaoguang
2006-03-14
Novel conductive polyanionic polymers and methods for their preparion are provided. The polyanionic polymers comprise repeating units of weakly-coordinating anionic groups chemically linked to polymer chains. The polymer chains in turn comprise repeating spacer groups. Spacer groups can be chosen to be of length and structure to impart desired electrochemical and physical properties to the polymers. Preferred embodiments are prepared from precursor polymers comprising the Lewis acid borate tri-coordinated to a selected ligand and repeating spacer groups to form repeating polymer chain units. These precursor polymers are reacted with a chosen Lewis base to form a polyanionic polymer comprising weakly coordinating anionic groups spaced at chosen intervals along the polymer chain. The polyanionic polymers exhibit high conductivity and physical properties which make them suitable as solid polymeric electrolytes in lithium batteries, especially secondary lithium batteries.
Determination of the pKa of the N-terminal amino group of ubiquitin by NMR
Oregioni, Alain; Stieglitz, Benjamin; Kelly, Geoffrey; Rittinger, Katrin; Frenkiel, Tom
2017-01-01
Ubiquitination regulates nearly every aspect of cellular life. It is catalysed by a cascade of three enzymes and results in the attachment of the C-terminal carboxylate of ubiquitin to a lysine side chain in the protein substrate. Chain extension occurs via addition of subsequent ubiquitin molecules to either one of the seven lysine residues of ubiquitin, or via its N-terminal α-amino group to build linear ubiquitin chains. The pKa of lysine side chains is around 10.5 and hence E3 ligases require a mechanism to deprotonate the amino group at physiological pH to produce an effective nucleophile. In contrast, the pKa of N-terminal α-amino groups of proteins can vary significantly, with reported values between 6.8 and 9.1, raising the possibility that linear chain synthesis may not require a general base. In this study we use NMR spectroscopy to determine the pKa for the N-terminal α-amino group of methionine1 of ubiquitin for the first time. We show that it is 9.14, one of the highest pKa values ever reported for this amino group, providing a rational for the observed need for a general base in the E3 ligase HOIP, which synthesizes linear ubiquitin chains. PMID:28252051
Peptide/protein-polymer conjugates: synthetic strategies and design concepts.
Gauthier, Marc A; Klok, Harm-Anton
2008-06-21
This feature article provides a compilation of tools available for preparing well-defined peptide/protein-polymer conjugates, which are defined as hybrid constructs combining (i) a defined number of peptide/protein segments with uniform chain lengths and defined monomer sequences (primary structure) with (ii) a defined number of synthetic polymer chains. The first section describes methods for post-translational, or direct, introduction of chemoselective handles onto natural or synthetic peptides/proteins. Addressed topics include the residue- and/or site-specific modification of peptides/proteins at Arg, Asp, Cys, Gln, Glu, Gly, His, Lys, Met, Phe, Ser, Thr, Trp, Tyr and Val residues and methods for producing peptides/proteins containing non-canonical amino acids by peptide synthesis and protein engineering. In the second section, methods for introducing chemoselective groups onto the side-chain or chain-end of synthetic polymers produced by radical, anionic, cationic, metathesis and ring-opening polymerization are described. The final section discusses convergent and divergent strategies for covalently assembling polymers and peptides/proteins. An overview of the use of chemoselective reactions such as Heck, Sonogashira and Suzuki coupling, Diels-Alder cycloaddition, Click chemistry, Staudinger ligation, Michael's addition, reductive alkylation and oxime/hydrazone chemistry for the convergent synthesis of peptide/protein-polymer conjugates is given. Divergent approaches for preparing peptide/protein-polymer conjugates which are discussed include peptide synthesis from synthetic polymer supports, polymerization from peptide/protein macroinitiators or chain transfer agents and the polymerization of peptide side-chain monomers.
Tanaka, Hiroaki; Fukahori, Suguru; Baba, Shinji; Ueno, Takato; Sivakumar, Ramadoss; Yagi, Minoru; Asagiri, Kimio; Ishii, Shinji; Tanaka, Yoshiaki
2016-05-01
The aim of the present study was to elucidate whether the administration of antioxidant-rich nutrients, including branched-chain amino acids (BCAAs), microelements, and vitamins, both alone and in combination, has a positive impact on liver function in a nonalcoholic steatohepatitis (NASH) mouse model and identify the mechanisms underlying these effects. Seven-week-old male KKAy mice fed a methionine- and choline-deficient diet (MCD) for 4 weeks were divided into 7 groups and fed the following planned diets for another 4 weeks: group A (normal diet), group B (MCD; control), group C (MCD with rich microelements), group D (MCD with rich BCAAs), group E (MCD with rich microelements and BCAAs), and group F (MCD with rich microelements, BCAAs, and vitamins). We then conducted biochemical assays, histological analyses, immunohistochemistry for 8-hydroxy-2'-deoxyguanosine (8-OHdG) and 4-hydroxy-2'-nonenal (4-HNE), and Western blotting for insulin glucose signaling, lipid metabolism, and endoplasmic reticulum (ER) stress-related signaling in liver specimens obtained from mice in each group. The morphometric grades of all NASH-related findings and the mean degree of 8-OHdG immunolocalization in groups D-F were significantly lower than those observed in group B. The expression levels of insulin receptor β subunit (IRβ) and p-elF in groups E and F and those of phosphatidyl-inositol 3 kinase (PI3K85), p-AcelCoA, and PERK in group F were similar to those noted in group A. The administration of a combination of antioxidant-rich nutrients, including BCAAs and microelements, is likely to suppress the progression of NASH by reducing oxidative stress, primarily via the downregulation of the ER stress pathway. © 2014 American Society for Parenteral and Enteral Nutrition.
TAKAHASHI, Kenji
2013-01-01
A group of enzymes, mostly hydrolases or certain transferases, utilize one or a few side-chain carboxyl groups of Asp and/or Glu as part of the catalytic machinery at their active sites. This review follows mainly the trail of studies performed by the author and his colleagues on the structure and function of such enzymes, starting from ribonuclease T1, then extending to three major types of carboxyl peptidases including aspartic peptidases, glutamic peptidases and serine-carboxyl peptidases. PMID:23759941
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zellmeier, M.; Rappich, J.; Nickel, N. H.
The influence of ether groups in the side chain of spin coated regioregular polythiophene derivatives on the polymer layer formation and the hybrid solar cell properties was investigated using electrical, optical, and X-ray diffraction experiments. The polymer layers are of high crystallinity but the polymer with 3 ether groups in the side chain (P3TOT) did not show any vibrational fine structure in the UV-Vis spectrum. The presence of ether groups in the side chains leads to better adhesion resulting in thinner and more homogeneous polymer layers. This, in turn, enhances the electronic properties of the planar c-Si/poly-thiophene hybrid solar cell.more » We find that the power conversion efficiency increases with the number of ether groups in the side chains, and a maximum power conversion efficiency of η = 9.6% is achieved even in simple planar structures.« less
Bjedov, Srđan; Jakimov, Dimitar; Pilipović, Ana; Poša, Mihalj; Sakač, Marija
2017-04-01
Bile acid derivatives with modifications in side chain and modifications on steroid skeleton were synthetized and their antitumor activity against five human cancer cell lines was investigated. Modifications in side chain include amid group, formed in reaction with 2-amino-2-methylpropanol, and 4,4-dimethyloxazoline group, obtained after cyclization of amides. In the steroid skeleton oxo groups were introduced in position 7 (2, 2a, 2b) and 7,12 (3, 3a, 3b). Ethylidene groups were introduced regio- and stereoselectively on C-7, and/or without stereoselectivity on C-3 by Wittig reaction. By combination of these modifications, a series of 19 bile acid derivatives were synthesized. Compounds containing both C-7 ethylidene and C-12 carbonyl groups (6, 6a, 6b) shown very good antitumor activity with IC 50 <5µM. Altering carboxylic group to amide or oxazoline group has positive effect on cytotoxicity. Different molecular descriptors were determined in silico and after principal component analysis was found that molecular descriptor BLTF96 can be used for fast assessment of experimental cytotoxicity of bile acid derivatives. Copyright © 2017 Elsevier Inc. All rights reserved.
The biosynthesis of nitrogen-, sulfur-, and high-carbon chain-containing sugars.
Lin, Chia-I; McCarty, Reid M; Liu, Hung-wen
2013-05-21
Carbohydrates serve many structural and functional roles in biology. While the majority of monosaccharides are characterized by the chemical composition (CH2O)n, modifications including deoxygenation, C-alkylation, amination, O- and N-methylation, which are characteristic of many sugar appendages of secondary metabolites, are not uncommon. Interestingly, some sugar molecules are formed via modifications including amine oxidation, sulfur incorporation, and "high-carbon" chain attachment. Most of these unusual sugars have been identified over the past several decades as components of microbially produced natural products, although a few high-carbon sugars are also found in the lipooligosaccharides of the outer cell walls of Gram-negative bacteria. Despite their broad distribution in nature, these sugars are considered "rare" due to their relative scarcity. The biosynthetic steps that underlie their formation continue to perplex researchers to this day and many questions regarding key transformations remain unanswered. This review will focus on our current understanding of the biosynthesis of unusual sugars bearing oxidized amine substituents, thio-functional groups, and high-carbon chains.
Methods for removing contaminant matter from a porous material
Fox, Robert V [Idaho Falls, ID; Avci, Recep [Bozeman, MT; Groenewold, Gary S [Idaho Falls, ID
2010-11-16
Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.
GPSS and Modeling of Computer Communication Networks.
1982-04-01
chains are used to alter the normal "flows" of transactions in a user defined manner. Transaction "flow" may be controlled on the basis of group ...authors refer to loops and rings interchangeably, including those who have designed loop networks with distributed control mechanisms [8,9,10,11,121...that detailed simulation of character by character transmission does not take place; rather, [ control message--data message-- control message! groupings
Lubricants or lubricant additives composed of ionic liquids containing ammonium cations
Qu, Jun [Knoxville, TN; Truhan, Jr; John, J [Cookeville, TN; Dai, Sheng [Knoxville, TN; Luo, Huimin [Knoxville, TN; Blau, Peter J [Knoxville, TN
2010-07-13
A lubricant or lubricant additive is an ionic liquid alkylammonium salt. The alkylammonium salt has the structure R.sub.xNH.sub.(4-x).sup.+,[F.sub.3C(CF.sub.2).sub.yS(O).sub.2].sub.2N.sup- .- where x is 1 to 3, R is independently C.sub.1 to C.sub.12 straight chain alkyl, branched chain alkyl, cycloalkyl, alkyl substituted cycloalkyl, cycloalkyl substituted alkyl, or, optionally, when x is greater than 1, two R groups comprise a cyclic structure including the nitrogen atom and 4 to 12 carbon atoms, and y is independently 0 to 11. The lubricant is effective for the lubrication of many surfaces including aluminum and ceramics surfaces.
Harrington, Charlene; Olney, Brian; Carrillo, Helen; Kang, Taewoon
2012-02-01
To compare staffing levels and deficiencies of the 10 largest U.S. for-profit nursing home chains with five other ownership groups and chain staffing and deficiencies before and after purchase by four private equity (PE) companies. Facilities for the largest for-profit chains were identified through Internet searches and company reports and matched with federal secondary data for 2003-2008 for each ownership group. Descriptive statistics and generalized estimation equation panel regression models examined staffing and deficiencies by ownership groups in the 2003-2008 period, controlling for facility characteristics, resident acuity, and market factors with state fixed effects. The top 10 for-profit chains had lower registered nurse and total nurse staffing hours than government facilities, controlling for other factors. The top 10 chains received 36 percent higher deficiencies and 41 percent higher serious deficiencies than government facilities. Other for-profit facilities also had lower staffing and higher deficiencies than government facilities. The chains purchased by PE companies showed little change in staffing levels, but the number of deficiencies and serious deficiencies increased in some postpurchase years compared with the prepurchase period. There is a need for greater study of large for-profit chains as well as those chains purchased by PE companies. © Health Research and Educational Trust.
Tandem catalysis for the preparation of cylindrical polypeptide brushes.
Rhodes, Allison J; Deming, Timothy J
2012-11-28
Here, we report a method for synthesis of cylindrical copolypeptide brushes via N-carboxyanhydride (NCA) polymerization utilizing a new tandem catalysis approach that allows preparation of brushes with controlled segment lengths in a straightforward, one-pot procedure requiring no intermediate isolation or purification steps. To obtain high-density brush copolypeptides, we used a "grafting from" approach where alloc-α-aminoamide groups were installed onto the side chains of NCAs to serve as masked initiators. These groups were inert during cobalt-initiated NCA polymerization and gave allyloxycarbonyl-α-aminoamide-substituted polypeptide main chains. The alloc-α-aminoamide groups were then activated in situ using nickel to generate initiators for growth of side-chain brush segments. This use of stepwise tandem cobalt and nickel catalysis was found to be an efficient method for preparation of high-chain-density, cylindrical copolypeptide brushes, where both the main chains and side chains can be prepared with controlled segment lengths.
Population Education in Science: Some Sample Lessons.
ERIC Educational Resources Information Center
United Nations Educational, Scientific, and Cultural Organization, Bangkok (Thailand). Regional Office for Education in Asia and Oceania.
This science teacher's manual contains nine sample population education lessons adapted from materials produced in several countries in Asia and Oceania. Activities are designed for lower primary through high school students. Included are class discussions, small group activities, and a role-playing situation. Food chains, human dependence upon…
Molecular Genetics of Mitochondrial Disorders
ERIC Educational Resources Information Center
Wong, Lee-Jun C.
2010-01-01
Mitochondrial respiratory chain (RC) disorders (RCDs) are a group of genetically and clinically heterogeneous diseases because of the fact that protein components of the RC are encoded by both mitochondrial and nuclear genomes and are essential in all cells. In addition, the biogenesis, structure, and function of mitochondria, including DNA…
Erythrolic acids A-E, Meroterpenoids from a Marine-Derived Erythrobacter sp
Hu, Youcai; Legako, Aaron G.; Espindola, Ana Paula D.M.; MacMillan, John B.
2012-01-01
Erythrolic acids A-E (1–5) are five unusual meroterpenoids isolated from the bacterium Erythrobacter sp. derived from a marine sediment sample collected in Galveston, TX. The structures were elucidated by means of detailed spectroscopic analysis and chemical derivatization. The erythrolic acids contain a 4-hydroxybenzoic acid appended with a modified terpene side chain. The side chain modifications include oxidation of a terminal methyl substituent and in the case of 1–4 addition of a 2-carbon unit to give terpene side chains of unusual length; C22 for 1 and 2, C17 for 3 and C12 for 4. The relative and absolute configurations of the meroterpenoids were determined by coupling constant, NOE and Mosher’s analysis. In vitro cytotoxicity towards a number of non-small cell lung cancer (NSCLC) cell lines revealed only modest activity for erythrolic acid D (4) (2.5 μM against HCC44). The discovery of these unusual diterpenes, along with the previously reported erythrazoles, demonstrate the natural product potential of a previously unstudied group of bacteria for drug discovery. The unusual nature of the terpene side chain, we believe, involves an oxidation of a terminal methyl group to a carboxylic acid and subsequent Claisen condensation with acetyl-CoA. PMID:22384985
Effect of Lactobacillus salivarius Ls-33 on fecal microbiota in obese adolescents.
Larsen, Nadja; Vogensen, Finn K; Gøbel, Rikke Juul; Michaelsen, Kim F; Forssten, Sofia D; Lahtinen, Sampo J; Jakobsen, Mogens
2013-12-01
This study is a part of the clinical trials with probiotic bacterium Lactobacillus salivarius Ls-33 conducted in obese adolescents. Previously reported clinical studies showed no effect of Ls-33 consumption on the metabolic syndrome in the subject group. The aim of the study was to investigate the impact of L. salivarius Ls-33 on fecal microbiota in obese adolescents. The study was a double-blinded intervention with 50 subjects randomized to intake of L. salivarius Ls-33 or placebo for 12 weeks. The fecal microbiota was assessed by real-time quantitative PCR before and after intervention. Concentrations of fecal short chain fatty acids were determined using gas chromatography. Ratios of Bacteroides-Prevotella-Porphyromonas group to Firmicutes belonging bacteria, including Clostridium cluster XIV, Blautia coccoides_Eubacteria rectale group and Roseburia intestinalis, were significantly increased (p ≤ 0.05) after administration of Ls-33. The cell numbers of fecal bacteria, including the groups above as well as Clostridium cluster I, Clostridium cluster IV, Faecalibacterium prausnitzii, Enterobacteriaceae, Enterococcus, the Lactobacillus group and Bifidobacterium were not significantly altered by intervention. Similarly, short chain fatty acids remained unaffected. L. salivarius Ls-33 might modify the fecal microbiota in obese adolescents in a way not related to metabolic syndrome. NCT 01020617. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun
2014-05-28
3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.
Changes in conformational dynamics of basic side chains upon protein-DNA association.
Esadze, Alexandre; Chen, Chuanying; Zandarashvili, Levani; Roy, Sourav; Pettitt, B Montgometry; Iwahara, Junji
2016-08-19
Basic side chains play major roles in recognition of nucleic acids by proteins. However, dynamic properties of these positively charged side chains are not well understood. In this work, we studied changes in conformational dynamics of basic side chains upon protein-DNA association for the zinc-finger protein Egr-1. By nuclear magnetic resonance (NMR) spectroscopy, we characterized the dynamics of all side-chain cationic groups in the free protein and in the complex with target DNA. Our NMR order parameters indicate that the arginine guanidino groups interacting with DNA bases are strongly immobilized, forming rigid interfaces. Despite the strong short-range electrostatic interactions, the majority of the basic side chains interacting with the DNA phosphates exhibited high mobility, forming dynamic interfaces. In particular, the lysine side-chain amino groups exhibited only small changes in the order parameters upon DNA-binding. We found a similar trend in the molecular dynamics (MD) simulations for the free Egr-1 and the Egr-1-DNA complex. Using the MD trajectories, we also analyzed side-chain conformational entropy. The interfacial arginine side chains exhibited substantial entropic loss upon binding to DNA, whereas the interfacial lysine side chains showed relatively small changes in conformational entropy. These data illustrate different dynamic characteristics of the interfacial arginine and lysine side chains. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Perceptual and Neural Olfactory Similarity in Honeybees
Sandoz, Jean-Christophe
2005-01-01
The question of whether or not neural activity patterns recorded in the olfactory centres of the brain correspond to olfactory perceptual measures remains unanswered. To address this question, we studied olfaction in honeybees Apis mellifera using the olfactory conditioning of the proboscis extension response. We conditioned bees to odours and tested generalisation responses to different odours. Sixteen odours were used, which varied both in their functional group (primary and secondary alcohols, aldehydes and ketones) and in their carbon-chain length (from six to nine carbons).The results obtained by presentation of a total of 16 × 16 odour pairs show that (i) all odorants presented could be learned, although acquisition was lower for short-chain ketones; (ii) generalisation varied depending both on the functional group and the carbon-chain length of odours trained; higher generalisation was found between long-chain than between short-chain molecules and between groups such as primary and secondary alcohols; (iii) for some odour pairs, cross-generalisation between odorants was asymmetric; (iv) a putative olfactory space could be defined for the honeybee with functional group and carbon-chain length as inner dimensions; (v) perceptual distances in such a space correlate well with physiological distances determined from optophysiological recordings of antennal lobe activity. We conclude that functional group and carbon-chain length are inner dimensions of the honeybee olfactory space and that neural activity in the antennal lobe reflects the perceptual quality of odours. PMID:15736975
Self-Assemblies of novel molecules, VECAR
NASA Astrophysics Data System (ADS)
Shrestha, Bijay; Kim, Hye-Young; Lee, Soojin; Novak, Brian; Moldovan, Dorel
2015-03-01
VECAR is a newly synthesized molecule, which is an amphiphilic antioxidant molecule that consists of two molecular groups, vitamin-E and Carnosine, linked by a hydrocarbon chain. The hydrocarbon chain is hydrophobic and both vitamin-E and Carnosine ends are hydrophilic. In the synthesis process, the length of the hydrophobic chain of VECAR molecules can vary from the shortest (n =0) to the longest (n =18), where n indicates the number of carbon atoms in the chain. We conducted MD simulation studies of self-assembly of VECAR molecules in water using GROMACS on LONI HPC resources. Our study shows that there is a strong correlation between the shape and atomistic structure of the self-assembled nano-structures (SANs) and the chain-length (n) of VECAR molecules. We will report the results of data analyses including the atomistic structure of each SANs and the dynamic and energetic mechanisms of their formation as function of time. In summary, both VECAR molecules of chain-length n =18 and 9 form worm-like micelles, which may be used as a drug delivery system. This research is supported by the Louisiana Board of Regents-RCS Grant (LEQSF(2012-15)-RD-A-19).
Site-directed decapsulation of bolaamphiphilic vesicles with enzymatic cleavable surface groups.
Popov, Mary; Grinberg, Sarina; Linder, Charles; Waner, Tal; Levi-Hevroni, Bosmat; Deckelbaum, Richard J; Heldman, Eliahu
2012-06-10
Stable nano-sized vesicles with a monolayer encapsulating membrane were prepared from novel bolaamphiphiles with choline ester head groups. The head groups were covalently bound to the alkyl chain of the bolaamphiphiles either via the nitrogen atom of the choline moiety, or via the choline ester's methyl group. Both types of bolaamphiphiles competed with acetylthiocholine for binding to acetylcholine esterase (AChE), yet, only the choline ester head groups bound to the alkyl chain via the nitrogen atom of the choline moiety were hydrolyzed by the enzyme. Likewise, only vesicles composed of bolaamphiphiles with head groups that were hydrolyzed by AChE released their encapsulated material upon exposure to the enzyme. Injection of carboxyfluorescein (CF)-loaded vesicles with cleavable choline ester head groups into mice resulted in the accumulation of CF in tissues that express high AChE activity, including the brain. By comparison, when vesicles with choline ester head groups that are not hydrolyzed by AChE were injected into mice, there was no accumulation of CF in tissues that highly express the enzyme. These results imply that bolaamphiphilic vesicles with surface groups that are substrates to enzymes which are highly expressed in target organs may potentially be used as a drug delivery system with controlled site-directed drug release. Copyright © 2011 Elsevier B.V. All rights reserved.
Relationship between ion pair geometries and electrostatic strengths in proteins.
Kumar, Sandeep; Nussinov, Ruth
2002-01-01
The electrostatic free energy contribution of an ion pair in a protein depends on two factors, geometrical orientation of the side-chain charged groups with respect to each other and the structural context of the ion pair in the protein. Conformers in NMR ensembles enable studies of the relationship between geometry and electrostatic strengths of ion pairs, because the protein structural contexts are highly similar across different conformers. We have studied this relationship using a dataset of 22 unique ion pairs in 14 NMR conformer ensembles for 11 nonhomologous proteins. In different NMR conformers, the ion pairs are classified as salt bridges, nitrogen-oxygen (N-O) bridges and longer-range ion pairs on the basis of geometrical criteria. In salt bridges, centroids of the side-chain charged groups and at least a pair of side-chain nitrogen and oxygen atoms of the ion-pairing residues are within a 4 A distance. In N-O bridges, at least a pair of the side-chain nitrogen and oxygen atoms of the ion-pairing residues are within 4 A distance, but the distance between the side-chain charged group centroids is greater than 4 A. In the longer-range ion pairs, the side-chain charged group centroids as well as the side-chain nitrogen and oxygen atoms are more than 4 A apart. Continuum electrostatic calculations indicate that most of the ion pairs have stabilizing electrostatic contributions when their side-chain charged group centroids are within 5 A distance. Hence, most (approximately 92%) of the salt bridges and a majority (68%) of the N-O bridges are stabilizing. Most (approximately 89%) of the destabilizing ion pairs are the longer-range ion pairs. In the NMR conformer ensembles, the electrostatic interaction between side-chain charged groups of the ion-pairing residues is the strongest for salt bridges, considerably weaker for N-O bridges, and the weakest for longer-range ion pairs. These results suggest empirical rules for stabilizing electrostatic interactions in proteins. PMID:12202384
Ricin - inhibitor design. Annual report, 15 April 1994-14 April 1995
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schramm, V.L.
1995-05-14
Substrates for ricin A-chain include short RNA stem-loop structures which have been synthesized with radioactive labels for ease of catalytic assay and for kinetic isotope effects. Ricin A-chain from several sources is incapable of completing multiple catalytic cycles using these substrates. A family of ricin substrate analogue molecules have been synthesized and tested which are specific for transition states with oxycarbonium character or for enzymatic mechanisms involving protonation of the adenine leaving group. Formycin analogues were incorporated into RNA oligomeric structures and tested for binding to ricin A-chain or as inhibitors of the ricin-inactivation of in vitro translation using rabbitmore » reticulocyte lysates. Ribo-oxycarbonium ion analogues containing iminoribitol analogues of ribose were synthetically incorporated into RNA oligomeric structures. Neither formycin nor ribo-oxycarbonium analogues, either singly or in RNA oligomers caused significant inhibition of ricin A-chain when assayed in reticulocyte lysate translation assays. The results indicate a novel transition state mechanism for ricin A-chain, or a requirement for additional features of 28s rRNA to bind transition state analogues.« less
Covariate adjustment of event histories estimated from Markov chains: the additive approach.
Aalen, O O; Borgan, O; Fekjaer, H
2001-12-01
Markov chain models are frequently used for studying event histories that include transitions between several states. An empirical transition matrix for nonhomogeneous Markov chains has previously been developed, including a detailed statistical theory based on counting processes and martingales. In this article, we show how to estimate transition probabilities dependent on covariates. This technique may, e.g., be used for making estimates of individual prognosis in epidemiological or clinical studies. The covariates are included through nonparametric additive models on the transition intensities of the Markov chain. The additive model allows for estimation of covariate-dependent transition intensities, and again a detailed theory exists based on counting processes. The martingale setting now allows for a very natural combination of the empirical transition matrix and the additive model, resulting in estimates that can be expressed as stochastic integrals, and hence their properties are easily evaluated. Two medical examples will be given. In the first example, we study how the lung cancer mortality of uranium miners depends on smoking and radon exposure. In the second example, we study how the probability of being in response depends on patient group and prophylactic treatment for leukemia patients who have had a bone marrow transplantation. A program in R and S-PLUS that can carry out the analyses described here has been developed and is freely available on the Internet.
Can Simple Transmission Chains Foster Collective Intelligence in Binary-Choice Tasks?
Moussaïd, Mehdi; Seyed Yahosseini, Kyanoush
2016-01-01
In many social systems, groups of individuals can find remarkably efficient solutions to complex cognitive problems, sometimes even outperforming a single expert. The success of the group, however, crucially depends on how the judgments of the group members are aggregated to produce the collective answer. A large variety of such aggregation methods have been described in the literature, such as averaging the independent judgments, relying on the majority or setting up a group discussion. In the present work, we introduce a novel approach for aggregating judgments-the transmission chain-which has not yet been consistently evaluated in the context of collective intelligence. In a transmission chain, all group members have access to a unique collective solution and can improve it sequentially. Over repeated improvements, the collective solution that emerges reflects the judgments of every group members. We address the question of whether such a transmission chain can foster collective intelligence for binary-choice problems. In a series of numerical simulations, we explore the impact of various factors on the performance of the transmission chain, such as the group size, the model parameters, and the structure of the population. The performance of this method is compared to those of the majority rule and the confidence-weighted majority. Finally, we rely on two existing datasets of individuals performing a series of binary decisions to evaluate the expected performances of the three methods empirically. We find that the parameter space where the transmission chain has the best performance rarely appears in real datasets. We conclude that the transmission chain is best suited for other types of problems, such as those that have cumulative properties.
NASA Astrophysics Data System (ADS)
Li, Qi; Guo, Longhai; Qiu, Teng; Xiao, Weidong; Du, Dianxing; Li, Xiaoyu
2016-07-01
A series of waterborne polyurethane (WPU) containing alkoxysilane side groups were synthesized by using the dihydroxy functionalized alkoxysilane. The diol with trimethoxysilane groups at the side chains was synthesized via Michael addition between 3-(methacryloxypropyl)trimethoxysilane (MAPTS) and diethanolamine (DEA). The silane diol was applied as the chain extender for the NCO-endcapped prepolymer of isophorone diisocyanate, polycarbonate diol, 2,2-bis(hydroxymethyl) butyric acid and 1,4-butanediol. The products with the silane content varied from 1.2 to 16.5 wt% were dispersed in water after neutralization. The effect of the silane diol on the particle size and morphology of the WPU dispersion was studied by dynamic light scattering (DLS) and transmission electron microscopy (TEM), respectively. X-ray photoelectron spectroscopy (XPS) characterization was carried out on the coating film of the WPU, revealing that the long flexible side chain is favorable for the silane components to emigrate toward the film surface and crosslink during the film formation process. As a result, both the surface contact angle to water and water adsorption of the WPU coating films increased with the silane content. Furthermore, the mechanical properties including the modulus and tensile strength of the films were also improved by the incorporation of silane diol.
Fogg, Kristi L; DellaValle, Diane M; Buckley, Jason R; Graham, Eric M; Zyblewski, Sinai C
2016-08-01
Chylothorax is a well-described complication after cardiothoracic surgery in children. Medical nutritional therapy for chylothorax includes medium-chain triglyceride (MCT) formulas and reduction in enteral long-chain triglyceride intake to reduce chyle production. Human milk is usually eliminated from the diet of infants with chylothorax because of its high long-chain triglyceride content. However, given the immunologic properties of human milk, young infants with chylothorax may benefit from using human milk over human milk substitutes. We performed a retrospective cohort study to describe the feasibility and efficacy of defatted human milk (DHM) for the treatment for chylothorax in infants after cardiac surgery and to compare growth outcomes between infants treated with DHM (n = 14) versus MCT formula (n = 21). There were no differences in mortality or length of hospital stay between the DHM and MCT formula treatment groups. The DHM treatment group had a significantly higher weight-for-age z-score at hospital discharge compared to the MCT formula group with median z-scores of -1 (-2 to 0.5) and -1.5 (-2 to 0), respectively (p = 0.02). In infants with chylothorax after cardiac surgery, DHM is a safe and feasible medical nutritional treatment and may have potential benefits for improved nutrition and growth.
Rosenmai, A K; Taxvig, C; Svingen, T; Trier, X; van Vugt-Lussenburg, B M A; Pedersen, M; Lesné, L; Jégou, B; Vinggaard, A M
2016-07-01
Migration of chemicals from packaging materials to foods may lead to human exposure. Polyfluoroalkyl substances (PFAS) can be used in technical mixtures (TMs) for use in food packaging of paper and board, and PFAS have been detected in human serum and umbilical cord blood. The specific structures of the PFAS in TMs are often unknown, but polyfluorinated alkyl phosphate esters (PAPs) have been characterized in TMs, food packaging, and in food. PAPs can be metabolized into fluorotelomer alcohols (FTOHs) and perfluoroalkyl carboxylic acids (PFCAs). Some PFAS have endocrine activities, highlighting the need to investigate these effects. Herein, we studied the endocrine activity of less characterized PFAS, including short-chain PFCAs and FTOHs, PAPs, and TMs of unknown chemical composition. Long-chain PFCAs were also included. We applied seven assays covering effects on estrogen, glucocorticoid, androgen, and peroxisome proliferator-activated receptor (PPAR) activity, as well as steroidogenesis in vitro and ex vivo. In general, PAPs, FTOHs, TMs, and long-chain PFCAs showed estrogenic activity through receptor activation and/or increasing 17β-estradiol levels. Furthermore, short- and long-chain PFCAs activated PPARα and PPARγ. Collectively, this means that (i) PAPs, FTOHs, and PFCAs exhibit endocrine activity through distinct and sometimes different mechanisms, (ii) two out of three tested TMs exhibited estrogenic activity, and (iii) short-chain FTOHs showed estrogenic activity and short-chain PFCAs generally activate both PPARα and PPARγ with similar potency and efficacy as long-chain PFCAs. In conclusion, several new and divergent toxicological targets were identified for different groups of PFAS. © 2016 American Society of Andrology and European Academy of Andrology.
NASA Astrophysics Data System (ADS)
Bush, Rosemary T.; McInerney, Francesca A.
2013-09-01
Long chain (C21 to C37) n-alkanes are among the most long-lived and widely utilized terrestrial plant biomarkers. Dozens of studies have examined the range and variation of n-alkane chain-length abundances in modern plants from around the world, and n-alkane distributions have been used for a variety of purposes in paleoclimatology and paleoecology as well as chemotaxonomy. However, most of the paleoecological applications of n-alkane distributions have been based on a narrow set of modern data that cannot address intra- and inter-plant variability. Here, we present the results of a study using trees from near Chicago, IL, USA, as well as a meta-analysis of published data on modern plant n-alkane distributions. First, we test the conformity of n-alkane distributions in mature leaves across the canopy of 38 individual plants from 24 species as well as across a single growing season and find no significant differences for either canopy position or time of leaf collection. Second, we compile 2093 observations from 86 sources, including the new data here, to examine the generalities of n-alkane parameters such as carbon preference index (CPI), average chain length (ACL), and chain-length ratios for different plant groups. We show that angiosperms generally produce more n-alkanes than do gymnosperms, supporting previous observations, and furthermore that CPI values show such variation in modern plants that it is prudent to discard the use of CPI as a quantitative indicator of n-alkane degradation in sediments. We also test the hypotheses that certain n-alkane chain lengths predominate in and therefore can be representative of particular plant groups, namely, C23 and C25 in Sphagnum mosses, C27 and C29 in woody plants, and C31 in graminoids (grasses). We find that chain-length distributions are highly variable within plant groups, such that chemotaxonomic distinctions between grasses and woody plants are difficult to make based on n-alkane abundances. In contrast, Sphagnum mosses are marked by their predominance of C23 and C25, chain lengths which are largely absent in terrestrial vascular plants. The results here support the use of C23 as a robust proxy for Sphagnum mosses in paleoecological studies, but not the use of C27, C29, and C31 to separate graminoids and woody plants from one another, as both groups produce highly variable but significant amounts of all three chain lengths. In Africa, C33 and C35 chain lengths appear to distinguish graminoids from some woody plants, but this may be a reflection of the differences in rainforest and savanna environments. Indeed, variation in the abundances of long n-alkane chain lengths may be responding in part to local environmental conditions, and this calls for a more directed examination of the effects of temperature and aridity on plant n-alkane distributions in natural environments.
Harrington, Charlene; Olney, Brian; Carrillo, Helen; Kang, Taewoon
2012-01-01
Objective To compare staffing levels and deficiencies of the 10 largest U.S. for-profit nursing home chains with five other ownership groups and chain staffing and deficiencies before and after purchase by four private equity (PE) companies. Data Sources Facilities for the largest for-profit chains were identified through Internet searches and company reports and matched with federal secondary data for 2003–2008 for each ownership group. Study Design Descriptive statistics and generalized estimation equation panel regression models examined staffing and deficiencies by ownership groups in the 2003–2008 period, controlling for facility characteristics, resident acuity, and market factors with state fixed effects. Principal Findings The top 10 for-profit chains had lower registered nurse and total nurse staffing hours than government facilities, controlling for other factors. The top 10 chains received 36 percent higher deficiencies and 41 percent higher serious deficiencies than government facilities. Other for-profit facilities also had lower staffing and higher deficiencies than government facilities. The chains purchased by PE companies showed little change in staffing levels, but the number of deficiencies and serious deficiencies increased in some postpurchase years compared with the prepurchase period. Conclusions There is a need for greater study of large for-profit chains as well as those chains purchased by PE companies. PMID:22091627
Herrera, Guillermo A
2014-10-01
Lesions associated with monoclonal light and heavy chains display a variety of glomerular, tubular interstitial, and vascular manifestations. While some of the entities are well recognized, including light and heavy chain deposition diseases, AL (light chain) and AH (heavy chain) amyloidosis, and light chain ("myeloma") cast nephropathy, other lesions centered on proximal tubules are much less accurately identified, properly diagnosed, and adequately understood in terms of pathogenesis and molecular mechanisms involved. These proximal tubule-centered lesions are typically associated with monoclonal light chains and have not been reported in patients with circulating monoclonal heavy chains. To determine the incidence of proximal tubulopathies in a series of patients with monoclonal light chain-related renal lesions and characterize them with an emphasis on clinical correlations and elucidation of molecular mechanisms involved in their pathogenesis. A study of 5410 renal biopsies with careful evaluation of light microscopic, immunofluorescence, and electron microscopic findings was conducted to identify these monoclonal light/heavy chain-related lesions. In selected cases, ultrastructural immunolabeling was performed to better illustrate and understand molecular mechanisms involved or to resolve specific diagnostic difficulties. In all, 2.5% of the biopsies were diagnosed as demonstrating renal pathology associated with monoclonal light or heavy chains. Of these, approximately 46% were classified as proximal tubule-centered lesions, also referred to as monoclonal light chain-associated proximal tubulopathies. These proximal tubulopathies were divided into 4 groups defined by characteristic immunomorphologic manifestations associated with specific clinical settings. These are important lesions whose recognition in the different clinical settings is extremely important for patients' clinical management, therapeutic purposes, and prognosis. These entities have been segregated into 4 distinct variants, conceptualized morphologically and clinically. Specific mechanisms involved in their pathogenesis are proposed.
The high-throughput synthesis and phase characterisation of amphiphiles: a sweet case study.
Feast, George C; Hutt, Oliver E; Mulet, Xavier; Conn, Charlotte E; Drummond, Calum J; Savage, G Paul
2014-03-03
A new method for the discovery of amphiphiles by using high-throughput (HT) methods to synthesise and characterise a library of galactose- and glucose-containing amphiphilic compounds is presented. The copper-catalysed azide–alkyne cycloaddition (CuAAC) “click” reaction between azide-tethered simple sugars and alkyne-substituted hydrophobic tails was employed to synthesise a library of compounds with systematic variations in chain length and unsaturation in a 24-vial array format. The liquid–crystalline phase behaviour was characterised in a HT manner by using synchrotron small-angle X-ray scattering (SSAXS). The observed structural variation with respect to chain parameters, including chain length and degree of unsaturation, is discussed, as well as hydration effects and degree of hydrogen bonding between head groups. The validity of our HT screening approach was verified by resynthesising a short-chain glucose amphiphile. A separate phase analysis of this compound confirmed the presence of numerous lyotropic liquid–crystalline phases.
Hsu, Fong-Fu
2016-01-01
Ceramide is a huge lipid family consisting of diversified structures including various modifications in the fatty acyl chain and the long chain base (LCB). In this contribution, negative-ion ESI linear ion-trap multiple-stage mass spectrometric method (LIT MSn) towards complete structural determination of ceramides in ten major families characterized as the [M – H]− ions is described. Multiple sets of fragment ions reflecting the fatty acyl chain and LCB were observed in the CID MS2 spectrum, while the sequential MS3 and MS4 spectra contain structural information for locating the double bond and the functional groups, permitting realization of the fragmentation processes. Thereby, differentiation of ceramide molecules varied by chain length, the LCB (sphingosine, phytosphigosine, 6-hydroxy-sphingosine), and by the modification (α-hydroxy-, β-hydroxy-, ω-hydroxy-FA) can be achieved; and many isomeric structures in the biological specimen can be revealed in detail. PMID:27523779
Ubiquitin chain specificities of E6AP E3 ligase and its HECT domain.
Kobayashi, Fuminori; Nishiuchi, Takumi; Takaki, Kento; Konno, Hiroki
2018-02-05
Ubiquitination of target proteins is accomplished by isopeptide bond formation between the carboxy group of the C-terminal glycine (Gly) residue of ubiquitin (Ub) and the ɛ-amino group of lysine (Lys) on the target proteins. The formation of an isopeptide bond between Ubs that gives rise to a poly-Ub chain on the target proteins and the types of poly-Ub chains formed depend on which of the seven Lys residues or N-terminal methionine (Met) residue on Ub is used for chain elongation. To understand the linkage specificity mechanism of Ub chains on E3, the previous study established an assay to monitor the formation of a free diubiquitin chain (Ub 2 chain synthesis assay) by HECT type E3 ligase. In this study, we investigated Ub 2 chain specificity using E6AP HECT domain. We here demonstrate the importance of the N-terminal domain of full length E6AP for Ub 2 chain specificity. Copyright © 2017 Elsevier Inc. All rights reserved.
Exploring backbone-cation alkyl spacers for multi-cation side chain anion exchange membranes
NASA Astrophysics Data System (ADS)
Zhu, Liang; Yu, Xuedi; Hickner, Michael A.
2018-01-01
In order to systematically study how the arrangement of cations on the side chain and length of alkyl spacers between cations impact the performance of multi-cation AEMs for alkaline fuel cells, a series of polyphenylene oxide (PPO)-based AEMs with different cationic side chains were synthesized. This work resulted in samples with two or three cations in a side chain pendant to the PPO backbone. More importantly, the length of the spacer between cations varied from 3 methylene (-CH2-) (C3) groups to 8 methylene (C8) groups. The highest conductivity, up to 99 mS/cm in liquid water at room temperature, was observed for the triple-cation side chain AEM with pentyl (C5) or hexyl (C6) spacers. The multi-cation AEMs were found to have decreased water uptake and ionic conductivity when the spacer chains between cations were lengthened from pentyl (C5) or hexyl (C6) to octyl (C8) linking groups. The triple-cation membranes with pentyl (C5) or hexyl (C6) groups between cations showed greatest stability after immersion in 1 M NaOH at 80 °C for 500 h.
Crystal structures of three 3,4,5-tri-meth-oxy-benzamide-based derivatives.
Gomes, Ligia R; Low, John Nicolson; Oliveira, Catarina; Cagide, Fernando; Borges, Fernanda
2016-05-01
The crystal structures of three benzamide derivatives, viz. N-(6-hy-droxy-hex-yl)-3,4,5-tri-meth-oxy-benzamide, C16H25NO5, (1), N-(6-anilinohex-yl)-3,4,5-tri-meth-oxy-benzamide, C22H30N2O4, (2), and N-(6,6-di-eth-oxy-hex-yl)-3,4,5-tri-meth-oxy-benzamide, C20H33NO6, (3), are described. These compounds differ only in the substituent at the end of the hexyl chain and the nature of these substituents determines the differences in hydrogen bonding between the mol-ecules. In each mol-ecule, the m-meth-oxy substituents are virtually coplanar with the benzyl ring, while the p-meth-oxy substituent is almost perpendicular. The carbonyl O atom of the amide rotamer is trans related with the amidic H atom. In each structure, the benzamide N-H donor group and O acceptor atoms link the mol-ecules into C(4) chains. In 1, a terminal -OH group links the mol-ecules into a C(3) chain and the combined effect of the C(4) and C(3) chains is a ribbon made up of screw related R 2 (2)(17) rings in which the ⋯O-H⋯ chain lies in the centre of the ribbon and the tri-meth-oxy-benzyl groups forms the edges. In 2, the combination of the benzamide C(4) chain and the hydrogen bond formed by the terminal N-H group to an O atom of the 4-meth-oxy group link the mol-ecules into a chain of R 2 (2)(17) rings. In 3, the mol-ecules are linked only by C(4) chains.
Timbermont, L; Lanckriet, A; Dewulf, J; Nollet, N; Schwarzer, K; Haesebrouck, F; Ducatelle, R; Van Immerseel, F
2010-04-01
The efficacy of target-released butyric acid, medium-chain fatty acids (C(6) to C(12) but mainly lauric acid) and essential oils (thymol, cinnamaldehyde, essential oil of eucalyptus) micro-encapsulated in a poly-sugar matrix to control necrotic enteritis was investigated. The minimal inhibitory concentrations of the different additives were determined in vitro, showing that lauric acid, thymol, and cinnamaldehyde are very effective in inhibiting the growth of Clostridium perfringens. The in vivo effects were studied in two trials in an experimental necrotic enteritis model in broiler chickens. In the first trial, four groups of chickens were fed a diet supplemented with butyric acid, with essential oils, with butyric acid in combination with medium-chain fatty acids, or with butyric acid in combination with medium-chain fatty acids and essential oils. In all groups except for the group receiving only butyric acid, a significant decrease in the number of birds with necrotic lesions was found compared with the infected, untreated control group. In the second trial the same products were tested but at a higher concentration. An additional group was fed a diet supplemented with only medium-chain fatty acids. In all groups except for that receiving butyric acid in combination with medium-chain fatty acids and essential oils, a significant decrease in the number of birds with necrotic lesions was found compared with the infected, untreated control group. These results suggest that butyric acid, medium-chain fatty acids and/or essential oils may contribute to the prevention of necrotic enteritis in broilers.
Pappu, Venkata K S; Kanyi, Victor; Santhanakrishnan, Arati; Lira, Carl T; Miller, Dennis J
2013-02-01
The liquid phase esterification of butyric acid with a series of linear and branched alcohols is examined. Four strong cation exchange resins, Amberlyst™ 15, Amberlyst™ 36, Amberlyst™ BD 20, and Amberlyst™ 70, were used along with para-toluenesulfonic acid as a homogeneous catalyst. The effect of increasing alcohol carbon chain length and branching on esterification rate at 60°C is presented. For all catalysts, the decrease in turnover frequency (TOF) with increasing carbon chain length of the alcohol is described in terms of steric hindrance, alcohol polarity, and hydroxyl group concentration. The kinetics of butyric acid esterification with 2-ethylhexanol using Amberlyst™ 70 catalyst is described with an activity-based, pseudo-homogeneous kinetic model that includes autocatalysis by butyric acid. Copyright © 2012 Elsevier Ltd. All rights reserved.
Surface vibrational structure at alkane liquid/vapor interfaces
NASA Astrophysics Data System (ADS)
Esenturk, Okan; Walker, Robert A.
2006-11-01
Broadband vibrational sum frequency spectroscopy (VSFS) has been used to examine the surface structure of alkane liquid/vapor interfaces. The alkanes range in length from n-nonane (C9H20) to n-heptadecane (C17H36), and all liquids except heptadecane are studied at temperatures well above their bulk (and surface) freezing temperatures. Intensities of vibrational bands in the CH stretching region acquired under different polarization conditions show systematic, chain length dependent changes. Data provide clear evidence of methyl group segregation at the liquid/vapor interface, but two different models of alkane chain structure can predict chain length dependent changes in band intensities. Each model leads to a different interpretation of the extent to which different chain segments contribute to the anisotropic interfacial region. One model postulates that changes in vibrational band intensities arise solely from a reduced surface coverage of methyl groups as alkane chain length increases. The additional methylene groups at the surface must be randomly distributed and make no net contribution to the observed VSF spectra. The second model considers a simple statistical distribution of methyl and methylene groups populating a three dimensional, interfacial lattice. This statistical picture implies that the VSF signal arises from a region extending several functional groups into the bulk liquid, and that the growing fraction of methylene groups in longer chain alkanes bears responsibility for the observed spectral changes. The data and resulting interpretations provide clear benchmarks for emerging theories of molecular structure and organization at liquid surfaces, especially for liquids lacking strong polar ordering.
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
Goulet, Olivier; Antébi, Helena; Wolf, Claude; Talbotec, Cécile; Alcindor, Louis-Gérald; Corriol, Odile; Lamor, Michèle; Colomb-Jung, Virginie
2010-01-01
SMOFlipid 20% is an intravenous lipid emulsion (ILE) containing soybean oil, medium-chain triglycerides, olive oil, and fish oil developed to provide energy, essential fatty acids (FAs), and long-chain ω-3 FAs as a mixed emulsion containing α-tocopherol. The aim was to assess the efficacy and safety of this new ILE in pediatric patients receiving home parenteral nutrition (HPN) compared with soybean oil emulsion (SOE). This single-center, randomized, double-blind study included 28 children on HPN allocated to receive either SMOFlipid 20% (n = 15) or a standard SOE (Intralipid 20%, n = 13). ILE was administered 4 to 5 times per week (goal dose, 2.0 g/kg/d) within a parenteral nutrition regimen. Assessments, including safety and efficacy parameters, were performed on day 0 and after the last study infusion (day 29). Lipid peroxidation was determined by measurement of thiobarbituric acid reactive substances (TBARS). There were no significant differences in laboratory safety parameters, including liver enzymes, between the groups on day 29. The mean ± standard deviation changes in the total bilirubin concentration between the initial and final values (day 29 to day 0) were significantly different between groups: SMOFlipid group -1.5 ± 2.4 µmol/L vs SOE group 2.3 ± 3.5 µmol/L, P < .01; 95% confidence interval [CI], -6.2 to -1.4). In plasma and red blood cell (RBC) phospholipids, the ω-3 FAs C20:5ω-3 (eicosapentaenoic acid) and + C22:6ω-3 (docosahexaenoic acid) increased significantly in the SMOFlipid group on day 29. The ω-3:ω-6 FA ratio was significantly elevated with SMOFlipid 20% compared with SOE group (plasma, day 29: 0.15 ± 0.06 vs 0.07 ± 0.02, P < .01, 95% CI, 0.04-0.11; and RBC, day 29: 0.23 ± 0.07 vs 0.14 ± 0.04, P < .01, 95% CI, 0.04-0.13). Plasma α-tocopherol concentration increased significantly more with SMOFlipid 20% (15.7 ± 15.9 vs 5.4 ± 15.2 µmol/L, P < .05; 95% CI, -2.1 to 22.6). The low-density lipoprotein-TBARS concentrations were not significantly different between both groups, indicating that lipid peroxidation did not differ between groups. SMOFlipid 20%, which contains 15% fish oil, was safe and well tolerated, decreased plasma bilirubin, and increased ω-3 FA and α-tocopherol status without changing lipid peroxidation.
26 CFR 1.972-1 - Consolidation of group of export trade corporations.
Code of Federal Regulations, 2010 CFR
2010-04-01
... decrease in investments in export trade assets to which section 970(b) applies as described in paragraph (c... consolidate a chain of export trade corporations shall terminate for the first taxable year of the foreign... foreign corporation which was included in such consolidation for the preceding taxable year ceases to...
A Game Demonstrating Aspects of Bumblebee Natural History
ERIC Educational Resources Information Center
Westgarth-Smith, Angus R.
2004-01-01
The Bumblebee Game is an exciting outdoor game, which demonstrates aspects of bumblebee natural history including food chains, food webs and competition for food, predation by crab spiders, parasitism by "Conopidae" ("Diptera") and brood parasitism by cuckoo bees. It has been played successfully with groups of 10-25 people. Although most suitable…
Yoshimura, Tomokazu; Okada, Mari; Matsuoka, Keisuke
2016-10-01
Quaternary ammonium salt-type cationic surfactants with an adamantyl group (hydrocarbon-type; C n AdAB, fluorocarbon-type; C m F C 3 AdAB, bola-type; Ad-s-Ad, where n, m and s represent hydrocarbon chain lengths of 8-16, fluorocarbon chain lengths of 4-8, and spacer chain length of 10-12) were synthesized via quaternization of N, N-dimethylaminoadamantane and n-alkyl bromide or 1, n-dibromoalkane. Conductivity and surface tension were measured to characterize the solution properties of the synthesized adamantyl group-containing cationic surfactants. In addition, the effects of hydrocarbon and fluorocarbon chain lengths and spacer chain length between headgroups on the measured properties were evaluated by comparison with those of conventional cationic surfactants. The critical micelle concentration (CMC) of C n AdAB and Ad-s-Ad was 2/5 of that for the corresponding conventional surfactants C n TAB and bola-type surfactants with similar number of carbons in the alkyl or alkylene chain; this was because of the increased hydrophobicity due to the adamantyl group. A linear relationship between the logarithm of CMC and the hydrocarbon chain length for C n AdAB was observed, as well as for C n TAB. The slope of the linear correlation for both surfactants was almost the same, indicating that the adamantyl group does not affect the CMC with variations in the hydrocarbon chain length. Similar to conventional surfactants C n TAB, the hydrocarbon-type C n AdAB is highly efficient in reducing the surface tension of water, despite the large occupied area per molecule resulting from the relatively bulky structure of the adamantane skeleton. On the other hand, the bola-type Ad-s-Ad resulted in increased surface tension compared to C n AdAB, indicating that the curved chain between adamantyl groups leads to poor adsorption and orientation at the air-water interface.
Okabayashi, Takehiro; Nishimori, Isao; Yamashita, Koichi; Sugimoto, Takeki; Namikawa, Tsutomu; Maeda, Hiromichi; Yatabe, Tomoaki; Hanazaki, Kazuhiro
2010-03-01
Glucose metabolism is adversely affected in patients following major surgery. Patients may develop hyperglycemia due to a combination of surgical stress and postoperative insulin resistance. A randomized trial was conducted to elucidate the effect of preoperative supplementation with carbohydrates and branched-chain amino acids on postoperative insulin resistance in patients undergoing hepatic resection. A total of 26 patients undergoing a hepatectomy for the treatment of a hepatic neoplasm were randomly assigned to receive a preoperative supplement of carbohydrate and branched-chain amino acid-enriched nutrient mixture or not. The postoperative blood glucose level and the total insulin requirement for normoglycemic control during the 16 h following hepatic resection were determined using the artificial pancreas STG-22. Postoperative insulin requirements for normoglycemic control in the group with preoperative nutritional support was significantly lower than that in the control group (P = 0.039). There was no incidence of hypoglycemia (<40 mg/dL) observed in patients, including those with diabetes mellitus, when the STG-22 was used to control blood glucose levels. STG-22 is a safe and reliable tool to control postoperative glucose metabolism and evaluate insulin resistance. The preoperative oral administration of carbohydrate and branched-chain amino acid-enriched nutrient is of clinical benefit and reduces postoperative insulin resistance in patients undergoing hepatic resection.
Rieder, Ronald F.
1971-01-01
Hemoglobin Gun Hill is an unstable mutant hemoglobin associated with mild compensated hemolysis. This abnormal protein has a deletion of five amino acids in the β-chains. The deletion includes the heme-binding proximal histidine at position 92. The β-chains of hemoglobin Gun Hill lack heme groups. Approximately 32% of the circulating hemoglobin in heterozygous subjects consists of the mutant hemoglobin. When reticulocytes were incubated with radioactive amino acid the specific activity of hemoglobin Gun Hill was three to six times that of hemoglobin A. Total incorporation of radioactivity into hemoglobin Gun Hill was two to three times that into hemoglobin A. There were 20-50% more total counts in β-Gun Hill (βGH) than in βA. These results indicate that in reticulocytes there was greater synthesis of the abnormal β-chains than βA-chains. The ratio of the specific activities of the α-chains of hemoglobin Gun Hill to the α-chains of hemoglobin A was 20: 1. There was evidence of a free pool of α-chains in the reticulocytes containing hemoglobin Gun Hill. After 10 min of incubation approximately 40% of the total α-chain radioactivity was in the free pool. When protein synthesis was blocked by incubation of reticulocytes with puromycin, the specific activity of the α-chains of hemoglobin Gun Hill continued to increase due to direct exchange of α-subunits between the free pool and preformed hemoglobin Gun Hill. Studies of the assembly of βA and βGH revealed that the rates of translation of the two polypeptide chains were equal and uniform. No evidence was obtained for the existence of “slow points” in the process of globin chain assembly. The studies also suggest that lack of strong heme-globin binding does not hinder the synthesis of globin chains. PMID:5540175
Mitochondrial respiratory chain complexes as sources and targets of thiol-based redox-regulation.
Dröse, Stefan; Brandt, Ulrich; Wittig, Ilka
2014-08-01
The respiratory chain of the inner mitochondrial membrane is a unique assembly of protein complexes that transfers the electrons of reducing equivalents extracted from foodstuff to molecular oxygen to generate a proton-motive force as the primary energy source for cellular ATP-synthesis. Recent evidence indicates that redox reactions are also involved in regulating mitochondrial function via redox-modification of specific cysteine-thiol groups in subunits of respiratory chain complexes. Vice versa the generation of reactive oxygen species (ROS) by respiratory chain complexes may have an impact on the mitochondrial redox balance through reversible and irreversible thiol-modification of specific target proteins involved in redox signaling, but also pathophysiological processes. Recent evidence indicates that thiol-based redox regulation of the respiratory chain activity and especially S-nitrosylation of complex I could be a strategy to prevent elevated ROS production, oxidative damage and tissue necrosis during ischemia-reperfusion injury. This review focuses on the thiol-based redox processes involving the respiratory chain as a source as well as a target, including a general overview on mitochondria as highly compartmentalized redox organelles and on methods to investigate the redox state of mitochondrial proteins. This article is part of a Special Issue entitled: Thiol-Based Redox Processes. Copyright © 2014 Elsevier B.V. All rights reserved.
The Biosynthesis of Nitrogen-, Sulfur-, and High-carbon Chain-containing Sugars†
Lin, Chia-I; McCarty, Reid M.; Liu, Hung-wen
2013-01-01
Carbohydrates serve many structural and functional roles in biology. While the majority of monosaccharides are characterized by the chemical composition: (CH2O)n, modifications including deoxygenation, C-alkylation, amination, O- and N-methylation, which are characteristic of many sugar appendages of secondary metabolites, are not uncommon. Interestingly, some sugar molecules are formed via modifications including amine oxidation, sulfur incorporation, and “high-carbon” chain attachment. Most of these unusual sugars have been identified over the past several decades as components of microbially produced natural products, although a few high-carbon sugars are also found in the lipooligosaccharides of the outer cell walls of Gram-negative bacteria. Despite their broad distribution in nature, these sugars are considered “rare” due to their relative scarcity. The biosynthetic steps that underlie their formation continue to perplex researchers to this day and many questions regarding key transformations remain unanswered. This review will focus on our current understanding of the biosynthesis of unusual sugars bearing oxidized amine substituents, thio-functional groups, and high-carbon chains. PMID:23348524
Kumar, Kiran; Shetty, Sharath; Krithika, M J; Cyriac, Bobby
2014-01-01
Background: The objective was to evaluate and compare the effect of Coca-Cola®, tea, Listerine® mouthwash on the force delivered by elastomeric chain in vitro. Materials and Methods: Four specimen groups (distilled water, Coca-Cola®, tea, Listerine® mouthwash) with a total sample size of 480 specimens. A specimen is described as a four link grey close elastomeric chain. Jigs, each with a series of pins set 25 mm apart, was used to hold stretched elastomeric chains at a constant length. These jigs allowed for complete submersion of the elastomeric chain in a water bath throughout the test period, as well as the dipping of elastomeric chains in respective control and test solutions. For 60 s, twice a day, groups were exposed to the respective solutions, the two daily exposure was separated by 9 h and force measurements were taken at six time points during the experiment, that is, 1 h, 24 h, 7 days, 14 days, 21 days, and 28 days. Force measurements were made by Instron machine by a single blinded examiner with the help of a second examiner. Results: It was found out that there was highly significant difference between groups control, Coca-Cola®, Listerine®, and tea as well as there was highly significant (p < 0.01) between time periods. Group versus time was also highly significant (p < 0.01). For all groups substantial amount of force decay occurred until 7 days. The control group reached plateau between 7 and 14 days and then suddenly decreased from 14 days to 28 days. The Coca-Cola® and the Listerine® group reached a plateau between 7 and 21 days then decrease between 21 and 28 days. The tea group showed plateau phase between 7 and 28 days. After 28 days in the control group, 25% force decay occurred while the test groups force decay of 30-50% occurred. Conclusion: Coca-Cola®, Listerine® mouthwash, and tea cause an increase in force decay of elastomeric chains over time. Tea caused highest force decay followed by Listerine® and Coca-Cola® when compared to control group. How to cite the article: Kumar K, Shetty S, Krithika MJ, Cyriac B. Effect of commonly used beverage, soft drink, and mouthwash on force delivered by elastomeric chain: A comparative in vitro study. J Int Oral Health 2014;6(3):7-10. PMID:25083025
Kumar, Kiran; Shetty, Sharath; Krithika, M J; Cyriac, Bobby
2014-06-01
The objective was to evaluate and compare the effect of Coca-Cola®, tea, Listerine® mouthwash on the force delivered by elastomeric chain in vitro. Four specimen groups (distilled water, Coca-Cola®, tea, Listerine® mouthwash) with a total sample size of 480 specimens. A specimen is described as a four link grey close elastomeric chain. Jigs, each with a series of pins set 25 mm apart, was used to hold stretched elastomeric chains at a constant length. These jigs allowed for complete submersion of the elastomeric chain in a water bath throughout the test period, as well as the dipping of elastomeric chains in respective control and test solutions. For 60 s, twice a day, groups were exposed to the respective solutions, the two daily exposure was separated by 9 h and force measurements were taken at six time points during the experiment, that is, 1 h, 24 h, 7 days, 14 days, 21 days, and 28 days. Force measurements were made by Instron machine by a single blinded examiner with the help of a second examiner. It was found out that there was highly significant difference between groups control, Coca-Cola®, Listerine®, and tea as well as there was highly significant (p < 0.01) between time periods. Group versus time was also highly significant (p < 0.01). For all groups substantial amount of force decay occurred until 7 days. The control group reached plateau between 7 and 14 days and then suddenly decreased from 14 days to 28 days. The Coca-Cola® and the Listerine® group reached a plateau between 7 and 21 days then decrease between 21 and 28 days. The tea group showed plateau phase between 7 and 28 days. After 28 days in the control group, 25% force decay occurred while the test groups force decay of 30-50% occurred. Coca-Cola®, Listerine® mouthwash, and tea cause an increase in force decay of elastomeric chains over time. Tea caused highest force decay followed by Listerine® and Coca-Cola® when compared to control group. How to cite the article: Kumar K, Shetty S, Krithika MJ, Cyriac B. Effect of commonly used beverage, soft drink, and mouthwash on force delivered by elastomeric chain: A comparative in vitro study. J Int Oral Health 2014;6(3):7-10.
Chiral Haldane phases of SU(N ) quantum spin chains
NASA Astrophysics Data System (ADS)
Roy, Abhishek; Quella, Thomas
2018-04-01
Gapped quantum spin chains with symmetry PSU(N ) =SU(N ) /ZN are known to possess N distinct symmetry protected topological phases. Besides the trivial phase, there are N -1 Haldane phases which are distinguished by the occurrence of massless boundary spins. We give an expression for a universal AKLT Hamiltonian for an arbitrary symmetry group, including the case where inversion symmetry is broken. Using a diagrammatic method, we construct Hamiltonians for two of the topological classes in SU(N ) that arise when the physical spin is in the adjoint representation. Since our results are valid for all N , we also discuss the large-N limit.
Lack of toxicity by medium chain triglycerides (MCT) in canines during a 90-day feeding study.
Matulka, Ray A; Thompson, D V M Larry; Burdock, George A
2009-01-01
Dietary fats in food are natural energy sources to animals and are included in the American Association of Feed Control Officials (AAFCO) manual as a requirement for dog food. Medium chain triglycerides are comprised of a glycerol backbone esterified to medium chain length (8-12 carbon) fatty acids (FA) and, in the context of this report, are all saturated FA. Unlike esterified long chain (>12 carbons) FA (long chain triglycerides or LCT), MCT are lower in caloric value, and are eliminated from the body more quickly than LCT. The objective of this study was to determine the safety of MCT when fed to beagles for 90 days at levels of 0%, 5%, 10%, and 15% MCT added to conventional feed. The beagles were monitored for signs of toxicity by clinical observations, body weight measurements, food consumption level, physical examinations, hematology and serum chemistry, ophthalmic examinations, and urinalysis. There were no signs of toxic effects observed in any of the animals that were related to feed, and the animal viability was 100% at the end of the study. Some animals exhibited significant increased blood urea nitrogen, potassium and cholesterol levels in the 10% and 15% MCT-fed groups. Also, in the same groups with elevated nitrogen, there were concomitant reductions in total blood protein and urine volumes. These changes in serum chemistry may be the result of protein sparing effects due to the high levels of MCT intake, and are not deemed to be pathological in nature. Animals receiving 15% MCT in feed had lower levels of food intake due to palatability issues. From the other examination parameters, there were no significant changes noted between groups receiving MCT and vehicle feed. No safety concerns were noted at any dose level, although an issue with palatability precluded identifying 15% as the highest dose level tested.
Ahmed, Ossama A; Kaisar, Hany H; Badawi, Rehab; Hawash, Nehad; Samir, Hossam; Shabana, Sherif St; Fouad, Mohamed Hassan A; Rizk, Fatma H; Khodeir, Samy A; Abd-Elsalam, Sherief
2018-01-01
Treatment of hepatitis C virus (HCV) infection has significantly changed during the last few years. The combination of ledipasvir and sofosbuvir has been shown to treat high proportions of patients with HCV genotype 1 with remarkable tolerability. The aim of the work was to assess the efficacy and safety of sofosbuvir plus ledipasvir in treating treatment-naïve Egyptian patients with genotype 4 HCV infection. In this open-label randomized study, 200 treatment-naive patients who were HCV antibody positive and HCV RNA positive by polymerase chain reaction, aged >18 years, were enrolled. The patients were classified into two groups: group I included 100 patients who received single therapy with sofosbuvir plus ledipasvir for 12 weeks and group II included 100 patients who received sofosbuvir plus oral weight-based ribavirin for 24 weeks. The primary end point was a sustained virological response at 12 weeks (SVR12) after the end of treatment, determined by quantitative polymerase chain reaction for HCV RNA. Group I patients showed statistically significant ( p <0.05) higher SVR12 compared with group II patients (99% vs. 80%). There was no statistical difference ( p >0.05%) between the studied groups regarding the frequencies of the side effects (26% vs. 29%). The most common adverse effects were headache, fatigue, myalgia, and cough. Sofosbuvir and ledipasvir treatment for 12 weeks was well tolerated by patients with HCV genotype 4 and resulted in 99% SVR for all patients who received 12 weeks of the study drugs. ClinicalTrials.gov Identifier: NCT02992457.
Burmester, Mike; Munilla, Jorge; Ortiz, Andrés; Caballero-Gil, Pino
2017-07-04
The National Strategy for Global Supply Chain Security published in 2012 by the White House identifies two primary goals for strengthening global supply chains: first, to promote the efficient and secure movement of goods, and second to foster a resilient supply chain. The Internet of Things (IoT), and in particular Radio Frequency Identification (RFID) technology, can be used to realize these goals. For product identification, tracking and real-time awareness, RFID tags are attached to goods. As tagged goods move along the supply chain from the suppliers to the manufacturers, and then on to the retailers until eventually they reach the customers, two major security challenges can be identified: (I) to protect the shipment of goods that are controlled by potentially untrusted carriers; and (II) to secure the transfer of ownership at each stage of the chain. For the former, grouping proofs in which the tags of the scanned goods generate a proof of "simulatenous" presence can be employed, while for the latter, ownership transfer protocols (OTP) are used. This paper describes enhanced security solutions for both challenges. We first extend earlier work on grouping proofs and group codes to capture resilient group scanning with untrusted readers; then, we describe a modified version of a recently published OTP based on channels with positive secrecy capacity adapted to be implemented on common RFID systems in the supply chain. The proposed solutions take into account the limitations of low cost tags employed in the supply chain, which are only required to generate pseudorandom numbers and compute one-way hash functions.
Ota, Tatsuya; Rast, Jonathan P.; Litman, Gary W.; Amemiya, Chris T.
2003-01-01
The lineage leading to lungfishes is one of the few major jawed vertebrate groups in which Ig heavy chain isotype structure has not been investigated at the genetic level. In this study, we have characterized three different Ig heavy chain isotypes of the African lungfish, Protopterus aethiopicus, including an IgM-type heavy chain and short and long forms of non-IgM heavy chains. Northern blot analysis as well as patterns of VH utilization suggest that the IgM and non-IgM isotypes are likely encoded in separate loci. The two non-IgM isotypes identified in Protopterus share structural features with the short and long forms of IgX/W/NARC (referred to hereafter as IgW), which were previously considered to be restricted to the cartilaginous fish. It seems that the IgW isotype has a far broader phylogenetic distribution than considered originally and raises questions with regard to the origin and evolutionary divergence of IgM and IgW. Moreover, its absence in other gnathostome lineages implies paradoxically that the IgW-type genes were lost from teleost and tetrapod lineages. PMID:12606718
Quantum spin chains with multiple dynamics
NASA Astrophysics Data System (ADS)
Chen, Xiao; Fradkin, Eduardo; Witczak-Krempa, William
2017-11-01
Many-body systems with multiple emergent time scales arise in various contexts, including classical critical systems, correlated quantum materials, and ultracold atoms. We investigate such nontrivial quantum dynamics in a different setting: a spin-1 bilinear-biquadratic chain. It has a solvable entangled ground state, but a gapless excitation spectrum that is poorly understood. By using large-scale density matrix renormalization group simulations, we find that the lowest excitations have a dynamical exponent z that varies from 2 to 3.2 as we vary a coupling in the Hamiltonian. We find an additional gapless mode with a continuously varying exponent 2 ≤z <2.7 , which establishes the presence of multiple dynamics. In order to explain these striking properties, we construct a continuum wave function for the ground state, which correctly describes the correlations and entanglement properties. We also give a continuum parent Hamiltonian, but show that additional ingredients are needed to capture the excitations of the chain. By using an exact mapping to the nonequilibrium dynamics of a classical spin chain, we find that the large dynamical exponent is due to subdiffusive spin motion. Finally, we discuss the connections to other spin chains and to a family of quantum critical models in two dimensions.
The hydrodeoxygenation of bioderived furans into alkanes.
Sutton, Andrew D; Waldie, Fraser D; Wu, Ruilian; Schlaf, Marcel; Silks, Louis A Pete; Gordon, John C
2013-05-01
The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.
The hydrodeoxygenation of bioderived furans into alkanes
NASA Astrophysics Data System (ADS)
Sutton, Andrew D.; Waldie, Fraser D.; Wu, Ruilian; Schlaf, Marcel; ‘Pete' Silks, Louis A.; Gordon, John C.
2013-05-01
The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.
Song, Bo; Liu, Guanqing; Xu, Rui; Yin, Shouchun; Wang, Zhiqiang; Zhang, Xi
2008-04-15
This article discusses the relationship between the molecular structure of bolaamphiphiles bearing mesogenic groups and their interfacial self-organized morphology. On the basis of the molecular structures of bolaamphiphiles, we designed and synthesized a series of molecules with different hydrophobic alkyl chain lengths, hydrophilic headgroups, mesogenic groups, and connectors between the alkyl chains and the mesogenic group. Through investigating their interfacial self-organization behavior, some experiential rules are summarized: (1) An appropriate alkyl chain length is necessary to form stable surface micelles; (2) different categories of headgroups have a great effect on the interfacial self-organized morphology; (3) different types of mesogenic groups have little effect on the structure of the interfacial assembly when it is changed from biphenyl to azobenzene or stilbene; (4) the orientation of the ester linker between the mesogenic group and alkyl chain can greatly influence the interfacial self-organization behavior. It is anticipated that this line of research may be helpful for the molecular engineering of bolaamphiphiles to form tailor-made morphologies.
Can Simple Transmission Chains Foster Collective Intelligence in Binary-Choice Tasks?
Moussaïd, Mehdi; Seyed Yahosseini, Kyanoush
2016-01-01
In many social systems, groups of individuals can find remarkably efficient solutions to complex cognitive problems, sometimes even outperforming a single expert. The success of the group, however, crucially depends on how the judgments of the group members are aggregated to produce the collective answer. A large variety of such aggregation methods have been described in the literature, such as averaging the independent judgments, relying on the majority or setting up a group discussion. In the present work, we introduce a novel approach for aggregating judgments—the transmission chain—which has not yet been consistently evaluated in the context of collective intelligence. In a transmission chain, all group members have access to a unique collective solution and can improve it sequentially. Over repeated improvements, the collective solution that emerges reflects the judgments of every group members. We address the question of whether such a transmission chain can foster collective intelligence for binary-choice problems. In a series of numerical simulations, we explore the impact of various factors on the performance of the transmission chain, such as the group size, the model parameters, and the structure of the population. The performance of this method is compared to those of the majority rule and the confidence-weighted majority. Finally, we rely on two existing datasets of individuals performing a series of binary decisions to evaluate the expected performances of the three methods empirically. We find that the parameter space where the transmission chain has the best performance rarely appears in real datasets. We conclude that the transmission chain is best suited for other types of problems, such as those that have cumulative properties. PMID:27880825
Web-based hydrodynamics computing
NASA Astrophysics Data System (ADS)
Shimoide, Alan; Lin, Luping; Hong, Tracie-Lynne; Yoon, Ilmi; Aragon, Sergio R.
2005-01-01
Proteins are long chains of amino acids that have a definite 3-d conformation and the shape of each protein is vital to its function. Since proteins are normally in solution, hydrodynamics (describes the movement of solvent around a protein as a function of shape and size of the molecule) can be used to probe the size and shape of proteins compared to those derived from X-ray crystallography. The computation chain needed for these hydrodynamics calculations consists of several separate programs by different authors on various platforms and often requires 3D visualizations of intermediate results. Due to the complexity, tools developed by a particular research group are not readily available for use by other groups, nor even by the non-experts within the same research group. To alleviate this situation, and to foment the easy and wide distribution of computational tools worldwide, we developed a web based interactive computational environment (WICE) including interactive 3D visualization that can be used with any web browser. Java based technologies were used to provide a platform neutral, user-friendly solution. Java Server Pages (JSP), Java Servlets, Java Beans, JOGL (Java bindings for OpenGL), and Java Web Start were used to create a solution that simplifies the computing chain for the user allowing the user to focus on their scientific research. WICE hides complexity from the user and provides robust and sophisticated visualization through a web browser.
Web-based hydrodynamics computing
NASA Astrophysics Data System (ADS)
Shimoide, Alan; Lin, Luping; Hong, Tracie-Lynne; Yoon, Ilmi; Aragon, Sergio R.
2004-12-01
Proteins are long chains of amino acids that have a definite 3-d conformation and the shape of each protein is vital to its function. Since proteins are normally in solution, hydrodynamics (describes the movement of solvent around a protein as a function of shape and size of the molecule) can be used to probe the size and shape of proteins compared to those derived from X-ray crystallography. The computation chain needed for these hydrodynamics calculations consists of several separate programs by different authors on various platforms and often requires 3D visualizations of intermediate results. Due to the complexity, tools developed by a particular research group are not readily available for use by other groups, nor even by the non-experts within the same research group. To alleviate this situation, and to foment the easy and wide distribution of computational tools worldwide, we developed a web based interactive computational environment (WICE) including interactive 3D visualization that can be used with any web browser. Java based technologies were used to provide a platform neutral, user-friendly solution. Java Server Pages (JSP), Java Servlets, Java Beans, JOGL (Java bindings for OpenGL), and Java Web Start were used to create a solution that simplifies the computing chain for the user allowing the user to focus on their scientific research. WICE hides complexity from the user and provides robust and sophisticated visualization through a web browser.
NASA Astrophysics Data System (ADS)
Cui, Honggang
2007-12-01
Amphiphilic block copolymers, consisting of at least two types of monomers with different affinity to the dissolving solvent(s), have been recognized as a molecular building unit for their chemical tunability and design flexibility. Amphiphilic block copolymers with a chargeable block have structural features of polyelectrolytes, block copolymers and surfactants. The combination of these different features offers great flexibility for developing novel assembled morphologies at the nanoscale and outstanding ability to control and manipulate those morphologies. The nanostructures, formed from the spontaneous association of amphiphilic block copolymer in selective solvents, show promise for applications in nanotechnology and pharmaceuticals, including drug delivery, tissue engineering and bio-imaging. A basic knowledge of their modes of self-assembly and their correspondence to application-related properties is just now being developed and poses a considerable scientific challenge. The goal of this dissertation is to investigate the associative behavior of charged, amphiphilic block copolymers in solvent mixtures while in the presence of organic counterions. Self-assembly of poly (acrylic acid)- block-poly (methyl acrylate)-block-polystyrene (PAA- b-PMA-b-PS) triblock copolymers produces nanodomains in THF/water solution specifically through the interaction with organic counterions (polyamines). These assembled structures can include classic micelles (spheres, cylinders and vesicles), but, more importantly, include non-classic micelles (disks, toroids, branched micelles and segmented micelles). Each micelle structure is stable and reproducible at different assembly conditions. The assembled micellar structures depend on not only solution components (thermodynamics) but also mixing procedure and consequent self-assembly pathway (kinetics). The key factors that determine the thermodynamic interactions that partially define the assembled structures and the kinetic assembly process include THF/water ratio, PS block length, the type and amount of organic counterions, and the mixing pathway. Their formation mechanism has been investigated from three aspects: (i) the chain structure of organic counterions, including spacer length, chain hydrophobicity between ionizable groups and the number of ionizable groups (amine group); (ii) molecular structure of the triblock copolymer, including block length of polystyrene and chain architecture; (iii) relative variation of the components, such as different ratios of THF to water and the different ratios of amine groups to acid groups. The first example of a novel micelle formed was the toroidal micelle. The toroidal micelle morphology, which is theoretically predicted but rarely observed, has been produced by the self assembly of PAA99- b-PMA73-b-PS66 in combination with 2,2-(ethylenedioxy)diethylamine (EDDA) and mixed THF/H2O solvent. It was found that toroids can be constructed by two mechanisms: elimination of energetically unfavored cylindrical micelle endcaps or perforation of disk-like micelles. Three-fold junctions were formed as intermediate structures to facilitate toroidal formation from cylindrical micelles. In order to construct toroids from cylindrical micelles, three requirements must be met: lower bending modulus (flexibility of cylinders), selfattraction between cylinders, and extra endcapping energy originating from chain packing frustration. Extremely high energy spheres can also fuse into toroids. Disk-like micelles can transform into a toroidal morphology when cylindrical packing geometry was initiated along the rims of disk-like micelles via solvent mixing that eventually perforated the disk center. The toroidal morphology can be kinetically trapped by either ridding the system of organic solvent or chemically crosslinking the PAA corona with EDDA via addition of 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide methiodide (DPEM). The interaction of positively-charged, multivalent organic amines with the negatively-charged PAA corona plays a decisive role in the formation of these micelles. Inter-chain binding from the interaction of the two amine end groups of diamines with acid groups from different PAA corona blocks governs the final assembled structures. Diamines with hydrophilic spacers induced the formation of micelles with larger interfacial curvature as the spacer length increased. Disk-like micelles, cylindrical micelles or spherical micelles were observed with the gradual increase of hydrophilic spacer length. Diamines with variable hydrophobic spacers showed a similar effect when the spacer length was less than six methylene units. Application of longer hydrophobic diamines had a reverse effect on the interfacial curvature. This effect was attributed to the interaction of hydrophobic diamine hydrocarbon linking chains with the PMA-b-PS hydrophobic core. These findings indicate an easy method to tune micelle structure with multivalent organic counterions. (Abstract shortened by UMI.)
Polymerizable disilanols having in-chain perfluoroalkyl groups
NASA Technical Reports Server (NTRS)
Patterson, W. J.; Morris, D. E. (Inventor)
1973-01-01
Disilanols containing in-chain perfluoroalkyl and aromatic groups and the process by which they were prepared are discussed. The disilanols, when reacted with a diaminosilane and cured, produce polymeric material resistant to hydrocarbon fuels and stable at elevated temperatures.
Lee, Ik Jae; Bae, Jung Im; You, Sei Hwan; Rhee, Yumie; Lee, Jong Ho
2011-01-01
Purpose The present study evaluated whether oral supplementation with a branched-chain amino acid (BCAA) improves the biochemical and amino acid profiles of liver tumor patients undergoing radiotherapy. Materials and Methods Patients were randomly assigned to one of 2 groups: a group given oral supplementation with BCAA granules (LIVACT granules; Samil Pharm Co., Korea, each granule containing L-isoleucine 952 mg, L-leucine 1,904 mg, and L-valine 1,144 mg) during radiotherapy, or a placebo group. Physical and biochemical examinations and measurements, including subjective symptoms, Child-Pugh class, body mass index, plasma albumin concentration, and plasma amino acid profiles were monitored. Results Fifty were enrolled between November 2005 and November 2006. We also analyzed data from 37 hepatocellular carcinoma (HCC) patients in order to evaluate a more homogenous group. The two groups of patients were comparable in terms of age, gender, Child-Pugh score, and underlying hepatitis virus type. Serum albumin, total protein, liver enzymes, and cholesterol showed a tendency to increase in the BCAA group. In this group, the percentage of cases that reverted to normal serum albumin levels between 3 and 10 weeks after administration of BCAA was significantly higher (41.18%) than in the placebo group (p=0.043). Conclusion Oral supplementation with a BCAA preparation seems to help HCC patients undergoing radiotherapy by increasing the BCAA concentration. PMID:21509160
Lee, Ik Jae; Seong, Jinsil; Bae, Jung Im; You, Sei Hwan; Rhee, Yumie; Lee, Jong Ho
2011-03-01
The present study evaluated whether oral supplementation with a branched-chain amino acid (BCAA) improves the biochemical and amino acid profiles of liver tumor patients undergoing radiotherapy. Patients were randomly assigned to one of 2 groups: a group given oral supplementation with BCAA granules (LIVACT granules; Samil Pharm Co., Korea, each granule containing L-isoleucine 952 mg, L-leucine 1,904 mg, and L-valine 1,144 mg) during radiotherapy, or a placebo group. Physical and biochemical examinations and measurements, including subjective symptoms, Child-Pugh class, body mass index, plasma albumin concentration, and plasma amino acid profiles were monitored. Fifty were enrolled between November 2005 and November 2006. We also analyzed data from 37 hepatocellular carcinoma (HCC) patients in order to evaluate a more homogenous group. The two groups of patients were comparable in terms of age, gender, Child-Pugh score, and underlying hepatitis virus type. Serum albumin, total protein, liver enzymes, and cholesterol showed a tendency to increase in the BCAA group. In this group, the percentage of cases that reverted to normal serum albumin levels between 3 and 10 weeks after administration of BCAA was significantly higher (41.18%) than in the placebo group (p=0.043). Oral supplementation with a BCAA preparation seems to help HCC patients undergoing radiotherapy by increasing the BCAA concentration.
Gelli, Aulo; Becquey, Elodie; Ganaba, Rasmane; Headey, Derek; Hidrobo, Melissa; Huybregts, Lieven; Verhoef, Hans; Kenfack, Romain; Zongouri, Sita; Guedenet, Hannah
2017-09-06
The SELEVER study is designed to evaluate the impact of an integrated agriculture-nutrition package of interventions (including poultry value chain development, women's empowerment activities, and a behavior change communications strategy to promote improved diets and feeding, care, and hygiene practices) on the diets, health, and nutritional status of women and children in Burkina Faso. This paper presents the rationale and study design. The impact evaluation involves a cluster randomized controlled trial design that will be implemented in 120 rural communities/villages within 60 communes supported by SELEVER in the Boucle de Mouhoun, Centre-Ouest, and Haut-Bassins regions of Burkina Faso. Communities will be randomly assigned to one of three treatment arms, including: (1) SELEVER intervention group; (2) SELEVER with an intensive WASH component; and (3) control group without intervention. Primary outcomes include the mean probability of adequacy of diets for women and children (aged 2-4 years at baseline), infant and young child feeding practices of caregivers of children aged 0-2 years, and household poultry production and sales. Intermediate outcomes along the agriculture and nutrition pathways will also be measured, including child nutrition status and development. The evaluation will follow a mixed-methods approach, including a panel of child-, household-, community-, and market-level surveys, and data collection points during post-harvest and lean seasons, as well as one year after implementation completion to examine sustainability. To our knowledge, this study is the first to rigorously examine from a food systems perspective, the simultaneous impact of scaling-up nutrition-specific and nutrition-sensitive interventions through a livestock value-chain and community-intervention platform, across nutrition, health, and agriculture domains. The findings of this evaluation will provide evidence to support the design of market-based nutrition-sensitive interventions. ISRCTN registry, ISRCTN16686478 . Registered on 2 December 2016.
Introduction to fatty acids and lipids.
Burdge, Graham C; Calder, Philip C
2015-01-01
The purpose of this article is to describe the structure, function and metabolism of fatty acids and lipids that are of particular importance in the context of parenteral nutrition. Lipids are a heterogeneous group of molecules that share the common property of hydrophobicity. Lipids range in structure from simple short hydrocarbon chains to more complex molecules, including triacylglycerols, phospholipids and sterols and their esters. Lipids within each class may differ structurally. Fatty acids are common components of complex lipids, and these differ according to chain length and the presence, number and position of double bonds in the hydrocarbon chain. Structural variation among complex lipids and among fatty acids gives rise to functional differences that result in different impacts upon metabolism and upon cell and tissue responses. Fatty acids and complex lipids exhibit a variety of structural variations that influence their metabolism and their functional effects. © 2015 S. Karger AG, Basel.
Slide-Ring Materials Using Cyclodextrin.
Ito, Kohzo
2017-01-01
We have recently synthesized slide-ring materials using cyclodextrin by cross-linking polyrotaxanes, a typical supramolecule. The slide-ring materials have polymer chains with bulky end groups topologically interlocked by figure-of-eight shaped junctions. This indicates that the cross-links can pass through the polymer chains similar to pulleys to relax the tension of the backbone polymer chains. The slide-ring materials also differ from conventional polymers in that the entropy of rings affects the elasticity. As a result, the slide-ring materials show quite small Young's modulus not proportional to the cross-linking density. This concept can be applied to a wide variety of polymeric materials as well as gels. In particular, the slide-ring materials show remarkable scratch-proof properties for coating materials for automobiles, cell phones, mobile computers, and so on. Further current applications include vibration-proof insulation materials for sound speakers, highly abrasive polishing media, dielectric actuators, and so on.
Murakami, Masashi; Ohte, Nobuhito; Suzuki, Takahiro; Ishii, Nobuyoshi; Igarashi, Yoshiaki; Tanoi, Keitaro
2014-01-01
Radionuclides, including 137Cs, were released from the disabled Fukushima Daiichi Nuclear Power Plant and had been deposited broadly over forested areas of north-eastern Honshu Island, Japan. In the forest, 137Cs was highly concentrated on leaf litters deposited in autumn 2010, before the accident. Monitoring of the distribution of 137Cs among functional groups clearly showed the role of the detrital food chain as the primary channel of 137Cs transfer to consumer organisms. Although many studies have reported the bioaccumulation (or dilution) of radioactive materials through trophic interactions, the present results highlight the importance of examining multiple possible pathways (e.g., grazing vs. detrital chains) in the proliferation of 137Cs through food webs. These results provide important insight into the future distribution and transfer of 137Cs within forest ecosystems. PMID:24398571
NASA Astrophysics Data System (ADS)
Li, Guo; Rangel, Tonatiuh; Liu, Zhen-Fei; Cooper, Valentino R.; Neaton, Jeffrey B.
2016-03-01
Using density functional theory (DFT) with a van der Waals density functional, we calculate the adsorption energetics and geometry of benzenediamine (BDA) molecules on Au(111) surfaces. Our results demonstrate that the reported self-assembled linear chain structure of BDA, stabilized via hydrogen bonds between amine groups, is energetically favored over previously studied monomeric phases. Moreover, using a model, which includes nonlocal polarization effects from the substrate and the neighboring molecules and incorporates many-body perturbation theory calculations within the GW approximation, we obtain approximate self-energy corrections to the DFT highest occupied molecular orbital (HOMO) energy associated with BDA adsorbate phases. We find that, independent of coverage, the HOMO energy of the linear chain phase is lower relative to the Fermi energy than that of the monomer phase, and in good agreement with values measured with ultraviolet photoelectron spectroscopy and x-ray photoelectron spectroscopy.
26 CFR 1.963-0 - Repeal of section 963; effective dates.
Code of Federal Regulations, 2012 CFR
2012-04-01
... after December 31, 1975, then a foreign corporation shall be includible in such election only if— (i) It... (i) of this paragraph from a chain or group election of a United States shareholder for its taxable.... The application of this paragraph may be illustrated by the following example: Example. (a) M is a...
Costs of food waste along the value chain: evidence from South Africa.
Nahman, Anton; de Lange, Willem
2013-11-01
In a previous paper (Nahman et al., 2012), the authors estimated the costs of household food waste in South Africa, based on the market value of the wasted food (edible portion only), as well as the costs of disposal to landfill. In this paper, we extend the analysis by assessing the costs of edible food waste throughout the entire food value chain, from agricultural production through to consumption at the household level. First, food waste at each stage of the value chain was quantified in physical units (tonnes) for various food commodity groups. Then, weighted average representative prices (per tonne) were estimated for each commodity group at each stage of the value chain. Finally, prices were multiplied by quantities, and the resulting values were aggregated across the value chain for all commodity groups. In this way, the total cost of food waste across the food value chain in South Africa was estimated at R61.5 billion per annum (approximately US$7.7 billion); equivalent to 2.1% of South Africa's annual gross domestic product. The bulk of this cost arises from the processing and distribution stages of the fruit and vegetable value chain, as well as the agricultural production and distribution stages of the meat value chain. These results therefore provide an indication of where interventions aimed at reducing food waste should be targeted. Copyright © 2013 Elsevier Ltd. All rights reserved.
Cecchet, F; Lis, D; Caudano, Y; Mani, A A; Peremans, A; Champagne, B; Guthmuller, J
2012-03-28
The knowledge of the first hyperpolarizability tensor elements of molecular groups is crucial for a quantitative interpretation of the sum frequency generation (SFG) activity of thin organic films at interfaces. Here, the SFG response of the terminal methyl group of a dodecanethiol (DDT) monolayer has been interpreted on the basis of calculations performed at the density functional theory (DFT) level of approximation. In particular, DFT calculations have been carried out on three classes of models for the aliphatic chains. The first class of models consists of aliphatic chains, containing from 3 to 12 carbon atoms, in which only one methyl group can freely vibrate, while the rest of the chain is frozen by a strong overweight of its C and H atoms. This enables us to localize the probed vibrational modes on the methyl group. In the second class, only one methyl group is frozen, while the entire remaining chain is allowed to vibrate. This enables us to analyse the influence of the aliphatic chain on the methyl stretching vibrations. Finally, the dodecanethiol (DDT) molecule is considered, for which the effects of two dielectrics, i.e. n-hexane and n-dodecane, are investigated. Moreover, DDT calculations are also carried out by using different exchange-correlation (XC) functionals in order to assess the DFT approximations. Using the DFT IR vectors and Raman tensors, the SFG spectrum of DDT has been simulated and the orientation of the methyl group has then been deduced and compared with that obtained using an analytical approach based on a bond additivity model. This analysis shows that when using DFT molecular properties, the predicted orientation of the terminal methyl group tends to converge as a function of the alkyl chain length and that the effects of the chain as well as of the dielectric environment are small. Instead, a more significant difference is observed when comparing the DFT-based results with those obtained from the analytical approach, thus indicating the importance of a quantum chemical description of the hyperpolarizability tensor elements of the methyl group. © 2012 IOP Publishing Ltd
Keil, Harry; Wasserman, David; Dawson, Charles R.
1944-01-01
1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415
Keil, H; Wasserman, D; Dawson, C R
1944-10-01
1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.
Gas-phase spectroscopy of synephrine by laser desorption supersonic jet technique.
Ishiuchi, Shun-ichi; Asakawa, Toshiro; Mitsuda, Haruhiko; Miyazaki, Mitsuhiko; Chakraborty, Shamik; Fujii, Masaaki
2011-09-22
In our previous work, we found that synephrine has six conformers in the gas phase, while adrenaline, which is a catecholamine and has the same side chain as synephrine, has been reported to have only two conformers. To determine the conformational geometries of synephrine, we measured resonance enhanced multiphoton ionization, ultraviolet-ultraviolet hole burning, and infrared dip spectra by utilizing the laser desorption supersonic jet technique. By comparing the observed infrared spectra with theoretical ones, we assigned geometries except for the orientations of the phenolic OH group. Comparison between the determined structures of synephrine and those of 2-methylaminno-1-phenylethanol, which has the same side chain as synephrine but no phenol OH group, leads to the conclusion that the phenolic OH group in synephrine does not affect the conformational flexibility of the side chain. In the case of adrenaline, which is expected to have 12 conformers if there are no interactions between the catecholic OH groups and the side chain, some interactions possibly exist between them because only two conformations are observed. By estimation of the dipole-dipole interaction energy between partial dipole moments of the catecholic OH groups and the side chain, it was concluded that the dipole-dipole interaction stabilizes specific conformers which are actually observed. © 2011 American Chemical Society
Crystal structures of three 3,4,5-trimethoxybenzamide-based derivatives
Gomes, Ligia R.; Low, John Nicolson; Oliveira, Catarina; Cagide, Fernando; Borges, Fernanda
2016-01-01
The crystal structures of three benzamide derivatives, viz. N-(6-hydroxyhexyl)-3,4,5-trimethoxybenzamide, C16H25NO5, (1), N-(6-anilinohexyl)-3,4,5-trimethoxybenzamide, C22H30N2O4, (2), and N-(6,6-diethoxyhexyl)-3,4,5-trimethoxybenzamide, C20H33NO6, (3), are described. These compounds differ only in the substituent at the end of the hexyl chain and the nature of these substituents determines the differences in hydrogen bonding between the molecules. In each molecule, the m-methoxy substituents are virtually coplanar with the benzyl ring, while the p-methoxy substituent is almost perpendicular. The carbonyl O atom of the amide rotamer is trans related with the amidic H atom. In each structure, the benzamide N—H donor group and O acceptor atoms link the molecules into C(4) chains. In 1, a terminal –OH group links the molecules into a C(3) chain and the combined effect of the C(4) and C(3) chains is a ribbon made up of screw related R 2 2(17) rings in which the ⋯O—H⋯ chain lies in the centre of the ribbon and the trimethoxybenzyl groups forms the edges. In 2, the combination of the benzamide C(4) chain and the hydrogen bond formed by the terminal N—H group to an O atom of the 4-methoxy group link the molecules into a chain of R 2 2(17) rings. In 3, the molecules are linked only by C(4) chains. PMID:27308017
NASA Astrophysics Data System (ADS)
Nelson, Peter N.; Ellis, Henry A.; Taylor, Richard A.
2014-01-01
Lattice structures and thermal behaviours for some long chain potassium carboxylates (nc = 8-18, inclusive) are investigated using Fourier Transform Infrared spectroscopy, X-ray Powder Diffraction, Solid State spin decoupled 13C NMR spectroscopy, Differential Scanning Calorimetry and Thermogravimetry. The measurements show that the carboxyl groups are coordinated to potassium atoms via asymmetric chelating bidentate bonding, with extensive carboxyl intermolecular interactions to yield tetrahedral metal centers, irrespective of chain length. Furthermore, the hydrocarbon chains are crystallized in the fully extended all-trans configuration and are arranged as non-overlapping lamellar bilayer structures with closely packed methyl groups from opposite layers. Additionally, odd-even alternation, observed in density and methyl group chemical shift, is ascribed to the relative vertical distances between layers in the bilayer, that are not in the same plane. Therefore, for even chain homologues, where this distances is less than for odd chain adducts, more intimate packing is indicated. The phase sequences for all compounds show several reversible crystal-crystal transition associated with kinetically controlled gauche-trans isomerism of the polymethylene chains which undergo incomplete fusion when heated to the melt. The compounds degrade above 785 K to yield carbon dioxide, water, potassium oxide and an alkene.
Middleton, L. Robert; Tarver, Jacob D.; Cordaro, Joseph; ...
2016-11-10
Melt state dynamics for a series of strictly linear polyethylenes with precisely spaced associating functional groups were investigated. The periodic pendant acrylic acid groups form hydrogen-bonded acid aggregates within the polyethylene (PE) matrix. The dynamics of these nanoscale heterogeneous morphologies were investigated from picosecond to nanosecond timescales by both quasi-elastic neutron scattering (QENS) measurements and fully atomistic molecular dynamics (MD) simulations. Two dynamic processes were observed. The faster dynamic processes which occur at the picosecond timescales are compositionally insensitive and indicative of spatially restricted local motions. The slower dynamic processes are highly composition dependent and indicate the structural relaxation ofmore » the polymer backbone. Higher acid contents, or shorter PE spacers between pendant acid groups, slow the structural relaxation timescale and increase the stretching parameter (β) of the structural relaxation. Additionally, the dynamics of specific hydrogen atom positions along the backbone correlate structural heterogeneity imposed by the associating acid groups with a mobility gradient along the polymer backbone. At time intervals (<2 ns), the mean-squared displacements for the four methylene groups closest to the acid groups are up to 10 times smaller than those of methylene groups further from the acid groups. At longer timescales acid aggregates rearrange and the chain dynamics of the slow, near-aggregate regions and the faster bridge regions converge, implying a characteristic timescale for the passage of chains between aggregates. As a result, the characterization of the nanoscale chain dynamics in these associating polymer systems both provides validation of simulation force fields and provides understanding of heterogeneous chain dynamics in associating polymers.« less
Ortiz, Andrés
2017-01-01
The National Strategy for Global Supply Chain Security published in 2012 by the White House identifies two primary goals for strengthening global supply chains: first, to promote the efficient and secure movement of goods, and second to foster a resilient supply chain. The Internet of Things (IoT), and in particular Radio Frequency Identification (RFID) technology, can be used to realize these goals. For product identification, tracking and real-time awareness, RFID tags are attached to goods. As tagged goods move along the supply chain from the suppliers to the manufacturers, and then on to the retailers until eventually they reach the customers, two major security challenges can be identified: (I) to protect the shipment of goods that are controlled by potentially untrusted carriers; and (II) to secure the transfer of ownership at each stage of the chain. For the former, grouping proofs in which the tags of the scanned goods generate a proof of “simulatenous” presence can be employed, while for the latter, ownership transfer protocols (OTP) are used. This paper describes enhanced security solutions for both challenges. We first extend earlier work on grouping proofs and group codes to capture resilient group scanning with untrusted readers; then, we describe a modified version of a recently published OTP based on channels with positive secrecy capacity adapted to be implemented on common RFID systems in the supply chain. The proposed solutions take into account the limitations of low cost tags employed in the supply chain, which are only required to generate pseudorandom numbers and compute one-way hash functions. PMID:28677637
Transport of triplet excitons along continuous 100 nm polyfluorene chains
Xi, Liang; Bird, Matthew; Mauro, Gina; ...
2014-12-03
Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less
A Risk Analysis of the Molybdenum-99 Supply Chain Using Bayesian Networks
NASA Astrophysics Data System (ADS)
Liang, Jeffrey Ryan
The production of Molybdenum-99 (99Mo) is critical to the field of nuclear medicine, where it is utilized in roughly 80% of all nuclear imaging procedures. In October of 2016, the National Research Universal (NRU) reactor in Canada, which historically had the highest 99Mo production capability worldwide, ceased routine production and will be permanently shut down in 2018. This loss of capacity has led to widespread concern over the ability of the 99Mo supply chain and to meet demand. There is significant disagreement among analyses from trade groups, governments, and other researchers, predicting everything from no significant impact to major worldwide shortages. Using Bayesian networks, this research focused on modeling the 99Mo supply chain to quantify how a disrupting event, such as the unscheduled downtime of a reactor, will impact the global supply. This not only includes quantifying the probability of a shortage occurring, but also identifying which nodes in the supply chain introduce the most risk to better inform decision makers on where future facilities or other risk mitigation techniques should be applied.
Liu, Xin; Ohta, Takeshi; Kawabata, Takeshi; Kawai, Fusako
2013-01-01
Ethoxy (EO) chain nonylphenol dehydrogenase (NPEO-DH) from Ensifer sp. AS08 and EO chain octylphenol dehydrogenase from Pseudomonas putida share common molecular characteristics with polyethylene glycol (PEG) dehydrogenases (PEG-DH) and comprise a PEG-DH subgroup in the family of glucose-methanol-choline (GMC) oxidoreductases that includes glucose/alcohol oxidase and glucose/choline dehydrogenase. Three-dimensional (3D) molecular modeling suggested that differences in the size, secondary structure and hydropathy in the active site caused differences in their substrate specificities toward EO chain alkylphenols and free PEGs. Based on 3D molecular modeling, site-directed mutagenesis was utilized to introduce mutations into potential catalytic residues of NPEO-DH. From steady state and rapid kinetic characterization of wild type and mutant NPEO-DHs, we can conclude that His465 and Asn507 are directly involved in the catalysis. Asn507 mediates the transfer of proton from a substrate to FAD and His465 transfers the same proton from the reduced flavin to an electron acceptor. PMID:23306149
Liu, Xin; Ohta, Takeshi; Kawabata, Takeshi; Kawai, Fusako
2013-01-10
Ethoxy (EO) chain nonylphenol dehydrogenase (NPEO-DH) from Ensifer sp. AS08 and EO chain octylphenol dehydrogenase from Pseudomonas putida share common molecular characteristics with polyethylene glycol (PEG) dehydrogenases (PEG-DH) and comprise a PEG-DH subgroup in the family of glucose-methanol-choline (GMC) oxidoreductases that includes glucose/alcohol oxidase and glucose/choline dehydrogenase. Three-dimensional (3D) molecular modeling suggested that differences in the size, secondary structure and hydropathy in the active site caused differences in their substrate specificities toward EO chain alkylphenols and free PEGs. Based on 3D molecular modeling, site-directed mutagenesis was utilized to introduce mutations into potential catalytic residues of NPEO-DH. From steady state and rapid kinetic characterization of wild type and mutant NPEO-DHs, we can conclude that His465 and Asn507 are directly involved in the catalysis. Asn507 mediates the transfer of proton from a substrate to FAD and His465 transfers the same proton from the reduced flavin to an electron acceptor.
NASA Astrophysics Data System (ADS)
Madkour, Tarek M.
2013-08-01
Nano-porous polymers of intrinsic microporosity, PIM, have exhibited excellent permeability and selectivity characteristics that could be utilized in an environmentally friendly gas separation process. A full understanding of the mechanism through which these membranes effectively and selectively allow for the permeation of specific gases will lead to further development of these membranes. Three factors obviously influenced the conformational behavior of these polymers, which are the presence of electronegative atoms, the presence of non-linearity in the polymeric backbones (backbone kinks) and the presence of bulky side groups on the polymeric chains. The dipole moment increased sharply with the presence of backbone kinks more than any other factor. Replacing the fluorine atoms with bulky alkyl groups didn't influence the dipole moment greatly indicating that the size of the side chains had much less dramatic influence on the dipole moment than having a bent backbone. Similarly, the presence of the backbone kinks in the polymeric chains influenced the polymeric chains to assume less extended configuration causing the torsional angles around the interconnecting bonds unable to cross the high potential energy barriers. The presence of the bulky side groups also caused the energy barriers of the cis-configurations to increase dramatically, which prevented the polymeric segments from experiencing full rotation about the connecting bonds. For these polymers, it was clear that the fully extended configurations are the preferred configurations in the absence of strong electronegative atoms, backbones kinks or bulky side groups. The addition of any of these factors to the polymeric structures resulted in the polymeric chains being forced to assume less extended configurations. Rather interestingly, the length or bulkiness of the side groups didn't affect the end-to-end distance distribution to a great deal since the presence of quite large bulky side chain such as the pentyl group has caused the polymeric chains to revert back to the fully extended configurations possibly due to the quite high potential energy barriers that the chains have to cross to reach the less extended configurational states.
ManickamAchari, Vijayan; Bryce, Richard A; Hashim, Rauzah
2014-01-01
The rational design of a glycolipid application (e.g. drug delivery) with a tailored property depends on the detailed understanding of its structure and dynamics. Because of the complexity of sugar stereochemistry, we have undertaken a simulation study on the conformational dynamics of a set of synthetic glycosides with different sugar groups and chain design, namely dodecyl β-maltoside, dodecyl β-cellobioside, dodecyl β-isomaltoside and a C12C10 branched β-maltoside under anhydrous conditions. We examined the chain structure in detail, including the chain packing, gauche/trans conformations and chain tilting. In addition, we also investigated the rotational dynamics of the headgroup and alkyl chains. Monoalkylated glycosides possess a small amount of gauche conformers (∼20%) in the hydrophobic region of the lamellar crystal (LC) phase. In contrast, the branched chain glycolipid in the fluid Lα phase has a high gauche population of up to ∼40%. Rotational diffusion analysis reveals that the carbons closest to the headgroup have the highest correlation times. Furthermore, its value depends on sugar type, where the rotational dynamics of an isomaltose was found to be 11-15% and more restrained near the sugar, possibly due to the chain disorder and partial inter-digitation compared to the other monoalkylated lipids. Intriguingly, the present simulation demonstrates the chain from the branched glycolipid bilayer has the ability to enter into the hydrophilic region. This interesting feature of the anhydrous glycolipid bilayer simulation appears to arise from a combination of lipid crowding and the amphoteric nature of the sugar headgroups.
Calderón, Juan C; Bolaños, Pura; Caputo, Carlo
2010-01-01
Electrically elicited Ca(2+) transients reported with the fast Ca(2+) dye MagFluo-4 AM and myosin heavy chain (MHC) electrophoretic patterns were obtained in intact, enzymatically dissociated fibres from adult mice extensor digitorum longus (EDL) and soleus muscles. Thirty nine fibres (23 from soleus and 16 from EDL) were analysed by both fluorescence microscopy and electrophoresis. These fibres were grouped as follows: group 1 included 13 type I and 4 type IC fibres; group 2 included 2 type IIC, 3 IIA and 1 I/IIA/IIX fibres; group 3 included 4 type IIX and 1 type IIX/IIB fibres; group 4 included 2 type IIB/IIX and 9 type IIB fibres. Ca(2+) transients obtained in groups 1, 2, 3 and 4 had the following kinetic parameters (mean +/- s.e.m.): amplitude (F/F): 0.61 +/- 0.05, 0.53 +/- 0.08, 0.61 +/- 0.06 and 0.61 +/- 0.03; rise time (ms): 1.64 +/- 0.05, 1.35 +/- 0.05, 1.18 +/- 0.06 and 1.14 +/- 0.04; half-amplitude width (ms): 19.12 +/- 1.85, 11.86 +/- 3.03, 4.62 +/- 0.31 and 4.23 +/- 0.37; and time constants of decay (tau(1) and tau(2), ms): 3.33 +/- 0.13 and 52.48 +/- 3.93, 2.69 +/- 0.22 and 41.06 +/- 9.13, 1.74 +/- 0.06 and 12.88 +/- 1.93, and 1.56 +/- 0.11 and 9.45 +/- 1.03, respectively. The statistical differences between the four groups and the analysis of the distribution of the parameters of Ca(2+) release and clearance show that there is a continuum from slow to fast, that parallels the MHC continuum from pure type I to pure IIB. However, type IIA fibres behave more like IIX and IIB fibres regarding Ca(2+) release but closer to type I fibres regarding Ca(2+) clearance. In conclusion, we show for the first time the diversity of Ca(2+) transients for the whole continuum of fibre types and correlate this functional diversity with the structural and biochemical diversity of the skeletal muscle fibres.
Oral branched-chain amino acids decrease whole-body proteolysis
NASA Technical Reports Server (NTRS)
Ferrando, A. A.; Williams, B. D.; Stuart, C. A.; Lane, H. W.; Wolfe, R. R.
1995-01-01
BACKGROUND: This study reports the effects of ingesting branched-chain amino acids (leucine, valine, and isoleucine) on protein metabolism in four men. METHODS: To calculate leg protein synthesis and breakdown, we used a new model that utilized the infusion of L-[ring-13C6]phenylalanine and the sampling of the leg arterial-venous difference and muscle biopsies. In addition, protein-bound enrichments provided for the direct calculation of muscle fractional synthetic rate. Four control subjects ingested an equivalent amount of essential amino acids (threonine, methionine, and histidine) to discern the effects of branched-chain amino acid nitrogen vs the effects of essential amino acid nitrogen. Each drink also included 50 g of carbohydrate. RESULTS: Consumption of the branched-chain and the essential amino acid solutions produced significant threefold and fourfold elevations in their respective arterial concentrations. Protein synthesis and breakdown were unaffected by branched-chain amino acids, but they increased by 43% (p < .05) and 36% (p < .03), respectively, in the group consuming the essential amino acids. However, net leg balance of phenylalanine was unchanged by either drink. Direct measurement of protein synthesis by tracer incorporation into muscle protein (fractional synthetic rate) revealed no changes within or between drinks. Whole-body phenylalanine flux was significantly suppressed by each solution but to a greater extent by the branched-chain amino acids (15% and 20%, respectively) (p < .001). CONCLUSIONS: These results suggest that branched-chain amino acid ingestion suppresses whole-body proteolysis in tissues other than skeletal muscle in normal men.
Monitoring the degrafting of polyelectrolyte brushes by using surface gradients
NASA Astrophysics Data System (ADS)
Ko, Yeongun; Genzer, Jan
Polymer brushes comprise densely grafted polymer chains on surfaces, which possess high stability and high concentration of reactive centers per unit area compared to physisorbed polymer film. Polymer brushes are employed in many applications, including anti-fouling surfaces, cell adhesive surfaces, responsive surfaces, low-friction surfaces, etc. Recently, researchers reported that charged (or chargeable) polymer brushes can be degrafted from substrate while incubated in buffer solutions. Based on previous experiments conducted in our group and by others, we assume that chain degrafting results from the hydrolysis of Si-O groups in head-group of the initiator and/or the ester groups in main body of the initiator. The kinetic of hydrolysis is affected by mechanical forces acting on the initiator. Those forces depend on the molecular weight and the grafting density of the brush, and the concentration and distribution of charges along the macromolecule (tuned by pH - for weak electrolytes - and concentration of external salt). In this work, we study the stability of poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) brushes in two solvents (ethanol and water) at various pH values in water and under different levels of external salt concentration. National Science Foundation.
What Happens When the Supply Chain Breaks? Implications for the Army Supply Chain Under Attack
2003-05-22
Supply Chain Integration office with Secretariat level leadership to facilitate DoD Component implementation of supply chain management practices...rather than cyber attack. Tim Belcher, Chief Technology Officer for Riptech, a computer security firm said “It was always assumed that a small group of
Granafei, Sara; Losito, Ilario; Trotta, Massimo; Italiano, Francesca; de Leo, Vincenzo; Agostiano, Angela; Palmisano, Francesco; Cataldi, Tommaso R I
2016-01-15
Ornithine lipids (OLs), a sub-group of the large (and of emerging interest) family of lipoamino acids of bacterial origin, contain a 3-hydroxy fatty acyl chain linked via an amide bond to the α-amino group of ornithine and via an ester bond to a second fatty acyl chain. OLs in extracts of Rhodobacter sphaeroides (R. sphaeroides) were investigated by high-performance reversed phase liquid chromatography (RPLC) with electrospray ionization mass spectrometry (ESI-MS) in negative ion mode using a linear ion trap (LIT). The presence of OLs bearing both saturated (i.e, 16:0, 17:0, 18:0, 19:0 and 20:0) and unsaturated chains (i.e., 18:1, 19:1, 19:2 and 20:1) was ascertained and their identification, even for isomeric, low abundance and partially co-eluting species, was achieved by low-energy collision induced dissociation (CID) multistage mass spectrometry (MS(n), n = 2-4). OLs signatures found in two R. sphaeroides strains, i.e., wild type 2.4.1 and mutant R26, were examined and up to 16 and 17 different OL species were successfully identified, respectively. OLs in both bacterial strains were characterized by several combinations of fatty chains on ester-linked and amide-linked 3-OH fatty acids. Multistage MS spectra of monoenoic amide-linked 3-OH acyl chains, allowed the identification of positional isomer of OL containing 18:1 (i.e. 9-octadecenoic) and 20:1 (i.e. 11-eicosenoic) fatty acids. The most abundant OL ([M-H](-) at m/z 717.5) in R. sphaeroides R26 was identified as OL 3-OH 20:1/19:1 (i.e., 3-OH-eicosenoic acid amide-linked to ornithine and esterified to a nonadecenoic chain containing a cyclopropane ring). An unusual OL (m/z 689.5 for the [M-H](-) ion), most likely containing a cyclopropene ester-linked acyl chain (i.e., OL 3-OH 18:0/19:2), was retrieved only in the carotenoidless mutant strain R26. Based on the biosynthetic pathways already known for cyclopropa(e)ne ring-including acyl chains, a plausible explanation was invoked for the enzymatic generation of this ester-linked chain in R. sphaeroides. Copyright © 2015 Elsevier B.V. All rights reserved.
The integrable quantum group invariant A2n-1(2) and Dn+1(2) open spin chains
NASA Astrophysics Data System (ADS)
Nepomechie, Rafael I.; Pimenta, Rodrigo A.; Retore, Ana L.
2017-11-01
A family of A2n(2) integrable open spin chains with Uq (Cn) symmetry was recently identified in arxiv:arXiv:1702.01482. We identify here in a similar way a family of A2n-1(2) integrable open spin chains with Uq (Dn) symmetry, and two families of Dn+1(2) integrable open spin chains with Uq (Bn) symmetry. We discuss the consequences of these symmetries for the degeneracies and multiplicities of the spectrum. We propose Bethe ansatz solutions for two of these models, whose completeness we check numerically for small values of n and chain length N. We find formulas for the Dynkin labels in terms of the numbers of Bethe roots of each type, which are useful for determining the corresponding degeneracies. In an appendix, we briefly consider Dn+1(2) chains with other integrable boundary conditions, which do not have quantum group symmetry.
Structures and application of oligosaccharides in human milk.
Kobata, Akira
2010-01-01
Comparative study of the oligosaccharide profiles of individual human milk revealed the presence of three different patterns. Four oligosaccharides containing the Fucalpha1-2Gal group were missing in the milk of non-secretor, and three oligosaccharides containing the Fucalpha1-4GlcNAc group were missing in the milk of Lewis negative individuals. Disappearance of some major oligosaccharides in these samples led to the finding of five novel minor oligosaccharides, which were hidden under the missing oligosaccharides. Following these studies, structures of many novel milk oligosaccharides were elucidated. At least 13 core oligosaccharides were found in these oligosaccharides. By adding alpha-fucosyl residues and sialic acid residues to these core oligosaccharides, more than one hundred oligosaccharides were formed. All these oligosaccharides contain lactose at their reducing termini. This evidence, together with the deletion phenomena found in the milk oligosaccharides of non-secretor and Lewis negative individuals, suggested that the oligosaccharides are formed from lactose by the concerted action of glycosyltransferases, which are responsible for elongation and branching of the Galbeta1-4GlcNAc group in the sugar chains of glycoconjugates on the surface of epithelial cells. Therefore, oligosaccharides in human milk could include many structures, starting from the Galbeta1-4GlcNAc group in the sugar chains of various glycoconjugates. Many lines of evidence recently indicated that virulent enteric bacteria and viruses start their infection by binding to particular sugar chains of glycoconjugates on the target cell surfaces. Therefore, milk oligosaccharides could be useful for developing drugs, which inhibit the infection of bacteria and viruses.
Petzinger, C; Larner, C; Heatley, J J; Bailey, C A; MacFarlane, R D; Bauer, J E
2014-04-01
The effect of α-linolenic acid from a flaxseed (FLX)-enriched diet on plasma lipid and fatty acid metabolism and possible atherosclerosis risk factors was studied in Monk parrots (Myiopsitta monachus). Twenty-four Monk parrots were randomly assigned to diets containing either 10% ground SUNs or 10% ground FLXs. Feed intake was calculated daily. Blood samples, body condition scores and body weights were obtained at -5 weeks, day 0, 7, 14, 28, 42 and 70. Plasma samples were analysed for total cholesterol, free cholesterol, triacylglycerols and lipoproteins. Phospholipid subfraction fatty acid profiles were determined. By day 70, the FLX group had significantly higher plasma phospholipid fatty acids including 18:3n-3 (α-linolenic acid), 20:5n-3 (eicosapentaenoic acid) and 22:6n-3 (docosahexaenoic acid). The sunflower group had significantly higher plasma phospholipid levels of 20:4n-6 (arachidonic acid). By day 70, the high-density lipoprotein (HDL) peak shifted resulting in significantly different HDL peak densities between the two experimental groups (1.097 g/ml FLX group and 1.095 g/ml SUN group, p = 0.028). The plasma fatty acid results indicate that Monk parrots can readily convert α-linolenic acid to the long-chain omega-3 derivatives including docosahexaenoic acid and reduce 20:4n-6 accumulation in plasma phospholipids. The reason for a shift in the HDL peak density is unknown at this time. Journal of Animal Physiology and Animal Nutrition © 2013 Blackwell Verlag GmbH.
Lee, Kiju; Wang, Yunfeng; Chirikjian, Gregory S
2007-11-01
Over the past several decades a number of O(n) methods for forward and inverse dynamics computations have been developed in the multi-body dynamics and robotics literature. A method was developed in 1974 by Fixman for O(n) computation of the mass-matrix determinant for a serial polymer chain consisting of point masses. In other recent papers, we extended this method in order to compute the inverse of the mass matrix for serial chains consisting of point masses. In the present paper, we extend these ideas further and address the case of serial chains composed of rigid-bodies. This requires the use of relatively deep mathematics associated with the rotation group, SO(3), and the special Euclidean group, SE(3), and specifically, it requires that one differentiates functions of Lie-group-valued argument.
Long-Chain Omega-3 Oils–An Update on Sustainable Sources
Nichols, Peter D.; Petrie, James; Singh, Surinder
2010-01-01
Seafood is currently the best and generally a safe source of long-chain (LC, (≥C20) omega-3 oils amongst the common food groups. LC omega-3 oils are also obtained in lower amounts per serve from red meat, egg and selected other foods. As global population increases the opportunities to increase seafood harvest are limited, therefore new alternate sources are required. Emerging sources include microalgae and under-utilized resources such as Southern Ocean krill. Prospects for new land plant sources of these unique and health-benefiting oils are also particularly promising, offering hope for alternate and sustainable supplies of these key oils, with resulting health, social, economic and environmental benefits. PMID:22254042
Long-chain omega-3 oils-an update on sustainable sources.
Nichols, Peter D; Petrie, James; Singh, Surinder
2010-06-01
Seafood is currently the best and generally a safe source of long-chain (LC, (≥C(20)) omega-3 oils amongst the common food groups. LC omega-3 oils are also obtained in lower amounts per serve from red meat, egg and selected other foods. As global population increases the opportunities to increase seafood harvest are limited, therefore new alternate sources are required. Emerging sources include microalgae and under-utilized resources such as Southern Ocean krill. Prospects for new land plant sources of these unique and health-benefiting oils are also particularly promising, offering hope for alternate and sustainable supplies of these key oils, with resulting health, social, economic and environmental benefits.
Penicillin and Beta-Lactam Hypersensitivity.
Har, Daniel; Solensky, Roland
2017-11-01
Ten percent of patients report penicillin allergy, but more than 90% of these individuals can tolerate penicillins. Skin testing remains the optimal method for evaluation of possible IgE-mediated penicillin allergy and is recommended by professional societies, as the harms for alternative antibiotics include antimicrobial resistance, prolonged hospitalizations, readmissions, and increased costs. Removal of penicillin allergy leads to decreased utilization of broad-spectrum antibiotics, such as fluoroquinolones and vancomycin. There is minimal allergic cross-reactivity between penicillins and cephalosporins. IgE-mediated allergy to cephalosporins is usually side-chain specific and may warrant graded challenge with cephalosporins containing dissimilar R1 or R2 group side chains. Copyright © 2017 Elsevier Inc. All rights reserved.
Antihypertensive neutral lipid
Snyder, Fred L.; Blank, Merle L.
1986-01-01
The invention relates to the discovery of a class of neutral acetylated ether-linked glycerolipids having the capacity to lower blood pressure in warm-blooded animals. This physiological effect is structure sensitive requiring a long chain alkyl group at the sn-1 position and a short carbon chain acyl group (acetyl or propionyl) at the sn-2 position, and a hydroxyl group at the sn-3 position.
Antihypertensive neutral lipid
Snyder, F.L.; Blank, M.L.
1984-10-26
The invention relates to the discovery of a class of neutral acetylated either-linked glycerolipids having the capacity to lower blood presure in warm-blooded animals. This physiological effect is structure sensitive requiring a long chain alkyl group at the sn-1 position and a short carbon chain acyl group (acetyl or propionyl) at the sn-2 position, and a hydroxyl group at the sn-3 position.
FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI
Ekstedt, Richard D.; Stollerman, Gene H.
1960-01-01
Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
Characterization and reactivity of organic monolayers on gold and platinum surfaces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Chien-Ching
1995-12-06
Purpose is to understand how the mobilization, dielectric, orientation, composition, coverage, and structure of self-assembled organic monolayers on metal surfaces affects the surface reactivities and properties of these films in order to facilitate the construction of desired films. Two model systems were used: tiols at Au and aromatic acids at Pt. Surface analysis methods, including contact angle, electrochemistry, ellipsometry, infrared reflection absorption spectroscopy (IRRAS), and x-ray photospectroscopy, were used to study the self-assembled organic monolayers on Au and Pt. IRRAS, contact angle, and electrochemistry were used to determine the surface pK a of phenylcarboxylic acids and pyridylcarboxylic acids monolayers onmore » Pt. These techniques were also used to determine the orientation of polymethylene chain axis and the carboxylic follow the structural evolution of the chains and end group of the thiolate monolayers during formation. IRRAS was also used to assess the carboxylic acid group in terms of its possible existence as the non-hydrogen-bonded species, the hydrogen-bonded dimeric group, and the hydrogen-bonded polymeric group. These different forms of the end group were also followed vs coverage, as well as the reactivity vs solution pH. IRRAS and contact angle were used to calculate the rate constant of the esterification of carboxylic acid-terminated monolayers on Au.« less
Prognostic Value of Serum Free Light Chain in Multiple Myeloma.
El Naggar, Amel A; El-Naggar, Mostafa; Mokhamer, El-Hassan; Avad, Mona W
2015-01-01
The measurement of serum free light chain (sFLC) has been shown to be valuable in screening for the presence of plasma cell dyscrasia as well as for baseline prognosis in newly diagnosed patients. The aim of the present work was to study the prognostic value of sFLC in multiple myeloma in relation to other serum biomarkers, response to therapy and survival. Forty five newly diagnosed patients with MM were included in the study. Patients were divided into responders and non-responders groups according to response to therapy. sFLC and serum Amyloid A (SAA) were measured by immunonephelometry. The non-responders group showed a statistically significant higher kappa/lambda or lambda/kappa ratio and higher β2 microglobulin level, but lower albumin level at presentation, as compared to the responders group (P < 0.001). However, no statistically significant difference was detected between the two groups regarding SA A or calcium levels. Comparison between sFLC ratio obtained before and after therapy revealed significant decrease after treatment in the responders group (P = 0.05). Survival was significantly inferior in patients with an FLC ratio of ≥ 2.6 or ≤ 0.56 compared with those with an FLC ratio that was between 0.56 and 2.6 (P = 0.002).
Dione, Michel; Ouma, Emily; Opio, Felix; Kawuma, Brian; Pezo, Danilo
2016-12-01
A study was undertaken between September 2014 and December 2014 to assess the perceptions of smallholder pig value chain actors of the risks and practices associated with the spread of African swine fever (ASF) disease within the pig value chains. Data was collected from 136 value chain actors and 36 key informants through 17 group discussions and two key informant interview (KII) sessions respectively using Participatory Rural Appraisal (PRA) tools. Results from this study revealed that according to value chain actors and stakeholders, the transporting, slaughtering, and collecting/bulking nodes represent the highest risk, followed by the inputs and services (feeds and drugs) supply nodes. The processing, whole sale and consumption nodes represented the lowest risk. Value chain actors are aware of the disease and its consequences to the pig industry, however biosecurity measures are poorly implemented at all nodes. As for the causes, value chain actors pointed to several factors, such as inadequate knowledge of mechanisms for the spread of the disease, poor enforcement of regulations on disease control, and low capacities of actors to implement biosecurity measures, amongst others. Although traders, butchers and veterinary practitioners accepted that they played an important role in the spread of the virus, they did not perceive themselves as key actors in the control of the disease; instead, they believed that only farmers should adopt biosecurity measures on their farms because they keep the pigs for a longer period. Most of the recommendations given by the value chain actors for controlling and preventing ASF disease were short term, and targeted mainly pig producers. These recommendations included: the establishment of live pig collection centres so that traders and brokers do not have to directly access pig farms, capacity building of value chain actors on application of biosecurity, enactment and enforcement of by-laws on live pig movements and establishment of operational outbreak reporting mechanism at district level. Long term recommendations included the development of a vaccine, as well as pen-side diagnostic tests. This study suggests that interventions to control ASF disease through application of biosecurity measures should target all value chain nodes, while putting more emphasis on post-farm nodes especially the trading. Copyright © 2016 Elsevier B.V. All rights reserved.
Barnett, Shonoi A; Amyes, Tina L; Wood, Bryant M; Gerlt, John A; Richard, John P
2008-07-29
Kinetic analysis of decarboxylation catalyzed by S154A, Q215A, and S154A/Q215A mutant yeast orotidine 5'-monophosphate decarboxylases with orotidine 5'-monophosphate (OMP) and with a truncated nucleoside substrate (EO) activated by phosphite dianion shows (1) the side chain of Ser-154 stabilizes the transition state through interactions with the pyrimidine rings of OMP or EO, (2) the side chain of Gln-215 interacts with the phosphodianion group of OMP or with phosphite dianion, and (3) the interloop hydrogen bond between the side chains of Ser-154 and Gln-215 orients the amide side chain of Gln-215 to interact with the phosphodianion group of OMP or with phosphite dianion.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xi, Liang; Bird, Matthew; Mauro, Gina
Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less
[Classification of cardiac amyloidosis: an immunohistochemical analysis].
Li, L; Duan, X J; Sun, Y; Lu, Y; Xu, H Y; Wang, Q Z; Wang, H Y
2018-02-08
Objective: To evaluate the sensitivity and specificity of immunohistochemistry (IHC) in the classification of cardiac amyloidosis on endomyocardial biopsy (EMB) and heart allograft. Methods: Twenty cardiac tissues from 19 patients at Fuwai Hospital from January, 1990 to April, 2017 with histopathologic features of amyloidosis and Congo red staining positivity were included. IHC was performed with monoclonal antibodies against AA amyloid and polyclonal antibodies against transthyretin (ATTR), λ-light chain (AL-λ), κ-light chain (AL-κ), ApoAⅠ, ApoAⅡ, ApoA Ⅳ and β(2)-microglobin. The extent of interstitial staining was evaluated by light microscopy, and three patterns were recognized; these included diffuse pericellular pattern, discrete pericellular pattern, and nodular pattern. Two patterns of vascular deposition were also noted, including arterial pattern and venous pattern. Endocardial involvement was also assessed and recorded. Results: Nineteen cases were divided into three groups according to the pattern of proteins expression in specimens. The first group (5 cases) only showed single protein expression on EMB. The second group (6 cases) showed more than one protein expression, but one of them was intensely stained or any staining of any protein together with ApoA Ⅳ co-staining. The third group (8 cases) also showed more than one protein expression and all of them had intense staining. Amyloid deposits were successfully subtyped as AL-λ, ATTR, AL-κ and ApoAⅠby IHC in the former two groups with the sensitivity of 11/19. In the third group, amyloid deposits could not be subtyped by immunohistochemistry due to their poor specificity. The pericellular pattern tended to favor AL over ATTR amyloidosis and vascular deposition tended to favor ATTR. Conclusions: Amyloid deposits can be reliably subtyped in diagnostic cardiac specimens using IHC. The co-deposition of chaperon proteins, the distribution of amyloid proteins and clinical features are also auxiliary to subtype cardiac amyloidosis.
Recent Development in Spectroscopic and Chemical Characterization of Cellulose
2005-01-01
specific to the reducing end groups of the polysaccharides , confirmed the parallel alignment of molecular chains within the microfibrils in native...they include primary, secondary, and tertiary structures. And indeed, crystallographic studies of the monosaccharides and of related structures...Two approaches were adopted for this purpose. The first was based on examining the Raman spectra of polysaccharide polymers and oligomers that
pH responsiveness of dendrimer-like poly(ethylene oxide)s.
Feng, Xiaoshuang; Taton, Daniel; Borsali, Redouane; Chaikof, Elliot L; Gnanou, Yves
2006-09-06
Poly(ethylene oxide) (PEO) and poly(acrylic acid) (PAA), two polymers known to form pH-sensitive aggregates through noncovalent interactions, were assembled in purposely designed architecture -a dendrimer-like PEO scaffold carrying short inner PAA chains-to produce unimolecular systems that exhibit pH responsiveness. Because of the particular placement of the PAA chains within the dendrimer-like structure, intermolecular complexation between acrylic acid (AA) and ethylene oxide (EO) units-and thus macroscopic aggregation or even mesoscopic micellization-could be avoided in favor of the sole intramolecular complexation. The sensitivity of such interactions to pH was exploited to generate dendrimer-like PEOs that reversibly shrink and expand with the pH. Such PAA-carrying dendrimer-like PEOs were synthesized in two main steps. First, a fifth-generation dendrimer-like PEO was obtained by combining anionic ring-opening polymerization (AROP) of ethylene oxide from a tris-hydroxylated core and selective branching reactions of PEO chain ends. To this end, an AB(2)C-type branching agent was designed: the latter includes a chloromethyl (A) group for its covalent attachment to the arm ends, two geminal hydroxyls (B(2)) protected in the form of a ketal ring for the growth of subsequent PEO generations by AROP, and a vinylic (C) double bonds for further functionalization of the interior of dendrimer-like PEOs. Reiteration of AROP and derivatization of PEO branches allowed us to prepare a dendrimer-like PEO of fourth generation with a total molar mass of 52,000 g x mol(-1), containing 24 external hydroxyl functions and 21 inner vinylic groups in the interior. A fifth generation of PEO chains was generated from this parent dendrimer-like PEO of fourth generation using a "conventional" AB(2)-type branching agent, and 48 PEO branches could be grown by AROP. The 48 outer hydroxy-end groups of the fifth-generation dendrimer-like PEO obtained were subsequently quantitatively converted into inert benzylic groups using benzyl bromide. The 21 internal vinylic groups carried by the PEO scaffold were then chemically modified in a two-step sequence into bromoester groups. The latter which are atom transfer radical polymerization (ATRP) initiating sites thus served to grow poly(tert-butylacrylate) chains. After a final step of hydrolysis of the tert-butyl ester groups, double, hydrophilic, dendrimer-like PEOs comprising 21 internal junction-attached poly(acrylic acid) (PAA) blocks could be obtained. Dynamic light scattering was used to determine the size of these dendrimer-like species in water and to investigate their response to pH variation: in particular, how the pH-sensitive complexation of EO and AA units affects their overall behavior.
Biza, Adriano; Jille-Traas, Ingeborg; Colomar, Mercedes; Belizan, Maria; Requejo Harris, Jennifer; Crahay, Beatrice; Merialdi, Mario; Nguyen, My Huong; Althabe, Fernando; Aleman, Alicia; Bergel, Eduardo; Carbonell, Alicia; Chavane, Leonardo; Delvaux, Therese; Geelhoed, Diederike; Gülmezoglu, Metin; Malapende, Celsa Regina; Melo, Armando; Osman, Nafissa Bique; Widmer, Mariana; Temmerman, Marleen; Betrán, Ana Pilar
2015-09-02
Maternal mortality remains a daunting problem in Mozambique and many other low-resource countries. High quality antenatal care (ANC) services can improve maternal and newborn health outcomes and increase the likelihood that women will seek skilled delivery care. This study explores the factors influencing provider uptake of the recommended package of ANC interventions in Mozambique. This study used qualitative research methods including key informant interviews with stakeholders from the health sector and a total of five focus group discussions with women with experience with ANC or women from the community. Study participants were selected from three health centers located in Maputo city, Tete, and Cabo Delgado provinces in Mozambique. Staff responsible for the medicines/supply chain at national, provincial and district level were interviewed. A check list was implemented to confirm the availability of the supplies required for ANC. Deductive content analysis was conducted. Three main groups of factors were identified that hinder the implementation of the ANC package in the study setting: a) system or organizational: include chronic supply chain deficiencies, failures in the continuing education system, lack of regular audits and supervision, absence of an efficient patient record system and poor environmental conditions at the health center; b) health care provider factors: such as limited awareness of current clinical guidelines and a resistant attitude to adopting new recommendations; and c) Users: challenges with accessing ANC, poor recognition amongst women about the purpose and importance of the specific interventions provided through ANC, and widespread perception of an unfriendly environment at the health center. The ANC package in Mozambique is not being fully implemented in the three study facilities, and a major barrier is poor functioning of the supply chain system. Recommendations for improving the implementation of antenatal interventions include ensuring clinical protocols based on the ANC model. Increasing the community understanding of the importance of ANC would improve demand for high quality ANC services. The supply chain functioning could be strengthened through the introduction of a kit system with all the necessary supplies for ANC and a simple monitoring system to track the stock levels is recommended.
You, Yi-Qian Nancy; Ling, Pei-Ra; Qu, Jason Zhensheng; Bistrian, Bruce R
2008-01-01
Fatty acid absorption patterns can have a major impact on the fatty acid composition in the portal, intestinal lymph, and systemic circulation. This study sought to determine the effects of long-chain triglycerides (LCT), medium-chain triglycerides (MCT), and 2-monododecanoin (2mono) on intestinal fatty acid composition during continuous feeding over a brief period. The lipid sources were 100% LCT, 100% MCT, a 50:50 mixture of LCT and MCT (LCT/MCT), and a 50:50 mixture of LCT and 2mono (LCT/2mono). A total of 27 rats were randomly given 1 of the 4 diets at 200 kcal/kg/d, with 30% of total calories from lipids over 3 hours. MCT significantly increased each of the medium-chain fatty acids (C6:0, C8:0, and C10:0) as free fatty acids in the portal vein and about 10%/mol of C10:0 as triglycerides in the lymph compared with the other groups. There was significantly less C10:0 in lymphatic triglycerides with LCT/MCT than with MCT, but more than in the LCT and LCT/2mono diets. MCT also significantly increased the contents of C16:0, C18:0, C18:1, and C20:4 in the lymphatic triglycerides compared with all other groups including LCT/MCT. The amount of linoleic acid (C18:2) in lymphatic triglycerides followed the relative amounts of this fatty acid in the diet, with the greatest in LCT followed by LCT/MCT and LCT/2mono and least in MCT. A so-called structured lipid composed of the medium-chain fatty acid dodecanoic acid on the 2 position and long-chain fatty acids on the 1 and 3 positions appeared to be endogenously synthesized in response to the LCT/2mono diet. The original differences in MCT and LCT content in the diets were preserved in the fatty acid composition in the intestinal free fatty acids and triglycerides during feeding. In addition, the duration of lipid administration can play a role in altering fatty acid composition in the intestine.
A DIETHER ANALOG OF PHOSPHATIDYL GLYCEROPHOSPHATE IN HALOBACTERIUM CUTIRUBRUM,
The major phosphatide in the extremely halophilic bacterium, Halobacterium cutirubrum, was isolated by a combination of solvent fractionation...precipitation through the barium salt, and final purification as the sodium salt. Analytical and degradative data showed the phosphatide to be a...phosphatidyl glycerophosphate with two long-chain ether groups instead of fatty acid ester groups. Both long-chain groups were found to be identical and were
Tarachiwin, Lucksanaporn; Sakdapipanich, Jitladda; Ute, Koichi; Kitayama, Tatsuki; Tanaka, Yasuyuki
2005-01-01
The treatment of deproteinized natural rubber (DPNR) latex with phospholipases A(2), B, C, and D decreased significantly the long-chain fatty acid ester contents in DPNR and also the molecular weight and Higgins' k' constant, except for phospholipase D treatment. This indicates the presence of phospholipid molecules in NR, which combine rubber molecules together. Transesterification of DPNR resulted in the decomposition of the functional group at the terminal chain-end (alpha-terminal), including phospholipids and formed linear rubber molecules. The addition of small amounts of ethanol into the DPNR solution reduced the molecular weight and shifted the molecular weight distribution (MWD) comparable to that of transesterified DPNR (TE-DPNR). The addition of diammonium hydrogen phosphate into DPNR-latex in order to remove Mg2+ ions yielded a slight decrease in molecular weight and a slight shift in MWD. The phospholipids are expected to link with mono- and diphosphate groups at the alpha-terminal by hydrogen bonding and/or ionic linkages. The decrease in the molecular weight and Huggins' k' constant of DPNR demonstrates the formation of linear molecules after decomposition of branch-points by this treatment, showing that phospholipids participate in the branching formation of NR. The branch-points formed at the alpha-terminus are postulated to originate predominantly by the association of phospholipids via micelle formation of long-chain fatty acid esters and hydrogen bonding between polar headgroups of phospholipids.
Cong, Minghua; Song, Chenxin; Zou, Baohua; Deng, Yingbing; Li, Shuluan; Liu, Xuehui; Liu, Weiwei; Liu, Jinying; Yu, Lei; Xu, Binghe
2015-03-17
To explore the effects of glutamine, eicosapntemacnioc acid (EPA) and branched-chain amino acids supplements in esophageal cancer patients on concurrent chemoradiotherapy and gastric cancer patients on chemotherapy. From April 2013 to April 2014, a total of 104 esophageal and gastric carcinoma patients on chemotherapy or concurrent chemoradiotherapy were recruited and randomly divided into experimental and control groups. Both groups received dietary counseling and routine nutritional supports while only experimental group received supplements of glutamine (20 g/d), EPA (3.3 g/d) and branched-chain amino acids (8 g/d). And body compositions, blood indicators, incidence of complications and completion rates of therapy were compared between two groups. After treatment, free fat mass and muscle weight increased significantly in experiment group while decreased in control group (P < 0.05). And albumin, red blood cell count, white blood cell count and blood platelet count remained stable in experiment group while declined significantly in control group. During treatment, compared to control group, the incidences of infection-associated complication were lower (6% vs 19%, P < 0.05) and the completion rates of therapy were significantly higher in experiment group (96% vs 83%, P < 0.05). Supplements of glutamine, EPA and branched-chain amino acids can help maintain nutrition status, decrease the complications and improve compliance for esophageal cancer patients on concurrent chemo-radiotherapy and gastric cancer patients on postoperative adjuvant chemotherapy.
NASA Astrophysics Data System (ADS)
Yamagaki, Tohru; Sugahara, Kohtaro; Watanabe, Takehiro
2014-01-01
To elucidate the influence of amino (-NH2) and acetamide (-NHCOCH3, -NAc) groups in sugar chains on their ionization and fragmentation, cycloamyloses (cyclodextrins, CyDs) and lacto-oligosaccharide are analyzed by MALDI TOF/TOF and ESI Q-TOF mass spectrometry. CyD derivatives substituted by amino or acetamide groups are ideal analytes to extract the function group effects, which are amino-CyD with one hexosamine (HexNH2) and acetamide-CyD with one N-acetyl hexosamine (HexNAc). Interestingly, the relative ion intensities and isotope-like patterns in their product ion spectra depend on the functional groups and ion forms of sugar chains. Consequently, the results indicate that a proton (H+) localizes on the amino group of the amino sugar, and that the proton (H+) induces their fragmentation. Sodium cation (Na+) attachment is independent from amino group and exerts no influence on their fragmentation patterns in amino group except for mono- and disaccharide fragment ions because there is the possibility of the reducing end effect. In contrast, a sodium cation localizes much more frequently on the acetamide group in acetamide-CyDs because the chemical species with HexNAc are stable. Thus, their ions with HexNAc are abundant. These results are consistent with the fragmentation of lacto-neo- N-tetraose and maltotetraose, suggesting that a sodium cation generally localizes much more frequently on the acetamide group in sugar chains.
Supply Chain Sourcing Game: A Negotiation Exercise
ERIC Educational Resources Information Center
Gumus, Mehmet; Love, Ernie C.
2013-01-01
This article introduces an exercise that simulates the negotiation process in a dynamic supply chain. The retailer and wholesaler roles are assigned to student groups who negotiate supply contracts in a number of rounds during a class period. Each group makes pricing, inventory, and ordering decision concurrently, and competes with others to…
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-10
... DEPARTMENT OF COMMERCE International Trade Administration Advisory Committee on Supply Chain... Organizations or Entities, Including Ports, To Apply for Membership on the Advisory Committee on Supply Chain... organizations or entities, including ports, to serve as members of the Advisory Committee on Supply Chain...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-14
... Parts Supply Chain, Global Product Life Cycles Management Unit Including Teleworkers Reporting to... workers of Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit...). Since eligible workers of Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles...
Gharakhanian, Eric G; Deming, Timothy J
2016-07-07
A series of thermoresponsive polypeptides has been synthesized using a methodology that allowed facile adjustment of side-chain functional groups. The lower critical solution temperature (LCST) properties of these polymers in water were then evaluated relative to systematic molecular modifications in their side-chains. It was found that in addition to the number of ethylene glycol repeats in the side-chains, terminal and linker groups also have substantial and predictable effects on cloud point temperatures (Tcp). In particular, we found that the structure of these polypeptides allowed for inclusion of polar hydroxyl groups, which significantly increased their hydrophilicity and decreased the need to use long oligoethylene glycol repeats to obtain LCSTs. The thioether linkages in these polypeptides were found to provide an additional structural feature for reversible switching of both polypeptide conformation and thermoresponsive properties.
Lee, Kiju; Wang, Yunfeng; Chirikjian, Gregory S.
2010-01-01
Over the past several decades a number of O(n) methods for forward and inverse dynamics computations have been developed in the multi-body dynamics and robotics literature. A method was developed in 1974 by Fixman for O(n) computation of the mass-matrix determinant for a serial polymer chain consisting of point masses. In other recent papers, we extended this method in order to compute the inverse of the mass matrix for serial chains consisting of point masses. In the present paper, we extend these ideas further and address the case of serial chains composed of rigid-bodies. This requires the use of relatively deep mathematics associated with the rotation group, SO(3), and the special Euclidean group, SE(3), and specifically, it requires that one differentiates functions of Lie-group-valued argument. PMID:20165563
Gift, Alan D; Hettenbaugh, Jacob A; Quandahl, Rachel A; Mapes, Madison
2017-11-06
The effects of polymers on the anhydrate-to-hydrate transformation of carbamazepine (CBZ) was investigated. The three types of polymers studied were polyvinylpyrrolidone (PVP), polyvinyl alcohol (PVA) and substituted celluloses which included hydroxypropyl methylcellulose (HPMC) and methylcellulose (MC). Anhydrous CBZ was added to dilute aqueous polymer solutions and Raman spectroscopy measurements were collected to monitor the kinetics of the solution-mediated transformation to CBZ dihydrate. Polymers exhibiting the greatest inhibition were able to reduce the growth phase of the solution-mediated transformation and change the habit of the hydrate crystal indicating polymer adsorption to the hydrate crystal surface as the mechanism of inhibition. The results of the various polymers showed that short chain substituted celluloses (HPMC and MC) inhibited the CBZ transformation to a much greater extent than longer chains. The same trend was observed for PVP and PVA, but to a lesser extent. These chain length effects were attributed to changes in polymer confirmation when adsorbed on the crystal surface. Additionally, decreasing the percentage of hydroxyl groups on the PVA polymer backbone reduced the ability of the polymer to inhibit the transformation and changing the degree of substitutions of methyl and hydroxypropyl groups on the cellulosic polymer backbone had no effect on the transformation.
Jan, Yih-Dean; Lee, Bor-Shiunn; Lin, Chun-Pin; Tseng, Wan-Yu
2014-04-01
Polymerization shrinkage is one of the main causes of dental restoration failure. This study tried to conjugate two diisocyanate side chains to dimethacrylate resins in order to reduce polymerization shrinkage and increase the hardness of composite resins. Diisocyanate, 2-hydroxyethyl methacrylate, and bisphenol A dimethacrylate were reacted in different ratios to form urethane-modified new resin matrices, and then mixed with 50 wt.% silica fillers. The viscosities of matrices, polymerization shrinkage, surface hardness, and degrees of conversion of experimental composite resins were then evaluated and compared with a non-modified control group. The viscosities of resin matrices increased with increasing diisocyanate side chain density. Polymerization shrinkage and degree of conversion, however, decreased with increasing diisocyanate side chain density. The surface hardness of all diisocyanate-modified groups was equal to or significantly higher than that of the control group. Conjugation of diisocyanate side chains to dimethacrylate represents an effective means of reducing polymerization shrinkage and increasing the surface hardness of dental composite resins. Copyright © 2012. Published by Elsevier B.V.
New polymer systems: Chain extension by dianhydrides
NASA Technical Reports Server (NTRS)
Rhein, R. A.; Ingham, J. D.
1972-01-01
The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.
Modelisation de l'historique d'operation de groupes turbine-alternateur
NASA Astrophysics Data System (ADS)
Szczota, Mickael
Because of their ageing fleet, the utility managers are increasingly in needs of tools that can help them to plan efficiently maintenance operations. Hydro-Quebec started a project that aim to foresee the degradation of their hydroelectric runner, and use that information to classify the generating unit. That classification will help to know which generating unit is more at risk to undergo a major failure. Cracks linked to the fatigue phenomenon are a predominant degradation mode and the loading sequences applied to the runner is a parameter impacting the crack growth. So, the aim of this memoir is to create a generator able to generate synthetic loading sequences that are statistically equivalent to the observed history. Those simulated sequences will be used as input in a life assessment model. At first, we describe how the generating units are operated by Hydro-Quebec and analyse the available data, the analysis shows that the data are non-stationnary. Then, we review modelisation and validation methods. In the following chapter a particular attention is given to a precise description of the validation and comparison procedure. Then, we present the comparison of three kind of model : Discrete Time Markov Chains, Discrete Time Semi-Markov Chains and the Moving Block Bootstrap. For the first two models, we describe how to take account for the non-stationnarity. Finally, we show that the Markov Chain is not adapted for our case, and that the Semi-Markov chains are better when they include the non-stationnarity. The final choice between Semi-Markov Chains and the Moving Block Bootstrap depends of the user. But, with a long term vision we recommend the use of Semi-Markov chains for their flexibility. Keywords: Stochastic models, Models validation, Reliability, Semi-Markov Chains, Markov Chains, Bootstrap
Wuxiuer, Yimingjiang; Morgunova, Ekaterina; Cols, Neus; Popov, Alexander; Karshikoff, Andrey; Sylte, Ingebrigt; Gonzàlez-Duarte, Roser; Ladenstein, Rudolf; Winberg, Jan-Olof
2012-08-01
All drosophilid alcohol dehydrogenases contain an eight-member water chain connecting the active site with the solvent at the dimer interface. A similar water chain has also been shown to exist in other short-chain dehydrogenase/reductase (SDR) enzymes, including therapeutically important SDRs. The role of this water chain in the enzymatic reaction is unknown, but it has been proposed to be involved in a proton relay system. In the present study, a connecting link in the water chain was removed by mutating Thr114 to Val114 in Scaptodrosophila lebanonensis alcohol dehydrogenase (SlADH). This threonine is conserved in all drosophilid alcohol dehydrogenases but not in other SDRs. X-ray crystallography of the SlADH(T114V) mutant revealed a broken water chain, the overall 3D structure of the binary enzyme-NAD(+) complex was almost identical to the wild-type enzyme (SlADH(wt) ). As for the SlADH(wt) , steady-state kinetic studies revealed that catalysis by the SlADH(T114V) mutant was consistent with a compulsory ordered reaction mechanism where the co-enzyme binds to the free enzyme. The mutation caused a reduction of the k(on) velocity for NAD(+) and its binding strength to the enzyme, as well as the rate of hydride transfer (k) in the ternary enzyme-NAD(+) -alcohol complex. Furthermore, it increased the pK(a) value of the group in the binary enzyme-NAD(+) complex that regulates the k(on) velocity of alcohol and alcohol-competitive inhibitors. Overall, the results indicate that an intact water chain is essential for optimal enzyme activity and participates in a proton relay system during catalysis. © 2012 The Authors Journal compilation © 2012 FEBS.
Hedengran, Anne; Szecsi, Pal B; Dyerberg, Jørn; Harris, William S; Stender, Steen
2015-02-01
To date, treatment of hypertriglyceridemia with long-chain n-3 polyunsaturated fatty acids (n-3 PUFA) has been investigated solely in fasting and postprandial subjects. However, non-fasting triacylglycerols are more strongly associated with risk of cardiovascular disease. The objective of this study was to investigate the effect of long-chain n-3 PUFA on non-fasting triacylglycerol levels and to compare the effects of n-3 PUFA formulated as acylglycerol (AG-PUFA) or ethyl esters (EE-PUFA). The study was a double-blinded randomized placebo-controlled interventional trial, and included 120 subjects with non-fasting plasma triacylglycerol levels of 1.7-5.65 mmol/L (150-500 mg/dL). The participants received approximately 3 g/day of AG-PUFA, EE-PUFA, or placebo for a period of eight weeks. The levels of non-fasting plasma triacylglycerols decreased 28% in the AG-PUFA group and 22% in the EE-PUFA group (P < 0.001 vs. placebo), with no significant difference between the two groups. The triacylglycerol lowering effect was evident after four weeks, and was inversely correlated with the omega-3 index (EPA + DHA content in erythrocyte membranes). The omega-3 index increased 63.2% in the AG-PUFA group and 58.5% in the EE-PUFA group (P < 0.001). Overall, the heart rate in the AG-PUFA group decreased by three beats per minute (P = 0.045). High-density lipoprotein (HDL) cholesterol increased in the AG-PUFA group (P < 0.001). Neither total nor non-HDL cholesterol changed in any group. Lipoprotein-associated phospholipase A2 (LpPLA2) decreased in the EE-PUFA group (P = 0.001). No serious adverse events were observed. Supplementation with long-chain n-3 PUFA lowered non-fasting triacylglycerol levels, suggestive of a reduction in cardiovascular risk. Regardless of the different effects on heart rate, HDL, and LpPLA2 that were observed, compared to placebo, AG-PUFA, and EE-PUFA are equally effective in reducing non-fasting triacylglycerol levels.
Shieshia, Mildred; Noel, Megan; Andersson, Sarah; Felling, Barbara; Alva, Soumya; Agarwal, Smisha; Lefevre, Amnesty; Misomali, Amos; Chimphanga, Boniface; Nsona, Humphreys; Chandani, Yasmin
2014-12-01
In 2010, 7.6 million children under five died globally - largely due to preventable diseases. Majority of these deaths occurred in sub-Saharan Africa. As a strategy to reduce child mortality, the Government of Malawi, in 2008, initiated integrated community case management allowing health surveillance assistants (HSAs) to treat sick children in communities. Malawi however, faces health infrastructure challenges, including weak supply chain systems leading to low product availability. A baseline assessment conducted in 2010 identified data visibility, transport and motivation of HSAs as challenges to continuous product availability. The project designed a mHealth tool as part of two interventions to address these challenges. A mobile health (mHealth) technology - cStock, for reporting on community stock data - was designed and implemented as an integral component of Enhanced Management (EM) and Efficient Product Transport (EPT) interventions. We developed a feasibility and acceptability framework to evaluate the effectiveness and predict the likelihood of scalability and ownership of the interventions. Mixed methods were used to conduct baseline and follow up assessments in May 2010 and February 2013, respectively. Routine monitoring data on community stock level reports, from cStock, were used to analyze supply chain performance over 18-month period in the intervention groups. Mean stock reporting rate by HSAs was 94% in EM group (n = 393) and 79% in EPT group (n = 253); mean reporting completeness was 85% and 65%, respectively. Lead time for HSA drug resupply over the 18-month period was, on average, 12.8 days in EM and 26.4 days in EPT, and mean stock out rate for 6 tracer products was significantly lower in EM compared to EPT group. Results demonstrate that cStock was feasible and acceptable to test users in Malawi, and that based on comparison with the EPT group, the team component of the EM group was an essential pairing with cStock to achieve the best possible supply chain performance and supply reliability. Establishing multi-level teams serves to connect HSAs with decision makers at higher levels of the health system, align objectives, clarify roles and promote trust and collaboration, thereby promoting country ownership and scalability of a cStock-like system.
Phenolic Polymer Solvation in Water and Ethylene Glycol, I: Molecular Dynamics Simulations
NASA Technical Reports Server (NTRS)
Bucholz, Eric W.; Haskins, Justin B.; Monk, Joshua D.; Bauschlicher, Charles W.; Lawson, John W.
2017-01-01
Interactions between pre-cured phenolic polymer chains and a solvent have a significant impact on the structure and properties of the final post-cured phenolic resin. Developing an understanding of the nature of these interactions is important and will aid in the selection of the proper solvent that will lead to the desired final product. Here, we investigate the role of phenolic chain structure and solvent type on the overall solvation performance of the system through molecular dynamics simulations. Two types of solvents are considered, ethylene glycol (EGL) and H2O. In addition, three phenolic chain structures were considered including two novolac-type chains with either an ortho-ortho (OON) or ortho-para (OPN) backbone network and a resole-type (RES) chain with an ortho-ortho network. Each system is characterized through structural analysis of the solvation shell and hydrogen bonding environment as well as through quantification of the solvation free energy along with partitioned interaction energies between specific molecular species. The combination of the simulations and analyses indicate that EGL provides a larger solvation free energy than H2O due to more energetically favorable hydrophilic interactions as well as favorable hydrophobic interactions between CH element groups. In addition, phenolic chain structure significantly impacts solvation performance with OON having limited intermolecular hydrogen bond formations while OPN and RES interact more favorably with the solvent molecules. The results suggest that a resole-type phenolic chain with an ortho-para network should have the best solvation performance in EGL, H2O, and other similar solvents.
Zbrun, María V; Romero-Scharpen, Analía; Olivero, Carolina; Zimmermann, Jorge A; Rossler, Eugenia; Soto, Lorena P; Astesana, Diego M; Blajman, Jesica E; Berisvil, Ayelén; Frizzo, Laureano S; Signorini, Marcelo L
The objective of this study was to investigate a clonal relationship among thermotolerant Campylobacter spp. isolates from different stages of the poultry meat supply chain in Argentina. A total of 128 thermotolerant Campylobacter spp. (89 C. jejuni and 39 C. coli) isolates from six poultry meat chains were examined. These isolates were from: a) hens from breeder flocks, b) chickens on the farm (at ages 1 wk and 5 wk), c) chicken carcasses in the slaughterhouse, and d) chicken carcasses in the retail market. Chickens sampled along each food chain were from the same batch. Campylobacter spp. isolates were analyzed using pulsed-field gel electrophoresis to compare different profiles according to the source. Clustering of C. jejuni isolates resulted in 17 profiles, with four predominant genotypes and many small profiles with just a few isolates or unique patterns, showing a very high degree of heterogeneity among the C. jejuni isolates. Some clusters included isolates from different stages within the same chain, which would indicate a spread of strains along the same poultry meat chain. Moreover, twenty-two strains of C. coli clustered in seven groups and the remaining 17 isolates exhibited unique profiles. Evidence for transmission of thermotolerant Campylobacter spp. through the food chain and cross contamination in the slaughterhouses were obtained. This collective evidence should be considered as the scientific basis to implement risk management measures to protect the public health. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Phenolic Polymer Solvation in Water and Ethylene Glycol, I: Molecular Dynamics Simulations.
Bucholz, Eric W; Haskins, Justin B; Monk, Joshua D; Bauschlicher, Charles W; Lawson, John W
2017-04-06
Interactions between pre-cured phenolic polymer chains and a solvent have a significant impact on the structure and properties of the final postcured phenolic resin. Developing an understanding of the nature of these interactions is important and will aid in the selection of the proper solvent that will lead to the desired final product. Here, we investigate the role of the phenolic chain structure and the solvent type on the overall solvation performance of the system through molecular dynamics simulations. Two types of solvents are considered: ethylene glycol (EGL) and H 2 O. In addition, three phenolic chain structures are considered, including two novolac-type chains with either an ortho-ortho (OON) or an ortho-para (OPN) backbone network and a resole-type (RES) chain with an ortho-ortho network. Each system is characterized through a structural analysis of the solvation shell and the hydrogen-bonding environment as well as through a quantification of the solvation free energy along with partitioned interaction energies between specific molecular species. The combination of simulations and the analyses indicate that EGL provides a higher solvation free energy than H 2 O due to more energetically favorable hydrophilic interactions as well as favorable hydrophobic interactions between CH element groups. In addition, the phenolic chain structure significantly affects the solvation performance, with OON having limited intermolecular hydrogen-bond formations, while OPN and RES interact more favorably with the solvent molecules. The results suggest that a resole-type phenolic chain with an ortho-para network should have the best solvation performance in EGL, H 2 O, and other similar solvents.
Porter, Joanne L.; Carr, Paul D.; Collyer, Charles A.; Ollis, David L.
2014-01-01
Dienelactone hydrolase (DLH) is a monomeric protein with a simple α/β-hydrolase fold structure. It readily crystallizes in space group P212121 from either a phosphate or ammonium sulfate precipitation buffer. Here, the structure of DLH at 1.85 Å resolution crystallized in space group C2 with two molecules in the asymmetric unit is reported. When crystallized in space group P212121 DLH has either phosphates or sulfates bound to the protein in crucial locations, one of which is located in the active site, preventing substrate/inhibitor binding. Another is located on the surface of the enzyme coordinated by side chains from two different molecules. Crystallization in space group C2 from a sodium citrate buffer results in new crystallographic protein–protein interfaces. The protein backbone is highly similar, but new crystal contacts cause changes in side-chain orientations and in loop positioning. In regions not involved in crystal contacts, there is little change in backbone or side-chain configuration. The flexibility of surface loops and the adaptability of side chains are important factors enabling DLH to adapt and form different crystal lattices. PMID:25005082
Shi, Yali; Vestergren, Robin; Nost, Therese Haugdahl; Zhou, Zhen; Cai, Yaqi
2018-04-17
Understanding the bioaccumulation mechanisms of per- and polyfluoroalkyl substances (PFASs) across different chain-lengths, isomers and functional groups represents a monumental scientific challenge with implications for chemical regulation. Here, we investigate how the differential tissue distribution and bioaccumulation behavior of 25 PFASs in crucian carp from two field sites impacted by point sources can provide information about the processes governing uptake, distribution and elimination of PFASs. Median tissue/blood ratios (TBRs) were consistently <1 for all PFASs and tissues except bile which displayed a distinct distribution pattern and enrichment of several perfluoroalkyl sulfonic acids. Transformation of concentration data into relative body burdens (RBBs) demonstrated that blood, gonads, and muscle together accounted for >90% of the amount of PFASs in the organism. Principal component analyses of TBRs and RBBs showed that the functional group was a relatively more important predictor of internal distribution than chain-length for PFASs. Whole body bioaccumulation factors (BAFs) for short-chain PFASs deviated from the positive relationship with hydrophobicity observed for longer-chain homologues. Overall, our results suggest that TBR, RBB, and BAF patterns were most consistent with protein binding mechanisms although partitioning to phospholipids may contribute to the accumulation of long-chain PFASs in specific tissues.
Soler, Vincent J; Laurent, Camille; Sakr, Frédéric; Regnier, Alain; Tricoire, Cyrielle; Cases, Olivier; Kozyraki, Renata; Douet, Jean-Yves; Pagot-Mathis, Véronique
2017-08-01
To date, only silicone oils and gases have the appropriate characteristics for use in vitreo-retinal surgery as vitreous substitutes with intraocular tamponading properties. This preliminary study evaluated the safety and efficacy of medium-chain triglycerides (MCTs) for use as a tamponading agent in minipigs. In 15 minipigs, 15 right eyes underwent vitrectomies followed by injection of MCT tamponade (day 1). Two groups were defined. In Group A (ten eyes), the surgical procedure before MCT injection included induced rhegmatogenous retinal detachment (RRD), retina flattening, and retinopexy. In Group B (five eyes), MCT was injected without inducing RRD; in these eyes, MCT was removed on day 90. Pigs were sacrificed on day 45 (Group A) or 120 (Group B). Eyes were examined on days 1, 5, 15, and 45 in both groups and on days 90 and 120 in Group B. In Group B only, we performed bilateral electroretinography examinations on days 1 and 120, and histological examinations of MCTs and controlateral eyes were performed after sacrifice. In Group A eyes (n = 9; one eye was non-assessable), on day 45, the retina was flat in seven eyes and two RRD detachments were observed in insufficiently MCT-filled eyes. In Group B, electroretinography showed no significant differences between MCT eyes and controls on days 1 or 120. Histological analyses revealed no signs of retinal toxicity. This study showed that MCT tamponade seems to be effective and safe; however, additional studies are needed before it becomes commonly used as a tamponading agent in humans.
NASA Astrophysics Data System (ADS)
Ding, Yong; Yu, Zongzhi; Zheng, Junping
2017-03-01
Dispersing inorganic nanoparticles in aqueous solutions is a key requirement for a great variety of products and processes, including carriers in drug delivery or fillers in polymers. To be highly functional in the final product, inorganic particles are required to be finely dispersed in nanoscale. In this study, silica was selected as a representative inorganic particle. Surface stabilizers with different chain length and charged group were designed to reveal the influence of electrostatic and van der Waals forces between silica and stabilizer on the dispersion of silica particles in aqueous medium. Results showed surface stabilizer with longer alkyl chain and charged group exerted best ability to deaggregate silica, leading to a hydrodynamic size of 51.1 nm. Surface stabilizer designing with rational structure is a promising solution for deagglomerating and reducing process time and energy. Giving the designability and adaptability of surface stabilizer, this method is of potential for dispersion of other inorganic nanoparticles.
Determination of component volumes of lipid bilayers from simulations.
Petrache, H I; Feller, S E; Nagle, J F
1997-01-01
An efficient method for extracting volumetric data from simulations is developed. The method is illustrated using a recent atomic-level molecular dynamics simulation of L alpha phase 1,2-dipalmitoyl-sn-glycero-3-phosphocholine bilayer. Results from this simulation are obtained for the volumes of water (VW), lipid (V1), chain methylenes (V2), chain terminal methyls (V3), and lipid headgroups (VH), including separate volumes for carboxyl (Vcoo), glyceryl (Vgl), phosphoryl (VPO4), and choline (Vchol) groups. The method assumes only that each group has the same average volume regardless of its location in the bilayer, and this assumption is then tested with the current simulation. The volumes obtained agree well with the values VW and VL that have been obtained directly from experiment, as well as with the volumes VH, V2, and V3 that require certain assumptions in addition to the experimental data. This method should help to support and refine some assumptions that are necessary when interpreting experimental data. Images FIGURE 4 PMID:9129826
Okuneva, A D; Vikhliantsev, I M; Shpagina, M D; Rogachevskiĭ, V V; Khutsian, S S; Poddubnaia, Z A; Grigor'ev, A I
2012-01-01
Changes of titin and myosin heavy chain isoform composition in skeletal muscles (m. soleus, m. gastrocnemius, m. tibialis anterior, m. psoas major) in Mongolian Gerbil (Meriones unguiculatus ) were investigated after 12-day spaceflight on board of Russian space vehicle "Foton-M3". In m. psoas and m. soleus in the gerbils from "Flight" group the expected increase in the content of fast myosin heavy chain isoforms (IIxd and IIa, respectively) were observed. No significant differences were found in the content of IIxd and IIa isoforms of myosin heavy chain in m. tibialis anterior in the gerbils from control group as compared to that in "Flight" group. An unexpected increase in the content of slow myosin heavy chain I isoform and a decrease in the content of fast IIx/d isoform in m. gastrocnemius of the gerbils from "Flight" group were observed. In skeletal muscles of the gerbils from "Flight" group the relative content of titin N2A-isoform was reduced (by 1,2-1,7 times), although the content of its NT-isoform, which was revealed in striated muscles of mammals in our experiments earlier, remained the same. When the content of titin N2A-isoform was decreased, no predictable abnormalities in sarcomeric structure and contractile ability of skeletal muscles in the gerbils from "Flight" group were found. An assumption on the leading role of titin NT-isoform in maintenance of structural and functional properties of striated muscles of mammals was made.
An Era of Persistent Engagement
2009-05-21
For the American people to be safer and enjoy expanding opportunities, the nation must work to deter would-be aggressors, open foreign markets ...sovereign states. They include organizations such as McDonald‘s, Adidas or Nike , and large hotel chains such as Best Western or Hilton...approach the United States’ own. In addition, there is the potentially toxic mix of rogue nations, terrorist groups, and nuclear, chemical, or biological
THERMALLY STABLE PERFLUORINATED POLYMERS
structure to cyclic product from perfluoroglutaronitrile and N2H4, opening of this cyclic product with polymerization to poly(N2-imidoyl perfluoroglutar ...Work on the 1,2,4-triazole polymer system, in which these heterocyclic groups are connected by perfluoroalkylene chains, included assignment of...hydrazidine), and synthesis of poly( perfluoropropylene - 1,2,4- triazole) both from the poly(imidoyl hydrazidine) and directly from the original cyclic
Muntlin Athlin, Åsa; Juhlin, Claes; Jangland, Eva
2017-02-01
Evidence-informed healthcare is the fundament for practice, whereby guidelines based on the best available evidence should assist health professionals in managing patients. Patients seeking care for acute abdominal pain form a common group in acute care settings worldwide, for whom decision-making and timely treatment are of paramount importance. There is ambiguity about the existence, use and content of guidelines for patients with acute abdomen. The objective was to describe and compare guidelines and management of patients with acute abdomen in different settings across the acute care delivery chain in Sweden. A national cross-sectional design was used. Twenty-nine ambulance stations, 17 emergency departments and 33 surgical wards covering all six Swedish health regions were included, and 23 guidelines were quality appraised using the validated Appraisal of Guidelines for Research & Evaluation II tool. There is a lack of guidelines in use for the management of this large group of patients between and within different healthcare areas across the acute care delivery chain. The quality appraisal identified that several guidelines were of poor quality, especially the in-hospital ones. Further, range orders for analgesics are common in the ambulance services and the surgical wards, but are seldom present in the emergency departments. Also, education in pain management is more common in the ambulance services. These findings are noteworthy as, hypothetically, the same patient could be treated in three different ways during the same care episode. There is an urgent need to develop high-quality evidence-based clinical guidelines for this patient group, with the entire care process in focus. © 2016 John Wiley & Sons, Ltd.
Using a Video Game to Teach Supply Chain and Logistics Management
ERIC Educational Resources Information Center
Liu, Chiung-Lin
2017-01-01
This study used OpenTTD, a video game that supports in-depth experiential learning, to evaluate undergraduate students' opinions regarding supply chain and logistics management learning. The 101 undergraduate participants were assigned to either an experimental group or a control group. From the post-test questionnaires, the analytical results…
Tunneling conductance of amine-linked alkyl chains.
Prodan, Emil; Car, Roberto
2008-06-01
The tunneling transport theory developed in ref 9 (Phys. Rev. B 2007, 76, 115102) is applied to molecular devices made of alkyl chains linked to gold electrodes via amine groups. Using the analytic expression of the tunneling conductance derived in our previous work, we identify the key physical quantities that characterize the conductance of these devices. By investigating the transport characteristics of three devices, containing four, six, and eight methyl groups, we extract the dependence of the tunneling conductance on the chain's length, which is an exponential decay law in agreement with recent experimental data.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-06-13
... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-74,671] Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit, Including Teleworkers Reporting to... Supply Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to Houston...
Hypermutation in shark immunoglobulin light chain genes results in contiguous substitutions.
Lee, Susan S; Tranchina, Daniel; Ohta, Yuko; Flajnik, Martin F; Hsu, Ellen
2002-04-01
Among 631 substitutions present in 90 nurse shark immunoglobulin light chain somatic mutants, 338 constitute 2-4 bp stretches of adjacent changes. An absence of mutations in perinatal sequences and the bias for one mutating V gene in adults suggest that the diversification is antigen dependent. The substitutions shared no patterns, and the absence of donor sequences, including from family members, supports the idea that most changes arose from nontemplated mutation. The tandem mutations as a group are distinguished by consistently fewer transition changes and an A bias. We suggest this is one of several pathways of hypermutation diversifying shark antigen-receptor genes--point mutations, tandem mutations, and mutations with a G-C preference--that coevolved with or preceded gene rearrangement.
MacDuff, G S; Krantz, P J; McClannahan, L E
1993-01-01
We used a graduated guidance procedure to teach 4 boys with autism to follow photographic activity schedules to increase on-task and on-schedule behavior. The multiple baseline across participants design included baseline, teaching, maintenance, resequencing of photographs, and generalization to novel photographs phases. The results indicated that photographic activity schedules (albums depicting after-school activities) produced sustained engagement, and skills generalized to a new sequence of photographs and to new photographs. The acquisition of schedule-following skills enabled these children with severe developmental disabilities to display lengthy response chains, independently change activities, and change activities in different group home settings in the absence of immediate supervision and prompts from others. PMID:8473261
Room-temperature ballistic energy transport in molecules with repeating units
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rubtsova, Natalia I.; Nyby, Clara M.; Zhang, Hong
2015-06-07
In materials, energy can propagate by means of two limiting regimes: diffusive and ballistic. Ballistic energy transport can be fast and efficient and often occurs with a constant speed. Using two-dimensional infrared spectroscopy methods, we discovered ballistic energy transport via individual polyethylene chains with a remarkably high speed of 1440 m/s and the mean free path length of 14.6 Å in solution at room temperature. Whereas the transport via the chains occurs ballistically, the mechanism switches to diffusive with the effective transport speed of 130 m/s at the end-groups attached to the chains. A unifying model of the transport inmore » molecules is presented with clear time separation and additivity among the transport along oligomeric fragments, which occurs ballistically, and the transport within the disordered fragments, occurring diffusively. The results open new avenues for making novel elements for molecular electronics, including ultrafast energy transporters, controlled chemical reactors, and sub-wavelength quantum nanoseparators.« less
Evaristi, Maria Francesca; Caubère, Céline; Harmancey, Romain; Desmoulin, Franck; Peacock, William Frank; Berry, Matthieu; Turkieh, Annie; Barutaut, Manon; Galinier, Michel; Dambrin, Camille; Polidori, Carlo; Miceli, Cristina; Chamontin, Bernard; Koukoui, François; Roncalli, Jerôme; Massabuau, Pierre; Smih, Fatima; Rouet, Philippe
2016-11-01
About 77.9 million (1 in 4) American adults have high blood pressure. High blood pressure is the primary cause of left ventricular hypertrophy (LVH), which represents a strong predictor of future heart failure and cardiovascular mortality. Previous studies have shown an altered metabolic profile in hypertensive patients with LVH. The goal of this study was to identify blood metabolomic LVH biomarkers by H NMR to provide novel diagnostic tools for rapid LVH detection in populations of hypertensive individuals. This cross-sectional study included 48 hypertensive patients with LVH matched with 48 hypertensive patients with normal LV size, and 24 healthy controls. Two-dimensional targeted M-mode echocardiography was performed to measure left ventricular mass index. Partial least squares discriminant analysis was used for the multivariate analysis of the H NMR spectral data. From the H NMR-based metabolomic profiling, signals coming from methylene (-CH2-) and methyl (-CH3) moieties of aliphatic chains from plasma lipids were identified as discriminant variables. The -CH2-/-CH3 ratio, an indicator of the mean length of the aliphatic lipid chains, was significantly higher (P < 0.001) in the LVH group than in the hypertensive group without LVH and controls. Receiver operating characteristic curve showed that a cutoff of 2.34 provided a 52.08% sensitivity and 85.42% specificity for discriminating LVH (AUC = 0.703, P-value < 0.001). We propose the -CH2-/-CH3 ratio from plasma aliphatic lipid chains as a biomarker for the diagnosis of left ventricular remodeling in hypertension.
Flavour production by Saprochaete and Geotrichum yeasts and their close relatives.
Grondin, Eric; Shum Cheong Sing, Alain; James, Steve; Nueno-Palop, Carmen; François, Jean Marie; Petit, Thomas
2017-12-15
In this study, a total of 30 yeast strains belonging to the genera Dipodascus, Galactomyces, Geotrichum, Magnusiomyces and Saprochaete were investigated for volatile organic compound production using HS-SPME-GC/MS analysis. The resulting flavour profiles, including 36 esters and 6 alcohols compounds, were statistically evaluated by cluster and PCA analysis. Two main groups of strains were extracted from this analysis, namely a group with a low ability to produce flavour and a group producing mainly alcohols. Two other minor groups of strains including Saprochaete suaveolens, Geotrichum marinum and Saprochaete gigas were diverging significantly from the main groups precisely because they showed a good ability to produce a large diversity of esters. In particular, we found that the Saprochaete genus (and their closed relatives) was characterized by a high production of unsaturated esters arising from partial catabolism of branched chain amino-acids. These esters were produced by eight phylogenetically related strains of Saprochaete genus. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Chung, Hyun-Joong; Ohno, Kohji; Composto, Russell
2013-03-01
We present an novel pathway to control the location of nanoparticles (NPs) in phase-separating polymer blend films containing poly(methyl methacrylate) (PMMA) and poly(styrene-ran-acrylonitrile) (SAN). Because hydrophobic polymer phases have a small interfacial energy, ~1 mJ/m2, subtle changes in the NP surface functionality can be used to guide NPs to either the interface between immiscible polymers or into one of the phases. Based on this idea, we designed a class of NPs grafted with PMMA brushes. These PMMA brushes were grown from the NP surface by atom transfer radical polymerization (ATRP), which results in chains terminated with chlorine atoms. The chain end can be substituted with protons (H) by dehalogenation. As a result, the NPs are strongly segregated at the interface when grafted PMMA chains are short (Mn =1.8K) and the end group is Cl, whereas NPs partition into PMMA-rich phase when chains are long (Mn =160K) and/or when chains are terminated with hydrogen. The Cl end groups and shorter chain length cause an increase in surface energy for the NPs. The increase in surface energy of short-chained NPs can be attributed to (i) an extended brush conformation (entropic) and/or (ii) a high density of ``unfavorable'' end groups (enthalpic). Finally, the impact of NPs on the morphological evolution of the polymer blend films will be discussed. Ref: H.-J.Chung et al., ACS Macro Lett. 1(1), 252-256 (2012).
Disconnection: the user voice within the wound dressing supply chain.
Campling, Natasha; Grocott, Patricia; Cowley, Sarah
2008-03-01
This study examined the user voice in England's National Health Service (NHS) wound dressing supply chain. The impetus for this work came from involvement in a collaboration between industry and clinicians, entitled Woundcare Research for Appropriate Products. Experiences from that study highlighted the notable absence of research about the impact of the supply chain on the users of dressings. Interview data are presented following an outline of the grounded theory method used. These data were obtained from key stakeholders (n = 41) within the wound dressing supply chain such as nurses, manufacturers, distributors, professional organizations, government organizations and user groups. The consequences of supply disconnection revealed haphazard supply, unmet user needs and lack of information transfer between player groups. These consequences explain the lack of user voice in the supply chain and have far-reaching implications for nursing management, through purchasing decisions and nurses' management of wound care.
NASA Astrophysics Data System (ADS)
Middleton, Luri Robert
Acid- and ion-containing polymers have interchain interactions that alter polymer behavior at the nano, micro, and bulk length scales. Strong secondary-bonds act as thermo-reversible physical crosslinks between chains which drive self-assembly. Tuning theses interactions can modify bulk polymer properties including stiffness, toughness, melt viscosity, resilience, clarity, abrasion resistance and puncture resistance. Furthermore, understanding and improving the relevant factors that control transport properties would have vast implications on developing solid polymer electrolytes (SPEs) for technologically important applications including water desalination, ion exchange membranes and microelectronics. This thesis explores the structure - processing - morphology - property relationships of acid and ionic functionalized polymers. Improvements in synthetic techniques and advancements in characterization methods have enabled new studies of associating polymer systems. Synthesis of entangled, high molecular weight, linear polyethylene (PE) chains functionalized with interacting pendant groups (acidic or ionic) placed periodically along the polymer backbone represent a new class of associating polymers. These polymers with periodic distributions of acid groups are much more homogenous than the commercially available polymers. Previous studies of these polymers with greater structural homogeneity revealed great variety in morphologies of the nano-aggregated polar groups within the non-polar polymer matrix. This thesis correlated the morphologies with bulk properties through real-time X-ray scattering and tensile deformation at a range of temperatures and sample compositions. New, transient morphologies and hierarchical morphologies were observed which coincided with unusual tensile strain hardening. These results indicate that improvements in synthetic control of polymers can enhance physical properties such as tensile strain-hardening, through cooperative bonding between chains. The structural regularity of precise polyethylenes also enables robust comparisons between experiments and computer simulations. At pico- to nano-seconds time scales and length scales of polymer and aggregate dynamics, neutron scattering and molecular dynamics simulations were combined to extend the knowledge of the molecular-level aggregated polymer dynamics. These experiments provide a baseline for future studies of ion-conduction in associating polymer melts.
Chain Effects: The Impact of Academy Chains on Low Income Students
ERIC Educational Resources Information Center
Hutchings, Merryn; Francis, Becky; De Vries, Robert
2014-01-01
The authors analysed school performance data to review how well disadvantaged pupils achieve in academy chains. They included chains only if they had at least three academies in 2013, and two sponsored secondary academies for the whole period from September 2010 to July 2013. This means that academies are included in our analysis only when there…
Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P
2002-12-01
The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.
Lin, Yin-Liang; Karduna, Andrew
2016-10-01
Proprioception is essential for shoulder neuromuscular control and shoulder stability. Exercise of the rotator cuff and scapulothoracic muscles is an important part of shoulder rehabilitation. The purpose of this study was to investigate the effect of rotator cuff and scapulothoracic muscle exercises on shoulder joint position sense. Thirty-six healthy subjects were recruited and randomly assigned into either a control or training group. The subjects in the training group received closed-chain and open-chain exercises focusing on rotator cuff and scapulothoracic muscles for four weeks. Shoulder joint position sense errors in elevation, including the humerothoracic, glenohumeral and scapulothoracic joints, was measured. After four weeks of exercise training, strength increased overall in the training group, which demonstrated the effect of exercise on the muscular system. However, the changes in shoulder joint position sense errors in any individual joint of the subjects in the training group were not different from those of the control subjects. Therefore, exercises specifically targeting individual muscles with low intensity may not be sufficient to improve shoulder joint position sense in healthy subjects. Future work is needed to further investigate which types of exercise are more effective in improving joint position sense, and the mechanisms associated with those changes. Copyright © 2016 Elsevier B.V. All rights reserved.
Lin, Yin-Liang; Karduna, Andrew
2016-01-01
Proprioception is essential for shoulder neuromuscular control and shoulder stability. Exercise of the rotator cuff and scapulothoracic muscles is an important part of shoulder rehabilitation. The purpose of this study was to investigate the effect of rotator cuff and scapulothoracic muscle exercises on shoulder joint position sense. Thirty-six healthy subjects were recruited and randomly assigned into either a control or training group. The subjects in the training group received closed-chain and open-chain exercises focusing on rotator cuff and scapulothoracic muscles for four weeks. Shoulder joint position sense errors in elevation, including the humerothoracic, glenohumeral and scapulothoracic joints, was measured. After four weeks of exercise training, strength increased overall in the training group, which demonstrated the effect of exercise on the muscular system. However, the changes in shoulder joint position sense errors in any individual joint of the subjects in the training group were not different from those of the control subjects. Therefore, exercises specifically targeting individual muscles with low intensity may not be sufficient to improve shoulder joint position sense in healthy subjects. Future work is needed to further investigate which types of exercise are more effective in improving joint position sense, and the mechanisms associated with those changes. PMID:27475714
Importance of medium chain fatty acids in animal nutrition
NASA Astrophysics Data System (ADS)
Baltić, B.; Starčević, M.; Đorđević, J.; Mrdović, B.; Marković, R.
2017-09-01
Fats in animal and human nutrition are a common subject of research. These studies most often pay attention to particular fat groups (saturated, unsaturated, polyunsaturated fats or fats grouped by the length of their fatty acid chains into short, medium or long chain fatty acids). Medium chain fatty acids (MCFAs) have two main sources: milk and coconut oil. To date, research has shown these acids have positive effects on health, production, feed digestibility and lower body and muscle fats in broilers and swine. MCFAs possess antibacterial, anticoccidial and antiviral effects. Also, it has been proven that these acids act synergistically if they are used together with organic acids, essential oils, or probiotics. Nowadays, commercial MCFA products are available for use in animal nutrition as feed additives.
NASA Astrophysics Data System (ADS)
Kuć, Marta; Cieślik-Boczula, Katarzyna; Rospenk, Maria
2017-11-01
The effect of inhalation anesthetics (enflurane, isoflurane, sevoflurane or halothane) on the lipid chain-melting phase transition of negatively charged phospholipid membranes was studied using near-infrared (NIR) spectroscopy supported by Principal Component Analysis (PCA). NIR spectra of anesthetics-mixed dipalmitoylphosphatidylglycerol (DPPG) membranes were recorded in a range of the first overtone of the symmetric and antisymmetric stretching vibrations of CH2 groups of lipid aliphatic chains as a function of increasing temperature. Anesthetic-dependent changes in the trans to gauche conformers ratio of CH2 groups in the hydrocarbon lipid chains were characterized in detail and compared with the zwitterionic lipid membranes, which were built of dipalmitoylphosphatidylcholine (DPPC) molecules.
The weight hierarchies and chain condition of a class of codes from varieties over finite fields
NASA Technical Reports Server (NTRS)
Wu, Xinen; Feng, Gui-Liang; Rao, T. R. N.
1996-01-01
The generalized Hamming weights of linear codes were first introduced by Wei. These are fundamental parameters related to the minimal overlap structures of the subcodes and very useful in several fields. It was found that the chain condition of a linear code is convenient in studying the generalized Hamming weights of the product codes. In this paper we consider a class of codes defined over some varieties in projective spaces over finite fields, whose generalized Hamming weights can be determined by studying the orbits of subspaces of the projective spaces under the actions of classical groups over finite fields, i.e., the symplectic groups, the unitary groups and orthogonal groups. We give the weight hierarchies and generalized weight spectra of the codes from Hermitian varieties and prove that the codes satisfy the chain condition.
The architecture of metal coordination groups in proteins.
Harding, Marjorie M
2004-05-01
A set of tables is presented and a survey given of the architecture of metal coordination groups in a representative set of protein structures from the Protein Data Bank [Bernstein et al. (1977), J. Mol. Biol. 112, 535-542; Berman et al. (2000), Nucleic Acids Res. 28, 235-242]. The structures have been determined to a resolution of 2.5 A or better; the metals considered are Ca, Mg, Mn, Fe, Cu, Zn, Na and K, with particular emphasis on Ca and Zn and the exclusion of haem groups and Fe/S clusters; the proteins are a representative set in which none has more than 30% sequence identity with any other. In them the metal is coordinated by several donor groups from different amino-acid residues in the protein chain and often also by water or other small molecules. The tables, for approximately 600 metal coordination groups, include information on the conformations of the protein chain in the region around the metal and reliability indicators. They illustrate the wide variety of coordination numbers, chelate-loop sizes and other properties and the different characteristics of different metals. They show that glycine has a particular significance in the position adjacent to a donor residue, especially in Ca coordination groups. They also show that metal coordination does not appear to lead to significant distortions of the torsion angles phi, psi from their normally allowed values. Very few metal coordination groups occur more than once in the representative set and when they do they are usually related in fold and function; they have similar but not necessarily identical conformations. However, individual chelate loops, for example Zn(-C-X-X'-C-), in which both cysteines are coordinated to Zn through S, and X and X' are any amino acids, are repeated frequently in many different and unrelated proteins. Not all chelate loops with the same composition have the same conformation, but for smaller loops there are usually one or two strongly preferred and well defined conformations. Quite frequently more than one metal coordination group is associated with one protein chain; these proteins are identified.
Lewis, R N; McElhaney, R N
1993-01-01
The mixed interdigitated gel phases of unlabeled, specifically 13C = O-labeled, and specifically chain-perdeuterated samples of 1-O-eicosanoyl, 2-O-lauroyl phosphatidylcholine and 1-O-decanoyl, 2-O-docosanoyl phosphatidylcholine were studied by infrared spectroscopy. Our results suggest that at the liquid-crystalline/gel phase transition temperatures of these lipids, there is a greater redistribution in the populations of free and hydrogen-bonded ester carbonyl groups than is commonly observed with symmetric chain n-saturated diacyl phosphatidylcholines. The formation of the mixed interdigitated gel phase coincides with the appearance of a marked asymmetry in the contours of the C = O stretching band, a process which becomes more pronounced as the temperature is reduced. This asymmetry is ascribed to the emergence of a predominant lipid population consisting of free sn1- and hydrogen-bonded (hydrated) sn2-ester carbonyl groups. This suggests that the region of the mixed interdigitated bilayer polar/apolar interface near to the sn1-ester carbonyl group is less hydrated than is the case with the noninterdigitated gel-phase bilayers formed by normal symmetric chain phosphatidylcholines. In the methylene deformation region of the spectrum, the unlabeled lipids exhibit a pronounced splitting of the CH2 scissoring bands. This splitting is significantly attenuated when the short chains are perdeuterated and collapses completely upon perdeuteration of the long chains, irrespective of whether the long (or short) chains are esterified to the sn1 or sn2 positions of the glycerol backbone. These results are consistent with a global hydrocarbon chain packing motif in which the zigzag planes of the hydrocarbon chains are perpendicular to each other and the sites occupied by long chains are twice as numerous as those occupied by short chains. The experimental support for this chain-packing motif enabled more detailed considerations of the possible ways in which these lipid molecules are assembled in the mixed interdigitated gel phase. Generally, our results are compatible with a previously proposed model in which the mixed interdigitated gel phase is an assembly of repeat units which consists of two phosphatidylcholine molecules forming a triple-chain structure with the long chains traversing the bilayer and with the methyl termini of the shorter chains opposed at the bilayer center. Our data also suggest that the packing format which is most consistent with our results and previously published work is one in which the hydrocarbon chains of each repeat unit are parallel to each other with the repeat units themselves being perpendicularly packed. PMID:8298016
Self-Assembled Monolayers of Dithiophosphinic Acids on Gold
NASA Astrophysics Data System (ADS)
San Juan, Ronan Roca
This dissertation reports the synthesis of derivatives of dithiophosphinic acids (R1R2DTPAs), and the formation and characterization of DTPA SAMs on gold to build a knowledge base on their nature of binding, organization of the alkyl chains and electrochemical barrier properties. The binding of DTPA molecules on gold depends on the morphology of the gold film: They bind in a mixed monodentate and bidentate modes on standard as-deposited (As-Dep) gold, while they fully chelate on smoother template-stripped (TS) gold. Chapter 2 focuses on van der Waals interactions of various alkyl chain lengths of symmetrical R2DTPA SAMs, which increase with increasing chain lengths similar to those of the analogous n-alkanethiol SAMs, but with alkyl chains that are generally less dense than those of n-alkanethiol SAMs. Chapter 3 addresses why the DTPA compounds do not chelate on the standard As-Dep gold by comparing (C16)2DTPA SAM to (C16 )2DDP SAM. Here, side chain crystallinity stabilizes DTPA SAM structure at the expense of chelation of the DTPA molecules, which leads to a mixture of bidentate and monodentate DTPA molecules, whereas the increased flexibility of the chains in DDP due to the oxygen atoms retains chelation of the DDP molecules. Chapter 4 focuses on the SAMs formed from RlongRshort DTPAs, which shows that the length of the short chain spacer affects SAM packing density and thickness. The SAMs of these molecules also show homogeneous mixing of Rlong and Rshort chains. Chapter 5 investigates PhRDTPA SAMs in preparation for molecular junction studies. The chelation of PhRDTPA molecules on TS gold allows the PhRDTPAs to act as molecular alligator clips. The length of the alkyl chains controls the density of the phenyl group and they fill in the voids between adsorbates to prevent electrical shorting. Finally, Chapter 6 incorporates OH tail group(s) to control the wettability of DTPA SAMs. The presence of OH groups in DTPAs forms hydrophilic SAMs. The symmetrical OH-terminated DTPA forms a SAM with similar packing density to that of an analogous CH3-terminated DTPA SAM, while the OH/CH 3-terminated DTPA forms a thin SAM with low molecular packing, however, the chains of this SAM are homogeneously mixed.
Fabbro, Simone Del; Nazzi, Francesco
2013-01-01
Tick-borne zoonoses are considered as emerging diseases. Tick repellents represent an effective tool for reducing the risk of tick bite and pathogens transmission. Previous work demonstrated the repellent activity of the phenylpropanoid eugenol against Ixodes ricinus; here we investigate the relationship between molecular structure and repellency in a group of substances related to that compound. We report the biological activity of 18 compounds varying for the presence/number of several moieties, including hydroxyl and methoxy groups and carbon side-chain. Each compound was tested at different doses with a bioassay designed to measure repellency against individual tick nymphs. Both vapor pressure and chemical features of the tested compounds appeared to be related to repellency. In particular, the hydroxyl and methoxy groups as well as the side-chain on the benzene ring seem to play a role. These results are discussed in light of available data on chemical perception in ticks. In the course of the study new repellent compounds were identified; the biological activity of some of them (at least as effective as the “gold standard” repellent DEET) appears to be very promising from a practical point of view. PMID:23805329
Ramazanzadeh, Rashid; Khodabandehloo, Mazaher; Farhadifar, Fariba; Rouhi, Samaneh; Ahmadi, Amjad; Menbari, Shaho; Fallahi, Fariba; Mirnejad, Reza
2016-10-01
Mycoplasma genitalium infections are suggested as causes of a number of pathological outcomes in pregnant women. The aim of this study was to evaluate the frequency of M. genitalium infections among pregnant women and its association with spontaneous abortion. In this case-control study we included 109 women with spontaneous abortion with a gestational age of 10-20 weeks (patients), and 109 women with normal pregnancy with a gestational age of 20-37 weeks (controls) in Sanandaj, Iran. Using specific primers and extracted DNA from endocervical swabs, a polymerase chain reaction was conducted for the detection of M. genitalium infection in both groups. The frequency of M. genitalium infection in patient and control groups was one (0.91%) and three (2.75%), respectively. In both control and patient groups using Fisher test, no association between mycoplasma infection and spontaneous abortion was seen. M. genitalium may be positive in the genital tract of some pregnant women but was not associated with spontaneous abortion. Further powerful studies with larger sample sizes are needed for the determination of a possible role of M. genitalium in pregnancy outcomes and spontaneous abortion.
Wang, Chu; Gao, Wei; Liang, Yong; Wang, Yawei; Jiang, Guibin
2018-03-21
Chlorinated paraffins (CPs) are widely used in domestic polymeric products as plasticizers and fire retardants. In this study, concentrations and congener profiles of short-chain and medium-chain chlorinated paraffins (SCCPs and MCCPs) were investigated in domestic polymeric products, including plastics, rubber and food packaging in China. The average concentrations of SCCPs in polyethylene terephthalate (PET), polypropylene (PP), polyethylene (PE) and food packaging were 234, 3968, 150 and 188 ng/g, respectively and the corresponding average concentrations of MCCPs in these samples were 37.4, 2537, 208 and 644 ng/g, respectively. The concentrations of CPs in rubber and polyvinylchloride (PVC) were significantly higher than in other matrices. The highest concentrations of SCCPs and MCCPs were found in a PVC cable sheath with 191 mg/g and 145 mg/g, respectively. Congener group profiles analysis indicated C 11 - and C 13 -congener groups were predominant in carbon homologues of SCCPs, and C 14 -congener groups were predominant in MCCPs. High levels of SCCPs and MCCPs in domestic polymeric products implied that they might be a significant source to the environment and human exposure. Copyright © 2018. Published by Elsevier Ltd.
Comparison of the One- and Bi-Direction Chained Equipercentile Equating
ERIC Educational Resources Information Center
Oh, Hyeonjoo; Moses, Tim
2012-01-01
This study investigated differences between two approaches to chained equipercentile (CE) equating (one- and bi-direction CE equating) in nearly equal groups and relatively unequal groups. In one-direction CE equating, the new form is linked to the anchor in one sample of examinees and the anchor is linked to the reference form in the other…
2014-01-01
Objectives Limited human resources are widely recognised as an impediment to achieving the health-related Millennium Development Goals in Pacific Island Countries, with the availability of medical supplies and suitably trained health personnel crucial to ensuring a well-functioning medical supply chain. This paper presents our findings as we seek to answer the research question ‘What factors influence the availability of medical supplies within the health facilities of Papua New Guinea?’ Methods We used a qualitative, triangulated strategy using semi-structured interviews, workplace observation and semi-structured focus groups. The parallel use of the interview tool and workplace observation tool allowed identification of ‘know-do’ gaps between what the interviewee said they did in their work practices, and the actual evidence of these practices. Focus groups provided further opportunities for raising and elaborating issues. Results During 2 weeks of data collection we conducted 17 interviews and 15 observational workplace surveys in 15 facilities. Sixteen health personnel participated in 3 focus groups across 2 provinces and one district. An array of medical supply issues across all levels of the medical supply chain were revealed, including standard operating procedures, facilities, transport, emergency medical kits, the cold chain and record keeping. The influence of health worker training and competency was found to be common across all of these issues. Conclusion The factors influencing the availability of medical supplies in PNG consist of a range of interrelating issues, consisting of both simple and complex problems involving the different levels and cadres of workers within the medical supply chain. Health systems sustainability theory suggests that a coordinated approach which addresses the inter-related nature of these issues, led by the PNG government and supported by suitable development partners, will be required for sustainable health systems change to occur. These changes are necessary for PNG to meet the health-related Millennium Development Goals. PMID:25848545
Brown, Andrew N; Gilbert, Ben
2014-01-01
Limited human resources are widely recognised as an impediment to achieving the health-related Millennium Development Goals in Pacific Island Countries, with the availability of medical supplies and suitably trained health personnel crucial to ensuring a well-functioning medical supply chain. This paper presents our findings as we seek to answer the research question 'What factors influence the availability of medical supplies within the health facilities of Papua New Guinea?' We used a qualitative, triangulated strategy using semi-structured interviews, workplace observation and semi-structured focus groups. The parallel use of the interview tool and workplace observation tool allowed identification of 'know-do' gaps between what the interviewee said they did in their work practices, and the actual evidence of these practices. Focus groups provided further opportunities for raising and elaborating issues. During 2 weeks of data collection we conducted 17 interviews and 15 observational workplace surveys in 15 facilities. Sixteen health personnel participated in 3 focus groups across 2 provinces and one district. An array of medical supply issues across all levels of the medical supply chain were revealed, including standard operating procedures, facilities, transport, emergency medical kits, the cold chain and record keeping. The influence of health worker training and competency was found to be common across all of these issues. The factors influencing the availability of medical supplies in PNG consist of a range of interrelating issues, consisting of both simple and complex problems involving the different levels and cadres of workers within the medical supply chain. Health systems sustainability theory suggests that a coordinated approach which addresses the inter-related nature of these issues, led by the PNG government and supported by suitable development partners, will be required for sustainable health systems change to occur. These changes are necessary for PNG to meet the health-related Millennium Development Goals.
Structure and Reaction Mechanism of Basil Eugenol Synthase
Louie, Gordon V.; Baiga, Thomas J.; Bowman, Marianne E.; Koeduka, Takao; Taylor, John H.; Spassova, Snejina M.; Pichersky, Eran; Noel, Joseph P.
2007-01-01
Phenylpropenes, a large group of plant volatile compounds that serve in multiple roles in defense and pollinator attraction, contain a propenyl side chain. Eugenol synthase (EGS) catalyzes the reductive displacement of acetate from the propenyl side chain of the substrate coniferyl acetate to produce the allyl-phenylpropene eugenol. We report here the structure determination of EGS from basil (Ocimum basilicum) by protein x-ray crystallography. EGS is structurally related to the short-chain dehydrogenase/reductases (SDRs), and in particular, enzymes in the isoflavone-reductase-like subfamily. The structure of a ternary complex of EGS bound to the cofactor NADP(H) and a mixed competitive inhibitor EMDF ((7S,8S)-ethyl (7,8-methylene)-dihydroferulate) provides a detailed view of the binding interactions within the EGS active site and a starting point for mutagenic examination of the unusual reductive mechanism of EGS. The key interactions between EMDF and the EGS-holoenzyme include stacking of the phenyl ring of EMDF against the cofactor's nicotinamide ring and a water-mediated hydrogen-bonding interaction between the EMDF 4-hydroxy group and the side-chain amino moiety of a conserved lysine residue, Lys132. The C4 carbon of nicotinamide resides immediately adjacent to the site of hydride addition, the C7 carbon of cinnamyl acetate substrates. The inhibitor-bound EGS structure suggests a two-step reaction mechanism involving the formation of a quinone-methide prior to reduction. The formation of this intermediate is promoted by a hydrogen-bonding network that favors deprotonation of the substrate's 4-hydroxyl group and disfavors binding of the acetate moiety, akin to a push-pull catalytic mechanism. Notably, the catalytic involvement in EGS of the conserved Lys132 in preparing the phenolic substrate for quinone methide formation through the proton-relay network appears to be an adaptation of the analogous role in hydrogen bonding played by the equivalent lysine residue in other enzymes of the SDR family. PMID:17912370
Colino, Jesus; Outschoorn, Ingrid
2004-01-01
The capsular polysaccharide of Neisseria meningitidis group B (CpsB) is a very poor immunogen in mammals; this has been considered to be due to the induction of tolerance to cross-reactive host glycoconjugates. It has hampered the development of an effective vaccine against this meningococcal group for many years. Syngeneic populations have a similar tolerogenic background. Thus, we used the variability in ability to mount CpsB-specific immunoglobulin (Ig) responses of individuals from these populations to reveal underlying mechanisms to tolerance contributing to the poor immunogenicity of CpsB. Here we analyze by ELISA, the individual CpsB-specific Ig response of BALB/c and other syngeneic mice to immunization with intact bacteria, using the distribution of light chains as a direct indicator of the repertoire dynamics of the response. Although approximately 96% of anti-CpsB Ig bear kappa-light chains, BALB/c mouse populations were heterogeneous in the light chain composition of their individual anti-CpsB Ig responses. The proportion of kappa and lambda-light chains used for anti-CpsB Ig was a private characteristic that remained relatively constant, for each individual, through repetitive immunizations regardless of the bacterial stimuli size. Despite the prevalence of individual use of kappa-light chains, 5% of BALB/c mice showed restricted usage of lambda-light chains in their CpsB-specific Ig responses, and an additional 11% use them significantly. The preferential use of lambda-light chains in these mice was strongly associated with defective IgM, and absent or barely detectable IgG anti-CpsB responses even after repetitive bacterial immunization. We conclude that differences in the private repertoire of specific Ig also contribute to mouse unresponsiveness to CpsB.
Kessner, Doreen; Brezesinski, Gerald; Funari, Sergio S; Dobner, Bodo; Neubert, Reinhard H H
2010-01-01
The stratum corneum (SC), the outermost layer of the mammalian skin, is the main skin barrier. Ceramides (CERs) as the major constituent of the SC lipid matrix are of particular interest. At the moment, 11 classes of CERs are identified, but the effect of each single ceramide species is still not known. Therefore in this article, the thermotropic behaviour of the long chain omega-acylceramides CER[EOS] and CER[EOP] was studied using X-ray powder diffraction and FT-Raman spectroscopy. It was found that the omega-acylceramides CER[EOS] and CER[EOP] do not show a pronounced polymorphism which is observed for shorter chain ceramides as a significant feature. The phase behaviour of both ceramides is strongly influenced by the extremely long acyl-chain residue. The latter has a much stronger influence compared with the structure of the polar head group, which is discussed as extremely important for the appearance of a rich polymorphism. Despite the strong influence of the long chain, the additional OH-group of the phyto-sphingosine type CER[EOP] influences the lamellar repeat distance and the chain packing. The less polar sphingosine type CER[EOS] is stronger influenced by the long acyl-chain residue. Hydration is necessary for the formation of an extended hydrogen-bonding network between the polar head groups leading to the appearance of a long-periodicity phase (LPP). In contrast, the more polar CER[EOP] forms the LPP with densely packed alkyl chains already in the dry state.
Pharmaceutical supply chain risks: a systematic review.
Jaberidoost, Mona; Nikfar, Shekoufeh; Abdollahiasl, Akbar; Dinarvand, Rassoul
2013-12-19
Supply of medicine as a strategic product in any health system is a top priority. Pharmaceutical companies, a major player of the drug supply chain, are subject to many risks. These risks disrupt the supply of medicine in many ways such as their quantity and quality and their delivery to the right place and customers and at the right time. Therefore risk identification in the supply process of pharmaceutical companies and mitigate them is highly recommended. In this study it is attempted to investigate pharmaceutical supply chain risks with perspective of manufacturing companies. Scopus, PubMed, Web of Science bibliographic databases and Google scholar scientific search engines were searched for pharmaceutical supply chain risk management studies with 6 different groups of keywords. All results found by keywords were reviewed and none-relevant articles were excluded by outcome of interests and researcher boundaries of study within 4 steps and through a systematic method. Nine articles were included in the systematic review and totally 50 main risks based on study outcome of interest extracted which classified in 7 categories. Most of reported risks were related to supply and supplier issues. Organization and strategy issues, financial, logistic, political, market and regulatory issues were in next level of importance. It was shown that the majority of risks in pharmaceutical supply chain were internal risks due to processes, people and functions mismanagement which could be managed by suitable mitigation strategies.
A comparison of medium-chain and long-chain triglycerides in surgical patients.
Jiang, Z M; Zhang, S Y; Wang, X R; Yang, N F; Zhu, Y; Wilmore, D
1993-01-01
Available lipid emulsions made from soybean or safflower oil are classified as long-chain triglycerides (LCT). In contrast, medium-chain triglyceride (MCT) emulsions have different physical properties and are metabolized by other biochemical pathways. To compare the differences between these two fat emulsions, the authors studied 12 surgical patients and 6 volunteers. These subjects were randomly assigned to receive parenteral nutrition with MCT or LCT emulsion. Measurement of arterial and venous concentration differences across the forearm demonstrated that muscle utilization was significantly improved with MCT administration. There was also a trend toward improved nitrogen balance in the MCT group, and less weight loss in the postoperative period also was observed in this group. During the fat clearance test, the serum ketone concentrations were significantly higher in the MCT than the LCT group. The improvement in nitrogen retention may be associated with increasing ketone and insulin levels. Fat emulsions containing 50% MCT are safe for use in parenteral nutrition and may provide an alternate fuel that improves protein metabolism. PMID:8439215
Odd-even chain packing, molecular and thermal models for some long chain sodium(I) n-alkanoates
NASA Astrophysics Data System (ADS)
Nelson, Peter N.; Ellis, Henry A.
2014-10-01
A homologous series of sodium(I) n-alkanoates, NaCnH2n-1O2, with chain lengths n = 8-18, inclusive, have been synthesized and their structural and thermal properties investigated via Fourier Transform Infrared and Solid State 13C NMR spectroscopies, X-ray powder diffraction, Thermogravimetry, Differential Scanning Calorimetry, Polarizing light microscopy and variable temperature Infrared spectroscopy. The measurements show that metal-carboxylate coordination is via asymmetric chelating bidentate bonding with extensive carboxyl group inter-molecular interactions in which four oxygen atoms are bonded tetrahedrally to a sodium atom. Furthermore, the compounds crystallize in a monoclinic crystal system with the hydrocarbon chains in the fully extended all-trans conformation, advancing along the c-axis. Moreover, the chains are packed as tilted (θ ∼ 63°), non-overlapping, tail-to-tail lamellar bilayers that are not in the same plane, within a lamellar. Though these compounds are nearly isostructural, there are subtle differences in the packing of the hydrocarbon chains in the crystal lattice, resulting in odd-even alternation in the terminal methyl group asymmetric stretching vibration and chemical shift. These differences arise from the relative vertical distances between hydrocarbon planes within the lamellar; such that, for odd-chain compounds, larger inter-planar distances result in less efficient packing in the crystal lattice and hence, lower inter-planar van der Waals interactions between hydrocarbon chains. Thermal traces, for all compounds, show several partially reversible solid-solid pre-melting transitions associated with different degrees of gauche conformers in the alkyl chains. The reversible gauche-trans isomerism, of the methylene groups, is kinetically controlled; hence, super-cooling of the melt and other transitions, are observed for all compounds. The kinetics of chain reversion follow the exponential law of nucleation, though complicated by competing processes. Thermogravimetric data show that all compounds decompose at temperatures in excess of 690 K; therefore, free radical thermal cracking of the hydrocarbon chains, in conjunction with decarboxylation is proposed for their non-oxidative degradation mechanism.
(R,S)-3-Carb-oxy-2-(isoquinolinium-2-yl)propanoate monohydrate.
Stilinović, Vladimir; Frkanec, Leo; Kaitner, Branko
2010-05-22
The title compound, C(13)H(11)NO(4)·H(2)O, is a monohydrate of a betaine exhibiting a positively charged N-substituted isoquino-line group and a deprotonated carboxyl group. In the crystal, mol-ecules are connected via short O-H⋯O hydrogen bonds between protonated and deprotonated carboxyl groups into chains of either R or S enanti-omers along [001]. These chains are additionally connected by hydrogen bonding between water mol-ecules and the deprotonated carb-oxy groups of neighbouring mol-ecules.
Brantingham, James W; Parkin-Smith, Gregory; Cassa, Tammy Kay; Globe, Gary A; Globe, Denise; Pollard, Henry; deLuca, Katie; Jensen, Muffit; Mayer, Stephan; Korporaal, Charmaine
2012-02-01
To determine the short-term effectiveness of full kinematic chain manual and manipulative therapy (MMT) plus exercise compared with targeted hip MMT plus exercise for symptomatic mild to moderate hip osteoarthritis (OA). Parallel-group randomized trial with 3-month follow-up. Two chiropractic outpatient teaching clinics. Convenience sample of eligible participants (N=111) with symptomatic hip OA were consented and randomly allocated to receive either the experimental or comparison treatment, respectively. Participants in the experimental group received full kinematic chain MMT plus exercise while those in the comparison group received targeted hip MMT plus exercise. Participants in both groups received 9 treatments over a 5-week period. Western Ontario and McMasters Osteoarthritis Index (WOMAC), Harris hip score (HHS), and Overall Therapy Effectiveness, alongside estimation of clinically meaningful outcomes. Total dropout was 9% (n=10) with 7% of total data missing, replaced using a multiple imputation method. No statistically significant differences were found between the 2 groups for any of the outcome measures (analysis of covariance, P=.45 and P=.79 for the WOMAC and HHS, respectively). There were no statistically significant differences in the primary or secondary outcome scores when comparing full kinematic chain MMT plus exercise with targeted hip MMT plus exercise for mild to moderate symptomatic hip OA. Consequently, the nonsignificant findings suggest that there would also be no clinically meaningful difference between the 2 groups. The results of this study provides guidance to musculoskeletal practitioners who regularly use MMT that the full kinematic chain approach does not appear to have any benefit over targeted treatment. Copyright © 2012 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Structure and dynamics of water inside endohedrally functionalized carbon nanotubes.
Paul, Sanjib; Abi, T G; Taraphder, Srabani
2014-05-14
We have carried out classical molecular dynamics simulations on the formation of extended water chains inside single-walled carbon nanotubes (SWCNTs) in water in the presence of selected functional groups covalently attached to the inner wall of the tube. Analogues of polar amino acid sidechains have been chosen to carry out the endohedral functionalization of SWCNTs. Our results show a spontaneous and asymmetric filling of the nanotube with dynamical water chains in all the cases studied. The presence of Asp- and Glu-like sidechains is found to result in the formation of well-ordered water chains across the tube having the maximum number of water molecules being retained within the core with the largest residence times. The presence of methyl or methylene groups along the suspended chain is observed to disrupt the formation of water chains with higher length and/or longer residence times. The importance of hydrogen bonding in forming these water chains is assessed in terms of the relaxations of different hydrogen bond correlation functions. For a given dimension of the hydrophobic nanopore, we thus obtain a scale comparing the ability of carboxylic, alcohol, and imidazole groups in controlling the structure and dynamics of water in it. Our results also suggest that SWCNTs of varying lengths, endohedrally functionalized with Asp- and Glu-like sidechains, may be used as design templates in CNT-based water storage devices.
DNA-Templated Polymerization of Side-Chain-Functionalized Peptide Nucleic Acid Aldehydes
Kleiner, Ralph E.; Brudno, Yevgeny; Birnbaum, Michael E.; Liu, David R.
2009-01-01
The DNA-templated polymerization of synthetic building blocks provides a potential route to the laboratory evolution of sequence-defined polymers with structures and properties not necessarily limited to those of natural biopolymers. We previously reported the efficient and sequence-specific DNA-templated polymerization of peptide nucleic acid (PNA) aldehydes. Here, we report the enzyme-free, DNA-templated polymerization of side-chain-functionalized PNA tetramer and pentamer aldehydes. We observed that the polymerization of tetramer and pentamer PNA building blocks with a single lysine-based side chain at various positions in the building block could proceed efficiently and sequence-specifically. In addition, DNA-templated polymerization also proceeded efficiently and in a sequence-specific manner with pentamer PNA aldehydes containing two or three lysine side chains in a single building block to generate more densely functionalized polymers. To further our understanding of side-chain compatibility and expand the capabilities of this system, we also examined the polymerization efficiencies of 20 pentamer building blocks each containing one of five different side-chain groups and four different side-chain regio- and stereochemistries. Polymerization reactions were efficient for all five different side-chain groups and for three of the four combinations of side-chain regio- and stereochemistries. Differences in the efficiency and initial rate of polymerization correlate with the apparent melting temperature of each building block, which is dependent on side-chain regio- and stereochemistry, but relatively insensitive to side-chain structure among the substrates tested. Our findings represent a significant step towards the evolution of sequence-defined synthetic polymers and also demonstrate that enzyme-free nucleic acid-templated polymerization can occur efficiently using substrates with a wide range of side-chain structures, functionalization positions within each building block, and functionalization densities. PMID:18341334
Heron, Stuart R; Woby, Steve R; Thompson, Dave P
2017-06-01
To assess the efficacy of three different exercise programmes in treating rotator cuff tendinopathy/shoulder impingement syndrome. Parallel group randomised clinical trial. Two out-patient NHS physiotherapy departments in Manchester, United Kingdom. 120 patients with shoulder pain of at least three months duration. Pain was reproduced on stressing the rotator cuff and participants had full passive range of movement at the shoulder. Three dynamic rotator cuff loading programmes; open chain resisted band exercises (OC) closed chain exercises (CC) and minimally loaded range of movement exercises (ROM). Change in Shoulder Pain and Disability Index (SPADI) score and the proportion of patients making a Minimally Clinically Important Change (MCIC) in symptoms 6 weeks after commencing treatment. All three programmes resulted in significant decreases in SPADI score, however there were no significant differences between the groups. Participants making a MCIC in symptoms were similar across all groups, however more participants deteriorated in the ROM group. Dropout rate was higher in the CC group, but when only patients completing treatment were considered more patients in the CC group made a meaningful reduction in pain and disability. Open chain, closed chain and range of movement exercises all seem to be effective in bringing about short term changes in pain and disability in patients with rotator cuff tendinopathy. ISRCTN76701121. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.
Hou, Lei; Wu, Peiyi
2016-06-21
Turbidity, DLS and FTIR measurements in combination with the perturbation correlation moving window (PCMW) technique and 2D correlation spectroscopy (2Dcos) analysis have been utilized to investigate the LCST-type transition of a oligo ethylene glycol acrylate-based copolymer (POEGA) in aqueous solutions in this work. As demonstrated in turbidity and DLS curves, the macroscopic phase separation was sharp and slightly concentration dependent. Moreover, individual chemical groups along polymer chains also display abrupt changes in temperature-variable IR spectra. However, according to conventional IR analysis, the C-H groups present obvious dehydration, whereas C[double bond, length as m-dash]O and C-O-C groups exhibit anomalous "forced hydration" during the steep phase transition. From these analyses together with the PCMW and 2Dcos results, it has been confirmed that the hydrophobic interaction among polymer chains drove the chain collapse and dominated the phase transition. In addition, the unexpected enhanced hydration behavior of C[double bond, length as m-dash]O and C-O-C groups was induced by forced hydrogen bonding between polar groups along polymer chains and entrapped water molecules in the aggregates, which originated from the special chemical structure of POEGA.
NASA Astrophysics Data System (ADS)
Komarova, A. O.; Shashkov, M. V.; Sidel'nikov, V. N.
2017-11-01
Capillary columns based on a number of thermostable polysiloxane-silarylene motionless phases are prepared and their properties are studied. Three polymers with different contents of methyl and phenyl groups are synthesized: dimethylsiloxanesilarylene (DMS), methylphenylsiloxanesilarylene (MPhS), and diphenylsiloxanesilarylene (DPhS). Studies of their thermostability show that the level of the background current of these columns upon heating to 350°C is several times lower than that of a column based on polydimethylsiloxane. Based on McReynolds' studies of polarity and Abraham's studies of the selectivity of prepared columns according to the parameters of intermolecular interactions, it is found that silarylene MLPs are more affected by the contributions from specific interactions (especially for dipole-dipole, π-π-, and n-π-interactions) than MLPs with no phenylene inserts. The effect on the selectivity of a phenyl group inside a chain differs from the one produced by the phenyl groups in side MLP chains. The effect on the selectivity of a phenyl group inside a chain differs from the one produced by the phenyl groups in side MLP chains. Examples of the separation of test mixtures of aromatic and oxygen-containing compounds are obtained, along with an extract of thistle oil containing tocopherols and phytosterols at a final temperature of analysis of 350°C.
Methods for Equating Mental Tests.
1984-11-01
1983) compared conventional and IRT methods for equating the Test of English as a Foreign Language ( TOEFL ) after chaining. Three conventional and...three IRT equating methods were examined in this study; two sections of TOEFL were each (separately) equated. The IRT methods included the following: (a...group. A separate base form was established for each of the six equating methods. Instead of equating the base-form TOEFL to itself, the last (eighth
Exploring new packaging and delivery options for the immunization supply chain.
Zehrung, Darin; Jarrahian, Courtney; Giersing, Birgitte; Kristensen, Debra
2017-04-19
A variety of vaccine packaging and delivery technologies may benefit the immunization supply chain. These include alternative primary packaging, such as blow-fill-seal polymer containers, and novel delivery technologies, such intradermal delivery devices, microarray patches, and sublingual formulations of vaccines, and others in development. The potential timeline to availability of these technologies varies and depends on their stage of development and the type of data necessary to achieve licensure. Some new delivery devices are anticipated to be introduced in 2017, such as intradermal devices for delivery of inactivated poliovirus vaccine to stretch vaccine supplies due to a supply limitation. Other new technologies requiring vaccine reformulation, such as microarray patches and sublingual vaccines, may become available in the long term (2021 and beyond). Development of many new technologies requires partnership between vaccine and technology manufacturers and identification of the applicable regulatory pathway. Interaction with public-sector stakeholders early on (through engagement with forums such as the World Health Organization's Immunization Practices Advisory Committee Delivery Technologies Working Group) is important to ensure suitability for immunization program use. Key considerations for programmatic suitability of a new vaccine, packaging, and delivery device include cold chain volume, costs, and health impact. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Lonoctocog Alfa: A Review in Haemophilia A.
Al-Salama, Zaina T; Scott, Lesley J
2017-10-01
Lonoctocog alfa (rVIII-SingleChain; Afstyla ® ) is a novel single-chain recombinant factor VIII (FVIII) molecule, with a truncated B-domain and the heavy and light chains covalently linked to form a stable and homogenous drug that binds with high affinity to von Willebrand factor (VWF). Intravenous lonoctocog alfa is approved for the prophylaxis and treatment of bleeding in patients with haemophilia A in several countries worldwide. In two pivotal, multicentre trials, lonoctocog alfa was effective in the treatment of bleeding episodes and as prophylaxis, including for perioperative management in adults, adolescents and children. In terms of haemostatic efficacy in controlling bleeding episodes, overall treatment and investigator-assessed success rates were high across all age groups, with the majority of these bleeds controlled with a single injection of lonoctocog alfa. Low median spontaneous, overall and traumatic annualized bleeding rates were evident with prophylactic lonoctocog alfa regimens in both trials. Lonoctocog alfa was generally well-tolerated, with very low rates of injection-site reactions. No previously treated patient experienced an anaphylactic reaction or developed an inhibitor. In conclusion, lonoctocog alfa is an effective and generally well-tolerated alternative to conventional FVIII products for the treatment and prophylaxis of bleeding, including in the surgical setting, in adults, adolescents and children with haemophilia A.
Grouping patients for masseter muscle genotype-phenotype studies.
Moawad, Hadwah Abdelmatloub; Sinanan, Andrea C M; Lewis, Mark P; Hunt, Nigel P
2012-03-01
To use various facial classifications, including either/both vertical and horizontal facial criteria, to assess their effects on the interpretation of masseter muscle (MM) gene expression. Fresh MM biopsies were obtained from 29 patients (age, 16-36 years) with various facial phenotypes. Based on clinical and cephalometric analysis, patients were grouped using three different classifications: (1) basic vertical, (2) basic horizontal, and (3) combined vertical and horizontal. Gene expression levels of the myosin heavy chain genes MYH1, MYH2, MYH3, MYH6, MYH7, and MYH8 were recorded using quantitative reverse transcriptase polymerase chain reaction (RT-PCR) and were related to the various classifications. The significance level for statistical analysis was set at P ≤ .05. Using classification 1, none of the MYH genes were found to be significantly different between long face (LF) patients and the average vertical group. Using classification 2, MYH3, MYH6, and MYH7 genes were found to be significantly upregulated in retrognathic patients compared with prognathic and average horizontal groups. Using classification 3, only the MYH7 gene was found to be significantly upregulated in retrognathic LF compared with prognathic LF, prognathic average vertical faces, and average vertical and horizontal groups. The use of basic vertical or basic horizontal facial classifications may not be sufficient for genetics-based studies of facial phenotypes. Prognathic and retrognathic facial phenotypes have different MM gene expressions; therefore, it is not recommended to combine them into one single group, even though they may have a similar vertical facial phenotype.
Li, Kelei; Wu, Kejian; Zhao, Yimin; Huang, Tao; Lou, Dajun; Yu, Xiaomei; Li, Duo
2015-08-26
The present case-control study explored the interaction between marine-derived n-3 long chain polyunsaturated fatty acids (n-3 LC PUFAs) and uric acid (UA) on glucose metabolism and risk of type 2 diabetes mellitus (T2DM). Two hundred and eleven healthy subjects in control group and 268 T2DM subjects in case group were included. Plasma phospholipid (PL) fatty acids and biochemical parameters were detected by standard methods. Plasma PL C22:6n-3 was significantly lower in case group than in control group, and was negatively correlated with fasting glucose (r = -0.177, p < 0.001). Higher plasma PL C22:6n-3 was associated with lower risk of T2DM, and the OR was 0.32 (95% confidence interval (CI), 0.12 to 0.80; p = 0.016) for per unit increase of C22:6n-3. UA was significantly lower in case group than in control group. UA was positively correlated with fasting glucose in healthy subjects, but this correlation became negative in T2DM subjects. A significant interaction was observed between C22:6n-3 and UA on fasting glucose (p for interaction = 0.005): the lowering effect of C22:6n-3 was only significant in subjects with a lower level of UA. In conclusion, C22:6n-3 interacts with UA to modulate glucose metabolism.
Three-Dimensional Polypeptide Architectures Through Tandem Catalysis and Click Chemistry
NASA Astrophysics Data System (ADS)
Rhodes, Allison Jane
Rapid renal clearance, liver accumulation, proteolytic degradation and non-specificity are challenges small molecule drugs, peptides, proteins and nucleic acid therapeutics encounter en route to their intended destination within the body. Nanocarriers (i.e. dendritric polymers, vesicles, and micelles) of approximately 100 nm in diameter, shuttle small molecule drugs to their desired location through passive (EPR effect) and active (ligand-mediated) targeting, maximizing therapeutic efficiency. Polypeptide-based polymers are water-soluble, biocompatible, non-toxic and are therefore excellent candidates for nanocarriers. Dendritic polymers, including dendrimers, cylindrical brushes, and star polymers, are the newest class of nanomedicine drug delivery vehicles. The synthesis and characterization of dendritic polymers is challenging, with tedious and costly procedures. Dendritic polymers possess peripheral pendent functional groups that can potentially be used in ligand-mediated drug delivery vehicles and bioimaging applications. More specifically, cylindrical brushes are dendritic polymers where a single linear polymer (primary chain) has polymer chains (secondary chains) grafted to it. Recently, research groups have shown that cylindrical brush polymers are capable of nanoparticle and supramolecular structure self-assembly. The facile preparation of high-density brush copolypeptides by the "grafting from" approach will be discussed. This approach utilizes a novel, tandem catalytic methodology where alloc-alpha-aminoamide groups are installed within the side-chains of the alpha-amino-N-carboxyanhydride (NCA) monomer serving as masked initiators. These groups are inert during cobalt initiated NCA polymerization, and give alloc-alpha-aminoamide substituted polypeptide main-chains. The alloc-alpha-aminoamide groups are activated in situ using nickel to generate initiators for growth of side-chain brush segments. This method proves to be efficient, yielding well-defined, high-density brushes for applications in drug delivery and imaging. Here, we also report a method for the synthesis of soluble, well-defined, azido functionalized polypeptides in a straightforward, 3-step synthesis. Homo and diblock azidopolypeptides were prepared with controlled segment lengths via living polymerization using Co(PMe3)4 initiator. Through copper azide alkyne click chemistry (CuAAC) in organic solvent, azidopolypeptides were regioselectively and quantitatively modified with carboxylic acid (pH-responsive), amino acid and sugar functional groups. Finally, the advances towards well-defined hyperbranched polypeptides through alpha-amino-acid-N-thiocarboxyanhydrides (NTAs) will be discussed. Within the past 10 years, controlled NCA (alpha-amino acid-N-carboxyanhydride) ring-opening polymerization (ROP) has emerged, expanding the application of copolypeptide polymers in various drug delivery and tissue engineering motifs. Modification of NCA monomers to the corresponding alpha-amino-acid-N-thiocarboxyanhydride (NTA) will diversify ROP reactions, leading to more complex polypeptides (such as hyperbranched polymers), in addition to the possibility of performing these polymerizations under ambient conditions, which would greatly expand their potential utility. The project focuses on the preparation of hyperbranched polypeptides with well-defined architectures and controlled branching density in a one-pot reaction. This will be accomplished by taking advantage of the different selectivities of Co(PMe3)4 and depeNi(COD) polymerization initiators, and by exploiting the reactivity difference between NCA and the more stable NTA monomers.
42 CFR 421.404 - Assignment of providers and suppliers to MACs.
Code of Federal Regulations, 2012 CFR
2012-10-01
... section— Chain provider means a group of two or more providers under common ownership or control. Common..., prosthetics, orthotics, and supplies (DMEPOS) means the types of services specified in § 421.210(b). Eligible....202 of this chapter. Qualified chain provider means a chain provider comprised of— (1) 10 or more...
42 CFR 421.404 - Assignment of providers and suppliers to MACs.
Code of Federal Regulations, 2014 CFR
2014-10-01
... section— Chain provider means a group of two or more providers under common ownership or control. Common..., prosthetics, orthotics, and supplies (DMEPOS) means the types of services specified in § 421.210(b). Eligible....202 of this chapter. Qualified chain provider means a chain provider comprised of— (1) 10 or more...
42 CFR 421.404 - Assignment of providers and suppliers to MACs.
Code of Federal Regulations, 2013 CFR
2013-10-01
... section— Chain provider means a group of two or more providers under common ownership or control. Common..., prosthetics, orthotics, and supplies (DMEPOS) means the types of services specified in § 421.210(b). Eligible....202 of this chapter. Qualified chain provider means a chain provider comprised of— (1) 10 or more...
78 FR 3031 - Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-15
... PRINTING SYSTEMS (PPS), SUPPLY CHAIN OPERATIONS (FORMERLY KNOWN AS IWS), VANCOUVER, WA. In accordance with... Services (IWS) and Supply Chain Operations (formerly known as IWS) units. The workers within PPS (both... Group, Vancouver, Washington (TA-W-81,739A), and H-P, PPS, Supply Chain Operations, Vancouver...
42 CFR 421.404 - Assignment of providers and suppliers to MACs.
Code of Federal Regulations, 2010 CFR
2010-10-01
...— Chain provider means a group of two or more providers under common ownership or control. Common control..., prosthetics, orthotics, and supplies (DMEPOS) means the types of services specified in § 421.210(b). Eligible....202 of this chapter. Qualified chain provider means a chain provider comprised of— (1) 10 or more...
42 CFR 421.404 - Assignment of providers and suppliers to MACs.
Code of Federal Regulations, 2011 CFR
2011-10-01
...— Chain provider means a group of two or more providers under common ownership or control. Common control..., prosthetics, orthotics, and supplies (DMEPOS) means the types of services specified in § 421.210(b). Eligible....202 of this chapter. Qualified chain provider means a chain provider comprised of— (1) 10 or more...
Electron tunneling through covalent and noncovalent pathways in proteins
NASA Technical Reports Server (NTRS)
Beratan, David N.; Onuchic, Jose Nelson; Hopfield, J. J.
1987-01-01
A model is presented for electron tunneling in proteins which allows the donor-acceptor interaction to be mediated by the covalent bonds between amino acids and noncovalent contacts between amino acid chains. The important tunneling pathways are predicted to include mostly bonded groups with less favorable nonbonded interactions being important when the through bond pathway is prohibitively long. In some cases, vibrational motion of nonbonded groups along the tunneling pathway strongly influences the temperature dependence of the rate. Quantitative estimates for the sizes of these noncovalent interactions are made and their role in protein mediated electron transport is discussed.
Zhao, Hongxia; Liu, Jiaping; Ran, Qianping; Yang, Yong; Shu, Xin
2017-03-01
Comb-like polycarboxylate ether (PCE) molecules with different content of methyl groups substituted on backbone and different location of methyl groups substituted on the side chains, respectively, were designed and were studied in explicit salt solutions by all-atom molecular dynamics simulations. Methyl groups substituted on the backbone of PCE have a great effect on the conformation of PCE. Stiffness of charged backbone was not only affected by the rotational freedom but also the electrostatic repulsion between the charged COO - groups. The interaction of counterions (Na + ) with COO - groups for PCE3 (with part of AA substituted by MAA on the backbone) was stronger and the screen effect was great, which decided the smaller size of PCE3. The interaction between water and COO - groups was strong regardless of the content of AA substituted by MAA on the backbone. The effect of methyl groups substituted on the different location of side chains on the conformation of PCE was less than that of methyl groups substituted on the backbone. The equilibrium sizes of the four PCE molecules with methyl groups substituted on the side chains were similar. Graphical Abstract Effect of methyl groups on conformational properties of small ionized comb-like polyelectrolytes at the atomic level.
SYSTEMATIC THEORETICAL STUDY ON THE INTERSTELLAR CARBON CHAIN MOLECULES
DOE Office of Scientific and Technical Information (OSTI.GOV)
Etim, Emmanuel E.; Arunan, Elangannan; Gorai, Prasanta
2016-12-01
In an effort to further our interest in understanding the basic chemistry of interstellar molecules, here we carry out an extensive investigation of the stabilities of interstellar carbon chains; C{sub n}, H{sub 2}C{sub n}, HC{sub n}N and C{sub n}X (X = N, O, Si, S, H, P, H{sup −}, N{sup −}). These sets of molecules account for about 20% of all the known interstellar and circumstellar molecules. Their high abundances, therefore, demand serious attention. High-level ab initio quantum chemical calculations are employed to accurately estimate the enthalpy of formation, chemical reactivity indices, global hardness and softness, and other chemical parametersmore » of these molecules. Chemical modeling of the abundances of these molecular species has also been performed. Of the 89 molecules considered from these groups, 47 have been astronomically observed, and these observed molecules are found to be more stable with respect to other members of the group. Of the 47 observed molecules, 60% are odd-numbered carbon chains. Interstellar chemistry is not actually driven by thermodynamics, but it is primarily dependent on various kinetic parameters. However, we found that the detectability of the odd-numbered carbon chains could be correlated due to the fact that they are more stable than the corresponding even-numbered carbon chains. Based on this aspect, the next possible carbon chain molecule for astronomical observation in each group is proposed. The effect of kinetics in the formation of some of these carbon chain molecules is also discussed.« less
Acute effects of different dynamic exercises on hamstring strain risk factors.
Chen, Che Hsiu; Xin, Ye; Lee, Kuang Wu; Lin, Ming Ju; Lin, Jiu Jenq
2018-01-01
The purpose of the study was to examine the acute effects of different dynamic exercise interventions on hamstring muscle performance. Thirty-six young men with poor hamstring flexibility were randomly assigned to three intervention groups: jogging combined with dynamic open kinetic chain stretching (DS), jogging combined with dynamic closed kinetic chain stretching (lunge with eccentric hamstring windmills, LEC), and jogging only (CON) groups. Hamstring flexibility, muscle stiffness (area under the curve, AUC), joint position sense (JPS), maximal eccentric strength (ECC), and angle of peak torque (APT) were recorded before and immediately after the exercise interventions. The results showed that the hamstring flexibility increased in DS (p < 0.001); muscle stiffness decreased in DS and was lower than jogging (p < 0.001). Moreover, ECC increased in LEC and was higher than jogging and DS (p < 0.001). APT was different among 3 groups (p < 0.001). Decreased accuracy of JPS was found in DS and jogging (p < 0.001). In conclusion, the dynamic closed kinetic chain stretching (LEC) as compared to open kinetic chain stretching (DS) or jogging group, may be an effective technique to enhance muscle performance during the pre-competition warm-up routine.
Acute effects of different dynamic exercises on hamstring strain risk factors
Xin, Ye; Lee, Kuang Wu; Lin, Ming Ju
2018-01-01
The purpose of the study was to examine the acute effects of different dynamic exercise interventions on hamstring muscle performance. Thirty-six young men with poor hamstring flexibility were randomly assigned to three intervention groups: jogging combined with dynamic open kinetic chain stretching (DS), jogging combined with dynamic closed kinetic chain stretching (lunge with eccentric hamstring windmills, LEC), and jogging only (CON) groups. Hamstring flexibility, muscle stiffness (area under the curve, AUC), joint position sense (JPS), maximal eccentric strength (ECC), and angle of peak torque (APT) were recorded before and immediately after the exercise interventions. The results showed that the hamstring flexibility increased in DS (p < 0.001); muscle stiffness decreased in DS and was lower than jogging (p < 0.001). Moreover, ECC increased in LEC and was higher than jogging and DS (p < 0.001). APT was different among 3 groups (p < 0.001). Decreased accuracy of JPS was found in DS and jogging (p < 0.001). In conclusion, the dynamic closed kinetic chain stretching (LEC) as compared to open kinetic chain stretching (DS) or jogging group, may be an effective technique to enhance muscle performance during the pre-competition warm-up routine. PMID:29390001
Said, Ahmed M; Hangauer, David G
2015-01-01
One of the underappreciated non-covalent binding factors, which can significantly affect ligand-protein binding affinity, is the cooperativity between ligand functional groups. Using four different series of thrombin inhibitors, we reveal a strong positive cooperativity between an H-bond accepting carbonyl functionality and the adjacent P3 hydrophobic side chain. Adding an H-bond donating amine adjacent to the P3 hydrophobic side chain further increases this positive cooperativity thereby improving the Ki by as much as 546-fold. In contrast, adding an amidine multiple H-bond/salt bridge group in the distal S1 pocket does not affect this cooperativity. An analysis of the crystallographic B-factors of the ligand groups inside the binding site indicates that the strong cooperativity is mainly due to a significant mutual reduction in the residual mobility of the hydrophobic side chain and the H-bonding functionalities that is absent when the separation distance is large. This type of cooperativity is important to encode in binding affinity prediction software, and to consider in SAR studies. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Triplet Transport to and Trapping by Acceptor End Groups on Conjugated Polyfluorene Chains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sreearunothai, P.; Miller, J.; Estrada, A.
2011-08-31
Triplet excited states created in polyfluorene (pF) molecules having average lengths up to 170 repeat units were transported to and captured by trap groups at the ends in less {approx}40 ns. Almost all of the triplets attached to the chains reached the trap groups, ruling out the presence of substantial numbers of defects that prevent transport. The transport yields a diffusion coefficient D of at least 3 x 10{sup -4} cm{sup 2} s{sup -1}, which is 30 times typical molecular diffusion and close to a value for triplet transport reported by Keller (J. Am. Chem. Soc.2011, 133, 11289-11298). The tripletmore » states were created in solution by pulse radiolysis; time resolution was limited by the rate of attachment of triplets to the pF chains. Naphthylimide (NI) or anthraquinone (AQ) groups attached to the ends of the chains acted as traps for the triplets, although AQ would not have been expected to serve as a trap on the basis of triplet energies of the separate molecules. The depths of the NI and AQ triplet traps were determined by intermolecular triplet transfer equilibria and temperature dependence. The trap depths are shallow, just a few times thermal energy for both, so a small fraction of the triplets reside in the pF chains in equilibrium with the end-trapped triplets. Trapping by AQ appears to arise from charge transfer interactions between the pF chains and the electron-accepting AQ groups. Absorption bands of the end-trapped triplet states are similar in peak wavelength (760 nm) and shape to the 760 nm bands of triplets in the pF chains but have reduced intensities. When an electron donor, N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD), is added to the solution, it reacts with the end-trapped triplets to remove the 760 nm bands and to make the trapping irreversible. New bands created upon reaction with TMPD may be due to charge transfer states.« less
NASA Astrophysics Data System (ADS)
Pichierri, Fabio
2014-08-01
Using density functional theory (DFT) we design two novel chain molecules containing a left-handed (thia)helicene unit connected to a right-handed (thia)helicene unit via a phosphoroussbnd phosphorous (Psbnd P) bond. These chains represent the molecular analogs of the novel hemihelix structure recently discovered by a group of Harvard University scientists. The HOMO and LUMO levels of the heterochiral chains, termed hemihelicenes, are localized on the left- and right-handed blocks, respectively. In contrast, the frontier orbitals of the chains containing homochiral (thia)helicenes connected by a Psbnd P bond are delocalized all over the chain.
Shang, Kuo-Chung; Lu, Chin-Shan; Li, Shaorui
2010-05-01
This study investigated crucial green supply chain management (GSCM) capability dimensions and firm performance based on electronics-related manufacturing firms in Taiwan. On the basis of a factor analysis, six green supply chain management dimensions were identified: green manufacturing and packaging, environmental participation, green marketing, green suppliers, green stock, and green eco-design. According to their factor scores in the GSCM dimensions, a cluster analysis subsequently assigned responding firms into four groups, namely, the weak GSCM oriented group, the green marketing oriented group, the green supplier oriented group, and the green stock oriented group. Differences in firm performance and GSCM dimensions among groups were examined. Results indicated that the green marketing oriented group performed best. Based on the resource-based view (RBV), the capability of the green marketing oriented group was considered to be the deployment of a collection of resources that enables it to successfully compete against rivals. The importance of green marketing as a GSCM capability and strategic asset/critical resources for electronics-related manufacturing firms to obtain a competitive edge is therefore highlighted in this study. Copyright 2010 Elsevier Ltd. All rights reserved.
Bhukal, Ishwar; Thimmarayan, Gokul; Bala, Indu; Solanki, Sohan Lal; Samra, Tanvir
2014-11-01
Significant increase in serum triglyceride (ST) concentration have been described in adult population after prolonged administration of propofol formulation containing long chain triglyceride (LCT). Though, medium chain triglyceride-LCT (MCT-LCT) propofol when compared with LCT propofol for long-term sedation in adults resulted in identical triglyceride levels, the elimination of triglyceride was faster in patients administered MCT-LCT propofol. A total of 40 children were randomized into two groups of 20 each; Group I were induced with 1% LCT propofol (3 mg/kg) and Group II with 1% medium and LCT propofol and maintained with descalating dose of 20.15 and 10 mg/kg/h at 10 min intervals. Blood samples for ST concentration were obtained before induction of anesthesia, at the end of propofol infusion and 4 h after terminating propofol infusion. ST levels were raised significantly above the basal values in both the groups but the rise was significantly higher in Group I (P < 0.05). Four hours after stopping propofol infusion the triglyceride levels were similar to the basal values in Group II, whereas in Group I the values were significantly greater than the baseline (P < 0.05) as well as those of Group II (P < 0.05). No clinically significant adverse effect of hypertriglyceridemia was observed. Even short term anesthesia with LCT and MCT-LCT propofol (1%) leads to elevated ST levels. The increase in ST levels is less with MCT-LCT propofol and elimination of triglyceride is also rapid after terminating MCT-LCT propofol infusion.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Middleton, L. Robert; Tarver, Jacob D.; Cordaro, Joseph
Melt state dynamics for a series of strictly linear polyethylenes with precisely spaced associating functional groups were investigated. The periodic pendant acrylic acid groups form hydrogen-bonded acid aggregates within the polyethylene (PE) matrix. The dynamics of these nanoscale heterogeneous morphologies were investigated from picosecond to nanosecond timescales by both quasi-elastic neutron scattering (QENS) measurements and fully atomistic molecular dynamics (MD) simulations. Two dynamic processes were observed. The faster dynamic processes which occur at the picosecond timescales are compositionally insensitive and indicative of spatially restricted local motions. The slower dynamic processes are highly composition dependent and indicate the structural relaxation ofmore » the polymer backbone. Higher acid contents, or shorter PE spacers between pendant acid groups, slow the structural relaxation timescale and increase the stretching parameter (β) of the structural relaxation. Additionally, the dynamics of specific hydrogen atom positions along the backbone correlate structural heterogeneity imposed by the associating acid groups with a mobility gradient along the polymer backbone. At time intervals (<2 ns), the mean-squared displacements for the four methylene groups closest to the acid groups are up to 10 times smaller than those of methylene groups further from the acid groups. At longer timescales acid aggregates rearrange and the chain dynamics of the slow, near-aggregate regions and the faster bridge regions converge, implying a characteristic timescale for the passage of chains between aggregates. As a result, the characterization of the nanoscale chain dynamics in these associating polymer systems both provides validation of simulation force fields and provides understanding of heterogeneous chain dynamics in associating polymers.« less
The effect of knee extensor open kinetic chain resistance training in the ACL-injured knee.
Barcellona, Massimo G; Morrissey, Matthew C; Milligan, Peter; Clinton, Melissa; Amis, Andrew A
2015-11-01
To investigate the effect of different loads of knee extensor open kinetic chain resistance training on anterior knee laxity and function in the ACL-injured (ACLI) knee. Fifty-eight ACLI subjects were randomised to one of three (12-week duration) training groups. The STAND group trained according to a standardised rehabilitation protocol. Subjects in the LOW and HIGH group trained as did the STAND group but with the addition of seated knee extensor open kinetic chain resistance training at loads of 2 sets of 20 repetition maximum (RM) and 20 sets of 2RM, respectively. Anterior knee laxity and measurements of physical and subjective function were performed at baseline, 6 and 12 weeks. Thirty-six subjects were tested at both baseline and 12 weeks (STAND n = 13, LOW n = 11, HIGH n = 12). The LOW group demonstrated a reduction in 133 N anterior knee laxity between baseline and 12 weeks testing when compared to the HIGH and the STAND groups (p = 0.009). Specifically, the trained-untrained knee laxity decreased an average of approximately 5 mm in the LOW group while remaining the same in the other two groups. Twelve weeks of knee extensor open kinetic chain resistance training at loads of 2 sets of 20RM led to a reduction in anterior knee laxity in the ACLI knee. This reduction in laxity does not appear to offer any significant short-term functional advantages when compared to a standard rehabilitation protocol. These results indicate that knee laxity can be decreased with resistance training of the thigh muscles. Randomised controlled trial, Level II.
Don't break the chain: importance of supply chain management in the operating room setting.
Bilyk, Candis
2008-09-01
Management of supplies within the operating room (OR) has considerable implications for decreasing healthcare costs while maintaining high-quality patient care. This area of healthcare therefore requires more monitoring by end-users including OR management, physicians, and nursing staff. This article is based on understanding supply chain management in the OR setting. Information provided throughout the article can be applied to small or large health care centers. It defines supply chain management and contains a brief overview of supply chain processes. It reviews the benefits of following these processes. The article also includes recommendations for improving the supply chain in the OR.
Nancy You, Yi-Qian; Ling, Pei-Ra; Qu, Jason Zhensheng; Bistrian, Bruce R.
2011-01-01
Background Fatty acid absorption patterns can have a major impact on the fatty acid composition in the portal, intestinal lymph, and systemic circulation. This study sought to determine the effects of long-chain triglycerides (LCT), medium-chain triglycerides (MCT), and 2-monododecanoin (2mono) on intestinal fatty acid composition during continuous feeding over a brief period. Methods The lipid sources were 100% LCT, 100% MCT, a 50:50 mixture of LCT and MCT (LCT/MCT), and a 50:50 mixture of LCT and 2mono (LCT/2mono). A total of 27 rats were randomly given 1 of the 4 diets at 200 kcal/kg/d, with 30% of total calories from lipids over 3 hours. Results MCT significantly increased each of the medium-chain fatty acids (C6:0, C8:0, and C10:0) as free fatty acids in the portal vein and about 10%/mol of C10:0 as triglycerides in the lymph compared with the other groups. There was significantly less C10:0 in lymphatic triglycerides with LCT/MCT than with MCT, but more than in the LCT and LCT/2mono diets. MCT also significantly increased the contents of C16:0, C18:0, C18:1, and C20:4 in the lymphatic triglycerides compared with all other groups including LCT/MCT. The amount of linoleic acid (C18:2) in lymphatic triglycerides followed the relative amounts of this fatty acid in the diet, with the greatest in LCT followed by LCT/MCT and LCT/2mono and least in MCT. A so-called structured lipid composed of the medium-chain fatty acid dodecanoic acid on the 2 position and long-chain fatty acids on the 1 and 3 positions appeared to be endogenously synthesized in response to the LCT/2mono diet. Conclusions The original differences in MCT and LCT content in the diets were preserved in the fatty acid composition in the intestinal free fatty acids and triglycerides during feeding. In addition, the duration of lipid administration can play a role in altering fatty acid composition in the intestine. PMID:18407910
A hybrid approach for integrated healthcare cooperative purchasing and supply chain configuration.
Rego, Nazaré; Claro, João; Pinho de Sousa, Jorge
2014-12-01
This paper presents an innovative and flexible approach for recommending the number, size and composition of purchasing groups, for a set of hospitals willing to cooperate, while minimising their shared supply chain costs. This approach makes the financial impact of the various cooperation alternatives transparent to the group and the individual participants, opening way to a negotiation process concerning the allocation of the cooperation costs and gains. The approach was developed around a hybrid Variable Neighbourhood Search (VNS)/Tabu Search metaheuristic, resulting in a flexible tool that can be applied to purchasing groups with different characteristics, namely different operative and market circumstances, and to supply chains with different topologies and atypical cost characteristics. Preliminary computational results show the potential of the approach in solving a broad range of problems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cowan, D.S.; Panicucci, R.; McClelland, R.A.
The nitroimidazole-linked phenanthridine series of compounds (NLP-1, 2, and 3) were synthesized under the assumption that it should be possible to enhance the molar efficiency of 2-nitroimidazoles as hypoxic cell radiosensitizers and cytotoxins by targeting them to their likely site of action, DNA. The targeting group chosen was the phenanthridine moiety, the major component of the classical DNA intercalating compound, ethidium bromide. The sole difference between the compounds is the length of the hydrocarbon chain linking the nitroimidazole to the phenanthridine. The phenanthridine group with a three-carbon side chain, P-1, was also synthesized to allow studies on the effect ofmore » the targeting group by itself. The ability of the compounds to bind to DNA is inversely proportional to their linker chain length with binding constant values ranging from approximately 1 {times} 10(5) mol-1 for NLP-2 to 6 {times} 10(5) mol-1 for NLP-3. The NLP compounds show selective toxicity to hypoxic cells at 37 degrees C at external drug concentrations 10-40 times lower than would be required for untargeted 2-nitroimidazoles such as misonidazole in vitro. Toxicity to both hypoxic and aerobic cells is dependent on the linker chain: the shorter the chain, the greater the toxicity. In addition, the NLP compounds radiosensitize hypoxic cells at external drug concentrations as low as 0.05 mM with almost the full oxygen effect being observed at a concentration of 0.5 mM. These concentrations are 10-100 times lower than would be required for similar radiosensitization using misonidazole. Radiosensitizing ability is independent of linker chain length. The present compounds represent prototypes for further studies of the efficacy and mechanism of action of 2-nitroimidazoles targeted to DNA by linkage to an intercalating group.« less
Re-assessing the role of plant community change and climate in the PETM n-alkane record
NASA Astrophysics Data System (ADS)
Bush, R. T.; Baczynski, A. A.; McInerney, F. A.; Chen, D.
2012-12-01
The terrestrial leaf wax n-alkane record of the Paleocene-Eocene Thermal Maximum (PETM) in the Bighorn Basin, Wyoming, shows large excursions in both carbon isotope (δ13C) values and n-alkane average chain length (ACL). At the onset of the PETM, ACL values increase from ~28.5 to ~30.1 while the negative carbon isotope excursion (CIE) is 4-6‰ in magnitude and larger than δ13C records from other materials. It has been hypothesized previously that both the ACL excursion and the large magnitude of the CIE were caused by a concurrent turnover in the local flora from a mixed conifer/angiosperm community before the PETM to a different suite of angiosperm species during the PETM. Here, we present the results of a meta-analysis of data (>2000 data from 89 sources, both published and unpublished) on n-alkane amounts and chain length distributions in modern plants from around the world. We applied the data in two sets of comparisons: 1) within and among plant groups such as herbs and graminoids, and 2) between plants and climate, using reported collection locations for outdoor plants and climate values generated via GIS extraction of WorldClim modeled data. We show that angiosperms, as group, produce more n-alkanes than do gymnosperms by 1-2 orders of magnitude, and this means that the gymnosperm contribution to a mixed soil n-alkane pool would be negligible, even in an ecosystem where gymnosperms dominated (i.e. the pre/post-PETM ecosystems). The modern plant data also demonstrate that turnover of the plant community during the PETM, even among only the angiosperm species, is likely not the source of the observed ACL excursion. First, we constructed "representative" groups of PETM and pre/post-PETM communities using living relative species at the Chicago Botanic Garden and find no significant difference in chain length distributions between the two groups. Second and moreover, the modern plant data reveal that n-alkane chain length distributions are tremendously variable within large vascular plant groups--both functional groups such as woody plants or graminoids as well as phylogenetic groups at the family level or higher. This variability makes it difficult at best to use n-alkane chain lengths to distinguish one vascular group from another, as was previously suggested. Instead, our results suggest that chain length distributions and ACL are driven more by climate, especially temperature. Longer chain lengths, with their increased hydrophobicity, would likely experience favorable selection under warmer or drier conditions where leaf water loss is likely to be a greater stress. Thus, it may be that we can interpret the increase in ACL during the PETM as a direct response by the flora to increased temperature during the hyperthermal event, and n-alkane chain length distributions, properly constrained, may possibly serve as a qualitative paleotemperature proxy.
Donatini, Bruno
2014-01-01
This preliminary randomized study investigated the efficacy of medicinal mushrooms, Trametes versicolor (TV), Ganoderma lucidum (GL), and Laetiporus sulphureus (LS), on the clearance of oral human papillomavirus (HPV, serotypes 16 and 18). Among 472 patients who underwent oral swabs for gingivitis, 61 patients were positive for HPV16 or HPV18. Twenty patients were included in group 1 (LS) and 41 patients were included in group 2 (TV+GL) for 2 months. Polymerase chain reaction (PCR) for HPV was performed at inclusion and after 2 months. In group 1, the clearance was equal to 5% after 2 months of treatment. In group 2, the clearance was equal to 88% (P<0.001). The detection of HPV16 or HPV18 could become relevant in routine since positivity is frequent and because a harmless and costless treatment may exist. The use of TV+GL for the clearance of oral HPV deserves further investigation.
Novakova, Lenka; Axelsson, Markus; Malmeström, Clas; Imberg, Henrik; Elias, Olle; Zetterberg, Henrik; Nerman, Olle; Lycke, Jan
2018-01-01
Neurodegeneration occurs during the early stages of multiple sclerosis. It is an essential, devastating part of the pathophysiology. Tools for measuring the degree of neurodegeneration could improve diagnostics and patient characterization. This study aimed to determine the diagnostic value of biomarkers of degeneration in patients with recent clinical onset of suspected multiple sclerosis, and to evaluate these biomarkers for characterizing disease course. This cross-sectional study included 271 patients with clinical features of suspected multiple sclerosis onset and was the baseline of a prospective study. After diagnostic investigations, the patients were classified into the following disease groups: patients with clinically isolated syndrome (n = 4) or early relapsing remitting multiple sclerosis (early RRMS; n = 93); patients with relapsing remitting multiple sclerosis with disease durations ≥2 years (established RRMS; n = 39); patients without multiple sclerosis, but showing symptoms (symptomatic controls; n = 89); and patients diagnosed with other diseases (n = 46). In addition, we included healthy controls (n = 51) and patients with progressive multiple sclerosis (n = 23). We analyzed six biomarkers of neurodegeneration: cerebrospinal fluid neurofilament light chain levels; cerebral spinal fluid glial fibrillary acidic protein; cerebral spinal fluid tau; retinal nerve fiber layer thickness; macula volume; and the brain parenchymal fraction. Except for increased cerebral spinal fluid neurofilament light chain levels, median 670 ng/L (IQR 400-2110), we could not find signs of early degeneration in the early disease group with recent clinical onset. However, the intrathecal immunoglobin G production and cerebral spinal fluid neurofilament light chain levels showed diagnostic value. Moreover, elevated levels of cerebral spinal fluid glial fibrillary acidic protein, thin retinal nerve fiber layers, and low brain parenchymal fractions were associated with progressive disease, but not with the other phenotypes. Thin retinal nerve fiber layers and low brain parenchymal fractions, which indicated neurodegeneration, were associated with longer disease duration. In clinically suspected multiple sclerosis, intrathecal immunoglobin G production and neurofilament light chain levels had diagnostic value. Therefore, these biomarkers could be included in diagnostic work-ups for multiple sclerosis. We found that the thickness of the retinal nerve fiber layer and the brain parenchymal fraction were not different between individuals that were healthy, symptomatic, or newly diagnosed with multiple sclerosis. This finding suggested that neurodegeneration had not reached a significant magnitude in patients with a recent clinical onset of multiple sclerosis.
Chromatography of Penicillins, Penicilloates, and Penicilloylamides on Dextran Gels
Hyslop, Newton E.; Milligan, Richard J.
1974-01-01
The factors influencing the chromatographic behavior on dextran gels of penicillins and their derivatives were investigated by comparing elution profiles and partition coefficients (KD and KAV) of penicillins differing in side-chain structure and among penicillin derivatives of identical side-chain but different nuclear structure. Under the conditions of pH and ionic strength employed (pH 7.4, 0.145 M NaCl, 0.05 M PO4), side-chain adsorptive effects best explained the anomalous behavior of benzylpenicillin and of oxacillin and its chlorine-substituted analogues. Polar side-chain substituents, such as the amino group of ampicillin and the carboxyl group of carbenicillin, and cleavage of the β-lactam ring, exemplified by penicilloates and penicilloylamines, both appeared to interfere with side-chain-directed adsorption. The differential adsorption of penicillins and their derivatives to dextran gels is not only of theoretical interest relative to the mechanism of chromatography but of practical application to analytical and preparative procedures in penicillin chemistry. PMID:15825415
Effect of unsaturation on the absorption of ethane and ethylene in imidazolium-based ionic liquids.
Moura, Leila; Mishra, Manas; Bernales, Varinia; Fuentealba, Patricio; Padua, Agilio A H; Santini, Catherine C; Costa Gomes, Margarida F
2013-06-20
The influence of the presence of imidazolium side chain unsaturation on the solubility of ethane and ethylene was studied in three ionic liquids: 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)amide-saturated alkyl side-chain in the cation; 1-methyl-3-(buten-3-yl)imidazolium bis(trifluorosulfonyl)imide-double bond in the side-chain of the cation; and 1-methyl-3-benzylimidazolium bis(trifluorosulfonyl)imide-benzyl group in the side-chain of the cation. The solubility of both gases decreases when the side-chain of the cations is functionalized with an unsaturated group. This can be explained by a less favorable enthalpy of solvation. The difference of solubility between ethane and ethylene can be explained from a balance of enthalpic and entropic factors: for the ionic liquid with the saturated alkyl side-chain and the benzyl-substituted side-chain, it is the favorable entropy of solvation that explains the larger ethylene solubility, whereas in the case of the saturated side-chain, it is the more favorable enthalpy of solvation. Molecular simulation allowed the identification of the mechanisms of solvation and the preferential solvation sites for each gas in the different ionic liquids. Simulations have shown that the entropy of solvation is more favorable when the presence of the gas weakens the cation-anion interactions or when the gas can be solvated near different sites of the ionic liquid.
Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime
2014-01-01
ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331
Assessing cold chain status in a metro city of India: an intervention study.
Mallik, S; Mandal, P K; Chatterjee, C; Ghosh, P; Manna, N; Chakrabarty, D; Bagchi, S N; Dasgupta, S
2011-03-01
Cold chain maintenance is an essential activity to maintain the potency of vaccines and to prevent adverse events following immunization. One baseline study highlighted the unsatisfactory cold chain status in city of Kolkata in India. To assess the changes which occurred in the cold chain status after the intervention undertaken to improve the status and also to assess the awareness of the cold chain handlers regarding cold chain maintenance. Intervention consisted of reorganization of cold chain points and training of health manpower in Kolkata Municipal area regarding immunization and cold chain following the guidelines as laid by Govt of India. Reevaluation of cold chain status was done at 20 institutions selected by stratified systematic random sampling after the intervention. The results were compared with baseline survey. Significant improvement had been observed in correct placing of cold chain equipment, maintenance of stock security, orderly placing of ice packs, diluents and vaccines inside the equipment, temperature recording and maintenance. But awareness and skill of cold chain handlers regarding basics of cold chain maintenance was not satisfactory. The success of intervention included significant improvement of cold chain status including creation of a designated cold chain handler. The gaps lay in non-availability of non-electrical cold chain equipment and separate cold chain room, policy makers should stress. Cold chain handlers need reorientation training regarding heat & cold sensitive vaccines, preventive maintenance and correct contingency plan.
Medium-chain triglyceride feeding in premature infants: effects on calcium and magnesium absorption.
Tantibhedhyangkul, P; Hashim, S A
1978-04-01
The effect of medium-chain triglycerides (MCT) on the absorption of calcium and magnesium in premature infants was studied in 34 infants with birth weights lower than 2,000 gm. The infants were divided into three groups and fed three formulas similar in nutrient content except for the type of fat, as follows: group 1 (control): corn oil, oleo, and coconut oil (39:41:20); group 2: MCT, corn oil, and coconut oil (40:40:20); group 3: MCT and corn oil (80:20). The infants fed MCT-containing formulas absorbed significantly more calcium than the control group. Magnesium absorption was significantly increased in the 80% MCT group.
National supply-chain survey of drug manufacturer back orders.
Wellman, G S
2001-07-01
The impact of manufacturer back orders on the supply chain for pharmaceuticals in the institutional setting was studied. A questionnaire was distributed during May and June 2000 to 600 institutional pharmacies affiliated with a major national drug and supply group purchasing organization. The instrument included questions on basic institutional demographics, perceptions about the frequency of manufacturer back orders for pharmaceuticals, the quality of communication with manufacturers and wholesalers about back orders, the two most significant back orders that had occurred in the 12 months preceding the survey, and the reasons for and impact of back orders. A total of 170 usable surveys were returned (net response rate, 28.3%). Reported manufacturer back orders included an array of drug classes, including blood products, antimicrobials, antiarrhythmics, benzodiazepine antagonists, thrombolytics, corticosteroids, and antihypertensives. Respondents perceived significant back orders as increasing in frequency. Communication by manufacturers and wholesalers about back orders was reported to be relatively poor. A raw-material shortage was the most common reason given by manufacturers for back orders (36.5%), followed by a regulatory issue (23.2%). In most cases (92%), medical staff members had to be contacted, indicating an interruption in the normal drug distribution process. In over a third of instances, respondents stated that the back order resulted in less optimal therapy. A survey found that manufacturer back orders for pharmaceuticals were increasing in frequency and that information flow within the supply chain was insufficient to meet the needs of end users.
Huang, Long; Liu, Meiying; Mao, Liucheng; Huang, Qiang; Huang, Hongye; Wan, Qing; Tian, Jianwen; Wen, Yuanqing; Zhang, Xiaoyong; Wei, Yen
2017-12-01
As a new type of mesoporous silica materials with large pore diameter (pore size between 2 and 50nm) and high specific surface areas, SBA-15 has been widely explored for different applications especially in the biomedical fields. The surface modification of SBA-15 with functional polymers has demonstrated to be an effective way for improving its properties and performance. In this work, we reported the preparation of PEGylated SBA-15 polymer composites through surface-initiated chain transfer free radical polymerization for the first time. The thiol group was first introduced on SBA-15 via co-condensation with γ-mercaptopropyltrimethoxysilane (MPTS), that were utilized to initiate the chain transfer free radical polymerization using poly(ethylene glycol) methyl ether methacrylate (PEGMA) and itaconic acid (IA) as the monomers. The successful modification of SBA-15 with poly(PEGMA-co-IA) copolymers was evidenced by a series of characterization techniques, including 1 H NMR, FT-IR, TGA and XPS. The final SBA-15-SH- poly(PEGMA-co-IA) composites display well water dispersity and high loading capability towards cisplatin (CDDP) owing to the introduction of hydrophilic PEGMA and carboxyl groups. Furthermore, the CDDP could be released from SBA-15-SH-poly(PEGMA-co-IA)-CDDP complexes in a pH dependent behavior, suggesting the potential controlled drug delivery of SBA-15-SH-poly(PEGMA-co-IA). More importantly, the strategy should be also useful for fabrication of many other functional materials for biomedical applications owing to the advantages of SBA-15 and well monomer adoptability of chain transfer free radical polymerization. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Broadhurst, C. Leigh; Schmidt, Walter F.; Kim, Moon S.; Nguyen, Julie K.; Qin, Jianwei; Chao, Kuanglin; Bauchan, Gary L.; Shelton, Daniel R.
2016-05-01
The structural, cognitive and visual development of the human brain and retina strictly require long-chain polyunsaturated fatty acids (LC-PUFA). Excluding water, the mammalian brain is about 60% lipid. One of the great unanswered questions with respect to biological science in general is the absolute necessity of the LC-PUFA docosahexaenoic acid (DHA; 22:6n-3) in these fast signal processing tissues. A lipid of the same chain length with just one less diene group, docosapentaenoic acid (DPA; 22:5n-6) is fairly abundant in terrestrial food chains yet cannot substitute for DHA. Gradient Temperature Raman spectroscopy (GTRS) applies the temperature gradients utilized in differential scanning calorimetry to Raman spectroscopy, providing a straightforward technique to identify molecular rearrangements that occur near and at phase transitions. Herein we apply GTRS to DPA, and DHA from -100 to 20°C. 20 Mb three-dimensional data arrays with 1°C increments and first/second derivatives allows complete assignment of solid, liquid and transition state vibrational modes, including low intensity/frequency vibrations that cannot be readily analyzed with conventional Raman. DPA and DHA show significant spectral changes with premelting (-33 and -60°C, respectively) and melting (-27 and -44°C, respectively). The CH2-(HC=CH)-CH2 moieties are not identical in the second half of the DHA and DPA structures. The DHA molecule contains major CH2 twisting (1265 cm-1) with no noticeable CH2 bending, consistent with a flat helical structure with small pitch. Further modeling of neuronal membrane phospholipids must take into account this structure for DHA, which would be configured parallel to the hydrophilic head group line.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Wei; Chakravarty, Bornali; Zheng, Fei
Human fatty acid synthase (hFAS) is a homodimeric multidomain enzyme that catalyzes a series of reactions leading to the de novo biosynthesis of long-chain fatty acids, mainly palmitate. The carboxy-terminal thioesterase (TE) domain determines the length of the fatty acyl chain and its ultimate release by hydrolysis. Because of the upregulation of hFAS in a variety of cancers, it is a target for antiproliferative agent development. Dietary long-chain polyunsaturated fatty acids (PUFAs) have been known to confer beneficial effects on many diseases and health conditions, including cancers, inflammations, diabetes, and heart diseases, but the precise molecular mechanisms involved have notmore » been elucidated. We report the crystal structure of the hFAS TE domain covalently modified and inactivated by methyl {gamma}-linolenylfluorophosphonate. Whereas the structure confirmed the phosphorylation by the phosphonate head group of the active site serine, it also unexpectedly revealed the binding of the 18-carbon polyunsaturated {gamma}-linolenyl tail in a long groove-tunnel site, which itself is formed mainly by the emergence of an {alpha} helix (the 'helix flap'). We then found inhibition of the TE domain activity by the PUFA dihomo-{gamma}-linolenic acid; {gamma}- and {alpha}-linolenic acids, two popular dietary PUFAs, were less effective. Dihomo-{gamma}-linolenic acid also inhibited fatty acid biosynthesis in 3T3-L1 preadipocytes and selective human breast cancer cell lines, including SKBR3 and MDAMB231. In addition to revealing a novel mechanism for the molecular recognition of a polyunsaturated fatty acyl chain, our results offer a new framework for developing potent FAS inhibitors as therapeutics against cancers and other diseases.« less
Dasopoulou, Maria; Briana, Despina D; Boutsikou, Theodora; Karakasidou, Eirini; Roma, Eleftheria; Costalos, Christos; Malamitsi-Puchner, Ariadne
2015-03-01
Gut hormones play an important role in the adaptation of the immature neonatal gut, and their secretion may be modulated by prebiotics. Furthermore, prebiotics are well known for their hypolipidemic potentials. We tested the hypothesis that prebiotics could alter motilin and gastrin secretion and reduce lipids in healthy preterms. A total of 167 newborns were randomized to either a prebiotics enriched formula containing dietary oligosaccharides (short-chain galacto-oligo-saccharides/long-chain fructo-oligo-saccharides [scGOS/lcFOS]), at a concentration of 0.8 g/100 ml, or a common preterm formula. Day 1 and 16 basal motilin, gastrin concentrations, and lipids were evaluated together with growth parameters, gastric residue, bowel habits, and feeding tolerance. Adverse events including necrotizing enterocolitis (NEC) and septicemia were also recorded. Mean motilin increase and day 16 mean values were greater for the intervention, compared with the control group (P = .001, P = .005, respectively), while gastrin remained high in both groups. Mean cholesterol and low density lipoprotein (LDL) increase were significantly greater in the control, compared with the intervention (P = .037, and P = .001) group. Day 16 LDL levels were significantly higher in the control group. Mean weight was increased in the control group, while gastric residue was less and stool frequency was increased in the intervention group. NEC and septicemia were not statistically different between groups. A prebiotics enriched formula resulted in significant surge of motilin relating to reduced gastric residue, compared with a common preterm formula. Mean cholesterol change was lower, while LDL was not increased in the prebiotics group, compared with the control group. © 2013 American Society for Parenteral and Enteral Nutrition.
Ayliffe, Michael John; Behrens, Judith; Stern, Simon; Sumar, Nazira
2012-08-01
This study investigated bone marrow plasma cell subsets and monoclonal free light chain concentrations in blood of monoclonal gammopathy patients. 54 bone marrow samples were stained by double immunofluorescence to enumerate cellular subsets making either intact monoclonal immunoglobulin or free light chains only. Blood taken at the same time was assayed for free light chains by an automated immunoassay. Patients were assigned to three cellular population categories: single intact monoclonal immunoglobulin (59%), dual monoclonal immunoglobulin and free light chain only (31%), or single free light chain only (9%). The median affected free light chain concentration of each group was 75 mg/l, 903 mg/l and 3320 mg/l, respectively, but with substantial overlap. In myeloma patients the difference in serum free light chain concentrations between patients with free light chain only marrow cells and those without was statistically significant. Serum free light chain levels >600 mg/l result mostly from marrow cells restricted to free light chain production.
(R,S)-3-Carboxy-2-(isoquinolinium-2-yl)propanoate monohydrate
Stilinović, Vladimir; Frkanec, Leo; Kaitner, Branko
2010-01-01
The title compound, C13H11NO4·H2O, is a monohydrate of a betaine exhibiting a positively charged N-substituted isoquinoline group and a deprotonated carboxyl group. In the crystal, molecules are connected via short O—H⋯O hydrogen bonds between protonated and deprotonated carboxyl groups into chains of either R or S enantiomers along [001]. These chains are additionally connected by hydrogen bonding between water molecules and the deprotonated carboxy groups of neighbouring molecules. PMID:21579503
Composition and spectra of copper-carotenoid sediments from a pyrite mine stream in Spain.
Garcia-Guinea, Javier; Furio, Marta; Sanchez-Moral, Sergio; Jurado, Valme; Correcher, Virgilio; Saiz-Jimenez, Cesareo
2015-01-25
Mine drainages of La Poderosa (El Campillo, Huelva, Spain), located in the Rio Tinto Basin (Iberian Pyrite Belt) generate carotenoid complexes mixed with copper sulfates presenting good natural models for the production of carotenoids from microorganisms. The environmental conditions of Rio Tinto Basin include important environmental stresses to force the microorganisms to accumulate carotenoids. Here we show as carotenoid compounds in sediments can be analyzed directly in the solid state by Raman and Luminescence spectroscopy techniques to identify solid carotenoid, avoiding dissolution and pre-concentration treatments, since the hydrous copper-salted paragenesis do not mask the Raman emission of carotenoids. Raman spectra recorded from one of these specimens' exhibit major features at approximately 1006, 1154, and 1520 cm(-1). The bands at 1520 cm(-1) and 1154 cm(-1) can be assigned to in-phase C=C (γ(-1)) and C-C stretching (γ(-2)) vibrations of the polyene chain in carotenoids. The in-plane rocking deformations of CH3 groups linked to this chain coupled with C-C bonds are observed in the 1006 cm(-1) region. X-irradiation pretreatments enhance the cathodoluminescence spectra emission of carotenoids enough to distinguish organic compounds including hydroxyl and carboxyl groups. Carotenoids in copper-sulfates could be used as biomarkers and useful proxies for understanding remote mineral formations as well as for terrestrial environmental investigations related to mine drainage contamination including biological activity and photo-oxidation processes. Copyright © 2014. Published by Elsevier B.V.
Hu, Qiao -Sheng; Hong, Kunlun; Zhang, Hong -Hai
2015-08-12
In this study, a general strategy toward the synthesis of well-defined conjugated polymers with controlled heterobisfunctional chain ends via combination of controlled Pd(0)/t-Bu 3P Suzuki cross-coupling polymerization with the post-polymerization modification of the triflate (OTf) group was disclosed.
An algebraic program for the states associated with the U(5) ⊃ O(5) ⊃ O(3) chain of groups
NASA Astrophysics Data System (ADS)
Yannouleas, C.; Pacheco, J. M.
1988-12-01
A REDUCE program is presented that calculates algebraically the γ-dependent part of the states associated with the U(5) ⊃ O(5) ⊃ O(3) chain of groups, familiar from nuclear-structure problems. The method of solution is a direct implementation of the analytic expressions given by Chacón and Moshinsky.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Qiao -Sheng; Hong, Kunlun; Zhang, Hong -Hai
In this study, a general strategy toward the synthesis of well-defined conjugated polymers with controlled heterobisfunctional chain ends via combination of controlled Pd(0)/t-Bu 3P Suzuki cross-coupling polymerization with the post-polymerization modification of the triflate (OTf) group was disclosed.
Lynch, J W; Bailey, J W
1995-05-01
Diets containing either triacetin (the water-soluble triglyceride of acetate) or long-chain triglycerides (LCT) were fed to rats for 30 d to determine the effect on body weight gain and adipose tissue cellularity. Male Sprague-Dawley rats were allowed free access to one of three diets: a control diet containing 5% of energy as fat or one of two experimental diets that contained 30% triglyceride (by energy). The source of the triglyceride in the two experimental groups was either 100% LCT or 95% triacetin + 5% LCT. Within the experimental groups receiving 30% fat, the source of dietary triglyceride (LCT vs. triacetin) did not affect total energy consumption. There were no significant differences in body weight at the onset of the study; however, animals fed 100% LCT weighed significantly more than the other two groups at the end of the study. In all three fat pads studied, animals fed triacetin had significantly lower pad mass than did animals fed LCT. Mean fat cell size was smaller in fat depots of animals fed short-chain triglyceride. Provision of dietary energy as the short-chain triglyceride triacetin in lieu of LCT resulted in lower weight gain and fat deposition. These data demonstrate the impact of dietary triglyceride composition on body weight regulation.
Rafferty, Jake L; Siepmann, J Ilja; Schure, Mark R
2009-03-20
Particle-based simulations using the configurational-bias and Gibbs ensemble Monte Carlo techniques are carried out to probe the effects of various chromatographic parameters on bonded-phase chain conformation, solvent penetration, and retention in reversed-phase liquid chromatography (RPLC). Specifically, we investigate the effects due to the length of the bonded-phase chains (C(18), C(8), and C(1)), the inclusion of embedded polar groups (amide and ether) near the base of the bonded-phase chains, the column pressure (1, 400, and 1000 atm), and the pore shape (planar slit pore versus cylindrical pore with a 60A diameter). These simulations utilize a bonded-phase coverage of 2.9 micromol/m(2)and a mobile phase containing methanol at a molfraction of 33% (about 50% by volume). The simulations show that chain length, embedded polar groups, and pore shape significantly alter structural and retentive properties of the model RPLC system, whereas the column pressure has a relatively small effect. The simulation results are extensively compared to retention measurements. A molecular view of the RPLC retention mechanism emerges that is more complex than can be inferred from thermodynamic measurements.
Protein-linked Ubiquitin Chain Structure Restricts Activity of Deubiquitinating Enzymes*
Schaefer, Jonathan B.; Morgan, David O.
2011-01-01
The attachment of lysine 48 (Lys48)-linked polyubiquitin chains to proteins is a universal signal for degradation by the proteasome. Here, we report that long Lys48-linked chains are resistant to many deubiquitinating enzymes (DUBs). Representative enzymes from this group, Ubp15 from yeast and its human ortholog USP7, rapidly remove mono- and diubiquitin from substrates but are slow to remove longer Lys48-linked chains. This resistance is lost if the structure of Lys48-linked chains is disrupted by mutation of ubiquitin or if chains are linked through Lys63. In contrast to Ubp15 and USP7, Ubp12 readily cleaves the ends of long chains, regardless of chain structure. We propose that the resistance to many DUBs of long, substrate-attached Lys48-linked chains helps ensure that proteins are maintained free from ubiquitin until a threshold of ubiquitin ligase activity enables degradation. PMID:22072716
[Evaluation of an Xpert EV (Cepheid®) molecular diagnostic technique for enteroviral meningitis].
Alonso Pérez, Natalia; Sagastizabal Cardelus, Belén; Prieto Tato, Luis Manuel; Guillén Martín, Sara; González Torralba, Ana; García Bermejo, Isabel; Ramos Amador, José Tomás
2017-10-01
Polymerase chain reaction (PCR) assays have shown to be useful and quick for the diagnosis of enterovirus in aseptic meningitis. The aim of our study was to analyse the changes in clinical practice after the introduction of a real-time polymerase chain reaction (RT-PCR) technique using the Xpert EV (Cepheid ® ) assay for the qualitative detection of enterovirus RNA in cerebrospinal fluid specimens from children with suspected viral meningitis. A retrospective study was performed in children older than 1year, diagnosed with enterovirus meningitis in a third level hospital from November 2006 to February 2013. The first period, before the availability of Xpert EV (Cepheid ® ) (Group1, November 2006-August 2010) was compared with the later period (Group2, September 2010-February 2013). Clinical characteristics, the mean length of stay, and the cost per inpatient cases, were compared between the 2periods. Forty-one patients (60.9% male) were included, with a median age of 64 months (interquartile range 28-96). Twenty-six patients (63.4%) were included in Group2. There were non-statistically significant differences in the epidemiological, disease severity, and laboratory characteristics between both periods of study. A significant difference was observed in the mean length of stay, with it being shorter in Group2 (48hours vs 40.5hours, P=.039), and a significant lower inpatient cost per case (€779.77 vs €656.05, P<.05). Xpert EV (Cepheid ® ) assay was useful for decreasing the length of hospital stay and the costs associated with hospitalisation in children with enterovirus meningitis. Copyright © 2016 Asociación Española de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.
Yesselman, Joseph D; Horowitz, Scott; Brooks, Charles L; Trievel, Raymond C
2015-03-01
The propensity of backbone Cα atoms to engage in carbon-oxygen (CH · · · O) hydrogen bonding is well-appreciated in protein structure, but side chain CH · · · O hydrogen bonding remains largely uncharacterized. The extent to which side chain methyl groups in proteins participate in CH · · · O hydrogen bonding is examined through a survey of neutron crystal structures, quantum chemistry calculations, and molecular dynamics simulations. Using these approaches, methyl groups were observed to form stabilizing CH · · · O hydrogen bonds within protein structure that are maintained through protein dynamics and participate in correlated motion. Collectively, these findings illustrate that side chain methyl CH · · · O hydrogen bonding contributes to the energetics of protein structure and folding. © 2014 Wiley Periodicals, Inc.
Precise Nanoelectronics with Adatom Chains
NASA Technical Reports Server (NTRS)
Yamada, Toshishige
1999-01-01
Adatom chains on an atomically regulated substrate will be building components in future precise nanoelectronics. Adatoms need to be secured with chemical bonding, but then electronic isolation between the adatom and substrate systems is not guaranteed. A one-dimensional model shows that good isolation with existence of surface states is expected on an s-p crossing substrate such as Si, Ge, or GaAs, reflecting the bulk nature of the substrate. Isolation is better if adatoms are electronically similar to the substrate atoms, and can be manipulated by hydrogenation. Chain structures with group IV adatoms with two chemical bonds, or group III adatoms with one chemical bond, are semiconducting, reflecting the surface nature of the substrate. These structures are unintentionally doped due to the charge transfer across the chemical bonds. Physical properties of adatom chains have to be determined for the unified adatom-substrate system.
Periodic nanostructures from self assembled wedge-type block-copolymers
Xia, Yan; Sveinbjornsson, Benjamin R.; Grubbs, Robert H.; Weitekamp, Raymond; Miyake, Garret M.; Piunova, Victoria; Daeffler, Christopher Scot
2015-06-02
The invention provides a class of wedge-type block copolymers having a plurality of chemically different blocks, at least a portion of which incorporates a wedge group-containing block providing useful properties. For example, use of one or more wedge group-containing blocks in some block copolymers of the invention significantly inhibits chain entanglement and, thus, the present block copolymers materials provide a class of polymer materials capable of efficient molecular self-assembly to generate a range of structures, such as periodic nanostructures and microstructures. Materials of the present invention include copolymers having one or more wedge group-containing blocks, and optionally for some applications copolymers also incorporating one or more polymer side group-containing blocks. The present invention also provides useful methods of making and using wedge-type block copolymers.
Connolly, B A; Rider, P
1985-01-01
Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448
NASA Astrophysics Data System (ADS)
Amalric, Julien; Marchand-Brynaert, Jacqueline
2011-12-01
A novel route for chalcogenide glass surface modification is disclosed. The formation of an organic monolayer from disulfide derivatives is studied on two different glasses of formula GexAsySez by water contact angle measurement, X-ray photoelectron spectroscopy (XPS) and Fourier transform infrared spectroscopy in attenuated total reflection mode (FTIR-ATR). The potential anchoring group is the disulfide functionality. Since thioctic acid derivatives absorb around 335 nm, an irradiation step is included, in order to favor S-S disruption. Three types of disulfide compounds are grafted onto small glass breaks for contact angle and XPS analyses. The results show effective changes of surface state. According to contact angle measurement, the deposited organic layer functionalized by a small polyethylene glycol chain leads to a more hydrophilic surface, long alkyl chain or a perfluorinated carbon chain leads to a more hydrophobic surface. XPS shows the presence at the surface of an organic layer with sulfur and ethylene oxide chains, or augmentation of organic carbons or fluorine and Csbnd F bonds. The photo-assisted grafting of the disulfides onto an ATR prism made of chalcogenide glass shows that this surface modification process does not affect infrared transparency, despite UV treatment, and accurate structural analysis can be performed.
Kanagawa, Motoi; Toda, Tatsushi
2017-01-01
Muscular dystrophy is a group of genetic disorders characterized by progressive muscle weakness. In the early 2000s, a new classification of muscular dystrophy, dystroglycanopathy, was established. Dystroglycanopathy often associates with abnormalities in the central nervous system. Currently, at least eighteen genes have been identified that are responsible for dystroglycanopathy, and despite its genetic heterogeneity, its common biochemical feature is abnormal glycosylation of alpha-dystroglycan. Abnormal glycosylation of alpha-dystroglycan reduces its binding activities to ligand proteins, including laminins. In just the last few years, remarkable progress has been made in determining the sugar chain structures and gene functions associated with dystroglycanopathy. The normal sugar chain contains tandem structures of ribitol-phosphate, a pentose alcohol that was previously unknown in humans. The dystroglycanopathy genes fukutin, fukutin-related protein (FKRP), and isoprenoid synthase domain-containing protein (ISPD) encode essential enzymes for the synthesis of this structure: fukutin and FKRP transfer ribitol-phosphate onto sugar chains of alpha-dystroglycan, and ISPD synthesizes CDP-ribitol, a donor substrate for fukutin and FKRP. These findings resolved long-standing questions and established a disease subgroup that is ribitol-phosphate deficient, which describes a large population of dystroglycanopathy patients. Here, we review the history of dystroglycanopathy, the properties of the sugar chain structure of alpha-dystroglycan, dystroglycanopathy gene functions, and therapeutic strategies. PMID:29081423
Supply-Chain Optimization Template
NASA Technical Reports Server (NTRS)
Quiett, William F.; Sealing, Scott L.
2009-01-01
The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.
Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves
2006-12-01
Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.
The effect of self-assembled monolayers on graphene conductivity and morphology
NASA Astrophysics Data System (ADS)
Moore, T. L.; Chen, J. H.; Riddick, B.; Williams, E. D.
2009-03-01
Graphene transport properties are limited by charge defects in SiO2, and by large charge density due to strong interaction with SiC. To modify these effects we have treated 300 nm SiO2 with tricholosilanes with different termination groups including pure and fluoro and amino-terminated hydrocarbons for use as substrates for mechanical exfoliation of graphene. XPS measurements verify the presence of the expected termination groups. AFM measurements reveal modified monolayer roughness and correlation lengths; for a fluorinated carbon chain the RMS roughness is 0.266 ± 0.017 nm and the correlation length is 10.2 ± 0.7 nm compared to 0.187 ± 0.011 nm and 19.8 ± 2.5 nm for SiO2. Surface free energies of the monolayers and the SiO2 blank have been computed from static contact angle measurements and all decrease the SiO2 surface free energy; for the fluorinated carbon chain monolayer a decrease of 20 mJ/m^2 from SiO2. We will discuss the ease of exfoliation, and the morphology and conductivity of graphene on these monolayers.
Wu, Ming-Hsun; Wang, Ming-Yang; Yang, Chin-Yao; Kuo, Min-Liang; Lin, Ming-Tsan
2014-09-01
SMOFlipid 20% is intravenous lipid emulsion (ILE) containing long-chain triglycerides (LCT), medium-chain triglycerides (MCT), olive oil, and fish oil as a mixed emulsion containing α-tocopherol. The aim was to assess the efficacy of this new ILE in gastrointestinal surgery compared with MCT/LCT. In this prospective study, 40 patients were randomized to SMOFlipid 20% or MCT/LCT (Lipovenoes 20%) group. Clinical and biochemistry data were collected. Inflammatory markers (CRP, IL-6, IL-10, TNF-α, TGF-β1) and oxidative stress (ROS and superoxide) were measured. Thirty-five patients (17 males and 18 females) with a mean age of 57 years completed the study. The patients' demographic characteristics (age, gender, height, body weight, and BMI) were similar without significant differences between groups. The increment of triglyceride on day 6 from baseline was significantly lower in SMOFlipid group than in Lipovenoes MCT/LCT group. Inflammatory markers, as well as superoxide radical and total oxygen radical were not different between groups. Despite the comparable effect on inflammatory response, because of its well-balanced fatty acid pattern, relatively low n-6:n-3 ratio, and high vitamin E content, SMOFlipid had a better triglyceride-lowering effect as compared with MCT/LCT in adult patients undergoing gastrointestinal surgery. © 2013 American Society for Parenteral and Enteral Nutrition.
Bhattacharyya, Sudeepa; Yan, Ke; Pence, Lisa; Simpson, Pippa M; Gill, Pritmohinder; Letzig, Lynda G; Beger, Richard D; Sullivan, Janice E; Kearns, Gregory L; Reed, Michael D; Marshall, James D; Van Den Anker, John N; James, Laura P
2014-01-01
Aim Long-chain acylcarnitines have been postulated to be sensitive biomarkers of acetaminophen (APAP)-induced hepatotoxicity in mouse models. In the following study, the relationship of acylcarnitines with other known indicators of APAP toxicity was examined in children receiving low-dose (therapeutic) and high-dose (‘overdose’ or toxic ingestion) exposure to APAP. Materials & methods The study included three subject groups: group A (therapeutic dose, n = 187); group B (healthy controls, n = 23); and group C (overdose, n = 62). Demographic, clinical and laboratory data were collected for each subject. Serum samples were used for measurement of APAP protein adducts, a biomarker of the oxidative metabolism of APAP and for targeted metabolomics analysis of serum acylcarnitines using ultra performance liquid chromatography–triple-quadrupole mass spectrometry. Results Significant increases in oleoyl- and palmitoyl-carnitines were observed with APAP exposure (low dose and overdose) compared with controls. Significant increases in serum ALT, APAP protein adducts and acylcarnitines were observed in overdose children that received delayed treatment (time to treatment from overdose >24 h) with the antidote N-acetylcysteine. Time to peak APAP protein adducts in serum was shorter than that of the acylcarnitines and serum ALT. Conclusion Perturbations in long-chain acylcarnitines in children with APAP toxicity suggest that mitochrondrial injury and associated impairment in the β-oxidation of fatty acids are clinically relevant as biomarkers of APAP toxicity. PMID:24521011
Bhattacharyya, Sudeepa; Yan, Ke; Pence, Lisa; Simpson, Pippa M; Gill, Pritmohinder; Letzig, Lynda G; Beger, Richard D; Sullivan, Janice E; Kearns, Gregory L; Reed, Michael D; Marshall, James D; Van Den Anker, John N; James, Laura P
2014-01-01
Long-chain acylcarnitines have been postulated to be sensitive biomarkers of acetaminophen (APAP)-induced hepatotoxicity in mouse models. In the following study, the relationship of acylcarnitines with other known indicators of APAP toxicity was examined in children receiving low-dose (therapeutic) and high-dose ('overdose' or toxic ingestion) exposure to APAP. The study included three subject groups: group A (therapeutic dose, n = 187); group B (healthy controls, n = 23); and group C (overdose, n = 62). Demographic, clinical and laboratory data were collected for each subject. Serum samples were used for measurement of APAP protein adducts, a biomarker of the oxidative metabolism of APAP and for targeted metabolomics analysis of serum acylcarnitines using ultra performance liquid chromatography-triple-quadrupole mass spectrometry. Significant increases in oleoyl- and palmitoyl-carnitines were observed with APAP exposure (low dose and overdose) compared with controls. Significant increases in serum ALT, APAP protein adducts and acylcarnitines were observed in overdose children that received delayed treatment (time to treatment from overdose >24 h) with the antidote N-acetylcysteine. Time to peak APAP protein adducts in serum was shorter than that of the acylcarnitines and serum ALT. Perturbations in long-chain acylcarnitines in children with APAP toxicity suggest that mitochrondrial injury and associated impairment in the β-oxidation of fatty acids are clinically relevant as biomarkers of APAP toxicity.
Liu, Zhidan; Chen, Chunlan; Li, Xiaoyan; Zhao, Chuang; Li, Zunyuan; Liang, Wei; Lin, Yufang
2018-02-01
Cupping therapy has a long history in traditional medicine especially in Asian countries. It was controversial whether cupping induced blisters are beneficial to healing effects, and the formation and content in the blisters remain unexplored. We aimed to identify and compare the molecular components of the blister fluid from the cupping therapy and the scalds to explore the necessary of inducing cupping induced blisters. Fluid sample of blisters from fifteen patients receiving cupping therapy (Cupping group) and scald burns (Scald group) were collected in this study. Proteins from the blisters were separated by two-dimensional electrophoresis (2D-gel) and further analyzed by mass spectrometry. In addition, the changes in particular proteins were confirmed by Western blotting. The protein components are significantly different between blister from cupping therapy and scalds. The immune responses, oxidative stress and metabolic related proteins (Ig lambda-2 chain C regions, Ig gamma-1 chain C region, hemopexin, prdx2, calmodulin, succinyl-CoA ligase and tetranectin) were increased, whereas the hemoglobin subunit beta was decreased in the Cupping group compared with the Scald group. Cupping induced blisters contain several proteins which relate to the activation of certain immune pathways including anti-oxidation, anti-apoptosis, tissue repairing and metabolic regulation. This proteomic analysis may indicate a significant clue to the mechanism study of cupping. Copyright © 2017 Elsevier Ltd. All rights reserved.
Supramolecular Polymers Based on Non-Coplanar AAA-DDD Hydrogen-Bonded Complexes.
Mendez, Iamnica J Linares; Wang, Hong-Bo; Yuan, Ying-Xue; Wisner, James A
2018-03-01
Non-coplanar triple-hydrogen-bond arrays are connected as telechelic groups to alkyl chains and their properties as AA/BB type supramolecular polymers are examined. Viscosity studies at three temperatures are used to study the ring-chain equilibrium and determine the critical concentrations where polymer chains are formed. It is observed that neither the temperature range studied nor the alkyl chain length of one component significantly affect the polymerization properties in this system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
de Almeida Rabello Oliveira, Marcela; da Rocha Ataíde, Terezinha; de Oliveira, Suzana Lima; de Melo Lucena, Ana Luíza; de Lira, Carla Emmanuela Pereira Rodrigues; Soares, Anderson Acioli; de Almeida, Clarissa Beatriz Santos; Ximenes-da-Silva, Adriana
2008-03-21
The ketogenic diet (KD) is a high fat and low carbohydrate and protein diet. It is used in the clinical treatment of epilepsy, in order to decrease cerebral excitability. KD is usually composed by long-chain triglycerides (LCT) while medium-chain triglycerides (MCT) diet is beginning to be used in some clinical treatment of disorders of pyruvate carboxylase enzyme and long-chain fatty acid oxidation. Our study aimed to analyze the effects of medium- and long-chain KD on cerebral electrical activity, analyzing the propagation of the phenomenon of cortical spreading depression (CSD). Three groups of weaned rats (21 days old) received, for 7 weeks, either a control (AIN-93G diet), or a MCT-KD (rich in triheptanoin oil), or a LCT-KD (rich in soybean oil). They were compared to another three groups (21 days old) receiving the same diets for just 10 days. CSD propagation was evaluated just after ending the dietary treatments. Results showed that short-term KD treatment resulted in a significant reduction of the CSD velocity of propagation (control group: 4.02+/-1.04mm/min; MCT-KD: 0.81+/-1.46mm/min and LCT-KD: 2.26+/-0.41mm/min) compared to the control group. However, long-term treatment with both KDs had no effect on the CSD velocity (control group: 3.10+/-0.41mm/min, MCT-KD: 2.91+/-1.62mm/min, LCT-KD: 3.02+/-2.26mm/min) suggesting that both short-term KDs have a positive effect in decreasing brain cerebral excitability in young animals. These data show for the first time that triheptanoin has an effect on central nervous system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Bing-Ping, E-mail: ybp@fjirsm.ac.cn; Mao, Jiang-Gao
Systematic explorations of new compounds in the cadmium iodate system by hydrothermal reactions led to two layered iodates, namely, Cd(IO{sub 3})X (X=Cl, OH). Cd(IO{sub 3})Cl crystallizes in the orthorhombic space group Cmca (No. 64) whereas Cd(IO{sub 3})(OH) crystallizes in the orthorhombic space group Pnma (No. 62). Cd(IO{sub 3})Cl displays a unique double layered structure composed of {sup 1}{sub ∞}[Cd−O{sub 3}Cl]{sub n} chains. Cadmium octahedrons form a 1D chain along the a-axis through edge sharing, and such chains are further interconnected via IO{sub 3} groups to form a special double layer on (020) plane. Cd(IO{sub 3})(OH) also exhibits a layered structuremore » that is composed of cadmium cations, IO{sub 3} groups and hydroxyl ions. Within a layer, chains of CdO{sub 6} edge-shared octahedra are observed along the b-axis. And these chains are connected by IO{sub 3} groups into a layer parallel to the bc plane. Spectroscopic characterizations, elemental analysis, and thermogravimetric analysis for the reported two compounds are also presented. - Graphical abstract: Two new layered cadmium iodates Cd(IO{sub 3})X (X=Cl, OH) are reported. Cd(IO{sub 3})Cl features a unique double layered structure whereas Cd(IO{sub 3})(OH) displays an ordinary layered structure. - Highlights: • Two new layered cadmium iodates Cd(IO{sub 3})X (X=Cl, OH) are reported. • Cd(IO{sub 3})Cl features a unique double layered structure. • Cd(IO{sub 3})(OH) displays an ordinary layered structure. • The spectroscopic and thermal properties have been studied in detail.« less
Continuously Variable Transmission
NASA Technical Reports Server (NTRS)
Grana, D. C.
1985-01-01
Chain slides along two cones, in novel transmission concept. Transmission includes chain drive between two splined shafts. Chain sprockets follow surfaces of two cones. As one chain sprocket moves toward smaller diameter other chain sprocket moves toward larger diameter, thereby changing "gear" ratio. Movement initiated by tension applied to chain by planetary gear mechanism. Device positive, simple, and efficient over wide range of speed ratios.
NASA Astrophysics Data System (ADS)
Kwiecień, Iwona; Radecka, Iza; Kowalczuk, Marek; Jelonek, Katarzyna; Orchel, Arkadiusz; Adamus, Grażyna
2017-10-01
The novel copolymers composed of poly-γ-glutamic acid (γ-PGA) and oligoesters have been developed. The structures of the obtained copolymers including variety of end groups were determined at the molecular level with the aid of electrospray ionization multistage mass spectrometry (ESI-MSn). The fragmentation experiment performed for the selected sodium adducts of the copolymers confirmed that the developed methods lead to the formation of graft copolymers composed of poly-γ-glutamic acid (γ-PGA) backbone and oligoesters pendant chains. Moreover, it was established that fragmentation of selected sodium adducts of graft copolymers proceeded via random breakage of amide bonds along the backbone and ester bonds of the oligoesters pendant chains. Considering potential applications of the synthesized copolymers in the area of biomaterials, the hydrolytic degradation under laboratory conditions and in vitro cytotoxicity tests were performed. The ESI-MSn technique applied in this study has been proven to be a useful tool in structural studies of novel graft copolymers as well as their degradation products. [Figure not available: see fulltext.
Discovery of antitumor ursolic acid long-chain diamine derivatives as potent inhibitors of NF-κB.
Jiang, Wei; Huang, Ri-Zhen; Zhang, Jing; Guo, Tong; Zhang, Meng-Ting; Huang, Xiao-Chao; Zhang, Bin; Liao, Zhi-Xin; Sun, Jing; Wang, Heng-Shan
2018-05-08
A series of inhibitors of NF-κB based on ursolic acid (UA) derivatives containing long-chain diamine moieties were designed and synthesized as well as evaluated the antitumor effects. These compounds exhibited significant inhibitory activity to the NF-κB with IC 50 values at micromolar concentrations in A549 lung cancer cell line. Among them, compound 8c exerted potent activity against the test tumor cell lines including multidrug resistant human cancer lines, with the IC 50 values ranged from 5.22 to 8.95 μM. Moreover, compound 8c successfully suppressed the migration of A549 cells. Related mechanism study indicated compound 8c caused cell cycle arrest at G1 phase and triggered apoptosis in A549 cells through blockage of NF-κB signalling pathway. Molecular docking study revealed that key interactions between 8c and the active site of NF-κB in which the bulky and strongly electrophilic group of long-chain diamine moieties were important for improving activity. Copyright © 2018 Elsevier Inc. All rights reserved.
Yu, W H; Kang, E T; Neoh, K G
2005-01-04
Surface modification of poly(tetrafluoroethylene) (PTFE) films by well-defined comb copolymer brushes was carried out. Peroxide initiators were generated directly on the PTFE film surface via radio frequency Ar plasma pretreatment, followed by air exposure. Poly(glycidyl methacrylate) (PGMA) brushes were first prepared by surface-initiated reversible addition-fragmentation chain transfer polymerization from the peroxide initiators on the PTFE surface in the presence of a chain transfer agent. Kinetics study revealed a linear increase in the graft concentration of PGMA with the reaction time, indicating that the chain growth from the surface was consistent with a "controlled" or "living" process. alpha-Bromoester moieties were attached to the grafted PGMA by reaction of the epoxide groups with 2-bromo-2-methylpropionic acid. The comb copolymer brushes were subsequently prepared via surface-initiated atom transfer radical polymerization of two hydrophilic vinyl monomers, including poly(ethylene glycol) methyl ether methacrylate and sodium salt of 4-styrenesulfonic acid. The chemical composition of the modified PTFE surfaces was characterized by X-ray photoelectron spectroscopy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
Raust, Jacques-Antoine; Bruell, Adele; Sinha, Pritish; Hiller, Wolf; Pasch, Harald
2010-09-01
A comprehensive two-dimensional liquid chromatography system was developed to precisely describe the molecular heterogeneity of fatty alcohol ethoxylates. The end-group functionality was analyzed by gradient HPLC while ethylene oxide oligomer distributions were characterized by liquid adsorption chromatography. A baseline separation of all functionality fractions irrespective of the ethylene oxide oligomer chain length was achieved on nonpolar X-Terra(®) C(18) with a methanol-water gradient, whereas an isocratic flow of isopropanol-water on a polar Chromolith(®) Si column gave a separation according to the oligomer chain length without interference of the end-group distribution. The combination of these two methods to conduct online two-dimensional liquid chromatography experiments resulted in a comprehensive two-dimensional picture on the molecular heterogeneity of the sample.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Genetics Home Reference: DOLK-congenital disorder of glycosylation
... called glycosylation, which attaches groups of sugar molecules (oligosaccharides) to proteins. Glycosylation changes proteins in ways that ... to dolichol phosphate in order to build the oligosaccharide chain. Once the chain is formed, dolichol phosphate ...
Carbon Chains Containing Group IV Elements: Rotational Detection of GeC_4 and GeC_5
NASA Astrophysics Data System (ADS)
McCarthy, Michael C.; Martin-Drumel, Marie-Aline; Thorwirth, Sven
2017-06-01
Following the recent discovery of T-shaped GeC_2 by chirped-pulse FT microwave spectroscopy, evidence has been found for two longer carbon chains, GeC_4 and GeC_5, guided by high-level quantum chemical calculations of their molecular structure. Like their isovalent Si-bearing counterparts, those with an even number of carbon atoms are predicted to possess ^1Σ ground states, while odd-numbered carbon chains have low-lying ^3Σ linear isomers; all are predicted to be highly polar. With the exception of ^{73}Ge, rotational lines of the other four Ge isotopic species have been observed between 6 and 18 GHz. From these measurements, the Ge-C bond length has been determined to high precision, and can be compared to that found in other Ge species, such as GeC [1] and GeC_3Ge [2] studied previously at rotational resolution. Somewhat surprisingly, the spectrum of GeC_5 very closely resembles that of ^1Σ molecule, presumably owing to the very large spin-orbit constant of atomic Ge, which is manifest as an equally large spin-spin constant in the chain. A comparison between the production of SiC_n and GeC_n chains by laser ablation, including the absence of those with n=3, will be given. [1] C. R. Brazier and J. I. Ruiz, J. Mol. Spectrosc., 270, 26-32 (2011). [2] S. Thorwirth et al., J. Phys. Chem. A, 120, 254-259 (2016).
Pharmaceutical supply chain risks: a systematic review
2013-01-01
Introduction Supply of medicine as a strategic product in any health system is a top priority. Pharmaceutical companies, a major player of the drug supply chain, are subject to many risks. These risks disrupt the supply of medicine in many ways such as their quantity and quality and their delivery to the right place and customers and at the right time. Therefore risk identification in the supply process of pharmaceutical companies and mitigate them is highly recommended. Objective In this study it is attempted to investigate pharmaceutical supply chain risks with perspective of manufacturing companies. Methods Scopus, PubMed, Web of Science bibliographic databases and Google scholar scientific search engines were searched for pharmaceutical supply chain risk management studies with 6 different groups of keywords. All results found by keywords were reviewed and none-relevant articles were excluded by outcome of interests and researcher boundaries of study within 4 steps and through a systematic method. Results Nine articles were included in the systematic review and totally 50 main risks based on study outcome of interest extracted which classified in 7 categories. Most of reported risks were related to supply and supplier issues. Organization and strategy issues, financial, logistic, political, market and regulatory issues were in next level of importance. Conclusion It was shown that the majority of risks in pharmaceutical supply chain were internal risks due to processes, people and functions mismanagement which could be managed by suitable mitigation strategies. PMID:24355166
Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T
2015-12-01
To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.
Pineda-Juárez, Juan Antonio; Sánchez-Ortiz, Néstor Alonso; Castillo-Martínez, Lilia; Orea-Tejeda, Arturo; Cervantes-Gaytán, Rocío; Keirns-Davis, Candace; Pérez-Ocampo, Carlos; Quiroz-Bautista, Karla; Tenorio-Dupont, Mónica; Ronquillo-Martínez, Alberto
2016-02-01
Heart Failure (HF) is a complex syndrome, which can include the physiological, neural hormonal and metabolic complications known as "Cardiac Cachexia" (CC). In the development of CC there is a release of catabolic cytokines (Tumor Necrosis Factor-α, interleukins 1 and 6) that cause a decrease of fat free mass and fat mass. These changes in body composition might be reversed with a therapeutic combination of resistance exercise and branched chain amino acid supplementation (BCAA). Evaluate changes in body composition after a resistance exercise program and BCAA supplementation in patients with HF. In a randomized clinical trial with 3 month of follow-up anthropometric body composition analysis and stress tests were evaluated at the beginning and in the end of the study. Patients were divided into two groups; the experimental group performed the resistance exercise program and received 10 g/day BCAA supplementation, and the control group only performed the resistance exercise program. Both groups were provided with individualized diets and conventional medical treatment. Changes were found in hip circumference between the groups (p = 0.02), and muscle strength was increased in the experimental group (8%) and the control group (11.4%) with no difference between them. METS and VO2Max also increased in experimental and control groups (16.6% and 50.1% respectively). Regarding changes in symptoms, improvements in fatigue (45.4%), decubitus intolerance (21.8%) and dyspnea (25.4%) were observed in the overall sample. Improvements in physical and functional capacities are attributed to resistance exercise program but not to the BCAA supplementation. NCT02240511. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Versatile On-Resin Synthesis of High Mannose Glycosylated Asparagine with Functional Handles
Chen, Rui; Pawlicki, Mark A.; Tolbert, Thomas J.
2013-01-01
Here we present a synthetic route for solid phase synthesis of N-linked glycoconjugates containing high mannose oligosaccharides which allows the incorporation of useful functional handles on the N-terminus of asparagine. In this strategy, the C-terminus of an Fmoc protected aspartic acid residue is first attached to a solid phase support. The side chain of aspartic acid is protected by a 2-phenylisopropyl protecting group, which allows selective deprotection for the introduction of glycosylation. By using a convergent on-resin glycosylamine coupling strategy, an N-glycosidic linkage is successfully formed on the free side chain of the resin bound aspartic acid with a large high mannose oligosaccharide, Man8GlcNAc2, to yield N-linked high mannose glycosylated asparagine. The use of on-resin glycosylamine coupling provides excellent glycosylation yield, can be applied to couple other types of oligosaccharides, and also makes it possible to recover excess oligosaccharides conveniently after the on-resin coupling reaction. Useful functional handles including an alkene (p-vinylbenzoic acid), an alkyne (4-pentynoic acid), biotin, and 5-carboxyfluorescein are then conjugated onto the N-terminal amine of asparagine on-resin after the removal of the Fmoc protecting group. In this way, useful functional handles are introduced onto the glycosylated asparagine while maintaining the structural integrity of the reducing end of the oligosaccharide. The asparagine side chain also serves as a linker between the glycan and the functional group and preserves the native presentation of N-linked glycan which may aid in biochemical and structural studies. As an example of a biochemical study using functionalized high mannose glycosylated asparagine, a fluorescence polarization assay has been utilized to study the binding of the lectin Concanavalin A (ConA) using 5-carboxyfluorescein labeled high mannose glycosylated asparagine. PMID:24326091
Ahn, B K; Kwon, O J; Kang, C M
2012-01-01
The exchange donor program in renal transplantation is an efficient solution for recipients with a blood type or crossmatch-incompatible donor. However, this program has some difficulties to define unacceptable human leukocyte antigen matches, deteriorating clinical potential recipient condition, and withdrawal of donor consent. We analyzed the outcomes of exchange donor renal transplantation through the altruistic unbalanced chain. Among 152 cases of exchange donor renal transplantation from 1991 to 2010 in our hospital, we performed 58 procedures through altruistic unbalanced chains. We compared their outcomes with the direct and balanced chain group. We analyzed retrospectively whether this program expanded the donor pool, seeking better immunologic, size, and age matching. The graft survival and acute rejection rates did not differ significantly in the two groups. Of 152 cases, 58 (38.2%) renal transplantations were performed through an unbalanced chain. Seventeen waiting list recipients were transplanted through an altruistic unbalanced chain. In blood type O recipients (n = 32), the causes of registration in the exchange program were ABO incompatibility (93.3%), and positive crossmatch (6.7%). Nine altruistic blood type O donors and 9 (28.1%) type O recipients underwent transplantations through this chain. We suggest the altruistic unbalanced chain may expand the donor pool with advantages for difficult-to-match pairs. The disadvantages of type O recipients may be overcome through the use of an unbalanced chain. The altruistic unbalanced exchange transplantation program can help easy-to-match subjects, shortening the waiting periods. Copyright © 2012 Elsevier Inc. All rights reserved.
Fibrinogen gamma-A chain precursor in CSF: a candidate biomarker for Alzheimer's disease
Lee, Joung Wook; Namkoong, Hong; Kim, Hyun Kee; Kim, Sanghee; Hwang, Dong Whi; Na, Hae Ri; Ha, Seon-Ah; Kim, Jae-Ryong; Kim, Jin Woo
2007-01-01
Background Cerebrospinal fluid (CSF) may be valuable for exploring protein markers for the diagnosis of Alzheimer's disease (AD). The prospect of early detection and treatment, to slow progression, holds hope for aging populations with increased average lifespan. The aim of the present study was to investigate candidate CSF biological markers in patients with mild cognitive impairment (MCI) and AD and compare them with age-matched normal control subjects. Methods We applied proteomics approaches to analyze CSF samples derived from 27 patients with AD, 3 subjects with MCI and 30 controls. The AD group was subdivided into three groups by clinical severity according to clinical dementia rating (CDR), a well known clinical scale for dementia. Results We demonstrated an elevated level of fibrinogen gamma-A chain precursor protein in CSF from patients with mild cognitive impairment and AD compared to the age-matched normal subjects. Moreover, its expression was more prominent in the AD group than in the MCI and correlated with disease severity and progression. In contrast, fibrinogen gamma-A chain precursor protein was detected very low in the age-matched normal group. Conclusion These findings suggest that the CSF level of fibrinogen gamma-A chain precursor may be a candidate biomarker for AD. PMID:17565664
Ito, Hiroyuki; Tanabe, Hiroki; Kawagishi, Hirokazu; Tadashi, Wada; Yasuhiko, Tomono; Sugiyama, Kimio; Kiriyama, Shuhachi; Morita, Tatsuya
2009-10-01
Anti-inflammatory effects of short-chain inulin-like fructans (SCF) on trinitrobenzene sulfonic acid (TNBS)-induced colitis were investigated in rats, focusing specifically on endotoxin and bacterial translocations. SCF with degrees of polymerization (DP) of 4 and 8 were used. Rats were fed either control diet or diets including 60 g DP4 or DP8 per kilogram for 7 days, and then received intracolonic TNBS and were fed the respective diets for a further 10 days. DP4 and DP8 significantly reduced colonic injuries as assessed by damage score, but the reduction of colonic myeloperoxidase activity was manifest solely with DP8. At 3 days after colitis induction, bacterial translocation to the mesenteric lymph node was significantly lower in the DP4 and DP8 groups, but significant reduction in the portal endotoxin concentration was achieved solely in the DP8 group. Immediately prior to colitis induction, cecal immunoglobulin A and mucin concentrations were higher in the DP4 and DP8 groups, but these changes were abolished at 10 days post colitis induction. The data suggest that SCF exert prophylactic effects against TNBS colitis, presumably as a result of inhibitory effects on endotoxin and bacterial translocations.
Wölk, Christian; Drescher, Simon; Meister, Annette; Blume, Alfred; Langner, Andreas; Dobner, Bodo
2013-09-16
A series of novel malonic acid diamides (second generation) with two long hydrophobic alkyl chains and an alkaline polar head group was synthesised and characterised as a new class of amino-functionalised lipids. These peptide-mimic lipids are suitable for polynucleotide transfer. The lipids bear a novel backbone consisting of a lysine unit and a malonic acid unit. Six different head-group structures, which vary in size and number of amino groups that can be protonated, were attached to the backbone structure. Furthermore, different alkyl chains were used to build the lipophilic part (namely tetradecyl, hexadecyl, and oleyl). Phase transitions of the new compounds in aqueous dispersions at pH 10 were analysed and discussed in terms of head group and alkyl chain variations. The shape and size of the formed aggregates of selected lipid dispersions were investigated by dynamic light scattering and transmission electron microscopy. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Heinen, Silke; Weinhart, Marie
2017-03-07
For a meaningful correlation of surface coatings with their respective biological response reproducible coating procedures, well-defined surface coatings, and thorough surface characterization with respect to layer thickness and grafting density are indispensable. The same applies to polymeric monolayer coatings which are intended to be used for, e.g., fundamental studies on the volume phase transition of surface end-tethered thermoresponsive polymer chains. Planar gold surfaces are frequently used as model substrates, since they allow a variety of straightforward surface characterization methods. Herein we present reproducible grafting-to procedures performed with thermoresponsive poly(glycidyl ether) copolymers composed of glycidyl methyl ether (GME) and ethyl glycidyl ether (EGE). The copolymers feature different molecular weights (2 kDa, 9 kDa, 24 kDa) and are equipped with varying sulfur-containing anchor groups in order to achieve adjustable grafting densities on gold surfaces and hence control the tethered polymers' chain conformation. We determined "wet" and "dry" thicknesses of these coatings by QCM-D and ellipsometry measurements and deduced anchor distances and degrees of chain overlap of the polymer chains assembled on gold. Grafting under cloud point conditions allowed for higher degrees of chain overlap compared to grafting from a good solvent like ethanol, independent of the used sulfur-containing anchor group for polymers with low (2 kDa) and medium (9 kDa) molecular weights. By contrast, the achieved grafting densities and thus chain overlaps of surface-tethered polymers with high (24 kDa) molecular weights were identical for both grafting methods. Monolayers prepared from an ethanolic solution of poly(glycidyl ether)s equipped with sterically demanding disulfide-containing anchors revealed the lowest degrees of chain overlap. The ratio of the radius of gyration to the anchor distance (2 R g /l) of the latter coating was found to be lower than 1.4, indicating that the assembly was rather in the mushroom-like than in the brush regime. Polymer chains with thiol-containing anchors of different alkyl chain lengths (C 11 SH vs C 4 SH) formed assemblies with comparable degrees of chain overlap with 2 R g /l values above 1.4 and are thus in the brush regime. Molecular weights influenced the achievable degree of chain overlap on the surface. Coatings prepared with the medium molecular weight polymer (9 kDa) resulted in the highest chain packing density. Control of grafting density and thus chain overlap in different regimes (brush vs mushroom) on planar gold substrates are attainable for monolayer coatings with poly(GME-ran-EGE) by adjusting the polymer's molecular weight and anchor group as well as the conditions for the grafting-to procedure.
Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime
2014-08-01
ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude
2006-03-01
The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.
Substrate Effects for Atomic Chain Electronics
NASA Technical Reports Server (NTRS)
Yamada, Toshishige; Saini, Subhash (Technical Monitor)
1998-01-01
A substrate for future atomic chain electronics, where adatoms are placed at designated positions and form atomically precise device components, is studied theoretically. The substrate has to serve as a two-dimensional template for adatom mounting with a reasonable confinement barrier and also provide electronic isolation, preventing unwanted coupling between independent adatom structures. For excellent structural stability, we demand chemical bonding between the adatoms and substrate atoms, but then good electronic isolation may not be guaranteed. Conditions are clarified for good isolation. Because of the chemical bonding, fundamental adatom properties are strongly influenced: a chain with group IV adatoms having two chemical bonds, or a chain with group III adatoms having one chemical bond is semiconducting. Charge transfer from or to the substrate atoms brings about unintentional doping, and the electronic properties have to be considered for the entire combination of the adatom and substrate systems even if the adatom modes are well localized at the surface.
López Arbeloa, F; Bañuelos Prieto, J; López Arbeloa, I; Costela, A; García-Moreno, I; Gómez, C; Amat-Guerri, F; Liras, M; Sastre, R
2003-07-01
The photophysical, lasing and thermostability properties of newly synthesized analogs of the commercial dye pyrromethene 567 (PM567) have been measured in polymeric matrices of poly(methyl methacrylate) both when used as a dopant and when covalently bounded to the polymeric chain. These analogs have an acetoxy or a polymerizable methacryloyloxy group at the end of a polymethylene chain at Position 8 of the PM567 chromophore core. Clear correlations between photophysical and lasing characteristics are observed. Linking chain lengths with three or more methylene units give the highest fluorescence quantum yields (as high as 0.89) and lasing efficiencies (as high as 41%). The covalent linkage of the chromophore to the polymeric chain via the methacryloyloxy group improves the photostability of the PM567 chromophore.
Tang, Hui; Yang, Chuan-Zhong; Li, Huan; Wen, Wei; Huang, Fang-Fang; Huang, Zhi-Feng; Shi, Yu-Ping; Yu, Yan-Liang; Chen, Li-Lian; Yuan, Rui-Qin; Zhu, Xiao-Yu
2017-06-01
To investigate the fat emulsion tolerance in preterm infants of different gestational ages in the early stage after birth. A total of 98 preterm infants were enrolled and divided into extremely preterm infant group (n=17), early preterm infant group (n=48), and moderate-to-late preterm infant group (n=33). According to the dose of fat emulsion, they were further divided into low- and high-dose subgroups. The umbilical cord blood and dried blood filter papers within 3 days after birth were collected. Tandem mass spectrometry was used to measure the content of short-, medium-, and long-chain acylcarnitines. The extremely preterm infant and early preterm infant groups had a significantly lower content of long-chain acylcarnitines in the umbilical cord blood and dried blood filter papers within 3 days after birth than the moderate-to-late preterm infant group (P<0.05), and the content was positively correlated with gestational age (P<0.01). On the second day after birth, the low-dose fat emulsion subgroup had a significantly higher content of short-, medium-, and long-chain acylcarnitines than the high-dose fat emulsion subgroup among the extremely preterm infants (P<0.05). In the early preterm infant and moderate-to-late preterm infant groups, there were no significant differences in the content of short-, medium-, and long-chain acylcarnitines between the low- and high-dose fat emulsion subgroups within 3 days after birth. Compared with moderate-to-late preterm infants, extremely preterm infants and early preterm infants have a lower capacity to metabolize long-chain fatty acids within 3 days after birth. Early preterm infants and moderate-to-late preterm infants may tolerate high-dose fat emulsion in the early stage after birth, but extremely preterm infants may have an insufficient capacity to metabolize high-dose fat emulsion.
Quantum criticality and duality in the Sachdev-Ye-Kitaev/AdS2 chain
NASA Astrophysics Data System (ADS)
Jian, Shao-Kai; Xian, Zhuo-Yu; Yao, Hong
2018-05-01
We show that the quantum critical point (QCP) between a diffusive metal and ferromagnetic (or antiferromagnetic) phases in the SYK chain has a gravitational description corresponding to the double-trace deformation in an AdS2 chain. Specifically, by studying a double-trace deformation of a Z2 scalar in an AdS2 chain where the Z2 scalar is dual to the order parameter in the SYK chain, we find that the susceptibility and renormalization group equation describing the QCP in the SYK chain can be exactly reproduced in the holographic model. Our results suggest that the infrared geometry in the gravity theory dual to the diffusive metal of the SYK chain is also an AdS2 chain. We further show that the transition in SYK model captures universal information about double-trace deformation in generic black holes with near horizon AdS2 space-time.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Somov, N. V., E-mail: somov@phys.unn.ru; Chausov, F. F., E-mail: xps@ftiudm.ru; Zakirova, R. M., E-mail: ftt@udsu.ru
Aqua(pentahydrogennitrilotris(methylenephosphonato))lithium hydrate is a linear coordination polymer. Its crystal structure is described in space group P{sup –}1, Z = 2; a = 5.5732(2), b = 7.0106(2), and c = 16.9010(5) Å; α = 97.515(2)°, β = 94.551(2)°, and γ = 95.123(2)°. The tetrahedral coordination of the Li atom includes two oxygen atoms of a phosphonate ligand, one oxygen atom of another phosphonate ligand, and a water molecule. Complex formation is accompanied by closing of the eight-membered Li–O–P–C–N–C–P–O chelate ring. Polymeric chains run along the [100] direction. The chains are connected by hydrogen bonds.
NASA Astrophysics Data System (ADS)
Milani, Alberto; Castiglioni, Chiara; Brambilla, Luigi; Zerbi, Giuseppe
2012-02-01
We present a computational study based on DFT simulations of the infrared spectra of several short alkyl chains carrying polar end groups. The work aims to provide guidelines for the detection of marker bands signalling the occurrence of specific intramolecular interactions between the polar head and CH2 groups at different distances. In particular, the CH stretching region is investigated and new features assigned to normal modes localized on the CH2 groups nearest to the electron-withdrawing atom are identified. The study has been extended also to the rationalization of the experimental IR features shown by a 1-Chloroeicosane (C20H41Cl) sample.
Gerecht, Karola; Figueiredo, Angelo Miguel; Hansen, D Flemming
2017-09-16
Arginine residues are imperative for many active sites and protein-interaction interfaces. A new NMR-based method is presented to determine the rotational dynamics around the N ε -C ζ bond of arginine side chains. An application to a 19 kDa protein shows that the strengths of interactions involving arginine side chains can be characterised.
Method for fabricating hafnia films
Hu, Michael Z [Knoxville, TN
2007-08-21
The present invention comprises a method for fabricating hafnia film comprising the steps of providing a substrate having a surface that allows formation of a self-assembled monolayer thereon via covalent bonding; providing an aqueous solution that provides homogeneous hafnium ionic complexes and hafnium nanoclusters wherein the aqueous solution is capable of undergoing homogeneous precipitation under controlled conditions for a desired period of time at a controlled temperature and controlled solution acidity for desired nanocluster nucleation and growth kinetics, desired nanocluster size, desired growth rate of film thickness and desired film surface characteristics. The method further comprising forming the self-assembled monolayer on the surface of the substrate wherein the self-assembled monolayer comprises a plurality of hydrocarbon chains cross-linked together along the surface of the substrate, the hydrocarbon chains being uniformly spaced from one another and wherein each of the hydrocarbon chains having a functional anchoring group at a first end of the chain covalently bonded with the surface of the substrate and each of the hydrocarbon chains having a functional terminating group projected away from the surface wherein the functional terminating group provides a bonding site for the hafnium film to grow; and exposing the substrate to the aqueous solution for a desired period of time at a controlled temperature wherein the hafnium ionic complexes and the hafnium nanoclusters are deposited on the bonding site of the functional terminating group thereby forming the hafnia film wherein the hafnium bonded to the hydrocarbons and to one another provide a uniform ordered arrangement defined by the uniform arrangement of the hydrocarbons.
C5H9N isomers: pointers to possible branched chain interstellar molecules
NASA Astrophysics Data System (ADS)
Etim, Emmanuel E.; Gorai, Prasanta; Das, Ankan; Arunan, Elangannan
2017-04-01
The astronomical observation of isopropyl cyanide further stresses the link between the chemical composition of the interstellar medium (ISM) and molecular composition of the meteorites in which there is a dominance of branched chain amino acids as compared to the straight. However, observations of more branched chain molecules in ISM will firmly establish this link. In the light of this, we have considered C5H9N isomeric group in which the next higher member of the alkyl cyanide and other branched chain isomers belong. High-level quantum chemical calculations have been employed in estimating accurate energies of these isomers. From the results, the only isomer of the group that has been astronomically searched, n-butyl cyanide is not the most stable isomer and therefore, which might explain why its search could only yield upper limits of its column density without a successful detection. Rather, the two most stable isomers of the group are the branched chain isomers; tert-butylnitrile and isobutyl cyanide. Based on the rotational constants of these isomers, it is found that the expected intensity of tert-butylnitrile is the maximum among this isomeric group. Thus, this is proposed as the most probable candidate for astronomical observation. A simple LTE (local thermodynamic equilibrium) modelling has also been carried out to check the possibility of detecting tert-butyl cyanide in the millimetre-wave region. Contribution to the Topical Issue "Low-Energy Interactions related to Atmospheric and Extreme Conditions", edited by S. Ptasinska, M. Smialek-Telega, A. Milosavljevic and B. Sivaraman.
Da Boit, Mariasole; Sibson, Rachael; Sivasubramaniam, Selvaraj; Meakin, Judith R; Greig, Carolyn A; Aspden, Richard M; Thies, Frank; Jeromson, Stewart; Hamilton, D Lee; Speakman, John R; Hambly, Catherine; Mangoni, Arduino A; Preston, Thomas; Gray, Stuart R
2017-01-01
Resistance exercise increases muscle mass and function in older adults, but responses are attenuated compared with younger people. Data suggest that long-chain n-3 polyunsaturated fatty acids (PUFAs) may enhance adaptations to resistance exercise in older women. To our knowledge, this possibility has not been investigated in men. We sought to determine the effects of long-chain n-3 PUFA supplementation on resistance exercise training-induced increases in muscle mass and function and whether these effects differ between older men and women. Fifty men and women [men: n = 27, mean ± SD age: 70.6 ± 4.5 y, mean ± SD body mass index (BMI; in kg/m 2 ): 25.6 ± 4.2; women: n = 23, mean ± SD age: 70.7 ± 3.3 y, mean ± SD BMI: 25.3 ± 4.7] were randomly assigned to either long-chain n-3 PUFA (n = 23; 3 g fish oil/d) or placebo (n = 27; 3 g safflower oil/d) and participated in lower-limb resistance exercise training twice weekly for 18 wk. Muscle size, strength, and quality (strength per unit muscle area), functional abilities, and circulating metabolic and inflammatory markers were measured before and after the intervention. Maximal isometric torque increased after exercise training to a greater (P < 0.05) extent in the long-chain n-3 PUFA group than in the placebo group in women, with no differences (P > 0.05) between groups in men. In both sexes, the effect of exercise training on maximal isokinetic torque at 30, 90, and 240° s -1 , 4-m walk time, chair-rise time, muscle anatomic cross-sectional area, and muscle fat did not differ (P > 0.05) between groups. There was a greater (P < 0.05) increase in muscle quality in women after exercise training in the long-chain n-3 PUFA group than in the placebo group, with no such differences in men (P > 0.05). Long-chain n-3 PUFAs resulted in a greater decrease (P < 0.05) than the placebo in plasma triglyceride concentrations in both sexes, with no differences (P > 0.05) in glucose, insulin, or inflammatory markers. Long-chain n-3 PUFA supplementation augments increases in muscle function and quality in older women but not in older men after resistance exercise training. This trial was registered at clinicaltrials.gov as NCT02843009.
Nadzirin, Nurul; Willett, Peter; Artymiuk, Peter J.; Firdaus-Raih, Mohd
2013-01-01
We describe a server that allows the interrogation of the Protein Data Bank for hypothetical 3D side chain patterns that are not limited to known patterns from existing 3D structures. A minimal side chain description allows a variety of side chain orientations to exist within the pattern, and generic side chain types such as acid, base and hydroxyl-containing can be additionally deployed in the search query. Moreover, only a subset of distances between the side chains need be specified. We illustrate these capabilities in case studies involving arginine stacks, serine-acid group arrangements and multiple catalytic triad-like configurations. The IMAAAGINE server can be accessed at http://mfrlab.org/grafss/imaaagine/. PMID:23716645
Aqueous solution dispersement of carbon nanotubes
NASA Technical Reports Server (NTRS)
Kim, Jae-Woo (Inventor); Park, Cheol (Inventor); Choi, Sang H. (Inventor); Lillehei, Peter T. (Inventor); Harrison, Joycelyn S. (Inventor)
2011-01-01
Carbon nanotubes (CNTs) are dispersed in an aqueous buffer solution consisting of at least 50 weight percent water and a remainder weight percent that includes a buffer material. The buffer material has a molecular structure defined by a first end, a second end, and a middle disposed between the first and second ends. The first end is a cyclic ring with nitrogen and oxygen heteroatomes, the middle is a hydrophobic alkyl chain, and the second end is a charged group.
Quantifying Short-Chain Chlorinated Paraffin Congener Groups.
Yuan, Bo; Bogdal, Christian; Berger, Urs; MacLeod, Matthew; Gebbink, Wouter A; Alsberg, Tomas; de Wit, Cynthia A
2017-09-19
Accurate quantification of short-chain chlorinated paraffins (SCCPs) poses an exceptional challenge to analytical chemists. SCCPs are complex mixtures of chlorinated alkanes with variable chain length and chlorination level; congeners with a fixed chain length (n) and number of chlorines (m) are referred to as a "congener group" C n Cl m . Recently, we resolved individual C n Cl m by mathematically deconvolving soft ionization high-resolution mass spectra of SCCP mixtures. Here we extend the method to quantifying C n Cl m by introducing C n Cl m specific response factors (RFs) that are calculated from 17 SCCP chain-length standards with a single carbon chain length and variable chlorination level. The signal pattern of each standard is measured on APCI-QTOF-MS. RFs of each C n Cl m are obtained by pairwise optimization of the normal distribution's fit to the signal patterns of the 17 chain-length standards. The method was verified by quantifying SCCP technical mixtures and spiked environmental samples with accuracies of 82-123% and 76-109%, respectively. The absolute differences between calculated and manufacturer-reported chlorination degrees were -0.9 to 1.0%Cl for SCCP mixtures of 49-71%Cl. The quantification method has been replicated with ECNI magnetic sector MS and ECNI-Q-Orbitrap-MS. C n Cl m concentrations determined with the three instruments were highly correlated (R 2 > 0.90) with each other.
2018-03-01
Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202-4302, and to the Office of Management and...chain, including products, services, information , finances, demand, relationships, and risks. In a more complete definition, supply chain management ...CHAIN? LESSONS LEARNED FROM INDUSTRY LEADERS IN SUPPLY CHAIN MANAGEMENT by Ronald H. Menz March 2018 Thesis Co-Advisors: Rodrigo Nieto-Gomez
Taskent-Sezgin, Humeyra; Marek, Peter; Thomas, Rosanne; Goldberg, Daniel; Chung, Juah; Carrico, Isaac; Raleigh, Daniel P.
2011-01-01
p-Cyanophenylalanine is an extremely useful fluorescence probe of protein structure which can be recombinantly and chemically incorporated into proteins. The probe has been used to study protein folding, protein-membrane interactions, protein-peptide interactions and amyloid formation, however the factors that control its fluorescence are not fully understood. Hydrogen bonding to the cyano group is known to play a major role in modulating the fluorescence quantum yield, but the role of potential side-chain quenchers has not yet been elucidated. A systematic study on the effects of different side-chains on p-cyanophenylalanine fluorescence is reported. Tyr is found to have the largest effect followed by deprotonated His, Met, Cys, protonated His, Asn, Arg, and protonated Lys. Deprotonated amino groups are much more effective fluorescence quenchers than protonated amino groups. Free neutral imidazole and hydroxide ion are also effective quenchers of p-cyanophenylalanine fluorescence with Stern-Volmer constants of 39.8 M−1 and 22.1 M−1, respectively. The quenching of p-cyanophenylalanine fluorescence by specific side-chains is exploited to develop specific, high sensitivity, fluorescence probes of helix formation. The approach is demonstrated with Ala based peptides that contain a p-cyanophenylalanine-His or a p-cyanophenylalanine-Tyr pair located at positions i and i+4. The p-cyanophenylalanine-His pair is most useful when the His side-chain is deprotonated and is, thus, complimentary to Trp-His pair which is most sensitive when the His side-chain is protonated. PMID:20565125
Solubilization of cyclohexane in aqueous solutions of sodium. cap alpha. -alkyl alkanoates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sagitani, H.; Suzuki, T.; Nagai, M.
1982-01-01
The effect of branched alkyl chain length and the position of the COONa group on the solubilizing power of n-alkane sodium carboxylates was studied. The lipophilic property and the amount of solubilized cyclohexane increased with the branched chain length of branched soaps, and with the change of the position of the -COONa group from 3 to 7 in the alkyl chain of pentadecane -3, -5, and -7 sodium carboxylates. Alpha-branched soaps having proper branched alkyl chains were better solubilizers for cyclohexane than straight chain compounds. The amount of cyclohexane solublized by C/sub 10/ H/sub 21/ CH(C/sub 6/H/sub 13/) COONa wasmore » about three times greater than the amount solubilized by C/sub 17/ H/sub 35/ COONa. There was a marked increase in the solubilization of cyclohexane replacing ..cap alpha..-branched fatty acid soaps with optimum amount of cosurfactants such as C/sub 8/H/sub 17/ (OCH/sub 2/CH/sub 2/)/sub 2/OH. Namely, solubilization increased markedly at the optimum hydrophile-lipophile balance of mixed surfactant. 21 references.« less
NASA Astrophysics Data System (ADS)
Hsu, Fong-Fu
2016-04-01
Hydroxyphthioceranoic (HPA) and phthioceranoic (PA) acids are polymethylated long chain fatty acids with and without a hydroxyl group attached to the carbon next to the terminal methyl-branched carbon distal to the carboxylic end of the long-chain fatty acid, respectively. They are the major components of the sulfolipids found in the cell wall of Mycobacterium tuberculosis (M. tuberculosis) strain H37Rv. In this report, I describe CID linear ion-trap MSn mass spectrometric approaches combined with charge-reverse derivatization strategy toward characterization of these complex lipids, which were released from sulfolipids by alkaline hydrolysis and sequentially derivatized to the N-(4-aminomethylphenyl) pyridinium (AMPP) derivatives. This method affords complete characterization of HPA and PA, including the location of the hydroxyl group and the multiple methyl side chains. The study also led to the notion that the hydroxyphthioceranoic acid in sulfolipid consists of two (for hC24) to 12 (for hC52) methyl branches, and among them 2,4,6,8,10,12,14,16-octamethyl-17-hydroxydotriacontanoic acid (hC40) is the most prominent, while phthioceranoic acids are the minor constituents. These results confirm our previous findings that sulfolipid II, a family of homologous 2-stearoyl(palmitoyl)-3,6,6'-tris(hydroxyphthioceranoy1)-trehalose 2'-sulfates is the predominant species, and sulfolipid I, a family of homologous 2-stearoyl(palmitoyl)-3-phthioceranoyl-6,6'-bis(hydroxyphthioceranoy1)-trehalose 2'-sulfates is the minor species in the cell wall of M. tuberculosis.
Li, Meng; Jain, Sunit; Baker, Brett J; Taylor, Chris; Dick, Gregory J
2014-01-01
Particulate membrane-associated hydrocarbon monooxygenases (pHMOs) are critical components of the aerobic degradation pathway for low molecular weight hydrocarbons, including the potent greenhouse gas methane. Here, we analysed pHMO gene diversity in metagenomes and metatranscriptomes of hydrocarbon-rich hydrothermal plumes in the Guaymas Basin (GB) and nearby background waters in the deep Gulf of California. Seven distinct phylogenetic groups of pHMO were present and transcriptionally active in both plume and background waters, including several that are undetectable with currently available polymerase chain reaction (PCR) primers. The seven groups of pHMOs included those related to a putative ethane oxidizing Methylococcaceae-like group, a group of the SAR324 Deltaproteobacteria, three deep-sea clades (Deep sea-1/symbiont-like, Deep sea-2/PS-80 and Deep sea-3/OPU3) within gammaproteobacterial methanotrophs, one clade related to Group Z and one unknown group. Differential abundance of pHMO gene transcripts in plume and background suggests niche differentiation between groups. Corresponding 16S rRNA genes reflected similar phylogenetic and transcriptomic abundance trends. The novelty of transcriptionally active pHMOs we recovered from a hydrocarbon-rich hydrothermal plume suggests there are significant gaps in our knowledge of the diversity and function of these enzymes in the environment. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Takahashi, Daisuke; Inomata, Tatsuji; Fukui, Tatsuya
2017-06-26
We previously reported an efficient peptide synthesis method, AJIPHASE®, that comprises repeated reactions and isolations by precipitation. This method utilizes an anchor molecule with long-chain alkyl groups as a protecting group for the C-terminus. To further improve this method, we developed a one-pot synthesis of a peptide sequence wherein the synthetic intermediates were isolated by solvent extraction instead of precipitation. A branched-chain anchor molecule was used in the new process, significantly enhancing the solubility of long peptides and the operational efficiency compared with the previous method, which employed precipitation for isolation and a straight-chain aliphatic group. Another prerequisite for this solvent-extraction-based strategy was the use of thiomalic acid and DBU for Fmoc deprotection, which facilitates the removal of byproducts, such as the fulvene adduct. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bricout, M; Grévent, D; Lebre, A S; Rio, M; Desguerre, I; De Lonlay, P; Valayannopoulos, V; Brunelle, F; Rötig, A; Munnich, A; Boddaert, N
2014-07-01
Mitochondrial diseases are characterised by a broad clinical and genetic heterogeneity that makes diagnosis difficult. Owing to the wide pattern of symptoms in mitochondrial disorders and the constantly growing number of disease genes, their genetic diagnosis is difficult and genotype/phenotype correlations remain elusive. Brain MRI appears as a useful tool for genotype/phenotype correlations. Here, we summarise the various combinations of MRI lesions observed in the most frequent mitochondrial respiratory chain deficiencies so as to direct molecular genetic test in patients at risk of such diseases. We believe that the combination of brain MRI features is of value to support respiratory chain deficiency and direct molecular genetic tests. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
NASA Astrophysics Data System (ADS)
Jiao, Tifeng; Wang, Yujin; Zhang, Qingrui; Zhou, Jingxin; Gao, Faming
2013-04-01
In this paper, new azobenzene imide derivatives with different substituent groups were designed and synthesized. Their gelation behaviors in 21 solvents were tested as novel low-molecular-mass organic gelators. It was shown that the alkyl substituent chains and headgroups of azobenzene residues in gelators played a crucial role in the gelation behavior of all compounds in various organic solvents. More alkyl chains in molecular skeletons in present gelators are favorable for the gelation of organic solvents. Scanning electron microscopy and atomic force microscopy observations revealed that the gelator molecules self-assemble into different aggregates, from wrinkle, lamella, and belt to fiber with the change of solvents. Spectral studies indicated that there existed different H-bond formations between amide groups and conformations of methyl chains. The present work may give some insight to the design and character of new organogelators and soft materials with special molecular structures.
2013-01-01
In this paper, new azobenzene imide derivatives with different substituent groups were designed and synthesized. Their gelation behaviors in 21 solvents were tested as novel low-molecular-mass organic gelators. It was shown that the alkyl substituent chains and headgroups of azobenzene residues in gelators played a crucial role in the gelation behavior of all compounds in various organic solvents. More alkyl chains in molecular skeletons in present gelators are favorable for the gelation of organic solvents. Scanning electron microscopy and atomic force microscopy observations revealed that the gelator molecules self-assemble into different aggregates, from wrinkle, lamella, and belt to fiber with the change of solvents. Spectral studies indicated that there existed different H-bond formations between amide groups and conformations of methyl chains. The present work may give some insight to the design and character of new organogelators and soft materials with special molecular structures. PMID:23566628
Berntsen, Hanne Friis; Bjørklund, Cesilie Granum; Audinot, Jean-Nicolas; Hofer, Tim; Verhaegen, Steven; Lentzen, Esther; Gutleb, Arno Christian; Ropstad, Erik
2017-12-01
The toxicity of long chained perfluoroalkyl acids (PFAAs) has previously been reported to be related to the length of the perfluorinated carbon chain and functional group attached. In the present study, we compared the cytotoxicity of six PFAAs, using primary cultures of rat cerebellar granule neurons (CGNs). Two perfluoroalkyl sulfonic acids (PFSAs, chain length C 6 and C 8 ) and four perfluoroalkyl carboxylic acids (PFCAs, chain length C 8 -C 11 ) were studied. These PFAAs have been detected in human blood and the brain tissue of mammals. The cell viability trypan blue and MTT assays were used to determine toxicity potencies (based on LC 50 values) after 24h exposure (in descending order): perfluoroundecanoic acid (PFUnDA)≥perfluorodecanoic acid (PFDA)>perfluorooctanesulfonic acid potassium salt (PFOS)>perfluorononanoic acid (PFNA)>perfluorooctanoic acid (PFOA)>perfluorohexanesulfonic acid potassium salt (PFHxS). Concentrations of the six PFAAs that produced equipotent effects after 24h exposure were used to further explore the dynamics of viability changes during this period. Therefore viability was assessed at 10, 30, 60, 90, 120 and 180min as well as 6, 12, 18 and 24h. A difference in the onset of reduction in viability was observed, occurring relatively quickly (30-60min) for PFOS, PFDA and PFUnDA, and much slower (12-24h) for PFHxS, PFOA and PFNA. A slight protective effect of vitamin E against PFOA, PFNA and PFOS-induced reduction in viability indicated a possible involvement of oxidative stress. PFOA and PFOS did not induce lipid peroxidation on their own, but significantly accelerated cumene hydroperoxide-induced lipid peroxidation. When distribution of the six PFAAs in the CGN-membrane was investigated using NanoSIMS50 imaging, two distinct patterns appeared. Whereas PFHxS, PFOS and PFUnDA aggregated in large hotspots, PFOA, PFNA and PFDA showed a more dispersed distribution pattern. In conclusion, the toxicity of the investigated PFAAs increased with increasing carbon chain length. For molecules with a similar chain length, a sulfonate functional group led to greater toxicity than a carboxyl group. Copyright © 2017 Elsevier B.V. All rights reserved.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petters, Sarah Suda; Pagonis, Demetrios; Claflin, Megan Suzanne
The albedo and microphysical properties of clouds are controlled in part by the hygroscopicity of particles serving as cloud condensation nuclei (CCN). Hygroscopicity of complex organic mixtures in the atmosphere varies widely and remains challenging to predict. Here we present new measurements characterizing the CCN activity of pure compounds in which carbon chain length and the number of hydroperoxy, carboxyl, and carbonyl functional groups were systematically varied to establish the contributions of these groups to organic aerosol apparent hygroscopicity. Apparent hygroscopicity decreased with carbon chain length and increased with polar functional groups in the order carboxyl > hydroperoxy > carbonyl.more » Activation diameters at different supersaturations deviated from the -3/2 slope in log-log space predicted by Köhler theory, suggesting that water solubility limits CCN activity of particles composed of weakly functionalized organic compounds. Results are compared to a functional group contribution model that predicts CCN activity of organic compounds. The model performed well for most compounds but under-predicted the CCN activity of hydroperoxy groups. New best-fit hydroperoxy group/water interaction parameters were derived from the available CCN data. Lastly, these results may help improve estimates of the CCN activity of ambient organic aerosols from composition data.« less
Petters, Sarah Suda; Pagonis, Demetrios; Claflin, Megan Suzanne; ...
2017-06-16
The albedo and microphysical properties of clouds are controlled in part by the hygroscopicity of particles serving as cloud condensation nuclei (CCN). Hygroscopicity of complex organic mixtures in the atmosphere varies widely and remains challenging to predict. Here we present new measurements characterizing the CCN activity of pure compounds in which carbon chain length and the number of hydroperoxy, carboxyl, and carbonyl functional groups were systematically varied to establish the contributions of these groups to organic aerosol apparent hygroscopicity. Apparent hygroscopicity decreased with carbon chain length and increased with polar functional groups in the order carboxyl > hydroperoxy > carbonyl.more » Activation diameters at different supersaturations deviated from the -3/2 slope in log-log space predicted by Köhler theory, suggesting that water solubility limits CCN activity of particles composed of weakly functionalized organic compounds. Results are compared to a functional group contribution model that predicts CCN activity of organic compounds. The model performed well for most compounds but under-predicted the CCN activity of hydroperoxy groups. New best-fit hydroperoxy group/water interaction parameters were derived from the available CCN data. Lastly, these results may help improve estimates of the CCN activity of ambient organic aerosols from composition data.« less
How major restaurant chains plan their menus: the role of profit, demand, and health.
Glanz, Karen; Resnicow, Ken; Seymour, Jennifer; Hoy, Kathy; Stewart, Hayden; Lyons, Mark; Goldberg, Jeanne
2007-05-01
Increased away-from-home eating is associated with lower diet quality, and may contribute to the increasing prevalence of overweight and obesity. Healthier food choices in restaurants may help mitigate the rise in obesity and improve diet quality. This study sought to understand the views of executives at major U.S. restaurant chains regarding the process, motivation for, and challenges of offering healthier options on their menus. The Healthy Menu Study used in-depth structured telephone interviews with 41 senior menu development and marketing executives at leading casual dining and fast-food restaurant chains. The interview guide covered menu trends, influences on introduction and continuation of new menu items, and barriers to adding healthy foods. Data analysis included tabulation of responses, identification of themes, and examination of subgroup differences. Growing sales and increasing profits are the most important considerations, mentioned by 61% of respondents; health and nutrition were noted as important by 21%. Restaurants may try to avoid losing groups with a "health seeker" by offering healthier foods (low in fat and calories, more fruits and vegetables) (27% of chains), but operators believe demand for healthier foods is not widespread. Additional obstacles to including healthier menu items are short shelf life of produce (46%), increased preparation time, low sales, and high labor costs. Not surprisingly, profit margins are the primary determinants of why restaurants do or do not add and continue to serve healthier food options. Without an increase in consumer demand, it is unlikely the restaurant industry will increase their offering of healthy food choices. Insight into the restaurant industry perspective is important for developing promising strategies to encourage healthier eating patterns.
α-tocopherol is well designed to protect polyunsaturated phospholipids: MD simulations
Leng, Xiaoling; Kinnun, Jacob A.; Marquardt, Drew; ...
2015-10-20
Here, the presumptive function for alpha-tocopherol (αtoc) in membranes is to protect polyunsaturated lipids against oxidation. Although the chemistry of the process is well established, the role played by molecular structure that we address here with atomistic molecular-dynamics simulations remains controversial. The simulations were run in the constant particle NPT ensemble on hydrated lipid bilayers composed of SDPC (1-stearoyl-2-docosahexaenoylphosphatidylcholine, 18:0-22:6PC) and SOPC (1-stearoyl-2-oleoylphosphatidylcholine, 18:0-18:1PC) in the presence of 20 mol % αtoc at 37°C. SDPC with SA (stearic acid) for the sn-1 chain and DHA (docosahexaenoic acid) for the sn-2 chain is representative of polyunsaturated phospholipids, while SOPC with OAmore » (oleic acid) substituted for the sn-2 chain serves as a monounsaturated control. Solid-state 2H nuclear magnetic resonance and neutron diffraction experiments provide validation. The simulations demonstrate that high disorder enhances the probability that DHA chains at the sn-2 position in SDPC rise up to the bilayer surface, whereby they encounter the chromanol group on αtoc molecules. This behavior is reflected in the van der Waals energy of interaction between αtoc and acyl chains, and illustrated by density maps of distribution for acyl chains around αtoc molecules that were constructed. An ability to more easily penetrate deep into the bilayer is another attribute conferred upon the chromanol group in αtoc by the high disorder possessed by DHA. By examining the trajectory of single molecules, we found that αtoc flip-flops across the SDPC bilayer on a submicrosecond timescale that is an order-of-magnitude greater than in SOPC. Our results reveal mechanisms by which the sacrificial hydroxyl group on the chromanol group can trap lipid peroxyl radicals within the interior and near the surface of a polyunsaturated membrane. At the same time, water-soluble reducing agents that regenerate αtoc can access the chromanol group when it locates at the surface.« less
Surface properties of functional polymer systems
NASA Astrophysics Data System (ADS)
Wong, Derek
Polymer surface modification typically involves blending with other polymers or chemical modification of the parent polymer. Such strategies inevitably result in polymer systems that are spatially and chemically heterogeneous, and which exhibit the phenomenon of surface segregation. This work investigates the effects of chain architecture on the surface segregation behavior of such functionally modified polymers using a series of end- and center-fluorinated poly(D,L-lactide). Surface segregation of the fluorinated functional groups was observed in both chain architectures via AMPS and water contact angle. Higher surface segregation was noted for functional groups located at the chain end as opposed to those in the middle of the chain. A self-consistent mean-field lattice theory was used to model the composition depth profiles of functional groups and excellent agreement was found between the model predictions and the experimental AMPS data in both chain architectures. Polymer properties are also in general dependent on both time and temperature, and exhibit a range of relaxation times in response to environmental stimuli. This behavior arises from the characteristic frequencies of molecular motions of the polymer chain and the interrelationship between time and temperature has been widely established for polymer bulk properties. There is evidence that surface properties also respond in a manner that is time and temperature dependent and that this dependence may not be the same as that observed for bulk properties. AMPS and water contact angle experiments were used to investigate the surface reorganization behavior of functional groups using a series of anionically synthesized end-fluorinated and end-carboxylated poly(styrene). It was found that both types of functional end-groups reorganized upon a change in the polarity of the surface environment in order to minimize the surface free energy. ADXPS and contact angle results suggest that the reorganization depth was confined to the top 2--3 nm of the surface. Contact angle results showed also that the reorganization process proceeded as a function of (time) 1/2, indicating that it is likely diffusion controlled. The magnitudes of the activation energies determined from the experimental data according to the Arhenius equation, suggest that the process is possibly correlated with known bulk beta and gamma relaxations in the polymer.
α-Tocopherol Is Well Designed to Protect Polyunsaturated Phospholipids: MD Simulations
Leng, Xiaoling; Kinnun, Jacob J.; Marquardt, Drew; Ghefli, Mikel; Kučerka, Norbert; Katsaras, John; Atkinson, Jeffrey; Harroun, Thad A.; Feller, Scott E.; Wassall, Stephen R.
2015-01-01
The presumptive function for alpha-tocopherol (αtoc) in membranes is to protect polyunsaturated lipids against oxidation. Although the chemistry of the process is well established, the role played by molecular structure that we address here with atomistic molecular-dynamics simulations remains controversial. The simulations were run in the constant particle NPT ensemble on hydrated lipid bilayers composed of SDPC (1-stearoyl-2-docosahexaenoylphosphatidylcholine, 18:0-22:6PC) and SOPC (1-stearoyl-2-oleoylphosphatidylcholine, 18:0-18:1PC) in the presence of 20 mol % αtoc at 37°C. SDPC with SA (stearic acid) for the sn-1 chain and DHA (docosahexaenoic acid) for the sn-2 chain is representative of polyunsaturated phospholipids, while SOPC with OA (oleic acid) substituted for the sn-2 chain serves as a monounsaturated control. Solid-state 2H nuclear magnetic resonance and neutron diffraction experiments provide validation. The simulations demonstrate that high disorder enhances the probability that DHA chains at the sn-2 position in SDPC rise up to the bilayer surface, whereby they encounter the chromanol group on αtoc molecules. This behavior is reflected in the van der Waals energy of interaction between αtoc and acyl chains, and illustrated by density maps of distribution for acyl chains around αtoc molecules that were constructed. An ability to more easily penetrate deep into the bilayer is another attribute conferred upon the chromanol group in αtoc by the high disorder possessed by DHA. By examining the trajectory of single molecules, we found that αtoc flip-flops across the SDPC bilayer on a submicrosecond timescale that is an order-of-magnitude greater than in SOPC. Our results reveal mechanisms by which the sacrificial hydroxyl group on the chromanol group can trap lipid peroxyl radicals within the interior and near the surface of a polyunsaturated membrane. At the same time, water-soluble reducing agents that regenerate αtoc can access the chromanol group when it locates at the surface. PMID:26488652
α-Tocopherol Is Well Designed to Protect Polyunsaturated Phospholipids: MD Simulations.
Leng, Xiaoling; Kinnun, Jacob J; Marquardt, Drew; Ghefli, Mikel; Kučerka, Norbert; Katsaras, John; Atkinson, Jeffrey; Harroun, Thad A; Feller, Scott E; Wassall, Stephen R
2015-10-20
The presumptive function for alpha-tocopherol (αtoc) in membranes is to protect polyunsaturated lipids against oxidation. Although the chemistry of the process is well established, the role played by molecular structure that we address here with atomistic molecular-dynamics simulations remains controversial. The simulations were run in the constant particle NPT ensemble on hydrated lipid bilayers composed of SDPC (1-stearoyl-2-docosahexaenoylphosphatidylcholine, 18:0-22:6PC) and SOPC (1-stearoyl-2-oleoylphosphatidylcholine, 18:0-18:1PC) in the presence of 20 mol % αtoc at 37°C. SDPC with SA (stearic acid) for the sn-1 chain and DHA (docosahexaenoic acid) for the sn-2 chain is representative of polyunsaturated phospholipids, while SOPC with OA (oleic acid) substituted for the sn-2 chain serves as a monounsaturated control. Solid-state (2)H nuclear magnetic resonance and neutron diffraction experiments provide validation. The simulations demonstrate that high disorder enhances the probability that DHA chains at the sn-2 position in SDPC rise up to the bilayer surface, whereby they encounter the chromanol group on αtoc molecules. This behavior is reflected in the van der Waals energy of interaction between αtoc and acyl chains, and illustrated by density maps of distribution for acyl chains around αtoc molecules that were constructed. An ability to more easily penetrate deep into the bilayer is another attribute conferred upon the chromanol group in αtoc by the high disorder possessed by DHA. By examining the trajectory of single molecules, we found that αtoc flip-flops across the SDPC bilayer on a submicrosecond timescale that is an order-of-magnitude greater than in SOPC. Our results reveal mechanisms by which the sacrificial hydroxyl group on the chromanol group can trap lipid peroxyl radicals within the interior and near the surface of a polyunsaturated membrane. At the same time, water-soluble reducing agents that regenerate αtoc can access the chromanol group when it locates at the surface. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Nonsimultaneous chains and dominos in kidney- paired donation-revisited.
Ashlagi, I; Gilchrist, D S; Roth, A E; Rees, M A
2011-05-01
Since 2008, kidney exchange in America has grown in part from the incorporation of nondirected donors in transplant chains rather than simple exchanges. It is controversial whether these chains should be performed simultaneously 'domino-paired donation', (DPD) or nonsimultaneously 'nonsimultaneous extended altruistic donor, chains (NEAD). NEAD chains create 'bridge donors' whose incompatible recipients receive kidneys before the bridge donor donates, and so risk reneging by bridge donors, but offer the opportunity to create more transplants by overcoming logistical barriers inherent in simultaneous chains. Gentry et al. simulated whether DPD or NEAD chains would produce more transplants when chain segment length was limited to three transplants, and reported that DPD performed at least as well as NEAD chains. As this finding contrasts with the experience of several groups involved in kidney-paired donation, we performed simulations that allowed for longer chain segments and used actual patient data from the Alliance for Paired Donation. When chain segments of 4-6 transplants are allowed in the simulations, NEAD chains produce more transplants than DPD. Our simulations showed not only more transplants as chain length increased, but also that NEAD chains produced more transplants for highly sensitized and blood type O recipients. ©2011 The Authors Journal compilation©2011 The American Society of Transplantation and the American Society of Transplant Surgeons.
Exact phase boundaries and topological phase transitions of the X Y Z spin chain
NASA Astrophysics Data System (ADS)
Jafari, S. A.
2017-07-01
Within the block spin renormalization group, we give a very simple derivation of the exact phase boundaries of the X Y Z spin chain. First, we identify the Ising order along x ̂ or y ̂ as attractive renormalization group fixed points of the Kitaev chain. Then, in a global phase space composed of the anisotropy λ of the X Y interaction and the coupling Δ of the Δ σzσz interaction, we find that the above fixed points remain attractive in the two-dimesional parameter space. We therefore classify the gapped phases of the X Y Z spin chain as: (1) either attracted to the Ising limit of the Kitaev-chain, which in turn is characterized by winding number ±1 , depending on whether the Ising order parameter is along x ̂ or y ̂ directions; or (2) attracted to the charge density wave (CDW) phases of the underlying Jordan-Wigner fermions, which is characterized by zero winding number. We therefore establish that the exact phase boundaries of the X Y Z model in Baxter's solution indeed correspond to topological phase transitions. The topological nature of the phase transitions of the X Y Z model justifies why our analytical solution of the three-site problem that is at the core of the present renormalization group treatment is able to produce the exact phase boundaries of Baxter's solution. We argue that the distribution of the winding numbers between the three Ising phases is a matter of choice of the coordinate system, and therefore the CDW-Ising phase is entitled to host appropriate form of zero modes. We further observe that in the Kitaev-chain the renormalization group flow can be cast into a geometric progression of a properly identified parameter. We show that this new parameter is actually the size of the (Majorana) zero modes.
Dhar, Jesmita; Chakrabarti, Pinak; Saini, Harpreet; Raghava, Gajendra Pal Singh; Kishore, Raghuvansh
2015-02-01
Mimicry of structural motifs is a common feature in proteins. The 10-membered hydrogen-bonded ring involving the main-chain C − O in a β-turn can be formed using a side-chain carbonyl group leading to Asx-turn. We show that the N − H component of hydrogen bond can be replaced by a C(γ) -H group in the side chain, culminating in a nonconventional C − H···O interaction. Because of its shape this β-turn mimic is designated as ω-turn, which is found to occur ∼ three times per 100 residues. Three residues (i to i + 2) constitute the turn with the C − H···O interaction occurring between the terminal residues, constraining the torsion angles ϕi + 1, ψi + 1, ϕi + 2 and χ'1(i + 2) (using the interacting C(γ) atom). Based on these angles there are two types of ω-turns, each of which can be further divided into two groups. C(β) -branched side-chains, and Met and Gln have high propensities to occur at i + 2; for the last two residues the carbonyl oxygen may participate in an additional interaction involving the S and amino group, respectively. With Cys occupying the i + 1 position, such turns are found in the metal-binding sites. N-linked glycosylation occurs at the consensus pattern Asn-Xaa-Ser/Thr; with Thr at i + 2, the sequence can adopt the secondary structure of a ω-turn, which may be the recognition site for protein modification. Location between two β-strands is the most common occurrence in protein tertiary structure, and being generally exposed ω-turn may constitute the antigenic determinant site. It is a stable scaffold and may be used in protein engineering and peptide design. © 2014 Wiley Periodicals, Inc.
What is the Right RFID for Your Process?
2006-04-30
chain efficiency at the US Department of Defense (DoD) and at major retailers such as Wal-Mart, Tesco and others has prompted these organizations...areas of expertise include global operations, supply- chain management, sustainable technologies, product stewardship, reverse logistics and...time MBA programs. Areas of Apte’s research interests include managing service operations, supply- chain management, technology management, and
Shin, Jicheol; Park, Gi Eun; Lee, Dae Hee; Um, Hyun Ah; Lee, Tae Wan; Cho, Min Ju; Choi, Dong Hoon
2015-02-11
New thienothiophene-flanked diketopyrrolopyrrole and thiophene-containing π-extended conjugated polymers with various branched alkyl side-chains were successfully synthesized. 2-Octyldodecyl, 2-decyltetradecyl, 2-tetradecylhexadecyl, 2-hexadecyloctadecyl, and 2-octadecyldocosyl groups were selected as the side-chain moieties and were anchored to the N-positions of the thienothiophene-flanked diketopyrrolopyrrole unit. All five polymers were found to be soluble owing to the bulkiness of the side chains. The thin-film transistor based on the 2-tetradecylhexadecyl-substituted polymer showed the highest hole mobility of 1.92 cm2 V(-1) s(-1) due to it having the smallest π-π stacking distance between the polymer chains, which was determined by grazing incidence X-ray diffraction. Bulk heterojunction polymer solar cells incorporating [6,6]-phenyl-C71-butyric acid methyl ester as the n-type molecule and the additive 1,8-diiodooctane (1 vol %) were also constructed from the synthesized polymers without thermal annealing; the device containing the 2-octyldodecyl-substituted polymer exhibited the highest power conversion efficiency of 5.8%. Although all the polymers showed similar physical properties, their device performance was clearly influenced by the sizes of the branched alkyl side-chain groups.
Propagating synchrony in feed-forward networks
Jahnke, Sven; Memmesheimer, Raoul-Martin; Timme, Marc
2013-01-01
Coordinated patterns of precisely timed action potentials (spikes) emerge in a variety of neural circuits but their dynamical origin is still not well understood. One hypothesis states that synchronous activity propagating through feed-forward chains of groups of neurons (synfire chains) may dynamically generate such spike patterns. Additionally, synfire chains offer the possibility to enable reliable signal transmission. So far, mostly densely connected chains, often with all-to-all connectivity between groups, have been theoretically and computationally studied. Yet, such prominent feed-forward structures have not been observed experimentally. Here we analytically and numerically investigate under which conditions diluted feed-forward chains may exhibit synchrony propagation. In addition to conventional linear input summation, we study the impact of non-linear, non-additive summation accounting for the effect of fast dendritic spikes. The non-linearities promote synchronous inputs to generate precisely timed spikes. We identify how non-additive coupling relaxes the conditions on connectivity such that it enables synchrony propagation at connectivities substantially lower than required for linearly coupled chains. Although the analytical treatment is based on a simple leaky integrate-and-fire neuron model, we show how to generalize our methods to biologically more detailed neuron models and verify our results by numerical simulations with, e.g., Hodgkin Huxley type neurons. PMID:24298251
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.
The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with ({sup 3}H)N-ethylmaleimide. This pool of soluble alpha chains was 0.067 {plus minus} 0.017% of hemoglobin in blood of normal adult, 0.11 {plus minus} 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% inmore » the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using ({sup 3}H)N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups.« less
Kaever, Thomas; Meng, Xiangzhi; Matho, Michael H.; Schlossman, Andrew; Li, Sheng; Sela-Culang, Inbal; Ofran, Yanay; Buller, Mark; Crump, Ryan W.; Parker, Scott; Frazier, April; Crotty, Shane; Zajonc, Dirk M.; Peters, Bjoern
2014-01-01
ABSTRACT Vaccinia virus (VACV) L1 is an important target for viral neutralization and has been included in multicomponent DNA or protein vaccines against orthopoxviruses. To further understand the protective mechanism of the anti-L1 antibodies, we generated five murine anti-L1 monoclonal antibodies (MAbs), which clustered into 3 distinct epitope groups. While two groups of anti-L1 failed to neutralize, one group of 3 MAbs potently neutralized VACV in an isotype- and complement-independent manner. This is in contrast to neutralizing antibodies against major VACV envelope proteins, such as H3, D8, or A27, which failed to completely neutralize VACV unless the antibodies are of complement-fixing isotypes and complement is present. Compared to nonneutralizing anti-L1 MAbs, the neutralization antibodies bound to the recombinant L1 protein with a significantly higher affinity and also could bind to virions. By using a variety of techniques, including the isolation of neutralization escape mutants, hydrogen/deuterium exchange mass spectrometry, and X-ray crystallography, the epitope of the neutralizing antibodies was mapped to a conformational epitope with Asp35 as the key residue. This epitope is similar to the epitope of 7D11, a previously described potent VACV neutralizing antibody. The epitope was recognized mainly by CDR1 and CDR2 of the heavy chain, which are highly conserved among antibodies recognizing the epitope. These antibodies, however, had divergent light-chain and heavy-chain CDR3 sequences. Our study demonstrates that the conformational L1 epitope with Asp35 is a common site of vulnerability for potent neutralization by a divergent group of antibodies. IMPORTANCE Vaccinia virus, the live vaccine for smallpox, is one of the most successful vaccines in human history, but it presents a level of risk that has become unacceptable for the current population. Studying the immune protection mechanism of smallpox vaccine is important for understanding the basic principle of successful vaccines and the development of next-generation, safer vaccines for highly pathogenic orthopoxviruses. We studied antibody targets in smallpox vaccine by developing potent neutralizing antibodies against vaccinia virus and comprehensively characterizing their epitopes. We found a site in vaccinia virus L1 protein as the target of a group of highly potent murine neutralizing antibodies. The analysis of antibody-antigen complex structure and the sequences of the antibody genes shed light on how these potent neutralizing antibodies are elicited from immunized mice. PMID:25031354
Hong, Chi Rac; Lee, Gyu Whan; Paik, Hyun-Dong; Chang, Pahn-Shick; Choi, Seung Jun
2018-01-15
This study confirmed the possibility of biopolymer-type stabilizers to increase the saturation concentration of branched-chain amino acids by preventing their crystallization/precipitation. Although microfluidization increased the initial solubility, it failed to increase the saturation concentration of the branched-chain amino acids. The saturation concentration of the branched-chain amino acids increased from 3.81% to 4.42% and 4.85% after the incorporation of food hydrocolloids and proteins, respectively. However, the branched-chain amino acids:stabilizer ratio did not affect the solubility. In the case of food hydrocolloid-based solutions, crystal formation and growth of branched-chain amino acids occurred during storage, resulting in the precipitation of branched-chain amino acid crystals. However, food proteins effectively increased the stability of the solubilized branched-chain amino acids. The improved solubility and stability of the solubilized branched-chain amino acids could be attributed to interactions between the functional groups (carboxyl, amine, sulfate, aliphatic, aromatic, etc.) of the stabilizer and the branched-chain amino acid molecules. Copyright © 2017 Elsevier Ltd. All rights reserved.
Martín-Sanz, Alberto; de la Vega, Marcelino Pérez; Murillo, Jesús; Caminero, Constantino
2013-07-01
Pseudomonas syringae pv. syringae causes extensive yield losses in the pea crop worldwide, although there is little information on its host specialization and its interactions with pea. A collection of 88 putative P. syringae pv. syringae strains (including 39 strains isolated from pea) was characterized by repetitive polymerase chain reaction (rep-PCR), multilocus sequence typing (MLST), and syrB amplification and evaluated for pathogenicity and virulence. rep-PCR data grouped the strains from pea into two groups (1B and 1C) together with strains from other hosts; a third group (1A) was formed exclusively with strains isolated from non-legume species. MLST data included all strains from pea in the genomospecies 1 of P. syringae pathovars defined in previous studies; they were distributed in the same three groups defined by rep-PCR. The inoculations performed in two pea cultivars showed that P. syringae pv. syringae strains from groups 1A and 1C were less virulent than strains from group 1B, suggesting a possible pathogenic specialization in this group. This study shows the existence of genetically and pathogenically distinct P. syringae pv. syringae strain groups from pea, which will be useful for the diagnostic and epidemiology of this pathogen and for disease resistance breeding.
Highly conductive side chain block copolymer anion exchange membranes.
Wang, Lizhu; Hickner, Michael A
2016-06-28
Block copolymers based on poly(styrene) having pendent trimethyl styrenylbutyl ammonium (with four carbon ring-ionic group alkyl linkers) or benzyltrimethyl ammonium groups with a methylene bridge between the ring and ionic group were synthesized by reversible addition-fragmentation radical (RAFT) polymerization as anion exchange membranes (AEMs). The C4 side chain polymer showed a 17% increase in Cl(-) conductivity of 33.7 mS cm(-1) compared to the benzyltrimethyl ammonium sample (28.9 mS cm(-1)) under the same conditions (IEC = 3.20 meq. g(-1), hydration number, λ = ∼7.0, cast from DMF/1-propanol (v/v = 3 : 1), relative humidity = 95%). As confirmed by small angle X-ray scattering (SAXS), the side chain block copolymers with tethered ammonium cations showed well-defined lamellar morphologies and a significant reduction in interdomain spacing compared to benzyltrimethyl ammonium containing block copolymers. The chemical stabilities of the block copolymers were evaluated under severe, accelerated conditions, and degradation was observed by (1)H NMR. The block copolymer with C4 side chain trimethyl styrenylbutyl ammonium motifs displayed slightly improved stability compared to that of a benzyltrimethyl ammonium-based AEM at 80 °C in 1 M NaOD aqueous solution for 30 days.
Muffler, L.J.P.; Clynne, M.A.; Calvert, A.T.; Champion, D.E.
2011-01-01
The Poison Lake chain consists of small, monogenetic, calc-alkaline basaltic volcanoes located east of the Cascade arc axis, 30 km ENE of Lassen Peak in northeastern California. This chain consists of 39 distinguishable units in a 14-km-long and 2-kmwide zone trending NNW, parallel to nearby Quaternary normal faults. The 39 units fall into nine coherent groups based on stratigraphy, field characteristics, petrography, and major-element compositions. Petrographic differences among groups are expressed by different amounts and proportions of phenocrysts. MgO-SiO 2, K 2O-SiO 2, and TiO 2-SiO 2 variation diagrams illustrate clear differences in compatible and incompatible elements among the groups. Variation of K 2O/ TiO 2 and K 2O/P 2O 5 with MgO indicates that most of the basalts of the Poison Lake chain cannot be related by crystal fractionation at different pressures and that compositions have not been affected significantly by incorporation of low-degree silicic crustal melt or interaction with sialic crust. Limited traceelement and whole-rock isotopic data also suggest little if any incorporation of uppercrustal material, and that compositional variation among groups primarily reflects source compositional differences. Precise 40Ar/ 39Ar determinations show that the lavas were erupted between 100 and 110 ka. The migration of paleomagnetic remanent directions over 30?? suggests that the entire Poison Lake chain could represent three short-lived episodes of volcanism within a period as brief as 500 yr. The diverse geologic, petrographic, chemical, paleomagnetic, and age data indicate that each of the nine groups represents a small, discrete magma batch generated in the mantle and stored briefly in the lower crust. A NNW normal fault zone provided episodic conduits that allowed rapid ascent of these batches to the surface, where they erupted as distinct volcanic groups, each aligned along a segment of the Poison Lake chain. Compositional diversity of these primitive magmas argues against widespread, long-lived ponding of uniform basalt magma at the base of the crust in this region and against interaction with a zone of melting, assimilation, storage, and homogenization (MASH) in the lower crust. ?? 2011 Geological Society of America.
Parallel and serial grouping of image elements in visual perception.
Houtkamp, Roos; Roelfsema, Pieter R
2010-12-01
The visual system groups image elements that belong to an object and segregates them from other objects and the background. Important cues for this grouping process are the Gestalt criteria, and most theories propose that these are applied in parallel across the visual scene. Here, we find that Gestalt grouping can indeed occur in parallel in some situations, but we demonstrate that there are also situations where Gestalt grouping becomes serial. We observe substantial time delays when image elements have to be grouped indirectly through a chain of local groupings. We call this chaining process incremental grouping and demonstrate that it can occur for only a single object at a time. We suggest that incremental grouping requires the gradual spread of object-based attention so that eventually all the object's parts become grouped explicitly by an attentional labeling process. Our findings inspire a new incremental grouping theory that relates the parallel, local grouping process to feedforward processing and the serial, incremental grouping process to recurrent processing in the visual cortex.
Biopolymers Containing Unnatural Amino Acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schultz, Peter
Although the main chain structure of polymers has a profound effect on their materials properties, the side groups can also have dramatic effects on their properties including conductivity, liquid crystallinity, hydrophobicity, elasticity and biodegradability. Unfortunately control over the side chain structure of polymers remains a challenge – it is difficult to control the sequence of chain elongation when mixtures of monomers are polymerized, and postpolymerization side chain modification is made difficult by polymer effects on side chain reactivity. In contrast, the mRNA templated synthesis of polypeptides on the ribosome affords absolute control over the primary sequence of the twenty aminomore » acid monomers. Moreover, the length of the biopolymer is precisely controlled as are sites of crosslinking. However, whereas synthetic polymers can be synthesized from monomers with a wide range of chemically defined structures, ribosomal biosynthesis is largely limited to the 20 canonical amino acids. For many applications in material sciences, additional building blocks would be desirable, for example, amino acids containing metallocene, photoactive, and halogenated side chains. To overcome this natural constraint we have developed a method that allows unnatural amino acids, beyond the common twenty, to be genetically encoded in response to nonsense or frameshift codons in bacteria, yeast and mammalian cells with high fidelity and good yields. Here we have developed methods that allow identical or distinct noncanonical amino acids to be incorporated at multiple sites in a polypeptide chain, potentially leading to a new class of templated biopolymers. We have also developed improved methods for genetically encoding unnatural amino acids. In addition, we have genetically encoded new amino acids with novel physical and chemical properties that allow selective modification of proteins with synthetic agents. Finally, we have evolved new metal-ion binding sites in proteins using a novel metal-ion binding amino acid, which may facilitate our ability to generate new protein based sensors and catalysts.« less
Biopolymers Containing Unnatural Building Blocks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schultz, Peter G.
2013-06-30
Although the main chain structure of polymers has a profound effect on their materials properties, the side groups can also have dramatic effects on their properties including conductivity, liquid crystallinity, hydrophobicity, elasticity and biodegradability. Unfortunately control over the side chain structure of polymers remains a challenge – it is difficult to control the sequence of chain elongation when mixtures of monomers are polymerized, and postpolymerization side chain modification is made difficult by polymer effects on side chain reactivity. In contrast, the mRNA templated synthesis of polypeptides on the ribosome affords absolute control over the primary sequence of the twenty aminomore » acid monomers. Moreover, the length of the biopolymer is precisely controlled as are sites of crosslinking. However, whereas synthetic polymers can be synthesized from monomers with a wide range of chemically defined structures, ribosomal biosynthesis is largely limited to the 20 canonical amino acids. For many applications in material sciences, additional building blocks would be desirable, for example, amino acids containing metallocene, photoactive, and halogenated side chains. To overcome this natural constraint we have developed a method that allows unnatural amino acids, beyond the common twenty, to be genetically encoded in response to nonsense or frameshift codons in bacteria, yeast and mammalian cells with high fidelity and good yields. Here we have developed methods that allow identical or distinct noncanonical amino acids to be incorporated at multiple sites in a polypeptide chain, potentially leading to a new class of templated biopolymers. We have also developed improved methods for genetically encoding unnatural amino acids. In addition, we have genetically encoded new amino acids with novel physical and chemical properties that allow selective modification of proteins with synthetic agents. Finally, we have evolved new metal-ion binding sites in proteins using a novel metal-ion binding amino acid, which may facilitate our ability to generate new protein based sensors and catalysts.« less
Validation of serum free light chain reference ranges in primary care.
Galvani, Luca; Flanagan, Jane; Sargazi, Mansour; Neithercut, William D
2016-05-01
The demand for measurement of serum immunoglobulin free kappa (κ) and lambda (λ) light chains has increased. The κ:λ ratio is used to assist in diagnosis/monitoring of plasma cell disorders. The binding site reference range for serum-free light chain κ:λ ratios of 0.26-1.65 was derived from healthy volunteers. Subsequently, a reference range of 0.37-3.1 for patients with chronic kidney disease has been proposed. Elevated free light chain concentrations and borderline raised free light chain ratios also may be found in polyclonal gammopathies and with other non-renal illnesses. This assessment was conducted to validate the established free light chain reference ranges in individuals from primary care. A total of 130 samples were identified from routine blood samples collected in primary care for routine biochemistry testing and estimated glomerular filtration rate calculation. The median and range of κ:λ ratios found in each estimated glomerular filtration rate group used for chronic kidney disease classification were higher than previously described. This was the case for individuals with normal or essentially normal renal function with estimated glomerular filtration rates>90, (0.58-1.76) and estimated glomerular filtration rate of 60-90 mL/min/1.73 m(2), (0.71-1.93). Individuals with estimated glomerular filtration rate 15-30, (0.72-4.50) and estimated glomerular filtration rate <15 ml/min/1.73 m(2) (0.71-4.95) also had higher values when compared to the current renal reference range of 0.37-3.10. Elevation of free light chain-κ:λ ratios may occur in the absence of a reduced renal function shown by a normal estimated glomerular filtration rate and in the presence of reduced renal function by estimated glomerular filtration rate when comparing results with the established reference ranges. Explanations include choice of analytical systems or the presence of other concurrent non-plasma cell illness. © The Author(s) 2016.
Supply chain analysis of e-tailing versus retailing operation - a case study
NASA Astrophysics Data System (ADS)
Kumar, Sameer; Tiffany, Maryellen; Vaidya, Salil
2016-07-01
The swift growth of e-commerce or e-tailing as a consumer retail channel has made it a serious competitor to traditional retail channels and is changing consumers' purchasing behaviour. The purpose of this case study, based on Target and Amazon.com, is to analyse the attributes of traditional retailing, e-tailing, and hybrid supply chain models to form conclusions about the feasibility of an idealised supply chain model for the future. An integrated and generalised modelling framework is used that incorporates Six Sigma - define, measure, analyse, improve, control methodology leveraging various tools, including process flow maps, cause and effect diagram, performance efficiency metrics, failure mode and effects analysis (FMEA), and Monte Carlo simulation. Based on this analysis and research, the conclusion is that the idealised supply chain of the future may evolve into a hybrid supply chain, which includes both e-tail and retail channels. The main recommendations from this study include assessing the risks of migrating to such a hybrid supply chain and to leverage the recommended actions provided in the hybrid FMEA. To facilitate more effective and mature processes, this study can guide researchers in exhaustive empirical evaluations of hybrid supply chains, gather experiences and lessons learned for practitioners.
Zhao, Chen; Shi, Zong-Hai; Zhong, Jun; Liu, Jian-Guo; Li, Jun-Qing
2016-01-01
In this study, soil samples collected from different plain afforestation time (1 year, 4 years, 10 years, 15 years, and 20 years) in Miyun were characterized, including total organic carbon (TOC), total nitrogen (TN), total phosphorus (TP), available K (K+), microbial biomass carbon (MBC), and dissolved organic carbon (DOC). The DOM in the soil samples with different afforestation time was further characterized via DOC, UV-Visible spectroscopy, excitation-emission matrix (EEM) fluorescence spectroscopy, and 1H NMR spectroscopy. The results suggested that the texture of soil sample was sandy. The extracted DOM from soil consisted mainly of aliphatic chains and only a minor aromatic component. It can be included that afforestation can improve the soil quality to some extent, which can be partly reflected from the indexes like TOC, TN, TP, K+, MBC, and DOC. And the characterization of DOM implied that UV humic-like substances were the major fluorophores components in the DOM of the soil samples, which consisted of aliphatic chains and aromatic components with carbonyl, carboxyl, and hydroxyl groups. PMID:27433371
Magnetization curves of di-, tri- and tetramerized mixed spin-1 and spin-2 Heisenberg chains
NASA Astrophysics Data System (ADS)
Karľová, Katarína; Strečka, Jozef
2018-05-01
Magnetization curves of ferrimagnetic mixed spin-1 and spin-2 Heisenberg chains are calculated with the help of density-matrix renormalization group method and quantum Monte Carlo simulations by considering a spin dimerization (1,2), trimerization (1,1,2) and tetramerization (1,1,1,2). The investigated mixed-spin Heisenberg chains can be alternatively viewed as a pure spin-1 Heisenberg chain, which contains at a regular lattice positions spin-2 particles. Unlike the antiferromagnetic spin-1 Heisenberg chain solely displaying a zero magnetization plateau due to the Haldane phase, the ferrimagnetic mixed spin-(1,2), spin-(1,1,2) and spin-(1,1,1,2) Heisenberg chains exhibit more striking magnetization curves involving at least two intermediate magnetization plateaux and quantum spin-liquid states.
Nacharaju, Parimala; Boctor, Fouad N; Manjula, Belur N; Acharya, Seetharama A
2005-03-01
The surface decoration of red blood cells (RBCs) by polyethylene glycol (PEG) chains has been an approach developed to camouflage the blood group antigens from their antibodies. A PEGylation protocol, however, that can mask the antigens appropriately to inhibit the agglutination of RBCs with the respective antibodies is not available so far. A new approach for PEGylation of RBC membrane proteins has been designed with thiolation-mediated maleimide chemistry. The accessibility of the surface lysine residues of membrane proteins to bulky PEG reagents was increased by linking an extension arm carrying a thiol group. RBCs have been PEGylated by thiolation-mediated chemistry with maleimidophenyl-PEG (Mal-Phe-PEG) reagents of different chain lengths. Mal-Phe-PEG-5000 chains alone masked the most important antigens of the Rh system (C, c, E, e, and D) from their antibodies. The masking of the A and B antigens needed a combination of Mal-Phe-PEG-5000 and Mal-Phe-PEG-20000 chains to inhibit the agglutination of RBCs completely with anti-A or anti-B. Thiolation-mediated PEGylation of RBCs with Mal-Phe-PEG-5000 and Mal-Phe-PEG-20000 converts Group A Rh(D)+ and B Rh(D)+ RBCs into RBCs with serologic behavior comparable to Group O Rh(D)- RBCs that are considered as universal RBCs for transfusion.
Uyar, Zafer; Degirmenci, Mustafa; Genli, Nasrettin; Yilmaz, Ayse
2017-01-01
Abstract A new well-defined bisbenzoin group end-functionalized poly(ε-caprolactone) macrophotoinitiator (PCL-(PI)2) was synthesized by combination of ring opening polymerization (ROP) and click chemistry. The ROP of ε-CL monomer in bulk at 110 °C, by means of a hydroxyl functional initiator namely, 3-cyclohexene-1-methanol in conjunction with stannous-2-ethylhexanoate, (Sn(Oct)2), yielded a well-defined PCL with a cyclohexene end-chain group (PCL-CH). The bromination and subsequent azidation of the cyclohexene end-chain group gave bisazido functionalized poly(ε-caprolactone) (PCL-(N3)2). Separately, an acetylene functionalized benzoin photoinitiator (PI-alkyne) was synthesized by using benzoin and propargyl bromide. Then the click reaction between PCL-(N3)2 and PI-alkyne was performed by Cu(I) catalysis. The spectroscopic studies revealed that poly(ε-caprolactone) with bisbenzoin photoactive functional group at the chain end (PCL-(PI)2) with controlled chain length and low-polydispersity was obtained. This PCL-(PI)2 macrophotoinitiator was used as a precursor in photoinduced free radical promoted cationic polymerization to synthesize an AB2-type miktoarm star copolymer consisting of poly(ε-caprolactone) (PCL, as A block) and poly(cyclohexene oxide) (PCHO, as B block), namely PCL(PCHO)2. PMID:29491778
Ran, Jin; Wu, Liang; Wei, Bing; Chen, Yaoyao; Xu, Tongwen
2014-01-01
Polymeric materials as anion exchange membranes (AEMs) play an essential role in the field of energy and environment. The achievement of high performance AEMs by the precise manipulation of macromolecular architecture remains a daunting challenge. Herein, we firstly report a novel rod-coil graft copolymer AEM, possessing rigid hydrophobic main chains and soft hydrophilic graft chains. The low graft density, which can alleviate the adverse influences of ioinc graft chains on the main chains, was obtained by using the living polymerization technique. Consequently, the grafted ionic groups which result in the degradation of polymer backbone was decreased to a small degree. Moreover, the relatively long graft chains induced the nanophase separation between the hydrophobic polymer chains and hydrophilic graft chains, which creates a convinient pathway for high hydroxide ion mobility. Such an accurate molecular design simultaneously improves the hydroxide ion conductivity and alkaline stability as well as dimensional stability. PMID:25255843
Characterization of Lipid A Variants by Energy-Resolved Mass Spectrometry: Impact of Acyl Chains
NASA Astrophysics Data System (ADS)
Crittenden, Christopher M.; Akin, Lucas D.; Morrison, Lindsay J.; Trent, M. Stephen; Brodbelt, Jennifer S.
2017-06-01
Lipid A molecules consist of a diglucosamine sugar core with a number of appended acyl chains that vary in their length and connectivity. Because of the challenging nature of characterizing these molecules and differentiating between isomeric species, an energy-resolved MS/MS strategy was undertaken to track the fragmentation trends and map genealogies of product ions originating from consecutive cleavages of acyl chains. Generalizations were developed based on the number and locations of the primary and secondary acyl chains as well as variations in preferential cleavages arising from the location of the phosphate groups. Secondary acyl chain cleavage occurs most readily for lipid A species at the 3' position, followed by primary acyl chain fragmentation at both the 3' and 3 positions. In the instances of bisphosphorylated lipid A variants, phosphate loss occurs readily in conjunction with the most favorable primary and secondary acyl chain cleavages. [Figure not available: see fulltext.
NASA Astrophysics Data System (ADS)
Ran, Jin; Wu, Liang; Wei, Bing; Chen, Yaoyao; Xu, Tongwen
2014-09-01
Polymeric materials as anion exchange membranes (AEMs) play an essential role in the field of energy and environment. The achievement of high performance AEMs by the precise manipulation of macromolecular architecture remains a daunting challenge. Herein, we firstly report a novel rod-coil graft copolymer AEM, possessing rigid hydrophobic main chains and soft hydrophilic graft chains. The low graft density, which can alleviate the adverse influences of ioinc graft chains on the main chains, was obtained by using the living polymerization technique. Consequently, the grafted ionic groups which result in the degradation of polymer backbone was decreased to a small degree. Moreover, the relatively long graft chains induced the nanophase separation between the hydrophobic polymer chains and hydrophilic graft chains, which creates a convinient pathway for high hydroxide ion mobility. Such an accurate molecular design simultaneously improves the hydroxide ion conductivity and alkaline stability as well as dimensional stability.
Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S
1999-09-01
Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.
Masoud, Ahmed I; Tsay, T Peter; BeGole, Ellen; Bedran-Russo, Ana K
2014-11-01
To compare the following over a period of 8 weeks: (1) force decay between thermoplastic (TP) and thermoset (TS) elastomeric chains; (2) force decay between light (200-g) and heavy (350-g) initial forces; and (3) force decay between direct chains and chain loops (stretched from one pin around the second pin and back to the first pin). TP and TS chains were obtained from American Orthodontics™ (AOTP, AOTS) and ORMCO™ (OrTP, OrTS). Each of the four chain groups was subdivided into four subgroups with 10 specimens per subgroup: (1) direct chains light force, (2) direct chains heavy force, (3) chain loops light force, and (4) chain loops heavy force. The experiment was performed in artificial saliva (pH of 6.75) at 37°C. A significant difference was found between TP and TS chains, with an average mean difference of around 20% more force decay found in the TP chains (P < .001, α = .05). There was no significant difference between direct chains and chain loops except in OrTP, in which direct chains showed more force decay. There was also no significant difference in force decay identified when using light vs heavy forces. TS chains decayed less than TP chains, and chain loop retraction was beneficial only when using OrTP chains. Contrary to the interchangeable use of TP and TS chains in the published literature and in clinical practice, this study demonstrates that they perform differently under stress and that a clear distinction should be made between the two.
Canonical Drude Weight for Non-integrable Quantum Spin Chains
NASA Astrophysics Data System (ADS)
Mastropietro, Vieri; Porta, Marcello
2018-03-01
The Drude weight is a central quantity for the transport properties of quantum spin chains. The canonical definition of Drude weight is directly related to Kubo formula of conductivity. However, the difficulty in the evaluation of such expression has led to several alternative formulations, accessible to different methods. In particular, the Euclidean, or imaginary-time, Drude weight can be studied via rigorous renormalization group. As a result, in the past years several universality results have been proven for such quantity at zero temperature; remarkably, the proofs work for both integrable and non-integrable quantum spin chains. Here we establish the equivalence of Euclidean and canonical Drude weights at zero temperature. Our proof is based on rigorous renormalization group methods, Ward identities, and complex analytic ideas.
Duveau, Damien Y; Arce, Pablo M; Schoenfeld, Robert A; Raghav, Nidhi; Cortopassi, Gino A; Hecht, Sidney M
2010-09-01
Analogues of mitoQ and idebenone were synthesized to define the structural elements that support oxygen consumption in the mitochondrial respiratory chain. Eight analogues were prepared and fully characterized, then evaluated for their ability to support oxygen consumption in the mitochondrial respiratory chain. While oxygen consumption was strongly inhibited by mitoQ analogues 2-4 in a chain length-dependent manner, modification of idebenone by replacement of the quinone methoxy groups by methyl groups (analogues 6-8) reduced, but did not eliminate, oxygen consumption. Idebenone analogues 6-8 also displayed significant cytoprotective properties toward cultured mammalian cells in which glutathione had been depleted by treatment with diethyl maleate. Copyright 2010 Elsevier Ltd. All rights reserved.
Almond, Philip M; Albrecht-Schmitt, Thomas E
2002-10-21
The reactions of UO(2)(C(2)H(3)O(2))(2).2H(2)O with K(2)TeO(3).H(2)O, Na(2)TeO(3) and TlCl, or Na(2)TeO(3) and Sr(OH)(2).8H(2)O under mild hydrothermal conditions yield K[UO(2)Te(2)O(5)(OH)] (1), Tl(3)[(UO(2))(2)[Te(2)O(5)(OH)](Te(2)O(6))].2H(2)O (2) and beta-Tl(2)[UO(2)(TeO(3))(2)] (3), or Sr(3)[UO(2)(TeO(3))(2)](TeO(3))(2) (4), respectively. The structure of 1 consists of tetragonal bipyramidal U(VI) centers that are bound by terminal oxo groups and tellurite anions. These UO(6) units span between one-dimensional chains of corner-sharing, square pyramidal TeO(4) polyhedra to create two-dimensional layers. Alternating corner-shared oxygen atoms in the tellurium oxide chains are protonated to create short/long bonding patterns. The one-dimensional chains of corner-sharing TeO(4) units found in 1 are also present in 2. However, in 2 there are two distinct chains present, one where alternating corner-shared oxygen atoms are protonated, and one where the chains are unprotonated. The uranyl moieties in 2 are bound by five oxygen atoms from the tellurite chains to create seven-coordinate pentagonal bipyramidal U(VI). The structures of 3 and 4 both contain one-dimensional [UO(2)(TeO(3))(2)](2-) chains constructed from tetragonal bipyramidal U(VI) centers that are bridged by tellurite anions. The chains differ between 3 and 4 in that all of the pyramidal tellurite anions in 3 have the same orientation, whereas the tellurite anions in 4 have opposite orientations on each side of the chain. In 4, there are also additional isolated TeO(3)(2-) anions present. Crystallographic data: 1, orthorhombic, space group Cmcm, a = 7.9993(5) A, b = 8.7416(6) A, c = 11.4413(8) A, Z = 4; 2, orthorhombic, space group Pbam, a = 10.0623(8) A, b = 23.024(2) A, c = 7.9389(6) A, Z = 4; 3, monoclinic, space group P2(1)/n, a = 5.4766(4) A, b = 8.2348(6) A, c = 20.849(3) A, beta = 92.329(1) degrees, Z = 4; 4, monoclinic, space group C2/c, a = 20.546(1) A, b = 5.6571(3) A, c = 13.0979(8) A, beta = 94.416(1) degrees, Z = 4.
Lin, Man; Wang, Na; Yao, Bei; Zhong, Yao; Lin, Yan; You, Tianhui
2018-04-19
Postpartum dysgalactia is a common clinical problem for lactating women. Seeking out the safe and efficient phytoestrogens will be a promising strategy for postpartum dysgalactia therapy. In this study, the postpartum mice within four groups, including control group, the model group, and the treatment groups intragastrically administrated with normal saline, bromocriptine, bromocriptine plus 17α-ethinyl estradiol, and bromocriptine plus quercetin, respectively, were used. The results showed that quercetin, a kind of natural phytoestrogen, could efficiently promote lactation yield and mammary gland development in the agalactosis mice produced by bromocriptine administration. Mechanically, quercetin, such as 17α-ethinyl estradiol, significantly stimulated prolactin (PRL) production and deposition in the mammary gland in the agalactosis mice determined by western blotting, quantitative polymerase chain reaction, and enzyme-linked immunosorbent assay, respectively. Furthermore, quercetin could increase the expression of β-casein, stearoyl-CoA desaturase, fatty acid synthase, and α-lactalbumin in the breast tissues that are responsible for the production of fatty acid, lactose, and galactose in the milk at the transcriptional level determined by quantitative polymerase chain reaction. Specifically, quercetin promoted primary mammary epithelial cell proliferation and stimulated prolactin receptor (PRLR) expression probably via AKT activation in vitro. In conclusion, this study indicates that estrogen-like quercetin promotes mammary gland development and lactation yield in milk-deficient mice, probably via stimulating PRL expression and release from the pituitary gland, as well as induces PRLR expression in primary mammary epithelial cells. Copyright © 2018 John Wiley & Sons, Ltd.
Subbaiah, P V; Liu, M
1996-05-31
Oxidation of lipoproteins results in the formation of several polar phospholipids with pro-inflammatory and pro-atherogenic properties. To examine the possible role of lecithin/cholesterol acyltransferase (LCAT) in the metabolism of these oxidized phospholipids, we oxidized whole plasma with either Cu(2+) or a free-radical generator, and determined the various activities of LCAT. Oxidation caused a reduction in plasma phosphatidylcholine (PC), an increase in a short-chain polar PC (SCP-PC), and an inhibition of the transfer of long-chain acyl groups to cholesterol (LCAT activity) or to lyso PC (lysolecithin acyltransferase (LAT) I activity). However, the transfer of short-chain acyl groups from SCP-PC to lyso PCLAT II activity) was stimulated several fold, in direct correlation with the degree of oxidation. LAT II activity was not stimulated by oxidation in LCAT-deficient plasma, showing that it is carried out by LCAT. Oxidized normal plasma exhibited low LCAT activity even in the presence of exogenous proteoliposome substrate, indicating that the depletion of substrate PC was not responsible for the loss of activity. Oxidation of isolated LDL or HDL abolished their ability to support LCAT and LAT I activities of exogenous enzyme, but promoted the LAT II activity. Purified LCAT lost its LCAT and LAT I functions, but not its LAT II function, when oxidized in vitro. These results show that while oxidation of plasma causes a loss of LCAT's ability to transfer long-chain acyl groups, its ability to transfer short-chain acyl groups, from SCP-PC is retained, and even stimulated, suggesting that LCAT may have a physiological role in the metabolism of oxidized PC in plasma.
Sato, Hisako; Nakae, Takahiro; Morimoto, Kazuya; Tamura, Kenji
2012-02-28
Vibrational circular dichroism (VCD) spectra were recorded on benzene-d(6) gels formed by chiral low molecular mass gelators (LMGs), trans(RR)- or trans(SS)-N,N'-alkanoyl-1,2-diaminocyclohexane (denoted by RR-C(n) or SS-C(n), respectively; n = the number of carbon atoms in an introduced alkanoyl group). Attention was focused on the effects of alkyl chain length on the structures of the gels. When n was changed from 6 to 12, the signs of the coupled peaks around 1550 cm(-1) in the VCD spectra, which were assigned to the symmetric and asymmetric C=O stretching vibrations from the higher to lower wavenumber, respectively, critically depended on the alkyl chain length. In the case of RR-C(n), for example, the signs of the couplet were plus and minus for n = 8, 9, 10 and 12, while the signs of the same couplet were reversed for n = 6 and 7. The conformations of LMGs in fibrils were determined by comparing the observed IR and VCD spectra with those calculated for a monomeric molecule. The observed reversal of signs in the C=O couplet was rationalized in terms of the different modes of hydrogen bonding. In the case of C(8), C(9), C(10) and C(12), gelator molecules were stacked with their cyclohexyl rings in parallel, forming double anti-parallel chains of intermolecular hydrogen bonds using two pairs of >NH and >C=O groups. In case of C(6) and C(7), gelator molecules were stacked through a single chain of intermolecular hydrogen bonds using a pair of >NH and >C=O groups. The remaining pair of >NH and >C=O groups formed an intramolecular hydrogen bond.
Guddat, L W; Shan, L; Broomell, C; Ramsland, P A; Fan, Z; Anchin, J M; Linthicum, D S; Edmundson, A B
2000-09-29
The three-dimensional structure of a complex of an Fab from a murine IgG2b(lambda) antibody (NC10.14) with a high potency sweet tasting hap- ten, N-(p-cyanophenyl)-N'-(diphenylmethyl)-N"-(carboxymethyl)guan idine (NC174), has been determined to 2.6 A resolution by X-ray crystallography. This complex crystallized in the triclinic space group P1, with two molecules in the asymmetric unit. In contrast to a companion monoclonal antibody (NC6.8) with a kappa-type light chain and similar high affinity for the NC174 ligand, the NC10.14 antibody possessed a large and deep antigen combining site bounded primarily by the third complementarity-determining regions (CDR3s) of the light and heavy chains. CDR3 of the heavy chain dominated the site and its crown protruded into the external solvent as a type 1' beta-turn. NC174 was nested against HCDR3 and was held in place by two tryptophan side-chains (L91 and L96) from LCDR3. The diphenyl rings were accommodated on an upper tier of the binding pocket that is largely hydrophobic. At the floor of the site, a positively charged arginine side-chain (H95) stabilized the orientation of the electronegative cyano group of the hapten. The negative charge on the acetate group was partially neutralized by a hydrogen bond with the phenolic hydroxyl group of tyrosine H58. Comparisons of the modes of binding of NC174 to the NC6.8 and NC10.14 antibodies illustrate the enormous structural and mechanistic diversity manifest by immune responses. Copyright 2000 Academic Press.
Arakawa, Mie; Masaki, Takayuki; Nishimura, Junko; Seike, Masataka; Yoshimatsu, Hironobu
2011-01-01
It has been demonstrated the involvement of branched-chain amino acids (BCAA) on obesity and related metabolic disorder. We investigated the effects of branched-chain amino acids (BCAA) on obesity and on glucose/fat homeostasis in mice fed on a high-fat (45%) diet. BCAA was dissolved in 0.5% methylcellulose and added to the drinking water (BCAA-treated group). A high-fat diet was provided for 6 weeks and BCAA was given for 2 weeks. The BCAA-treated group gained almost 7% less body weight and had less epididymal adipose tissue (WAT) mass than the control group (p<0.05). BCAA supplementation also reduced the hepatic and skeletal muscle triglyceride (TG) concentrations (p<0.05). The hepatic levels of PPAR-alpha and uncoupling protein (UCP) 2, and the level of PPAR-alpha and UCP3 in the skeletal muscle were greater in the BCAA-treated group than in the control mice (p<0.05). These results demonstrate that the liver and muscle TG concentration are less in BCAA-treated group. BCAA affects PPAR-alpha and UCP expression in muscle and liver tissue.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Popp, R.A.; Enlow, M.K.
The clinical hematologic change in 2 groups of progeny from mice carrying radiation-induced strain SEC ..cap alpha..-chain deficiencies was found to be similar to the hematologic alterations in persons with ..cap alpha..-thalassemia. The heterozygous deletion or inactivation of the ..cap alpha..-chain gene in mice caused an anemia similar to ..cap alpha..-thalassemina minor in persons. The ..cap alpha..-chain deficiency in mice created an erythrocytosis, reticulocytosis, and microcytic, hypochromic anemia comparable with the changes in human ..cap alpha..-thalassemia minor resulting from deletion of the ..cap alpha..-chain gene. These mouse mutants are the only known animal models of human thalassemia. A comparison ofmore » hematologic values obtained from progeny possessing an ..cap alpha..-chain gene deficiency and from progeny possessing a ..beta..-chain duplication suggested that the deficiency of ..cap alpha..-chain synthesis, rather than a simple imbalance between the amounts of ..cap alpha..- and ..beta..-chains produced, was primarily responsible for the altered hematologic characteristics in these ..cap alpha..-thalassemic mice.« less
Pinazo, A; Petrizelli, V; Bustelo, M; Pons, R; Vinardell, M P; Mitjans, M; Manresa, A; Perez, L
2016-05-01
Cationic double chain surfactants have attracted much interest because they can give rise to cationic vesicles that can be used in biomedical applications. Using a simple and economical synthetic approach, we have synthesized four double-chain surfactants with different alkyl chain lengths (LANHCx). The critical aggregation concentration of the double chain surfactants is at least one order of magnitude lower than the CMC of their corresponding single-chain LAM and the solutions prepared with the LANHCx contain stable cationic vesicles. Encouragingly, these new arginine derivatives show very low haemolytic activity and weaker cytotoxic effects than conventional dialkyl dimethyl ammonium surfactants. In addition, the surfactant with the shortest alkyl chain exhibits good antimicrobial activity against Gram-positive bacteria. The results show that a rational design applied to cationic double chain surfactants might serve as a promising strategy for the development of safe cationic vesicular systems. Copyright © 2016 Elsevier B.V. All rights reserved.
Sun, Shengtong; Wu, Peiyi
2015-12-28
One easy strategy to comprehend the complex folding/crystallization behaviors of proteins is to study the self-assembly process of their synthetic polymeric analogues with similar properties owing to their simple structures and easy access to molecular design. Poly(2-isopropyl-2-oxazoline) (PIPOZ) is often regarded as an ideal pseudopeptide with similar two-step crystallization behavior to proteins, whose aqueous solution experiences successive lower critical solution temperature (LCST)-type liquid-liquid phase separation upon heating and irreversible crystallization when annealed above LCST for several hours. In this paper, by microscopic observations, IR and Raman spectroscopy in combination with 2D correlation analysis, we show that the second step of PIPOZ crystallization in hot water can be further divided into two apparent stages, i.e., nucleation and crystal growth, and perfect crystalline PIPOZ chains are found to only develop in the second stage. While all the groups exhibit changes in initial nucleation, only methylene groups on the backbone participate in the crystal growth stage. During nucleation, a group motion transfer is found from the side chain to the backbone, and nucleation is assumed to be mainly driven by the cleavage of bridging C=O···D-O-D···O=C hydrogen bonds followed by chain arrangement due to amide dipolar orientation. Nevertheless, during crystal growth, a further chain ordering process occurs resulting in the final formation of crystalline PIPOZ chains with partial trans conformation of backbones and alternative side chains on the two sides. The underlying crystallization mechanism of PIPOZ in hot water we present here may provide very useful information for understanding the crystallization of biomacromolecules in biological systems.
ERIC Educational Resources Information Center
Chen, Haiwen; Holland, Paul
2009-01-01
In this paper, we develop a new chained equipercentile equating procedure for the nonequivalent groups with anchor test (NEAT) design under the assumptions of the classical test theory model. This new equating is named chained true score equipercentile equating. We also apply the kernel equating framework to this equating design, resulting in a…
NASA Astrophysics Data System (ADS)
Pal, Sanjima; Jadhav, Mahesh; Weyhermüller, Thomas; Patil, Yogesh; Nethaji, M.; Kasabe, Umesh; Kathawate, Laxmi; Konkimalla, V. Badireenath; Salunke-Gawali, Sunita
2013-10-01
Side chain homologated derivatives of 2-chloro-3-(n-alkylamino)-1,4-naphthoquinone {n-alkyl: pentyl; L-5, hexyl; L-6, heptyl; L-7 and octyl; L-8} have been synthesized and characterized by elemental analysis, FT-IR, 1H NMR, UV-visible spectroscopy and LC-MS. Compounds, L-4, {n-alkyl: butyl; L-4}, L-6 and L-8 have been characterized by single crystal X-ray diffraction studies. The single crystal X-ray structures reveal that L-4 and L-8 crystallizes in P21 space group, while L-6 in P21/c space group. Molecules of L-4 and L-8 from polymeric chains through Csbnd H⋯O and Nsbnd H⋯O close contacts. L-6 is a dimer formed by Nsbnd H⋯O interaction. Slipped π-π stacking interactions are observed between quinonoid and benzenoid rings of L-4 and L-8. Orientations of alkyl group in L-4 and L-8 is on same side of the chain and polymeric chains run opposite to one another to form zip like structure to the alkyl groups. Antiproliferative activities of L-1 to L-8{n-alkyl: methyl; L-1, ethyl; L-2, propyl; L-3 and butyl; L-4} were studied in cancer cells of colon (COLO205), brain (U87MG) and pancreas (MIAPaCa2) where L-1, L-2 and L-3 were active in MIAPaCa2 (L-1 = L-2 > L-3) and COLO205 (L-2 = L-3 > L-1) and inactive in U87MG. From antiproliferative studies with compounds L-1 to L-8 it can be concluded that homologation of 2-chloro-3-(n-alkylamino)-1,4-napthoquinone with saturated methyl groups yielded tissue specific compounds such as L-2 (for MIAPaCa2) and L-3 (for COLO205) with optimal activity.
Carlson, SJ; Nandivada, P; Chang, MI; Mitchell, PD; O’Loughlin, A; Cowan, E; Gura, KM; Nose, V; Bistrian, B; Puder, M
2014-01-01
Objective Parenteral nutrition associated liver disease (PNALD) is a deadly complication of long term parenteral nutrition (PN) use in infants. Fish oil-based lipid emulsion has been shown in recent years to effectively treat PNALD. Alternative fat sources free of essential fatty acids have recently been investigated for health benefits related to decreased inflammatory response. We hypothesized that the addition of medium-chain triglycerides (MCT) to a purified fish oil-based diet would decrease the response to inflammatory challenge in mice, while allowing for sufficient growth and development. Materials/Methods Six groups of ten adult male C57/Bl6 mice were pair-fed different dietary treatments for a period of twelve weeks, varying only in fat source (percent calories by weight): 10.84% soybean oil (SOY), 10% coconut oil (HCO), 10% medium-chain triglycerides (MCT), 3% purified fish oil (PFO), 3% purified fish oil with 3% medium-chain triglycerides (50:50 MCT:PFO) and 3% purified fish oil with 7.59% medium-chain triglycerides (70:30 MCT:PFO). An endotoxin challenge was administered to half of the animals in each group at the completion of dietary treatment. Results All groups demonstrated normal growth throughout the study period. Groups fed MCT and HCO diets demonstrated biochemical essential fatty acid deficiency and decreased IL-6 and TNF-α response to endotoxin challenge. Groups containing PFO had increased inflammatory response to endotoxin challenge, and the addition of MCT to PFO mitigated this inflammatory response. Conclusion These results suggest that the addition of MCT to PFO formulations may decrease the host response to inflammatory challenge, which may pose potential for optimized PN formulations. Inclusion of MCT in lipid emulsions given with PN formulations may be of use in therapeutic interventions for disease states resulting from chronic inflammation. PMID:25458829
Carlson, Sarah J; Nandivada, Prathima; Chang, Melissa I; Mitchell, Paul D; O'Loughlin, Alison; Cowan, Eileen; Gura, Kathleen M; Nose, Vania; Bistrian, Bruce R; Puder, Mark
2015-02-01
Parenteral nutrition associated liver disease (PNALD) is a deadly complication of long term parenteral nutrition (PN) use in infants. Fish oil-based lipid emulsion has been shown in recent years to effectively treat PNALD. Alternative fat sources free of essential fatty acids have recently been investigated for health benefits related to decreased inflammatory response. We hypothesized that the addition of medium-chain triglycerides (MCT) to a purified fish oil-based diet would decrease the response to inflammatory challenge in mice, while allowing for sufficient growth and development. Six groups of ten adult male C57/Bl6 mice were pair-fed different dietary treatments for a period of twelve weeks, varying only in fat source (percent calories by weight): 10.84% soybean oil (SOY), 10% coconut oil (HCO), 10% medium-chain triglycerides (MCT), 3% purified fish oil (PFO), 3% purified fish oil with 3% medium-chain triglycerides (50:50 MCT:PFO) and 3% purified fish oil with 7.59% medium-chain triglycerides (70:30 MCT:PFO). An endotoxin challenge was administered to half of the animals in each group at the completion of dietary treatment. All groups demonstrated normal growth throughout the study period. Groups fed MCT and HCO diets demonstrated biochemical essential fatty acid deficiency and decreased IL-6 and TNF-α response to endotoxin challenge. Groups containing PFO had increased inflammatory response to endotoxin challenge, and the addition of MCT to PFO mitigated this inflammatory response. These results suggest that the addition of MCT to PFO formulations may decrease the host response to inflammatory challenge, which may pose potential for optimized PN formulations. Inclusion of MCT in lipid emulsions given with PN formulations may be of use in therapeutic interventions for disease states resulting from chronic inflammation. Copyright © 2015 Elsevier Inc. All rights reserved.
Zhang, Xi; Song, Fei; Taxipalati, Maierhaba; Wei, Wei; Feng, Fengqin
2014-01-01
The objective of this research was to determine the effect of sugar or fatty acid in sugar ester compounds on the surface-active properties and antimicrobial activities of these compounds. Disaccharides of medium-chain fatty acid monoesters were synthesized through transesterifications by immobilized lipase (Lipozyme TLIM) to yield nine monoesters for subsequent study. Their antimicrobial activities were investigated using three pathogenic microorganisms: Staphylococcus aureus, Escherichia coli O157:H7 and Candida albicans. Their surface-active properties including air–water surface tension, critical micelle concentration, and foaming and emulsion power and stability were also studied. The results showed that all of the tested monoesters were more effective against Staphylococcus aureus (Gram-positive bacterium) than against Escherichia coli O157:H7 (Gram-negative bacterium). The results demonstrated that the carbon chain length was the most important factor influencing the surface properties, whereas degree of esterification and hydrophilic groups showed little effect. PMID:25531369
Sustainability of rare earth elements chain: from production to food - a review.
Turra, Christian
2018-02-01
Rare earth elements (REE) are a group of chemical elements that include lanthanoids (lanthanum to lutetium), scandium and yttrium. In the last decades, the REE demand in the industry and other areas has increased significantly. In general, REE have shown low concentrations in soils, plants, water and atmosphere, but they may accumulate in such environments due to anthropogenic inputs. In areas where there is REE contamination, the slow accumulation of these elements in the environment could become problematic. Many studies have shown environmental areas contaminated with REE and their toxic effects. Thus, it is important to review, in order to improve the current understanding of these elements in the environment, showing the effects of REE exposure in mining, soil, water, plants and food. Besides, there are few suppliers and a limited quantity of these elements in the world. This paper suggests options to improve the sustainability management of REE chain.
Harrington, Charlene; Hauser, Clarilee; Olney, Brian; Rosenau, Pauline Vaillancourt
2011-01-01
This study examined the ownership, financing, and management strategies of the 10 largest for-profit nursing home chains in the United States, including the four largest chains purchased by private equity corporations. Descriptive data were collected from Internet searches, company reports, and other sources for the decade 1998-2008. Since 1998, the largest chains have made many changes in their ownership and structure, and some have converted from publicly traded companies to private ownership. This study shows the increasing complexity of corporate nursing home ownership and the lack of public information about ownership and financial status. The chains have used strategies to maximize shareholder and investor value that include increasing Medicare revenues, occupancy rates, and company diversification, establishing multiple layers of corporate ownership, developing real estate investment trusts, and creating limited liability companies. These strategies enhance shareholder and investor profits, reduce corporate taxes, and reduce liability risk. There is a need for greater transparency in ownership and financial reporting and for more government oversight of the largest for-profit chains, including those owned by private equity companies.
A Novel Multilayered RFID Tagged Cargo Integrity Assurance Scheme
Yang, Ming Hour; Luo, Jia Ning; Lu, Shao Yong
2015-01-01
To minimize cargo theft during transport, mobile radio frequency identification (RFID) grouping proof methods are generally employed to ensure the integrity of entire cargo loads. However, conventional grouping proofs cannot simultaneously generate grouping proofs for a specific group of RFID tags. The most serious problem of these methods is that nonexistent tags are included in the grouping proofs because of the considerable amount of time it takes to scan a high number of tags. Thus, applying grouping proof methods in the current logistics industry is difficult. To solve this problem, this paper proposes a method for generating multilayered offline grouping proofs. The proposed method provides tag anonymity; moreover, resolving disputes between recipients and transporters over the integrity of cargo deliveries can be expedited by generating grouping proofs and automatically authenticating the consistency between the receipt proof and pick proof. The proposed method can also protect against replay attacks, multi-session attacks, and concurrency attacks. Finally, experimental results verify that, compared with other methods for generating grouping proofs, the proposed method can efficiently generate offline grouping proofs involving several parties in a supply chain using mobile RFID. PMID:26512673
NASA Astrophysics Data System (ADS)
Usui, Kota; Hunger, Johannes; Bonn, Mischa; Sulpizi, Marialore
2018-05-01
Room temperature ionic liquids (RTILs) have been shown to exhibit spatial heterogeneity or structural heterogeneity in the sense that they form hydrophobic and ionic domains. Yet studies of the relationship between this structural heterogeneity and the ˜picosecond motion of the molecular constituents remain limited. In order to obtain insight into the time scales relevant to this structural heterogeneity, we perform molecular dynamics simulations of a series of RTILs. To investigate the relationship between the structures, i.e., the presence of hydrophobic and ionic domains, and the dynamics, we gradually increase the size of the hydrophobic part of the cation from ethylammonium nitrate (EAN), via propylammonium nitrate (PAN), to butylammonium nitrate (BAN). The two ends of the organic cation, namely, the charged Nhead-H group and the hydrophobic Ctail-H group, exhibit rotational dynamics on different time scales, evidencing dynamical heterogeneity. The dynamics of the Nhead-H group is slower because of the strong coulombic interaction with the nitrate counter-ionic anions, while the dynamics of the Ctail-H group is faster because of the weaker van der Waals interaction with the surrounding atoms. In particular, the rotation of the Nhead-H group slows down with increasing cationic chain length, while the rotation of the Ctail-H group shows little dependence on the cationic chain length, manifesting that the dynamical heterogeneity is enhanced with a longer cationic chain. The slowdown of the Nhead-H group with increasing cationic chain length is associated with a lower number of nitrate anions near the Nhead-H group, which presumably results in the increase of the energy barrier for the rotation. The sensitivity of the Nhead-H rotation to the number of surrounding nitrate anions, in conjunction with the varying number of nitrate anions, gives rise to a broad distribution of Nhead-H reorientation times. Our results suggest that the asymmetry of the cations and the larger excluded volume for longer cationic chain are important for both the structural heterogeneity and the dynamical heterogeneities. The observed dynamical heterogeneities may affect the rates of chemical reactions depending on where the reactants are solvated in ionic liquids and provide an additional guideline for the design of RTILs as solvents.
High resolution observations with Artemis-IV and the NRH. I. Type IV associated narrow-band bursts
NASA Astrophysics Data System (ADS)
Bouratzis, C.; Hillaris, A.; Alissandrakis, C. E.; Preka-Papadema, P.; Moussas, X.; Caroubalos, C.; Tsitsipis, P.; Kontogeorgos, A.
2016-02-01
Context. Narrow-band bursts appear on dynamic spectra from microwave to decametric frequencies as fine structures with very small duration and bandwidth. They are believed to be manifestations of small scale energy release through magnetic reconnection. Aims: We analyzed 27 metric type IV events with embedded narrow-band bursts, which were observed by the ARTEMIS-IV radio spectrograph from 30 June 1999 to 1 August 2010. We examined the morphological characteristics of isolated narrow-band structures (mostly spikes) and groups or chains of structures. Methods: The events were recorded with the SAO high resolution (10 ms cadence) receiver of ARTEMIS-IV in the 270-450 MHz range. We measured the duration, spectral width, and frequency drift of ~12 000 individual narrow-band bursts, groups, and chains. Spike sources were imaged with the Nançay radioheliograph (NRH) for the event of 21 April 2003. Results: The mean duration of individual bursts at fixed frequency was ~100 ms, while the instantaneous relative bandwidth was ~2%. Some bursts had measurable frequency drift, either positive or negative. Quite often spikes appeared in chains, which were closely spaced in time (column chains) or in frequency (row chains). Column chains had frequency drifts similar to type-IIId bursts, while most of the row chains exhibited negative frequently drifts with a rate close to that of fiber bursts. From the analysis of NRH data, we found that spikes were superimposed on a larger, slowly varying, background component. They were polarized in the same sense as the background source, with a slightly higher degree of polarization of ~65%, and their size was about 60% of their size in total intensity. Conclusions: The duration and bandwidth distributions did not show any clear separation in groups. Some chains tended to assume the form of zebra, lace stripes, fiber bursts, or bursts of the type-III family, suggesting that such bursts might be resolved in spikes when viewed with high resolution. The NRH data indicate that the spikes are not fluctuations of the background, but represent additional emission such as what would be expected from small-scale reconnection.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-20
... labeling; (2) supply chain issues; and, (3) other issues. FDA may use the information received to develop...? B. Supply Chain Issues 3. What are the supply chain factors (including storage, shipping, and... the optimal point in the supply chain (e.g., newly manufactured product, newly shipped product) and...
Statistical thermodynamics of amphiphile chains in micelles
Ben-Shaul, A.; Szleifer, I.; Gelbart, W. M.
1984-01-01
The probability distribution of amphiphile chain conformations in micelles of different geometries is derived through maximization of their packing entropy. A lattice model, first suggested by Dill and Flory, is used to represent the possible chain conformations in the micellar core. The polar heads of the chains are assumed to be anchored to the micellar surface, with the other chain segments occupying all lattice sites in the interior of the micelle. This “volume-filling” requirement, the connectivity of the chains, and the geometry of the micelle define constraints on the possible probability distributions of chain conformations. The actual distribution is derived by maximizing the chain's entropy subject to these constraints; “reversals” of the chains back towards the micellar surface are explicitly included. Results are presented for amphiphiles organized in planar bilayers and in cylindrical and spherical micelles of different sizes. It is found that, for all three geometries, the bond order parameters decrease as a function of the bond distance from the polar head, in accordance with recent experimental data. The entropy differences associated with geometrical changes are shown to be significant, suggesting thereby the need to include curvature (environmental)-dependent “tail” contributions in statistical thermodynamic treatments of micellization. PMID:16593492
Molecular design of high performance zwitterionic liquids for enhanced heavy-oil recovery processes.
Martínez-Magadán, J M; Cartas-Rosado, A R; Oviedo-Roa, R; Cisneros-Dévora, R; Pons-Jiménez, M; Hernández-Altamirano, R; Zamudio-Rivera, L S
2018-03-01
Branched gemini zwitterionic liquids, which contain two zwitterionic moieties of linked quaternary-ammonium and carboxylate groups, are proposed as chemicals to be applied in the Enhanced Oil Recovery (EOR) from fractured carbonate reservoirs. The zwitterionic moieties are bridged between them through an alkyl chain containing 12 ether groups, and each zwitterionic moiety has attached a long alkyl tail including a CC double bond. A theoretical molecular mechanism over which EOR could rest, consisting on both the disaggregation of heavy oil and the reservoir-rock wettability alteration, was suggested. Results show that chemicals can both reduce the viscosity and remove heavy-oil molecules from the rock surface. Copyright © 2018. Published by Elsevier Inc.
Wang, Yue-Hu; Goto, Masuo; Wang, Li-Ting; Hsieh, Kan-Yen; Morris-Natschke, Susan L; Tang, Gui-Hua; Long, Chun-Lin; Lee, Kuo-Hsiung
2014-10-15
Twenty-five amide alkaloids (1-25) from Piper boehmeriifolium and 10 synthetic amide alkaloid derivatives (39-48) were evaluated for antiproliferative activity against eight human tumor cell lines, including chemosensitive and multidrug-resistant (MDR) cell lines. The results suggested tumor type-selectivity. 1-[7-(3,4,5-Trimethoxyphenyl)heptanoyl]piperidine (46) exhibited the best inhibitory activity (IC50=4.94 μM) against the P-glycoprotein (P-gp)-overexpressing KBvin MDR sub-line, while it and all other tested compounds, except 9, were inactive (IC50 >40 μM) against MDA-MB-231 and SK-BR-3. Structure-activity relationships (SARs) indicated that (i) 3,4,5-trimethoxy phenyl substitution is critical for selectivity against KBvin, (ii) the 4-methoxy group in this pattern is crucial for antiproliferative activity, (iii) double bonds in the side chain are not needed for activity, and (iv), in arylalkenylacyl amide alkaloids, replacement of an isobutylamino group with pyrrolidin-1-yl or piperidin-1-yl significantly improved activity. Further study on Piper amides is warranted, particularly whether side chain length affects the ability to overcome the MDR cancer phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ashtari, M; Cann, N M
2012-11-23
Poly-proline chains and derivatives have been recently examined as the basis for new chiral stationary phases in high performance liquid chromatography. The selectivity of poly-proline has been measured for peptides with up to ten proline units. In this article, we employ molecular dynamics simulations to examine the interfacial structure and solvation of surface-bound poly-proline chiral selectors. Specifically, we study the interfacial structure of trimethylacetyl-terminated poly-proline chains with three-to-six prolines. The surface includes silanol groups and end-caps, to better capture the characteristics of the stationary phase, and the solvent is either a polar water/methanol or a relatively apolar n-hexane/2-propanol mixture. We begin with a comprehensive ab initio study of the conformers, their energies, and an assessment of conformer flexibility. Force fields have been developed for each poly-proline selector. Molecular dynamics simulations are employed to study the preferred backbone conformations and solvent hydrogen bonding for different poly-proline/solvent interfaces. For triproline, the effect of two different terminal groups, trimethylacetyl and t-butyl carbamate are compared. Copyright © 2012 Elsevier B.V. All rights reserved.
Mechanistic Design of Chemically Diverse Polymers with Applications in Oral Drug Delivery.
Mosquera-Giraldo, Laura I; Borca, Carlos H; Meng, Xiangtao; Edgar, Kevin J; Slipchenko, Lyudmila V; Taylor, Lynne S
2016-11-14
Polymers play a key role in stabilizing amorphous drug formulations, a recent strategy employed to improve solubility and bioavailability of drugs delivered orally. However, the molecular mechanism of stabilization is unclear, therefore, the rational design of new crystallization-inhibiting excipients remains a substantial challenge. This article presents a combined experimental and computational approach to elucidate the molecular features that improve the effectiveness of cellulose polymers as solution crystallization inhibitors, a crucial first step toward their rational design. Polymers with chemically diverse substituents including carboxylic acids, esters, ethers, alcohols, amides, amines, and sulfides were synthesized. Measurements of nucleation induction times of the model drug, telaprevir, show that the only effective polymers contained carboxylate groups in combination with an optimal hydrocarbon chain length. Computational results indicate that polymer conformation as well as solvation free energy are important determinants of effectiveness at inhibiting crystallization and show that simulations are a promising predictive tool in the screening of polymers. This study suggests that polymers need to have an adequate hydrophilicity to promote solvation in an aqueous environment, and sufficient hydrophobic regions to drive interactions with the drug. Particularly, the right balance between key substituent groups and lengths of hydrocarbon side chains is needed to create effective materials.
Chain Reaction Polymerization.
ERIC Educational Resources Information Center
McGrath, James E.
1981-01-01
The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)
New polymer systems: Chain extension by dianhydrides
NASA Technical Reports Server (NTRS)
Rhein, R. A.; Ingham, J. D.
1974-01-01
Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.
Green certification, e-commerce, and low-carbon economy for international tourist hotels.
Chen, Long-Fei
2018-05-22
Increasing population and over-consumption are placing unprecedented demands on agriculture and natural resources. The Earth is suffering from global warning and environmental destruction while our agricultural systems are concurrently degrading land, water, biodiversity, and climate on a global scale. For a sustainable future, green certification, e-commerce, and environment education can boost low-carbon economy with decreasing carbon emissions, but very few researches address them for the hotel industry. This research studies the performance impact of e-commerce, international hotel chain, local hotel chain, and green certification for carbon emission reductions of international tourist hotels of Taiwan. It reveals that, after a sufficiently long time, there is an improvement in the environmental and economic performance of the green-certified hotel group. In addition, it reveals that, as recommended by the operation policy, the international hotel chain group together with e-commerce has better performance than local hotel chain. It is also discussed how to sustain the continuing improvement in low-carbon performance of the hotel industry.
Tisdale, M. J.; Brennan, R. A.
1988-01-01
A comparison has been made between the ability of long-chain triglycerides (LCT) and medium-chain triglycerides (MCT) to prevent weight loss induced by the cachexia-inducing colon adenocarcinoma (MAC16) and to reduce tumour size. There was no difference in calorie consumption or nitrogen intake between the various groups. When compared with a normal control high carbohydrate, low fat diet, animals fed MCT showed a reduced weight loss and a marked reduction in tumour size. In contrast neither weight loss nor tumour size differed significantly from the controls in animals fed the LCT diet. An elevated plasma level of 3-hydroxybuturate was found only in the animals fed the MCT diets. Administration of LCT caused an increase in the plasma level of FFA, which was not observed in the MCT group. These results suggest that diets containing MCT would provide the best ketogenic regime to reverse the weight loss in cancer cachexia with a concomitant reduction in tumour size. PMID:3219268
Yang, Siwei; Sun, Jing; Zhu, Chong; He, Peng; Peng, Zheng; Ding, Guqiao
2016-02-07
The graphene quantum dot based fluorescent probe community needs unambiguous evidence about the control on the ion selectivity. In this paper, polyethylene glycol modified N-doped graphene quantum dots (PN-GQDs) were synthesized by alkylation reaction between graphene quantum dots and organic halides. We demonstrate the tunable selectivity and sensitivity by controlling the supramolecular recognition through the length and the end group size of the polyether chain on PN-GQDs. The relationship formulae between the selectivity/detection limit and polyether chains are experimentally deduced. The polyether chain length determines the interaction between the PN-GQDs and ions with different ratios of charge to radius, which in turn leads to a good selectivity control. Meanwhile the detection limit shows an exponential growth with the size of end groups of the polyether chain. The PN-GQDs can be used as ultrasensitive and selective fluorescent probes for Li(+), Na(+), K(+), Mg(2+), Ca(2+) and Sr(2+), respectively.
Revilla-López, Guillem; Torras, Juan; Jiménez, Ana I.; Cativiela, Carlos; Nussinov, Ruth; Alemán, Carlos
2009-01-01
The intrinsic conformational preferences of the non-proteinogenic amino acids constructed by incorporating the arginine side chain in the β position of 1-aminocyclopentane-1-carboxylic acid (either in a cis or a trans orientation relative to the amino group) have been investigated using computational methods. These compounds may be considered as constrained analogues of arginine (denoted as c5Arg) in which the orientation of the side chain is fixed by the cyclopentane moiety. Specifically, the N-acetyl-N′-methylamide derivatives of cis and trans-c5Arg have been examined in the gas phase and in solution using B3LYP/6-311+G(d,p) calculations and Molecular Dynamics simulations. Results indicate that the conformational space available to these compounds is highly restricted, their conformational preferences being dictated by the ability of the guanidinium group in the side chain to establish hydrogen-bond interactions with the backbone. A comparison with the behavior previously described for the analogous phenylalanine derivatives is presented. PMID:19236034
Insulin chains as efficient fusion tags for prokaryotic expression of short peptides.
Deng, Ligang; Xue, Xiaoying; Shen, Cangjie; Song, Xiaohan; Wang, Chunyang; Wang, Nan
2017-10-01
Insulin chains are usually expressed in Escherichia coli as fusion proteins with different tags, including various low molecular weight peptide tags. The objective of this study was to determine if insulin chains could facilitate the recombinant expression of other target proteins, with an emphasis on low molecular weight peptides. A series of short peptides were fused to mini-proinsulin, chain B or chain A, and induced for expression in Escherichia coli. All the tested peptides including glucagon-like peptide 1 (GLP-1), a C-terminal extended GLP-1, oxyntomodulin, enfuvirtide, linaclotide, and an unstructured artificial peptide were expressed with reasonable yields, identified by Tricine-SDS-PAGE and immunoblotting. All recombinant products were expressed in inclusion bodies. The effective accumulation of products was largely attributed to the insoluble expression induced by fusion with insulin chains, and was confirmed by the fusion expression of transthyretin. Insulin chains thus show promise as efficient fusion tags for mass production of heterologous peptides in prokaryotes. Copyright © 2017 Elsevier Inc. All rights reserved.
Oxidation of Peptides by Methyl(trifluoromethyl)dioxirane: the Protecting Group Matters
Rella, Maria Rosaria; Williard, Paul G.
2011-01-01
Representative Boc protected and acetyl protected peptide methyl esters bearing alkyl side chains undergo effective oxidation using methyl(trifluoromethyl)dioxirane (1b) under mild conditions. We observe a protecting group dependency in the chemoselectivity displayed by the dioxirane 1b. N-hydroxylation occurs in the case of the Boc protected peptides, side chain hydroxylation takes place in the case of acetyl protected peptides. Both are attractive transformations since they yield derivatized peptides that serve as valuable synthons. PMID:17221970
End-functionalized ROMP polymers for Biomedical Applications
Madkour, Ahmad E.; Koch, Amelie H. R.; Lienkamp, Karen; Tew, Gregory N.
2010-01-01
We present two novel allyl-based terminating agents that can be used to end-functionalize living polymer chains obtained by ring-opening metathesis polymerization (ROMP) using Grubbs’ third generation catalyst. Both terminating agents can be easily synthesized and yield ROMP polymers with stable, storable activated ester groups at the chain-end. These end-functionalized ROMP polymers are attractive building blocks for advanced polymeric materials, especially in the biomedical field. Dye-labeling and surface-coupling of antimicrobially active polymers using these end-groups were demonstrated. PMID:21499549
Hydrogen bonding between phosphate and amino acid side chains
NASA Astrophysics Data System (ADS)
Carmona, P.; Rodriguez, M. L.
1986-03-01
Hydrogen bonds between polar groups of amino acid side chains (histidine, lysine, glutamic acid) and phosphate ions have been studied by infrared spectroscopy. Proton transfer from amino acid groups to phosphate occur mainly in case that tribasic and dibasic phosphate ions take part in hydrogen bonds. Conformational changes and continuum are strongly related to the degree of proton transfer and hydration. It is pointed out that the aforementioned properties should be of great significance for nucleation and growth of prostatic and renal stones.
Coalescence of 3-phenyl-propynenitrile on Cu(111) into interlocking pinwheel chains
NASA Astrophysics Data System (ADS)
Luo, Miaomiao; Lu, Wenhao; Kim, Daeho; Chu, Eric; Wyrick, Jon; Holzke, Connor; Salib, Daniel; Cohen, Kamelia D.; Cheng, Zhihai; Sun, Dezheng; Zhu, Yeming; Einstein, T. L.; Bartels, Ludwig
2011-10-01
3-phenyl-propynenitrile (PPN) adsorbs on Cu(111) in a hexagonal network of molecular trimers formed through intermolecular interaction of the cyano group of one molecule with the aromatic ring of its neighbor. Heptamers of trimers coalesce into interlocking pinwheel-shaped structures that, by percolating across islands of the original trimer coverage, create the appearance of gear chains. Density functional theory aids in identifying substrate stress associated with the chemisorption of PPN's acetylene group as the cause of this transition.
Ahmed, Belal; Jo, Hongil; Oh, Seung-Jin; Ok, Kang Min
2018-05-15
Four novel transition metal oxyfluorides, [Zn(pz) 3 ][MoO 2 F 4 ]·0.1H 2 O (1), [Zn(pz) 2 F 2 ][Zn(pz) 3 ] 2 [WO 2 F 4 ] 2 (2), [Cd(pz) 4 ][Cd(pz) 4 (H 2 O)][MoO 2 F 4 ] 2 ·0.625H 2 O (3), and [Zn(mpz) 3 ] 2 [MoO 2 F 4 ] 2 (4) (pz = pyrazole; mpz = 3-methyl pyrazole) have been synthesized. Compounds 1 and 4 contain helical chains. Compound 2 accommodates zigzag chains, and compound 3 has quasi-one-dimensional linear chains. The variable chain structures are found to be attributable to the different structure-directing anionic groups and hydrogen bonding interactions. Compound 4 crystallized in the noncentrosymmetric (NCS) polar space group, Pna2 1 , is nonphase-matchable (Type I), and reveals a moderate second-harmonic-generation (SHG) efficiency (10 × α-SiO 2 ). The observed SHG efficiency of compound 4 is due to the small net polarization occurring from the arrangement of ZnN 3 F 2 trigonal bipyramids. Spectroscopic and thermal characterizations along with calculations for the title materials are reported.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Josephson, Matthew P.; Sikkink, Laura A.; Penheiter, Alan R.
2011-12-16
Highlights: Black-Right-Pointing-Pointer Cardiac myosin regulatory light chain (MYL2) is phosphorylated at S15. Black-Right-Pointing-Pointer Smooth muscle myosin light chain kinase (smMLCK) is a ubiquitous kinase. Black-Right-Pointing-Pointer It is a widely believed that MYL2 is a poor substrate for smMLCK. Black-Right-Pointing-Pointer In fact, smMLCK efficiently and rapidly phosphorylates S15 in MYL2. Black-Right-Pointing-Pointer Phosphorylation kinetics measured by novel fluorescence method without radioactivity. -- Abstract: Specific phosphorylation of the human ventricular cardiac myosin regulatory light chain (MYL2) modifies the protein at S15. This modification affects MYL2 secondary structure and modulates the Ca{sup 2+} sensitivity of contraction in cardiac tissue. Smooth muscle myosin light chainmore » kinase (smMLCK) is a ubiquitous kinase prevalent in uterus and present in other contracting tissues including cardiac muscle. The recombinant 130 kDa (short) smMLCK phosphorylated S15 in MYL2 in vitro. Specific modification of S15 was verified using the direct detection of the phospho group on S15 with mass spectrometry. SmMLCK also specifically phosphorylated myosin regulatory light chain S15 in porcine ventricular myosin and chicken gizzard smooth muscle myosin (S20 in smooth muscle) but failed to phosphorylate the myosin regulatory light chain in rabbit skeletal myosin. Phosphorylation kinetics, measured using a novel fluorescence method eliminating the use of radioactive isotopes, indicates similar Michaelis-Menten V{sub max} and K{sub M} for regulatory light chain S15 phosphorylation rates in MYL2, porcine ventricular myosin, and chicken gizzard myosin. These data demonstrate that smMLCK is a specific and efficient kinase for the in vitro phosphorylation of MYL2, cardiac, and smooth muscle myosin. Whether smMLCK plays a role in cardiac muscle regulation or response to a disease causing stimulus is unclear but it should be considered a potentially significant kinase in cardiac tissue on the basis of its specificity, kinetics, and tissue expression.« less
Shen, Andrew Nathanael; Pope, Derek A.; Hutsell, Blake A.; Newland, M. Christopher
2015-01-01
Adolescence is characterized by neural and behavior development that includes increases in novel experiences and impulsive choice. Experimental rodent models can characterize behavior phenotypes that typify adolescence. The present experiment was designed to characterize differences between adolescent (post-natal day (PND) 34 - 60) and adult (PND 70 - 96) BALB/c mice using a response-initiated spatial discrimination reversal (SDR) and incremental repeated acquisition of response chains (IRA) procedures. During SDR, adolescents omitted more trials and were slower to initiate trials than adults, but the age groups did not differ on accuracy and perseveration measures. During IRA, adolescents displayed poorer overall performance (measured by progress quotient), lower accuracy at individual chain links, and completed fewer long response chains (>3 links) than adults. In both procedures (SDR and IRA), the poorer performance of adolescents appeared to be related to the use of a response device that was spatially removed from reinforcer delivery. These results indicate that SDR and IRA performance can be established during the brief rodent adolescent period but that these two age groups’ performances differ. We hypothesize that adolescent behavior is more sensitive than adult behavior to the spatiotemporal distance between response device and location of reinforcer delivery. PMID:26051193
Population Synthesis of Radio and Y-ray Millisecond Pulsars Using Markov Chain Monte Carlo
NASA Astrophysics Data System (ADS)
Gonthier, Peter L.; Billman, C.; Harding, A. K.
2013-04-01
We present preliminary results of a new population synthesis of millisecond pulsars (MSP) from the Galactic disk using Markov Chain Monte Carlo techniques to better understand the model parameter space. We include empirical radio and γ-ray luminosity models that are dependent on the pulsar period and period derivative with freely varying exponents. The magnitudes of the model luminosities are adjusted to reproduce the number of MSPs detected by a group of ten radio surveys and by Fermi, predicting the MSP birth rate in the Galaxy. We follow a similar set of assumptions that we have used in previous, more constrained Monte Carlo simulations. The parameters associated with the birth distributions such as those for the accretion rate, magnetic field and period distributions are also free to vary. With the large set of free parameters, we employ Markov Chain Monte Carlo simulations to explore the large and small worlds of the parameter space. We present preliminary comparisons of the simulated and detected distributions of radio and γ-ray pulsar characteristics. We express our gratitude for the generous support of the National Science Foundation (REU and RUI), Fermi Guest Investigator Program and the NASA Astrophysics Theory and Fundamental Program.
Synthesis and biological activity of alkynoic acids derivatives against mycobacteria
Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.
2015-01-01
2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431
French, H P; Keogan, F; Gilsenan, C; Waldron, L; O'Connell, P
2010-06-01
To assess patient satisfaction with exercise for knee osteoarthritis (OA). A convenience sample of 27 patients recruited to a randomized controlled trial (RCT) comparing open kinetic chain and closed kinetic chain exercises for knee OA were reassessed at nine months post-randomization. Clinical outcomes included self-report and physical performance measures of function and pain severity. Patients also completed the Physiotherapy Outpatient Survey (POPS), which is a multi-dimensional measure of patient satisfaction with physiotherapy. There was no significant difference in satisfaction between the two intervention groups. Overall mean satisfaction for the entire cohort was 4.07 of a maximum score of 5 (standard deviation (SD) = 0.52). Lower levels of satisfaction with outcome (mean = 3.56, SD = 0.8) were reported compared with other domains of expectations, communication, organization and the therapist (mean = 3.79-4.49; SDs = 0.42-0.92). Both intervention groups improved from baseline on clinical outcomes of pain, self-report function and walking distance, with no significant differences between the two groups. High levels of satisfaction were reported in this subsample of knee OA patients participating in an RCT evaluating the effects of different exercise approaches for knee OA. Satisfaction varied depending on the satisfaction domain, with lower satisfaction with outcome compared with other aspects of care. The POPS questionnaire can be used to measure the multi-dimensional aspects of satisfaction with physiotherapy.
Armstrong, Craig T.; Mason, Philip E.; Anderson, J. L. Ross; Dempsey, Christopher E.
2016-01-01
Gating charges in voltage-sensing domains (VSD) of voltage-sensitive ion channels and enzymes are carried on arginine side chains rather than lysine. This arginine preference may result from the unique hydration properties of the side chain guanidinium group which facilitates its movement through a hydrophobic plug that seals the center of the VSD, as suggested by molecular dynamics simulations. To test for side chain interactions implicit in this model we inspected interactions of the side chains of arginine and lysine with each of the 19 non-glycine amino acids in proteins in the protein data bank. The arginine guanidinium interacts with non-polar aromatic and aliphatic side chains above and below the guanidinium plane while hydrogen bonding with polar side chains is restricted to in-plane positions. In contrast, non-polar side chains interact largely with the aliphatic part of the lysine side chain. The hydration properties of arginine and lysine are strongly reflected in their respective interactions with non-polar and polar side chains as observed in protein structures and in molecular dynamics simulations, and likely underlie the preference for arginine as a mobile charge carrier in VSD. PMID:26899474
NASA Astrophysics Data System (ADS)
Armstrong, Craig T.; Mason, Philip E.; Anderson, J. L. Ross; Dempsey, Christopher E.
2016-02-01
Gating charges in voltage-sensing domains (VSD) of voltage-sensitive ion channels and enzymes are carried on arginine side chains rather than lysine. This arginine preference may result from the unique hydration properties of the side chain guanidinium group which facilitates its movement through a hydrophobic plug that seals the center of the VSD, as suggested by molecular dynamics simulations. To test for side chain interactions implicit in this model we inspected interactions of the side chains of arginine and lysine with each of the 19 non-glycine amino acids in proteins in the protein data bank. The arginine guanidinium interacts with non-polar aromatic and aliphatic side chains above and below the guanidinium plane while hydrogen bonding with polar side chains is restricted to in-plane positions. In contrast, non-polar side chains interact largely with the aliphatic part of the lysine side chain. The hydration properties of arginine and lysine are strongly reflected in their respective interactions with non-polar and polar side chains as observed in protein structures and in molecular dynamics simulations, and likely underlie the preference for arginine as a mobile charge carrier in VSD.
Dudev, Todor; Doudeva, Lyudmila
2017-02-01
The effect of the extra methylene group on the ligation properties of glutamic (Glu) vs. aspartic (Asp) acid, and glutamine (Gln) vs. asparagine (Asn) amino acids-two pairs of protein building blocks differing by the length of their side chains-has been studied by employing DFT calculations combined with polarizable continuum model (PCM) computations. Complexes of the nominal species with partner ligands of various structures, charge states, and degree of solvent exposure have been examined. The results obtained reveal that the difference in the alkyl chain length of these amino acid residues does not affect the mode of their binding. This, however, influences the thermodynamics of the ligand-ligand and ligand-metal recognition thus bestowing unique ligation characteristics on the competing entities. The calculations reveal that the competition between the longer-chain and shorter-chain analogs is entropy driven and that the differential electronic effects are of minor importance for the process. Thus, the outcome of the rivalry between Asp and Glu, and Asn and Gln is almost unaffected by the nature of the partner ligand, its charge state and, in most cases, the dielectric properties of the binding site. The longer-chain Glu, as opposed to its shorter-chain Asp counterpart, is the preferred partner ligand in various protein binding sites. Contrariwise, the shorter-chain Asn binds more favorably to the respective binding sites than its longer-chain Gln analog. The results obtained shed additional light on the intimate mechanism of the ligand-ligand and ligand-metal recognition in proteins and could be employed as guidelines in protein engineering and design.
Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J
2005-01-01
To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.
Gauging a Hydrocarbon Ruler by an Intrinsic Exciton Probe†
Khan, M. Adil; Neale, Chris; Michaux, Catherine; Pomés, Régis; Privé, Gilbert G.; Woody, Robert W.; Bishop, Russell E.
2016-01-01
The structural basis of lipid acyl-chain selection by membrane-intrinsic enzymes is poorly understood because most integral membrane enzymes of lipid metabolism have proven refractory to structure determination; however, robust enzymes from the outer membranes of Gram-negative bacteria are now providing a first glimpse at the underlying mechanisms. The methylene unit resolution of the phospholipid: lipid A palmitoyltransferase PagP is determined by the hydrocarbon ruler, a 16-carbon saturated acyl-chain-binding pocket buried within the transmembrane β-barrel structure. Substitution of Gly88 lining the floor of the hydrocarbon ruler with Ala or Met makes the enzyme select specifically 15- or 12-carbon saturated acyl chains, respectively, indicating that hydrocarbon ruler depth determines acyl-chain selection. However, the Gly88Cys PagP resolution does not diminish linearly because it selects both 14- and 15-carbon saturated acyl chains. We discovered that an exciton, emanating from a buried Tyr26–Trp66 phenol–indole interaction, is extinguished by a local structural perturbation arising from the proximal Gly88Cys PagP sulfhydryl group. Site-specific S-methylation of the single Cys afforded Gly88Cys-S-methyl PagP, which reasserted both the exciton and methylene unit resolution by specifically selecting 13-carbon saturated acyl chains for transfer to lipid A. Unlike the other Gly88 substitutions, the Cys sulfhydryl group recedes from the hydrocarbon ruler floor and locally perturbs the subjacent Tyr26 and Trp66 aromatic rings. The resulting hydrocarbon ruler expansion thus occurs at the exciton’s expense and accommodates an extra methylene unit in the selected acyl chain. The hydrocarbon ruler–exciton juxtaposition endows PagP with a molecular gauge for probing the structural basis of lipid acyl-chain selection in a membrane-intrinsic environment. PMID:17375935
Khan, Sher Bahadar; Zou, Geng; Cheng, Yu-Ting; Xiao, Ran; Li, Lu; Wu, Bin; Zhou, Rui
2017-06-01
Escherichia coli is an important foodborne zoonotic pathogen. A total of 285 strains of E. coli were isolated from the production and supply chain of pork in Hubei, China and characterized. Their phylogroups (A, B1, B2, and D) and virulence genes of public health importance become more and more diverse along the production and supply chain. Copyright © 2016. Published by Elsevier B.V.
Armentrout, P B; Yang, Bo; Rodgers, M T
2014-04-24
Metal cation-amino acid interactions are key components controlling the secondary structure and biological function of proteins, enzymes, and macromolecular complexes comprising these species. Determination of pairwise interactions of alkali metal cations with amino acids provides a thermodynamic vocabulary that begins to quantify these fundamental processes. In the present work, we expand a systematic study of such interactions by examining rubidium and cesium cations binding with the acidic amino acids (AA), aspartic acid (Asp) and glutamic acid (Glu), and their amide derivatives, asparagine (Asn) and glutamine (Gln). These eight complexes are formed using electrospray ionization and their bond dissociation energies (BDEs) are determined experimentally using threshold collision-induced dissociation with xenon in a guided ion beam tandem mass spectrometer. Analyses of the energy-dependent cross sections include consideration of unimolecular decay rates, internal energy of the reactant ions, and multiple ion-neutral collisions. Quantum chemical calculations are conducted at the B3LYP, MP2(full), and M06 levels of theory using def2-TZVPPD basis sets, with results showing reasonable agreement with experiment. At 0 and 298 K, most levels of theory predict that the ground-state conformers for M(+)(Asp) and M(+)(Asn) involve tridentate binding of the metal cation to the backbone carbonyl, amino, and side-chain carbonyl groups, although tridentate binding to the carboxylic acid group and side-chain carbonyl is competitive for M(+)(Asn). For the two longer side-chain amino acids, Glu and Gln, multiple structures are competitive. A comparison of these results to those for the smaller alkali cations, Na(+) and K(+), provides insight into the trends in binding energies associated with the molecular polarizability and dipole moment of the side chain. For all four metal cations, the BDEs are inversely correlated with the size of the metal cation and follow the order Asp < Glu < Asn < Gln.
Hewett, Daniel M.; Bocklitz, Sebastian; Tabor, Daniel P.; ...
2017-05-23
The conformational preferences of pentyl- through decylbenzene are studied under jet-cooled conditions in the gas phase. Laser-induced fluorescence excitation spectra, fluorescence-dip infrared spectra in the alkyl CH stretch region, and Raman spectra are combined to provide assignments for the observed conformers. Density functional theory calculations at the B3LYP-D3BJ/def2TZVP level of theory provide relative energies and normal mode vibrations that serve as inputs for an anharmonic local mode theory introduced in earlier work on alkylbenzenes with n = 2–4. This model explicitly includes anharmonic mixing of the CH stretch modes with the overtones of scissors/bend modes of the CH 2 andmore » CH 3 groups in the alkyl chain, and is used to assign and interpret the single-conformation IR spectra. In octylbenzene, a pair of LIF transitions shifted -92 and -78 cm -1 from the all-trans electronic origin have unique alkyl CH stretch transitions that are fit by the local model to a g1g3g4 conformation in which the alkyl chain folds back over the aromatic ring π cloud. Its calculated energy is only 1.0 kJ mol -1 above the all-trans global minimum. This fold is at an alkyl chain length less than half that of the pure alkanes (n = 18), consistent with a smaller energy cost for the g1 dihedral and the increased dispersive interaction of the chain with the π cloud. Local site frequencies for the entire set of conformers from the local mode model show ‘edge effects’ that raise the site frequencies of CH 2(1) and CH 2(2) due to the phenyl ring and CH 2(n - 1) due to the methyl group. The g1g3g4 conformer also shows local sites shifted up in frequency at CH 2(3) and CH 2(6) due to interaction with the π cloud.« less
Jin, Yazhong; Zhang, Chong; Liu, Wei; Tang, Yufan; Qi, Hongyan; Chen, Hao; Cao, Songxiao
2016-01-01
Alcohol dehydrogenases (ADH), encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH), designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into three groups respectively, namely long-, medium-, and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into six medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed. PMID:27242871
Lindgren, B F; Ruokonen, E; Magnusson-Borg, K; Takala, J
2001-02-01
Patients with sepsis and trauma are characterised by hypermetabolism, insulin resistance and protein catabolism. Fat emulsions containing medium chain triglycerides have been suggested to be beneficial for these patients since medium chain fatty acids are a more readily available source of energy when compared to long chain fatty acids. The aim of this study was to compare a medium and long chain triglyceride emulsion consisting of structured triglycerides (ST) with a long chain triglyceride (LCT) emulsion in terms of effects on nitrogen balance, energy metabolism and safety. 30 ICU patients with sepsis or multiple injury received a fat emulsion with ST or 20% LCT (1.5 g triglycerides/kg body weight/day) as a component of total parenteral nutrition (TPN), for 5 days in a double blind randomised parallel group design. The main analysis was made on the 3 day per protocol population due to lack of patients at day 5. There were no differences in baseline characteristics of the two groups receiving either the LCT or the ST emulsion. The efficacy analysis was performed on the per protocol population (n=9 ST, n=11 LCT). There was a significant difference between the two treatments regarding daily nitrogen balances when the first 3 days were analysed P=0.0038). This resulted in an amelioration of the nitrogen balance on day 3 in the group on ST as compared to those on LCT (0.1+/-2.4 g vs -9.9+/-2.1 g P=0.01). The 3 day cumulative nitrogen balance was significantly better in the group receiving ST compared to those on LCT (-0.7+/-6.0 vs -16.7+/-3.9 P=0.03). This better cumulative nitrogen balance on day 3 was also preserved as a tendency (P=0.061) in the analysis of the intention to treat population, but on day 5 there was no significant difference (P=0.08). The ST emulsion was well tolerated and no difference was found compared to the LCT emulsion regarding respiratory quotient, energy expenditure, glucose or triglyceride levels during infusion. Administration of a structured triglyceride emulsion resulted in an amelioration of nitrogen balance despite no effect on energy expenditure in short term administration over 3 days to ICU patients when compared to a long chain triglyceride emulsion. No side effects linked to medium chain triglycerides were noted. Copyright 2001 Harcourt Publishers Ltd.
Unit and internal chain profile of African rice (Oryza glaberrima) amylopectin.
Gayin, Joseph; Abdel-Aal, El-Sayed M; Manful, John; Bertoft, Eric
2016-02-10
High-performance anion-exchange chromatography was used to study the unit chain profiles of amylopectins and their φ,β-limit dextrins from two African rice (Oryza glaberrima) accessions-TOG 12440 and IRGC 103759. The samples were compared with two Asian rice (Oryza sativa) samples (cv Koshihikari and cv WITA 4) and one O. sativa × O. glaberrima cross (NERICA 4). The ratio of short:long chains ranged between 12.1 and 13.8, and the ratio of A:B-chains was ∼ 1.0 in all samples. A significant difference was observed in the distribution of internal chains with regards to the proportion of short "fingerprint" B-chains (Bfp-chains), which in the φ,β-limit dextrins have a degree of polymerization (DP) 3-7. The African rice starches and NERICA 4 had higher levels of Bfp-chains, but the major group of short B-chains (DP 8-25) was similar to that of the Asian rice samples. The average chain length (CL), internal chain length (ICL), and total internal chain length (TICL) were similar in all samples. However, the external chain length (ECL) was longer in the African rice samples and NERICA 4. ECL correlated positively and significantly (p<0.05) with gelatinization transition temperatures and enthalpy suggesting differences between the two rice types in cooking properties. Copyright © 2015 Elsevier Ltd. All rights reserved.
An Overview of Chain of Custody Options for LETTERPRESS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smartt, Heidi A.
2016-11-01
This purpose of this document is to provide an overview of Chain of Custody (CoC) technology options that could be made available for the LETTERPRESS exercise as part of the Quad Working Group. The Quad Working Group comprises five sub-working groups (Management, Protocol, Simulation, Technology, and Training) with members from the U.S., U.K., Norway, and Sweden having the goal of providing a repeatable, realistic arms control exercise (dubbed LETTERPRESS) to be executed in representative facilities and using non-proliferative but representative treaty items. The Technology Working Group is responsible for supporting the technology requirements of the LETTERPRESS exercise and as suchmore » the technologies presented here are possible options to meet those requirements.« less
Winners and losers in the complex web of global supply chains.
Glendon, Lee
2013-01-01
This paper discusses how supply chain, risk and business continuity professionals can collaboratively address the consequences of increasing supply chain complexity in order to deliver both resilient and sustainable supply chains. The paper identifies the key drivers of complexity supported by recent case examples, including the equine DNA scandal and the Rana Plaza tragedy in Bangladesh.
Local Dynamics of Acid- and Ion-containing Copolymer Melts
NASA Astrophysics Data System (ADS)
Winey, Karen; Middleton, Robert; Tarver, Jacob; Tyagi, Madhusudan; Soles, Christopher; Frischknecht, Amalie
Interest in acid- and ion-containing polymers arises in part from applications as single-ion conductors for selectively transporting a counter ion for battery applications. Structurally, the low dielectric constant of organic polymers and strong ionic interactions leads to ionic aggregation. Here the polymer backbone motion was investigated through quasi-elastic neutron scattering measurements (QENS) and compared with fully atomistic molecular dynamic simulations of precise poly(ethylene-acrylic acid) copolymers and their ionomers (pxAA-y%Li). The effect of carbon spacer length (x =9, 15, 21) between the acid groups and the degree of neutralization (y) with Li on PE backbone dynamics were considered. Systematic slowing in chain dynamics were observed with increasing neutralization where polymer dynamics appear constrained due to anchoring effects. Simulations provide complementary viewpoints indicating a gradient in chain dynamics as a distance away from acid groups. These results indicate that the addition of pendant acid groups inhibit typical PE backbone motion and the neutralized forms strongly suppress the fraction of mobile PE chain.
Ganassi, Sonia; Pistillo, Marco O.; Di Domenico, Carmela; De Cristofaro, Antonio; Di Palma, Antonella Marta
2017-01-01
The meadow spittlebug, Philaenus spumarius L. (Hemiptera, Aphrophoridae) is a commonly found vector of Xylella fastidiosa Wells et al. (1987) strain subspecies pauca associated with the “Olive Quick Decline Syndrome” in Italy. To contribute to the knowledge of the adult P. spumarius chemoreceptivity, electroantennographic (EAG) responses of both sexes to 50 volatile organic compounds (VOCs) including aliphatic aldehydes, alcohols, esters, and ketones, terpenoids, and aromatics were recorded. Measurable EAG responses were elicited by all compounds tested. In both sexes, octanal, 2-octanol, 2-decanone, (E)-2-hexenyl acetate, and vanillin elicited the strongest antennal amplitude within the chemical groups of aliphatic saturated aldehydes, aliphatic alcohols, aliphatic acetates and aromatics, respectively. Male and female EAG responses to sulcatol, (±)linalool, and sulcatone were higher than those to other terpenoinds. In both sexes, the weakest antennal stimulants were phenethyl alcohol and 2-pentanone. Sexual differences in the EAG amplitude were found only for four of test compounds suggesting a general similarity between males and females in antennal sensitivity. The olfactory system of both sexes proved to be sensitive to changes in stimulus concentration, carbon chain length, and compound structure. Compounds with short carbon chain length (C5—C6) elicited lower EAG amplitudes than compounds with higher carbon chain length (C9—C10) in all classes of aliphatic hydrocarbons with different functional groups. The elucidation of the sensitivity profile of P. spumarius to a variety of VOCs provides a basis for future identification of behaviorally-active compounds useful for developing semiochemical-based control strategies of this pest. PMID:29287108
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Electron detachment of the hydrogen-bonded amino acid side-chain guanine complexes
NASA Astrophysics Data System (ADS)
Wang, Jing; Gu, Jiande; Leszczynski, Jerzy
2007-07-01
The photoelectron spectra of the hydrogen-bonded amino acid side-chain-guanine complexes has been studied at the partial third order (P3) self-energy approximation of the electron propagator theory. The correlation between the vertical electron detachment energy and the charge distributions on the guanine moiety reveals that the vertical electron detachment energy (VDE) increases as the positive charge distribution on the guanine increases. The low VDE values determined for the negatively charged complexes of the guanine-side-chain-group of Asp/Glu suggest that the influence of the H-bonded anionic groups on the VDE of guanine could be more important than that of the anionic backbone structure. The even lower vertical electron detachment energy for guanine is thus can be expected in the H-bonded protein-DNA systems.
Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon
2010-09-01
This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.
Short-Chain PEG Mixed-Monolayer Protected Gold Clusters Increase Clearance and Red Blood Cell Counts
Simpson, Carrie A.; Agrawal, Amanda C.; Balinski, Andrzej; Harkness, Kellen M.; Cliffel, David E.
2011-01-01
Monolayer-protected gold nanoparticles have great potential as novel building blocks for the design of new drugs and therapeutics based on the easy ability to multifunctionalize them for biological targeting and drug activity. In order to create nanoparticles that are biocompatible in vivo, poly-ethylene glycol functional groups have been added to many previous multifunctionalized particles to eliminate non-specific binding. Recently, monolayer-protected gold nanoparticles with mercaptoglycine functionalities were shown to elicit deleterious effects on the kidney in vivo that were eliminated by incorporating a long-chain, mercapto-undecyl-tetraethylene glycol, at very high loadings into a mixed monolayer. These long-chain PEGs induced an immune response to the particle presumably generating an anti-PEG antibody as seen in other long-chain PEG-ylated nanoparticles in vivo. In the present work, we explore the in vivo effects of high and low percent ratios of a shorter chain, mercapto-tetraethylene glycol, within the monolayer using simple place-exchange reactions. The shorter chain PEG MPCs were expected to have better water solubility due to elimination of the alkyl chain, no toxicity, and long-term circulation in vivo. Shorter chain lengths at lower concentrations should not trigger the immune system into creating an anti-PEG antibody. We found that a 10% molar exchange of this short chain PEG within the monolayer met three of the desired goals: high water solubility, no toxicity, and no immune response as measured by white blood cell counts, but none of the short chain PEG mixed monolayer compositions enabled the nanoparticles to have a long circulation time within the blood as compared to mercapto-undecyl-ethylene glycol, which had a residence time of 4 weeks. We also compared the effects of a hydroxyl versus a carboxylic acid terminal functional group on the end of the PEG thiol on both clearance and immune response. The results indicate that short-chain length PEGs, regardless of termini, increase clearance rates compared to the previous long-chain PEG studies while carboxylated-termini increase red blood cell counts at high loadings. Given these findings, short-chain, alcohol-terminated PEG, exchanged at 10% was identified as a potential nanoparticle for further in vivo applications requiring short circulation lifetimes with desired features of no toxicity, no immune response, and high water solubility. PMID:21473648
Gouvea, Maria Isabel S; Joao, Esau C; Teixeira, Maria de Lourdes B; Read, Jennifer S; Fracalanzza, Sergio E L; Souza, Claudia T V; Souza, Maria José de; Torres Filho, Helio M; Leite, Cassiana C F; do Brasil, Pedro E A A
2017-05-01
There are limited data regarding Xpert performance to detect Group B Streptococcus (GBS) in HIV-infected pregnant women. We evaluated the accuracy of a rapid real-time polymerase chain reaction (PCR) test in a cohort of HIV-infected women. At 35-37 weeks of pregnancy, a pair of combined rectovaginal swabs were collected for two GBS assays in a cohort of sequentially included HIV-infected women in Rio de Janeiro: (1) culture; and (2) real-time PCR assay [GeneXpert GBS (Cepheid, Sunnyvale, CA)]. Using culture as the reference, sensitivity, specificity, positive and negative-likelihood ratios were estimated. From June 2012 to February 2015, 337 pregnant women met inclusion criteria. One woman was later excluded, due to failure to obtain a result in the index test; 336 were included in the analyses. The GBS colonization rate was 19.04%. Sensitivity and specificity of the GeneXpert GBS assay were 85.94% (95% CI: 75.38-92.42) and 94.85% (95% CI: 91.55-96.91), respectively. Positive and negative predictive values were 79.71% (95% CI: 68.78-87.51) and 96.63% (95% CI: 93.72-98.22), respectively. GeneXpert GBS is an acceptable test for the identification of GBS colonization in HIV-infected pregnant women and represents a reasonable option to detect GBS colonization in settings where culture is not feasible.
Martin, David H.; Zozaya, Marcela; Lillis, Rebecca A.; Myers, Leann; Nsuami, M. Jacques; Ferris, Michael J.
2013-01-01
Background. The prevalence of Trichomonas vaginalis infection is highest in women with intermediate Nugent scores. We hypothesized that the vaginal microbiota in T. vaginalis–infected women differs from that in T. vaginalis–uninfected women. Methods. Vaginal samples from 30 T. vaginalis–infected women were matched by Nugent score to those from 30 T. vaginalis–uninfected women. Equal numbers of women with Nugent scores categorized as normal, intermediate, and bacterial vaginosis were included. The vaginal microbiota was assessed using 454 pyrosequencing analysis of polymerase chain reaction–amplified 16S ribosomal RNA gene sequences. The 16S ribosomal RNA gene sequence of an unknown organism was obtained by universal bacterial polymerase chain reaction amplification, cloning, and sequencing. Results. Principal coordinates analysis of the pyrosequencing data showed divergence of the vaginal microbiota in T. vaginalis–infected and T. vaginalis–uninfected patients among women with normal and those with intermediate Nugent scores but not among women with bacterial vaginosis. Cluster analysis revealed 2 unique groups of T. vaginalis–infected women. One had high abundance of Mycoplasma hominis and other had high abundance of an unknown Mycoplasma species. Women in the former group had clinical evidence of enhanced vaginal inflammation. Conclusions. T. vaginalis may alter the vaginal microbiota in a manner that is favorable to its survival and/or transmissibility. An unknown Mycoplasma species plays a role in some of these transformations. In other cases, these changes may result in a heightened host inflammatory response. PMID:23482642
Martin, David H; Zozaya, Marcela; Lillis, Rebecca A; Myers, Leann; Nsuami, M Jacques; Ferris, Michael J
2013-06-15
The prevalence of Trichomonas vaginalis infection is highest in women with intermediate Nugent scores. We hypothesized that the vaginal microbiota in T. vaginalis-infected women differs from that in T. vaginalis-uninfected women. Vaginal samples from 30 T. vaginalis-infected women were matched by Nugent score to those from 30 T. vaginalis-uninfected women. Equal numbers of women with Nugent scores categorized as normal, intermediate, and bacterial vaginosis were included. The vaginal microbiota was assessed using 454 pyrosequencing analysis of polymerase chain reaction-amplified 16S ribosomal RNA gene sequences. The 16S ribosomal RNA gene sequence of an unknown organism was obtained by universal bacterial polymerase chain reaction amplification, cloning, and sequencing. Principal coordinates analysis of the pyrosequencing data showed divergence of the vaginal microbiota in T. vaginalis-infected and T. vaginalis-uninfected patients among women with normal and those with intermediate Nugent scores but not among women with bacterial vaginosis. Cluster analysis revealed 2 unique groups of T. vaginalis-infected women. One had high abundance of Mycoplasma hominis and other had high abundance of an unknown Mycoplasma species. Women in the former group had clinical evidence of enhanced vaginal inflammation. T. vaginalis may alter the vaginal microbiota in a manner that is favorable to its survival and/or transmissibility. An unknown Mycoplasma species plays a role in some of these transformations. In other cases, these changes may result in a heightened host inflammatory response.
Zengin, Adem; Caykara, Tuncer
2017-05-01
Herein, we have designed a novel multilayer system composed of poly(methyl methacrylate) [poly(MMA)] brush, biotin, streptavidin and protein-A on a silicon substrate to attach onanti-immunoglobulin G (anti-IgG). poly(MMA) brush with vinyl end-group was first synthesized by the interface-mediated catalytic chain transfer polymerization. The brush was then modified with cysteamine molecules to generate the polymer chains with amine end-group via a thiol-ene click chemistry. The amine end-groups of poly(MMA) chains were also modified with biotin units to ensure selective connection points for streptavidin molecules. Finally, a multilayer system on the silicon substrate was formed by using streptavidin and protein-A molecules, respectively. This multilayer system was employed to attach anti-IgG molecules in a highly oriented manner and provide anti-IgG molecular functional configuration on the multilayer. High reproducibility of the amount of anti-IgG adsorption and homogeneous anti-IgG adsorption layer on the silicon surface could be provided by this multilayer system. The multilayer system with protein A may be opened the door for designing an efficient immunoassay protein chip. Copyright © 2017. Published by Elsevier B.V.
Muscle Activity Patterns Do Not Differ Between Push-Up and Bench Press Exercises.
Gottschall, Jinger S; Hastings, Bryce; Becker, Zachary
2018-05-29
Popular topics for upper body resistance training involve the differences between hand positions, open versus closed chain exercises, and movement variations for the novice to the advanced. We hypothesized that there will be no difference between closed (push-up) versus open (bench press) chain exercises for the primary muscle group activity nor would there be a difference between push-ups on the toes versus knees with respect to the percent contribution of each muscle. We measured surface muscle activity of 8 upper body and core muscles during a sequence of push-up and bench press variations with a normalized weight for twelve active men. Each participant completed push-ups and bench press exercises at each of three hand positions. Our results demonstrated that there were few differences between closed versus open chain exercises for the primary muscle groups with the exception of core activation. To add, in general, narrow hand positions yielded greater activation and there were no significant differences between push-ups on the toes versus knees with respect to the percent contribution for the primary muscle groups. To sum, closed chain exercises may be preferred for functional training and knee push-ups may be ideal as a novice push-up variation.
Structure and thermotropic phase behavior of sodium and potassium carboxylate ionomers
NASA Astrophysics Data System (ADS)
Mantsch, H. H.; Weng, S. F.; Yang, P. W.; Eysel, H. H.
1994-07-01
A molecular complex is formed between long-chain carboxylic acids and their alkali salts in a 1 : 1 mixture. These so-called "acid soaps" or carboxylate ionomers have multilamellar bilayer-type structures in solid state, which are retained in the presence of excess water, resembling the dispersions (gels) formed by typical two-chain amphiphiles, e.g. lipids. The special arrangement of hydrogen-bonded pairs of carboxylic acid and carboxylate groups into a unique "head-group" is supported by frequency shifts and partial or total disappearance of the characteristic vibrations of carboxylic acid dimers and of carboxylate groups. The existence of well-ordered hydrocarbon chains is demonstrated by the existence and polarization properties of the methylene rocking and wagging propagation modes. The gel to liquid-crystal phase transition of the hydrated acid soaps shows practically no cation dependence, unlike the corresponding phase transition in neutral soaps which varies considerably with the nature of the counterion. There is spectroscopic evidence to suggest a cooperative process that involves "melting" of the alkyl chains and disintegration of the hydrogen-bonded carboxylate—carboxylic acid complex, followed by a cation-dependent equilibrium that favors the formation of acid dimers at elevated temperatures and some form of hydrogen-bonded ion pair aggregates at intermediate temperatures.
Zhang, Xu; Wang, Fengshan; Sheng, Juzheng
2016-06-16
Heparan sulfate (HS) is widely distributed in mammalian tissues in the form of HS proteoglycans, which play essential roles in various physiological and pathological processes. In contrast to the template-guided processes involved in the synthesis of DNA and proteins, HS biosynthesis is not believed to involve a template. However, it appears that the final structure of HS chains was strictly regulated. Herein, we report research based hypothesis that two major steps, namely "coding" and "decoding" steps, are involved in the biosynthesis of HS, which strictly regulate its chemical structure and biological activity. The "coding" process in this context is based on the distribution of sulfate moieties on the amino groups of the glucosamine residues in the HS chains. The sulfation of these amine groups is catalyzed by N-deacetylase/N-sulfotransferase, which has four isozymes. The composition and distribution of sulfate groups and iduronic acid residues on the glycan chains of HS are determined by several other modification enzymes, which can recognize these coding sequences (i.e., the "decoding" process). The degree and pattern of the sulfation and epimerization in the HS chains determines the extent of their interactions with several different protein factors, which further influences their biological activity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Marafino, John N; Gallagher, Tara M; Barragan, Jhosdyn; Volkers, Brandi L; LaDow, Jade E; Bonifer, Kyle; Fitzgerald, Gabriel; Floyd, Jason L; McKenna, Kristin; Minahan, Nicholas T; Walsh, Brenna; Seifert, Kyle; Caran, Kevin L
2015-07-01
Two novel series of tris-cationic, tripled-headed, double-tailed amphiphiles were synthesized and the effects of tail length and head group composition on the critical aggregation concentration (CAC), thermodynamic parameters, and minimum inhibitory concentration (MIC) against six bacterial strains were investigated. Synergistic antibacterial combinations of these amphiphiles were also identified. Amphiphiles in this study are composed of a benzene core with three benzylic ammonium bromide groups, two of which have alkyl chains, each 8-16 carbons in length. The third head group is a trimethylammonium or pyridinium. Log of critical aggregation concentration (log[CAC]) and heat of aggregation (ΔHagg) were both inversely proportional to the length of the linear hydrocarbon chains. Antibacterial activity increases with tail length until an optimal tail length of 12 carbons per chain, above which, activity decreased. The derivatives with two 12 carbon chains had the best antibacterial activity, killing all tested strains at concentrations of 1-2μM for Gram-positive and 4-16μM for Gram-negative bacteria. The identity of the third head group (trimethylammonium or pyridinium) had minimal effect on colloidal and antibacterial activity. The antibacterial activity of several binary combinations of amphiphiles from this study was higher than activity of individual amphiphiles, indicating that these combinations are synergistic. These amphiphiles show promise as novel antibacterial agents that could be used in a variety of applications. Copyright © 2015 Elsevier Ltd. All rights reserved.
Influence of ester-modified lipids on bilayer structure.
Villanueva, Diana Y; Lim, Joseph B; Klauda, Jeffery B
2013-11-19
Lipid membranes function as barriers for cells to prevent unwanted chemicals from entering the cell and wanted chemicals from leaving. Because of their hydrophobic interior, membranes do not allow water to penetrate beyond the headgroup region. We performed molecular simulations to examine the effects of ester-modified lipids, which contain ester groups along their hydrocarbon chains, on bilayer structure. We chose two lipids from those presented in Menger et al. [J. Am. Chem. Soc. 2006, 128, 14034] with ester groups in (1) the upper half of the lipid chain (MEPC) and (2) the middle and end of the lipid chain (MGPC). MGPC (30%)/POPC bilayers formed stable water pores of diameter 5-7 Å, but MGPC (22%)/POPC and MEPC (30%)/POPC bilayers did not form these defects. These pores were similar to those formed during electroporation; i.e., the head groups lined the pore and allowed water and ions to transport across the bilayer. However, we found that lateral organization of the MGPC lipids into clusters, instead of an electric field or charge disparity as in electroporation, was essential for pore formation. On the basis of this, we propose an overall mechanism for pore formation. The similarities between the ester-modified lipids and byproducts of lipid peroxidation with multiple hydrophilic groups in the middle of the chain suggest that free radical reactions with unsaturated lipids and sterols result in fundamental changes that may be similar to what is seen in bilayers with ester-modified lipids.
Jain, Tania; Kosiorek, Heidi E; Kung, Shu T; Shah, Vishal S; Dueck, Amylou C; Gonzalez-Calle, Veronica; Luft, Susan; Reeder, Craig B; Adams, Roberta; Noel, Pierre; Larsen, Jeremy T; Mikhael, Joseph; Bergsagel, Leif; Stewart, A Keith; Fonseca, Rafael
2018-05-04
The hematologic response is critical in patients with light chain amyloidosis because a good response is known to improve organ response and overall survival. We present a retrospective analysis to compare the hematologic and organ response in patients who received bortezomib-based therapy before autologous stem cell transplantation (ASCT) versus those who received non-bortezomib-based therapy before ASCT and those who underwent ASCT at diagnosis. Of a total of 63 patients who underwent ASCT for light chain amyloidosis, 34 received bortezomib-based therapy before ASCT (Bor-ASCT) and 29 did not receive bortezomib therapy (non-Bor-ASCT). A greater number of patients had involvement of ≥ 3 organs and cardiac involvement in the Bor-ASCT group, suggesting a greater risk at baseline in the Bor-ASCT group. At 3, 6, and 12 months after ASCT, the hematologic response was better in the Bor-ASCT group, with a statistically significance difference at 6 months (partial response or better in 82% vs. 20%; P = .002) and 12 months (partial response or better in 76% vs. 33%; P = .02). Organ responses (66% vs. 21%; P < .001) and median overall survival (not reached vs. 53 months; P = .001) were also greater in the Bor-ASCT group. Our study has shown that bortezomib-based therapy before ASCT improves the hematologic response, organ response and overall survival, potentially by decreasing the light chain load before ASCT. Copyright © 2018 Elsevier Inc. All rights reserved.
Prediction of protein secondary structure content for the twilight zone sequences.
Homaeian, Leila; Kurgan, Lukasz A; Ruan, Jishou; Cios, Krzysztof J; Chen, Ke
2007-11-15
Secondary protein structure carries information about local structural arrangements, which include three major conformations: alpha-helices, beta-strands, and coils. Significant majority of successful methods for prediction of the secondary structure is based on multiple sequence alignment. However, multiple alignment fails to provide accurate results when a sequence comes from the twilight zone, that is, it is characterized by low (<30%) homology. To this end, we propose a novel method for prediction of secondary structure content through comprehensive sequence representation, called PSSC-core. The method uses a multiple linear regression model and introduces a comprehensive feature-based sequence representation to predict amount of helices and strands for sequences from the twilight zone. The PSSC-core method was tested and compared with two other state-of-the-art prediction methods on a set of 2187 twilight zone sequences. The results indicate that our method provides better predictions for both helix and strand content. The PSSC-core is shown to provide statistically significantly better results when compared with the competing methods, reducing the prediction error by 5-7% for helix and 7-9% for strand content predictions. The proposed feature-based sequence representation uses a comprehensive set of physicochemical properties that are custom-designed for each of the helix and strand content predictions. It includes composition and composition moment vectors, frequency of tetra-peptides associated with helical and strand conformations, various property-based groups like exchange groups, chemical groups of the side chains and hydrophobic group, auto-correlations based on hydrophobicity, side-chain masses, hydropathy, and conformational patterns for beta-sheets. The PSSC-core method provides an alternative for predicting the secondary structure content that can be used to validate and constrain results of other structure prediction methods. At the same time, it also provides useful insight into design of successful protein sequence representations that can be used in developing new methods related to prediction of different aspects of the secondary protein structure. (c) 2007 Wiley-Liss, Inc.
7 CFR 4284.922 - Project eligibility.
Code of Federal Regulations, 2013 CFR
2013-01-01
... agreement with another member of the supply network that is engaged in the value chain on a marketing... revenues resulting from the project that will benefit the producer applicants supplying the majority of the... disadvantaged group. (2) If the applicant is applying for Mid-Tier Value Chain reserved funds, the applicant...
7 CFR 4284.922 - Project eligibility.
Code of Federal Regulations, 2012 CFR
2012-01-01
... agreement with another member of the supply network that is engaged in the value chain on a marketing... revenues resulting from the project that will benefit the producer applicants supplying the majority of the... disadvantaged group. (2) If the applicant is applying for Mid-Tier Value Chain reserved funds, the applicant...
7 CFR 4284.922 - Project eligibility.
Code of Federal Regulations, 2014 CFR
2014-01-01
... agreement with another member of the supply network that is engaged in the value chain on a marketing... revenues resulting from the project that will benefit the producer applicants supplying the majority of the... disadvantaged group. (2) If the applicant is applying for Mid-Tier Value Chain reserved funds, the applicant...
The Role of Mitochondrial Dysfunction in Psychiatric Disease
ERIC Educational Resources Information Center
Scaglia, Fernando
2010-01-01
Mitochondrial respiratory chain disorders are a group of genetically and clinically heterogeneous disorders caused by the biochemical complexity of mitochondrial respiration and the fact that two genomes, one mitochondrial and one nuclear, encode the components of the respiratory chain. These disorders can manifest at birth or present later in…
Cao, Kai; Ward, Jonathan; Amos, Ryan C; Jeong, Moon Gon; Kim, Kyoung Taek; Gauthier, Mario; Foucher, Daniel; Wang, Xiaosong
2014-09-11
Theoretical calculations illustrate that organometallic macromolecules with piano stool coordination repeating units (Fe-acyl complex) adopt linear chain configuration with a P-Fe-C backbone surrounded by aromatic groups. The macromolecules show molecular weight-dependent and temperature stimulated solution behaviour in DMSO.
Barlow, R. B.; Zoller, Anne
1964-01-01
A survey has been made of the effects on junctional transmission of the complete series of polymethylene bis-trimethylammonium (BTM) and bis-triethylammonium (BTE) salts from the decamethylene compounds (BTM 10 and BTE 10) to those with twenty-one methylene groups in the chain. These were tested for their ability to cause contracture of the isolated chick biventer cervicis preparation, and for their ability to block the twitch responses of this preparation, those of the rat isolated diaphragm preparation, and those of the cat tibialis anterior preparation. They were also tested for their ability to block transmission in the cat superior cervical ganglion, to block the actions of acetylcholine on the guinea-pig isolated ileum, and for ability to inhibit the hydrolysis of acetylcholine by acetylcholinesterase. Their electrical conductivity has been measured in aqueous solution. Ability to cause contracture of the chick biventer cervicis is confined to the compounds BTM 10 to 15; BTE 10, 11 and 12 have some weak activity but the other BTE compounds, and the BTM compounds with more than fifteen methylene groups, have virtually no activity. In the BTE series both neuromuscular blocking and ganglion-blocking activities increase with chain length up to a maximum in the region of BTE 15 to 17 and then decline. In the BTM series ganglion-blocking activity increases with chain length in much the same way as in the BTE series, though the maximum activity is at a slightly longer chain length. At the neuromuscular junction an increase in chain length beyond BTM 10 leads to a decline in activity but this returns to some extent at longer chain lengths, reaching a second maximum at BTM 18, above which it declines further. At the ganglion BTE 16 is only slightly more active than BTM 16 and about five-times as active as hexamethonium; at the neuromuscular junction in the cat BTE 16 is about five-times as active as BTM 16 and about eight-times as active as (+)-tubocurarine. The affinity of the BTE compounds for the postganglionic acetylcholine receptors of the guinea-pig ileum reaches a maximum at BTE 14 but does not decline significantly with further increase in chain length. Anticholinesterase activity, likewise, does not alter significantly between BTM 12 and BTM 21 and the activity of the compounds in the BTE series appears to be similar. This property could conceivably be modifying the actions of some of the intermediate compounds but is not likely to be affecting those of the more active ones. The conductivity experiments indicate that micelle formation could be limiting the actions of the compounds with 20 or 21 methylene groups, but is not likely to be affecting those of the other compounds. The results suggest that there is a regular increase with chain length of the affinity of these compounds for the receptors in the ganglia and at the neuromuscular junction but that efficacy in causing contracture is limited to compounds with three methyl groups in the cationic head and a chain of about ten methylene groups. The connexion between this ability to depolarize and the ability to block transmission by desensitization is discussed. PMID:14208190
Gabriel, N E; Agman, N V; Roberts, M F
1987-11-17
Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.
NASA Astrophysics Data System (ADS)
Dabkowska, Aleksandra P.; Lawrence, M. Jayne; McLain, Sylvia E.; Lorenz, Christian D.
2013-01-01
Molecular dynamics simulations are used to provide a detailed investigation of the hydrogen bond networks around the phosphatidylcholine (PC) head group in 1,2-dipropionyl-sn-glycero-3-phosphocholine in pure water, 10 mol.% and 30 mol.% dimethylsulfoxide (DMSO)-water solutions. Specifically, it is observed that DMSO replaces those water molecules that are within the first solvation shell of the choline, phosphate and ester groups of the PC head group, but are not hydrogen-bonded to the group. The effect of the presence of DMSO on the hydrogen bond network around the PC head groups of the lipid changes with the concentration of DMSO. In comparison to the hydrogen bond network observed in the pure water system, the number of hydrogen-bonded chains of solvent molecules increases slightly for the 10 mol.% DMSO system, while, in the 30 mol.% DMSO system, the number of hydrogen-bonded chains of solvent molecules decreases.