Ground-state energies of the nonlinear sigma model and the Heisenberg spin chains
NASA Technical Reports Server (NTRS)
Zhang, Shoucheng; Schulz, H. J.; Ziman, Timothy
1989-01-01
A theorem on the O(3) nonlinear sigma model with the topological theta term is proved, which states that the ground-state energy at theta = pi is always higher than the ground-state energy at theta = 0, for the same value of the coupling constant g. Provided that the nonlinear sigma model gives the correct description for the Heisenberg spin chains in the large-s limit, this theorem makes a definite prediction relating the ground-state energies of the half-integer and the integer spin chains. The ground-state energies obtained from the exact Bethe ansatz solution for the spin-1/2 chain and the numerical diagonalization on the spin-1, spin-3/2, and spin-2 chains support this prediction.
Side-chain mobility in the folded state of Myoglobin
NASA Astrophysics Data System (ADS)
Lammert, Heiko; Onuchic, Jose
We study the accessibility of alternative side-chain rotamer configurations in the native state of Myoglobin, using an all-atom structure-based model. From long, unbiased simulation trajectories we determine occupancies of rotameric states and also estimate configurational and vibrational entropies. Direct sampling of the full native-state dynamics, enabled by the simple model, reveals facilitation of side-chain motions by backbone dynamics. Correlations between different dihedral angles are quantified and prove to be weak. We confirm global trends in the mobilities of side-chains, following burial and also the chemical character of residues. Surface residues loose little configurational entropy upon folding; side-chains contribute significantly to the entropy of the folded state. Mobilities of buried side-chains vary strongly with temperature. At ambient temperature, individual side-chains in the core of the protein gain substantial access to alternative rotamers, with occupancies that are likely observable experimentally. Finally, the dynamics of buried side-chains may be linked to the internal pockets, available to ligand gas molecules in Myoglobin.
Simplification of irreversible Markov chains by removal of states with fast leaving rates.
Jia, Chen
2016-07-07
In the recent work of Ullah et al. (2012a), the authors developed an effective method to simplify reversible Markov chains by removal of states with low equilibrium occupancies. In this paper, we extend this result to irreversible Markov chains. We show that an irreversible chain can be simplified by removal of states with fast leaving rates. Moreover, we reveal that the irreversibility of the chain will always decrease after model simplification. This suggests that although model simplification can retain almost all the dynamic information of the chain, it will lose some thermodynamic information as a trade-off. Examples from biology are also given to illustrate the main results of this paper. Copyright © 2016 Elsevier Ltd. All rights reserved.
Thorwart, Michael
2018-01-01
Realizing Majorana bound states (MBS) in condensed matter systems is a key challenge on the way toward topological quantum computing. As a promising platform, one-dimensional magnetic chains on conventional superconductors were theoretically predicted to host MBS at the chain ends. We demonstrate a novel approach to design of model-type atomic-scale systems for studying MBS using single-atom manipulation techniques. Our artificially constructed atomic Fe chains on a Re surface exhibit spin spiral states and a remarkable enhancement of the local density of states at zero energy being strongly localized at the chain ends. Moreover, the zero-energy modes at the chain ends are shown to emerge and become stabilized with increasing chain length. Tight-binding model calculations based on parameters obtained from ab initio calculations corroborate that the system resides in the topological phase. Our work opens new pathways to design MBS in atomic-scale hybrid structures as a basis for fault-tolerant topological quantum computing. PMID:29756034
Kim, Howon; Palacio-Morales, Alexandra; Posske, Thore; Rózsa, Levente; Palotás, Krisztián; Szunyogh, László; Thorwart, Michael; Wiesendanger, Roland
2018-05-01
Realizing Majorana bound states (MBS) in condensed matter systems is a key challenge on the way toward topological quantum computing. As a promising platform, one-dimensional magnetic chains on conventional superconductors were theoretically predicted to host MBS at the chain ends. We demonstrate a novel approach to design of model-type atomic-scale systems for studying MBS using single-atom manipulation techniques. Our artificially constructed atomic Fe chains on a Re surface exhibit spin spiral states and a remarkable enhancement of the local density of states at zero energy being strongly localized at the chain ends. Moreover, the zero-energy modes at the chain ends are shown to emerge and become stabilized with increasing chain length. Tight-binding model calculations based on parameters obtained from ab initio calculations corroborate that the system resides in the topological phase. Our work opens new pathways to design MBS in atomic-scale hybrid structures as a basis for fault-tolerant topological quantum computing.
Majorana bound states in the finite-length chain
NASA Astrophysics Data System (ADS)
Zvyagin, A. A.
2015-08-01
Recent experiments investigating edge states in ferromagnetic atomic chains on superconducting substrate are analyzed. In particular, finite size effects are considered. It is shown how the energy of the Majorana bound state depends on the length of the chain, as well as on the parameters of the model. Oscillations of the energy of the bound edge state in the chain as a function of the length of the chain, and as a function of the applied voltage (or the chemical potential) are studied. In particular, it has been shown that oscillations can exist only for some values of the effective potential.
Quantum-information approach to the Ising model: Entanglement in chains of qubits
NASA Astrophysics Data System (ADS)
Štelmachovič, Peter; Bužek, Vladimír
2004-09-01
Simple physical interactions between spin- 1/2 particles may result in quantum states that exhibit exotic correlations that are difficult to find if one simply explores state spaces of multipartite systems. In particular, we present a detailed investigation of the well-known Ising model of a chain (ring) of spin- 1/2 particles (qubits) in a transverse magnetic field. We present explicit expressions for eigenstates of the model Hamiltonian for arbitrary number of spin- 1/2 particles in the chain in the standard (computer) basis, and we investigate quantum entanglement between individual qubits. We analyze bipartite as well as multipartite entanglement in the ground state of the model. In particular, we show that bipartite entanglement between pairs of qubits of the Ising chain (measured in terms of a concurrence) as a function of the parameter λ has a maximum around the point λ=1 , and it monotonically decreases for large values of λ . We prove that in the limit λ→∞ this state is locally unitary equivalent to an N -partite Greenberger-Horn-Zeilinger state. We also analyze a very specific eigenstate of the Ising Hamiltonian with a zero eigenenergy (we denote this eigenstate as the X -state). This X -state exhibits the “extreme” entanglement in a sense that an arbitrary subset A of k⩽n qubits in the Ising chain composed of N=2n+1 qubits is maximally entangled with the remaining qubits (set B ) in the chain. In addition, we prove that by performing a local operation just on the subset B , one can transform the X -state into a direct product of k singlets shared by the parties A and B . This property of the X -state can be utilized for new secure multipartite communication protocols.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suhara, Tadahiro; Kanada-En'yo, Yoshiko
We investigate the linear-chain structures in highly excited states of {sup 14}C using a generalized molecular-orbital model, by which we incorporate an asymmetric configuration of three {alpha} clusters in the linear-chain states. By applying this model to the {sup 14}C system, we study the {sup 10}Be+{alpha} correlation in the linear-chain state of {sup 14}C. To clarify the origin of the {sup 10}Be+{alpha} correlation in the {sup 14}C linear-chain state, we analyze linear 3 {alpha} and 3{alpha} + n systems in a similar way. We find that a linear 3{alpha} system prefers the asymmetric 2{alpha} + {alpha} configuration, whose origin ismore » the many-body correlation incorporated by the parity projection. This configuration causes an asymmetric mean field for two valence neutrons, which induces the concentration of valence neutron wave functions around the correlating 2{alpha}. A linear-chain structure of {sup 16}C is also discussed.« less
A Markov chain model for reliability growth and decay
NASA Technical Reports Server (NTRS)
Siegrist, K.
1982-01-01
A mathematical model is developed to describe a complex system undergoing a sequence of trials in which there is interaction between the internal states of the system and the outcomes of the trials. For example, the model might describe a system undergoing testing that is redesigned after each failure. The basic assumptions for the model are that the state of the system after a trial depends probabilistically only on the state before the trial and on the outcome of the trial and that the outcome of a trial depends probabilistically only on the state of the system before the trial. It is shown that under these basic assumptions, the successive states form a Markov chain and the successive states and outcomes jointly form a Markov chain. General results are obtained for the transition probabilities, steady-state distributions, etc. A special case studied in detail describes a system that has two possible state ('repaired' and 'unrepaired') undergoing trials that have three possible outcomes ('inherent failure', 'assignable-cause' 'failure' and 'success'). For this model, the reliability function is computed explicitly and an optimal repair policy is obtained.
Markov chains for testing redundant software
NASA Technical Reports Server (NTRS)
White, Allan L.; Sjogren, Jon A.
1988-01-01
A preliminary design for a validation experiment has been developed that addresses several problems unique to assuring the extremely high quality of multiple-version programs in process-control software. The procedure uses Markov chains to model the error states of the multiple version programs. The programs are observed during simulated process-control testing, and estimates are obtained for the transition probabilities between the states of the Markov chain. The experimental Markov chain model is then expanded into a reliability model that takes into account the inertia of the system being controlled. The reliability of the multiple version software is computed from this reliability model at a given confidence level using confidence intervals obtained for the transition probabilities during the experiment. An example demonstrating the method is provided.
Newman, Roger H; Hill, Stefan J; Harris, Philip J
2013-12-01
A synchrotron wide-angle x-ray scattering study of mung bean (Vigna radiata) primary cell walls was combined with published solid-state nuclear magnetic resonance data to test models for packing of (1→4)-β-glucan chains in cellulose microfibrils. Computer-simulated peak shapes, calculated for 36-chain microfibrils with perfect order or uncorrelated disorder, were sharper than those in the experimental diffractogram. Introducing correlated disorder into the models broaden the simulated peaks but only when the disorder was increased to unrealistic magnitudes. Computer-simulated diffractograms, calculated for 24- and 18-chain models, showed good fits to experimental data. Particularly good fits to both x-ray and nuclear magnetic resonance data were obtained for collections of 18-chain models with mixed cross-sectional shapes and occasional twinning. Synthesis of 18-chain microfibrils is consistent with a model for cellulose-synthesizing complexes in which three cellulose synthase polypeptides form a particle and six particles form a rosette.
Classification of customer lifetime value models using Markov chain
NASA Astrophysics Data System (ADS)
Permana, Dony; Pasaribu, Udjianna S.; Indratno, Sapto W.; Suprayogi
2017-10-01
A firm’s potential reward in future time from a customer can be determined by customer lifetime value (CLV). There are some mathematic methods to calculate it. One method is using Markov chain stochastic model. Here, a customer is assumed through some states. Transition inter the states follow Markovian properties. If we are given some states for a customer and the relationships inter states, then we can make some Markov models to describe the properties of the customer. As Markov models, CLV is defined as a vector contains CLV for a customer in the first state. In this paper we make a classification of Markov Models to calculate CLV. Start from two states of customer model, we make develop in many states models. The development a model is based on weaknesses in previous model. Some last models can be expected to describe how real characters of customers in a firm.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Man, Zhong-Xiao, E-mail: zxman@mail.qfnu.edu.cn; An, Nguyen Ba, E-mail: nban@iop.vast.ac.vn; Xia, Yun-Jie, E-mail: yjxia@mail.qfnu.edu.cn
In combination with the theories of open system and quantum recovering measurement, we propose a quantum state transfer scheme using spin chains by performing two sequential operations: a projective measurement on the spins of ‘environment’ followed by suitably designed quantum recovering measurements on the spins of interest. The scheme allows perfect transfer of arbitrary multispin states through multiple parallel spin chains with finite probability. Our scheme is universal in the sense that it is state-independent and applicable to any model possessing spin–spin interactions. We also present possible methods to implement the required measurements taking into account the current experimental technologies.more » As applications, we consider two typical models for which the probabilities of perfect state transfer are found to be reasonably high at optimally chosen moments during the time evolution. - Highlights: • Scheme that can achieve perfect quantum state transfer is devised. • The scheme is state-independent and applicable to any spin-interaction models. • The scheme allows perfect transfer of arbitrary multispin states. • Applications to two typical models are considered in detail.« less
Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude
2006-03-01
The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.
Fast-slow asymptotics for a Markov chain model of fast sodium current
NASA Astrophysics Data System (ADS)
Starý, Tomáš; Biktashev, Vadim N.
2017-09-01
We explore the feasibility of using fast-slow asymptotics to eliminate the computational stiffness of discrete-state, continuous-time deterministic Markov chain models of ionic channels underlying cardiac excitability. We focus on a Markov chain model of fast sodium current, and investigate its asymptotic behaviour with respect to small parameters identified in different ways.
NASA Astrophysics Data System (ADS)
Lo Iudice, N.; Bianco, D.; Andreozzi, F.; Porrino, A.; Knapp, F.
2012-10-01
Large scale shell model calculations based on a new diagonalization algorithm are performed in order to investigate the mixed symmetry states in chains of nuclei in the proximity of N=82. The resulting spectra and transitions are in agreement with the experiments and consistent with the scheme provided by the interacting boson model.
Thermodynamic perturbation theory for fused sphere hard chain fluids using nonadditive interactions
NASA Astrophysics Data System (ADS)
Abu-Sharkh, Basel F.; Sunaidi, Abdallah; Hamad, Esam Z.
2004-03-01
A model is developed for the equation of state of fused chains based on Wertheim thermodynamic perturbation theory and nonadditive size interactions. The model also assumes that the structure (represented by the radial distribution function) of the fused chain fluid is the same as that of the touching hard sphere chain fluid. The model is completely based on spherical additive and nonadditive size interactions. The model has the advantage of offering good agreement with simulation data while at the same time being independent of fitted parameters. The model is most accurate for short chains, small values of Δ (slightly fused spheres) and at intermediate (liquidlike) densities.
NASA Astrophysics Data System (ADS)
Choi, Hwan Bin; Lee, Ji-Woo
2017-09-01
We study quantum phase transitions of a XXZ spin model with spin S = 1/2 and 1 in one dimension. The XXZ spin chain is one of basic models in understanding various one-dimensional magnetic materials. To study this model, we construct infinite-lattice matrix product state (iMPS), which is a tensor product form for a one-dimensional many-body quantum wave function. By using timeevolution- block-decimation method (TEBD) on iMPS, we obtain the ground states of the XXZ model at zero temperature. This method is very delicate in calculating ground states so that we developed a reliable method of finding the ground state with the dimension of entanglement coefficients up to 300, which is beyond the previous works. By analyzing ground-state energies, half-chain entanglement entropies, and entanglement spectrum, we found the signatures of quantum phase transitions between ferromagnetic phase, XY phase, Haldane phase, and antiferromagnetic phase.
First and second order semi-Markov chains for wind speed modeling
NASA Astrophysics Data System (ADS)
Prattico, F.; Petroni, F.; D'Amico, G.
2012-04-01
The increasing interest in renewable energy leads scientific research to find a better way to recover most of the available energy. Particularly, the maximum energy recoverable from wind is equal to 59.3% of that available (Betz law) at a specific pitch angle and when the ratio between the wind speed in output and in input is equal to 1/3. The pitch angle is the angle formed between the airfoil of the blade of the wind turbine and the wind direction. Old turbine and a lot of that actually marketed, in fact, have always the same invariant geometry of the airfoil. This causes that wind turbines will work with an efficiency that is lower than 59.3%. New generation wind turbines, instead, have a system to variate the pitch angle by rotating the blades. This system able the wind turbines to recover, at different wind speed, always the maximum energy, working in Betz limit at different speed ratios. A powerful system control of the pitch angle allows the wind turbine to recover better the energy in transient regime. A good stochastic model for wind speed is then needed to help both the optimization of turbine design and to assist the system control to predict the value of the wind speed to positioning the blades quickly and correctly. The possibility to have synthetic data of wind speed is a powerful instrument to assist designer to verify the structures of the wind turbines or to estimate the energy recoverable from a specific site. To generate synthetic data, Markov chains of first or higher order are often used [1,2,3]. In particular in [3] is presented a comparison between a first-order Markov chain and a second-order Markov chain. A similar work, but only for the first-order Markov chain, is conduced by [2], presenting the probability transition matrix and comparing the energy spectral density and autocorrelation of real and synthetic wind speed data. A tentative to modeling and to join speed and direction of wind is presented in [1], by using two models, first-order Markov chain with different number of states, and Weibull distribution. All this model use Markov chains to generate synthetic wind speed time series but the search for a better model is still open. Approaching this issue, we applied new models which are generalization of Markov models. More precisely we applied semi-Markov models to generate synthetic wind speed time series. Semi-Markov processes (SMP) are a wide class of stochastic processes which generalize at the same time both Markov chains and renewal processes. Their main advantage is that of using whatever type of waiting time distribution for modeling the time to have a transition from one state to another one. This major flexibility has a price to pay: availability of data to estimate the parameters of the model which are more numerous. Data availability is not an issue in wind speed studies, therefore, semi-Markov models can be used in a statistical efficient way. In this work we present three different semi-Markov chain models: the first one is a first-order SMP where the transition probabilities from two speed states (at time Tn and Tn-1) depend on the initial state (the state at Tn-1), final state (the state at Tn) and on the waiting time (given by t=Tn-Tn-1), the second model is a second order SMP where we consider the transition probabilities as depending also on the state the wind speed was before the initial state (which is the state at Tn-2) and the last one is still a second order SMP where the transition probabilities depends on the three states at Tn-2,Tn-1 and Tn and on the waiting times t_1=Tn-1-Tn-2 and t_2=Tn-Tn-1. The three models are used to generate synthetic time series for wind speed by means of Monte Carlo simulations and the time lagged autocorrelation is used to compare statistical properties of the proposed models with those of real data and also with a time series generated though a simple Markov chain. [1] F. Youcef Ettoumi, H. Sauvageot, A.-E.-H. Adane, Statistical bivariate modeling of wind using first-order Markov chain and Weibull distribution, Renewable Energy, 28/2003 1787-1802. [2] A. Shamshad, M.A. Bawadi, W.M.W. Wan Hussin, T.A. Majid, S.A.M. Sanusi, First and second order Markov chain models for synthetic generation of wind speed time series, Energy 30/2005 693-708. [3] H. Nfaoui, H. Essiarab, A.A.M. Sayigh, A stochastic Markov chain model for simulating wind speed time series at Tangiers, Morocco, Renewable Energy 29/2004, 1407-1418.
Newman, Roger H.; Hill, Stefan J.; Harris, Philip J.
2013-01-01
A synchrotron wide-angle x-ray scattering study of mung bean (Vigna radiata) primary cell walls was combined with published solid-state nuclear magnetic resonance data to test models for packing of (1→4)-β-glucan chains in cellulose microfibrils. Computer-simulated peak shapes, calculated for 36-chain microfibrils with perfect order or uncorrelated disorder, were sharper than those in the experimental diffractogram. Introducing correlated disorder into the models broaden the simulated peaks but only when the disorder was increased to unrealistic magnitudes. Computer-simulated diffractograms, calculated for 24- and 18-chain models, showed good fits to experimental data. Particularly good fits to both x-ray and nuclear magnetic resonance data were obtained for collections of 18-chain models with mixed cross-sectional shapes and occasional twinning. Synthesis of 18-chain microfibrils is consistent with a model for cellulose-synthesizing complexes in which three cellulose synthase polypeptides form a particle and six particles form a rosette. PMID:24154621
NASA Astrophysics Data System (ADS)
Panu, U. S.; Ng, W.; Rasmussen, P. F.
2009-12-01
The modeling of weather states (i.e., precipitation occurrences) is critical when the historical data are not long enough for the desired analysis. Stochastic models (e.g., Markov Chain and Alternating Renewal Process (ARP)) of the precipitation occurrence processes generally assume the existence of short-term temporal-dependency between the neighboring states while implying the existence of long-term independency (randomness) of states in precipitation records. Existing temporal-dependent models for the generation of precipitation occurrences are restricted either by the fixed-length memory (e.g., the order of a Markov chain model), or by the reining states in segments (e.g., persistency of homogenous states within dry/wet-spell lengths of an ARP). The modeling of variable segment lengths and states could be an arduous task and a flexible modeling approach is required for the preservation of various segmented patterns of precipitation data series. An innovative Dictionary approach has been developed in the field of genome pattern recognition for the identification of frequently occurring genome segments in DNA sequences. The genome segments delineate the biologically meaningful ``words" (i.e., segments with a specific patterns in a series of discrete states) that can be jointly modeled with variable lengths and states. A meaningful “word”, in hydrology, can be referred to a segment of precipitation occurrence comprising of wet or dry states. Such flexibility would provide a unique advantage over the traditional stochastic models for the generation of precipitation occurrences. Three stochastic models, namely, the alternating renewal process using Geometric distribution, the second-order Markov chain model, and the Dictionary approach have been assessed to evaluate their efficacy for the generation of daily precipitation sequences. Comparisons involved three guiding principles namely (i) the ability of models to preserve the short-term temporal-dependency in data through the concepts of autocorrelation, average mutual information, and Hurst exponent, (ii) the ability of models to preserve the persistency within the homogenous dry/wet weather states through analysis of dry/wet-spell lengths between the observed and generated data, and (iii) the ability to assesses the goodness-of-fit of models through the likelihood estimates (i.e., AIC and BIC). Past 30 years of observed daily precipitation records from 10 Canadian meteorological stations were utilized for comparative analyses of the three models. In general, the Markov chain model performed well. The remainders of the models were found to be competitive from one another depending upon the scope and purpose of the comparison. Although the Markov chain model has a certain advantage in the generation of daily precipitation occurrences, the structural flexibility offered by the Dictionary approach in modeling the varied segment lengths of heterogeneous weather states provides a distinct and powerful advantage in the generation of precipitation sequences.
Borges, Itamar; Aquino, Adélia J A; Köhn, Andreas; Nieman, Reed; Hase, William L; Chen, Lin X; Lischka, Hans
2013-12-11
A detailed quantum chemical simulation of the excitonic and charge-transfer (CT) states of a bulk heterojunction model containing poly(thieno[3,4-b]thiophene benzodithiophene) (PTB1)/[6,6]-phenyl-C61-butyric acid methyl ester (PCBM) is reported. The largest molecular model contains two stacked PTB1 trimer chains interacting with C60 positioned on top of and lateral to the (PTB1)3 stack. The calculations were performed using the algebraic diagrammatic construction method to second order (ADC(2)). One main result of the calculations is that the CT states are located below the bright inter-chain excitonic state, directly accessible via internal conversion processes. The other important aspects of the calculations are the formation of discrete bands of CT states originating from the lateral C60's and the importance of inter-chain charge delocalization for the stability of the CT states. A simple model for the charge separation step is also given, revealing the energetic feasibility of the overall photovoltaic process.
Thermal conductivity of the Lennard-Jones chain fluid model.
Galliero, Guillaume; Boned, Christian
2009-12-01
Nonequilibrium molecular dynamics simulations have been performed to estimate, analyze, and correlate the thermal conductivity of a fluid composed of short Lennard-Jones chains (up to 16 segments) over a large range of thermodynamic conditions. It is shown that the dilute gas contribution to the thermal conductivity decreases when the chain length increases for a given temperature. In dense states, simulation results indicate that the residual thermal conductivity of the monomer increases strongly with density, but is weakly dependent on the temperature. Compared to the monomer value, it has been noted that the residual thermal conductivity of the chain was slightly decreasing with its length. Using these results, an empirical relation, including a contribution due to the critical enhancement, is proposed to provide an accurate estimation of the thermal conductivity of the Lennard-Jones chain fluid model (up to 16 segments) over the domain 0.8
Noise can speed convergence in Markov chains.
Franzke, Brandon; Kosko, Bart
2011-10-01
A new theorem shows that noise can speed convergence to equilibrium in discrete finite-state Markov chains. The noise applies to the state density and helps the Markov chain explore improbable regions of the state space. The theorem ensures that a stochastic-resonance noise benefit exists for states that obey a vector-norm inequality. Such noise leads to faster convergence because the noise reduces the norm components. A corollary shows that a noise benefit still occurs if the system states obey an alternate norm inequality. This leads to a noise-benefit algorithm that requires knowledge of the steady state. An alternative blind algorithm uses only past state information to achieve a weaker noise benefit. Simulations illustrate the predicted noise benefits in three well-known Markov models. The first model is a two-parameter Ehrenfest diffusion model that shows how noise benefits can occur in the class of birth-death processes. The second model is a Wright-Fisher model of genotype drift in population genetics. The third model is a chemical reaction network of zeolite crystallization. A fourth simulation shows a convergence rate increase of 64% for states that satisfy the theorem and an increase of 53% for states that satisfy the corollary. A final simulation shows that even suboptimal noise can speed convergence if the noise applies over successive time cycles. Noise benefits tend to be sharpest in Markov models that do not converge quickly and that do not have strong absorbing states.
Exact solution of the relativistic quantum Toda chain
NASA Astrophysics Data System (ADS)
Zhang, Xin; Cao, Junpeng; Yang, Wen-Li; Shi, Kangjie; Wang, Yupeng
2017-03-01
The relativistic quantum Toda chain model is studied with the generalized algebraic Bethe Ansatz method. By employing a set of local gauge transformations, proper local vacuum states can be obtained for this model. The exact spectrum and eigenstates of the model are thus constructed simultaneously.
Jiang, Hao; Adidharma, Hertanto
2014-11-07
The thermodynamic modeling of flexible charged hard-sphere chains representing polyampholyte or polyelectrolyte molecules in solution is considered. The excess Helmholtz energy and osmotic coefficients of solutions containing short polyampholyte and the osmotic coefficients of solutions containing short polyelectrolytes are determined by performing canonical and isobaric-isothermal Monte Carlo simulations. A new equation of state based on the thermodynamic perturbation theory is also proposed for flexible charged hard-sphere chains. For the modeling of such chains, the use of solely the structure information of monomer fluid for calculating the chain contribution is found to be insufficient and more detailed structure information must therefore be considered. Two approaches, i.e., the dimer and dimer-monomer approaches, are explored to obtain the contribution of the chain formation to the Helmholtz energy. By comparing with the simulation results, the equation of state with either the dimer or dimer-monomer approach accurately predicts the excess Helmholtz energy and osmotic coefficients of polyampholyte and polyelectrolyte solutions except at very low density. It also well captures the effect of temperature on the thermodynamic properties of these solutions.
NASA Astrophysics Data System (ADS)
Minami, Kazuhiko
2017-12-01
An infinite number of spin chains are solved and it is derived that the ground-state phase transitions belong to the universality classes with central charge c = m / 2, where m is an integer. The models are diagonalized by automatically obtained transformations, many of which are different from the Jordan-Wigner transformation. The free energies, correlation functions, string order parameters, exponents, central charges, and the phase diagram are obtained. Most of the examples consist of the stabilizers of the cluster state. A unified structure of the one-dimensional XY and cluster-type spin chains is revealed, and other series of solvable models can be obtained through this formula.
Side-chain-side-chain interactions and stability of the helical state
NASA Astrophysics Data System (ADS)
Zangi, Ronen
2014-01-01
Understanding the driving forces that lead to the stability of the secondary motifs found in proteins, namely α-helix and β-sheet, is a major goal in structural biology. The thermodynamic stability of these repetitive units is a result of a delicate balance between many factors, which in addition to the peptide chain involves also the solvent. Despite the fact that the backbones of all amino acids are the same (except of that of proline), there are large differences in the propensity of the different amino acids to promote the helical structure. In this paper, we investigate by explicit-solvent molecular dynamics simulations the role of the side chains (modeled as coarse-grained single sites) in stabilizing α helices in an aqueous solution. Our model systems include four (six-mer-nine-mer) peptide lengths in which the magnitude of the effective attraction between the side chains is systematically increased. We find that these interactions between the side chains can induce (for the nine-mer almost completely) a transition from a coil to a helical state. This transition is found to be characterized by three states in which the intermediate state is a partially folded α-helical conformation. In the absence of any interactions between the side chains the free energy change for helix formation has a small positive value indicating that favorable contributions from the side chains are necessary to stabilize the helical conformation. Thus, the helix-coil transition is controlled by the effective potentials between the side-chain residues and the magnitude of the required attraction per residue, which is on the order of the thermal energy, reduces with the length of the peptide. Surprisingly, the plots of the population of the helical state (or the change in the free energy for helix formation) as a function of the total effective interactions between the side chains in the helical state for all peptide lengths fall on the same curve.
Berlow, Noah; Pal, Ranadip
2011-01-01
Genetic Regulatory Networks (GRNs) are frequently modeled as Markov Chains providing the transition probabilities of moving from one state of the network to another. The inverse problem of inference of the Markov Chain from noisy and limited experimental data is an ill posed problem and often generates multiple model possibilities instead of a unique one. In this article, we address the issue of intervention in a genetic regulatory network represented by a family of Markov Chains. The purpose of intervention is to alter the steady state probability distribution of the GRN as the steady states are considered to be representative of the phenotypes. We consider robust stationary control policies with best expected behavior. The extreme computational complexity involved in search of robust stationary control policies is mitigated by using a sequential approach to control policy generation and utilizing computationally efficient techniques for updating the stationary probability distribution of a Markov chain following a rank one perturbation.
State-space reduction and equivalence class sampling for a molecular self-assembly model.
Packwood, Daniel M; Han, Patrick; Hitosugi, Taro
2016-07-01
Direct simulation of a model with a large state space will generate enormous volumes of data, much of which is not relevant to the questions under study. In this paper, we consider a molecular self-assembly model as a typical example of a large state-space model, and present a method for selectively retrieving 'target information' from this model. This method partitions the state space into equivalence classes, as identified by an appropriate equivalence relation. The set of equivalence classes H, which serves as a reduced state space, contains none of the superfluous information of the original model. After construction and characterization of a Markov chain with state space H, the target information is efficiently retrieved via Markov chain Monte Carlo sampling. This approach represents a new breed of simulation techniques which are highly optimized for studying molecular self-assembly and, moreover, serves as a valuable guideline for analysis of other large state-space models.
A descriptive model of resting-state networks using Markov chains.
Xie, H; Pal, R; Mitra, S
2016-08-01
Resting-state functional connectivity (RSFC) studies considering pairwise linear correlations have attracted great interests while the underlying functional network structure still remains poorly understood. To further our understanding of RSFC, this paper presents an analysis of the resting-state networks (RSNs) based on the steady-state distributions and provides a novel angle to investigate the RSFC of multiple functional nodes. This paper evaluates the consistency of two networks based on the Hellinger distance between the steady-state distributions of the inferred Markov chain models. The results show that generated steady-state distributions of default mode network have higher consistency across subjects than random nodes from various RSNs.
The topological basis realization and the corresponding XXX spin chain
NASA Astrophysics Data System (ADS)
Sun, C. F.; Xue, K.; Wang, G. C.; Zhou, C. C.; Du, G. J.
2011-06-01
In this paper, it is shown that the XXX model can be constructed from the Temperley-Lieb algebra (TLA) generator. We find that the topological basis states are the two eigenstaes of a closed four-qubit Heisenberg XXX spin chain. Specifically, the spin single states and the energy single state of the system all fall on the topological basis states. It is worth mentioning that for the closed 2N-qubit (N=2, 3, 4, ...) Heisenberg XXX spin chain, all the topological basis states for 2N particles are the spin single states of the system. And the number of the topological basis states is equal to the number of the spin single states of the system, which is \\frac{(2N)!}{N!(N+1)!} .
Capacity of a quantum memory channel correlated by matrix product states
NASA Astrophysics Data System (ADS)
Mulherkar, Jaideep; Sunitha, V.
2018-04-01
We study the capacity of a quantum channel where channel acts like controlled phase gate with the control being provided by a one-dimensional quantum spin chain environment. Due to the correlations in the spin chain, we get a quantum channel with memory. We derive formulas for the quantum capacity of this channel when the spin state is a matrix product state. Particularly, we derive exact formulas for the capacity of the quantum memory channel when the environment state is the ground state of the AKLT model and the Majumdar-Ghosh model. We find that the behavior of the capacity for the range of the parameters is analytic.
Rapid Configurational Fluctuations in a Model of Methylcellulose
NASA Astrophysics Data System (ADS)
Li, Xiaolan; Dorfman, Kevin
Methylcellulose is a thermoresponsive polymer that undergoes a phase transition at elevated temperature, forming fibrils of a uniform diameter. However, the gelation mechanism is still unclear, in particular at higher polymer concentrations. We have investigated a coarse-grained model for methylcellulose, proposed by Larson and coworkers, that produces collapsed toroids in dilute solution with a radius close to that in experiments. Using Brownian Dynamics simulations, we demonstrate that this model's dihedral potential generates ``flipping events'', which helps the chain to avoid kinetic traps by undergoing a sudden transition between a coiled and a collapsed state. If the dihedral potential is removed, the chains cannot escape from their collapsed configuration, whereas at high dihedral potentials, the chains cannot stabilize the collapsed state. We will present quantitative results on the effect of the dihedral potential on both chain statistics and dynamic behavior, and discuss the implication of our results on the spontaneous formation of high-aspect ratio fibrils in experiments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Hao; Adidharma, Hertanto, E-mail: adidharm@uwyo.edu
The thermodynamic modeling of flexible charged hard-sphere chains representing polyampholyte or polyelectrolyte molecules in solution is considered. The excess Helmholtz energy and osmotic coefficients of solutions containing short polyampholyte and the osmotic coefficients of solutions containing short polyelectrolytes are determined by performing canonical and isobaric-isothermal Monte Carlo simulations. A new equation of state based on the thermodynamic perturbation theory is also proposed for flexible charged hard-sphere chains. For the modeling of such chains, the use of solely the structure information of monomer fluid for calculating the chain contribution is found to be insufficient and more detailed structure information must thereforemore » be considered. Two approaches, i.e., the dimer and dimer-monomer approaches, are explored to obtain the contribution of the chain formation to the Helmholtz energy. By comparing with the simulation results, the equation of state with either the dimer or dimer-monomer approach accurately predicts the excess Helmholtz energy and osmotic coefficients of polyampholyte and polyelectrolyte solutions except at very low density. It also well captures the effect of temperature on the thermodynamic properties of these solutions.« less
Measurement-based quantum teleportation on finite AKLT chains
NASA Astrophysics Data System (ADS)
Fujii, Akihiko; Feder, David
In the measurement-based model of quantum computation, universal quantum operations are effected by making repeated local measurements on resource states which contain suitable entanglement. Resource states include two-dimensional cluster states and the ground state of the Affleck-Kennedy-Lieb-Tasaki (AKLT) state on the honeycomb lattice. Recent studies suggest that measurements on one-dimensional systems in the Haldane phase teleport perfect single-qubit gates in the correlation space, protected by the underlying symmetry. As laboratory realizations of symmetry-protected states will necessarily be finite, we investigate the potential for quantum gate teleportation in finite chains of a bilinear-biquadratic Hamiltonian which is a generalization of the AKLT model representing the full Haldane phase.
Andreev molecules in semiconductor nanowire double quantum dots.
Su, Zhaoen; Tacla, Alexandre B; Hocevar, Moïra; Car, Diana; Plissard, Sébastien R; Bakkers, Erik P A M; Daley, Andrew J; Pekker, David; Frolov, Sergey M
2017-09-19
Chains of quantum dots coupled to superconductors are promising for the realization of the Kitaev model of a topological superconductor. While individual superconducting quantum dots have been explored, control of longer chains requires understanding of interdot coupling. Here, double quantum dots are defined by gate voltages in indium antimonide nanowires. High transparency superconducting niobium titanium nitride contacts are made to each of the dots in order to induce superconductivity, as well as probe electron transport. Andreev bound states induced on each of dots hybridize to define Andreev molecular states. The evolution of these states is studied as a function of charge parity on the dots, and in magnetic field. The experiments are found in agreement with a numerical model.Quantum dots in a nanowire are one possible approach to creating a solid-state quantum simulator. Here, the authors demonstrate the coupling of electronic states in a double quantum dot to form Andreev molecule states; a potential building block for longer chains suitable for quantum simulation.
Schmandt, Nicolaus T; Galán, Roberto F
2012-09-14
Markov chains provide realistic models of numerous stochastic processes in nature. We demonstrate that in any Markov chain, the change in occupation number in state A is correlated to the change in occupation number in state B if and only if A and B are directly connected. This implies that if we are only interested in state A, fluctuations in B may be replaced with their mean if state B is not directly connected to A, which shortens computing time considerably. We show the accuracy and efficacy of our approximation theoretically and in simulations of stochastic ion-channel gating in neurons.
A Decision Model for Steady-State Choice in Concurrent Chains
ERIC Educational Resources Information Center
Christensen, Darren R.; Grace, Randolph C.
2010-01-01
Grace and McLean (2006) proposed a decision model for acquisition of choice in concurrent chains which assumes that after reinforcement in a terminal link, subjects make a discrimination whether the preceding reinforcer delay was short or long relative to a criterion. Their model was subsequently extended by Christensen and Grace (2008, 2009a,…
Dynamic effective connectivity in cortically embedded systems of recurrently coupled synfire chains.
Trengove, Chris; Diesmann, Markus; van Leeuwen, Cees
2016-02-01
As a candidate mechanism of neural representation, large numbers of synfire chains can efficiently be embedded in a balanced recurrent cortical network model. Here we study a model in which multiple synfire chains of variable strength are randomly coupled together to form a recurrent system. The system can be implemented both as a large-scale network of integrate-and-fire neurons and as a reduced model. The latter has binary-state pools as basic units but is otherwise isomorphic to the large-scale model, and provides an efficient tool for studying its behavior. Both the large-scale system and its reduced counterpart are able to sustain ongoing endogenous activity in the form of synfire waves, the proliferation of which is regulated by negative feedback caused by collateral noise. Within this equilibrium, diverse repertoires of ongoing activity are observed, including meta-stability and multiple steady states. These states arise in concert with an effective connectivity structure (ECS). The ECS admits a family of effective connectivity graphs (ECGs), parametrized by the mean global activity level. Of these graphs, the strongly connected components and their associated out-components account to a large extent for the observed steady states of the system. These results imply a notion of dynamic effective connectivity as governing neural computation with synfire chains, and related forms of cortical circuitry with complex topologies.
Modeling methodology for supply chain synthesis and disruption analysis
NASA Astrophysics Data System (ADS)
Wu, Teresa; Blackhurst, Jennifer
2004-11-01
The concept of an integrated or synthesized supply chain is a strategy for managing today's globalized and customer driven supply chains in order to better meet customer demands. Synthesizing individual entities into an integrated supply chain can be a challenging task due to a variety of factors including conflicting objectives, mismatched incentives and constraints of the individual entities. Furthermore, understanding the effects of disruptions occurring at any point in the system is difficult when working toward synthesizing supply chain operations. Therefore, the goal of this research is to present a modeling methodology to manage the synthesis of a supply chain by linking hierarchical levels of the system and to model and analyze disruptions in the integrated supply chain. The contribution of this research is threefold: (1) supply chain systems can be modeled hierarchically (2) the performance of synthesized supply chain system can be evaluated quantitatively (3) reachability analysis is used to evaluate the system performance and verify whether a specific state is reachable, allowing the user to understand the extent of effects of a disruption.
Ising Model on Tangled Chain, Some Thermodynamic Properties
NASA Astrophysics Data System (ADS)
Mejdani, R.
1996-09-01
In this paper we consider an Ising model on tangled chain, where some additional bonds compared to a pure Ising chain are presented. To understand the behavior of this system and the competition between ferromagnetic bonds J along the chain and antiferromagnetic bonds J' across the chain, we have studied in detail analytically and iteratively some of the thermodynamic quantities. Particularly interesting is, in the zero-field and zero-temperature limit, the behavior of the magnetization and the susceptibility closely related to the ground-state configurations and their degeneracies. This degeneracy, presented at the condition J' ≤ -J between J and J', explains, also, the existence of nonzero entropy at zero temperature. This model applied as a lattice gas model defined on a tangled chain could be also useful for the experimental investigations in studying the saturation curves for the enzyme kinetics or the melting curves for DNA-denaturation.
Jia, Chen
2017-09-01
Here we develop an effective approach to simplify two-time-scale Markov chains with infinite state spaces by removal of states with fast leaving rates, which improves the simplification method of finite Markov chains. We introduce the concept of fast transition paths and show that the effective transitions of the reduced chain can be represented as the superposition of the direct transitions and the indirect transitions via all the fast transition paths. Furthermore, we apply our simplification approach to the standard Markov model of single-cell stochastic gene expression and provide a mathematical theory of random gene expression bursts. We give the precise mathematical conditions for the bursting kinetics of both mRNAs and proteins. It turns out that random bursts exactly correspond to the fast transition paths of the Markov model. This helps us gain a better understanding of the physics behind the bursting kinetics as an emergent behavior from the fundamental multiscale biochemical reaction kinetics of stochastic gene expression.
NASA Astrophysics Data System (ADS)
Jia, Chen
2017-09-01
Here we develop an effective approach to simplify two-time-scale Markov chains with infinite state spaces by removal of states with fast leaving rates, which improves the simplification method of finite Markov chains. We introduce the concept of fast transition paths and show that the effective transitions of the reduced chain can be represented as the superposition of the direct transitions and the indirect transitions via all the fast transition paths. Furthermore, we apply our simplification approach to the standard Markov model of single-cell stochastic gene expression and provide a mathematical theory of random gene expression bursts. We give the precise mathematical conditions for the bursting kinetics of both mRNAs and proteins. It turns out that random bursts exactly correspond to the fast transition paths of the Markov model. This helps us gain a better understanding of the physics behind the bursting kinetics as an emergent behavior from the fundamental multiscale biochemical reaction kinetics of stochastic gene expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bian, Bao-An; Institute of Low Energy Nuclear Physics, Beijing Normal University, Beijing 100875; Di, Yao-Min
2007-01-15
The systematics of g factor of the first excited 2{sup +} state vs neutron number N is studied by the projected shell model. The study covers the even-even nuclei of all isotopic chains from Gd to Pt. g factors are calculated by using the many-body wave functions that well reproduce the energy levels and B(E2)s of the ground-state bands. For Gd to W isotopes the characteristic feature of the g factor data along an isotopic chain is described by the present model. Deficiency of the model in the g factor description for the heavier Os and Pt isotopes is discussed.
Sebastian, Tunny; Jeyaseelan, Visalakshi; Jeyaseelan, Lakshmanan; Anandan, Shalini; George, Sebastian; Bangdiwala, Shrikant I
2018-01-01
Hidden Markov models are stochastic models in which the observations are assumed to follow a mixture distribution, but the parameters of the components are governed by a Markov chain which is unobservable. The issues related to the estimation of Poisson-hidden Markov models in which the observations are coming from mixture of Poisson distributions and the parameters of the component Poisson distributions are governed by an m-state Markov chain with an unknown transition probability matrix are explained here. These methods were applied to the data on Vibrio cholerae counts reported every month for 11-year span at Christian Medical College, Vellore, India. Using Viterbi algorithm, the best estimate of the state sequence was obtained and hence the transition probability matrix. The mean passage time between the states were estimated. The 95% confidence interval for the mean passage time was estimated via Monte Carlo simulation. The three hidden states of the estimated Markov chain are labelled as 'Low', 'Moderate' and 'High' with the mean counts of 1.4, 6.6 and 20.2 and the estimated average duration of stay of 3, 3 and 4 months, respectively. Environmental risk factors were studied using Markov ordinal logistic regression analysis. No significant association was found between disease severity levels and climate components.
Magnetic End States in a Strongly Interacting One-Dimensional Topological Kondo Insulator
Lobos, Alejandro M.; Dobry, Ariel O.; Galitski, Victor
2015-05-22
Topological Kondo insulators are strongly correlated materials where itinerant electrons hybridize with localized spins, giving rise to a topologically nontrivial band structure. Here, we use nonperturbative bosonization and renormalization-group techniques to study theoretically a one-dimensional topological Kondo insulator, described as a Kondo-Heisenberg model, where the Heisenberg spin-1/2 chain is coupled to a Hubbard chain through a Kondo exchange interaction in the p-wave channel (i.e., a strongly correlated version of the prototypical Tamm-Schockley model).We derive and solve renormalization-group equations at two-loop order in the Kondo parameter, and find that, at half filling, the charge degrees of freedom in the Hubbard chainmore » acquire a Mott gap, even in the case of a noninteracting conduction band (Hubbard parameter U = 0). Furthermore, at low enough temperatures, the system maps onto a spin-1/2 ladder with local ferromagnetic interactions along the rungs, effectively locking the spin degrees of freedom into a spin-1 chain with frozen charge degrees of freedom. This structure behaves as a spin-1 Haldane chain, a prototypical interacting topological spin model, and features two magnetic spin-1/2 end states for chains with open boundary conditions. In conclusion, our analysis allows us to derive an insightful connection between topological Kondo insulators in one spatial dimension and the well-known physics of the Haldane chain, showing that the ground state of the former is qualitatively different from the predictions of the naive mean-field theory.« less
The role of protein homochirality in shaping the energy landscape of folding
Nanda, Vikas; Andrianarijaona, Aina; Narayanan, Chitra
2007-01-01
The homochirality, or isotacticity, of the natural amino acids facilitates the formation of regular secondary structures such as α-helices and β-sheets. However, many examples exist in nature where novel polypeptide topologies use both l- and d-amino acids. In this study, we explore how stereochemistry of the polypeptide backbone influences basic properties such as compactness and the size of fold space by simulating both lattice and all-atom polypeptide chains. We formulate a rectangular lattice chain model in both two and three dimensions, where monomers are chiral, having the effect of restricting local conformation. Syndiotactic chains with alternating chirality of adjacent monomers have a very large ensemble of accessible conformations characterized predominantly by extended structures. Isotactic chains on the other hand, have far fewer possible conformations and a significant fraction of these are compact. Syndiotactic chains are often unable to access maximally compact states available to their isotactic counterparts of the same length. Similar features are observed in all-atom models of isotactic versus syndiotactic polyalanine. Our results suggest that protein isotacticity has evolved to increase the enthalpy of chain collapse by facilitating compact helical states and to reduce the entropic cost of folding by restricting the size of the unfolded ensemble of competing states. PMID:17600146
El Yazid Boudaren, Mohamed; Monfrini, Emmanuel; Pieczynski, Wojciech; Aïssani, Amar
2014-11-01
Hidden Markov chains have been shown to be inadequate for data modeling under some complex conditions. In this work, we address the problem of statistical modeling of phenomena involving two heterogeneous system states. Such phenomena may arise in biology or communications, among other fields. Namely, we consider that a sequence of meaningful words is to be searched within a whole observation that also contains arbitrary one-by-one symbols. Moreover, a word may be interrupted at some site to be carried on later. Applying plain hidden Markov chains to such data, while ignoring their specificity, yields unsatisfactory results. The Phasic triplet Markov chain, proposed in this paper, overcomes this difficulty by means of an auxiliary underlying process in accordance with the triplet Markov chains theory. Related Bayesian restoration techniques and parameters estimation procedures according to the new model are then described. Finally, to assess the performance of the proposed model against the conventional hidden Markov chain model, experiments are conducted on synthetic and real data.
Logofet, D O; Evstigneev, O I; Aleĭnikov, A A; Morozova, A O
2014-01-01
A homogeneous Markov chain of three aggregated states "pond--swamp--wood" is proposed as a model of cyclic zoogenic successions caused by beaver (Castor fiber L.) life activity in a forest biogeocoenosis. To calibrate the chain transition matrix, the data have appeared sufficient that were gained from field studies undertaken in "Bryanskii Les" Reserve in the years of 2002-2008. Major outcomes of the calibrated model ensue from the formulae of finite homogeneous Markov chain theory: the stationary probability distribution of states, thematrix (T) of mean first passage times, and the mean durations (M(j)) of succession stages. The former illustrates the distribution of relative areas under succession stages if the current trends and transition rates of succession are conserved in the long-term--it has appeared close to the observed distribution. Matrix T provides for quantitative characteristics of the cyclic process, specifying the ranges the experts proposed for the duration of stages in the conceptual scheme of succession. The calculated values of M(j) detect potential discrepancies between empirical data, the expert knowledge that summarizes the data, and the postulates accepted in the mathematical model. The calculated M2 value falls outside the expert range, which gives a reason to doubt the validity of expert estimation proposed, the aggregation mode chosen for chain states, or/and the accuracy-of data available, i.e., to draw certain "lessons" from partially successful calibration. Refusal to postulate the time homogeneity or the Markov property of the chain is also discussed among possible ways to improve the model.
Predicting landscape vegetation dynamics using state-and-transition simulation models
Colin J. Daniel; Leonardo Frid
2012-01-01
This paper outlines how state-and-transition simulation models (STSMs) can be used to project changes in vegetation over time across a landscape. STSMs are stochastic, empirical simulation models that use an adapted Markov chain approach to predict how vegetation will transition between states over time, typically in response to interactions between succession,...
Characterizing Plasmonic Excitations of Quasi-2D Chains
NASA Astrophysics Data System (ADS)
Townsend, Emily; Bryant, Garnett
A quantum description of the optical response of nanostructures and other atomic-scale systems is desirable for modeling systems that use plasmons for quantum information transfer, or coherent transport and interference of quantum states, as well as systems small enough for electron tunneling or quantum confinement to affect the electronic states of the system. Such a quantum description is complicated by the fact that collective and single-particle excitations can have similar energies and thus will mix. We seek to better understand the excitations of nanosystems to identify which characteristics of the excitations are most relevant to modeling their behavior. In this work we use a quasi 2-dimensional linear atomic chain as a model system, and exact diagonalization of the many-body Hamiltonian to obtain its excitations. We compare this to previous work in 1-d chains which used a combination of criteria involving a many-body state's transfer dipole moment, balance, transfer charge, dynamical response, and induced-charge distribution to identify which excitations are plasmonic in character.
Reentrant topological phase transition in a bridging model between Kitaev and Haldane chains
NASA Astrophysics Data System (ADS)
Sugimoto, Takanori; Ohtsu, Mitsuyoshi; Tohyama, Takami
2017-12-01
We present a reentrant phase transition in a bridging model between two different topological models: Kitaev and Haldane chains. This model is activated by introducing a bond alternation into the Kitaev chain [A. Y. Kitaev, Phys. Usp. 44, 131 (2001), 10.1070/1063-7869/44/10S/S29]. Without the bond alternation, the finite pairing potential induces a topological state defined by the zero-energy Majorana edge mode, while finite bond alternation without the pairing potential makes a different topological state similar to the Haldane state, which is defined by the local Berry phase in the bulk. The topologically ordered state corresponds to the Su-Schrieffer-Heeger state, which is classified as the same symmetry class. We thus find a phase transition between the two topological phases with a reentrant phenomenon, and extend the phase diagram in the plane of the pairing potential and the bond alternation by using three techniques: recursive equation, fidelity, and Pfaffian. In addition, we find that the phase transition is characterized by both the change of the position of Majorana zero-energy modes from one edge to the other edge and the emergence of a string order in the bulk, and that the reentrance is based on a sublattice U(1) rotation. Consequently, our paper and model not only open a direct way to discuss the bulk and edge topologies but demonstrate an example of the reentrant topologies.
Transition probabilities of health states for workers in Malaysia using a Markov chain model
NASA Astrophysics Data System (ADS)
Samsuddin, Shamshimah; Ismail, Noriszura
2017-04-01
The aim of our study is to estimate the transition probabilities of health states for workers in Malaysia who contribute to the Employment Injury Scheme under the Social Security Organization Malaysia using the Markov chain model. Our study uses four states of health (active, temporary disability, permanent disability and death) based on the data collected from the longitudinal studies of workers in Malaysia for 5 years. The transition probabilities vary by health state, age and gender. The results show that men employees are more likely to have higher transition probabilities to any health state compared to women employees. The transition probabilities can be used to predict the future health of workers in terms of a function of current age, gender and health state.
Thermodynamic limit and boundary energy of the su(3) spin chain with non-diagonal boundary fields
NASA Astrophysics Data System (ADS)
Wen, Fakai; Yang, Tao; Yang, Zhanying; Cao, Junpeng; Hao, Kun; Yang, Wen-Li
2017-02-01
We investigate the thermodynamic limit of the su (n)-invariant spin chain models with unparallel boundary fields. It is found that the contribution of the inhomogeneous term in the associated T-Q relation to the ground state energy does vanish in the thermodynamic limit. This fact allows us to calculate the boundary energy of the system. Taking the su (2) (or the XXX) spin chain and the su (3) spin chain as concrete examples, we have studied the corresponding boundary energies of the models. The method used in this paper can be generalized to study the thermodynamic properties and boundary energy of other high rank models with non-diagonal boundary fields.
Overshoot in biological systems modelled by Markov chains: a non-equilibrium dynamic phenomenon.
Jia, Chen; Qian, Minping; Jiang, Daquan
2014-08-01
A number of biological systems can be modelled by Markov chains. Recently, there has been an increasing concern about when biological systems modelled by Markov chains will perform a dynamic phenomenon called overshoot. In this study, the authors found that the steady-state behaviour of the system will have a great effect on the occurrence of overshoot. They showed that overshoot in general cannot occur in systems that will finally approach an equilibrium steady state. They further classified overshoot into two types, named as simple overshoot and oscillating overshoot. They showed that except for extreme cases, oscillating overshoot will occur if the system is far from equilibrium. All these results clearly show that overshoot is a non-equilibrium dynamic phenomenon with energy consumption. In addition, the main result in this study is validated with real experimental data.
Folding and stability of helical bundle proteins from coarse-grained models.
Kapoor, Abhijeet; Travesset, Alex
2013-07-01
We develop a coarse-grained model where solvent is considered implicitly, electrostatics are included as short-range interactions, and side-chains are coarse-grained to a single bead. The model depends on three main parameters: hydrophobic, electrostatic, and side-chain hydrogen bond strength. The parameters are determined by considering three level of approximations and characterizing the folding for three selected proteins (training set). Nine additional proteins (containing up to 126 residues) as well as mutated versions (test set) are folded with the given parameters. In all folding simulations, the initial state is a random coil configuration. Besides the native state, some proteins fold into an additional state differing in the topology (structure of the helical bundle). We discuss the stability of the native states, and compare the dynamics of our model to all atom molecular dynamics simulations as well as some general properties on the interactions governing folding dynamics. Copyright © 2013 Wiley Periodicals, Inc.
Infinite coherence time of edge spins in finite-length chains
NASA Astrophysics Data System (ADS)
Maceira, Ivo A.; Mila, Frédéric
2018-02-01
Motivated by the recent observation that exponentially long coherence times can be achieved for edge spins in models with strong zero modes, we study the impact of level crossings in finite-length spin chains on the dynamics of the edge spins. Focusing on the X Y spin-1 /2 chain with a transverse or longitudinal magnetic field, two models relevant to understanding recent experimental results on cobalt adatoms, we show that the edge spins can remain coherent for an infinite time even for a finite-length chain if the magnetic field is tuned to a value at which there is a level crossing. Furthermore, we show that the edge spins remain coherent for any initial state for the integrable case of a transverse field because all states have level crossings at the same value of the field, while the coherence time is increasingly large for lower temperatures in the case of a longitudinal field, which is nonintegrable.
Statistical physics of the symmetric group.
Williams, Mobolaji
2017-04-01
Ordered chains (such as chains of amino acids) are ubiquitous in biological cells, and these chains perform specific functions contingent on the sequence of their components. Using the existence and general properties of such sequences as a theoretical motivation, we study the statistical physics of systems whose state space is defined by the possible permutations of an ordered list, i.e., the symmetric group, and whose energy is a function of how certain permutations deviate from some chosen correct ordering. Such a nonfactorizable state space is quite different from the state spaces typically considered in statistical physics systems and consequently has novel behavior in systems with interacting and even noninteracting Hamiltonians. Various parameter choices of a mean-field model reveal the system to contain five different physical regimes defined by two transition temperatures, a triple point, and a quadruple point. Finally, we conclude by discussing how the general analysis can be extended to state spaces with more complex combinatorial properties and to other standard questions of statistical mechanics models.
Statistical physics of the symmetric group
NASA Astrophysics Data System (ADS)
Williams, Mobolaji
2017-04-01
Ordered chains (such as chains of amino acids) are ubiquitous in biological cells, and these chains perform specific functions contingent on the sequence of their components. Using the existence and general properties of such sequences as a theoretical motivation, we study the statistical physics of systems whose state space is defined by the possible permutations of an ordered list, i.e., the symmetric group, and whose energy is a function of how certain permutations deviate from some chosen correct ordering. Such a nonfactorizable state space is quite different from the state spaces typically considered in statistical physics systems and consequently has novel behavior in systems with interacting and even noninteracting Hamiltonians. Various parameter choices of a mean-field model reveal the system to contain five different physical regimes defined by two transition temperatures, a triple point, and a quadruple point. Finally, we conclude by discussing how the general analysis can be extended to state spaces with more complex combinatorial properties and to other standard questions of statistical mechanics models.
A Looping-Based Model for Quenching Repression
Pollak, Yaroslav; Goldberg, Sarah; Amit, Roee
2017-01-01
We model the regulatory role of proteins bound to looped DNA using a simulation in which dsDNA is represented as a self-avoiding chain, and proteins as spherical protrusions. We simulate long self-avoiding chains using a sequential importance sampling Monte-Carlo algorithm, and compute the probabilities for chain looping with and without a protrusion. We find that a protrusion near one of the chain’s termini reduces the probability of looping, even for chains much longer than the protrusion–chain-terminus distance. This effect increases with protrusion size, and decreases with protrusion-terminus distance. The reduced probability of looping can be explained via an eclipse-like model, which provides a novel inhibitory mechanism. We test the eclipse model on two possible transcription-factor occupancy states of the D. melanogaster eve 3/7 enhancer, and show that it provides a possible explanation for the experimentally-observed eve stripe 3 and 7 expression patterns. PMID:28085884
Modeling Bi-induced changes in the electronic structure of GaAs1-xBix alloys
NASA Astrophysics Data System (ADS)
Virkkala, Ville; Havu, Ville; Tuomisto, Filip; Puska, Martti J.
2013-12-01
We suggested recently [V. Virkkala , Phys. Rev. BPRBMDO1098-012110.1103/PhysRevB.88.035204 88, 035204 (2013)] that the band-gap narrowing in dilute GaAs1-xNx alloys can be explained to result from the broadening of the localized N states due to the N-N interaction along the zigzag chains in the <110> directions. In that study our tight-binding modeling based on first-principles density-functional calculations took into account the random distribution of N atoms in a natural way. In this work we extend our modeling to GaAs1-xBix alloys. Our results indicate that Bi states mix with host material states. However, the states near the valence-band edge agglomerate along the zigzag chains originating from individual Bi atoms. This leads to Bi-Bi interactions in a random alloy broadening these states in energy and causing the band-gap narrowing.
López-Moreno, Sergio; Martínez-Ojeda, Rosa Haydeé; López-Arellano, Oliva; Jarillo-Soto, Edgar; Castro-Albarrán, Juan Manuel
2011-01-01
To assess the consequences of private outsourcing on the overall supply and filling of prescriptions in state health services. The research was conducted using quantitative and qualitative techniques in 13 states. The information was collected through interviews and direct observation. The interviews were carried on staff of state health services related to the drug supply chain and users of health services. The quantitative approach examined the percentage of stocked full recipes in a sample of users. States that have opted for the fully outsourced model, and properly monitored this choice, have increased the supply of drugs to their users and guaranteed the supply in the care units in charge. Other states with the outsourced model have multiple problems: direct purchase of drugs not included in the basic drugs catalogue, failure of suppliers and shortage of supplies in the laboratories that provide the company. The main disadvantages identified in all models were: the subordination of the medical criteria to administrative criteria, insufficient planning based on local care needs, heterogeneous procedures, insufficient knowledge of regulations and lack of normativity. The results indicate that the incorporation of private providers in the drug supply chain may not be the solution to bring down the shortage faced by health services, especially at the hospital level. The shift to outsourcing models has developed without incorporating evaluation mechanisms and the consequences that this transition can have on state health systems must be investigated more deeply.
The open XXX spin chain in the SoV framework: scalar product of separate states
NASA Astrophysics Data System (ADS)
Kitanine, N.; Maillet, J. M.; Niccoli, G.; Terras, V.
2017-06-01
We consider the XXX open spin-1/2 chain with the most general non-diagonal boundary terms, that we solve by means of the quantum separation of variables (SoV) approach. We compute the scalar products of separate states, a class of states which notably contains all the eigenstates of the model. As usual for models solved by SoV, these scalar products can be expressed as some determinants with a non-trivial dependance in terms of the inhomogeneity parameters that have to be introduced for the method to be applicable. We show that these determinants can be transformed into alternative ones in which the homogeneous limit can easily be taken. These new representations can be considered as generalizations of the well-known determinant representation for the scalar products of the Bethe states of the periodic chain. In the particular case where a constraint is applied on the boundary parameters, such that the transfer matrix spectrum and eigenstates can be characterized in terms of polynomial solutions of a usual T-Q equation, the scalar product that we compute here corresponds to the scalar product between two off-shell Bethe-type states. If in addition one of the states is an eigenstate, the determinant representation can be simplified, hence leading in this boundary case to direct analogues of algebraic Bethe ansatz determinant representations of the scalar products for the periodic chain.
Weber, Juliane; Zachow, Christopher; Witthaut, Dirk
2018-03-01
Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.
NASA Astrophysics Data System (ADS)
Weber, Juliane; Zachow, Christopher; Witthaut, Dirk
2018-03-01
Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.
Gabriel, N E; Agman, N V; Roberts, M F
1987-11-17
Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.
Smith, Timothy M.; Kim, Taegon; Pelton, Rylie E. O.; Suh, Kyo; Schmitt, Jennifer
2017-01-01
Corn production, and its associated inputs, is a relatively large source of greenhouse gas emissions and uses significant amounts of water and land, thus contributing to climate change, fossil fuel depletion, local air pollutants, and local water scarcity. As large consumers of this corn, corporations in the ethanol and animal protein industries are increasingly assessing and reporting sustainability impacts across their supply chains to identify, prioritize, and communicate sustainability risks and opportunities material to their operations. In doing so, many have discovered that the direct impacts of their owned operations are dwarfed by those upstream in the supply chain, requiring transparency and knowledge about environmental impacts along the supply chains. Life cycle assessments (LCAs) have been used to identify hotspots of environmental impacts at national levels, yet these provide little subnational information necessary for guiding firms’ specific supply networks. In this paper, our Food System Supply-Chain Sustainability (FoodS3) model connects spatial, firm-specific demand of corn purchasers with upstream corn production in the United States through a cost minimization transport model. This provides a means to link county-level corn production in the United States to firm-specific demand locations associated with downstream processing facilities. Our model substantially improves current LCA assessment efforts that are confined to broad national or state level impacts. In drilling down to subnational levels of environmental impacts that occur over heterogeneous areas and aggregating these landscape impacts by specific supply networks, targeted opportunities for improvements to the sustainability performance of supply chains are identified. PMID:28874548
Smith, Timothy M; Goodkind, Andrew L; Kim, Taegon; Pelton, Rylie E O; Suh, Kyo; Schmitt, Jennifer
2017-09-19
Corn production, and its associated inputs, is a relatively large source of greenhouse gas emissions and uses significant amounts of water and land, thus contributing to climate change, fossil fuel depletion, local air pollutants, and local water scarcity. As large consumers of this corn, corporations in the ethanol and animal protein industries are increasingly assessing and reporting sustainability impacts across their supply chains to identify, prioritize, and communicate sustainability risks and opportunities material to their operations. In doing so, many have discovered that the direct impacts of their owned operations are dwarfed by those upstream in the supply chain, requiring transparency and knowledge about environmental impacts along the supply chains. Life cycle assessments (LCAs) have been used to identify hotspots of environmental impacts at national levels, yet these provide little subnational information necessary for guiding firms' specific supply networks. In this paper, our Food System Supply-Chain Sustainability (FoodS 3 ) model connects spatial, firm-specific demand of corn purchasers with upstream corn production in the United States through a cost minimization transport model. This provides a means to link county-level corn production in the United States to firm-specific demand locations associated with downstream processing facilities. Our model substantially improves current LCA assessment efforts that are confined to broad national or state level impacts. In drilling down to subnational levels of environmental impacts that occur over heterogeneous areas and aggregating these landscape impacts by specific supply networks, targeted opportunities for improvements to the sustainability performance of supply chains are identified.
NASA Astrophysics Data System (ADS)
Finch, Peter E.; Flohr, Michael; Frahm, Holger
2018-02-01
We study two families of quantum models which have been used previously to investigate the effect of topological symmetries in one-dimensional correlated matter. Various striking similarities are observed between certain {Z}n quantum clock models, spin chains generalizing the Ising model, and chains of non-Abelian anyons constructed from the so(n)2 fusion category for odd n, both subject to periodic boundary conditions. In spite of the differences between these two types of quantum chains, e.g. their Hilbert spaces being spanned by tensor products of local spin states or fusion paths of anyons, the symmetries of the lattice models are shown to be closely related. Furthermore, under a suitable mapping between the parameters describing the interaction between spins and anyons the respective Hamiltonians share part of their energy spectrum (although their degeneracies may differ). This spin-anyon correspondence can be extended by fine-tuning of the coupling constants leading to exactly solvable models. We show that the algebraic structures underlying the integrability of the clock models and the anyon chain are the same. For n = 3,5,7 we perform an extensive finite size study—both numerical and based on the exact solution—of these models to map out their ground state phase diagram and to identify the effective field theories describing their low energy behaviour. We observe that the continuum limit at the integrable points can be described by rational conformal field theories with extended symmetry algebras which can be related to the discrete ones of the lattice models.
Predicting the stability of nanodevices
NASA Astrophysics Data System (ADS)
Lin, Z. Z.; Yu, W. F.; Wang, Y.; Ning, X. J.
2011-05-01
A simple model based on the statistics of single atoms is developed to predict the stability or lifetime of nanodevices without empirical parameters. Under certain conditions, the model produces the Arrhenius law and the Meyer-Neldel compensation rule. Compared with the classical molecular-dynamics simulations for predicting the stability of monatomic carbon chain at high temperature, the model is proved to be much more accurate than the transition state theory. Based on the ab initio calculation of the static potential, the model can give out a corrected lifetime of monatomic carbon and gold chains at higher temperature, and predict that the monatomic chains are very stable at room temperature.
NASA Astrophysics Data System (ADS)
Yang, Qi; Cao, Yue; Chen, Shiyin; Teng, Yue; Meng, Yanli; Wang, Gangcheng; Sun, Chunfang; Xue, Kang
2018-03-01
In this paper, we construct a new set of orthonormal topological basis states for six qubits with the topological single loop d = 2. By acting on the subspace, we get a new five-dimensional (5D) reduced matrix. In addition, it is shown that the Heisenberg XXX spin-1/2 chain of six qubits can be constructed from the Temperley-Lieb algebra (TLA) generator, both the energy ground state and the spin singlet states of the system can be described by the set of topological basis states.
NASA Astrophysics Data System (ADS)
Yang, Qi; Cao, Yue; Chen, Shiyin; Teng, Yue; Meng, Yanli; Wang, Gangcheng; Sun, Chunfang; Xue, Kang
2018-06-01
In this paper, we construct a new set of orthonormal topological basis states for six qubits with the topological single loop d = 2. By acting on the subspace, we get a new five-dimensional (5 D) reduced matrix. In addition, it is shown that the Heisenberg XXX spin-1/2 chain of six qubits can be constructed from the Temperley-Lieb algebra (TLA) generator, both the energy ground state and the spin singlet states of the system can be described by the set of topological basis states.
Electronic states of the Cu 3O 1217- model cluster
NASA Astrophysics Data System (ADS)
Chen, Xue-an; Chen, Zhi-fang; Heng, Fu; Tang, Youqi; Ye, Xue-qi; Zhu, Min-hui
1991-03-01
The Fenske-Hall molecular orbital calculations were performed on the model cluster Cu 3O 1217-. The calculated results revealed that the major contribution to the electronic states near the Fermi level comes from the orbitals of Cu 3d and O 2p, with dominantly oxygen p character, and the oxidation beyond the Cu 2+ state does not lead to Cu 3+ but to O - state. There exists the strong covalent bonding between copper and neighboring oxygen ions, especially between the chain Cu(1) and bridge O(4) ions. The slight displacement of O(4) along the c-axis toward Cu(2) can result in a decrease in the HOMO-LUMO gap and a strengthening of the chain-plane coupling.
NASA Astrophysics Data System (ADS)
Nguyen, Hong T.; Smith, Tyler B.; Hoy, Robert S.; Karayiannis, Nikos Ch.
2015-10-01
We map out the solid-state morphologies formed by model soft-pearl-necklace polymers as a function of chain stiffness, spanning the range from fully flexible to rodlike chains. The ratio of Kuhn length to bead diameter (lK/r0) increases monotonically with increasing bending stiffness kb and yields a one-parameter model that relates chain shape to bulk morphology. In the flexible limit, monomers occupy the sites of close-packed crystallites while chains retain random-walk-like order. In the rodlike limit, nematic chain ordering typical of lamellar precursors coexists with close-packing. At intermediate values of bending stiffness, the competition between random-walk-like and nematic chain ordering produces glass-formation; the range of kb over which this occurs increases with the thermal cooling rate | T ˙ | implemented in our molecular dynamics simulations. Finally, values of kb between the glass-forming and rodlike ranges produce complex ordered phases such as close-packed spirals. Our results should provide a useful initial step in a coarse-grained modeling approach to systematically determining the effect of chain stiffness on the crystallization-vs-glass-formation competition in both synthetic and colloidal polymers.
Diverging conductance at the contact between random and pure quantum XX spin chains
NASA Astrophysics Data System (ADS)
Chatelain, Christophe
2017-11-01
A model consisting of two quantum XX spin chains, one homogeneous and the second with random couplings drawn from a binary distribution, is considered. The two chains are coupled to two different non-local thermal baths and their dynamics is governed by a Lindblad equation. In the steady state, a current J is induced between the two chains by coupling them together by their edges and imposing different chemical potentials μ to the two baths. While a regime of linear characteristics J versus Δμ is observed in the absence of randomness, a gap opens as the disorder strength is increased. In the infinite-randomness limit, this behavior is related to the density of states of the localized states contributing to the current. The conductance is shown to diverge in this limit.
Irreversible Markov chains in spin models: Topological excitations
NASA Astrophysics Data System (ADS)
Lei, Ze; Krauth, Werner
2018-01-01
We analyze the convergence of the irreversible event-chain Monte Carlo algorithm for continuous spin models in the presence of topological excitations. In the two-dimensional XY model, we show that the local nature of the Markov-chain dynamics leads to slow decay of vortex-antivortex correlations while spin waves decorrelate very quickly. Using a Fréchet description of the maximum vortex-antivortex distance, we quantify the contributions of topological excitations to the equilibrium correlations, and show that they vary from a dynamical critical exponent z∼ 2 at the critical temperature to z∼ 0 in the limit of zero temperature. We confirm the event-chain algorithm's fast relaxation (corresponding to z = 0) of spin waves in the harmonic approximation to the XY model. Mixing times (describing the approach towards equilibrium from the least favorable initial state) however remain much larger than equilibrium correlation times at low temperatures. We also describe the respective influence of topological monopole-antimonopole excitations and of spin waves on the event-chain dynamics in the three-dimensional Heisenberg model.
Chemical event chain model of coupled genetic oscillators.
Jörg, David J; Morelli, Luis G; Jülicher, Frank
2018-03-01
We introduce a stochastic model of coupled genetic oscillators in which chains of chemical events involved in gene regulation and expression are represented as sequences of Poisson processes. We characterize steady states by their frequency, their quality factor, and their synchrony by the oscillator cross correlation. The steady state is determined by coupling and exhibits stochastic transitions between different modes. The interplay of stochasticity and nonlinearity leads to isolated regions in parameter space in which the coupled system works best as a biological pacemaker. Key features of the stochastic oscillations can be captured by an effective model for phase oscillators that are coupled by signals with distributed delays.
Chemical event chain model of coupled genetic oscillators
NASA Astrophysics Data System (ADS)
Jörg, David J.; Morelli, Luis G.; Jülicher, Frank
2018-03-01
We introduce a stochastic model of coupled genetic oscillators in which chains of chemical events involved in gene regulation and expression are represented as sequences of Poisson processes. We characterize steady states by their frequency, their quality factor, and their synchrony by the oscillator cross correlation. The steady state is determined by coupling and exhibits stochastic transitions between different modes. The interplay of stochasticity and nonlinearity leads to isolated regions in parameter space in which the coupled system works best as a biological pacemaker. Key features of the stochastic oscillations can be captured by an effective model for phase oscillators that are coupled by signals with distributed delays.
SpaceNet: Modeling and Simulating Space Logistics
NASA Technical Reports Server (NTRS)
Lee, Gene; Jordan, Elizabeth; Shishko, Robert; de Weck, Olivier; Armar, Nii; Siddiqi, Afreen
2008-01-01
This paper summarizes the current state of the art in interplanetary supply chain modeling and discusses SpaceNet as one particular method and tool to address space logistics modeling and simulation challenges. Fundamental upgrades to the interplanetary supply chain framework such as process groups, nested elements, and cargo sharing, enabled SpaceNet to model an integrated set of missions as a campaign. The capabilities and uses of SpaceNet are demonstrated by a step-by-step modeling and simulation of a lunar campaign.
Describing a Strongly Correlated Model System with Density Functional Theory.
Kong, Jing; Proynov, Emil; Yu, Jianguo; Pachter, Ruth
2017-07-06
The linear chain of hydrogen atoms, a basic prototype for the transition from a metal to Mott insulator, is studied with a recent density functional theory model functional for nondynamic and strong correlation. The computed cohesive energy curve for the transition agrees well with accurate literature results. The variation of the electronic structure in this transition is characterized with a density functional descriptor that yields the atomic population of effectively localized electrons. These new methods are also applied to the study of the Peierls dimerization of the stretched even-spaced Mott insulator to a chain of H 2 molecules, a different insulator. The transitions among the two insulating states and the metallic state of the hydrogen chain system are depicted in a semiquantitative phase diagram. Overall, we demonstrate the capability of studying strongly correlated materials with a mean-field model at the fundamental level, in contrast to the general pessimistic view on such a feasibility.
Single-copy entanglement in critical quantum spin chains
NASA Astrophysics Data System (ADS)
Eisert, J.; Cramer, M.
2005-10-01
We consider the single-copy entanglement as a quantity to assess quantum correlations in the ground state in quantum many-body systems. We show for a large class of models that already on the level of single specimens of spin chains, criticality is accompanied with the possibility of distilling a maximally entangled state of arbitrary dimension from a sufficiently large block deterministically, with local operations and classical communication. These analytical results—which refine previous results on the divergence of block entropy as the rate at which maximally entangled pairs can be distilled from many identically prepared chains—are made quantitative for general isotropic translationally invariant spin chains that can be mapped onto a quasifree fermionic system, and for the anisotropic XY model. For the XX model, we provide the asymptotic scaling of ˜(1/6)log2(L) , and contrast it with the block entropy.
Markov chain Monte Carlo estimation of quantum states
NASA Astrophysics Data System (ADS)
Diguglielmo, James; Messenger, Chris; Fiurášek, Jaromír; Hage, Boris; Samblowski, Aiko; Schmidt, Tabea; Schnabel, Roman
2009-03-01
We apply a Bayesian data analysis scheme known as the Markov chain Monte Carlo to the tomographic reconstruction of quantum states. This method yields a vector, known as the Markov chain, which contains the full statistical information concerning all reconstruction parameters including their statistical correlations with no a priori assumptions as to the form of the distribution from which it has been obtained. From this vector we can derive, e.g., the marginal distributions and uncertainties of all model parameters, and also of other quantities such as the purity of the reconstructed state. We demonstrate the utility of this scheme by reconstructing the Wigner function of phase-diffused squeezed states. These states possess non-Gaussian statistics and therefore represent a nontrivial case of tomographic reconstruction. We compare our results to those obtained through pure maximum-likelihood and Fisher information approaches.
Ordered states in the Kitaev-Heisenberg model: From 1D chains to 2D honeycomb.
Agrapidis, Cliò Efthimia; van den Brink, Jeroen; Nishimoto, Satoshi
2018-01-29
We study the ground state of the 1D Kitaev-Heisenberg (KH) model using the density-matrix renormalization group and Lanczos exact diagonalization methods. We obtain a rich ground-state phase diagram as a function of the ratio between Heisenberg (J = cosϕ) and Kitaev (K = sinϕ) interactions. Depending on the ratio, the system exhibits four long-range ordered states: ferromagnetic-z, ferromagnetic-xy, staggered-xy, Néel-z, and two liquid states: Tomonaga-Luttinger liquid and spiral-xy. The two Kitaev points [Formula: see text] and [Formula: see text] are singular. The ϕ-dependent phase diagram is similar to that for the 2D honeycomb-lattice KH model. Remarkably, all the ordered states of the honeycomb-lattice KH model can be interpreted in terms of the coupled KH chains. We also discuss the magnetic structure of the K-intercalated RuCl 3 , a potential Kitaev material, in the framework of the 1D KH model. Furthermore, we demonstrate that the low-lying excitations of the 1D KH Hamiltonian can be explained within the combination of the known six-vertex model and spin-wave theory.
Hybrid modeling and empirical analysis of automobile supply chain network
NASA Astrophysics Data System (ADS)
Sun, Jun-yan; Tang, Jian-ming; Fu, Wei-ping; Wu, Bing-ying
2017-05-01
Based on the connection mechanism of nodes which automatically select upstream and downstream agents, a simulation model for dynamic evolutionary process of consumer-driven automobile supply chain is established by integrating ABM and discrete modeling in the GIS-based map. Firstly, the rationality is proved by analyzing the consistency of sales and changes in various agent parameters between the simulation model and a real automobile supply chain. Second, through complex network theory, hierarchical structures of the model and relationships of networks at different levels are analyzed to calculate various characteristic parameters such as mean distance, mean clustering coefficients, and degree distributions. By doing so, it verifies that the model is a typical scale-free network and small-world network. Finally, the motion law of this model is analyzed from the perspective of complex self-adaptive systems. The chaotic state of the simulation system is verified, which suggests that this system has typical nonlinear characteristics. This model not only macroscopically illustrates the dynamic evolution of complex networks of automobile supply chain but also microcosmically reflects the business process of each agent. Moreover, the model construction and simulation of the system by means of combining CAS theory and complex networks supplies a novel method for supply chain analysis, as well as theory bases and experience for supply chain analysis of auto companies.
Using spiral chain models for study of nanoscroll structures
NASA Astrophysics Data System (ADS)
Savin, Alexander V.; Sakovich, Ruslan A.; Mazo, Mikhail A.
2018-04-01
Molecular nanoribbons with different chemical structures can form scrolled packings possessing outstanding properties and application perspectives due to their morphology. Here, we propose a simplified two-dimensional model of the molecular chain that allows us to describe the molecular nanoribbon's scrolled packings of various structures as a spiral packaging chain. The model allows us to obtain the possible stationary states of single-layer nanoribbon scrolls of graphene, graphane, fluorographene, fluorographane (graphene hydrogenated on one side and fluorinated on the other side), graphone C4H (graphene partially hydrogenated on one side), and fluorographone C4F . The obtained states and the states of the scrolls found through all-atomic models coincide with good accuracy. We show the stability of scrolled packings and calculate the dependence of energy, the number of coils, and the inner and outer radius of the scrolled packing on the nanoribbon length. It is shown that a scrolled packing is the most energetically favorable conformation for nanoribbons of graphene, graphane, fluorographene, and fluorographane at large lengths. A double-scrolled packing when the nanoribbon is symmetrically rolled into a scroll from opposite ends is more advantageous for longer length nanoribbons of graphone and fluorographone. We show the possibility of the existence of scrolled packings for nanoribbons of fluorographene and the existence of two different types of scrolls for nanoribbons of fluorographane, which correspond to the left and right Archimedean spirals of the chain model. The simplicity of the proposed model allows us to consider the dynamics of molecular nanoribbon scrolls of sufficiently large lengths and at sufficiently large time intervals.
Low temperature scanning tunneling microscopy of metallic and organic nanostructures
NASA Astrophysics Data System (ADS)
Fölsch, Stefan
2006-03-01
Low temperature scanning tunneling microscopy (LT-STM) is capable of both characterizing and manipulating atomic-scale structures at surfaces. It thus provides a powerful experimental tool to gain fundamental insight into how electronic properties evolve when controlling size, geometry, and composition of nanometric model systems at the level of single atoms and molecules. The experiments discussed in this talk employ a Cu(111) surface onto which perfect nanostructures are assembled from native adatoms and organic molecules. Using single Cu adatoms as building blocks, we obtain zero-, one-, and two-dimensional quantum objects (corresponding to the discrete adatom, monatomic adatom chains, and compact adatom assemblies) with intriguing electronic properties. Depending on the structure shape and the number of incorporated atoms we observe the formation of characteristic quantum levels which merge into the sp-derived Shockley surface state in the limit of extended 2D islands; this state exists on many surfaces, such as Cu(111). Our results reveal the natural linkage between this traditional surface property, the quantum confinement in compact adatom structures, and the quasi-atomic state associated with the single adatom. In a second step, we study the interaction of pentacene (C22H14) with Cu adatom chains serving as model quantum wires. We find that STM-based manipulation is capable of connecting single molecules to the chain ends in a defined way, and that the molecule-chain interaction shifts the chain-localized quantum states to higher binding energies. The present system provides an instructive model case to study single organic molecules interacting with metallic nanostructures. The microscopic nature of such composite structures is of importance for any future molecular-based device realization since it determines the contact conductance between the molecular unit and its metal ''contact pad''.
Analysis and design of a second-order digital phase-locked loop
NASA Technical Reports Server (NTRS)
Blasche, P. R.
1979-01-01
A specific second-order digital phase-locked loop (DPLL) was modeled as a first-order Markov chain with alternatives. From the matrix of transition probabilities of the Markov chain, the steady-state phase error of the DPLL was determined. In a similar manner the loop's response was calculated for a fading input. Additionally, a hardware DPLL was constructed and tested to provide a comparison to the results obtained from the Markov chain model. In all cases tested, good agreement was found between the theoretical predictions and the experimental data.
Negativity as the entanglement measure to probe the Kondo regime in the spin-chain Kondo model
NASA Astrophysics Data System (ADS)
Bayat, Abolfazl; Sodano, Pasquale; Bose, Sougato
2010-02-01
We study the entanglement of an impurity at one end of a spin chain with a block of spins using negativity as a true measure of entanglement to characterize the unique features of the gapless Kondo regime in the spin-chain Kondo model. For this spin chain in the Kondo regime we determine—with a true entanglement measure—the spatial extent of the Kondo screening cloud, we propose an ansatz for its ground state and demonstrate that the impurity spin is indeed maximally entangled with the cloud. To better evidence the peculiarities of the Kondo regime, we carry a parallel analysis of the entanglement properties of the Kondo spin-chain model in the gapped dimerized regime. Our study shows how a genuine entanglement measure stemming from quantum information theory can fully characterize also nonperturbative regimes accessible to certain condensed matter systems.
Jacobsen, J L; Saleur, H
2008-02-29
We determine exactly the probability distribution of the number N_(c) of valence bonds connecting a subsystem of length L>1 to the rest of the system in the ground state of the XXX antiferromagnetic spin chain. This provides, in particular, the asymptotic behavior of the valence-bond entanglement entropy S_(VB)=N_(c)ln2=4ln2/pi(2)lnL disproving a recent conjecture that this should be related with the von Neumann entropy, and thus equal to 1/3lnL. Our results generalize to the Q-state Potts model.
Valence-bond theory of linear Hubbard and Pariser-Parr-Pople models
NASA Astrophysics Data System (ADS)
Soos, Z. G.; Ramasesha, S.
1984-05-01
The ground and low-lying states of finite quantum-cell models with one state per site are obtained exactly through a real-space basis of valence-bond (VB) diagrams that explicitly conserve the total spin. Regular and alternating Hubbard and Pariser-Parr-Pople (PPP) chains and rings with Ne electrons on N(<=12) sites are extrapolated to infinite arrays. The ground-state energy and optical gap of regular U=4|t| Hubbard chains agree with exact results, suggesting comparable accuracy for alternating Hubbard and PPP models, but differ from mean-field results. Molecular PPP parameters describe well the excitations of finite polyenes, odd polyene ions, linear cyanine dyes, and slightly overestimate the absorption peaks in polyacetylene (CH)x. Molecular correlations contrast sharply with uncorrelated descriptions of topological solitons, which are modeled by regular polyene radicals and their ions for both wide and narrow alternation crossovers. Neutral solitons have no midgap absorption and negative spin densities, while the intensity of the in-gap excitation of charged solitons is not enhanced. The properties of correlated states in quantum-cell models with one valence state per site are discussed in the adiabatic limit for excited-state geometries and instabilities to dimerization.
NASA Astrophysics Data System (ADS)
Bhattacharya, Utso; Dutta, Amit
2018-06-01
We study the one-dimensional Kitaev chain with long-range superconductive pairing terms at a finite temperature where the system is prepared in a mixed state in equilibrium with a heat reservoir maintained at a constant temperature T . In order to probe the footprint of the ground-state topological behavior of the model at finite temperature, we look at two global quantities extracted out of two geometrical constructions: the Uhlmann and the interferometric phase. Interestingly, when the long-range effect dominates, the Uhlmann phase approach fails to reproduce the topological aspects of the model in the pure-state limit; on the other hand, the interferometric phase which has a proper pure state reduction, shows a behavior independent of the ambient temperature.
NASA Astrophysics Data System (ADS)
Sclauzero, Gabriele; Dal Corso, Andrea; Smogunov, Alexander
2012-04-01
We study the energetics, the electronic structure, and the ballistic transport of an infinite Au monatomic chain with an adsorbed CO molecule. We find that the bridge adsorption site is energetically favored with respect to the atop site, both at the equilibrium Au-Au spacing of the chain and at larger spacings. Instead, a substitutional configuration requires a very elongated Au-Au bond, well above the rupture distance of the pristine Au chain. The electronic structure properties can be described by the Blyholder model, which involves the formation of bonding/antibonding pairs of 5σ and 2π states through the hybridization between molecular levels of CO and metallic states of the chain. In the atop geometry, we find an almost vanishing conductance due to the 5σ antibonding states giving rise to a Fano-like destructive interference close to the Fermi energy. In the bridge geometry, instead, the same states are shifted to higher energies and the conductance reduction with respect to pristine Au chain is much smaller. We also examine the effects of strain on the ballistic transport, finding opposite behaviors for the atop and bridge conductances. Only the bridge geometry shows a strain dependence compatible with the experimental conductance traces.
Rigorous decoupling between edge states in frustrated spin chains and ladders
NASA Astrophysics Data System (ADS)
Chepiga, Natalia; Mila, Frédéric
2018-05-01
We investigate the occurrence of exact zero modes in one-dimensional quantum magnets of finite length that possess edge states. Building on conclusions first reached in the context of the spin-1/2 X Y chain in a field and then for the spin-1 J1-J2 Heisenberg model, we show that the development of incommensurate correlations in the bulk invariably leads to oscillations in the sign of the coupling between edge states, and hence to exact zero energy modes at the crossing points where the coupling between the edge states rigorously vanishes. This is true regardless of the origin of the frustration (e.g., next-nearest-neighbor coupling or biquadratic coupling for the spin-1 chain), of the value of the bulk spin (we report on spin-1/2, spin-1, and spin-2 examples), and of the value of the edge-state emergent spin (spin-1/2 or spin-1).
NASA Astrophysics Data System (ADS)
Wang, Ji-Guo; Yang, Shi-Jie
2017-05-01
We study a model to realize the long-distance correlated tunneling of ultracold bosons in a one-dimensional optical lattice chain. The model reveals the behavior of a quantum Newton's cradle, which is the perfect transfer between two macroscopic quantum states. Due to the Bose enhancement effect, we find that the resonantly tunneling through a Mott domain is greatly enhanced.
Theory of high-force DNA stretching and overstretching.
Storm, C; Nelson, P C
2003-05-01
Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.
LECTURES ON GAME THEORY, MARKOV CHAINS, AND RELATED TOPICS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thompson, G L
1958-03-01
Notes on nine lectures delivered at Sandin Corporation in August 1957 are given. Part one contains the manuscript of a paper concerning a judging problem. Part two is concerned with finite Markov-chain theory amd discusses regular Markov chains, absorbing Markov chains, the classification of states, application to the Leontief input-output model, and semimartingales. Part three contains notes on game theory and covers matrix games, the effect of psychological attitudes on the outcomes of games, extensive games, amd matrix theory applied to mathematical economics. (auth)
Residue-Specific Side-Chain Polymorphisms via Particle Belief Propagation.
Ghoraie, Laleh Soltan; Burkowski, Forbes; Li, Shuai Cheng; Zhu, Mu
2014-01-01
Protein side chains populate diverse conformational ensembles in crystals. Despite much evidence that there is widespread conformational polymorphism in protein side chains, most of the X-ray crystallography data are modeled by single conformations in the Protein Data Bank. The ability to extract or to predict these conformational polymorphisms is of crucial importance, as it facilitates deeper understanding of protein dynamics and functionality. In this paper, we describe a computational strategy capable of predicting side-chain polymorphisms. Our approach extends a particular class of algorithms for side-chain prediction by modeling the side-chain dihedral angles more appropriately as continuous rather than discrete variables. Employing a new inferential technique known as particle belief propagation, we predict residue-specific distributions that encode information about side-chain polymorphisms. Our predicted polymorphisms are in relatively close agreement with results from a state-of-the-art approach based on X-ray crystallography data, which characterizes the conformational polymorphisms of side chains using electron density information, and has successfully discovered previously unmodeled conformations.
NASA Astrophysics Data System (ADS)
O'Connor, Thomas; Robbins, Mark
Glassy polymers are a ubiquitous part of modern life, but much about their mechanical properties remains poorly understood. Since chains in glassy states are hindered from exploring their conformational entropy, they can't be understood with common entropic network models. Additionally, glassy states are highly sensitive to material history and nonequilibrium distributions of chain alignment and entanglement can be produced during material processing. Understanding how these far-from equilibrium states impact mechanical properties is analytically challenging but essential to optimizing processing methods. We use molecular dynamics simulations to study the yield and strain hardening of glassy polymers as separate functions of the degree of molecular alignment and inter-chain entanglement. We vary chain alignment and entanglement with three different preparation protocols that mimic common processing conditions in and out of solution. We compare our results to common mechanical models of amorphous polymers and assess their applicability to different experimental processing conditions. This research was performed within the Center for Materials in Extreme Dynamic Environments (CMEDE) under the Hopkins Extreme Materials Institute at Johns Hopkins University. Financial support was provided by Grant W911NF-12-2-0022.
Liu, Jian; McLuckey, Scott A.
2012-01-01
The effect of cation charge state on product partitioning in the gas-phase ion/ion electron transfer reactions of multiply protonated tryptic peptides, model peptides, and relatively large peptides with singly charged radical anions has been examined. In particular, partitioning into various competing channels, such as proton transfer (PT) versus electron transfer (ET), electron transfer with subsequent dissociation (ETD) versus electron transfer with no dissociation (ET,noD), and fragmentation of backbone bonds versus fragmentation of side chains, was measured quantitatively as a function of peptide charge state to allow insights to be drawn about the fundamental aspects of ion/ion reactions that lead to ETD. The ET channel increases relative to the PT channel, ETD increases relative to ET,noD, and fragmentation at backbone bonds increases relative to side-chain cleavages as cation charge state increases. The increase in ET versus PT with charge state is consistent with a Landau-Zener based curve-crossing model. An optimum charge state for ET is predicted by the model for the ground state-to-ground state reaction. However, when the population of excited product ion states is considered, it is possible that a decrease in ET efficiency as charge state increases will not be observed due to the possibility of the population of excited electronic states of the products. Several factors can contribute to the increase in ETD versus ET,noD and backbone cleavage versus side-chain losses. These factors include an increase in reaction exothermicity and charge state dependent differences in precursor and product ion structures, stabilities, and sites of protonation. PMID:23264749
An analytical approach to top predator interference on the dynamics of a food chain model
NASA Astrophysics Data System (ADS)
Senthamarai, R.; Vijayalakshmi, T.
2018-04-01
In this paper, a nonlinear mathematical model is proposed and analyzed to study of top predator interference on the dynamics of a food chain model. The mathematical model is formulated using the system of non-linear ordinary differential equations. In this model, there are three state dimensionless variables, viz, size of prey population x, size of intermediate predator y and size of top predator population z. The analytical results are compared with the numerical simulation using MATLAB software and satisfactory results are noticed.
Document Ranking Based upon Markov Chains.
ERIC Educational Resources Information Center
Danilowicz, Czeslaw; Balinski, Jaroslaw
2001-01-01
Considers how the order of documents in information retrieval responses are determined and introduces a method that uses a probabilistic model of a document set where documents are regarded as states of a Markov chain and where transition probabilities are directly proportional to similarities between documents. (Author/LRW)
Simulating reservoir lithologies by an actively conditioned Markov chain model
NASA Astrophysics Data System (ADS)
Feng, Runhai; Luthi, Stefan M.; Gisolf, Dries
2018-06-01
The coupled Markov chain model can be used to simulate reservoir lithologies between wells, by conditioning them on the observed data in the cored wells. However, with this method, only the state at the same depth as the current cell is going to be used for conditioning, which may be a problem if the geological layers are dipping. This will cause the simulated lithological layers to be broken or to become discontinuous across the reservoir. In order to address this problem, an actively conditioned process is proposed here, in which a tolerance angle is predefined. The states contained in the region constrained by the tolerance angle will be employed for conditioning in the horizontal chain first, after which a coupling concept with the vertical chain is implemented. In order to use the same horizontal transition matrix for different future states, the tolerance angle has to be small. This allows the method to work in reservoirs without complex structures caused by depositional processes or tectonic deformations. Directional artefacts in the modeling process are avoided through a careful choice of the simulation path. The tolerance angle and dipping direction of the strata can be obtained from a correlation between wells, or from seismic data, which are available in most hydrocarbon reservoirs, either by interpretation or by inversion that can also assist the construction of a horizontal probability matrix.
How old is this bird? The age distribution under some phase sampling schemes.
Hautphenne, Sophie; Massaro, Melanie; Taylor, Peter
2017-12-01
In this paper, we use a finite-state continuous-time Markov chain with one absorbing state to model an individual's lifetime. Under this model, the time of death follows a phase-type distribution, and the transient states of the Markov chain are known as phases. We then attempt to provide an answer to the simple question "What is the conditional age distribution of the individual, given its current phase"? We show that the answer depends on how we interpret the question, and in particular, on the phase observation scheme under consideration. We then apply our results to the computation of the age pyramid for the endangered Chatham Island black robin Petroica traversi during the monitoring period 2007-2014.
NASA Astrophysics Data System (ADS)
Hauke, Philipp; Cucchietti, Fernando M.; Müller-Hermes, Alexander; Bañuls, Mari-Carmen; Cirac, J. Ignacio; Lewenstein, Maciej
2010-11-01
Systems with long-range interactions show a variety of intriguing properties: they typically accommodate many metastable states, they can give rise to spontaneous formation of supersolids, and they can lead to counterintuitive thermodynamic behavior. However, the increased complexity that comes with long-range interactions strongly hinders theoretical studies. This makes a quantum simulator for long-range models highly desirable. Here, we show that a chain of trapped ions can be used to quantum simulate a one-dimensional (1D) model of hard-core bosons with dipolar off-site interaction and tunneling, equivalent to a dipolar XXZ spin-1/2 chain. We explore the rich phase diagram of this model in detail, employing perturbative mean-field theory, exact diagonalization and quasi-exact numerical techniques (density-matrix renormalization group and infinite time-evolving block decimation). We find that the complete devil's staircase—an infinite sequence of crystal states existing at vanishing tunneling—spreads to a succession of lobes similar to the Mott lobes found in Bose-Hubbard models. Investigating the melting of these crystal states at increased tunneling, we do not find (contrary to similar 2D models) clear indications of supersolid behavior in the region around the melting transition. However, we find that inside the insulating lobes there are quasi-long-range (algebraic) correlations, as opposed to models with nearest-neighbor tunneling, that show exponential decay of correlations.
PolyUbiquitin Chain Linkage Topology Selects the Functions from the Underlying Binding Landscape
Wang, Yong; Tang, Chun; Wang, Erkang; Wang, Jin
2014-01-01
Ubiquitin (Ub) can generate versatile molecular signals and lead to different celluar fates. The functional poly-valence of Ub is believed to be resulted from its ability to form distinct polymerized chains with eight linkage types. To provide a full picture of ubiquitin code, we explore the binding landscape of two free Ub monomers and also the functional landscapes of of all eight linkage types by theoretical modeling. Remarkably, we found that most of the compact structures of covalently connected dimeric Ub chains (diUbs) pre-exist on the binding landscape. These compact functional states were subsequently validated by corresponding linkage models. This leads to the proposal that the folding architecture of Ub monomer has encoded all functional states into its binding landscape, which is further selected by different topologies of polymeric Ub chains. Moreover, our results revealed that covalent linkage leads to symmetry breaking of interfacial interactions. We further propose that topological constraint not only limits the conformational space for effective switching between functional states, but also selects the local interactions for realizing the corresponding biological function. Therefore, the topological constraint provides a way for breaking the binding symmetry and reaching the functional specificity. The simulation results also provide several predictions that qualitatively and quantitatively consistent with experiments. Importantly, the K48 linkage model successfully predicted intermediate states. The resulting multi-state energy landscape was further employed to reconcile the seemingly contradictory experimental data on the conformational equilibrium of K48-diUb. Our results further suggest that hydrophobic interactions are dominant in the functional landscapes of K6-, K11-, K33- and K48 diUbs, while electrostatic interactions play a more important role in the functional landscapes of K27, K29, K63 and linear linkages. PMID:24992446
PolyUbiquitin chain linkage topology selects the functions from the underlying binding landscape.
Wang, Yong; Tang, Chun; Wang, Erkang; Wang, Jin
2014-07-01
Ubiquitin (Ub) can generate versatile molecular signals and lead to different celluar fates. The functional poly-valence of Ub is believed to be resulted from its ability to form distinct polymerized chains with eight linkage types. To provide a full picture of ubiquitin code, we explore the binding landscape of two free Ub monomers and also the functional landscapes of of all eight linkage types by theoretical modeling. Remarkably, we found that most of the compact structures of covalently connected dimeric Ub chains (diUbs) pre-exist on the binding landscape. These compact functional states were subsequently validated by corresponding linkage models. This leads to the proposal that the folding architecture of Ub monomer has encoded all functional states into its binding landscape, which is further selected by different topologies of polymeric Ub chains. Moreover, our results revealed that covalent linkage leads to symmetry breaking of interfacial interactions. We further propose that topological constraint not only limits the conformational space for effective switching between functional states, but also selects the local interactions for realizing the corresponding biological function. Therefore, the topological constraint provides a way for breaking the binding symmetry and reaching the functional specificity. The simulation results also provide several predictions that qualitatively and quantitatively consistent with experiments. Importantly, the K48 linkage model successfully predicted intermediate states. The resulting multi-state energy landscape was further employed to reconcile the seemingly contradictory experimental data on the conformational equilibrium of K48-diUb. Our results further suggest that hydrophobic interactions are dominant in the functional landscapes of K6-, K11-, K33- and K48 diUbs, while electrostatic interactions play a more important role in the functional landscapes of K27, K29, K63 and linear linkages.
State-transfer simulation in integrated waveguide circuits
NASA Astrophysics Data System (ADS)
Latmiral, L.; Di Franco, C.; Mennea, P. L.; Kim, M. S.
2015-08-01
Spin-chain models have been widely studied in terms of quantum information processes, for instance for the faithful transmission of quantum states. Here, we investigate the limitations of mapping this process to an equivalent one through a bosonic chain. In particular, we keep in mind experimental implementations, which the progress in integrated waveguide circuits could make possible in the very near future. We consider the feasibility of exploiting the higher dimensionality of the Hilbert space of the chain elements for the transmission of a larger amount of information, and the effects of unwanted excitations during the process. Finally, we exploit the information-flux method to provide bounds to the transfer fidelity.
Shimizu, Kaoru; Tokura, Yasuhiro
2015-12-01
This paper presents a theoretical framework for analyzing the quantum fluctuation properties of a quantum spin chain subject to a quantum phase transition. We can quantify the fluctuation properties by examining the correlation between the fluctuations of two neighboring spins subject to the quantum uncertainty. To do this, we first compute the reduced density matrix ρ of the spin pair from the ground state |Ψ⟩ of a spin chain, and then identify the quantum correlation part ρ(q) embedded in ρ. If the spin chain is translationally symmetric and characterized by a nearest-neighbor two-body spin interaction, we can determine uniquely the form of ρ(q) as W|Φ〉〈Φ| with the weight W ≤1, and quantify the fluctuation properties using the two-spin entangled state |Φ〉. We demonstrate the framework for a transverse-field quantum Ising spin chain and indicate its validity for more general spin chain models.
Exactly solved mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy
NASA Astrophysics Data System (ADS)
Lisnyi, Bohdan; Strečka, Jozef
2015-03-01
The mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy is exactly solved through the generalized decoration-iteration transformation and the transfer-matrix method. The decoration-iteration transformation is first used for establishing a rigorous mapping equivalence with the corresponding spin-1 Blume-Emery-Griffiths chain, which is subsequently exactly treated within the transfer-matrix technique. Apart from three classical ground states the model exhibits three striking quantum ground states in which a singlet-dimer state of the interstitial Heisenberg spins is accompanied either with a frustrated state or a polarized state or a non-magnetic state of the nodal Ising spins. It is evidenced that two magnetization plateaus at zero and/or one-half of the saturation magnetization may appear in low-temperature magnetization curves. The specific heat may display remarkable temperature dependences with up to three and four distinct round maxima in a zero and non-zero magnetic field, respectively.
Non-local electron transport through normal and topological ladder-like atomic systems
NASA Astrophysics Data System (ADS)
Kurzyna, Marcin; Kwapiński, Tomasz
2018-05-01
We propose a locally protected ladder-like atomic system (nanoconductor) on a substrate that is insensitive to external perturbations. The system corresponds to coupled atomic chains fabricated on different surfaces. Electron transport properties of such conductors are studied theoretically using the model tight-binding Su-Schriffer-Hegger (SSH) Hamiltonian and Green's function formalism. We have found that the conductance of the system is almost insensitive to single adatoms and oscillates as a function of the side chain length with very large periods. Non-local character of the electron transport was observed also for topological SSH chains where nontrivial end states survive in the presence of disturbances as well as for different substrates. We have found that the careful inspection of the density of states or charge waves can provide the information about the atom energy levels and hopping amplitudes. Moreover, the ladder-like geometry allows one to distinguish between normal and topological zero-energy states. It is important that topological chains do not reveal Friedel oscillations which are observed in non-topological chains.
Quantum Model of Emerging Grammars
NASA Technical Reports Server (NTRS)
Zak, M.
1999-01-01
A special class of quantum recurrent nets simulating Markov chains with absorbing states is introduced. The absorbing states are exploited for pattern recognition: each class of patterns, each combination of patterns acquires its own meaning.
Critical excitation spectrum of a quantum chain with a local three-spin coupling.
McCabe, John F; Wydro, Tomasz
2011-09-01
Using the phenomenological renormalization group (PRG), we evaluate the low-energy excitation spectrum along the critical line of a quantum spin chain having a local interaction between three Ising spins and longitudinal and transverse magnetic fields, i.e., a Turban model. The low-energy excitation spectrum found with the PRG agrees with the spectrum predicted for the (D(4),A(4)) conformal minimal model under a nontrivial correspondence between translations at the critical line and discrete lattice translations. Under this correspondence, the measurements confirm a prediction that the critical line of this quantum spin chain and the critical point of the two-dimensional three-state Potts model are in the same universality class.
NASA Astrophysics Data System (ADS)
Widyawan, A.; Pasaribu, U. S.; Henintyas, Permana, D.
2015-12-01
Nowadays some firms, including insurer firms, think that customer-centric services are better than product-centric ones in terms of marketing. Insurance firms will try to attract as many new customer as possible while maintaining existing customer. This causes the Customer Lifetime Value (CLV) becomes a very important thing. CLV are able to put customer into different segments and calculate the present value of a firm's relationship with its customer. Insurance customer will depend on the last service he or she can get. So if the service is bad now, then customer will not renew his contract though the service is very good at an erlier time. Because of this situation one suitable mathematical model for modeling customer's relationships and calculating their lifetime value is Markov Chain. In addition, the advantages of using Markov Chain Modeling is its high degree of flexibility. In 2000, Pfeifer and Carraway states that Markov Chain Modeling can be used for customer retention situation. In this situation, Markov Chain Modeling requires only two states, which are present customer and former ones. This paper calculates customer lifetime value in an insurance firm with two distinctive interest rates; the constant interest rate and uniform distribution of interest rates. The result shows that loyal customer and the customer who increase their contract value have the highest CLV.
Li, Michael; Dushoff, Jonathan; Bolker, Benjamin M
2018-07-01
Simple mechanistic epidemic models are widely used for forecasting and parameter estimation of infectious diseases based on noisy case reporting data. Despite the widespread application of models to emerging infectious diseases, we know little about the comparative performance of standard computational-statistical frameworks in these contexts. Here we build a simple stochastic, discrete-time, discrete-state epidemic model with both process and observation error and use it to characterize the effectiveness of different flavours of Bayesian Markov chain Monte Carlo (MCMC) techniques. We use fits to simulated data, where parameters (and future behaviour) are known, to explore the limitations of different platforms and quantify parameter estimation accuracy, forecasting accuracy, and computational efficiency across combinations of modeling decisions (e.g. discrete vs. continuous latent states, levels of stochasticity) and computational platforms (JAGS, NIMBLE, Stan).
Metastates in Mean-Field Models with Random External Fields Generated by Markov Chains
NASA Astrophysics Data System (ADS)
Formentin, M.; Külske, C.; Reichenbachs, A.
2012-01-01
We extend the construction by Külske and Iacobelli of metastates in finite-state mean-field models in independent disorder to situations where the local disorder terms are a sample of an external ergodic Markov chain in equilibrium. We show that for non-degenerate Markov chains, the structure of the theorems is analogous to the case of i.i.d. variables when the limiting weights in the metastate are expressed with the aid of a CLT for the occupation time measure of the chain. As a new phenomenon we also show in a Potts example that for a degenerate non-reversible chain this CLT approximation is not enough, and that the metastate can have less symmetry than the symmetry of the interaction and a Gaussian approximation of disorder fluctuations would suggest.
Constructing 1/omegaalpha noise from reversible Markov chains.
Erland, Sveinung; Greenwood, Priscilla E
2007-09-01
This paper gives sufficient conditions for the output of 1/omegaalpha noise from reversible Markov chains on finite state spaces. We construct several examples exhibiting this behavior in a specified range of frequencies. We apply simple representations of the covariance function and the spectral density in terms of the eigendecomposition of the probability transition matrix. The results extend to hidden Markov chains. We generalize the results for aggregations of AR1-processes of C. W. J. Granger [J. Econometrics 14, 227 (1980)]. Given the eigenvalue function, there is a variety of ways to assign values to the states such that the 1/omegaalpha condition is satisfied. We show that a random walk on a certain state space is complementary to the point process model of 1/omega noise of B. Kaulakys and T. Meskauskas [Phys. Rev. E 58, 7013 (1998)]. Passing to a continuous state space, we construct 1/omegaalpha noise which also has a long memory.
Intrachain exciton dynamics in conjugated polymer chains in solution.
Tozer, Oliver Robert; Barford, William
2015-08-28
We investigate exciton dynamics on a polymer chain in solution induced by the Brownian rotational motion of the monomers. Poly(para-phenylene) is chosen as the model system and excitons are modeled via the Frenkel exciton Hamiltonian. The Brownian fluctuations of the torsional modes were modeled via the Langevin equation. The rotation of monomers in polymer chains in solution has a number of important consequences for the excited state properties. First, the dihedral angles assume a thermal equilibrium which causes off-diagonal disorder in the Frenkel Hamiltonian. This disorder Anderson localizes the Frenkel exciton center-of-mass wavefunctions into super-localized local exciton ground states (LEGSs) and higher-energy more delocalized quasi-extended exciton states (QEESs). LEGSs correspond to chromophores on polymer chains. The second consequence of rotations-that are low-frequency-is that their coupling to the exciton wavefunction causes local planarization and the formation of an exciton-polaron. This torsional relaxation causes additional self-localization. Finally, and crucially, the torsional dynamics cause the Frenkel Hamiltonian to be time-dependent, leading to exciton dynamics. We identify two distinct types of dynamics. At low temperatures, the torsional fluctuations act as a perturbation on the polaronic nature of the exciton state. Thus, the exciton dynamics at low temperatures is a small-displacement diffusive adiabatic motion of the exciton-polaron as a whole. The temperature dependence of the diffusion constant has a linear dependence, indicating an activationless process. As the temperature increases, however, the diffusion constant increases at a faster than linear rate, indicating a second non-adiabatic dynamics mechanism begins to dominate. Excitons are thermally activated into higher energy more delocalized exciton states (i.e., LEGSs and QEESs). These states are not self-localized by local torsional planarization. During the exciton's temporary occupation of a LEGS-and particularly a quasi-band QEES-its motion is semi-ballistic with a large group velocity. After a short period of rapid transport, the exciton wavefunction collapses again into an exciton-polaron state. We present a simple model for the activated dynamics which is in agreement with the data.
NASA Astrophysics Data System (ADS)
Rojas, M.; de Souza, S. M.; Rojas, Onofre
2017-02-01
The quantum teleportation plays an important role in quantum information process, in this sense, the quantum entanglement properties involving an infinite chain structure is quite remarkable because real materials could be well represented by an infinite chain. We study the teleportation of an entangled state through a couple of quantum channels, composed by Heisenberg dimers in an infinite Ising-Heisenberg diamond chain, the couple of chains are considered sufficiently far away from each other to be ignored the any interaction between them. To teleporting a couple of qubits through the quantum channel, we need to find the average density operator for Heisenberg spin dimers, which will be used as quantum channels. Assuming the input state as a pure state, we can apply the concept of fidelity as a useful measurement of teleportation performance of a quantum channel. Using the standard teleportation protocol, we have derived an analytical expression for the output concurrence, fidelity, and average fidelity. We study in detail the effects of coupling parameters, external magnetic field and temperature dependence of quantum teleportation. Finally, we explore the relations between entanglement of the quantum channel, the output entanglement and the average fidelity of the system. Through a kind of phase diagram as a function of Ising-Heisenberg diamond chain model parameters, we illustrate where the quantum teleportation will succeed and a region where the quantum teleportation could fail.
Thermodynamics and mechanics of stretch-induced crystallization in rubbers
NASA Astrophysics Data System (ADS)
Guo, Qiang; Zaïri, Fahmi; Guo, Xinglin
2018-05-01
The aim of the present paper is to provide a quantitative prediction of the stretch-induced crystallization in natural rubber, the exclusive reason for its history-dependent thermomechanical features. A constitutive model based on a micromechanism inspired molecular chain approach is formulated within the context of the thermodynamic framework. The molecular configuration of the partially crystallized single chain is analyzed and calculated by means of some statistical mechanical methods. The random thermal oscillation of the crystal orientation, considered as a continuous random variable, is treated by means of a representative angle. The physical expression of the chain free energy is derived according to a two-step strategy by separating crystallization and stretching. This strategy ensures that the stretch-induced part of the thermodynamic crystallization force is null at the initial instant and allows, without any additional constraint, the formulation of a simple linear relationship for the crystallinity evolution law. The model contains very few physically interpretable material constants to simulate the complex mechanism: two chain-scale constants, one crystallinity kinetics constant, three thermodynamic constants related to the newly formed crystallites, and a function controlling the crystal orientation with respect to the chain. The model is used to discuss some important aspects of the micromechanism and the macroresponse under the equilibrium state and the nonequilibrium state involved during stretching and recovery, and continuous relaxation.
Sampling rare fluctuations of discrete-time Markov chains
NASA Astrophysics Data System (ADS)
Whitelam, Stephen
2018-03-01
We describe a simple method that can be used to sample the rare fluctuations of discrete-time Markov chains. We focus on the case of Markov chains with well-defined steady-state measures, and derive expressions for the large-deviation rate functions (and upper bounds on such functions) for dynamical quantities extensive in the length of the Markov chain. We illustrate the method using a series of simple examples, and use it to study the fluctuations of a lattice-based model of active matter that can undergo motility-induced phase separation.
Sampling rare fluctuations of discrete-time Markov chains.
Whitelam, Stephen
2018-03-01
We describe a simple method that can be used to sample the rare fluctuations of discrete-time Markov chains. We focus on the case of Markov chains with well-defined steady-state measures, and derive expressions for the large-deviation rate functions (and upper bounds on such functions) for dynamical quantities extensive in the length of the Markov chain. We illustrate the method using a series of simple examples, and use it to study the fluctuations of a lattice-based model of active matter that can undergo motility-induced phase separation.
The Effect of Dialysis Chains on Mortality among Patients Receiving Hemodialysis
Zhang, Yi; Cotter, Dennis J; Thamer, Mae
2011-01-01
Objective To examine the association between dialysis facility chain affiliation and patient mortality. Study Setting Medicare dialysis population. Study Design Data from the United States Renal Data System (USRDS) were used to identify 3,601 free-standing dialysis facilities and 34,914 Medicare patients' incidence to end-stage renal disease (ESRD) in 2004. Mixed-effect regression models were used to estimate patient mortality by dialysis facility chain and profit status during the 2-year follow-up. Data Collection USRDS data were matched with facility, cost, and census data. Principle Findings Of the five largest dialysis chains, the lowest mortality risk was observed among patients dialyzed at nonprofit (NP) Chain 5 facilities. Compared with Chain 5, hazard ratios were 19 percent higher (95 percent CI 1.06–1.34) and 24 percent higher (95 percent CI 1.10–1.40) for patients dialyzed at for-profit (FP) Chain 1 and Chain 2 facilities, respectively. In addition, patients at FP facilities had a 13 percent higher risk of mortality than those in NP facilities (95 percent CI 1.06–1.22). Conclusions Large chain affiliation is an independent risk factor for ESRD mortality in the United States. Given the movement toward further consolidation of large FP chains, reasons behind the increase in mortality require scrutiny. PMID:21143480
Free-fermion descriptions of parafermion chains and string-net models
NASA Astrophysics Data System (ADS)
Meichanetzidis, Konstantinos; Turner, Christopher J.; Farjami, Ashk; Papić, Zlatko; Pachos, Jiannis K.
2018-03-01
Topological phases of matter remain a focus of interest due to their unique properties: fractionalization, ground-state degeneracy, and exotic excitations. While some of these properties can occur in systems of free fermions, their emergence is generally associated with interactions between particles. Here, we quantify the role of interactions in general classes of topological states of matter in one and two spatial dimensions, including parafermion chains and string-net models. Surprisingly, we find that certain topological states can be exactly described by free fermions, while others saturate the maximum possible distance from their optimal free-fermion description [C. J. Turner et al., Nat. Commun. 8, 14926 (2017), 10.1038/ncomms14926]. Our work opens the door to understanding the complexity of topological models by establishing new types of fermionization procedures to describe their low-energy physics, thus making them amenable to experimental realizations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castillo-Villar, Krystel K.; Eksioglu, Sandra; Taherkhorsandi, Milad
The production of biofuels using second-generation feedstocks has been recognized as an important alternative source of sustainable energy and its demand is expected to increase due to regulations such as the Renewable Fuel Standard. However, the pathway to biofuel industry maturity faces unique, unaddressed challenges. Here, to address this challenges, this article presents an optimization model which quantifies and controls the impact of biomass quality variability on supply chain related decisions and technology selection. We propose a two-stage stochastic programming model and associated efficient solution procedures for solving large-scale problems to (1) better represent the random nature of the biomassmore » quality (defined by moisture and ash contents) in supply chain modeling, and (2) assess the impact of these uncertainties on the supply chain design and planning. The proposed model is then applied to a case study in the state of Tennessee. Results show that high moisture and ash contents negatively impact the unit delivery cost since poor biomass quality requires the addition of quality control activities. Experimental results indicate that supply chain cost could increase as much as 27%–31% when biomass quality is poor. We assess the impact of the biomass quality on the topological supply chain. Our case study indicates that biomass quality impacts supply chain costs; thus, it is important to consider the impact of biomass quality in supply chain design and management decisions.« less
Castillo-Villar, Krystel K.; Eksioglu, Sandra; Taherkhorsandi, Milad
2017-02-20
The production of biofuels using second-generation feedstocks has been recognized as an important alternative source of sustainable energy and its demand is expected to increase due to regulations such as the Renewable Fuel Standard. However, the pathway to biofuel industry maturity faces unique, unaddressed challenges. Here, to address this challenges, this article presents an optimization model which quantifies and controls the impact of biomass quality variability on supply chain related decisions and technology selection. We propose a two-stage stochastic programming model and associated efficient solution procedures for solving large-scale problems to (1) better represent the random nature of the biomassmore » quality (defined by moisture and ash contents) in supply chain modeling, and (2) assess the impact of these uncertainties on the supply chain design and planning. The proposed model is then applied to a case study in the state of Tennessee. Results show that high moisture and ash contents negatively impact the unit delivery cost since poor biomass quality requires the addition of quality control activities. Experimental results indicate that supply chain cost could increase as much as 27%–31% when biomass quality is poor. We assess the impact of the biomass quality on the topological supply chain. Our case study indicates that biomass quality impacts supply chain costs; thus, it is important to consider the impact of biomass quality in supply chain design and management decisions.« less
Anomalous bulk behavior in the free parafermion Z (N ) spin chain
NASA Astrophysics Data System (ADS)
Alcaraz, Francisco C.; Batchelor, Murray T.
2018-06-01
We demonstrate using direct numerical diagonalization and extrapolation methods that boundary conditions have a profound effect on the bulk properties of a simple Z (N ) model for N ≥3 for which the model Hamiltonian is non-Hermitian. For N =2 the model reduces to the well-known quantum Ising model in a transverse field. For open boundary conditions, the Z (N ) model is known to be solved exactly in terms of free parafermions. Once the ends of the open chain are connected by considering the model on a ring, the bulk properties, including the ground-state energy per site, are seen to differ dramatically with increasing N . Other properties, such as the leading finite-size corrections to the ground-state energy, the mass gap exponent, and the specific-heat exponent, are also seen to be dependent on the boundary conditions. We speculate that this anomalous bulk behavior is a topological effect.
Improved packing of protein side chains with parallel ant colonies.
Quan, Lijun; Lü, Qiang; Li, Haiou; Xia, Xiaoyan; Wu, Hongjie
2014-01-01
The accurate packing of protein side chains is important for many computational biology problems, such as ab initio protein structure prediction, homology modelling, and protein design and ligand docking applications. Many of existing solutions are modelled as a computational optimisation problem. As well as the design of search algorithms, most solutions suffer from an inaccurate energy function for judging whether a prediction is good or bad. Even if the search has found the lowest energy, there is no certainty of obtaining the protein structures with correct side chains. We present a side-chain modelling method, pacoPacker, which uses a parallel ant colony optimisation strategy based on sharing a single pheromone matrix. This parallel approach combines different sources of energy functions and generates protein side-chain conformations with the lowest energies jointly determined by the various energy functions. We further optimised the selected rotamers to construct subrotamer by rotamer minimisation, which reasonably improved the discreteness of the rotamer library. We focused on improving the accuracy of side-chain conformation prediction. For a testing set of 442 proteins, 87.19% of X1 and 77.11% of X12 angles were predicted correctly within 40° of the X-ray positions. We compared the accuracy of pacoPacker with state-of-the-art methods, such as CIS-RR and SCWRL4. We analysed the results from different perspectives, in terms of protein chain and individual residues. In this comprehensive benchmark testing, 51.5% of proteins within a length of 400 amino acids predicted by pacoPacker were superior to the results of CIS-RR and SCWRL4 simultaneously. Finally, we also showed the advantage of using the subrotamers strategy. All results confirmed that our parallel approach is competitive to state-of-the-art solutions for packing side chains. This parallel approach combines various sources of searching intelligence and energy functions to pack protein side chains. It provides a frame-work for combining different inaccuracy/usefulness objective functions by designing parallel heuristic search algorithms.
Radford, Isolde H; Fersht, Alan R; Settanni, Giovanni
2011-06-09
Atomistic molecular dynamics simulations of the TZ1 beta-hairpin peptide have been carried out using an implicit model for the solvent. The trajectories have been analyzed using a Markov state model defined on the projections along two significant observables and a kinetic network approach. The Markov state model allowed for an unbiased identification of the metastable states of the system, and provided the basis for commitment probability calculations performed on the kinetic network. The kinetic network analysis served to extract the main transition state for folding of the peptide and to validate the results from the Markov state analysis. The combination of the two techniques allowed for a consistent and concise characterization of the dynamics of the peptide. The slowest relaxation process identified is the exchange between variably folded and denatured species, and the second slowest process is the exchange between two different subsets of the denatured state which could not be otherwise identified by simple inspection of the projected trajectory. The third slowest process is the exchange between a fully native and a partially folded intermediate state characterized by a native turn with a proximal backbone H-bond, and frayed side-chain packing and termini. The transition state for the main folding reaction is similar to the intermediate state, although a more native like side-chain packing is observed.
Singer, Philipp; Helic, Denis; Taraghi, Behnam; Strohmaier, Markus
2014-01-01
One of the most frequently used models for understanding human navigation on the Web is the Markov chain model, where Web pages are represented as states and hyperlinks as probabilities of navigating from one page to another. Predominantly, human navigation on the Web has been thought to satisfy the memoryless Markov property stating that the next page a user visits only depends on her current page and not on previously visited ones. This idea has found its way in numerous applications such as Google's PageRank algorithm and others. Recently, new studies suggested that human navigation may better be modeled using higher order Markov chain models, i.e., the next page depends on a longer history of past clicks. Yet, this finding is preliminary and does not account for the higher complexity of higher order Markov chain models which is why the memoryless model is still widely used. In this work we thoroughly present a diverse array of advanced inference methods for determining the appropriate Markov chain order. We highlight strengths and weaknesses of each method and apply them for investigating memory and structure of human navigation on the Web. Our experiments reveal that the complexity of higher order models grows faster than their utility, and thus we confirm that the memoryless model represents a quite practical model for human navigation on a page level. However, when we expand our analysis to a topical level, where we abstract away from specific page transitions to transitions between topics, we find that the memoryless assumption is violated and specific regularities can be observed. We report results from experiments with two types of navigational datasets (goal-oriented vs. free form) and observe interesting structural differences that make a strong argument for more contextual studies of human navigation in future work.
Singer, Philipp; Helic, Denis; Taraghi, Behnam; Strohmaier, Markus
2014-01-01
One of the most frequently used models for understanding human navigation on the Web is the Markov chain model, where Web pages are represented as states and hyperlinks as probabilities of navigating from one page to another. Predominantly, human navigation on the Web has been thought to satisfy the memoryless Markov property stating that the next page a user visits only depends on her current page and not on previously visited ones. This idea has found its way in numerous applications such as Google's PageRank algorithm and others. Recently, new studies suggested that human navigation may better be modeled using higher order Markov chain models, i.e., the next page depends on a longer history of past clicks. Yet, this finding is preliminary and does not account for the higher complexity of higher order Markov chain models which is why the memoryless model is still widely used. In this work we thoroughly present a diverse array of advanced inference methods for determining the appropriate Markov chain order. We highlight strengths and weaknesses of each method and apply them for investigating memory and structure of human navigation on the Web. Our experiments reveal that the complexity of higher order models grows faster than their utility, and thus we confirm that the memoryless model represents a quite practical model for human navigation on a page level. However, when we expand our analysis to a topical level, where we abstract away from specific page transitions to transitions between topics, we find that the memoryless assumption is violated and specific regularities can be observed. We report results from experiments with two types of navigational datasets (goal-oriented vs. free form) and observe interesting structural differences that make a strong argument for more contextual studies of human navigation in future work. PMID:25013937
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berenstein, David; Kavli Institute for Theoretical Physics, University of California at Santa Barbara, California 93106; Correa, Diego H.
We study an XXX open spin chain with variable number of sites, where the variability is introduced only at the boundaries. This model arises naturally in the study of giant gravitons in the anti-de Sitter-space/conformal field-theory correspondence. We show how to quantize the spin chain by mapping its states to a bosonic lattice of finite length with sources and sinks of particles at the boundaries. Using coherent states, we show how the Hamiltonian for the bosonic lattice gives the correct description of semiclassical open strings ending on giant gravitons.
Teleportation via thermally entangled states of a two-qubit Heisenberg XX chain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo Ye
2002-12-01
Recently, entanglement teleportation has been investigated by Lee and Kim [Phys. Rev. Lett. 84, 4236 (2000)]. In this paper we study entanglement teleportation via two separate thermally entangled states of a two-qubit Heisenberg XX chain. We established the condition under which the parameters of the model have to satisfy in order to teleport entanglement. The necessary minimum amount of thermal entanglement for some fixed strength of exchange coupling is a function of the magnetic field and the temperature.
NASA Astrophysics Data System (ADS)
Birkel, C.; Paroli, R.; Spezia, L.; Tetzlaff, D.; Soulsby, C.
2012-12-01
In this paper we present a novel model framework using the class of Markov Switching Autoregressive Models (MSARMs) to examine catchments as complex stochastic systems that exhibit non-stationary, non-linear and non-Normal rainfall-runoff and solute dynamics. Hereby, MSARMs are pairs of stochastic processes, one observed and one unobserved, or hidden. We model the unobserved process as a finite state Markov chain and assume that the observed process, given the hidden Markov chain, is conditionally autoregressive, which means that the current observation depends on its recent past (system memory). The model is fully embedded in a Bayesian analysis based on Markov Chain Monte Carlo (MCMC) algorithms for model selection and uncertainty assessment. Hereby, the autoregressive order and the dimension of the hidden Markov chain state-space are essentially self-selected. The hidden states of the Markov chain represent unobserved levels of variability in the observed process that may result from complex interactions of hydroclimatic variability on the one hand and catchment characteristics affecting water and solute storage on the other. To deal with non-stationarity, additional meteorological and hydrological time series along with a periodic component can be included in the MSARMs as covariates. This extension allows identification of potential underlying drivers of temporal rainfall-runoff and solute dynamics. We applied the MSAR model framework to streamflow and conservative tracer (deuterium and oxygen-18) time series from an intensively monitored 2.3 km2 experimental catchment in eastern Scotland. Statistical time series analysis, in the form of MSARMs, suggested that the streamflow and isotope tracer time series are not controlled by simple linear rules. MSARMs showed that the dependence of current observations on past inputs observed by transport models often in form of the long-tailing of travel time and residence time distributions can be efficiently explained by non-stationarity either of the system input (climatic variability) and/or the complexity of catchment storage characteristics. The statistical model is also capable of reproducing short (event) and longer-term (inter-event) and wet and dry dynamical "hydrological states". These reflect the non-linear transport mechanisms of flow pathways induced by transient climatic and hydrological variables and modified by catchment characteristics. We conclude that MSARMs are a powerful tool to analyze the temporal dynamics of hydrological data, allowing for explicit integration of non-stationary, non-linear and non-Normal characteristics.
Disordering Chain Motions in Fluoropolymers
NASA Astrophysics Data System (ADS)
Holt, David B.; Farmer, Barry L.
1998-03-01
Rotational and conformational disorder play important roles in the solid state phases of fluoropolymers such as polytetrafluoro- ethylene (PTFE). Modeling disordering processes and transitions which occur in fluoropolymers has been hampered due to a lack of force field parameters that adequately describe both the intra- and intermolecular characteristics (conformations and distances) of these polymers in the solid state. A force field has been developed which overcomes these inadequacies and has been utilized in molecular dynamics simulations on a system of PTFE oligomers to investigate two of the primary disordering processes that occur in the solid phases: rotations of chains about their helical axes and the formation and subsequent behavior of helix reversals. The simulation results confirm helix reversal activity at low temperatures and demonstrate correlations between chain segment rotations or librations and helix reversal motion. A mechanism for large scale chain segment rotations is proposed.
Theory of polyelectrolytes in solvents.
Chitanvis, Shirish M
2003-12-01
Using a continuum description, we account for fluctuations in the ionic solvent surrounding a Gaussian, charged chain and derive an effective short-ranged potential between the charges on the chain. This potential is repulsive at short separations and attractive at longer distances. The chemical potential can be derived from this potential. When the chemical potential is positive, it leads to a meltlike state. For a vanishingly low concentration of segments, this state exhibits scaling behavior for long chains. The Flory exponent characterizing the radius of gyration for long chains is calculated to be approximately 0.63, close to the classical value obtained for second order phase transitions. For short chains, the radius of gyration varies linearly with N, the chain length, and is sensitive to the parameters in the interaction potential. The linear dependence on the chain length N indicates a stiff behavior. The chemical potential associated with this interaction changes sign, when the screening length in the ionic solvent exceeds a critical value. This leads to condensation when the chemical potential is negative. In this state, it is shown using the mean-field approximation that spherical and toroidal condensed shapes can be obtained. The thickness of the toroidal polyelectrolyte is studied as a function of the parameters of the model, such as the ionic screening length. The predictions of this theory should be amenable to experimental verification.
Frenkel-Kontorova model with a transversal degree of freedom: Static properties of kinks
NASA Astrophysics Data System (ADS)
Braun, Oleg M.; Chubykalo, Oksana A.; Kivshar, Yuri S.; Vázquez, Luis
1993-08-01
We consider a generalized Frenkel-Kontorova (FK) model with a transversal degree of freedom proposed by Braun and Kivshar [Phys. Rev. B 44, 7694 (1991)]. The model describes an atomic chain subjected to a two-dimensional (2D) substrate potential that is periodic in one direction and parabolic in the transversal direction, the interatomic interaction being exponentially repulsive. The ground state of the system undergoes a phase transition from the trivial one-dimensional (1D) to a quasi-2D state when the repulsion exceeds a certain critical value. The quasi-2D ground state admits two different types of kinks, ``massive,'' kinks which may be considered as a generalization of the kinks of the standard 1D FK chain, and ``nonmassive'' (phase) kinks, which appear to be due to dimerization of the ground state. We investigate the static characteristics of these two kinds of the kinks (the kink effective mass, the kink rest energy, and the height of the Peierls-Nabarro potential) analytically as well as by means of numerical simulations when the chain with the periodic boundary conditions contains a single kink. In particular, we show that the ``massive'' kinks may be described in the continuum approximation by a perturbed sine-Gordon equation while properties of the ``nonmassive'' kinks may be analyzed within the framework of an effective φ4 model derived for translational displacements. The role of the transversal degree of freedom in mass-transport properties of the generalized FK model applied to describe surface diffusion is also discussed.
Kim, Kyungmok; Lee, Jaewook
2016-01-01
This paper describes a sliding friction model for an electro-deposited coating. Reciprocating sliding tests using ball-on-flat plate test apparatus are performed to determine an evolution of the kinetic friction coefficient. The evolution of the friction coefficient is classified into the initial running-in period, steady-state sliding, and transition to higher friction. The friction coefficient during the initial running-in period and steady-state sliding is expressed as a simple linear function. The friction coefficient in the transition to higher friction is described with a mathematical model derived from Kachanov-type damage law. The model parameters are then estimated using the Markov Chain Monte Carlo (MCMC) approach. It is identified that estimated friction coefficients obtained by MCMC approach are in good agreement with measured ones. PMID:28773359
Adsorption of poly(ethylene succinate) chain onto graphene nanosheets: A molecular simulation.
Kelich, Payam; Asadinezhad, Ahmad
2016-09-01
Understanding the interaction between single polymer chain and graphene nanosheets at local and global length scales is essential for it underlies the mesoscopic properties of polymer nanocomposites. A computational attempt was then performed using atomistic molecular dynamics simulation to gain physical insights into behavior of a model aliphatic polyester, poly(ethylene succinate), single chain near graphene nanosheets, where the effects of the polymer chain length, graphene functionalization, and temperature on conformational properties of the polymer were studied comparatively. Graphene functionalization was carried out through extending the parameters set of an all-atom force field. The results showed a significant conformational transition of the polymer chain from three-dimensional statistical coil, in initial state, to two-dimensional fold, in final state, during adsorption on graphene. The conformational order, overall shape, end-to-end separation statistics, and mobility of the polymer chain were found to be influenced by the graphene functionalization, temperature, and polymer chain length. Furthermore, the polymer chain dynamics mode during adsorption on graphene was observed to transit from normal diffusive to slow subdiffusive mode. The findings from this computational study could shed light on the physics of the early stages of aliphatic polyester chain organization induced by graphene. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Julie, Hongki; Pasaribu, Udjianna S.; Pancoro, Adi
2015-12-01
This paper will allow Markov Chain's application in genome shared identical by descent by two individual at full sibs model. The full sibs model was a continuous time Markov Chain with three state. In the full sibs model, we look for the cumulative distribution function of the number of sub segment which have 2 IBD haplotypes from a segment of the chromosome which the length is t Morgan and the cumulative distribution function of the number of sub segment which have at least 1 IBD haplotypes from a segment of the chromosome which the length is t Morgan. This cumulative distribution function will be developed by the moment generating function.
Herbei, Radu; Kubatko, Laura
2013-03-26
Markov chains are widely used for modeling in many areas of molecular biology and genetics. As the complexity of such models advances, it becomes increasingly important to assess the rate at which a Markov chain converges to its stationary distribution in order to carry out accurate inference. A common measure of convergence to the stationary distribution is the total variation distance, but this measure can be difficult to compute when the state space of the chain is large. We propose a Monte Carlo method to estimate the total variation distance that can be applied in this situation, and we demonstrate how the method can be efficiently implemented by taking advantage of GPU computing techniques. We apply the method to two Markov chains on the space of phylogenetic trees, and discuss the implications of our findings for the development of algorithms for phylogenetic inference.
An affine microsphere approach to modeling strain-induced crystallization in rubbery polymers
NASA Astrophysics Data System (ADS)
Nateghi, A.; Dal, H.; Keip, M.-A.; Miehe, C.
2018-01-01
Upon stretching a natural rubber sample, polymer chains orient themselves in the direction of the applied load and form crystalline regions. When the sample is retracted, the original amorphous state of the network is restored. Due to crystallization, properties of rubber change considerably. The reinforcing effect of the crystallites stiffens the rubber and increases the crack growth resistance. It is of great importance to understand the mechanism leading to strain-induced crystallization. However, limited theoretical work has been done on the investigation of the associated kinetics. A key characteristic observed in the stress-strain diagram of crystallizing rubber is the hysteresis, which is entirely attributed to strain-induced crystallization. In this work, we propose a micromechanically motivated material model for strain-induced crystallization in rubbers. Our point of departure is constructing a micromechanical model for a single crystallizing polymer chain. Subsequently, a thermodynamically consistent evolution law describing the kinetics of crystallization on the chain level is proposed. This chain model is then incorporated into the affine microsphere model. Finally, the model is numerically implemented and its performance is compared to experimental data.
Comparing the locking threshold for rings and chains of oscillators.
Ottino-Löffler, Bertrand; Strogatz, Steven H
2016-12-01
We present a case study of how topology can affect synchronization. Specifically, we consider arrays of phase oscillators coupled in a ring or a chain topology. Each ring is perfectly matched to a chain with the same initial conditions and the same random natural frequencies. The only difference is their boundary conditions: periodic for a ring and open for a chain. For both topologies, stable phase-locked states exist if and only if the spread or "width" of the natural frequencies is smaller than a critical value called the locking threshold (which depends on the boundary conditions and the particular realization of the frequencies). The central question is whether a ring synchronizes more readily than a chain. We show that it usually does, but not always. Rigorous bounds are derived for the ratio between the locking thresholds of a ring and its matched chain, for a variant of the Kuramoto model that also includes a wider family of models.
Comparing the locking threshold for rings and chains of oscillators
NASA Astrophysics Data System (ADS)
Ottino-Löffler, Bertrand; Strogatz, Steven H.
2016-12-01
We present a case study of how topology can affect synchronization. Specifically, we consider arrays of phase oscillators coupled in a ring or a chain topology. Each ring is perfectly matched to a chain with the same initial conditions and the same random natural frequencies. The only difference is their boundary conditions: periodic for a ring and open for a chain. For both topologies, stable phase-locked states exist if and only if the spread or "width" of the natural frequencies is smaller than a critical value called the locking threshold (which depends on the boundary conditions and the particular realization of the frequencies). The central question is whether a ring synchronizes more readily than a chain. We show that it usually does, but not always. Rigorous bounds are derived for the ratio between the locking thresholds of a ring and its matched chain, for a variant of the Kuramoto model that also includes a wider family of models.
A convenient basis for the Izergin-Korepin model
NASA Astrophysics Data System (ADS)
Qiao, Yi; Zhang, Xin; Hao, Kun; Cao, Junpeng; Li, Guang-Liang; Yang, Wen-Li; Shi, Kangjie
2018-05-01
We propose a convenient orthogonal basis of the Hilbert space for the quantum spin chain associated with the A2(2) algebra (or the Izergin-Korepin model). It is shown that compared with the original basis the monodromy-matrix elements acting on this basis take relatively simple forms, which is quite similar as that for the quantum spin chain associated with An algebra in the so-called F-basis. As an application of our general results, we present the explicit recursive expressions of the Bethe states in this basis for the Izergin-Korepin model.
Localization Protection and Symmetry Breaking in One-dimensional Potts Chains
NASA Astrophysics Data System (ADS)
Friedman, Aaron; Vasseur, Romain; Potter, Andrew; Parameswaran, Siddharth
Recent work on the 3-state Potts and Z3 clock models has demonstrated that their ordered phases are connected by duality to a phase that hosts topologically protected parafermionic zero modes at the system's boundary. The analogy with Kitaev's example of the one-dimensional Majorana chain (similarly related by duality to the Ising model) suggests that such zero modes may also be stabilized in highly excited states by many-body localization (MBL). However, the Potts model has a non-Abelian S3 symmetry believed to be incompatible with MBL; hence any MBL state must spontaneously break this symmetry, either completely or into one of its abelian subgroups (Z2 or Z3), with the topological phase corresponding to broken Z3 symmetry. We therefore study the excited state phase structure of random three-state Potts and clock models in one dimension using exact diagonalization and real-space renormalization group techniques. We also investigate the interesting possibility of a direct excited-state transition between MBL phases that break either Z3 or Z2 symmetry, forbidden within Landau theory. NSF DGE-1321846 (AJF), NSF DMR-1455366 and President's Research Catalyst Award No. CA-15-327861 from the University of California Office of the President (SAP), LDRD Program of LBNL (RV), NSF PHY11-25915 at the KITP (AJF, RV, SAP).
The Twilight Zone between Protein Order and Disorder
Szilágyi, A.; Györffy, D.; Závodszky, P.
2008-01-01
The amino acid composition of intrinsically disordered proteins and protein segments characteristically differs from that of ordered proteins. This observation forms the basis of several disorder prediction methods. These, however, usually perform worse for smaller proteins (or segments) than for larger ones. We show that the regions of amino acid composition space corresponding to ordered and disordered proteins overlap with each other, and the extent of the overlap (the “twilight zone”) is larger for short than for long chains. To explain this finding, we used two-dimensional lattice model proteins containing hydrophobic, polar, and charged monomers and revealed the relation among chain length, amino acid composition, and disorder. Because the number of chain configurations exponentially grows with chain length, a larger fraction of longer chains can reach a low-energy, ordered state than do shorter chains. The amount of information carried by the amino acid composition about whether a protein or segment is (dis)ordered grows with increasing chain length. Smaller proteins rely more on specific interactions for stability, which limits the possible accuracy of disorder prediction methods. For proteins in the “twilight zone”, size can determine order, as illustrated by the example of two-state homodimers. PMID:18441033
The twilight zone between protein order and disorder.
Szilágyi, A; Györffy, D; Závodszky, P
2008-08-01
The amino acid composition of intrinsically disordered proteins and protein segments characteristically differs from that of ordered proteins. This observation forms the basis of several disorder prediction methods. These, however, usually perform worse for smaller proteins (or segments) than for larger ones. We show that the regions of amino acid composition space corresponding to ordered and disordered proteins overlap with each other, and the extent of the overlap (the "twilight zone") is larger for short than for long chains. To explain this finding, we used two-dimensional lattice model proteins containing hydrophobic, polar, and charged monomers and revealed the relation among chain length, amino acid composition, and disorder. Because the number of chain configurations exponentially grows with chain length, a larger fraction of longer chains can reach a low-energy, ordered state than do shorter chains. The amount of information carried by the amino acid composition about whether a protein or segment is (dis)ordered grows with increasing chain length. Smaller proteins rely more on specific interactions for stability, which limits the possible accuracy of disorder prediction methods. For proteins in the "twilight zone", size can determine order, as illustrated by the example of two-state homodimers.
Excitonic quantum interference in a quantum dot chain with rings.
Hong, Suc-Kyoung; Nam, Seog Woo; Yeon, Kyu-Hwang
2008-04-16
We demonstrate excitonic quantum interference in a closely spaced quantum dot chain with nanorings. In the resonant dipole-dipole interaction model with direct diagonalization method, we have found a peculiar feature that the excitation of specified quantum dots in the chain is completely inhibited, depending on the orientational configuration of the transition dipole moments and specified initial preparation of the excitation. In practice, these excited states facilitating quantum interference can provide a conceptual basis for quantum interference devices of excitonic hopping.
Transition records of stationary Markov chains.
Naudts, Jan; Van der Straeten, Erik
2006-10-01
In any Markov chain with finite state space the distribution of transition records always belongs to the exponential family. This observation is used to prove a fluctuation theorem, and to show that the dynamical entropy of a stationary Markov chain is linear in the number of steps. Three applications are discussed. A known result about entropy production is reproduced. A thermodynamic relation is derived for equilibrium systems with Metropolis dynamics. Finally, a link is made with recent results concerning a one-dimensional polymer model.
Numazawa, Satoshi; Smith, Roger
2011-10-01
Classical harmonic transition state theory is considered and applied in discrete lattice cells with hierarchical transition levels. The scheme is then used to determine transitions that can be applied in a lattice-based kinetic Monte Carlo (KMC) atomistic simulation model. The model results in an effective reduction of KMC simulation steps by utilizing a classification scheme of transition levels for thermally activated atomistic diffusion processes. Thermally activated atomistic movements are considered as local transition events constrained in potential energy wells over certain local time periods. These processes are represented by Markov chains of multidimensional Boolean valued functions in three-dimensional lattice space. The events inhibited by the barriers under a certain level are regarded as thermal fluctuations of the canonical ensemble and accepted freely. Consequently, the fluctuating system evolution process is implemented as a Markov chain of equivalence class objects. It is shown that the process can be characterized by the acceptance of metastable local transitions. The method is applied to a problem of Au and Ag cluster growth on a rippled surface. The simulation predicts the existence of a morphology-dependent transition time limit from a local metastable to stable state for subsequent cluster growth by accretion. Excellent agreement with observed experimental results is obtained.
Fattal, D R; Ben-Shaul, A
1994-01-01
A molecular, mean-field theory of chain packing statistics in aggregates of amphiphilic molecules is applied to calculate the conformational properties of the lipid chains comprising the hydrophobic cores of dipalmitoyl-phosphatidylcholine (DPPC), dioleoyl-phosphatidylcholine (DOPC), and palmitoyl-oleoyl-phosphatidylcholine (POPC) bilayers in their fluid state. The central quantity in this theory, the probability distribution of chain conformations, is evaluated by minimizing the free energy of the bilayer assuming only that the segment density within the hydrophobic region is uniform (liquidlike). Using this distribution we calculate chain conformational properties such as bond orientational order parameters and spatial distributions of the various chain segments. The lipid chains, both the saturated palmitoyl (-(CH2)14-CH3) and the unsaturated oleoyl (-(CH2)7-CH = CH-(CH2)7-CH3) chains are modeled using rotational isomeric state schemes. All possible chain conformations are enumerated and their statistical weights are determined by the self-consistency equations expressing the condition of uniform density. The hydrophobic core of the DPPC bilayer is treated as composed of single (palmitoyl) chain amphiphiles, i.e., the interactions between chains originating from the same lipid headgroup are assumed to be the same as those between chains belonging to different molecules. Similarly, the DOPC system is treated as a bilayer of oleoyl chains. The POPC bilayer is modeled as an equimolar mixture of palmitoyl and oleoyl chains. Bond orientational order parameter profiles, and segment spatial distributions are calculated for the three systems above, for several values of the bilayer thickness (or, equivalently, average area/headgroup) chosen, where possible, so as to allow for comparisons with available experimental data and/or molecular dynamics simulations. In most cases the agreement between the mean-field calculations, which are relatively easy to perform, and the experimental and simulation data is very good, supporting their use as an efficient tool for analyzing a variety of systems subject to varying conditions (e.g., bilayers of different compositions or thicknesses at different temperatures). PMID:7811955
Global quantum discord and matrix product density operators
NASA Astrophysics Data System (ADS)
Huang, Hai-Lin; Cheng, Hong-Guang; Guo, Xiao; Zhang, Duo; Wu, Yuyin; Xu, Jian; Sun, Zhao-Yu
2018-06-01
In a previous study, we have proposed a procedure to study global quantum discord in 1D chains whose ground states are described by matrix product states [Z.-Y. Sun et al., Ann. Phys. 359, 115 (2015)]. In this paper, we show that with a very simple generalization, the procedure can be used to investigate quantum mixed states described by matrix product density operators, such as quantum chains at finite temperatures and 1D subchains in high-dimensional lattices. As an example, we study the global discord in the ground state of a 2D transverse-field Ising lattice, and pay our attention to the scaling behavior of global discord in 1D sub-chains of the lattice. We find that, for any strength of the magnetic field, global discord always shows a linear scaling behavior as the increase of the length of the sub-chains. In addition, global discord and the so-called "discord density" can be used to indicate the quantum phase transition in the model. Furthermore, based upon our numerical results, we make some reliable predictions about the scaling of global discord defined on the n × n sub-squares in the lattice.
Experimental linear-optics simulation of ground-state of an Ising spin chain.
Xue, Peng; Zhan, Xian; Bian, Zhihao
2017-05-19
We experimentally demonstrate a photonic quantum simulator: by using a two-spin Ising chain (an isolated dimer) as an example, we encode the wavefunction of the ground state with a pair of entangled photons. The effect of magnetic fields, leading to a critical modification of the correlation between two spins, can be simulated by just local operations. With the ratio of simulated magnetic fields and coupling strength increasing, the ground state of the system changes from a product state to an entangled state and back to another product state. The simulated ground states can be distinguished and the transformations between them can be observed by measuring correlations between photons. This simulation of the Ising model with linear quantum optics opens the door to the future studies which connect quantum information and condensed matter physics.
Modelling magnetic anisotropy of single-chain magnets in |d/J| ≥ 1 regime
NASA Astrophysics Data System (ADS)
Haldar, Sumit; Raghunathan, Rajamani; Sutter, Jean-Pascal; Ramasesha, S.
2017-11-01
Single-molecule magnets (SMMs) with single-ion anisotropies comparable to exchange interactions J between spins have recently been synthesised. Here, we provide theoretical insights into the magnetism of such systems. We study spin chains with site-spins, s = 1, 3/2 and 2 and strength of on-site anisotropy comparable to the exchange constants between the spins. We find that large on-site anisotropies lead to crossing of the states with different MS values in the same spin manifold to which they belong in the absence of anisotropy. When on-site anisotropy is increased further, we also find that the MS states of the higher energy spin states descend below the MS states of the ground spin manifold. Giant spin in this limit is no longer conserved and describing the axial and rhombic anisotropies of the molecule, DM and EM, respectively, is not possible. However, the giant spin of the low-lying large MS states is very nearly an integer and, using this spin value, it is possible to construct an effective spin-Hamiltonian and compute the molecular magnetic anisotropy constants DM and EM. We report effect of finite sizes, rotations of site anisotropies and chain dimerisation on the effective anisotropy of the spin chains.
NASA Astrophysics Data System (ADS)
Foo, Grace M.; Pandey, R. B.
1998-05-01
A discrete-to-continuum approach is introduced to study the static and dynamic properties of polymer chain systems with a bead-spring chain model in two dimensions. A finitely extensible nonlinear elastic potential is used for the bond between the consecutive beads with the Lennard-Jones (LJ) potential with smaller (Rc=21/6σ=0.95) and larger (Rc=2.5σ=2.1) values of the upper cutoff for the nonbonding interaction among the neighboring beads. We find that chains segregate at temperature T=1.0 with Rc=2.1 and remain desegregated with Rc=0.95. At low temperature (T=0.2), chains become folded, in a ribbonlike conformation, unlike random and self-avoiding walk conformations at T=1.0. The power-law dependence of the rms displacements of the center of mass (Rc.m.) of the chains and their center node (Rcn) with time are nonuniversal, with the range of exponents ν1~=0.45-0.25 and ν2~=0.30-0.10, respectively. Both radius of gyration (Rg) and average bond length (
Constructing 1/ωα noise from reversible Markov chains
NASA Astrophysics Data System (ADS)
Erland, Sveinung; Greenwood, Priscilla E.
2007-09-01
This paper gives sufficient conditions for the output of 1/ωα noise from reversible Markov chains on finite state spaces. We construct several examples exhibiting this behavior in a specified range of frequencies. We apply simple representations of the covariance function and the spectral density in terms of the eigendecomposition of the probability transition matrix. The results extend to hidden Markov chains. We generalize the results for aggregations of AR1-processes of C. W. J. Granger [J. Econometrics 14, 227 (1980)]. Given the eigenvalue function, there is a variety of ways to assign values to the states such that the 1/ωα condition is satisfied. We show that a random walk on a certain state space is complementary to the point process model of 1/ω noise of B. Kaulakys and T. Meskauskas [Phys. Rev. E 58, 7013 (1998)]. Passing to a continuous state space, we construct 1/ωα noise which also has a long memory.
Theoretical and computational studies of excitons in conjugated polymers
NASA Astrophysics Data System (ADS)
Barford, William; Bursill, Robert J.; Smith, Richard W.
2002-09-01
We present a theoretical and computational analysis of excitons in conjugated polymers. We use a tight-binding model of π-conjugated electrons, with 1/r interactions for large r. In both the weak-coupling limit (defined by W>>U) and the strong-coupling limit (defined by W<
Weidner, Tobias; Breen, Nicholas F.; Li, Kun; Drobny, Gary P.; Castner, David G.
2010-01-01
The power of combining sum frequency generation (SFG) vibrational spectroscopy and solid-state nuclear magnetic resonance (ssNMR) spectroscopy to quantify, with site specificity and atomic resolution, the orientation and dynamics of side chains in synthetic model peptides adsorbed onto polystyrene (PS) surfaces is demonstrated in this study. Although isotopic labeling has long been used in ssNMR studies to site-specifically probe the structure and dynamics of biomolecules, the potential of SFG to probe side chain orientation in isotopically labeled surface-adsorbed peptides and proteins remains largely unexplored. The 14 amino acid leucine-lysine peptide studied in this work is known to form an α-helical secondary structure at liquid-solid interfaces. Selective, individual deuteration of the isopropyl group in each leucine residue was used to probe the orientation and dynamics of each individual leucine side chain of LKα14 adsorbed onto PS. The selective isotopic labeling methods allowed SFG analysis to determine the orientations of individual side chains in adsorbed peptides. Side chain dynamics were obtained by fitting the deuterium ssNMR line shape to specific motional models. Through the combined use of SFG and ssNMR, the dynamic trends observed for individual side chains by ssNMR have been correlated with side chain orientation relative to the PS surface as determined by SFG. This combination provides a more complete and quantitative picture of the structure, orientation, and dynamics of these surface-adsorbed peptides than could be obtained if either technique were used separately. PMID:20628016
A flower-like Ising model. Thermodynamic properties
NASA Astrophysics Data System (ADS)
Mejdani, R.; Ifti, M.
1995-03-01
We consider a flower-like Ising model, in which there are some additional bonds (in the “flower-core”) compared to a pure Ising chain. To understand the behaviour of this system and particularly the competition between ferromagnetic (usual) bonds along the chain and antiferromagnetic (additional) bonds across the chain, we study analytically and iteratively the main thermodynamic quantities. Very interesting is, in the zero-field and zero-temperature limit, the behaviour of the magnetization and the susceptibility, closely related to the ground state configurations and their degeneracies. This degeneracy explains the existence of non-zero entropy at zero temperature, in our results. Also, this model could be useful for the experimental investigations in studying the saturation curves for the enzyme kinetics or the melting curves for DNA-denaturation in some flower-like configurations.
Srai, Jagjit Singh; Badman, Clive; Krumme, Markus; Futran, Mauricio; Johnston, Craig
2015-03-01
This paper examines the opportunities and challenges facing the pharmaceutical industry in moving to a primarily "continuous processing"-based supply chain. The current predominantly "large batch" and centralized manufacturing system designed for the "blockbuster" drug has driven a slow-paced, inventory heavy operating model that is increasingly regarded as inflexible and unsustainable. Indeed, new markets and the rapidly evolving technology landscape will drive more product variety, shorter product life-cycles, and smaller drug volumes, which will exacerbate an already unsustainable economic model. Future supply chains will be required to enhance affordability and availability for patients and healthcare providers alike despite the increased product complexity. In this more challenging supply scenario, we examine the potential for a more pull driven, near real-time demand-based supply chain, utilizing continuous processing where appropriate as a key element of a more "flow-through" operating model. In this discussion paper on future supply chain models underpinned by developments in the continuous manufacture of pharmaceuticals, we have set out; The significant opportunities to moving to a supply chain flow-through operating model, with substantial opportunities in inventory reduction, lead-time to patient, and radically different product assurance/stability regimes. Scenarios for decentralized production models producing a greater variety of products with enhanced volume flexibility. Production, supply, and value chain footprints that are radically different from today's monolithic and centralized batch manufacturing operations. Clinical trial and drug product development cost savings that support more rapid scale-up and market entry models with early involvement of SC designers within New Product Development. The major supply chain and industrial transformational challenges that need to be addressed. The paper recognizes that although current batch operational performance in pharma is far from optimal and not necessarily an appropriate end-state benchmark for batch technology, the adoption of continuous supply chain operating models underpinned by continuous production processing, as full or hybrid solutions in selected product supply chains, can support industry transformations to deliver right-first-time quality at substantially lower inventory profiles. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.
Nonrotational states in isotonic chains of heavy nuclei
NASA Astrophysics Data System (ADS)
Adamian, G. G.; Malov, L. A.; Antonenko, N. V.; Jolos, R. V.
2018-03-01
The ground-state deformations of heavy nuclei are explored with the microscopic-macroscopic approach using the single-particle Woods-Saxon potential of the quasiparticle-phonon model. The calculations of the energies of low-lying nonrotational states take into account the residual pairing and phonon-quasiparticle interactions. The spectra of these states are presented for the N =147 -161 isotones. The sensitivity of the calculated results to the parameters of the model is studied. A rather good description of the available experimental data is demonstrated.
Majorana spin in magnetic atomic chain systems
NASA Astrophysics Data System (ADS)
Li, Jian; Jeon, Sangjun; Xie, Yonglong; Yazdani, Ali; Bernevig, B. Andrei
2018-03-01
In this paper, we establish that Majorana zero modes emerging from a topological band structure of a chain of magnetic atoms embedded in a superconductor can be distinguished from trivial localized zero energy states that may accidentally form in this system using spin-resolved measurements. To demonstrate this key Majorana diagnostics, we study the spin composition of magnetic impurity induced in-gap Shiba states in a superconductor using a hybrid model. By examining the spin and spectral densities in the context of the Bogoliubov-de Gennes (BdG) particle-hole symmetry, we derive a sum rule that relates the spin densities of localized Shiba states with those in the normal state without superconductivity. Extending our investigations to a ferromagnetic chain of magnetic impurities, we identify key features of the spin properties of the extended Shiba state bands, as well as those associated with a localized Majorana end mode when the effect of spin-orbit interaction is included. We then formulate a phenomenological theory for the measurement of the local spin densities with spin-polarized scanning tunneling microscopy (STM) techniques. By combining the calculated spin densities and the measurement theory, we show that spin-polarized STM measurements can reveal a sharp contrast in spin polarization between an accidental-zero-energy trivial Shiba state and a Majorana zero mode in a topological superconducting phase in atomic chains. We further confirm our results with numerical simulations that address generic parameter settings.
Building Simple Hidden Markov Models. Classroom Notes
ERIC Educational Resources Information Center
Ching, Wai-Ki; Ng, Michael K.
2004-01-01
Hidden Markov models (HMMs) are widely used in bioinformatics, speech recognition and many other areas. This note presents HMMs via the framework of classical Markov chain models. A simple example is given to illustrate the model. An estimation method for the transition probabilities of the hidden states is also discussed.
Folding of Polymer Chains in Early Stage of Crystallization
NASA Astrophysics Data System (ADS)
Yuan, Shichen; Miyoshi, Toshikazu
Understanding the structural formation of long polymer chains in the early stage of crystallization is one of the long-standing problems in polymer science. Using solid state NMR, we investigated chain trajectory of isotactic polypropylene in the mesomorphic nano-domains formed via rapid and deep quenching. Comparison of experimental and simulated 13C-13C Double Quantum (DQ) buildup curves demonstrated that instead of random re-entry models and solidification models, individual chains in the mesomorphic form iPP adopt adjacent reentry sequences with an average folding number of
Bayesian tomography by interacting Markov chains
NASA Astrophysics Data System (ADS)
Romary, T.
2017-12-01
In seismic tomography, we seek to determine the velocity of the undergound from noisy first arrival travel time observations. In most situations, this is an ill posed inverse problem that admits several unperfect solutions. Given an a priori distribution over the parameters of the velocity model, the Bayesian formulation allows to state this problem as a probabilistic one, with a solution under the form of a posterior distribution. The posterior distribution is generally high dimensional and may exhibit multimodality. Moreover, as it is known only up to a constant, the only sensible way to addressthis problem is to try to generate simulations from the posterior. The natural tools to perform these simulations are Monte Carlo Markov chains (MCMC). Classical implementations of MCMC algorithms generally suffer from slow mixing: the generated states are slow to enter the stationary regime, that is to fit the observations, and when one mode of the posterior is eventually identified, it may become difficult to visit others. Using a varying temperature parameter relaxing the constraint on the data may help to enter the stationary regime. Besides, the sequential nature of MCMC makes them ill fitted toparallel implementation. Running a large number of chains in parallel may be suboptimal as the information gathered by each chain is not mutualized. Parallel tempering (PT) can be seen as a first attempt to make parallel chains at different temperatures communicate but only exchange information between current states. In this talk, I will show that PT actually belongs to a general class of interacting Markov chains algorithm. I will also show that this class enables to design interacting schemes that can take advantage of the whole history of the chain, by authorizing exchanges toward already visited states. The algorithms will be illustrated with toy examples and an application to first arrival traveltime tomography.
Concentration and saturation effects of tethered polymer chains on adsorbing surfaces
NASA Astrophysics Data System (ADS)
Descas, Radu; Sommer, Jens-Uwe; Blumen, Alexander
2006-12-01
We consider end-grafted chains at an adsorbing surface under good solvent conditions using Monte Carlo simulations and scaling arguments. Grafting of chains allows us to fix the surface concentration and to study a wide range of surface concentrations from the undersaturated state of the surface up to the brushlike regime. The average extension of single chains in the direction parallel and perpendicular to the surface is analyzed using scaling arguments for the two-dimensional semidilute surface state according to Bouchaud and Daoud [J. Phys. (Paris) 48, 1991 (1987)]. We find good agreement with the scaling predictions for the scaling in the direction parallel to the surface and for surface concentrations much below the saturation concentration (dense packing of adsorption blobs). Increasing the grafting density we study the saturation effects and the oversaturation of the adsorption layer. In order to account for the effect of excluded volume on the adsorption free energy we introduce a new scaling variable related with the saturation concentration of the adsorption layer (saturation scaling). We show that the decrease of the single chain order parameter (the fraction of adsorbed monomers on the surface) with increasing concentration, being constant in the ideal semidilute surface state, is properly described by saturation scaling only. Furthermore, the simulation results for the chains' extension from higher surface concentrations up to the oversaturated state support the new scaling approach. The oversaturated state can be understood using a geometrical model which assumes a brushlike layer on top of a saturated adsorption layer. We provide evidence that adsorbed polymer layers are very sensitive to saturation effects, which start to influence the semidilute surface scaling even much below the saturation threshold.
Atomic spin-chain realization of a model for quantum criticality
NASA Astrophysics Data System (ADS)
Toskovic, R.; van den Berg, R.; Spinelli, A.; Eliens, I. S.; van den Toorn, B.; Bryant, B.; Caux, J.-S.; Otte, A. F.
2016-07-01
The ability to manipulate single atoms has opened up the door to constructing interesting and useful quantum structures from the ground up. On the one hand, nanoscale arrangements of magnetic atoms are at the heart of future quantum computing and spintronic devices; on the other hand, they can be used as fundamental building blocks for the realization of textbook many-body quantum models, illustrating key concepts such as quantum phase transitions, topological order or frustration as a function of system size. Here, we use low-temperature scanning tunnelling microscopy to construct arrays of magnetic atoms on a surface, designed to behave like spin-1/2 XXZ Heisenberg chains in a transverse field, for which a quantum phase transition from an antiferromagnetic to a paramagnetic phase is predicted in the thermodynamic limit. Site-resolved measurements on these finite-size realizations reveal a number of sudden ground state changes when the field approaches the critical value, each corresponding to a new domain wall entering the chains. We observe that these state crossings become closer for longer chains, suggesting the onset of critical behaviour. Our results present opportunities for further studies on quantum behaviour of many-body systems, as a function of their size and structural complexity.
NASA Astrophysics Data System (ADS)
Monthus, Cécile
2018-03-01
For the line of critical antiferromagnetic XXZ chains with coupling J > 0 and anisotropy 0<Δ ≤slant 1 , we describe how the block-spin renormalization procedure preserving the SU q (2) symmetry introduced by Martin-Delgado and Sierra (1996 Phys. Rev. Lett. 76 1146) can be reformulated as the translation-invariant scale-invariant tree-tensor-state of the smallest dimension that is compatible with the quantum symmetries of the model. The properties of this tree-tensor-state are studied in detail via the ground-state energy, the magnetizations and the staggered magnetizations, as well as the Shannon-Renyi entropies characterizing the multifractality of the components of the wave function.
Machine learning in sentiment reconstruction of the simulated stock market
NASA Astrophysics Data System (ADS)
Goykhman, Mikhail; Teimouri, Ali
2018-02-01
In this paper we continue the study of the simulated stock market framework defined by the driving sentiment processes. We focus on the market environment driven by the buy/sell trading sentiment process of the Markov chain type. We apply the methodology of the Hidden Markov Models and the Recurrent Neural Networks to reconstruct the transition probabilities matrix of the Markov sentiment process and recover the underlying sentiment states from the observed stock price behavior. We demonstrate that the Hidden Markov Model can successfully recover the transition probabilities matrix for the hidden sentiment process of the Markov Chain type. We also demonstrate that the Recurrent Neural Network can successfully recover the hidden sentiment states from the observed simulated stock price time series.
A switchable polymer layer: Chain folding in end-charged polymer brushes
NASA Astrophysics Data System (ADS)
Heine, David; Wu, David T.
2001-03-01
We use a self-consistent field approximation to model the configurations of end-charged homopolymer and block copolymer brushes in response to an external electric field due to charges on the grafting surface. By varying the charge density on the grafting surface, we can cause the chains either to extend outward, greatly increasing the brush height, or to loop back to the grafting surface. We show that such a copolymer brush can present one block at the exposed surface in the extended state and present the other block in the retracted state. This occurs for both a solvated brush and a dry brush. We also compare these results to those of a modified Alexander-de Gennes model for the end-charged homopolymer brush.
Improved packing of protein side chains with parallel ant colonies
2014-01-01
Introduction The accurate packing of protein side chains is important for many computational biology problems, such as ab initio protein structure prediction, homology modelling, and protein design and ligand docking applications. Many of existing solutions are modelled as a computational optimisation problem. As well as the design of search algorithms, most solutions suffer from an inaccurate energy function for judging whether a prediction is good or bad. Even if the search has found the lowest energy, there is no certainty of obtaining the protein structures with correct side chains. Methods We present a side-chain modelling method, pacoPacker, which uses a parallel ant colony optimisation strategy based on sharing a single pheromone matrix. This parallel approach combines different sources of energy functions and generates protein side-chain conformations with the lowest energies jointly determined by the various energy functions. We further optimised the selected rotamers to construct subrotamer by rotamer minimisation, which reasonably improved the discreteness of the rotamer library. Results We focused on improving the accuracy of side-chain conformation prediction. For a testing set of 442 proteins, 87.19% of X1 and 77.11% of X12 angles were predicted correctly within 40° of the X-ray positions. We compared the accuracy of pacoPacker with state-of-the-art methods, such as CIS-RR and SCWRL4. We analysed the results from different perspectives, in terms of protein chain and individual residues. In this comprehensive benchmark testing, 51.5% of proteins within a length of 400 amino acids predicted by pacoPacker were superior to the results of CIS-RR and SCWRL4 simultaneously. Finally, we also showed the advantage of using the subrotamers strategy. All results confirmed that our parallel approach is competitive to state-of-the-art solutions for packing side chains. Conclusions This parallel approach combines various sources of searching intelligence and energy functions to pack protein side chains. It provides a frame-work for combining different inaccuracy/usefulness objective functions by designing parallel heuristic search algorithms. PMID:25474164
NASA Astrophysics Data System (ADS)
Abhinav, S.; Manohar, C. S.
2018-03-01
The problem of combined state and parameter estimation in nonlinear state space models, based on Bayesian filtering methods, is considered. A novel approach, which combines Rao-Blackwellized particle filters for state estimation with Markov chain Monte Carlo (MCMC) simulations for parameter identification, is proposed. In order to ensure successful performance of the MCMC samplers, in situations involving large amount of dynamic measurement data and (or) low measurement noise, the study employs a modified measurement model combined with an importance sampling based correction. The parameters of the process noise covariance matrix are also included as quantities to be identified. The study employs the Rao-Blackwellization step at two stages: one, associated with the state estimation problem in the particle filtering step, and, secondly, in the evaluation of the ratio of likelihoods in the MCMC run. The satisfactory performance of the proposed method is illustrated on three dynamical systems: (a) a computational model of a nonlinear beam-moving oscillator system, (b) a laboratory scale beam traversed by a loaded trolley, and (c) an earthquake shake table study on a bending-torsion coupled nonlinear frame subjected to uniaxial support motion.
NASA Technical Reports Server (NTRS)
Smith, Grant D.; Jaffe, R. L.; Yoon, D. Y.; Arnold, James O. (Technical Monitor)
1994-01-01
Conformational energy contours of perfluoroalkanes, determined from ab initio calculations, confirm the well-known spitting of trans states into two minima at plus or minus 17 degrees but also show that the gauche states split as well, with minima at plus or minus 124 degrees and plus or minus 84 in order to relieve steric crowding. The directions of such split distortions from the perfectly staggered states are strongly coupled for adjacent pairs of bonds in a manner identical to the intradyad pair for poly (isobutylene) chains. These conformational characteristics are fully represented by a six-state rotational isomeric state (RIS) model for PTFE comprised of t(+), t(-), g(sup +)+, g(sup +)-, g(sup -) + and g(sup -)-states, located at the split energy minima. The resultant 6 x 6 statistical weight matrix is described by first-order interaction parameters for the g+(+) (ca. 0.6 kcal/mol) and g+- (ca. 2.0 kcal/mol) states, and second order parameters for the g(sup +)+g(sup +)+ (ca 0.6 kcal/mol) and g(sup +)+g(sup -)+ (ca. 1.0 kcal/mol) states. This six-state RIS model, without adjustment of the geometric or energy parameters as determined from the ab initio calculations, predicts the unperturbed chain dimensions and the fraction of gauche bonds as a function of temperature for PTFE in good agreement with available experimental values.
NASA Astrophysics Data System (ADS)
Levkovich-Maslyuk, Fedor
2016-08-01
We give a pedagogical introduction to the Bethe ansatz techniques in integrable QFTs and spin chains. We first discuss and motivate the general framework of asymptotic Bethe ansatz for the spectrum of integrable QFTs in large volume, based on the exact S-matrix. Then we illustrate this method in several concrete theories. The first case we study is the SU(2) chiral Gross-Neveu model. We derive the Bethe equations via algebraic Bethe ansatz, solving in the process the Heisenberg XXX spin chain. We discuss this famous spin chain model in some detail, covering in particular the coordinate Bethe ansatz, some properties of Bethe states, and the classical scaling limit leading to finite-gap equations. Then we proceed to the more involved SU(3) chiral Gross-Neveu model and derive the Bethe equations using nested algebraic Bethe ansatz to solve the arising SU(3) spin chain. Finally we show how a method similar to the Bethe ansatz works in a completely different setting, namely for the 1D oscillator in quantum mechanics.
Srai, Jagjit Singh; Badman, Clive; Krumme, Markus; Futran, Mauricio; Johnston, Craig
2015-03-01
This paper examines the opportunities and challenges facing the pharmaceutical industry in moving to a primarily "continuous processing"-based supply chain. The current predominantly "large batch" and centralized manufacturing system designed for the "blockbuster" drug has driven a slow-paced, inventory heavy operating model that is increasingly regarded as inflexible and unsustainable. Indeed, new markets and the rapidly evolving technology landscape will drive more product variety, shorter product life-cycles, and smaller drug volumes, which will exacerbate an already unsustainable economic model. Future supply chains will be required to enhance affordability and availability for patients and healthcare providers alike despite the increased product complexity. In this more challenging supply scenario, we examine the potential for a more pull driven, near real-time demand-based supply chain, utilizing continuous processing where appropriate as a key element of a more "flow-through" operating model. In this discussion paper on future supply chain models underpinned by developments in the continuous manufacture of pharmaceuticals, we have set out; The paper recognizes that although current batch operational performance in pharma is far from optimal and not necessarily an appropriate end-state benchmark for batch technology, the adoption of continuous supply chain operating models underpinned by continuous production processing, as full or hybrid solutions in selected product supply chains, can support industry transformations to deliver right-first-time quality at substantially lower inventory profiles. © 2015 The Authors. Journal of Pharmaceutical Sciences published by Wiley Periodicals, Inc. and the American Pharmacists Association. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Entanglement of purification: from spin chains to holography
NASA Astrophysics Data System (ADS)
Nguyen, Phuc; Devakul, Trithep; Halbasch, Matthew G.; Zaletel, Michael P.; Swingle, Brian
2018-01-01
Purification is a powerful technique in quantum physics whereby a mixed quantum state is extended to a pure state on a larger system. This process is not unique, and in systems composed of many degrees of freedom, one natural purification is the one with minimal entanglement. Here we study the entropy of the minimally entangled purification, called the entanglement of purification, in three model systems: an Ising spin chain, conformal field theories holographically dual to Einstein gravity, and random stabilizer tensor networks. We conjecture values for the entanglement of purification in all these models, and we support our conjectures with a variety of numerical and analytical results. We find that such minimally entangled purifications have a number of applications, from enhancing entanglement-based tensor network methods for describing mixed states to elucidating novel aspects of the emergence of geometry from entanglement in the AdS/CFT correspondence.
About Block Dynamic Model of Earthquake Source.
NASA Astrophysics Data System (ADS)
Gusev, G. A.; Gufeld, I. L.
One may state the absence of a progress in the earthquake prediction papers. The short-term prediction (diurnal period, localisation being also predicted) has practical meaning. Failure is due to the absence of the adequate notions about geological medium, particularly, its block structure and especially in the faults. Geological and geophysical monitoring gives the basis for the notion about geological medium as open block dissipative system with limit energy saturation. The variations of the volume stressed state close to critical states are associated with the interaction of the inhomogeneous ascending stream of light gases (helium and hydrogen) with solid phase, which is more expressed in the faults. In the background state small blocks of the fault medium produce the sliding of great blocks in the faults. But for the considerable variations of ascending gas streams the formation of bound chains of small blocks is possible, so that bound state of great blocks may result (earthquake source). Recently using these notions we proposed a dynamical earthquake source model, based on the generalized chain of non-linear bound oscillators of Fermi-Pasta-Ulam type (FPU). The generalization concerns its in homogeneity and different external actions, imitating physical processes in the real source. Earlier weak inhomogeneous approximation without dissipation was considered. Last has permitted to study the FPU return (return to initial state). Probabilistic properties in quasi periodic movement were found. The chain decay problem due to non-linearity and external perturbations was posed. The thresholds and dependence of life- time of the chain are studied. The great fluctuations of life-times are discovered. In the present paper the rigorous consideration of the inhomogeneous chain including the dissipation is considered. For the strong dissipation case, when the oscillation movements are suppressed, specific effects are discovered. For noise action and constantly arising deformation the dependence of life-time on noise amplitude is investigated. Also for the initial shock we have chosen the amplitudes, when it determined the life-time, as principal cause. For this case it appeared, that life-time had non-monotonous dependence on the noise amplitude ("temperature"). There was the domain of the "temperatures", where the life-time reached a maximum. The comparison of different dissipation intensities was performed.
Ultrafast exciton migration in an HJ-aggregate: Potential surfaces and quantum dynamics
NASA Astrophysics Data System (ADS)
Binder, Robert; Polkehn, Matthias; Ma, Tianji; Burghardt, Irene
2017-01-01
Quantum dynamical and electronic structure calculations are combined to investigate the mechanism of exciton migration in an oligothiophene HJ aggregate, i.e., a combination of oligomer chains (J-type aggregates) and stacked aggregates of such chains (H-type aggregates). To this end, a Frenkel exciton model is parametrized by a recently introduced procedure [Binder et al., J. Chem. Phys. 141, 014101 (2014)] which uses oligomer excited-state calculations to perform an exact, point-wise mapping of coupled potential energy surfaces to an effective Frenkel model. Based upon this parametrization, the Multi-Layer Multi-Configuration Time-Dependent Hartree (ML-MCTDH) method is employed to investigate ultrafast dynamics of exciton transfer in a small, asymmetric HJ aggregate model composed of 30 sites and 30 active modes. For a partially delocalized initial condition, it is shown that a torsional defect confines the trapped initial exciton, and planarization induces an ultrafast resonant transition between an HJ-aggregated segment and a covalently bound "dangling chain" end. This model is a minimal realization of experimentally investigated mixed systems exhibiting ultrafast exciton transfer between aggregated, highly planarized chains and neighboring disordered segments.
Entanglement Theories: Packing vs. Percolation
NASA Astrophysics Data System (ADS)
Wool, Richard
2007-03-01
There are two emergent theories of polymer entanglements, the Packing Model (Fetters, Lohse, Graessley, Milner, Whitten, ˜'98) and the Percolation Model (Wool ˜'93). The Packing model suggests that the entanglement molecular weight Me is determined by Me = K p^3, where the packing length parameter p = V/R^2 in which V is the volume of the chain (V=M/ρNa), R is the end-to end vector of the chain, and K 357 ρNa, is an empirical constant. The Percolation model states that an entanglement network develops when the number of chains per unit area σ, intersecting any load bearing plane, is equal to 3 times the number of chain segments (1/a cross-section), such that when 3aσ =1 at the percolation threshold, Me 31 MjC∞, in which Mj is the step molecular weight and C∞ is the characteristic ratio. There are no fitting parameters in the Percolation model. The Packing model predicts that Me decreases rapidly with chain stiffness, as Me˜1/C∞^3, while the Percolation model predicts that Me increases with C∞, as Me˜C∞. The Percolation model was found to be the correct model based on computer simulations (M. Bulacu et al) and a re-analysis of the Packing model experimental data. The Packing model can be derived from the Percolation model, but not visa versa, and reveals a surprising accidental relation between C∞ and Mj in the front factor K. This result significantly impacts the interpretation of the dynamics of rheology and fracture of entangled polymers.
Exact goodness-of-fit tests for Markov chains.
Besag, J; Mondal, D
2013-06-01
Goodness-of-fit tests are useful in assessing whether a statistical model is consistent with available data. However, the usual χ² asymptotics often fail, either because of the paucity of the data or because a nonstandard test statistic is of interest. In this article, we describe exact goodness-of-fit tests for first- and higher order Markov chains, with particular attention given to time-reversible ones. The tests are obtained by conditioning on the sufficient statistics for the transition probabilities and are implemented by simple Monte Carlo sampling or by Markov chain Monte Carlo. They apply both to single and to multiple sequences and allow a free choice of test statistic. Three examples are given. The first concerns multiple sequences of dry and wet January days for the years 1948-1983 at Snoqualmie Falls, Washington State, and suggests that standard analysis may be misleading. The second one is for a four-state DNA sequence and lends support to the original conclusion that a second-order Markov chain provides an adequate fit to the data. The last one is six-state atomistic data arising in molecular conformational dynamics simulation of solvated alanine dipeptide and points to strong evidence against a first-order reversible Markov chain at 6 picosecond time steps. © 2013, The International Biometric Society.
NASA Astrophysics Data System (ADS)
Wang, Xiaodong; Zhang, Xiaoyu; Cai, Hongming; Xu, Boyi
Enacting a supply-chain process involves variant partners and different IT systems. REST receives increasing attention for distributed systems with loosely coupled resources. Nevertheless, resource model incompatibilities and conflicts prevent effective process modeling and deployment in resource-centric Web service environment. In this paper, a Petri-net based framework for supply-chain process integration is proposed. A resource meta-model is constructed to represent the basic information of resources. Then based on resource meta-model, XML schemas and documents are derived, which represent resources and their states in Petri-net. Thereafter, XML-net, a high level Petri-net, is employed for modeling control and data flow of process. From process model in XML-net, RESTful services and choreography descriptions are deduced. Therefore, unified resource representation and RESTful services description are proposed for cross-system integration in a more effective way. A case study is given to illustrate the approach and the desirable features of the approach are discussed.
Le modèle stochastique SIS pour une épidémie dans un environnement aléatoire.
Bacaër, Nicolas
2016-10-01
The stochastic SIS epidemic model in a random environment. In a random environment that is a two-state continuous-time Markov chain, the mean time to extinction of the stochastic SIS epidemic model grows in the supercritical case exponentially with respect to the population size if the two states are favorable, and like a power law if one state is favorable while the other is unfavorable.
Phase diagram and quench dynamics of the cluster-XY spin chain
NASA Astrophysics Data System (ADS)
Montes, Sebastián; Hamma, Alioscia
2012-08-01
We study the complete phase space and the quench dynamics of an exactly solvable spin chain, the cluster-XY model. In this chain, the cluster term and the XY couplings compete to give a rich phase diagram. The phase diagram is studied by means of the quantum geometric tensor. We study the time evolution of the system after a critical quantum quench using the Loschmidt echo. The structure of the revivals after critical quantum quenches presents a nontrivial behavior depending on the phase of the initial state and the critical point.
Phase diagram and quench dynamics of the cluster-XY spin chain.
Montes, Sebastián; Hamma, Alioscia
2012-08-01
We study the complete phase space and the quench dynamics of an exactly solvable spin chain, the cluster-XY model. In this chain, the cluster term and the XY couplings compete to give a rich phase diagram. The phase diagram is studied by means of the quantum geometric tensor. We study the time evolution of the system after a critical quantum quench using the Loschmidt echo. The structure of the revivals after critical quantum quenches presents a nontrivial behavior depending on the phase of the initial state and the critical point.
A Case Study on Engineering Failure Analysis of Link Chain
Lee, Seong-Beom; Lee, Hong-Chul
2010-01-01
Objectives The objective of this study was to investigate the effect of chain installation condition on stress distribution that could eventually cause disastrous failure from sudden deformation and geometric rupture. Methods Fractographic method used for the failed chain indicates that over-stress was considered as the root cause of failure. 3D modeling and finite element analysis for the chain, used in a crane hook, were performed with a three-dimensional interactive application program, CATIA, commercial finite element analysis and computational fluid dynamic software, ANSYS. Results The results showed that the state of stress was changed depending on the initial position of the chain that was installed in the hook. Especially, the magnitude of the stress was strongly affected by the bending forces, which are 2.5 times greater (under the simulation condition currently investigated) than that from the plain tensile load. Also, it was noted that the change of load state is strongly related to the failure of parts. The chain can hold an ultimate load of about 8 tons with only the tensile load acting on it. Conclusion The conclusions of this research clearly showed that a reduction of the loss from similar incidents can be achieved when an operator properly handles the installation of the chain. PMID:22953162
What are we missing? Scope 3 greenhouse gas emissions accounting in the metals and minerals industry
NASA Astrophysics Data System (ADS)
Greene, Suzanne E.
2018-05-01
Metal and mineral companies have significant greenhouse gas emissions in their upstream and downstream value chains due to outsourced extraction, beneficiation and transportation activities, depending on a firm's business model. While many companies move towards more transparent reporting of corporate greenhouse gas emissions, value chain emissions remain difficult to capture, particularly in the global supply chain. Incomplete reports make it difficult for companies to track emissions reductions goals or implement sustainable supply chain improvements, especially for commodity products that form the base of many other sector's value chains. Using voluntarily-reported CDP data, this paper sheds light on hotspots in value chain emissions for individual metal and mineral companies, and for the sector as a whole. The state of value chain emissions reporting for the industry is discussed in general, with a focus on where emissions could potentially be underestimated and how estimates could be improved.
Transport of spin qubits with donor chains under realistic experimental conditions
NASA Astrophysics Data System (ADS)
Mohiyaddin, Fahd A.; Kalra, Rachpon; Laucht, Arne; Rahman, Rajib; Klimeck, Gerhard; Morello, Andrea
2016-07-01
The ability to transport quantum information across some distance can facilitate the design and operation of a quantum processor. One-dimensional spin chains provide a compact platform to realize scalable spin transport for a solid-state quantum computer. Here, we model odd-sized donor chains in silicon under a range of experimental nonidealities, including variability of donor position within the chain. We show that the tolerance against donor placement inaccuracies is greatly improved by operating the spin chain in a mode where the electrons are confined at the Si-SiO2 interface. We then estimate the required time scales and exchange couplings, and the level of noise that can be tolerated to achieve high-fidelity transport. We also propose a protocol to calibrate and initialize the chain, thereby providing a complete guideline for realizing a functional donor chain and utilizing it for spin transport.
Transport of spin qubits with donor chains under realistic experimental conditions
Mohiyaddin, Fahd A.; Kalra, Rachpon; Laucht, Arne; ...
2016-07-25
The ability to transport quantum information across some distance can facilitate the design and operation of a quantum processor. One-dimensional spin chains provide a compact platform to realize scalable spin transport for a solid-state quantum computer. Here, we model odd-sized donor chains in silicon under a range of experimental nonidealities, including variability of donor position within the chain. We show that the tolerance against donor placement inaccuracies is greatly improved by operating the spin chain in a mode where the electrons are confined at the Si-SiO 2 interface. We then estimate the required time scales and exchange couplings, and themore » level of noise that can be tolerated to achieve high-fidelity transport. As a result, we also propose a protocol to calibrate and initialize the chain, thereby providing a complete guideline for realizing a functional donor chain and utilizing it for spin transport.« less
Molecular mechanism and structure of Trigger Factor bound to the translating ribosome
Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke
2008-01-01
Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744
Kozaki, Kouji; Yamagata, Yuki; Mizoguchi, Riichiro; Imai, Takeshi; Ohe, Kazuhiko
2017-06-19
Medical ontologies are expected to contribute to the effective use of medical information resources that store considerable amount of data. In this study, we focused on disease ontology because the complicated mechanisms of diseases are related to concepts across various medical domains. The authors developed a River Flow Model (RFM) of diseases, which captures diseases as the causal chains of abnormal states. It represents causes of diseases, disease progression, and downstream consequences of diseases, which is compliant with the intuition of medical experts. In this paper, we discuss a fact repository for causal chains of disease based on the disease ontology. It could be a valuable knowledge base for advanced medical information systems. We developed the fact repository for causal chains of diseases based on our disease ontology and abnormality ontology. This section summarizes these two ontologies. It is developed as linked data so that information scientists can access it using SPARQL queries through an Resource Description Framework (RDF) model for causal chain of diseases. We designed the RDF model as an implementation of the RFM for the fact repository based on the ontological definitions of the RFM. 1554 diseases and 7080 abnormal states in six major clinical areas, which are extracted from the disease ontology, are published as linked data (RDF) with SPARQL endpoint (accessible API). Furthermore, the authors developed Disease Compass, a navigation system for disease knowledge. Disease Compass can browse the causal chains of a disease and obtain related information, including abnormal states, through two web services that provide general information from linked data, such as DBpedia, and 3D anatomical images. Disease Compass can provide a complete picture of disease-associated processes in such a way that fits with a clinician's understanding of diseases. Therefore, it supports user exploration of disease knowledge with access to pertinent information from a variety of sources.
Doubly self-consistent field theory of grafted polymers under simple shear in steady state.
Suo, Tongchuan; Whitmore, Mark D
2014-03-21
We present a generalization of the numerical self-consistent mean-field theory of polymers to the case of grafted polymers under simple shear. The general theoretical framework is presented, and then applied to three different chain models: rods, Gaussian chains, and finitely extensible nonlinear elastic (FENE) chains. The approach is self-consistent at two levels. First, for any flow field, the polymer density profile and effective potential are calculated self-consistently in a manner similar to the usual self-consistent field theory of polymers, except that the calculation is inherently two-dimensional even for a laterally homogeneous system. Second, through the use of a modified Brinkman equation, the flow field and the polymer profile are made self-consistent with respect to each other. For all chain models, we find that reasonable levels of shear cause the chains to tilt, but it has very little effect on the overall thickness of the polymer layer, causing a small decrease for rods, and an increase of no more than a few percent for the Gaussian and FENE chains. Using the FENE model, we also probe the individual bond lengths, bond correlations, and bond angles along the chains, the effects of the shear on them, and the solvent and bonded stress profiles. We find that the approximations needed within the theory for the Brinkman equation affect the bonded stress, but none of the other quantities.
Using Markov Chains to predict the natural progression of diabetic retinopathy.
Srikanth, Priyanka
2015-01-01
To study the natural progression of diabetic retinopathy in patients with type 2 diabetes. This was an observational study of 153 cases with type 2 diabetes from 2010 to 2013. The state of patient was noted at end of each year and transition matrices were developed to model movement between years. Patients who progressed to severe non-proliferative diabetic retinopathy (NPDR) were treated. Markov Chains and Chi-square test were used for statistical analysis. We modelled the transition of 153 patients from NPDR to blindness on an annual basis. At the end of year 3, we compared results from the Markov model versus actual data. The results from Chi-square test confirmed that there was statistically no significant difference (P=0.70) which provided assurance that the model was robust to estimate mean sojourn times. The key finding was that a patient entering the system in mild NPDR state is expected to stay in that state for 5y followed by 1.07y in moderate NPDR, be in the severe NPDR state for 1.33y before moving into PDR for roughly 8y. It is therefore expected that such a patient entering the model in a state of mild NPDR will enter blindness after 15.29y. Patients stay for long time periods in mild NPDR before transitioning into moderate NPDR. However, they move rapidly from moderate NPDR to proliferative diabetic retinopathy (PDR) and stay in that state for long periods before transitioning into blindness.
Enlarged symmetry algebras of spin chains, loop models, and S-matrices
NASA Astrophysics Data System (ADS)
Read, N.; Saleur, H.
2007-08-01
The symmetry algebras of certain families of quantum spin chains are considered in detail. The simplest examples possess m states per site ( m⩾2), with nearest-neighbor interactions with U(m) symmetry, under which the sites transform alternately along the chain in the fundamental m and its conjugate representation m¯. We find that these spin chains, even with arbitrary coefficients of these interactions, have a symmetry algebra A much larger than U(m), which implies that the energy eigenstates fall into sectors that for open chains (i.e., free boundary conditions) can be labeled by j=0,1,…,L, for the 2 L-site chain such that the degeneracies of all eigenvalues in the jth sector are generically the same and increase rapidly with j. For large j, these degeneracies are much larger than those that would be expected from the U(m) symmetry alone. The enlarged symmetry algebra A(2L) consists of operators that commute in this space of states with the Temperley-Lieb algebra that is generated by the set of nearest-neighbor interaction terms; A(2L) is not a Yangian. There are similar results for supersymmetric chains with gl(m+n|n) symmetry of nearest-neighbor interactions, and a richer representation structure for closed chains (i.e., periodic boundary conditions). The symmetries also apply to the loop models that can be obtained from the spin chains in a spacetime or transfer matrix picture. In the loop language, the symmetries arise because the loops cannot cross. We further define tensor products of representations (for the open chains) by joining chains end to end. The fusion rules for decomposing the tensor product of representations labeled j and j take the same form as the Clebsch-Gordan series for SU(2). This and other structures turn the symmetry algebra A into a ribbon Hopf algebra, and we show that this is "Morita equivalent" to the quantum group U(sl) for m=q+q. The open-chain results are extended to the cases |m|<2 for which the algebras are no longer semisimple; these possess continuum limits that are critical (conformal) field theories, or massive perturbations thereof. Such models, for open and closed boundary conditions, arise in connection with disordered fermions, percolation, and polymers (self-avoiding walks), and certain non-linear sigma models, all in two dimensions. A product operation is defined in a related way for the Temperley-Lieb representations also, and the fusion rules for this are related to those for A or U(sl) representations; this is useful for the continuum limits also, as we discuss in a companion paper.
State of research: environmental pathways and food chain transfer.
Vaughan, B E
1984-01-01
Data on the chemistry of biologically active components of petroleum, synthetic fuel oils, certain metal elements and pesticides provide valuable generic information needed for predicting the long-term fate of buried waste constituents and their likelihood of entering food chains. Components of such complex mixtures partition between solid and solution phases, influencing their mobility, volatility and susceptibility to microbial transformation. Estimating health hazards from indirect exposures to organic chemicals involves an ecosystem's approach to understanding the unique behavior of complex mixtures. Metabolism by microbial organisms fundamentally alters these complex mixtures as they move through food chains. Pathway modeling of organic chemicals must consider the nature and magnitude of food chain transfers to predict biological risk where metabolites may become more toxic than the parent compound. To obtain predictions, major areas are identified where data acquisition is essential to extend our radiological modeling experience to the field of organic chemical contamination. PMID:6428875
The gap of the area-weighted Motzkin spin chain is exponentially small
NASA Astrophysics Data System (ADS)
Levine, Lionel; Movassagh, Ramis
2017-06-01
We prove that the energy gap of the model proposed by Zhang et al (2016 arXiv:1606.07795) is exponentially small in the square of the system size. In Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA) a class of exactly solvable quantum spin chain models was proposed that have integer spins (s), with a nearest neighbors Hamiltonian, and a unique ground state. The ground state can be seen as a uniform superposition of all s-colored Motzkin walks. The half-chain entanglement entropy provably violates the area law by a square root factor in the system’s size (˜\\sqrt{n} ) for s > 1. For s = 1, the violation is logarithmic (Bravyi et al 2012 Phys. Rev. Lett. 109 207202). Moreover in Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA) it was proved that the gap vanishes polynomially and is O(n -c ) with c≥slant2 . Recently, a deformation of Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA), which we call ‘weighted Motzkin quantum spin chain’ was proposed Zhang et al (2016 arXiv:1606.07795). This model has a unique ground state that is a superposition of the s-colored Motzkin walks weighted by tarea\\{Motzkin walk\\} with t > 1. The most surprising feature of this model is that it violates the area law by a factor of n. Here we prove that the gap of this model is upper bounded by 8ns t-n2/3 for t > 1 and s > 1.
The design and analysis of mooring system
NASA Astrophysics Data System (ADS)
Li, Yixuan
2017-05-01
In this paper, the force status and a design method of single chain mooring system for shallow sea observation network are studied. With treating the link of a chain, steel drum and steel pipe as a rigid body, the recurrence model is established by using Newton's first law and the law of Moment equilibrium theorem. Via the simplified calculation of dichotomy searching, we determine the design parameters of mooring system, such as anchor model, anchor chain length, heavy ball quality under different water flow and wind conditions. We apply MATLAB to simulate the internal steady state of the system in the fixed scheme, water depth of buoy and swimming area to meet the decision-making needs, providing an idea for the actual scheme design of mooring system.
Controlling measurement-induced nonlocality in the Heisenberg XX model by three-spin interactions
NASA Astrophysics Data System (ADS)
Xie, Yu-Xia; Sun, Yu-Hang; Li, Zhao
2018-01-01
We investigate the well-defined measures of measurement-induced nonlocality (MIN) for thermal states of the transverse field XX model, with the addition of three-spin interaction terms being introduced. The results showed that the MINs are very sensitive to system parameters of the chain. The three-spin interactions can serve as flexible parameters for enhancing MINs of the boundary spins, and the maximum enhancement achievable by varying strengths of the three-spin interactions are different for the chain with different number of spins.
Quantum phase transitions in the S=(1)/(2) distorted diamond chain
NASA Astrophysics Data System (ADS)
Li, Yan-Chao; Li, Shu-Shen
2008-11-01
By means of the second derivative of the ground-state and first-excited energy, the quantum phase transitions (QPTs) for the distorted diamond chain (DDC) with ferromagnetic and antiferromagnetic frustrated interactions and the trimerized case are investigated, respectively. Our results show the plentiful quantum phases owing to the spin interaction competitions in the model. Meanwhile, by using the transfer-matrix renormalization-group technique, we study the two-site thermal entanglement of the DDC model in the thermodynamic limit for a further understanding of the QPTs.
Quantum gates controlled by spin chain soliton excitations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuccoli, Alessandro, E-mail: cuccoli@fi.infn.it; Istituto Nazionale di Fisica Nucleare, Sezione di Firenze, I-50019 Sesto Fiorentino; Nuzzi, Davide
2014-05-07
Propagation of soliton-like excitations along spin chains has been proposed as a possible way for transmitting both classical and quantum information between two distant parties with negligible dispersion and dissipation. In this work, a somewhat different use of solitons is considered. Solitons propagating along a spin chain realize an effective magnetic field, well localized in space and time, which can be exploited as a means to manipulate the state of an external spin (i.e., a qubit) that is weakly coupled to the chain. We have investigated different couplings between the qubit and the chain, as well as different soliton shapes,more » according to a Heisenberg chain model. It is found that symmetry properties strongly affect the effectiveness of the proposed scheme, and the most suitable setups for implementing single qubit quantum gates are singled out.« less
Quantum transverse-field Ising model on an infinite tree from matrix product states
NASA Astrophysics Data System (ADS)
Nagaj, Daniel; Farhi, Edward; Goldstone, Jeffrey; Shor, Peter; Sylvester, Igor
2008-06-01
We give a generalization to an infinite tree geometry of Vidal’s infinite time-evolving block decimation (iTEBD) algorithm [G. Vidal, Phys. Rev. Lett. 98, 070201 (2007)] for simulating an infinite line of quantum spins. We numerically investigate the quantum Ising model in a transverse field on the Bethe lattice using the matrix product state ansatz. We observe a second order phase transition, with certain key differences from the transverse field Ising model on an infinite spin chain. We also investigate a transverse field Ising model with a specific longitudinal field. When the transverse field is turned off, this model has a highly degenerate ground state as opposed to the pure Ising model whose ground state is only doubly degenerate.
Multivariate Markov chain modeling for stock markets
NASA Astrophysics Data System (ADS)
Maskawa, Jun-ichi
2003-06-01
We study a multivariate Markov chain model as a stochastic model of the price changes of portfolios in the framework of the mean field approximation. The time series of price changes are coded into the sequences of up and down spins according to their signs. We start with the discussion for small portfolios consisting of two stock issues. The generalization of our model to arbitrary size of portfolio is constructed by a recurrence relation. The resultant form of the joint probability of the stationary state coincides with Gibbs measure assigned to each configuration of spin glass model. Through the analysis of actual portfolios, it has been shown that the synchronization of the direction of the price changes is well described by the model.
NASA Astrophysics Data System (ADS)
Cohen, D.; Michlmayr, G.; Or, D.
2012-04-01
Shearing of dense granular materials appears in many engineering and Earth sciences applications. Under a constant strain rate, the shearing stress at steady state oscillates with slow rises followed by rapid drops that are linked to the build up and failure of force chains. Experiments indicate that these drops display exponential statistics. Measurements of acoustic emissions during shearing indicates that the energy liberated by failure of these force chains has power-law statistics. Representing force chains as fibers, we use a stick-slip fiber bundle model to obtain analytical solutions of the statistical distribution of stress drops and failure energy. In the model, fibers stretch, fail, and regain strength during deformation. Fibers have Weibull-distributed threshold strengths with either quenched and annealed disorder. The shape of the distribution for drops and energy obtained from the model are similar to those measured during shearing experiments. This simple model may be useful to identify failure events linked to force chain failures. Future generalizations of the model that include different types of fiber failure may also allow identification of different types of granular failures that have distinct statistical acoustic emission signatures.
Adequacy of Si:P chains as Fermi-Hubbard simulators
NASA Astrophysics Data System (ADS)
Dusko, Amintor; Delgado, Alain; Saraiva, André; Koiller, Belita
2018-01-01
The challenge of simulating many-body models with analogue physical systems requires both experimental precision and very low operational temperatures. Atomically precise placement of dopants in Si permits the construction of nanowires by design. We investigate the suitability of these interacting electron systems as simulators of a fermionic extended Hubbard model on demand. We describe the single-particle wavefunctions as a linear combination of dopant orbitals (LCDO). The electronic states are calculated within configuration interaction (CI). Due to the peculiar oscillatory behavior of each basis orbital, properties of these chains are strongly affected by the interdonor distance R0, in a non-monotonic way. Ground state (T = 0 K) properties such as charge and spin correlations are shown to remain robust under temperatures up to 4 K for specific values of R0. The robustness of the model against disorder is also tested, allowing some fluctuation of the placement site around the target position. We suggest that finite donor chains in Si may serve as an analog simulator for strongly correlated model Hamiltonians. This simulator is, in many ways, complementary to those based on cold atoms in optical lattices—the trade-off between the tunability achievable in the latter and the survival of correlation at higher operation temperatures for the former suggests that both technologies are applicable for different regimes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cirac, J. Ignacio; Sierra, German; Instituto de Fisica Teorica, UAM-CSIC, Madrid
We generalize the matrix product states method using the chiral vertex operators of conformal field theory and apply it to study the ground states of the XXZ spin chain, the J{sub 1}-J{sub 2} model and random Heisenberg models. We compute the overlap with the exact wave functions, spin-spin correlators, and the Renyi entropy, showing that critical systems can be described by this method. For rotational invariant ansatzs we construct an inhomogenous extension of the Haldane-Shastry model with long-range exchange interactions.
Scheidegger, Stephan; Fuchs, Hans U; Zaugg, Kathrin; Bodis, Stephan; Füchslin, Rudolf M
2013-01-01
In order to overcome the limitations of the linear-quadratic model and include synergistic effects of heat and radiation, a novel radiobiological model is proposed. The model is based on a chain of cell populations which are characterized by the number of radiation induced damages (hits). Cells can shift downward along the chain by collecting hits and upward by a repair process. The repair process is governed by a repair probability which depends upon state variables used for a simplistic description of the impact of heat and radiation upon repair proteins. Based on the parameters used, populations up to 4-5 hits are relevant for the calculation of the survival. The model describes intuitively the mathematical behaviour of apoptotic and nonapoptotic cell death. Linear-quadratic-linear behaviour of the logarithmic cell survival, fractionation, and (with one exception) the dose rate dependencies are described correctly. The model covers the time gap dependence of the synergistic cell killing due to combined application of heat and radiation, but further validation of the proposed approach based on experimental data is needed. However, the model offers a work bench for testing different biological concepts of damage induction, repair, and statistical approaches for calculating the variables of state.
General Entanglement Scaling Laws from Time Evolution
NASA Astrophysics Data System (ADS)
Eisert, Jens; Osborne, Tobias J.
2006-10-01
We establish a general scaling law for the entanglement of a large class of ground states and dynamically evolving states of quantum spin chains: we show that the geometric entropy of a distinguished block saturates, and hence follows an entanglement-boundary law. These results apply to any ground state of a gapped model resulting from dynamics generated by a local Hamiltonian, as well as, dually, to states that are generated via a sudden quench of an interaction as recently studied in the case of dynamics of quantum phase transitions. We achieve these results by exploiting ideas from quantum information theory and tools provided by Lieb-Robinson bounds. We also show that there exist noncritical fermionic systems and equivalent spin chains with rapidly decaying interactions violating this entanglement-boundary law. Implications for the classical simulatability are outlined.
Solution of the Lindblad equation for spin helix states.
Popkov, V; Schütz, G M
2017-04-01
Using Lindblad dynamics we study quantum spin systems with dissipative boundary dynamics that generate a stationary nonequilibrium state with a nonvanishing spin current that is locally conserved except at the boundaries. We demonstrate that with suitably chosen boundary target states one can solve the many-body Lindblad equation exactly in any dimension. As solution we obtain pure states at any finite value of the dissipation strength and any system size. They are characterized by a helical stationary magnetization profile and a ballistic spin current which is independent of system size, even when the quantum spin system is not integrable. These results are derived in explicit form for the one-dimensional spin-1/2 Heisenberg chain and its higher-spin generalizations, which include the integrable spin-1 Zamolodchikov-Fateev model and the biquadratic Heisenberg chain.
Graph state generation with noisy mirror-inverting spin chains
NASA Astrophysics Data System (ADS)
Clark, Stephen R.; Klein, Alexander; Bruderer, Martin; Jaksch, Dieter
2007-06-01
We investigate the influence of noise on a graph state generation scheme which exploits a mirror inverting spin chain. Within this scheme the spin chain is used repeatedly as an entanglement bus (EB) to create multi-partite entanglement. The noise model we consider comprises of each spin of this EB being exposed to independent local noise which degrades the capabilities of the EB. Here we concentrate on quantifying its performance as a single-qubit channel and as a mediator of a two-qubit entangling gate, since these are basic operations necessary for graph state generation using the EB. In particular, for the single-qubit case we numerically calculate the average channel fidelity and whether the channel becomes entanglement breaking, i.e. expunges any entanglement the transferred qubit may have with other external qubits. We find that neither local decay nor dephasing noise cause entanglement breaking. This is in contrast to local thermal and depolarizing noise where we determine a critical length and critical noise coupling, respectively, at which entanglement breaking occurs. The critical noise coupling for local depolarizing noise is found to exhibit a power-law dependence on the chain length. For two-qubits we similarly compute the average gate fidelity and whether the ability for this gate to create entanglement is maintained. The concatenation of these noisy gates for the construction of a five-qubit linear cluster state and a Greenberger Horne Zeilinger state indicates that the level of noise that can be tolerated for graph state generation is tightly constrained.
Recent theoretical advances on superradiant phase transitions
NASA Astrophysics Data System (ADS)
Baksic, Alexandre; Nataf, Pierre; Ciuti, Cristiano
2013-03-01
The Dicke model describing a single-mode boson field coupled to two-level systems is an important paradigm in quantum optics. In particular, the physics of ``superradiant phase transitions'' in the ultrastrong coupling regime is the subject of a vigorous research activity in both cavity and circuit QED. Recently, we explored the rich physics of two interesting generalizations of the Dicke model: (i) A model describing the coupling of a boson mode to two independent chains A and B of two-level systems, where chain A is coupled to one quadrature of the boson field and chain B to the orthogonal quadrature. This original model leads to a quantum phase transition with a double symmetry breaking and a fourfold ground state degeneracy. (ii) A generalized Dicke model with three-level systems including the diamagnetic term. In contrast to the case of two-level atoms for which no-go theorems exist, in the case of three-level system we prove that the Thomas-Reich-Kuhn sum rule does not always prevent a superradiant phase transition.
Markov switching multinomial logit model: An application to accident-injury severities.
Malyshkina, Nataliya V; Mannering, Fred L
2009-07-01
In this study, two-state Markov switching multinomial logit models are proposed for statistical modeling of accident-injury severities. These models assume Markov switching over time between two unobserved states of roadway safety as a means of accounting for potential unobserved heterogeneity. The states are distinct in the sense that in different states accident-severity outcomes are generated by separate multinomial logit processes. To demonstrate the applicability of the approach, two-state Markov switching multinomial logit models are estimated for severity outcomes of accidents occurring on Indiana roads over a four-year time period. Bayesian inference methods and Markov Chain Monte Carlo (MCMC) simulations are used for model estimation. The estimated Markov switching models result in a superior statistical fit relative to the standard (single-state) multinomial logit models for a number of roadway classes and accident types. It is found that the more frequent state of roadway safety is correlated with better weather conditions and that the less frequent state is correlated with adverse weather conditions.
On the polymer physics origins of protein folding thermodynamics.
Taylor, Mark P; Paul, Wolfgang; Binder, Kurt
2016-11-07
A remarkable feature of the spontaneous folding of many small proteins is the striking similarity in the thermodynamics of the folding process. This process is characterized by simple two-state thermodynamics with large and compensating changes in entropy and enthalpy and a funnel-like free energy landscape with a free-energy barrier that varies linearly with temperature. One might attribute the commonality of this two-state folding behavior to features particular to these proteins (e.g., chain length, hydrophobic/hydrophilic balance, attributes of the native state) or one might suspect that this similarity in behavior has a more general polymer-physics origin. Here we show that this behavior is also typical for flexible homopolymer chains with sufficiently short range interactions. Two-state behavior arises from the presence of a low entropy ground (folded) state separated from a set of high entropy disordered (unfolded) states by a free energy barrier. This homopolymer model exhibits a funneled free energy landscape that reveals a complex underlying dynamics involving competition between folding and non-folding pathways. Despite the presence of multiple pathways, this simple physics model gives the robust result of two-state thermodynamics for both the cases of folding from a basin of expanded coil states and from a basin of compact globule states.
On the polymer physics origins of protein folding thermodynamics
NASA Astrophysics Data System (ADS)
Taylor, Mark P.; Paul, Wolfgang; Binder, Kurt
2016-11-01
A remarkable feature of the spontaneous folding of many small proteins is the striking similarity in the thermodynamics of the folding process. This process is characterized by simple two-state thermodynamics with large and compensating changes in entropy and enthalpy and a funnel-like free energy landscape with a free-energy barrier that varies linearly with temperature. One might attribute the commonality of this two-state folding behavior to features particular to these proteins (e.g., chain length, hydrophobic/hydrophilic balance, attributes of the native state) or one might suspect that this similarity in behavior has a more general polymer-physics origin. Here we show that this behavior is also typical for flexible homopolymer chains with sufficiently short range interactions. Two-state behavior arises from the presence of a low entropy ground (folded) state separated from a set of high entropy disordered (unfolded) states by a free energy barrier. This homopolymer model exhibits a funneled free energy landscape that reveals a complex underlying dynamics involving competition between folding and non-folding pathways. Despite the presence of multiple pathways, this simple physics model gives the robust result of two-state thermodynamics for both the cases of folding from a basin of expanded coil states and from a basin of compact globule states.
Srai, Jagjit Singh; Badman, Clive; Krumme, Markus; Futran, Mauricio; Johnston, Craig
2015-01-01
This paper examines the opportunities and challenges facing the pharmaceutical industry in moving to a primarily “continuous processing”-based supply chain. The current predominantly “large batch” and centralized manufacturing system designed for the “blockbuster” drug has driven a slow-paced, inventory heavy operating model that is increasingly regarded as inflexible and unsustainable. Indeed, new markets and the rapidly evolving technology landscape will drive more product variety, shorter product life-cycles, and smaller drug volumes, which will exacerbate an already unsustainable economic model. Future supply chains will be required to enhance affordability and availability for patients and healthcare providers alike despite the increased product complexity. In this more challenging supply scenario, we examine the potential for a more pull driven, near real-time demand-based supply chain, utilizing continuous processing where appropriate as a key element of a more “flow-through” operating model. In this discussion paper on future supply chain models underpinned by developments in the continuous manufacture of pharmaceuticals, we have set out; The significant opportunities to moving to a supply chain flow-through operating model, with substantial opportunities in inventory reduction, lead-time to patient, and radically different product assurance/stability regimes. Scenarios for decentralized production models producing a greater variety of products with enhanced volume flexibility. Production, supply, and value chain footprints that are radically different from today's monolithic and centralized batch manufacturing operations. Clinical trial and drug product development cost savings that support more rapid scale-up and market entry models with early involvement of SC designers within New Product Development. The major supply chain and industrial transformational challenges that need to be addressed. The paper recognizes that although current batch operational performance in pharma is far from optimal and not necessarily an appropriate end-state benchmark for batch technology, the adoption of continuous supply chain operating models underpinned by continuous production processing, as full or hybrid solutions in selected product supply chains, can support industry transformations to deliver right-first-time quality at substantially lower inventory profiles. © 2015 The Authors. Journal of Pharmaceutical Sciences published by Wiley Periodicals, Inc. and the American Pharmacists Association J Pharm Sci 104:840–849, 2015 PMID:25631279
Singlet fission in linear chains of molecules
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ambrosio, Francesco, E-mail: F.Ambrosio@warwick.ac.uk, E-mail: A.Troisi@warwick.ac.uk; Troisi, Alessandro, E-mail: F.Ambrosio@warwick.ac.uk, E-mail: A.Troisi@warwick.ac.uk
2014-11-28
We develop a model configuration interaction Hamiltonian to study the electronic structure of a chain of molecules undergoing singlet fission. We first consider models for dimer and trimer and then we use a matrix partitioning technique to build models of arbitrary size able to describe the relevant electronic structure for singlet fission in linear aggregates. We find that the multi-excitonic state (ME) is stabilized at short inter-monomer distance and the extent of this stabilization depends upon the size of orbital coupling between neighboring monomers. We also find that the coupling between ME states located on different molecules is extremely smallmore » leading to bandwidths in the order of ∼10 meV. This observation suggests that multi-exciton states are extremely localized by electron-phonon coupling and that singlet fission involves the transition between a relatively delocalized Frenkel exciton and a strongly localized multi-exciton state. We adopt the methodology commonly used to study non-radiative transitions to describe the singlet fission dynamics in these aggregates and we discuss the limit of validity of the approach. The results indicate that the phenomenology of singlet fission in molecular crystals is different in many important ways from what is observed in isolated dimers.« less
On the inversion of the 1 Bu and 2 Ag electronic states in α,ω-diphenylpolyenes
NASA Astrophysics Data System (ADS)
Catalán, J.
2003-07-01
An alternative model to that of the inversion of the states 1Bu and 2Ag is proposed for interpreting the photophysics of the α,ω-diphenylpolyenes. This model is based upon the existence of two chemical structures with Bu symmetry, which may be ascribed to the same excited electronic state 1Bu. One of the two chemical structures corresponds to the Franck-Condon structure with conjugated single and double bonds for the polyene chain, and another consists of a nearly equivalent series of partial double bonds along the polyene chain. The latter relaxed structure is consistent with the observation of high torsional energy barriers and low photoisomerization quantum yields for diphenylhexatriene in the singlet excited state manifold. Interestingly, such a simple quantum model as that of the particle in a one-dimensional box provides quite an accurate description of the absorption spectroscopic properties of these major compounds. This is partly the result of the most stable structures for these compounds being of the all-trans type; such structures increase in length as additional ethylene units are added, which makes them very similar to a one-dimensional box becoming increasingly longer.
NASA Astrophysics Data System (ADS)
Shu, G. J.; Tian, J. C.; Lin, C. K.; Hayashi, M.; Liou, S. C.; Chen, W. T.; Wong, Deniz P.; Liou, H. L.; Chou, F. C.
2018-05-01
In this reply to the comment on ‘Oxygen vacancy-induced magnetic moment in edge-sharing CuO2 chains of {{{Li}}}2{{{CuO}}}2-δ ’ (2017 New Journal of Physics 19 023206), we have clarified several key questions and conflicting results regarding the size of the intra-chain nearest neighbor coupling J 1 and the sign of the Weiss temperature Θ defined in the Curie–Weiss law of χ(T) = χ ◦ + C/(T ‑ Θ). Additional data analysis is conducted to verify the validity of the Curie–Weiss law fitting protocol, including the negative sign and size of Θ based on the high-temperature linear temperature dependence of 1/χ(T) for T > J 1 and \\tfrac{g{μ }B{SH}}{{k}BT}\\ll 1. The consistency between the magnetic antiferromagnetic (AF) ground state below T N and the negative sign of Θ in the high-temperature paramagnetic (PM) state is explained via the reduction of thermal fluctuation for a temperature-independent local field due to magnetic interaction of quantum nature. A magnetic dipole–dipole (MDD)-type interaction among FM chains is identified and proposed to be necessary for the 3D AF magnetic ground state formation, i.e., the Heisenberg model of an exchange-type interaction alone is not sufficient to fully describe the quasi-1D spin chain system of {{{Li}}}2{{{CuO}}}2. Several typical quasi-1D spin chain compounds, including {{{Li}}}2{{{CuO}}}2,{{{CuAs}}}2{{{O}}}4,{{{Sr}}}3{{{Fe}}}2{{{O}}}5, and CuGeO3, are compared to show why different magnetic ground states are achieved from the chemical bond perspective.
Maximally reliable Markov chains under energy constraints.
Escola, Sean; Eisele, Michael; Miller, Kenneth; Paninski, Liam
2009-07-01
Signal-to-noise ratios in physical systems can be significantly degraded if the outputs of the systems are highly variable. Biological processes for which highly stereotyped signal generations are necessary features appear to have reduced their signal variabilities by employing multiple processing steps. To better understand why this multistep cascade structure might be desirable, we prove that the reliability of a signal generated by a multistate system with no memory (i.e., a Markov chain) is maximal if and only if the system topology is such that the process steps irreversibly through each state, with transition rates chosen such that an equal fraction of the total signal is generated in each state. Furthermore, our result indicates that by increasing the number of states, it is possible to arbitrarily increase the reliability of the system. In a physical system, however, an energy cost is associated with maintaining irreversible transitions, and this cost increases with the number of such transitions (i.e., the number of states). Thus, an infinite-length chain, which would be perfectly reliable, is infeasible. To model the effects of energy demands on the maximally reliable solution, we numerically optimize the topology under two distinct energy functions that penalize either irreversible transitions or incommunicability between states, respectively. In both cases, the solutions are essentially irreversible linear chains, but with upper bounds on the number of states set by the amount of available energy. We therefore conclude that a physical system for which signal reliability is important should employ a linear architecture, with the number of states (and thus the reliability) determined by the intrinsic energy constraints of the system.
Chain of point-like potentials in Script R3 and infiniteness of the number of bound states
NASA Astrophysics Data System (ADS)
Boitsev, A. A.; Popov, I. Yu; Sokolov, O. V.
2014-10-01
Infinite chain of point-like potentials having the Hamiltonian with infinite number of eigenvalues below the continuous spectrum is constructed. The background of the model is the theory of self-adjoint extensions of symmetric operators in the Hilbert space. The analogous example of the Hamiltonian is obtained for the system of three-dimensional waveguides coupled through point-like windows.
Simple Model of Sickle Hemoglobin
NASA Astrophysics Data System (ADS)
Shiryayev, Andrey; Li, Xiaofei; Gunton, James
2006-03-01
A microscopic model is proposed for the interactions between sickle hemoglobin molecules based on information from the protein data bank. A Monte Carlo simulation of a simplified two patch model is carried out, with the goal of understanding fiber formation. A gradual transition from monomers to one dimensional chains is observed as one varies the density of molecules at fixed temperature, somewhat similar to the transition from monomers to polymer fibers in sickle hemoglobin molecules in solution. An observed competition between chain formation and crystallization for the model is also discussed. The results of the simulation of the equation of state are shown to be in excellent agreement with a theory for a model of globular proteins, for the case of two interacting sites.
Snipas, Mindaugas; Pranevicius, Henrikas; Pranevicius, Mindaugas; Pranevicius, Osvaldas; Paulauskas, Nerijus; Bukauskas, Feliksas F
2015-01-01
The primary goal of this work was to study advantages of numerical methods used for the creation of continuous time Markov chain models (CTMC) of voltage gating of gap junction (GJ) channels composed of connexin protein. This task was accomplished by describing gating of GJs using the formalism of the stochastic automata networks (SANs), which allowed for very efficient building and storing of infinitesimal generator of the CTMC that allowed to produce matrices of the models containing a distinct block structure. All of that allowed us to develop efficient numerical methods for a steady-state solution of CTMC models. This allowed us to accelerate CPU time, which is necessary to solve CTMC models, ~20 times.
Non-Fermi-Liquid Behavior in Transport Through Co-Doped Au Chains
NASA Astrophysics Data System (ADS)
Di Napoli, S.; Weichselbaum, A.; Roura-Bas, P.; Aligia, A. A.; Mokrousov, Y.; Blügel, S.
2013-05-01
We calculate the conductance as a function of temperature G(T) through Au monatomic chains containing one Co atom as a magnetic impurity, and connected to two conducting leads with a fourfold symmetry axis. Using the information derived from ab initio calculations, we construct an effective model H^eff that hybridizes a 3d7 quadruplet at the Co site with two 3d8 triplets through the hopping of 5dxz and 5dyz electrons of Au. The quadruplet is split by spin anisotropy due to spin-orbit coupling. Solving H^eff with the numerical renormalization group we find that at low temperatures G(T)=a-bT and the ground state impurity entropy is ln(2)/2, a behavior similar to the two-channel Kondo model. Stretching the chain leads to a non-Kondo phase, with the physics of the underscreened Kondo model at the quantum critical point.
Busch, Florian A
2014-02-01
Guard cells regulate CO2 uptake and water loss of a leaf by controlling stomatal movement in response to environmental factors such as CO2, humidity, and light. The mechanisms by which stomata respond to red light are actively debated in the literature, and even after decades of research it is still controversial whether stomatal movement is related to photosynthesis or not. This review summarizes the current knowledge of the red-light response of stomata. A comparison of published evidence suggests that stomatal movement is controlled by the redox state of photosynthetic electron transport chain components, in particular the redox state of plastoquinone. Potential consequences for the modeling of stomatal conductance are discussed.
Markov chain aggregation and its applications to combinatorial reaction networks.
Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz
2014-09-01
We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohiyaddin, Fahd A.; Kalra, Rachpon; Laucht, Arne
The ability to transport quantum information across some distance can facilitate the design and operation of a quantum processor. One-dimensional spin chains provide a compact platform to realize scalable spin transport for a solid-state quantum computer. Here, we model odd-sized donor chains in silicon under a range of experimental nonidealities, including variability of donor position within the chain. We show that the tolerance against donor placement inaccuracies is greatly improved by operating the spin chain in a mode where the electrons are confined at the Si-SiO 2 interface. We then estimate the required time scales and exchange couplings, and themore » level of noise that can be tolerated to achieve high-fidelity transport. As a result, we also propose a protocol to calibrate and initialize the chain, thereby providing a complete guideline for realizing a functional donor chain and utilizing it for spin transport.« less
Markov Chain Ontology Analysis (MCOA)
2012-01-01
Background Biomedical ontologies have become an increasingly critical lens through which researchers analyze the genomic, clinical and bibliographic data that fuels scientific research. Of particular relevance are methods, such as enrichment analysis, that quantify the importance of ontology classes relative to a collection of domain data. Current analytical techniques, however, remain limited in their ability to handle many important types of structural complexity encountered in real biological systems including class overlaps, continuously valued data, inter-instance relationships, non-hierarchical relationships between classes, semantic distance and sparse data. Results In this paper, we describe a methodology called Markov Chain Ontology Analysis (MCOA) and illustrate its use through a MCOA-based enrichment analysis application based on a generative model of gene activation. MCOA models the classes in an ontology, the instances from an associated dataset and all directional inter-class, class-to-instance and inter-instance relationships as a single finite ergodic Markov chain. The adjusted transition probability matrix for this Markov chain enables the calculation of eigenvector values that quantify the importance of each ontology class relative to other classes and the associated data set members. On both controlled Gene Ontology (GO) data sets created with Escherichia coli, Drosophila melanogaster and Homo sapiens annotations and real gene expression data extracted from the Gene Expression Omnibus (GEO), the MCOA enrichment analysis approach provides the best performance of comparable state-of-the-art methods. Conclusion A methodology based on Markov chain models and network analytic metrics can help detect the relevant signal within large, highly interdependent and noisy data sets and, for applications such as enrichment analysis, has been shown to generate superior performance on both real and simulated data relative to existing state-of-the-art approaches. PMID:22300537
Markov Chain Ontology Analysis (MCOA).
Frost, H Robert; McCray, Alexa T
2012-02-03
Biomedical ontologies have become an increasingly critical lens through which researchers analyze the genomic, clinical and bibliographic data that fuels scientific research. Of particular relevance are methods, such as enrichment analysis, that quantify the importance of ontology classes relative to a collection of domain data. Current analytical techniques, however, remain limited in their ability to handle many important types of structural complexity encountered in real biological systems including class overlaps, continuously valued data, inter-instance relationships, non-hierarchical relationships between classes, semantic distance and sparse data. In this paper, we describe a methodology called Markov Chain Ontology Analysis (MCOA) and illustrate its use through a MCOA-based enrichment analysis application based on a generative model of gene activation. MCOA models the classes in an ontology, the instances from an associated dataset and all directional inter-class, class-to-instance and inter-instance relationships as a single finite ergodic Markov chain. The adjusted transition probability matrix for this Markov chain enables the calculation of eigenvector values that quantify the importance of each ontology class relative to other classes and the associated data set members. On both controlled Gene Ontology (GO) data sets created with Escherichia coli, Drosophila melanogaster and Homo sapiens annotations and real gene expression data extracted from the Gene Expression Omnibus (GEO), the MCOA enrichment analysis approach provides the best performance of comparable state-of-the-art methods. A methodology based on Markov chain models and network analytic metrics can help detect the relevant signal within large, highly interdependent and noisy data sets and, for applications such as enrichment analysis, has been shown to generate superior performance on both real and simulated data relative to existing state-of-the-art approaches.
Charge and Spin Dynamics of the Hubbard Chains
NASA Technical Reports Server (NTRS)
Park, Youngho; Liang, Shoudan
1999-01-01
We calculate the local correlation functions of charge and spin for the one-chain and two-chain Hubbard model using density matrix renormalization group method and the recursion technique. Keeping only finite number of states we get good accuracy for the low energy excitations. We study the charge and spin gaps, bandwidths and weights of the spectra for various values of the on-site Coulomb interaction U and the electron filling. In the low energy part, the local correlation functions are different for the charge and spin. The bandwidths are proportional to t for the charge and J for the spin respectively.
Growing ethanol sector drives corn supply chain shift for the last decade
NASA Astrophysics Data System (ADS)
Kim, T.; Schmitt, J.; Brauman, K. A.; Smith, T. M.; Suh, K.
2017-12-01
The US is the largest producer in the world, 89% of corn production uses in domestic demands in 2012. Carbon emission and irrigated water usage in the corn farming stage are hot-spot in the meat production sectors, comprise 37% of all US corn demand. The annual capacity of the ethanol sector increases from 6.5 billion gallons to 15.3 billion gallons for the last decade. The growth of corn demand in ethanol sector makes corn supply chain shift. Most of the ethanol plants located in the Mid-west where is the top 12 corn producing states. Therefore animal feeds take more supply from the other states. The purpose of this study is to estimate environmental impacts and water scarcity associated embedded corn by the temporal and spatial corn supply chain model based on a cost minimization. We use publicly available county-level data on corn production, feed demands, aggregative carbon emission and irrigated water usage in farming state, and a water depletion index as a metric for determining water scarcity. The water stressed counties produce 23.3% of US total corn production in 2012, and the irrigated corn is 14.2%. We simulated the corn supply chain using linear programming and developed the web-based visualization tools called FoodS3 (Food Systems Supply-chain Sustainability tool, http://foods3.org).
Study of ordered hadron chains with the ATLAS detector
NASA Astrophysics Data System (ADS)
Aaboud, M.; Aad, G.; Abbott, B.; Abdinov, O.; Abeloos, B.; Abidi, S. H.; Abouzeid, O. S.; Abraham, N. L.; Abramowicz, H.; Abreu, H.; Abreu, R.; Abulaiti, Y.; Acharya, B. S.; Adachi, S.; Adamczyk, L.; Adelman, J.; Adersberger, M.; Adye, T.; Affolder, A. A.; Afik, Y.; Agatonovic-Jovin, T.; Agheorghiesei, C.; Aguilar-Saavedra, J. A.; Ahlen, S. P.; Ahmadov, F.; Aielli, G.; Akatsuka, S.; Akerstedt, H.; Åkesson, T. P. A.; Akilli, E.; Akimov, A. V.; Alberghi, G. L.; Albert, J.; Albicocco, P.; Alconada Verzini, M. J.; Alderweireldt, S. C.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexopoulos, T.; Alhroob, M.; Ali, B.; Aliev, M.; Alimonti, G.; Alison, J.; Alkire, S. P.; Allbrooke, B. M. M.; Allen, B. W.; Allport, P. P.; Aloisio, A.; Alonso, A.; Alonso, F.; Alpigiani, C.; Alshehri, A. A.; Alstaty, M. I.; Alvarez Gonzalez, B.; Álvarez Piqueras, D.; Alviggi, M. G.; Amadio, B. T.; Amaral Coutinho, Y.; Amelung, C.; Amidei, D.; Amor Dos Santos, S. P.; Amoroso, S.; Amundsen, G.; Anastopoulos, C.; Ancu, L. S.; Andari, N.; Andeen, T.; Anders, C. F.; Anders, J. K.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Angelidakis, S.; Angelozzi, I.; Angerami, A.; Anisenkov, A. V.; Anjos, N.; Annovi, A.; Antel, C.; Antonelli, M.; Antonov, A.; Antrim, D. J.; Anulli, F.; Aoki, M.; Aperio Bella, L.; Arabidze, G.; Arai, Y.; Araque, J. P.; Araujo Ferraz, V.; Arce, A. T. H.; Ardell, R. E.; Arduh, F. A.; Arguin, J.-F.; Argyropoulos, S.; Arik, M.; Armbruster, A. J.; Armitage, L. J.; Arnaez, O.; Arnold, H.; Arratia, M.; Arslan, O.; Artamonov, A.; Artoni, G.; Artz, S.; Asai, S.; Asbah, N.; Ashkenazi, A.; Asquith, L.; Assamagan, K.; Astalos, R.; Atkinson, M.; Atlay, N. B.; Augsten, K.; Avolio, G.; Axen, B.; Ayoub, M. K.; Azuelos, G.; Baas, A. E.; Baca, M. J.; Bachacou, H.; Bachas, K.; Backes, M.; Bagnaia, P.; Bahmani, M.; Bahrasemani, H.; Baines, J. T.; Bajic, M.; Baker, O. K.; Baldin, E. M.; Balek, P.; Balli, F.; Balunas, W. K.; Banas, E.; Bandyopadhyay, A.; Banerjee, Sw.; Bannoura, A. A. E.; Barak, L.; Barberio, E. L.; Barberis, D.; Barbero, M.; Barillari, T.; Barisits, M.-S.; Barkeloo, J. T.; Barklow, T.; Barlow, N.; Barnes, S. L.; Barnett, B. M.; Barnett, R. M.; Barnovska-Blenessy, Z.; Baroncelli, A.; Barone, G.; Barr, A. J.; Barranco Navarro, L.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Bartoldus, R.; Barton, A. E.; Bartos, P.; Basalaev, A.; Bassalat, A.; Bates, R. L.; Batista, S. J.; Batley, J. R.; Battaglia, M.; Bauce, M.; Bauer, F.; Bawa, H. S.; Beacham, J. B.; Beattie, M. D.; Beau, T.; Beauchemin, P. H.; Bechtle, P.; Beck, H. P.; Beck, H. C.; Becker, K.; Becker, M.; Becot, C.; Beddall, A. J.; Beddall, A.; Bednyakov, V. A.; Bedognetti, M.; Bee, C. P.; Beermann, T. A.; Begalli, M.; Begel, M.; Behr, J. K.; Bell, A. S.; Bella, G.; Bellagamba, L.; Bellerive, A.; Bellomo, M.; Belotskiy, K.; Beltramello, O.; Belyaev, N. L.; Benary, O.; Benchekroun, D.; Bender, M.; Bendtz, K.; Benekos, N.; Benhammou, Y.; Benhar Noccioli, E.; Benitez, J.; Benjamin, D. P.; Benoit, M.; Bensinger, J. R.; Bentvelsen, S.; Beresford, L.; Beretta, M.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Beringer, J.; Berlendis, S.; Bernard, N. R.; Bernardi, G.; Bernius, C.; Bernlochner, F. U.; Berry, T.; Berta, P.; Bertella, C.; Bertoli, G.; Bertolucci, F.; Bertram, I. A.; Bertsche, C.; Bertsche, D.; Besjes, G. J.; Bessidskaia Bylund, O.; Bessner, M.; Besson, N.; Betancourt, C.; Bethani, A.; Bethke, S.; Bevan, A. J.; Beyer, J.; Bianchi, R. M.; Biebel, O.; Biedermann, D.; Bielski, R.; Bierwagen, K.; Biesuz, N. V.; Biglietti, M.; Billoud, T. R. V.; Bilokon, H.; Bindi, M.; Bingul, A.; Bini, C.; Biondi, S.; Bisanz, T.; Bittrich, C.; Bjergaard, D. M.; Black, J. E.; Black, K. M.; Blair, R. E.; Blazek, T.; Bloch, I.; Blocker, C.; Blue, A.; Blum, W.; Blumenschein, U.; Blunier, S.; Bobbink, G. J.; Bobrovnikov, V. S.; Bocchetta, S. S.; Bocci, A.; Bock, C.; Boehler, M.; Boerner, D.; Bogavac, D.; Bogdanchikov, A. G.; Bohm, C.; Boisvert, V.; Bokan, P.; Bold, T.; Boldyrev, A. S.; Bolz, A. E.; Bomben, M.; Bona, M.; Boonekamp, M.; Borisov, A.; Borissov, G.; Bortfeldt, J.; Bortoletto, D.; Bortolotto, V.; Boscherini, D.; Bosman, M.; Bossio Sola, J. D.; Boudreau, J.; Bouffard, J.; Bouhova-Thacker, E. V.; Boumediene, D.; Bourdarios, C.; Boutle, S. K.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bracinik, J.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Breaden Madden, W. D.; Brendlinger, K.; Brennan, A. J.; Brenner, L.; Brenner, R.; Bressler, S.; Briglin, D. L.; Bristow, T. M.; Britton, D.; Britzger, D.; Brochu, F. M.; Brock, I.; Brock, R.; Brooijmans, G.; Brooks, T.; Brooks, W. K.; Brosamer, J.; Brost, E.; Broughton, J. H.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruni, A.; Bruni, G.; Bruni, L. S.; Brunt, Bh; Bruschi, M.; Bruscino, N.; Bryant, P.; Bryngemark, L.; Buanes, T.; Buat, Q.; Buchholz, P.; Buckley, A. G.; Budagov, I. A.; Buehrer, F.; Bugge, M. K.; Bulekov, O.; Bullock, D.; Burch, T. J.; Burdin, S.; Burgard, C. D.; Burger, A. M.; Burghgrave, B.; Burka, K.; Burke, S.; Burmeister, I.; Burr, J. T. P.; Busato, E.; Büscher, D.; Büscher, V.; Bussey, P.; Butler, J. M.; Buttar, C. M.; Butterworth, J. M.; Butti, P.; Buttinger, W.; Buzatu, A.; Buzykaev, A. R.; Cabrera Urbán, S.; Caforio, D.; Cairo, V. M.; Cakir, O.; Calace, N.; Calafiura, P.; Calandri, A.; Calderini, G.; Calfayan, P.; Callea, G.; Caloba, L. P.; Calvente Lopez, S.; Calvet, D.; Calvet, S.; Calvet, T. P.; Camacho Toro, R.; Camarda, S.; Camarri, P.; Cameron, D.; Caminal Armadans, R.; Camincher, C.; Campana, S.; Campanelli, M.; Camplani, A.; Campoverde, A.; Canale, V.; Cano Bret, M.; Cantero, J.; Cao, T.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Carbone, R. M.; Cardarelli, R.; Cardillo, F.; Carli, I.; Carli, T.; Carlino, G.; Carlson, B. T.; Carminati, L.; Carney, R. M. D.; Caron, S.; Carquin, E.; Carrá, S.; Carrillo-Montoya, G. D.; Casadei, D.; Casado, M. P.; Casolino, M.; Casper, D. W.; Castelijn, R.; Castillo Gimenez, V.; Castro, N. F.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Caudron, J.; Cavaliere, V.; Cavallaro, E.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Celebi, E.; Ceradini, F.; Cerda Alberich, L.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cervelli, A.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chan, S. K.; Chan, W. S.; Chan, Y. L.; Chang, P.; Chapman, J. D.; Charlton, D. G.; Chau, C. C.; Chavez Barajas, C. A.; Che, S.; Cheatham, S.; Chegwidden, A.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chelstowska, M. A.; Chen, C.; Chen, H.; Chen, J.; Chen, S.; Chen, S.; Chen, X.; Chen, Y.; Cheng, H. C.; Cheng, H. J.; Cheplakov, A.; Cheremushkina, E.; Cherkaoui El Moursli, R.; Cheu, E.; Cheung, K.; Chevalier, L.; Chiarella, V.; Chiarelli, G.; Chiodini, G.; Chisholm, A. S.; Chitan, A.; Chiu, Y. H.; Chizhov, M. V.; Choi, K.; Chomont, A. R.; Chouridou, S.; Chow, Y. S.; Christodoulou, V.; Chu, M. C.; Chudoba, J.; Chuinard, A. J.; Chwastowski, J. J.; Chytka, L.; Ciftci, A. K.; Cinca, D.; Cindro, V.; Cioara, I. A.; Ciocca, C.; Ciocio, A.; Cirotto, F.; Citron, Z. H.; Citterio, M.; Ciubancan, M.; Clark, A.; Clark, B. L.; Clark, M. R.; Clark, P. J.; Clarke, R. N.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Colasurdo, L.; Cole, B.; Colijn, A. P.; Collot, J.; Colombo, T.; Conde Muiño, P.; Coniavitis, E.; Connell, S. H.; Connelly, I. A.; Constantinescu, S.; Conti, G.; Conventi, F.; Cooke, M.; Cooper-Sarkar, A. M.; Cormier, F.; Cormier, K. J. R.; Corradi, M.; Corriveau, F.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Cottin, G.; Cowan, G.; Cox, B. E.; Cranmer, K.; Crawley, S. J.; Creager, R. A.; Cree, G.; Crépé-Renaudin, S.; Crescioli, F.; Cribbs, W. A.; Cristinziani, M.; Croft, V.; Crosetti, G.; Cueto, A.; Cuhadar Donszelmann, T.; Cukierman, A. R.; Cummings, J.; Curatolo, M.; Cúth, J.; Czekierda, S.; Czodrowski, P.; D'Amen, G.; D'Auria, S.; D'Eramo, L.; D'Onofrio, M.; da Cunha Sargedas de Sousa, M. J.; da Via, C.; Dabrowski, W.; Dado, T.; Dai, T.; Dale, O.; Dallaire, F.; Dallapiccola, C.; Dam, M.; Dandoy, J. R.; Daneri, M. F.; Dang, N. P.; Daniells, A. C.; Dann, N. S.; Danninger, M.; Dano Hoffmann, M.; Dao, V.; Darbo, G.; Darmora, S.; Dassoulas, J.; Dattagupta, A.; Daubney, T.; Davey, W.; David, C.; Davidek, T.; Davis, D. R.; Davison, P.; Dawe, E.; Dawson, I.; de, K.; de Asmundis, R.; de Benedetti, A.; de Castro, S.; de Cecco, S.; de Groot, N.; de Jong, P.; de la Torre, H.; de Lorenzi, F.; de Maria, A.; de Pedis, D.; de Salvo, A.; de Sanctis, U.; de Santo, A.; de Vasconcelos Corga, K.; de Vivie de Regie, J. B.; Debbe, R.; Debenedetti, C.; Dedovich, D. V.; Dehghanian, N.; Deigaard, I.; Del Gaudio, M.; Del Peso, J.; Delgove, D.; Deliot, F.; Delitzsch, C. M.; Dell'Acqua, A.; Dell'Asta, L.; Dell'Orso, M.; Della Pietra, M.; Della Volpe, D.; Delmastro, M.; Delporte, C.; Delsart, P. A.; Demarco, D. A.; Demers, S.; Demichev, M.; Demilly, A.; Denisov, S. P.; Denysiuk, D.; Derendarz, D.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deterre, C.; Dette, K.; Devesa, M. R.; Deviveiros, P. O.; Dewhurst, A.; Dhaliwal, S.; di Bello, F. A.; di Ciaccio, A.; di Ciaccio, L.; di Clemente, W. K.; di Donato, C.; di Girolamo, A.; di Girolamo, B.; di Micco, B.; di Nardo, R.; di Petrillo, K. F.; di Simone, A.; di Sipio, R.; di Valentino, D.; Diaconu, C.; Diamond, M.; Dias, F. A.; Diaz, M. A.; Diehl, E. B.; Dietrich, J.; Díez Cornell, S.; Dimitrievska, A.; Dingfelder, J.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djobava, T.; Djuvsland, J. I.; Do Vale, M. A. B.; Dobos, D.; Dobre, M.; Doglioni, C.; Dolejsi, J.; Dolezal, Z.; Donadelli, M.; Donati, S.; Dondero, P.; Donini, J.; Dopke, J.; Doria, A.; Dova, M. T.; Doyle, A. T.; Drechsler, E.; Dris, M.; Du, Y.; Duarte-Campderros, J.; Dubreuil, A.; Duchovni, E.; Duckeck, G.; Ducourthial, A.; Ducu, O. A.; Duda, D.; Dudarev, A.; Dudder, A. Chr.; Duffield, E. M.; Duflot, L.; Dührssen, M.; Dumancic, M.; Dumitriu, A. E.; Duncan, A. K.; Dunford, M.; Duran Yildiz, H.; Düren, M.; Durglishvili, A.; Duschinger, D.; Dutta, B.; Dyndal, M.; Dziedzic, B. S.; Eckardt, C.; Ecker, K. M.; Edgar, R. C.; Eifert, T.; Eigen, G.; Einsweiler, K.; Ekelof, T.; El Kacimi, M.; El Kosseifi, R.; Ellajosyula, V.; Ellert, M.; Elles, S.; Ellinghaus, F.; Elliot, A. A.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Enari, Y.; Endner, O. C.; Ennis, J. S.; Erdmann, J.; Ereditato, A.; Ernst, M.; Errede, S.; Escalier, M.; Escobar, C.; Esposito, B.; Estrada Pastor, O.; Etienvre, A. I.; Etzion, E.; Evans, H.; Ezhilov, A.; Ezzi, M.; Fabbri, F.; Fabbri, L.; Fabiani, V.; Facini, G.; Fakhrutdinov, R. M.; Falciano, S.; Falla, R. J.; Faltova, J.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farina, C.; Farina, E. M.; Farooque, T.; Farrell, S.; Farrington, S. M.; Farthouat, P.; Fassi, F.; Fassnacht, P.; Fassouliotis, D.; Faucci Giannelli, M.; Favareto, A.; Fawcett, W. J.; Fayard, L.; Fedin, O. L.; Fedorko, W.; Feigl, S.; Feligioni, L.; Feng, C.; Feng, E. J.; Feng, H.; Fenton, M. J.; Fenyuk, A. B.; Feremenga, L.; Fernandez Martinez, P.; Fernandez Perez, S.; Ferrando, J.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferreira de Lima, D. E.; Ferrer, A.; Ferrere, D.; Ferretti, C.; Fiedler, F.; Filipčič, A.; Filipuzzi, M.; Filthaut, F.; Fincke-Keeler, M.; Finelli, K. D.; Fiolhais, M. C. N.; Fiorini, L.; Fischer, A.; Fischer, C.; Fischer, J.; Fisher, W. C.; Flaschel, N.; Fleck, I.; Fleischmann, P.; Fletcher, R. R. M.; Flick, T.; Flierl, B. M.; Flores Castillo, L. R.; Flowerdew, M. J.; Forcolin, G. T.; Formica, A.; Förster, F. A.; Forti, A.; Foster, A. G.; Fournier, D.; Fox, H.; Fracchia, S.; Francavilla, P.; Franchini, M.; Franchino, S.; Francis, D.; Franconi, L.; Franklin, M.; Frate, M.; Fraternali, M.; Freeborn, D.; Fressard-Batraneanu, S. M.; Freund, B.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fusayasu, T.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gabrielli, A.; Gabrielli, A.; Gach, G. P.; Gadatsch, S.; Gadomski, S.; Gagliardi, G.; Gagnon, L. G.; Galea, C.; Galhardo, B.; Gallas, E. J.; Gallop, B. J.; Gallus, P.; Galster, G.; Gan, K. K.; Ganguly, S.; Gao, Y.; Gao, Y. S.; Garay Walls, F. M.; García, C.; García Navarro, J. E.; García Pascual, J. A.; Garcia-Sciveres, M.; Gardner, R. W.; Garelli, N.; Garonne, V.; Gascon Bravo, A.; Gasnikova, K.; Gatti, C.; Gaudiello, A.; Gaudio, G.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Gee, C. N. P.; Geisen, J.; Geisen, M.; Geisler, M. P.; Gellerstedt, K.; Gemme, C.; Genest, M. H.; Geng, C.; Gentile, S.; Gentsos, C.; George, S.; Gerbaudo, D.; Gershon, A.; Geßner, G.; Ghasemi, S.; Ghneimat, M.; Giacobbe, B.; Giagu, S.; Giangiacomi, N.; Giannetti, P.; Gibson, S. M.; Gignac, M.; Gilchriese, M.; Gillberg, D.; Gilles, G.; Gingrich, D. M.; Giordani, M. P.; Giorgi, F. M.; Giraud, P. F.; Giromini, P.; Giugliarelli, G.; Giugni, D.; Giuli, F.; Giuliani, C.; Giulini, M.; Gjelsten, B. K.; Gkaitatzis, S.; Gkialas, I.; Gkougkousis, E. L.; Gkountoumis, P.; Gladilin, L. K.; Glasman, C.; Glatzer, J.; Glaysher, P. C. F.; Glazov, A.; Goblirsch-Kolb, M.; Godlewski, J.; Goldfarb, S.; Golling, T.; Golubkov, D.; Gomes, A.; Gonçalo, R.; Goncalves Gama, R.; Goncalves Pinto Firmino da Costa, J.; Gonella, G.; Gonella, L.; Gongadze, A.; González de La Hoz, S.; Gonzalez-Sevilla, S.; Goossens, L.; Gorbounov, P. A.; Gordon, H. A.; Gorelov, I.; Gorini, B.; Gorini, E.; Gorišek, A.; Goshaw, A. T.; Gössling, C.; Gostkin, M. I.; Gottardo, C. A.; Goudet, C. R.; Goujdami, D.; Goussiou, A. G.; Govender, N.; Gozani, E.; Graber, L.; Grabowska-Bold, I.; Gradin, P. O. J.; Gramling, J.; Gramstad, E.; Grancagnolo, S.; Gratchev, V.; Gravila, P. M.; Gray, C.; Gray, H. M.; Greenwood, Z. D.; Grefe, C.; Gregersen, K.; Gregor, I. M.; Grenier, P.; Grevtsov, K.; Griffiths, J.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Gris, Ph.; Grivaz, J.-F.; Groh, S.; Gross, E.; Grosse-Knetter, J.; Grossi, G. C.; Grout, Z. J.; Grummer, A.; Guan, L.; Guan, W.; Guenther, J.; Guescini, F.; Guest, D.; Gueta, O.; Gui, B.; Guido, E.; Guillemin, T.; Guindon, S.; Gul, U.; Gumpert, C.; Guo, J.; Guo, W.; Guo, Y.; Gupta, R.; Gupta, S.; Gustavino, G.; Gutelman, B. J.; Gutierrez, P.; Gutierrez Ortiz, N. G.; Gutschow, C.; Guyot, C.; Guzik, M. P.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haber, C.; Hadavand, H. K.; Haddad, N.; Hadef, A.; Hageböck, S.; Hagihara, M.; Hakobyan, H.; Haleem, M.; Haley, J.; Halladjian, G.; Hallewell, G. D.; Hamacher, K.; Hamal, P.; Hamano, K.; Hamilton, A.; Hamity, G. N.; Hamnett, P. G.; Han, L.; Han, S.; Hanagaki, K.; Hanawa, K.; Hance, M.; Haney, B.; Hanke, P.; Hansen, J. B.; Hansen, J. D.; Hansen, M. C.; Hansen, P. H.; Hara, K.; Hard, A. S.; Harenberg, T.; Hariri, F.; Harkusha, S.; Harrington, R. D.; Harrison, P. F.; Hartmann, N. M.; Hasegawa, Y.; Hasib, A.; Hassani, S.; Haug, S.; Hauser, R.; Hauswald, L.; Havener, L. B.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hayakawa, D.; Hayden, D.; Hays, C. P.; Hays, J. M.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Heck, T.; Hedberg, V.; Heelan, L.; Heer, S.; Heidegger, K. K.; Heim, S.; Heim, T.; Heinemann, B.; Heinrich, J. J.; Heinrich, L.; Heinz, C.; Hejbal, J.; Helary, L.; Held, A.; Hellman, S.; Helsens, C.; Henderson, R. C. W.; Heng, Y.; Henkelmann, S.; Henriques Correia, A. M.; Henrot-Versille, S.; Herbert, G. H.; Herde, H.; Herget, V.; Hernández Jiménez, Y.; Herr, H.; Herten, G.; Hertenberger, R.; Hervas, L.; Herwig, T. C.; Hesketh, G. G.; Hessey, N. P.; Hetherly, J. W.; Higashino, S.; Higón-Rodriguez, E.; Hildebrand, K.; Hill, E.; Hill, J. C.; Hiller, K. H.; Hillier, S. J.; Hils, M.; Hinchliffe, I.; Hirose, M.; Hirschbuehl, D.; Hiti, B.; Hladik, O.; Hoad, X.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoenig, F.; Hohn, D.; Holmes, T. R.; Homann, M.; Honda, S.; Honda, T.; Hong, T. M.; Hooberman, B. H.; Hopkins, W. H.; Horii, Y.; Horton, A. J.; Hostachy, J.-Y.; Hou, S.; Hoummada, A.; Howarth, J.; Hoya, J.; Hrabovsky, M.; Hrdinka, J.; Hristova, I.; Hrivnac, J.; Hryn'ova, T.; Hrynevich, A.; Hsu, P. J.; Hsu, S.-C.; Hu, Q.; Hu, S.; Huang, Y.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Huffman, T. B.; Hughes, E. W.; Hughes, G.; Huhtinen, M.; Huo, P.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Idrissi, Z.; Iengo, P.; Igonkina, O.; Iizawa, T.; Ikegami, Y.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ilic, N.; Introzzi, G.; Ioannou, P.; Iodice, M.; Iordanidou, K.; Ippolito, V.; Isacson, M. F.; Ishijima, N.; Ishino, M.; Ishitsuka, M.; Issever, C.; Istin, S.; Ito, F.; Iturbe Ponce, J. M.; Iuppa, R.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jabbar, S.; Jackson, P.; Jacobs, R. M.; Jain, V.; Jakobi, K. B.; Jakobs, K.; Jakobsen, S.; Jakoubek, T.; Jamin, D. O.; Jana, D. K.; Jansky, R.; Janssen, J.; Janus, M.; Janus, P. A.; Jarlskog, G.; Javadov, N.; Javå¯Rek, T.; Javurkova, M.; Jeanneau, F.; Jeanty, L.; Jejelava, J.; Jelinskas, A.; Jenni, P.; Jeske, C.; Jézéquel, S.; Ji, H.; Jia, J.; Jiang, H.; Jiang, Y.; Jiang, Z.; Jiggins, S.; Jimenez Pena, J.; Jin, S.; Jinaru, A.; Jinnouchi, O.; Jivan, H.; Johansson, P.; Johns, K. A.; Johnson, C. A.; Johnson, W. J.; Jon-And, K.; Jones, R. W. L.; Jones, S. D.; Jones, S.; Jones, T. J.; Jongmanns, J.; Jorge, P. M.; Jovicevic, J.; Ju, X.; Juste Rozas, A.; Köhler, M. K.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kahn, S. J.; Kaji, T.; Kajomovitz, E.; Kalderon, C. W.; Kaluza, A.; Kama, S.; Kamenshchikov, A.; Kanaya, N.; Kanjir, L.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kaplan, L. S.; Kar, D.; Karakostas, K.; Karastathis, N.; Kareem, M. J.; Karentzos, E.; Karpov, S. N.; Karpova, Z. M.; Karthik, K.; Kartvelishvili, V.; Karyukhin, A. N.; Kasahara, K.; Kashif, L.; Kass, R. D.; Kastanas, A.; Kataoka, Y.; Kato, C.; Katre, A.; Katzy, J.; Kawade, K.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kay, E. F.; Kazanin, V. F.; Keeler, R.; Kehoe, R.; Keller, J. S.; Kellermann, E.; Kempster, J. J.; Kendrick, J.; Keoshkerian, H.; Kepka, O.; Kerševan, B. P.; Kersten, S.; Keyes, R. A.; Khader, M.; Khalil-Zada, F.; Khanov, A.; Kharlamov, A. G.; Kharlamova, T.; Khodinov, A.; Khoo, T. J.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kido, S.; Kilby, C. R.; Kim, H. Y.; Kim, S. H.; Kim, Y. K.; Kimura, N.; Kind, O. M.; King, B. T.; Kirchmeier, D.; Kirk, J.; Kiryunin, A. E.; Kishimoto, T.; Kisielewska, D.; Kitali, V.; Kivernyk, O.; Kladiva, E.; Klapdor-Kleingrothaus, T.; Klein, M. H.; Klein, M.; Klein, U.; Kleinknecht, K.; Klimek, P.; Klimentov, A.; Klingenberg, R.; Klingl, T.; Klioutchnikova, T.; Kluge, E.-E.; Kluit, P.; Kluth, S.; Kneringer, E.; Knoops, E. B. F. G.; Knue, A.; Kobayashi, A.; Kobayashi, D.; Kobayashi, T.; Kobel, M.; Kocian, M.; Kodys, P.; Koffas, T.; Koffeman, E.; Köhler, N. M.; Koi, T.; Kolb, M.; Koletsou, I.; Komar, A. A.; Komori, Y.; Kondo, T.; Kondrashova, N.; Köneke, K.; König, A. C.; Kono, T.; Konoplich, R.; Konstantinidis, N.; Kopeliansky, R.; Koperny, S.; Kopp, A. K.; Korcyl, K.; Kordas, K.; Korn, A.; Korol, A. A.; Korolkov, I.; Korolkova, E. V.; Kortner, O.; Kortner, S.; Kosek, T.; Kostyukhin, V. V.; Kotwal, A.; Koulouris, A.; Kourkoumeli-Charalampidi, A.; Kourkoumelis, C.; Kourlitis, E.; Kouskoura, V.; Kowalewska, A. B.; Kowalewski, R.; Kowalski, T. Z.; Kozakai, C.; Kozanecki, W.; Kozhin, A. S.; Kramarenko, V. A.; Kramberger, G.; Krasnopevtsev, D.; Krasny, M. W.; Krasznahorkay, A.; Krauss, D.; Kremer, J. A.; Kretzschmar, J.; Kreutzfeldt, K.; Krieger, P.; Krizka, K.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Krumnack, N.; Kruse, M. C.; Kubota, T.; Kucuk, H.; Kuday, S.; Kuechler, J. T.; Kuehn, S.; Kugel, A.; Kuger, F.; Kuhl, T.; Kukhtin, V.; Kukla, R.; Kulchitsky, Y.; Kuleshov, S.; Kulinich, Y. P.; Kuna, M.; Kunigo, T.; Kupco, A.; Kupfer, T.; Kuprash, O.; Kurashige, H.; Kurchaninov, L. L.; Kurochkin, Y. A.; Kurth, M. G.; Kus, V.; Kuwertz, E. S.; Kuze, M.; Kvita, J.; Kwan, T.; Kyriazopoulos, D.; La Rosa, A.; La Rosa Navarro, J. L.; La Rotonda, L.; La Ruffa, F.; Lacasta, C.; Lacava, F.; Lacey, J.; Lacker, H.; Lacour, D.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Lammers, S.; Lampl, W.; Lançon, E.; Landgraf, U.; Landon, M. P. J.; Lanfermann, M. C.; Lang, V. S.; Lange, J. C.; Langenberg, R. J.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Lanza, A.; Lapertosa, A.; Laplace, S.; Laporte, J. F.; Lari, T.; Lasagni Manghi, F.; Lassnig, M.; Lau, T. S.; Laurelli, P.; Lavrijsen, W.; Law, A. T.; Laycock, P.; Lazovich, T.; Lazzaroni, M.; Le, B.; Le Dortz, O.; Le Guirriec, E.; Le Quilleuc, E. P.; Leblanc, M.; Lecompte, T.; Ledroit-Guillon, F.; Lee, C. A.; Lee, G. R.; Lee, S. C.; Lee, L.; Lefebvre, B.; Lefebvre, G.; Lefebvre, M.; Legger, F.; Leggett, C.; Lehmann Miotto, G.; Lei, X.; Leight, W. A.; Leite, M. A. L.; Leitner, R.; Lellouch, D.; Lemmer, B.; Leney, K. J. C.; Lenz, T.; Lenzi, B.; Leone, R.; Leone, S.; Leonidopoulos, C.; Lerner, G.; Leroy, C.; Lesage, A. A. J.; Lester, C. G.; Levchenko, M.; Levêque, J.; Levin, D.; Levinson, L. J.; Levy, M.; Lewis, D.; Li, B.; Li, Changqiao; Li, H.; Li, L.; Li, Q.; Li, Q.; Li, S.; Li, X.; Li, Y.; Liang, Z.; Liberti, B.; Liblong, A.; Lie, K.; Liebal, J.; Liebig, W.; Limosani, A.; Lin, S. C.; Lin, T. H.; Lindquist, B. E.; Lionti, A. E.; Lipeles, E.; Lipniacka, A.; Lisovyi, M.; Liss, T. M.; Lister, A.; Litke, A. M.; Liu, B.; Liu, H.; Liu, H.; Liu, J. K. K.; Liu, J.; Liu, J. B.; Liu, K.; Liu, L.; Liu, M.; Liu, Y. L.; Liu, Y.; Livan, M.; Lleres, A.; Llorente Merino, J.; Lloyd, S. L.; Lo, C. Y.; Lo Sterzo, F.; Lobodzinska, E. M.; Loch, P.; Loebinger, F. K.; Loesle, A.; Loew, K. M.; Loginov, A.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Long, B. A.; Long, J. D.; Long, R. E.; Longo, L.; Looper, K. A.; Lopez, J. A.; Lopez Mateos, D.; Lopez Paz, I.; Lopez Solis, A.; Lorenz, J.; Lorenzo Martinez, N.; Losada, M.; Lösel, P. J.; Lou, X.; Lounis, A.; Love, J.; Love, P. A.; Lu, H.; Lu, N.; Lu, Y. J.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Luedtke, C.; Luehring, F.; Lukas, W.; Luminari, L.; Lundberg, O.; Lund-Jensen, B.; Lutz, M. S.; Luzi, P. M.; Lynn, D.; Lysak, R.; Lytken, E.; Lyu, F.; Lyubushkin, V.; Ma, H.; Ma, L. L.; Ma, Y.; Maccarrone, G.; Macchiolo, A.; MacDonald, C. M.; Maček, B.; Machado Miguens, J.; Madaffari, D.; Madar, R.; Mader, W. F.; Madsen, A.; Maeda, J.; Maeland, S.; Maeno, T.; Maevskiy, A. S.; Magerl, V.; Mahlstedt, J.; Maiani, C.; Maidantchik, C.; Maier, A. A.; Maier, T.; Maio, A.; Majersky, O.; Majewski, S.; Makida, Y.; Makovec, N.; Malaescu, B.; Malecki, Pa.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Malone, C.; Maltezos, S.; Malyukov, S.; Mamuzic, J.; Mancini, G.; Mandić, I.; Maneira, J.; Manhaes de Andrade Filho, L.; Manjarres Ramos, J.; Mankinen, K. H.; Mann, A.; Manousos, A.; Mansoulie, B.; Mansour, J. D.; Mantifel, R.; Mantoani, M.; Manzoni, S.; Mapelli, L.; Marceca, G.; March, L.; Marchese, L.; Marchiori, G.; Marcisovsky, M.; Marjanovic, M.; Marley, D. E.; Marroquim, F.; Marsden, S. P.; Marshall, Z.; Martensson, M. U. F.; Marti-Garcia, S.; Martin, C. B.; Martin, T. A.; Martin, V. J.; Martin Dit Latour, B.; Martinez, M.; Martinez Outschoorn, V. I.; Martin-Haugh, S.; Martoiu, V. S.; Martyniuk, A. C.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, L.; Mastrandrea, P.; Mastroberardino, A.; Masubuchi, T.; Mättig, P.; Maurer, J.; Maxfield, S. J.; Maximov, D. A.; Mazini, R.; Maznas, I.; Mazza, S. M.; Mc Fadden, N. C.; Mc Goldrick, G.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCarthy, T. G.; McClymont, L. I.; McDonald, E. F.; McFayden, J. A.; McHedlidze, G.; McMahon, S. J.; McNamara, P. C.; McPherson, R. A.; Meehan, S.; Megy, T. J.; Mehlhase, S.; Mehta, A.; Meideck, T.; Meier, K.; Meirose, B.; Melini, D.; Mellado Garcia, B. R.; Mellenthin, J. D.; Melo, M.; Meloni, F.; Melzer, A.; Menary, S. B.; Meng, L.; Meng, X. T.; Mengarelli, A.; Menke, S.; Meoni, E.; Mergelmeyer, S.; Merlassino, C.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Messina, A.; Metcalfe, J.; Mete, A. S.; Meyer, C.; Meyer, J.-P.; Meyer, J.; Meyer Zu Theenhausen, H.; Miano, F.; Middleton, R. P.; Miglioranzi, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Milesi, M.; Milic, A.; Millar, D. A.; Miller, D. W.; Mills, C.; Milov, A.; Milstead, D. A.; Minaenko, A. A.; Minami, Y.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Minegishi, Y.; Ming, Y.; Mir, L. M.; Mistry, K. P.; Mitani, T.; Mitrevski, J.; Mitsou, V. A.; Miucci, A.; Miyagawa, P. S.; Mizukami, A.; Mjörnmark, J. U.; Mkrtchyan, T.; Mlynarikova, M.; Moa, T.; Mochizuki, K.; Mogg, P.; Mohapatra, S.; Molander, S.; Moles-Valls, R.; Mondragon, M. C.; Mönig, K.; Monk, J.; Monnier, E.; Montalbano, A.; Montejo Berlingen, J.; Monticelli, F.; Monzani, S.; Moore, R. W.; Morange, N.; Moreno, D.; Moreno Llácer, M.; Morettini, P.; Morgenstern, S.; Mori, D.; Mori, T.; Morii, M.; Morinaga, M.; Morisbak, V.; Morley, A. K.; Mornacchi, G.; Morris, J. D.; Morvaj, L.; Moschovakos, P.; Mosidze, M.; Moss, H. J.; Moss, J.; Motohashi, K.; Mount, R.; Mountricha, E.; Moyse, E. J. W.; Muanza, S.; Mueller, F.; Mueller, J.; Mueller, R. S. P.; Muenstermann, D.; Mullen, P.; Mullier, G. A.; Munoz Sanchez, F. J.; Murray, W. J.; Musheghyan, H.; Muškinja, M.; Myagkov, A. G.; Myska, M.; Nachman, B. P.; Nackenhorst, O.; Nagai, K.; Nagai, R.; Nagano, K.; Nagasaka, Y.; Nagata, K.; Nagel, M.; Nagy, E.; Nairz, A. M.; Nakahama, Y.; Nakamura, K.; Nakamura, T.; Nakano, I.; Naranjo Garcia, R. F.; Narayan, R.; Narrias Villar, D. I.; Naryshkin, I.; Naumann, T.; Navarro, G.; Nayyar, R.; Neal, H. A.; Nechaeva, P. Yu.; Neep, T. J.; Negri, A.; Negrini, M.; Nektarijevic, S.; Nellist, C.; Nelson, A.; Nelson, M. E.; Nemecek, S.; Nemethy, P.; Nessi, M.; Neubauer, M. S.; Neumann, M.; Newman, P. R.; Ng, T. Y.; Nguyen Manh, T.; Nickerson, R. B.; Nicolaidou, R.; Nielsen, J.; Nikolaenko, V.; Nikolic-Audit, I.; Nikolopoulos, K.; Nilsen, J. K.; Nilsson, P.; Ninomiya, Y.; Nisati, A.; Nishu, N.; Nisius, R.; Nitsche, I.; Nitta, T.; Nobe, T.; Noguchi, Y.; Nomachi, M.; Nomidis, I.; Nomura, M. A.; Nooney, T.; Nordberg, M.; Norjoharuddeen, N.; Novgorodova, O.; Nowak, S.; Nozaki, M.; Nozka, L.; Ntekas, K.; Nurse, E.; Nuti, F.; O'Connor, K.; O'Neil, D. C.; O'Rourke, A. A.; O'Shea, V.; Oakham, F. G.; Oberlack, H.; Obermann, T.; Ocariz, J.; Ochi, A.; Ochoa, I.; Ochoa-Ricoux, J. P.; Oda, S.; Odaka, S.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohman, H.; Oide, H.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olariu, A.; Oleiro Seabra, L. F.; Olivares Pino, S. A.; Oliveira Damazio, D.; Olszewski, A.; Olszowska, J.; Onofre, A.; Onogi, K.; Onyisi, P. U. E.; Oppen, H.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlando, N.; Orr, R. S.; Osculati, B.; Ospanov, R.; Otero Y Garzon, G.; Otono, H.; Ouchrif, M.; Ould-Saada, F.; Ouraou, A.; Oussoren, K. P.; Ouyang, Q.; Owen, M.; Owen, R. E.; Ozcan, V. E.; Ozturk, N.; Pachal, K.; Pacheco Pages, A.; Pacheco Rodriguez, L.; Padilla Aranda, C.; Pagan Griso, S.; Paganini, M.; Paige, F.; Palacino, G.; Palazzo, S.; Palestini, S.; Palka, M.; Pallin, D.; Panagiotopoulou, E. St.; Panagoulias, I.; Pandini, C. E.; Panduro Vazquez, J. G.; Pani, P.; Panitkin, S.; Pantea, D.; Paolozzi, L.; Papadopoulou, Th. D.; Papageorgiou, K.; Paramonov, A.; Paredes Hernandez, D.; Parker, A. J.; Parker, M. A.; Parker, K. A.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pascuzzi, V. R.; Pasner, J. M.; Pasqualucci, E.; Passaggio, S.; Pastore, Fr.; Pataraia, S.; Pater, J. R.; Pauly, T.; Pearson, B.; Pedraza Lopez, S.; Pedro, R.; Peleganchuk, S. V.; Penc, O.; Peng, C.; Peng, H.; Penwell, J.; Peralva, B. S.; Perego, M. M.; Perepelitsa, D. V.; Peri, F.; Perini, L.; Pernegger, H.; Perrella, S.; Peschke, R.; Peshekhonov, V. D.; Peters, K.; Peters, R. F. Y.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridis, A.; Petridou, C.; Petroff, P.; Petrolo, E.; Petrov, M.; Petrucci, F.; Pettersson, N. E.; Peyaud, A.; Pezoa, R.; Phillips, F. H.; Phillips, P. W.; Piacquadio, G.; Pianori, E.; Picazio, A.; Piccaro, E.; Pickering, M. A.; Piegaia, R.; Pilcher, J. E.; Pilkington, A. D.; Pin, A. W. J.; Pinamonti, M.; Pinfold, J. L.; Pirumov, H.; Pitt, M.; Plazak, L.; Pleier, M.-A.; Pleskot, V.; Plotnikova, E.; Pluth, D.; Podberezko, P.; Poettgen, R.; Poggi, R.; Poggioli, L.; Pogrebnyak, I.; Pohl, D.; Polesello, G.; Poley, A.; Policicchio, A.; Polifka, R.; Polini, A.; Pollard, C. S.; Polychronakos, V.; Pommès, K.; Ponomarenko, D.; Pontecorvo, L.; Popeneciu, G. A.; Pospisil, S.; Potamianos, K.; Potrap, I. N.; Potter, C. J.; Poulsen, T.; Poveda, J.; Pozo Astigarraga, M. E.; Pralavorio, P.; Pranko, A.; Prell, S.; Price, D.; Primavera, M.; Prince, S.; Proklova, N.; Prokofiev, K.; Prokoshin, F.; Protopopescu, S.; Proudfoot, J.; Przybycien, M.; Puri, A.; Puzo, P.; Qian, J.; Qin, G.; Qin, Y.; Quadt, A.; Queitsch-Maitland, M.; Quilty, D.; Raddum, S.; Radeka, V.; Radescu, V.; Radhakrishnan, S. K.; Radloff, P.; Rados, P.; Ragusa, F.; Rahal, G.; Raine, J. A.; Rajagopalan, S.; Rangel-Smith, C.; Rashid, T.; Raspopov, S.; Ratti, M. G.; Rauch, D. M.; Rauscher, F.; Rave, S.; Ravinovich, I.; Rawling, J. H.; Raymond, M.; Read, A. L.; Readioff, N. P.; Reale, M.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reed, R. G.; Reeves, K.; Rehnisch, L.; Reichert, J.; Reiss, A.; Rembser, C.; Ren, H.; Rescigno, M.; Resconi, S.; Resseguie, E. D.; Rettie, S.; Reynolds, E.; Rezanova, O. L.; Reznicek, P.; Rezvani, R.; Richter, R.; Richter, S.; Richter-Was, E.; Ricken, O.; Ridel, M.; Rieck, P.; Riegel, C. J.; Rieger, J.; Rifki, O.; Rijssenbeek, M.; Rimoldi, A.; Rimoldi, M.; Rinaldi, L.; Ripellino, G.; Ristić, B.; Ritsch, E.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Rizzi, C.; Roberts, R. T.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robson, A.; Rocco, E.; Roda, C.; Rodina, Y.; Rodriguez Bosca, S.; Rodriguez Perez, A.; Rodriguez Rodriguez, D.; Roe, S.; Rogan, C. S.; Røhne, O.; Roloff, J.; Romaniouk, A.; Romano, M.; Romano Saez, S. M.; Romero Adam, E.; Rompotis, N.; Ronzani, M.; Roos, L.; Rosati, S.; Rosbach, K.; Rose, P.; Rosien, N.-A.; Rossi, E.; Rossi, L. P.; Rosten, J. H. N.; Rosten, R.; Rotaru, M.; Rothberg, J.; Rousseau, D.; Rozanov, A.; Rozen, Y.; Ruan, X.; Rubbo, F.; Rühr, F.; Ruiz-Martinez, A.; Rurikova, Z.; Rusakovich, N. A.; Russell, H. L.; Rutherfoord, J. P.; Ruthmann, N.; Ryabov, Y. F.; Rybar, M.; Rybkin, G.; Ryu, S.; Ryzhov, A.; Rzehorz, G. F.; Saavedra, A. F.; Sabato, G.; Sacerdoti, S.; Sadrozinski, H. F.-W.; Sadykov, R.; Safai Tehrani, F.; Saha, P.; Sahinsoy, M.; Saimpert, M.; Saito, M.; Saito, T.; Sakamoto, H.; Sakurai, Y.; Salamanna, G.; Salazar Loyola, J. E.; Salek, D.; Sales de Bruin, P. H.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sammel, D.; Sampsonidis, D.; Sampsonidou, D.; Sánchez, J.; Sanchez Martinez, V.; Sanchez Pineda, A.; Sandaker, H.; Sandbach, R. L.; Sander, C. O.; Sandhoff, M.; Sandoval, C.; Sankey, D. P. C.; Sannino, M.; Sano, Y.; Sansoni, A.; Santoni, C.; Santos, H.; Santoyo Castillo, I.; Sapronov, A.; Saraiva, J. G.; Sarrazin, B.; Sasaki, O.; Sato, K.; Sauvan, E.; Savage, G.; Savard, P.; Savic, N.; Sawyer, C.; Sawyer, L.; Saxon, J.; Sbarra, C.; Sbrizzi, A.; Scanlon, T.; Scannicchio, D. A.; Schaarschmidt, J.; Schacht, P.; Schachtner, B. M.; Schaefer, D.; Schaefer, L.; Schaefer, R.; Schaeffer, J.; Schaepe, S.; Schaetzel, S.; Schäfer, U.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Schiavi, C.; Schier, S.; Schildgen, L. K.; Schillo, C.; Schioppa, M.; Schlenker, S.; Schmidt-Sommerfeld, K. R.; Schmieden, K.; Schmitt, C.; Schmitt, S.; Schmitz, S.; Schnoor, U.; Schoeffel, L.; Schoening, A.; Schoenrock, B. D.; Schopf, E.; Schott, M.; Schouwenberg, J. F. P.; Schovancova, J.; Schramm, S.; Schuh, N.; Schulte, A.; Schultens, M. J.; Schultz-Coulon, H.-C.; Schulz, H.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwartzman, A.; Schwarz, T. A.; Schweiger, H.; Schwemling, Ph.; Schwienhorst, R.; Schwindling, J.; Sciandra, A.; Sciolla, G.; Scornajenghi, M.; Scuri, F.; Scutti, F.; Searcy, J.; Seema, P.; Seidel, S. C.; Seiden, A.; Seixas, J. M.; Sekhniaidze, G.; Sekhon, K.; Sekula, S. J.; Semprini-Cesari, N.; Senkin, S.; Serfon, C.; Serin, L.; Serkin, L.; Sessa, M.; Seuster, R.; Severini, H.; Sfiligoj, T.; Sforza, F.; Sfyrla, A.; Shabalina, E.; Shaikh, N. W.; Shan, L. Y.; Shang, R.; Shank, J. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Shaw, S. M.; Shcherbakova, A.; Shehu, C. Y.; Shen, Y.; Sherafati, N.; Sherwood, P.; Shi, L.; Shimizu, S.; Shimmin, C. O.; Shimojima, M.; Shipsey, I. P. J.; Shirabe, S.; Shiyakova, M.; Shlomi, J.; Shmeleva, A.; Shoaleh Saadi, D.; Shochet, M. J.; Shojaii, S.; Shope, D. R.; Shrestha, S.; Shulga, E.; Shupe, M. A.; Sicho, P.; Sickles, A. M.; Sidebo, P. E.; Sideras Haddad, E.; Sidiropoulou, O.; Sidoti, A.; Siegert, F.; Sijacki, Dj.; Silva, J.; Silverstein, S. B.; Simak, V.; Simic, Lj.; Simion, S.; Simioni, E.; Simmons, B.; Simon, M.; Sinervo, P.; Sinev, N. B.; Sioli, M.; Siragusa, G.; Siral, I.; Sivoklokov, S. Yu.; Sjölin, J.; Skinner, M. B.; Skubic, P.; Slater, M.; Slavicek, T.; Slawinska, M.; Sliwa, K.; Slovak, R.; Smakhtin, V.; Smart, B. H.; Smiesko, J.; Smirnov, N.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, J. W.; Smith, M. N. K.; Smith, R. W.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snyder, I. M.; Snyder, S.; Sobie, R.; Socher, F.; Soffer, A.; Søgaard, A.; Soh, D. A.; Sokhrannyi, G.; Solans Sanchez, C. A.; Solar, M.; Soldatov, E. Yu.; Soldevila, U.; Solodkov, A. A.; Soloshenko, A.; Solovyanov, O. V.; Solovyev, V.; Sommer, P.; Son, H.; Sopczak, A.; Sosa, D.; Sotiropoulou, C. L.; Soualah, R.; Soukharev, A. M.; South, D.; Sowden, B. C.; Spagnolo, S.; Spalla, M.; Spangenberg, M.; Spanò, F.; Sperlich, D.; Spettel, F.; Spieker, T. M.; Spighi, R.; Spigo, G.; Spiller, L. A.; Spousta, M.; St. Denis, R. D.; Stabile, A.; Stamen, R.; Stamm, S.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stanitzki, M. M.; Stapf, B. S.; Stapnes, S.; Starchenko, E. A.; Stark, G. H.; Stark, J.; Stark, S. H.; Staroba, P.; Starovoitov, P.; Stärz, S.; Staszewski, R.; Steinberg, P.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stewart, G. A.; Stockton, M. C.; Stoebe, M.; Stoicea, G.; Stolte, P.; Stonjek, S.; Stradling, A. R.; Straessner, A.; Stramaglia, M. E.; Strandberg, J.; Strandberg, S.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strubig, A.; Stucci, S. A.; Stugu, B.; Styles, N. A.; Su, D.; Su, J.; Suchek, S.; Sugaya, Y.; Suk, M.; Sulin, V. V.; Sultan, Dms; Sultansoy, S.; Sumida, T.; Sun, S.; Sun, X.; Suruliz, K.; Suster, C. J. E.; Sutton, M. R.; Suzuki, S.; Svatos, M.; Swiatlowski, M.; Swift, S. P.; Sykora, I.; Sykora, T.; Ta, D.; Tackmann, K.; Taenzer, J.; Taffard, A.; Tafirout, R.; Tahirovic, E.; Taiblum, N.; Takai, H.; Takashima, R.; Takasugi, E. H.; Takeshita, T.; Takubo, Y.; Talby, M.; Talyshev, A. A.; Tanaka, J.; Tanaka, M.; Tanaka, R.; Tanaka, S.; Tanioka, R.; Tannenwald, B. B.; Tapia Araya, S.; Tapprogge, S.; Tarem, S.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tashiro, T.; Tassi, E.; Tavares Delgado, A.; Tayalati, Y.; Taylor, A. C.; Taylor, A. J.; Taylor, G. N.; Taylor, P. T. E.; Taylor, W.; Teixeira-Dias, P.; Temple, D.; Ten Kate, H.; Teng, P. K.; Teoh, J. J.; Tepel, F.; Terada, S.; Terashi, K.; Terron, J.; Terzo, S.; Testa, M.; Teuscher, R. J.; Theveneaux-Pelzer, T.; Thiele, F.; Thomas, J. P.; Thomas-Wilsker, J.; Thompson, P. D.; Thompson, A. S.; Thomsen, L. A.; Thomson, E.; Tibbetts, M. J.; Ticse Torres, R. E.; Tikhomirov, V. O.; Tikhonov, Yu. A.; Timoshenko, S.; Tipton, P.; Tisserant, S.; Todome, K.; Todorova-Nova, S.; Todt, S.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tolley, E.; Tomlinson, L.; Tomoto, M.; Tompkins, L.; Toms, K.; Tong, B.; Tornambe, P.; Torrence, E.; Torres, H.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Treado, C. J.; Trefzger, T.; Tresoldi, F.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Tripiana, M. F.; Trischuk, W.; Trocmé, B.; Trofymov, A.; Troncon, C.; Trottier-McDonald, M.; Trovatelli, M.; Truong, L.; Trzebinski, M.; Trzupek, A.; Tsang, K. W.; Tseng, J. C.-L.; Tsiareshka, P. V.; Tsipolitis, G.; Tsirintanis, N.; Tsiskaridze, S.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsui, K. M.; Tsukerman, I. I.; Tsulaia, V.; Tsuno, S.; Tsybychev, D.; Tu, Y.; Tudorache, A.; Tudorache, V.; Tulbure, T. T.; Tuna, A. N.; Tupputi, S. A.; Turchikhin, S.; Turgeman, D.; Turk Cakir, I.; Turra, R.; Tuts, P. M.; Ucchielli, G.; Ueda, I.; Ughetto, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Ungaro, F. C.; Unno, Y.; Unverdorben, C.; Urban, J.; Urquijo, P.; Urrejola, P.; Usai, G.; Usui, J.; Vacavant, L.; Vacek, V.; Vachon, B.; Vadla, K. O. H.; Vaidya, A.; Valderanis, C.; Valdes Santurio, E.; Valente, M.; Valentinetti, S.; Valero, A.; Valéry, L.; Valkar, S.; Vallier, A.; Valls Ferrer, J. A.; van den Wollenberg, W.; van der Graaf, H.; van Gemmeren, P.; van Nieuwkoop, J.; van Vulpen, I.; van Woerden, M. C.; Vanadia, M.; Vandelli, W.; Vaniachine, A.; Vankov, P.; Vardanyan, G.; Vari, R.; Varnes, E. W.; Varni, C.; Varol, T.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vasquez, J. G.; Vasquez, G. A.; Vazeille, F.; Vazquez Schroeder, T.; Veatch, J.; Veeraraghavan, V.; Veloce, L. M.; Veloso, F.; Veneziano, S.; Ventura, A.; Venturi, M.; Venturi, N.; Venturini, A.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, A. T.; Vermeulen, J. C.; Vetterli, M. C.; Viaux Maira, N.; Viazlo, O.; Vichou, I.; Vickey, T.; Vickey Boeriu, O. E.; Viehhauser, G. H. A.; Viel, S.; Vigani, L.; Villa, M.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinogradov, V. B.; Vishwakarma, A.; Vittori, C.; Vivarelli, I.; Vlachos, S.; Vogel, M.; Vokac, P.; Volpi, G.; von der Schmitt, H.; von Toerne, E.; Vorobel, V.; Vorobev, K.; Vos, M.; Voss, R.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Vuillermet, R.; Vukotic, I.; Wagner, P.; Wagner, W.; Wagner-Kuhr, J.; Wahlberg, H.; Wahrmund, S.; Walder, J.; Walker, R.; Walkowiak, W.; Wallangen, V.; Wang, C.; Wang, C.; Wang, F.; Wang, H.; Wang, H.; Wang, J.; Wang, J.; Wang, Q.; Wang, R.; Wang, S. M.; Wang, T.; Wang, W.; Wang, W.; Wang, Z.; Wanotayaroj, C.; Warburton, A.; Ward, C. P.; Wardrope, D. R.; Washbrook, A.; Watkins, P. M.; Watson, A. T.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, B. M.; Webb, A. F.; Webb, S.; Weber, M. S.; Weber, S. W.; Weber, S. A.; Webster, J. S.; Weidberg, A. R.; Weinert, B.; Weingarten, J.; Weirich, M.; Weiser, C.; Weits, H.; Wells, P. S.; Wenaus, T.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M. D.; Werner, P.; Wessels, M.; Weston, T. D.; Whalen, K.; Whallon, N. L.; Wharton, A. M.; White, A. S.; White, A.; White, M. J.; White, R.; Whiteson, D.; Whitmore, B. W.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wiglesworth, C.; Wiik-Fuchs, L. A. M.; Wildauer, A.; Wilk, F.; Wilkens, H. G.; Williams, H. H.; Williams, S.; Willis, C.; Willocq, S.; Wilson, J. A.; Wingerter-Seez, I.; Winkels, E.; Winklmeier, F.; Winston, O. J.; Winter, B. T.; Wittgen, M.; Wobisch, M.; Wolf, T. M. H.; Wolff, R.; Wolter, M. W.; Wolters, H.; Wong, V. W. S.; Worm, S. D.; Wosiek, B. K.; Wotschack, J.; Wozniak, K. W.; Wu, M.; Wu, S. L.; Wu, X.; Wu, Y.; Wyatt, T. R.; Wynne, B. M.; Xella, S.; Xi, Z.; Xia, L.; Xu, D.; Xu, L.; Xu, T.; Yabsley, B.; Yacoob, S.; Yamaguchi, D.; Yamaguchi, Y.; Yamamoto, A.; Yamamoto, S.; Yamanaka, T.; Yamane, F.; Yamatani, M.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, H.; Yang, Y.; Yang, Z.; Yao, W.-M.; Yap, Y. C.; Yasu, Y.; Yatsenko, E.; Yau Wong, K. H.; Ye, J.; Ye, S.; Yeletskikh, I.; Yigitbasi, E.; Yildirim, E.; Yorita, K.; Yoshihara, K.; Young, C.; Young, C. J. S.; Yu, J.; Yu, J.; Yuen, S. P. Y.; Yusuff, I.; Zabinski, B.; Zacharis, G.; Zaidan, R.; Zaitsev, A. M.; Zakharchuk, N.; Zalieckas, J.; Zaman, A.; Zambito, S.; Zanzi, D.; Zeitnitz, C.; Zemaityte, G.; Zemla, A.; Zeng, J. C.; Zeng, Q.; Zenin, O.; Ženiš, T.; Zerwas, D.; Zhang, D.; Zhang, F.; Zhang, G.; Zhang, H.; Zhang, J.; Zhang, L.; Zhang, L.; Zhang, M.; Zhang, P.; Zhang, R.; Zhang, R.; Zhang, X.; Zhang, Y.; Zhang, Z.; Zhao, X.; Zhao, Y.; Zhao, Z.; Zhemchugov, A.; Zhou, B.; Zhou, C.; Zhou, L.; Zhou, M.; Zhou, M.; Zhou, N.; Zhu, C. G.; Zhu, H.; Zhu, J.; Zhu, Y.; Zhuang, X.; Zhukov, K.; Zibell, A.; Zieminska, D.; Zimine, N. I.; Zimmermann, C.; Zimmermann, S.; Zinonos, Z.; Zinser, M.; Ziolkowski, M.; Živković, L.; Zobernig, G.; Zoccoli, A.; Zou, R.; Zur Nedden, M.; Zwalinski, L.; Atlas Collaboration
2017-11-01
The analysis of the momentum difference between charged hadrons in high-energy proton-proton collisions is performed in order to study coherent particle production. The observed correlation pattern agrees with a model of a helical QCD string fragmenting into a chain of ground-state hadrons. A threshold momentum difference in the production of adjacent pairs of charged hadrons is observed, in agreement with model predictions. The presence of low-mass hadron chains also explains the emergence of charge-combination-dependent two-particle correlations commonly attributed to Bose-Einstein interference. The data sample consists of 190 μ b-1 of minimum-bias events collected with proton-proton collisions at a center-of-mass energy √{s }=7 TeV in the early low-luminosity data taking with the ATLAS detector at the LHC.
Kumar, Sameer; Honkanen, Erik J; Karl, Chad C
2009-01-01
This study examines the idea of developing a global health diplomacy supply chain as an important foreign policy approach with the aim of improving the lives of vulnerable populations and serving the best interests of the United States. The study was based on the review of academic literature, news events, and military communiques, and historical writings were studied to determine the feasibility of the idea and the extent of costs and benefits of such an endeavor. An integrated strategic business model, supported by a medical care delivery process, was developed to create a framework for a feasible global health diplomacy supply chain. The findings indicate that extremism can be contained by creating and efficiently executing an effective supply chain to get medical care units to those that need them. The limitations are the potential exit strategies required, the tactical abilities, and diplomatic techniques needed in order to create positive diplomatic change in aid distribution. Managers must consider how supply chains will affect other organizations giving aid and the potential public response. Moreover, determining the level of care necessary to achieve the greatest positive health diplomacy continues to require vigilant scrutiny over the potential cost/benefit analysis. The analysis is valuable to policymakers considering the impacts of health diplomacy by utilizing supply chain management.
Doubly self-consistent field theory of grafted polymers under simple shear in steady state
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suo, Tongchuan; Whitmore, Mark D., E-mail: mark-whitmore@umanitoba.ca
2014-03-21
We present a generalization of the numerical self-consistent mean-field theory of polymers to the case of grafted polymers under simple shear. The general theoretical framework is presented, and then applied to three different chain models: rods, Gaussian chains, and finitely extensible nonlinear elastic (FENE) chains. The approach is self-consistent at two levels. First, for any flow field, the polymer density profile and effective potential are calculated self-consistently in a manner similar to the usual self-consistent field theory of polymers, except that the calculation is inherently two-dimensional even for a laterally homogeneous system. Second, through the use of a modified Brinkmanmore » equation, the flow field and the polymer profile are made self-consistent with respect to each other. For all chain models, we find that reasonable levels of shear cause the chains to tilt, but it has very little effect on the overall thickness of the polymer layer, causing a small decrease for rods, and an increase of no more than a few percent for the Gaussian and FENE chains. Using the FENE model, we also probe the individual bond lengths, bond correlations, and bond angles along the chains, the effects of the shear on them, and the solvent and bonded stress profiles. We find that the approximations needed within the theory for the Brinkman equation affect the bonded stress, but none of the other quantities.« less
Harmonic balance optimization of terahertz Schottky diode multipliers using an advanced device model
NASA Technical Reports Server (NTRS)
Schlecht, E. T.; Chattopadhyay, G.; Maestrini, A.; Pukala, D.; Gill, J.; Mehdi, I.
2002-01-01
Substantial proress has been made recently in the advancement of solid state terahertz sources using chains of Schottky diode frequency multipliers. We have developed a harmonic balance simulator and corresponding diode model that incorporates many other factors participating in the diode behavior.
Using Markov Chains to predict the natural progression of diabetic retinopathy
Srikanth, Priyanka
2015-01-01
AIM To study the natural progression of diabetic retinopathy in patients with type 2 diabetes. METHODS This was an observational study of 153 cases with type 2 diabetes from 2010 to 2013. The state of patient was noted at end of each year and transition matrices were developed to model movement between years. Patients who progressed to severe non-proliferative diabetic retinopathy (NPDR) were treated. Markov Chains and Chi-square test were used for statistical analysis. RESULTS We modelled the transition of 153 patients from NPDR to blindness on an annual basis. At the end of year 3, we compared results from the Markov model versus actual data. The results from Chi-square test confirmed that there was statistically no significant difference (P=0.70) which provided assurance that the model was robust to estimate mean sojourn times. The key finding was that a patient entering the system in mild NPDR state is expected to stay in that state for 5y followed by 1.07y in moderate NPDR, be in the severe NPDR state for 1.33y before moving into PDR for roughly 8y. It is therefore expected that such a patient entering the model in a state of mild NPDR will enter blindness after 15.29y. CONCLUSION Patients stay for long time periods in mild NPDR before transitioning into moderate NPDR. However, they move rapidly from moderate NPDR to proliferative diabetic retinopathy (PDR) and stay in that state for long periods before transitioning into blindness. PMID:25709923
Taran, Iu A; Cihpev, K K; Stroganov, L B
1977-01-01
Kinetics of the model reaction between oligomeric planar lattice-model chains has been studied by Monte--Carlo method. Simulation of the chain's motion was performing using rules of Verdier--Stockmayer. The length of chains has been varied from 8 to 24 beads. The probabilities of breaking of a contact between two chains was given by w=exp(--U); the formation of an adjacent contact was controlled by mobility of chains. The probability of the formation of any isolated contact was given by w0=exp(--U0). Kinetic curves were obtained for mean number of contacts Z(t) with different initial conditions and U, U0 values. The estimation of mean rates of formation-breaking of contacts (V+ and V-) and their dependences on the time, U and U0 have been obtained. Rate constants for the formation-breaking of a contact (k+ and k-) were estimated as well as the distribution for k+/- over states of the binary complex. The calculations were made for the case of homopolymers, intrachain interactions were omitted.
Transitions of tethered chain molecules under tension.
Luettmer-Strathmann, Jutta; Binder, Kurt
2014-09-21
An applied tension force changes the equilibrium conformations of a polymer chain tethered to a planar substrate and thus affects the adsorption transition as well as the coil-globule and crystallization transitions. Conversely, solvent quality and surface attraction are reflected in equilibrium force-extension curves that can be measured in experiments. To investigate these effects theoretically, we study tethered chains under tension with Wang-Landau simulations of a bond-fluctuation lattice model. Applying our model to pulling experiments on biological molecules we obtain a good description of experimental data in the intermediate force range, where universal features dominate and finite size effects are small. For tethered chains in poor solvent, we observe the predicted two-phase coexistence at transitions from the globule to stretched conformations and also discover direct transitions from crystalline to stretched conformations. A phase portrait for finite chains constructed by evaluating the density of states for a broad range of solvent conditions and tensions shows how increasing tension leads to a disappearance of the globular phase. For chains in good solvents tethered to hard and attractive surfaces we find the predicted scaling with the chain length in the low-force regime and show that our results are well described by an analytical, independent-bond approximation for the bond-fluctuation model for the highest tensions. Finally, for a hard or slightly attractive surface the stretching of a tethered chain is a conformational change that does not correspond to a phase transition. However, when the surface attraction is sufficient to adsorb a chain it will undergo a desorption transition at a critical value of the applied force. Our results for force-induced desorption show the transition to be discontinuous with partially desorbed conformations in the coexistence region.
NASA Astrophysics Data System (ADS)
Gálisová, Lucia
2018-05-01
Ground-state properties of a hybrid double-tetrahedral chain, in which the localized Ising spins regularly alternate with triangular plaquettes occupied by a variable number of mobile electrons, are exactly investigated. We demonstrate that the zero-temperature phase diagram of the model involves several non-degenerate, two-fold degenerate and macroscopically degenerate chiral phases. Low-temperature dependencies of the entropy and specific heat are also examined in order to gain a deeper insight into the degeneracy of individual ground-state phases and phase transitions. It is shown that a diversity of the ground-state degeneracy manifests itself in multiple-peak structures of both thermodynamic quantities. A remarkable temperature dependencies of the specific heat with two and three Schottky-type maxima are discussed in detail.
NASA Astrophysics Data System (ADS)
Wen, Jing; Ma, Haibo
2017-07-01
For computing the intra-chain excitonic couplings in polymeric systems, here we propose a new fragmentation approach. A comparison for the energetic and spatial properties of the low-lying excited states in PPV between our scheme and full quantum chemical calculations, reveals that our scheme can nicely reproduce full quantum chemical results in weakly coupled systems. Further wavefunction analysis indicate that improved description for strongly coupled system can be achieved by the inclusion of the higher excited states within each fragments. Our proposed scheme is helpful for building the bridge linking the phenomenological descriptions of excitons and microscopic modeling for realistic polymers.
Origins of pressure-induced protein transitions.
Chalikian, Tigran V; Macgregor, Robert B
2009-12-18
The molecular mechanisms underlying pressure-induced protein denaturation can be analyzed based on the pressure-dependent differences in the apparent volume occupied by amino acids inside the protein and when they are exposed to water in an unfolded conformation. We present here an analysis for the peptide group and the 20 naturally occurring amino acid side chains based on volumetric parameters for the amino acids in the interior of the native state, the micelle-like interior of the pressure-induced denatured state, and the unfolded conformation modeled by N-acetyl amino acid amides. The transfer of peptide groups from the protein interior to water becomes increasingly favorable as pressure increases. Thus, solvation of peptide groups represents a major driving force in pressure-induced protein denaturation. Polar side chains do not appear to exhibit significant pressure-dependent changes in their preference for the protein interior or solvent. The transfer of nonpolar side chains from the protein interior to water becomes more unfavorable as pressure increases. We conclude that a sizeable population of nonpolar side chains remains buried inside a solvent-inaccessible core of the pressure-induced denatured state. At elevated pressures, this core may become packed almost as tightly as the interior of the native state. The presence and partial disappearance of large intraglobular voids is another driving force facilitating pressure-induced denaturation of individual proteins. Our data also have implications for the kinetics of protein folding and shed light on the nature of the folding transition state ensemble.
Quantum spin chains with multiple dynamics
NASA Astrophysics Data System (ADS)
Chen, Xiao; Fradkin, Eduardo; Witczak-Krempa, William
2017-11-01
Many-body systems with multiple emergent time scales arise in various contexts, including classical critical systems, correlated quantum materials, and ultracold atoms. We investigate such nontrivial quantum dynamics in a different setting: a spin-1 bilinear-biquadratic chain. It has a solvable entangled ground state, but a gapless excitation spectrum that is poorly understood. By using large-scale density matrix renormalization group simulations, we find that the lowest excitations have a dynamical exponent z that varies from 2 to 3.2 as we vary a coupling in the Hamiltonian. We find an additional gapless mode with a continuously varying exponent 2 ≤z <2.7 , which establishes the presence of multiple dynamics. In order to explain these striking properties, we construct a continuum wave function for the ground state, which correctly describes the correlations and entanglement properties. We also give a continuum parent Hamiltonian, but show that additional ingredients are needed to capture the excitations of the chain. By using an exact mapping to the nonequilibrium dynamics of a classical spin chain, we find that the large dynamical exponent is due to subdiffusive spin motion. Finally, we discuss the connections to other spin chains and to a family of quantum critical models in two dimensions.
Effect of PEO molecular weight on the miscibility and dynamics in epoxy/PEO blends.
Lu, Shoudong; Zhang, Rongchun; Wang, Xiaoliang; Sun, Pingchuan; Lv, Weifeng; Liu, Qingjie; Jia, Ninghong
2015-11-01
In this work, the effect of poly(ethylene oxide) (PEO) molecular weight in blends of epoxy (ER) and PEO on the miscibility, inter-chain weak interactions and local dynamics were systematically investigated by multi-frequency temperature modulation DSC and solid-state NMR techniques. We found that the molecular weight (M(w)) of PEO was a crucial factor in controlling the miscibility, chain dynamics and hydrogen bonding interactions between PEO and ER. A critical PEO molecular weight (M(crit)) around 4.5k was found. PEO was well miscible with ER when the molecular weight was below M(crit), where the chain motion of PEO was restricted due to strong inter-chain hydrogen bonding interactions. However, for the blends with high molecular weight PEO (M(w) > M(crit)), the miscibility between PEO and ER was poor, and most of PEO chains were considerably mobile. Finally, polarization inversion spin exchange at magic angle (PISEMA) solid-state NMR experiment further revealed the different mobility of the PEO in ER/PEO blends with different molecular weight of PEO at molecular level. Based on the DSC and NMR results, a tentative model was proposed to illustrate the miscibility in ER/PEO blends.
Supervised self-organization of homogeneous swarms using ergodic projections of Markov chains.
Chattopadhyay, Ishanu; Ray, Asok
2009-12-01
This paper formulates a self-organization algorithm to address the problem of global behavior supervision in engineered swarms of arbitrarily large population sizes. The swarms considered in this paper are assumed to be homogeneous collections of independent identical finite-state agents, each of which is modeled by an irreducible finite Markov chain. The proposed algorithm computes the necessary perturbations in the local agents' behavior, which guarantees convergence to the desired observed state of the swarm. The ergodicity property of the swarm, which is induced as a result of the irreducibility of the agent models, implies that while the local behavior of the agents converges to the desired behavior only in the time average, the overall swarm behavior converges to the specification and stays there at all times. A simulation example illustrates the underlying concept.
2010-12-01
An Analysis of United States Marine Corps Enlisted Entry-Level Training Using Supply Chain and Operations Management ______________________________________ By...Report 4. TITLE AND SUBTITLE: An Analysis of United States Marine Corps Enlisted Entry-Level Training Using Supply Chain and Operations Management 6...Level Training; United States Marine Corps; Operations Management ; Supply Chain Management; Process Analysis 16. PRICE CODE 17. SECURITY
Vigre, Håkan; Domingues, Ana Rita Coutinho Calado; Pedersen, Ulrik Bo; Hald, Tine
2016-03-01
The aim of the project as the cluster analysis was to in part to develop a generic structured quantitative microbiological risk assessment (QMRA) model of human salmonellosis due to pork consumption in EU member states (MSs), and the objective of the cluster analysis was to group the EU MSs according to the relative contribution of different pathways of Salmonella in the farm-to-consumption chain of pork products. In the development of the model, by selecting a case study MS from each cluster the model was developed to represent different aspects of pig production, pork production, and consumption of pork products across EU states. The objective of the cluster analysis was to aggregate MSs into groups of countries with similar importance of different pathways of Salmonella in the farm-to-consumption chain using available, and where possible, universal register data related to the pork production and consumption in each country. Based on MS-specific information about distribution of (i) small and large farms, (ii) small and large slaughterhouses, (iii) amount of pork meat consumed, and (iv) amount of sausages consumed we used nonhierarchical and hierarchical cluster analysis to group the MSs. The cluster solutions were validated internally using statistic measures and externally by comparing the clustered MSs with an estimated human incidence of salmonellosis due to pork products in the MSs. Finally, each cluster was characterized qualitatively using the centroids of the clusters. © 2016 Society for Risk Analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rajca, Andrzej; Takahashi, Masahiro; Pink, Maren
2008-06-30
Nitroxide diradicals, in which nitroxides are annelated to m-phenylene forming tricyclic benzobisoxazine-like structures, have been synthesized and characterized by X-ray crystallography, magnetic resonance (EPR and {sup 1}H NMR) spectroscopy, as well as magnetic studies in solution and in solid state. For the octamethyl derivative of benzobisoxazine nitroxide diradical, the conformationally constrained nitroxide moieties are coplanar with the m-phenylene, leading to large values of 2J (2J/k > 200 K in solution and 2J/k >> 300 K in the solid state). For the diradical, in which all ortho and para positions of the m-phenylene are sterically shielded, distortion of the nitroxide moietiesmore » from coplanarity is moderate, such that the singlet-triplet gaps remain large in both solution (2J/k > 200 K) and the solid state (2J/k {approx} 400-800 K), though an onset of thermal depopulation of the triplet ground state is detectable near room temperature. These diradicals have robust triplet ground states with strong ferromagnetic coupling and good stability at ambient conditions. Magnetic behavior of the nitroxide diradicals at low temperature is best fit to the model of one-dimensional S = 1 Heisenberg chains with intrachain antiferromagnetic coupling. The antiferromagnetic coupling between the S = 1 diradicals may be associated with the methyl nitroxide C-H {hor_ellipsis} O contacts, including nonclassical hydrogen bonds. These unprecedented organic S = 1 antiferromagnetic chains are highly isotropic, compared to those of the extensively studied Ni(II)-based chains.« less
High-resolution protein design with backbone freedom.
Harbury, P B; Plecs, J J; Tidor, B; Alber, T; Kim, P S
1998-11-20
Recent advances in computational techniques have allowed the design of precise side-chain packing in proteins with predetermined, naturally occurring backbone structures. Because these methods do not model protein main-chain flexibility, they lack the breadth to explore novel backbone conformations. Here the de novo design of a family of alpha-helical bundle proteins with a right-handed superhelical twist is described. In the design, the overall protein fold was specified by hydrophobic-polar residue patterning, whereas the bundle oligomerization state, detailed main-chain conformation, and interior side-chain rotamers were engineered by computational enumerations of packing in alternate backbone structures. Main-chain flexibility was incorporated through an algebraic parameterization of the backbone. The designed peptides form alpha-helical dimers, trimers, and tetramers in accord with the design goals. The crystal structure of the tetramer matches the designed structure in atomic detail.
Performance and state-space analyses of systems using Petri nets
NASA Technical Reports Server (NTRS)
Watson, James Francis, III
1992-01-01
The goal of any modeling methodology is to develop a mathematical description of a system that is accurate in its representation and also permits analysis of structural and/or performance properties. Inherently, trade-offs exist between the level detail in the model and the ease with which analysis can be performed. Petri nets (PN's), a highly graphical modeling methodology for Discrete Event Dynamic Systems, permit representation of shared resources, finite capacities, conflict, synchronization, concurrency, and timing between state changes. By restricting the state transition time delays to the family of exponential density functions, Markov chain analysis of performance problems is possible. One major drawback of PN's is the tendency for the state-space to grow rapidly (exponential complexity) compared to increases in the PN constructs. It is the state space, or the Markov chain obtained from it, that is needed in the solution of many problems. The theory of state-space size estimation for PN's is introduced. The problem of state-space size estimation is defined, its complexities are examined, and estimation algorithms are developed. Both top-down and bottom-up approaches are pursued, and the advantages and disadvantages of each are described. Additionally, the author's research in non-exponential transition modeling for PN's is discussed. An algorithm for approximating non-exponential transitions is developed. Since only basic PN constructs are used in the approximation, theory already developed for PN's remains applicable. Comparison to results from entropy theory show the transition performance is close to the theoretic optimum. Inclusion of non-exponential transition approximations improves performance results at the expense of increased state-space size. The state-space size estimation theory provides insight and algorithms for evaluating this trade-off.
Three real-time architectures - A study using reward models
NASA Technical Reports Server (NTRS)
Sjogren, J. A.; Smith, R. M.
1990-01-01
Numerous applications in the area of computer system analysis can be effectively studied with Markov reward models. These models describe the evolutionary behavior of the computer system by a continuous-time Markov chain, and a reward rate is associated with each state. In reliability/availability models, upstates have reward rate 1, and down states have reward rate zero associated with them. In a combined model of performance and reliability, the reward rate of a state may be the computational capacity, or a related performance measure. Steady-state expected reward rate and expected instantaneous reward rate are clearly useful measures which can be extracted from the Markov reward model. The diversity of areas where Markov reward models may be used is illustrated with a comparative study of three examples of interest to the fault tolerant computing community.
Integrability in heavy quark effective theory
NASA Astrophysics Data System (ADS)
Braun, Vladimir M.; Ji, Yao; Manashov, Alexander N.
2018-06-01
It was found that renormalization group equations in the heavy-quark effective theory (HQET) for the operators involving one effective heavy quark and light degrees of freedom are completely integrable in some cases and are related to spin chain models with the Hamiltonian commuting with the nondiagonal entry C( u) of the monodromy matrix. In this work we provide a more complete mathematical treatment of such spin chains in the QISM framework. We also discuss the relation of integrable models that appear in the HQET context with the large-spin limit of integrable models in QCD with light quarks. We find that the conserved charges and the "ground state" wave functions in HQET models can be obtained from the light-quark counterparts in a certain scaling limit.
Birch regeneration: a stochastic model
William B. Leak
1968-01-01
The regeneration of a clearcutting with paper or yellow birch is expressed as an elementary stochastic (probabalistic) model that is computationally similar to an absorbing Markov chain. In the general case, the model contains 29 states beginning with the development of a flower (ament) and terminating with the abortion of a flower or seed, or the development of an...
Pranevicius, Henrikas; Pranevicius, Mindaugas; Pranevicius, Osvaldas; Bukauskas, Feliksas F.
2015-01-01
The primary goal of this work was to study advantages of numerical methods used for the creation of continuous time Markov chain models (CTMC) of voltage gating of gap junction (GJ) channels composed of connexin protein. This task was accomplished by describing gating of GJs using the formalism of the stochastic automata networks (SANs), which allowed for very efficient building and storing of infinitesimal generator of the CTMC that allowed to produce matrices of the models containing a distinct block structure. All of that allowed us to develop efficient numerical methods for a steady-state solution of CTMC models. This allowed us to accelerate CPU time, which is necessary to solve CTMC models, ∼20 times. PMID:25705700
Naik, Mandar T.; Huang, Tai-Huang
2004-01-01
The lipoic acid bearing domain (hbLBD) of human mitochondrial branched chain α-ketoacid dehydrogenase (BCKD) plays important role of substrate channeling in oxidative decarboxylation of the branched chain α-ketoacids. Recently hbLBD has been found to follow two-step folding mechanism without detectable presence of stable or kinetic intermediates. The present study describes the conformational stability underlying the folding of this small β-barrel domain. Thermal denaturation in presence of urea and isothermal urea denaturation titrations are used to evaluate various thermodynamic parameters defining the equilibrium unfolding. The linear extrapolation model successfully describes the two-step; native state ↔denatured state unfolding transition of hbLBD. The average temperature of maximum stability of hbLBD is estimated as 295.6 ± 0.9 K. Cold denaturation of hbLBD is also predicted and discussed. PMID:15322287
Hora, Manuel; Carballo-Pacheco, Martin; Weber, Benedikt; Morris, Vanessa K.; Wittkopf, Antje; Buchner, Johannes; Strodel, Birgit; Reif, Bernd
2017-01-01
Antibody light chain amyloidosis is a rare disease caused by fibril formation of secreted immunoglobulin light chains (LCs). The huge variety of antibody sequences puts a serious challenge to drug discovery. The green tea polyphenol epigallocatechin-3-gallate (EGCG) is known to interfere with fibril formation in general. Here we present solution- and solid-state NMR studies as well as MD simulations to characterise the interaction of EGCG with LC variable domains. We identified two distinct EGCG binding sites, both of which include a proline as an important recognition element. The binding sites were confirmed by site-directed mutagenesis and solid-state NMR analysis. The EGCG-induced protein complexes are unstructured. We propose a general mechanistic model for EGCG binding to a conserved site in LCs. We find that EGCG reacts selectively with amyloidogenic mutants. This makes this compound a promising lead structure, that can handle the immense sequence variability of antibody LCs. PMID:28128355
Fundamentals of poly(lactic acid) microstructure, crystallization behavior, and properties
NASA Astrophysics Data System (ADS)
Kang, Shuhui
Poly(lactic acid) is an environmentally-benign biodegradable and sustainable thermoplastic material, which has found broad applications as food packaging films and as non-woven fibers. The crystallization and deformation mechanisms of the polymer are largely determined by the distribution of conformation and configuration. Knowledge of these mechanisms is needed to understand the mechanical and thermal properties on which processing conditions mainly depend. In conjunction with laser light scattering, Raman spectroscopy and normal coordinate analysis are used in this thesis to elucidate these properties. Vibrational spectroscopic theory, Flory's rotational isomeric state (RIS) theory, Gaussian chain statistics and statistical mechanics are used to relate experimental data to molecular chain structure. A refined RIS model is proposed, chain rigidity recalculated and chain statistics discussed. A Raman spectroscopic characterization method for crystalline and amorphous phase orientation has been developed. A shrinkage model is also proposed to interpret the dimensional stability for fibers and uni- or biaxially stretched films. A study of stereocomplexation formed by poly(l-lactic acid) and poly(d-lactic acid) is also presented.
Hennebicq, Emmanuelle; Deleener, Caroline; Brédas, Jean-Luc; Scholes, Gregory D; Beljonne, David
2006-08-07
The influence of chemical defects and conformational kinks on the nature of the lowest electronic excitations in phenylenevinylene-based polymers is assessed at the semiempirical quantum-chemical level. The amount of excited-state localization and the amplitude of through-space (Coulomb-like) versus through-bond (charge-transfer-like) interactions have been quantified by comparing the results provided by excitonic and supermolecular models. While excitation delocalization among conjugated segments delineated by the defects occurs in the acceptor configuration, self-confinement on individual chromophores follows from geometric relaxation in the excited-state donor configuration. The extent of excited-state localization is found to be sensitive to both the nature of the defect and the length of the conjugated chains. Implications for resonant energy transfer along conjugated polymer chains are discussed.
Optimal Control for Fast and Robust Generation of Entangled States in Anisotropic Heisenberg Chains
NASA Astrophysics Data System (ADS)
Zhang, Xiong-Peng; Shao, Bin; Zou, Jian
2017-05-01
Motivated by some recent results of the optimal control (OC) theory, we study anisotropic XXZ Heisenberg spin-1/2 chains with control fields acting on a single spin, with the aim of exploring how maximally entangled state can be prepared. To achieve the goal, we use a numerical optimization algorithm (e.g., the Krotov algorithm, which was shown to be capable of reaching the quantum speed limit) to search an optimal set of control parameters, and then obtain OC pulses corresponding to the target fidelity. We find that the minimum time for implementing our target state depending on the anisotropy parameter Δ of the model. Finally, we analyze the robustness of the obtained results for the optimal fidelities and the effectiveness of the Krotov method under some realistic conditions.
NASA Astrophysics Data System (ADS)
De Luca, Andrea; Collura, Mario; De Nardis, Jacopo
2017-07-01
We construct exact steady states of unitary nonequilibrium time evolution in the gapless XXZ spin-1/2 chain where integrability preserves ballistic spin transport at long times. We characterize the quasilocal conserved quantities responsible for this feature and introduce a computationally effective way to evaluate their expectation values on generic matrix product initial states. We employ this approach to reproduce the long-time limit of local observables in all quantum quenches which explicitly break particle-hole or time-reversal symmetry. We focus on a class of initial states supporting persistent spin currents and our predictions remarkably agree with numerical simulations at long times. Furthermore, we propose a protocol for this model where interactions, even when antiferromagnetic, are responsible for the unbounded growth of a macroscopic magnetic domain.
Modeling the solid-liquid phase transition in saturated triglycerides
NASA Astrophysics Data System (ADS)
Pink, David A.; Hanna, Charles B.; Sandt, Christophe; MacDonald, Adam J.; MacEachern, Ronald; Corkery, Robert; Rousseau, Dérick
2010-02-01
We investigated theoretically two competing published scenarios for the melting transition of the triglyceride trilaurin (TL): those of (1) Corkery et al. [Langmuir 23, 7241 (2007)], in which the average state of each TL molecule in the liquid phase is a discotic "Y" conformer whose three chains are dynamically twisted, with an average angle of ˜120° between them, and those of (2) Cebula et al. [J. Am. Oil Chem. Soc. 69, 130 (1992)], in which the liquid-state conformation of the TL molecule in the liquid phase is a nematic h∗-conformer whose three chains are in a modified "chair" conformation. We developed two competing models for the two scenarios, in which TL molecules are in a nematic compact-chair (or "h") conformation, with extended, possibly all-trans, chains at low-temperatures, and in either a Y conformation or an h∗ conformation in the liquid state at temperatures higher than the phase-transition temperature, T∗=319 K. We defined an h-Y model as a realization of the proposal of Corkery et al. [Langmuir 23, 7241 (2007)], and explored its predictions by mapping it onto an Ising model in a temperature-dependent field, performing a mean-field approximation, and calculating the transition enthalpy ΔH. We found that the most plausible realization of the h-Y model, as applied to the solid-liquid phase transition in TL, and likely to all saturated triglycerides, gave a value of ΔH in reasonable agreement with the experiment. We then defined an alternative h-h∗ model as a realization of the proposal of Cebula et al. [J. Am. Oil Chem. Soc. 69, 130 (1992)], in which the liquid phase exhibits an average symmetry breaking similar to an h conformation, but with twisted chains, to see whether it could describe the TL phase transition. The h-h∗ model gave a value of ΔH that was too small by a factor of ˜3-4. We also predicted the temperature dependence of the 1132 cm-1 Raman band for both models, and performed measurements of the ratios of three TL Raman bands in the temperature range of -20 °C≤T ≤90 °C. The experimental results were in accord with the predictions of the h-Y model and support the proposal of Corkery et al. [Langmuir 23, 7241 (2007)] that the liquid state is made up of molecules that are each, on average, in a Y conformation. Finally, we carried out computer simulations of minimal-model TLs in the liquid phase, and concluded that although the individual TL molecules are, on average, Y conformers, long-range discotic order is unlikely to exist.
Effects of ignoring baseline on modeling transitions from intact cognition to dementia.
Yu, Lei; Tyas, Suzanne L; Snowdon, David A; Kryscio, Richard J
2009-07-01
This paper evaluates the effect of ignoring baseline when modeling transitions from intact cognition to dementia with mild cognitive impairment (MCI) and global impairment (GI) as intervening cognitive states. Transitions among states are modeled by a discrete-time Markov chain having three transient (intact cognition, MCI, and GI) and two competing absorbing states (death and dementia). Transition probabilities depend on two covariates, age and the presence/absence of an apolipoprotein E-epsilon4 allele, through a multinomial logistic model with shared random effects. Results are illustrated with an application to the Nun Study, a cohort of 678 participants 75+ years of age at baseline and followed longitudinally with up to ten cognitive assessments per nun.
Duret, Steven; Guillier, Laurent; Hoang, Hong-Minh; Flick, Denis; Laguerre, Onrawee
2014-06-16
Deterministic models describing heat transfer and microbial growth in the cold chain are widely studied. However, it is difficult to apply them in practice because of several variable parameters in the logistic supply chain (e.g., ambient temperature varying due to season and product residence time in refrigeration equipment), the product's characteristics (e.g., pH and water activity) and the microbial characteristics (e.g., initial microbial load and lag time). This variability can lead to different bacterial growth rates in food products and has to be considered to properly predict the consumer's exposure and identify the key parameters of the cold chain. This study proposes a new approach that combines deterministic (heat transfer) and stochastic (Monte Carlo) modeling to account for the variability in the logistic supply chain and the product's characteristics. The model generates a realistic time-temperature product history , contrary to existing modeling whose describe time-temperature profile Contrary to existing approaches that use directly a time-temperature profile, the proposed model predicts product temperature evolution from the thermostat setting and the ambient temperature. The developed methodology was applied to the cold chain of cooked ham including, the display cabinet, transport by the consumer and the domestic refrigerator, to predict the evolution of state variables, such as the temperature and the growth of Listeria monocytogenes. The impacts of the input factors were calculated and ranked. It was found that the product's time-temperature history and the initial contamination level are the main causes of consumers' exposure. Then, a refined analysis was applied, revealing the importance of consumer behaviors on Listeria monocytogenes exposure. Copyright © 2014. Published by Elsevier B.V.
Adiabatically modeling quantum gates with two-site Heisenberg spins chain: Noise vs interferometry
NASA Astrophysics Data System (ADS)
Jipdi, M. N.; Tchoffo, M.; Fai, L. C.
2018-02-01
We study the Landau Zener (LZ) dynamics of a two-site Heisenberg spin chain assisted with noise and focus on the implementation of logic gates via the resulting quantum interference. We present the evidence of the quantum interference phenomenon in triplet spin states and confirm that, three-level systems mimic Landau-Zener-Stückelberg (LZS) interferometers with occupancies dependent on the effective phase. It emerges that, the critical parameters tailoring the system are obtained for constructive interferences where the two sets of the chain are found to be maximally entangled. Our findings demonstrate that the enhancement of the magnetic field strength suppresses noise effects; consequently, the noise severely impacts the occurrence of quantum interference for weak magnetic fields while for strong fields, quantum interference subsists and allows the modeling of universal sets of quantum gates.
Study of ordered hadron chains with the ATLAS detector
Aaboud, M.; Aad, G.; Abbott, B.; ...
2017-11-29
The analysis of the momentum difference between charged hadrons in high-energy proton-proton collisions is performed in order to study coherent particle production. The observed correlation pattern agrees with a model of a helical QCD string fragmenting into a chain of ground-state hadrons. A threshold momentum difference in the production of adjacent pairs of charged hadrons is observed, in agreement with model predictions. The presence of low-mass hadron chains also explains the emergence of charge-combination-dependent two-particle correlations commonly attributed to Bose-Einstein interference. Here, the data sample consists of 190 μb –1 of minimum-bias events collected with proton-proton collisions at a center-of-massmore » energy √s=7 TeV in the early low-luminosity data taking with the ATLAS detector at the LHC.« less
NASA Astrophysics Data System (ADS)
Gauthier, Nicolas; Fennell, Amy; Uldry, Anne-Christine; Delley, Bernard; Sibille, Romain; White, Jonathan; Niedermayer, Christof; Pomjakushin, Vladimir; Kenzelmann, Michel; Prevost, Bobby; Desilets-Benoit, Alexandre; Bianchi, Andrea D.; Dabkowska, Hanna A.; Nilsen, Goran; Regnault, Louis-Pierre
The simultaneous occurence of geometrical frustration and low dimensionality can lead to strongly correlated fluctuating ground states. In the SrLn2O4 compounds, the Ln magnetic ions form one-dimensional (1D) zig-zag chains that have both of these characteristics, offering a playground to study novel states of matter. In SrDy2O4, the two inequivalent Dy3+ sites are Ising-like with perpendicular easy-axes, favouring the decoupling of neighbouring zig-zag chains. No long range order is observed down to T = 60 mK in zero field but diffuse neutron scattering indicates short range correlations that are consistent with those of the 1D Ising zig-zag chain model. AC susceptibility measurements indicate a slowing down of the fluctuations at low temperatures. We attribute this behaviour to the domain walls in the zig-zag chains. Experimental evidence of a dimensionality crossover at low temperatures in SrDy2O4 suggest that the domains walls are trapped because of interchain interactions, precluding long-range order to the lowest temperatures.
Modeling and Computing of Stock Index Forecasting Based on Neural Network and Markov Chain
Dai, Yonghui; Han, Dongmei; Dai, Weihui
2014-01-01
The stock index reflects the fluctuation of the stock market. For a long time, there have been a lot of researches on the forecast of stock index. However, the traditional method is limited to achieving an ideal precision in the dynamic market due to the influences of many factors such as the economic situation, policy changes, and emergency events. Therefore, the approach based on adaptive modeling and conditional probability transfer causes the new attention of researchers. This paper presents a new forecast method by the combination of improved back-propagation (BP) neural network and Markov chain, as well as its modeling and computing technology. This method includes initial forecasting by improved BP neural network, division of Markov state region, computing of the state transition probability matrix, and the prediction adjustment. Results of the empirical study show that this method can achieve high accuracy in the stock index prediction, and it could provide a good reference for the investment in stock market. PMID:24782659
Forecasting client transitions in British Columbia's Long-Term Care Program.
Lane, D; Uyeno, D; Stark, A; Gutman, G; McCashin, B
1987-01-01
This article presents a model for the annual transitions of clients through various home and facility placements in a long-term care program. The model, an application of Markov chain analysis, is developed, tested, and applied to over 9,000 clients (N = 9,483) in British Columbia's Long Term Care Program (LTC) over the period 1978-1983. Results show that the model gives accurate forecasts of the progress of groups of clients from state to state in the long-term care system from time of admission until eventual death. Statistical methods are used to test the modeling hypothesis that clients' year-over-year transitions occur in constant proportions from state to state within the long-term care system. Tests are carried out by examining actual year-over-year transitions of each year's new admission cohort (1978-1983). Various subsets of the available data are analyzed and, after accounting for clear differences among annual cohorts, the most acceptable model of the actual client transition data occurred when clients were separated into male and female groups, i.e., the transition behavior of each group is describable by a different Markov model. To validate the model, we develop model estimates for the numbers of existing clients in each state of the long-term care system for the period (1981-1983) for which actual data are available. When these estimates are compared with the actual data, total weighted absolute deviations do not exceed 10 percent of actuals. Finally, we use the properties of the Markov chain probability transition matrix and simulation methods to develop three-year forecasts with prediction intervals for the distribution of the existing total clients into each state of the system. The tests, forecasts, and Markov model supplemental information are contained in a mechanized procedure suitable for a microcomputer. The procedure provides a powerful, efficient tool for decision makers planning facilities and services in response to the needs of long-term care clients. PMID:3121537
Su-Schrieffer-Heeger chain with one pair of [Formula: see text]-symmetric defects.
Jin, L; Wang, P; Song, Z
2017-07-19
The topologically nontrivial edge states induce [Formula: see text] transition in Su-Schrieffer-Heeger (SSH) chain with one pair of gain and loss at boundaries. In this study, we investigated a pair of [Formula: see text]-symmetric defects located inside the SSH chain, in particular, the defects locations are at the chain centre. The [Formula: see text] symmetry breaking of the bound states leads to the [Formula: see text] transition, the [Formula: see text]-symmetric phases and the localized states were studied. In the broken [Formula: see text]-symmetric phase, all energy levels break simultaneously in topologically trivial phase; however, two edge states in topologically nontrivial phase are free from the influence of the [Formula: see text]-symmetric defects. We discovered [Formula: see text]-symmetric bound states induced by the [Formula: see text]-symmetric local defects at the SSH chain centre. The [Formula: see text]-symmetric bound states significantly increase the [Formula: see text] transition threshold and coalesce to the topologically protected zero mode with vanishing probabilities on every other site of the left-half chain and the right-half chain, respectively.
Retrieve the Bethe states of quantum integrable models solved via the off-diagonal Bethe Ansatz
NASA Astrophysics Data System (ADS)
Zhang, Xin; Li, Yuan-Yuan; Cao, Junpeng; Yang, Wen-Li; Shi, Kangjie; Wang, Yupeng
2015-05-01
Based on the inhomogeneous T-Q relation constructed via the off-diagonal Bethe Ansatz, a systematic method for retrieving the Bethe-type eigenstates of integrable models without obvious reference state is developed by employing certain orthogonal basis of the Hilbert space. With the XXZ spin torus model and the open XXX spin- \\frac{1}{2} chain as examples, we show that for a given inhomogeneous T-Q relation and the associated Bethe Ansatz equations, the constructed Bethe-type eigenstate has a well-defined homogeneous limit.
NASA Astrophysics Data System (ADS)
Prodhan, Suryoday; Ramasesha, S.
2017-08-01
Singlet fission (SF) is a potential pathway for significant enhancement of efficiency in organic solar cells (OSC). In this paper, we study singlet fission in a pair of polyene molecules in two different stacking arrangements employing exact many-body wave packet dynamics. In the noninteracting model, the SF yield is absent. The individual molecules are treated within Hubbard and Pariser-Parr-Pople (PPP) models and the interaction between them involves transfer terms, intersite electron repulsions, and site-charge-bond-charge repulsion terms. Initial wave packet is constructed from excited singlet state of one molecule and ground state of the other. Time development of this wave packet under the influence of intermolecular interactions is followed within the Schrödinger picture by an efficient predictor-corrector scheme. In unsubstituted Hubbard and PPP chains, 2 1A excited singlet state leads to significant SF yield while the 1 1B state gives negligible fission yield. On substitution by donor-acceptor groups of moderate strength, the lowest excited state will have sufficient 2 1A character and hence results in significant SF yield. Because of rapid internal conversion, the nature of the lowest excited singlet will determine the SF contribution to OSC efficiency. Furthermore, we find the fission yield depends considerably on the stacking arrangement of the polyene molecules.
Entanglement spreading after a geometric quench in quantum spin chains
NASA Astrophysics Data System (ADS)
Alba, Vincenzo; Heidrich-Meisner, Fabian
2014-08-01
We investigate the entanglement spreading in the anisotropic spin-1/2 Heisenberg (XXZ) chain after a geometric quench. This corresponds to a sudden change of the geometry of the chain or, in the equivalent language of interacting fermions confined in a box trap, to a sudden increase of the trap size. The entanglement dynamics after the quench is associated with the ballistic propagation of a magnetization wave front. At the free fermion point (XX chain), the von Neumann entropy SA exhibits several intriguing dynamical regimes. Specifically, at short times a logarithmic increase is observed, similar to local quenches. This is accurately described by an analytic formula that we derive from heuristic arguments. At intermediate times partial revivals of the short-time dynamics are superposed with a power-law increase SA˜tα, with α <1. Finally, at very long times a steady state develops with constant entanglement entropy, apart from oscillations. As expected, since the model is integrable, we find that the steady state is nonthermal, although it exhibits extensive entanglement entropy. We also investigate the entanglement dynamics after the quench from a finite to the infinite chain (sudden expansion). While at long times the entanglement vanishes, we demonstrate that its relaxation dynamics exhibits a number of scaling properties. Finally, we discuss the short-time entanglement dynamics in the XXZ chain in the gapless phase. The same formula that describes the time dependence for the XX chain remains valid in the whole gapless phase.
Fidelity Witnesses for Fermionic Quantum Simulations
NASA Astrophysics Data System (ADS)
Gluza, M.; Kliesch, M.; Eisert, J.; Aolita, L.
2018-05-01
The experimental interest and developments in quantum spin-1 /2 chains has increased uninterruptedly over the past decade. In many instances, the target quantum simulation belongs to the broader class of noninteracting fermionic models, constituting an important benchmark. In spite of this class being analytically efficiently tractable, no direct certification tool has yet been reported for it. In fact, in experiments, certification has almost exclusively relied on notions of quantum state tomography scaling very unfavorably with the system size. Here, we develop experimentally friendly fidelity witnesses for all pure fermionic Gaussian target states. Their expectation value yields a tight lower bound to the fidelity and can be measured efficiently. We derive witnesses in full generality in the Majorana-fermion representation and apply them to experimentally relevant spin-1 /2 chains. Among others, we show how to efficiently certify strongly out-of-equilibrium dynamics in critical Ising chains. At the heart of the measurement scheme is a variant of importance sampling specially tailored to overlaps between covariance matrices. The method is shown to be robust against finite experimental-state infidelities.
Assessing significance in a Markov chain without mixing.
Chikina, Maria; Frieze, Alan; Pegden, Wesley
2017-03-14
We present a statistical test to detect that a presented state of a reversible Markov chain was not chosen from a stationary distribution. In particular, given a value function for the states of the Markov chain, we would like to show rigorously that the presented state is an outlier with respect to the values, by establishing a [Formula: see text] value under the null hypothesis that it was chosen from a stationary distribution of the chain. A simple heuristic used in practice is to sample ranks of states from long random trajectories on the Markov chain and compare these with the rank of the presented state; if the presented state is a [Formula: see text] outlier compared with the sampled ranks (its rank is in the bottom [Formula: see text] of sampled ranks), then this observation should correspond to a [Formula: see text] value of [Formula: see text] This significance is not rigorous, however, without good bounds on the mixing time of the Markov chain. Our test is the following: Given the presented state in the Markov chain, take a random walk from the presented state for any number of steps. We prove that observing that the presented state is an [Formula: see text]-outlier on the walk is significant at [Formula: see text] under the null hypothesis that the state was chosen from a stationary distribution. We assume nothing about the Markov chain beyond reversibility and show that significance at [Formula: see text] is best possible in general. We illustrate the use of our test with a potential application to the rigorous detection of gerrymandering in Congressional districting.
Assessing significance in a Markov chain without mixing
Chikina, Maria; Frieze, Alan; Pegden, Wesley
2017-01-01
We present a statistical test to detect that a presented state of a reversible Markov chain was not chosen from a stationary distribution. In particular, given a value function for the states of the Markov chain, we would like to show rigorously that the presented state is an outlier with respect to the values, by establishing a p value under the null hypothesis that it was chosen from a stationary distribution of the chain. A simple heuristic used in practice is to sample ranks of states from long random trajectories on the Markov chain and compare these with the rank of the presented state; if the presented state is a 0.1% outlier compared with the sampled ranks (its rank is in the bottom 0.1% of sampled ranks), then this observation should correspond to a p value of 0.001. This significance is not rigorous, however, without good bounds on the mixing time of the Markov chain. Our test is the following: Given the presented state in the Markov chain, take a random walk from the presented state for any number of steps. We prove that observing that the presented state is an ε-outlier on the walk is significant at p=2ε under the null hypothesis that the state was chosen from a stationary distribution. We assume nothing about the Markov chain beyond reversibility and show that significance at p≈ε is best possible in general. We illustrate the use of our test with a potential application to the rigorous detection of gerrymandering in Congressional districting. PMID:28246331
Zipursky, Simona; Tevi-Benissan, Carole; Djingarey, Mamoudou Harouna; Gbedonou, Placide; Youssouf, Brahim Oumar; Zaffran, Michel
2014-01-01
Abstract Objective To evaluate the potential economic benefits of keeping a meningitis A vaccine at or near ambient temperature for up to 4 days during a mass vaccination campaign. Methods During a 10-day mass vaccination campaign against meningitis A in three regions of Chad in 2011, the costs associated with storage and transport of the vaccine in a traditional cold chain system were evaluated. A mathematical model was used to estimate the savings that could have been achieved if the vaccine had been stored at or near ambient temperature – in a “controlled temperature” chain – at the peripheral levels of the supply chain system. Findings The cost of the cold chain and associated logistics used in the campaign in Chad was 0.24 United States dollars (US$) per person vaccinated. In the modelled scenario for a controlled temperature chain, however, these costs dropped by 50% and were estimated to be only US$ 0.12 per person vaccinated. Conclusion The implementation of a “controlled temperature” chain at the most peripheral levels of the supply chain system – assuming no associated loss of vaccine potency, efficacy or safety – could result in major economic benefits and allow vaccine coverage to be extended in low-resource settings. PMID:24623901
Model of directed lines for square ice with second-neighbor and third-neighbor interactions
NASA Astrophysics Data System (ADS)
Kirov, Mikhail V.
2018-02-01
The investigation of the properties of nanoconfined systems is one of the most rapidly developing scientific fields. Recently it has been established that water monolayer between two graphene sheets forms square ice. Because of the energetic disadvantage, in the structure of the square ice there are no longitudinally arranged molecules. The result is that the structure is formed by unidirectional straight-lines of hydrogen bonds only. A simple but accurate discrete model of square ice with second-neighbor and third-neighbor interactions is proposed. According to this model, the ground state includes all configurations which do not contain three neighboring unidirectional chains of hydrogen bonds. Each triplet increases the energy by the same value. This new model differs from an analogous model with long-range interactions where in the ground state all neighboring chains are antiparallel. The new model is suitable for the corresponding system of point electric (and magnetic) dipoles on the square lattice. It allows separately estimating the different contributions to the total binding energy and helps to understand the properties of infinite monolayers and finite nanostructures. Calculations of the binding energy for square ice and for point dipole system are performed using the packages TINKER and LAMMPS.
Propagating synchrony in feed-forward networks
Jahnke, Sven; Memmesheimer, Raoul-Martin; Timme, Marc
2013-01-01
Coordinated patterns of precisely timed action potentials (spikes) emerge in a variety of neural circuits but their dynamical origin is still not well understood. One hypothesis states that synchronous activity propagating through feed-forward chains of groups of neurons (synfire chains) may dynamically generate such spike patterns. Additionally, synfire chains offer the possibility to enable reliable signal transmission. So far, mostly densely connected chains, often with all-to-all connectivity between groups, have been theoretically and computationally studied. Yet, such prominent feed-forward structures have not been observed experimentally. Here we analytically and numerically investigate under which conditions diluted feed-forward chains may exhibit synchrony propagation. In addition to conventional linear input summation, we study the impact of non-linear, non-additive summation accounting for the effect of fast dendritic spikes. The non-linearities promote synchronous inputs to generate precisely timed spikes. We identify how non-additive coupling relaxes the conditions on connectivity such that it enables synchrony propagation at connectivities substantially lower than required for linearly coupled chains. Although the analytical treatment is based on a simple leaky integrate-and-fire neuron model, we show how to generalize our methods to biologically more detailed neuron models and verify our results by numerical simulations with, e.g., Hodgkin Huxley type neurons. PMID:24298251
NASA Astrophysics Data System (ADS)
Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.
2016-09-01
Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.
Chain and ladder models with two-body interactions and analytical ground states
NASA Astrophysics Data System (ADS)
Manna, Sourav; Nielsen, Anne E. B.
2018-05-01
We consider a family of spin-1 /2 models with few-body, SU(2)-invariant Hamiltonians and analytical ground states related to the one-dimensional (1D) Haldane-Shastry wave function. The spins are placed on the surface of a cylinder, and the standard 1D Haldane-Shastry model is obtained by placing the spins with equal spacing in a circle around the cylinder. Here, we show that another interesting family of models with two-body exchange interactions is obtained if we instead place the spins along one or two lines parallel to the cylinder axis, giving rise to chain and ladder models, respectively. We can change the scale along the cylinder axis without changing the radius of the cylinder. This gives us a parameter that controls the ratio between the circumference of the cylinder and all other length scales in the system. We use Monte Carlo simulations and analytical investigations to study how this ratio affects the properties of the models. If the ratio is large, we find that the two legs of the ladder decouple into two chains that are in a critical phase with Haldane-Shastry-like properties. If the ratio is small, the wave function reduces to a product of singlets. In between, we find that the behavior of the correlations and the Renyi entropy depends on the distance considered. For small distances the behavior is critical, and for long distances the correlations decay exponentially and the entropy shows an area law behavior. The distance up to which there is critical behavior gets larger as the ratio increases.
Carrasco, José A; Finkel, Federico; González-López, Artemio; Rodríguez, Miguel A
2017-01-01
We study the critical behavior and the ground-state entanglement of a large class of su(1|1) supersymmetric spin chains with a general (not necessarily monotonic) dispersion relation. We show that this class includes several relevant models, with both short- and long-range interactions of a simple form. We determine the low temperature behavior of the free energy per spin, and deduce that the models considered have a critical phase in the same universality class as a (1+1)-dimensional conformal field theory (CFT) with central charge equal to the number of connected components of the Fermi sea. We also study the Rényi entanglement entropy of the ground state, deriving its asymptotic behavior as the block size tends to infinity. In particular, we show that this entropy exhibits the logarithmic growth characteristic of (1+1)-dimensional CFTs and one-dimensional (fermionic) critical lattice models, with a central charge consistent with the low-temperature behavior of the free energy. Our results confirm the widely believed conjecture that the critical behavior of fermionic lattice models is completely determined by the topology of their Fermi surface.
NASA Astrophysics Data System (ADS)
Carrasco, José A.; Finkel, Federico; González-López, Artemio; Rodríguez, Miguel A.
2017-01-01
We study the critical behavior and the ground-state entanglement of a large class of su (1 |1 ) supersymmetric spin chains with a general (not necessarily monotonic) dispersion relation. We show that this class includes several relevant models, with both short- and long-range interactions of a simple form. We determine the low temperature behavior of the free energy per spin, and deduce that the models considered have a critical phase in the same universality class as a (1 +1 ) -dimensional conformal field theory (CFT) with central charge equal to the number of connected components of the Fermi sea. We also study the Rényi entanglement entropy of the ground state, deriving its asymptotic behavior as the block size tends to infinity. In particular, we show that this entropy exhibits the logarithmic growth characteristic of (1 +1 ) -dimensional CFTs and one-dimensional (fermionic) critical lattice models, with a central charge consistent with the low-temperature behavior of the free energy. Our results confirm the widely believed conjecture that the critical behavior of fermionic lattice models is completely determined by the topology of their Fermi surface.
Theory of optical transitions in conjugated polymers. II. Real systems
NASA Astrophysics Data System (ADS)
Marcus, Max; Tozer, Oliver Robert; Barford, William
2014-10-01
The theory of optical transitions developed in Barford and Marcus ["Theory of optical transitions in conjugated polymers. I. Ideal systems," J. Chem. Phys. 141, 164101 (2014)] for linear, ordered polymer chains is extended in this paper to model conformationally disordered systems. Our key result is that in the Born-Oppenheimer regime the emission intensities are proportional to S(1)/⟨IPR⟩, where S(1) is the Huang-Rhys parameter for a monomer. ⟨IPR⟩ is the average inverse participation ratio for the emitting species, i.e., local exciton ground states (LEGSs). Since the spatial coherence of LEGSs determines the spatial extent of chromophores, the significance of this result is that it directly relates experimental observables to chromophore sizes (where ⟨IPR⟩ is half the mean chromophore size in monomer units). This result is independent of the chromophore shape, because of the Born-Oppenheimer factorization of the many body wavefunction. We verify this prediction by density matrix renormalization group (DMRG) calculations of the Frenkel-Holstein model in the adiabatic limit for both linear, disordered chains and for coiled, ordered chains. We also model optical spectra for poly(p-phenylene) and poly(p-phenylene-vinylene) oligomers and polymers. For oligomers, we solve the fully quantized Frenkel-Holstein model via the DMRG method. For polymers, we use the much simpler method of solving the one-particle Frenkel model and employ the Born-Oppenheimer expressions relating the effective Franck-Condon factor of a chromophore to its inverse participation ratio. We show that increased disorder decreases chromophore sizes and increases the inhomogeneous broadening, but has a non-monotonic effect on transition energies. We also show that as planarizing the polymer chain increases the exciton band width, it causes the chromophore sizes to increase, the transition energies to decrease, and the broadening to decrease. Finally, we show that the absorption spectra are more broadened than the emission spectra and that the broadening of the absorption spectra increases as the chains become more coiled. This is primarily because absorption occurs to both LEGSs and quasi-extended exciton states (QEESs), and QEES acquire increased intensity as chromophores bend, while emission only occurs from LEGSs.
Tataru, Paula; Hobolth, Asger
2011-12-05
Continuous time Markov chains (CTMCs) is a widely used model for describing the evolution of DNA sequences on the nucleotide, amino acid or codon level. The sufficient statistics for CTMCs are the time spent in a state and the number of changes between any two states. In applications past evolutionary events (exact times and types of changes) are unaccessible and the past must be inferred from DNA sequence data observed in the present. We describe and implement three algorithms for computing linear combinations of expected values of the sufficient statistics, conditioned on the end-points of the chain, and compare their performance with respect to accuracy and running time. The first algorithm is based on an eigenvalue decomposition of the rate matrix (EVD), the second on uniformization (UNI), and the third on integrals of matrix exponentials (EXPM). The implementation in R of the algorithms is available at http://www.birc.au.dk/~paula/. We use two different models to analyze the accuracy and eight experiments to investigate the speed of the three algorithms. We find that they have similar accuracy and that EXPM is the slowest method. Furthermore we find that UNI is usually faster than EVD.
Computer Simulations of Polytetrafluoroethylene in the Solid State
NASA Astrophysics Data System (ADS)
Holt, D. B.; Farmer, B. L.; Eby, R. K.; Macturk, K. S.
1996-03-01
Force field parameters (Set I) for fluoropolymers were previously derived from MOPAC AM1 semiempirical data on model molecules. A second set (Set II) was derived from the AM1 results augmented by ab initio calculations. Both sets yield reasonable helical and phase II packing structures for polytetrafluoroethylene (PTFE) chains. However, Set I and Set II differ in the strength of van der Waals interactions, with Set II having deeper potential wells (order of magnitude). To differentiate which parameter set provides a better description of PTFE behavior, molecular dynamics simulations have been performed with Biosym Discover on clusters of PTFE chains which begin in a phase II packing environment. Added to the model are artificial constraints which allow the simulation of thermal expansion without having to define periodic boundary conditions for each specific temperature of interest. The preliminary dynamics simulations indicate that the intra- and intermolecular interactions provided by Set I are too weak. The degree of helical disorder and chain motion are high even at temperatures well below the phase II-phase IV transition temperature (19 C). Set II appears to yield a better description of PTFE in the solid state.
Dichromatic State Sum Models for Four-Manifolds from Pivotal Functors
NASA Astrophysics Data System (ADS)
Bärenz, Manuel; Barrett, John
2017-11-01
A family of invariants of smooth, oriented four-dimensional manifolds is defined via handle decompositions and the Kirby calculus of framed link diagrams. The invariants are parametrised by a pivotal functor from a spherical fusion category into a ribbon fusion category. A state sum formula for the invariant is constructed via the chain-mail procedure, so a large class of topological state sum models can be expressed as link invariants. Most prominently, the Crane-Yetter state sum over an arbitrary ribbon fusion category is recovered, including the nonmodular case. It is shown that the Crane-Yetter invariant for nonmodular categories is stronger than signature and Euler invariant. A special case is the four-dimensional untwisted Dijkgraaf-Witten model. Derivations of state space dimensions of TQFTs arising from the state sum model agree with recent calculations of ground state degeneracies in Walker-Wang models. Relations to different approaches to quantum gravity such as Cartan geometry and teleparallel gravity are also discussed.
Dichromatic State Sum Models for Four-Manifolds from Pivotal Functors
NASA Astrophysics Data System (ADS)
Bärenz, Manuel; Barrett, John
2018-06-01
A family of invariants of smooth, oriented four-dimensional manifolds is defined via handle decompositions and the Kirby calculus of framed link diagrams. The invariants are parametrised by a pivotal functor from a spherical fusion category into a ribbon fusion category. A state sum formula for the invariant is constructed via the chain-mail procedure, so a large class of topological state sum models can be expressed as link invariants. Most prominently, the Crane-Yetter state sum over an arbitrary ribbon fusion category is recovered, including the nonmodular case. It is shown that the Crane-Yetter invariant for nonmodular categories is stronger than signature and Euler invariant. A special case is the four-dimensional untwisted Dijkgraaf-Witten model. Derivations of state space dimensions of TQFTs arising from the state sum model agree with recent calculations of ground state degeneracies in Walker-Wang models. Relations to different approaches to quantum gravity such as Cartan geometry and teleparallel gravity are also discussed.
Brownian dynamics of a protein-polymer chain complex in a solid-state nanopore
NASA Astrophysics Data System (ADS)
Wells, Craig C.; Melnikov, Dmitriy V.; Gracheva, Maria E.
2017-08-01
We study the movement of a polymer attached to a large protein inside a nanopore in a thin silicon dioxide membrane submerged in an electrolyte solution. We use Brownian dynamics to describe the motion of a negatively charged polymer chain of varying lengths attached to a neutral protein modeled as a spherical bead with a radius larger than that of the nanopore, allowing the chain to thread the nanopore but preventing it from translocating. The motion of the protein-polymer complex within the pore is also compared to that of a freely translocating polymer. Our results show that the free polymer's standard deviations in the direction normal to the pore axis is greater than that of the protein-polymer complex. We find that restrictions imposed by the protein, bias, and neighboring chain segments aid in controlling the position of the chain in the pore. Understanding the behavior of the protein-polymer chain complex may lead to methods that improve molecule identification by increasing the resolution of ionic current measurements.
Brownian dynamics of a protein-polymer chain complex in a solid-state nanopore.
Wells, Craig C; Melnikov, Dmitriy V; Gracheva, Maria E
2017-08-07
We study the movement of a polymer attached to a large protein inside a nanopore in a thin silicon dioxide membrane submerged in an electrolyte solution. We use Brownian dynamics to describe the motion of a negatively charged polymer chain of varying lengths attached to a neutral protein modeled as a spherical bead with a radius larger than that of the nanopore, allowing the chain to thread the nanopore but preventing it from translocating. The motion of the protein-polymer complex within the pore is also compared to that of a freely translocating polymer. Our results show that the free polymer's standard deviations in the direction normal to the pore axis is greater than that of the protein-polymer complex. We find that restrictions imposed by the protein, bias, and neighboring chain segments aid in controlling the position of the chain in the pore. Understanding the behavior of the protein-polymer chain complex may lead to methods that improve molecule identification by increasing the resolution of ionic current measurements.
Majorana spin liquids, topology, and superconductivity in ladders
NASA Astrophysics Data System (ADS)
Le Hur, Karyn; Soret, Ariane; Yang, Fan
2017-11-01
We theoretically address spin chain analogs of the Kitaev quantum spin model on the honeycomb lattice. The emergent quantum spin-liquid phases or Anderson resonating valence-bond (RVB) states can be understood, as an effective model, in terms of p -wave superconductivity and Majorana fermions. We derive a generalized phase diagram for the two-leg ladder system with tunable interaction strengths between chains allowing us to vary the shape of the lattice (from square to honeycomb ribbon or brickwall ladder). We evaluate the winding number associated with possible emergent (topological) gapless modes at the edges. In the Az phase, as a result of the emergent Z2 gauge fields and π -flux ground state, one may build spin-1/2 (loop) qubit operators by analogy to the toric code. In addition, we show how the intermediate gapless B phase evolves in the generalized ladder model. For the brick-wall ladder, the B phase is reduced to one line, which is analyzed through perturbation theory in a rung tensor product states representation and bosonization. Finally, we show that doping with a few holes can result in the formation of hole pairs and leads to a mapping with the Su-Schrieffer-Heeger model in polyacetylene; a superconducting-insulating quantum phase transition for these hole pairs is accessible, as well as related topological properties.
Chapter 15: Using System Dynamics to Model Industry's Developmental Response to Energy Policy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bush, Brian; Inman, Daniel; Newes, Emily
In this chapter we explore the potential development of the biofuels industry using the Biomass Scenario Model (BSM), a system dynamics model developed at the National Renewable Energy Laboratory through the support of the U.S. Department of Energy. The BSM is designed to analyze the implications of policy on the development of the supply chain for biofuels in the United States. It explicitly represents the behavior of decision makers such as farmers, investors, fueling station owners, and consumers. We analyze several illustrative case studies that explore a range of policies and discuss how incentives interact with individual parts of themore » supply chain as well as the industry as a whole. The BSM represents specific incentives that are intended to approximate policy in the form of selected laws and regulations. Through characterizing the decision making behaviors of economic actors within the supply chain that critically influence the adoption rate of new biofuels production technologies and demonstrating synergies among policies, we find that incentives with coordinated impacts on each major element of the supply chain catalyze net effects of decision maker behavior such that the combined incentives are greater than the summed effects of individual incentives in isolation.« less
Efficient quantum state transfer in an engineered chain of quantum bits
NASA Astrophysics Data System (ADS)
Sandberg, Martin; Knill, Emanuel; Kapit, Eliot; Vissers, Michael R.; Pappas, David P.
2016-03-01
We present a method of performing quantum state transfer in a chain of superconducting quantum bits. Our protocol is based on engineering the energy levels of the qubits in the chain and tuning them all simultaneously with an external flux bias. The system is designed to allow sequential adiabatic state transfers, resulting in on-demand quantum state transfer from one end of the chain to the other. Numerical simulations of the master equation using realistic parameters for capacitive nearest-neighbor coupling, energy relaxation, and dephasing show that fast, high-fidelity state transfer should be feasible using this method.
Hopf-link topological nodal-loop semimetals
NASA Astrophysics Data System (ADS)
Zhou, Yao; Xiong, Feng; Wan, Xiangang; An, Jin
2018-04-01
We construct a generic two-band model which can describe topological semimetals with multiple closed nodal loops. All the existing multi-nodal-loop semimetals, including the nodal-net, nodal-chain, and Hopf-link states, can be examined within the same framework. Based on a two-nodal-loop model, the corresponding drumhead surface states for these topologically different bulk states are studied and compared with each other. The connection of our model with Hopf insulators is also discussed. Furthermore, to identify experimentally these topologically different semimetal states, especially to distinguish the Hopf-link from unlinked ones, we also investigate their Landau levels. It is found that the Hopf-link state can be characterized by the existence of a quadruply degenerate zero-energy Landau band, regardless of the direction of the magnetic field.
Boechat, B; Florencio, J; Saguia, A; de Alcantara Bonfim, O F
2014-03-01
We study the ground-state properties of a spin-1/2 model on a chain containing four-spin Ising-like interactions in the presence of both transverse and longitudinal magnetic fields. We use entanglement entropy and finite-size scaling methods to obtain the phase diagrams of the model. Our numerical calculations reveal a rich variety of phases and the existence of multicritical points in the system. We identify phases with both ferromagnetic and antiferromagnetic orderings. We also find periodically modulated orderings formed by a cluster of like spins followed by another cluster of opposite like spins. The quantum phases in the model are found to be separated by either first- or second-order transition lines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cirilo Antonio, N.; Manojlovic, N.; Departamento de Matematica, FCT, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro
sl{sub 2} Gaudin model with jordanian twist is studied. This system can be obtained as the semiclassical limit of the XXX spin chain deformed by the jordanian twist. The appropriate creation operators that yield the Bethe states of the Gaudin model and consequently its spectrum are defined. Their commutation relations with the generators of the corresponding loop algebra as well as with the generating function of integrals of motion are given. The inner products and norms of Bethe states and the relation to the solutions of the Knizhnik-Zamolodchikov equations are discussed.
NASA Astrophysics Data System (ADS)
Zhao, Xian-Geng; Jia, Sue-Tang
1992-09-01
The motion of hopping particles on an infinite chain is investigated. The model is characterized by the correlations between states due to exchange sites. The analytic solutions for this system are discussed in general case. For some special cases, exact results are obtained with the help of explicit calculations of propagators and mean square displacement deviation. Both probability propagators for the creation and annihilation of two particles or for the deformation and formation of Frenkel excitons are indicated.
The ground state of the Frenkel-Kontorova model
NASA Astrophysics Data System (ADS)
Babushkin, A. Yu.; Abkaryan, A. K.; Dobronets, B. S.; Krasikov, V. S.; Filonov, A. N.
2016-09-01
The continual approximation of the ground state of the discrete Frenkel-Kontorova model is tested using a symmetric algorithm of numerical simulation. A "kaleidoscope effect" is found, which means that the curves representing the dependences of the relative extension of an N-atom chain vary periodically with increasing N. Stairs of structural transitions for N ≫ 1 are analyzed by the channel selection method with the approximation N = ∞. Images of commensurable and incommensurable structures are constructed. The commensurable-incommensurable phase transitions are stepwise.
The topological basis expression of four-qubit XXZ spin chain with twist boundary condition
NASA Astrophysics Data System (ADS)
Du, Guijiao; Xue, Kang; Zhou, Chengcheng; Sun, Chunfang; Wang, Gangcheng
2013-07-01
We investigate the XXZ model's characteristic with the twisted boundary condition and the topological basis expression. Owing to twist boundary condition, the ground state energy will changing back and forth between E_{13} and E_{15} by modulate the parameter φ . By using TLA generators, the XXZ model's Hamiltonian can be constructed. All the eigenstates can be expressed by topological basis, and the whole of eigenstates' entanglement are maximally entangle states (Q(|φ _i> )=1).
NASA Astrophysics Data System (ADS)
Liu, Zugang
Network systems, including transportation and logistic systems, electric power generation and distribution networks as well as financial networks, provide the critical infrastructure for the functioning of our societies and economies. The understanding of the dynamic behavior of such systems is also crucial to national security and prosperity. The identification of new connections between distinct network systems is the inspiration for the research in this dissertation. In particular, I answer two questions raised by Beckmann, McGuire, and Winsten (1956) and Copeland (1952) over half a century ago, which are, respectively, how are electric power flows related to transportation flows and does money flow like water or electricity? In addition, in this dissertation, I achieve the following: (1) I establish the relationships between transportation networks and three other classes of complex network systems: supply chain networks, electric power generation and transmission networks, and financial networks with intermediation. The establishment of such connections provides novel theoretical insights as well as new pricing mechanisms, and efficient computational methods. (2) I develop new modeling frameworks based on evolutionary variational inequality theory that capture the dynamics of such network systems in terms of the time-varying flows and incurred costs, prices, and, where applicable, profits. This dissertation studies the dynamics of such network systems by addressing both internal competition and/or cooperation, and external changes, such as varying costs and demands. (3) I focus, in depth, on electric power supply chains. By exploiting the relationships between transportation networks and electric power supply chains, I develop a large-scale network model that integrates electric power supply chains and fuel supply markets. The model captures both the economic transactions as well as the physical transmission constraints. The model is then applied to the New England electric power supply chain consisting of 6 states, 5 fuel types, 82 power generators, with a total of 573 generating units, and 10 demand markets. The empirical case study demonstrates that the regional electricity prices simulated by the model match very well the actual electricity prices in New England. I also utilize the model to study interactions between electric power supply chains and energy fuel markets.
Theoretical description of the decays Λb→Λ(*)(1/2±,3/2±)+J /ψ
NASA Astrophysics Data System (ADS)
Gutsche, Thomas; Ivanov, Mikhail A.; Körner, Jürgen G.; Lyubovitskij, Valery E.; Lyubushkin, Vladimir V.; Santorelli, Pietro
2017-07-01
We calculate the invariant and helicity amplitudes for the transitions Λb→Λ(*)(JP)+J /ψ , where the Λ(*)(JP) are Λ (s u d )-type ground and excited states with JP quantum numbers JP=1/2± , 3/2± . The calculations are performed in the framework of a covariant confined quark model previously developed by us. We find that the values of the helicity amplitudes for the Λ*(1520 ,3/2-) and the Λ*(1890 ,3/2+) are suppressed compared with those for the ground state Λ (1116 ,1/2+) and the excited state Λ*(1405 ,1/2-). This analysis is important for the identification of the hidden charm pentaquark states Pc+(4380 ) and Pc+(4450 ) which were discovered in the decay chain Λb0→Pc+(→p J /ψ )+K- because the cascade decay chain Λb→Λ*(3/2±)(→p K-)+J /ψ involves the same final state.
cycle inventories Economic and environmentally extended input-output analysis Sustainable design and models for sustainable design and optimization of processes, supply chains and life cycles Interactions engineering design and assessment." Doctoral dissertation, The Ohio State University, 2015. Hanes
Principles of protein folding--a perspective from simple exact models.
Dill, K. A.; Bromberg, S.; Yue, K.; Fiebig, K. M.; Yee, D. P.; Thomas, P. D.; Chan, H. S.
1995-01-01
General principles of protein structure, stability, and folding kinetics have recently been explored in computer simulations of simple exact lattice models. These models represent protein chains at a rudimentary level, but they involve few parameters, approximations, or implicit biases, and they allow complete explorations of conformational and sequence spaces. Such simulations have resulted in testable predictions that are sometimes unanticipated: The folding code is mainly binary and delocalized throughout the amino acid sequence. The secondary and tertiary structures of a protein are specified mainly by the sequence of polar and nonpolar monomers. More specific interactions may refine the structure, rather than dominate the folding code. Simple exact models can account for the properties that characterize protein folding: two-state cooperativity, secondary and tertiary structures, and multistage folding kinetics--fast hydrophobic collapse followed by slower annealing. These studies suggest the possibility of creating "foldable" chain molecules other than proteins. The encoding of a unique compact chain conformation may not require amino acids; it may require only the ability to synthesize specific monomer sequences in which at least one monomer type is solvent-averse. PMID:7613459
ASSESSMENT OF HOUSEHOLD CARBON FOOTPRINT REDUCTION POTENTIALS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kramer, Klaas Jan; Homan, Greg; Brown, Rich
2009-04-15
The term ?household carbon footprint? refers to the total annual carbon emissions associated with household consumption of energy, goods, and services. In this project, Lawrence Berkeley National Laboratory developed a carbon footprint modeling framework that characterizes the key underlying technologies and processes that contribute to household carbon footprints in California and the United States. The approach breaks down the carbon footprint by 35 different household fuel end uses and 32 different supply chain fuel end uses. This level of end use detail allows energy and policy analysts to better understand the underlying technologies and processes contributing to the carbon footprintmore » of California households. The modeling framework was applied to estimate the annual home energy and supply chain carbon footprints of a prototypical California household. A preliminary assessment of parameter uncertainty associated with key model input data was also conducted. To illustrate the policy-relevance of this modeling framework, a case study was conducted that analyzed the achievable carbon footprint reductions associated with the adoption of energy efficient household and supply chain technologies.« less
10B+α states with chain-like structures in 14N
NASA Astrophysics Data System (ADS)
Kanada-En'yo, Yoshiko
2015-12-01
I investigate 10B+α -cluster states of 14N with a 10B+α -cluster model. Near the α -decay threshold energy, I obtain Kπ=3+ and Kπ=1+ rotational bands having 10B(3+) +α and 10B(1+) +α components, respectively. I assign the bandhead state of the Kπ=3+ band to the experimental 3+ at Ex=13.19 MeV of 14N observed in α scattering reactions by 10B and show that the calculated α -decay width is consistent with the experimental data. I discuss an α -cluster motion around the 10B cluster and show that the Kπ=3+ and Kπ=1+ rotational bands contain an enhanced component of a linear-chain 3 α configuration, in which an α cluster is localized in the longitudinal direction around the deformed 10B cluster.
Multiple spatially localized dynamical states in friction-excited oscillator chains
NASA Astrophysics Data System (ADS)
Papangelo, A.; Hoffmann, N.; Grolet, A.; Stender, M.; Ciavarella, M.
2018-03-01
Friction-induced vibrations are known to affect many engineering applications. Here, we study a chain of friction-excited oscillators with nearest neighbor elastic coupling. The excitation is provided by a moving belt which moves at a certain velocity vd while friction is modelled with an exponentially decaying friction law. It is shown that in a certain range of driving velocities, multiple stable spatially localized solutions exist whose dynamical behavior (i.e. regular or irregular) depends on the number of oscillators involved in the vibration. The classical non-repeatability of friction-induced vibration problems can be interpreted in light of those multiple stable dynamical states. These states are found within a "snaking-like" bifurcation pattern. Contrary to the classical Anderson localization phenomenon, here the underlying linear system is perfectly homogeneous and localization is solely triggered by the friction nonlinearity.
Enhancing Data Assimilation by Evolutionary Particle Filter and Markov Chain Monte Carlo
NASA Astrophysics Data System (ADS)
Moradkhani, H.; Abbaszadeh, P.; Yan, H.
2016-12-01
Particle Filters (PFs) have received increasing attention by the researchers from different disciplines in hydro-geosciences as an effective method to improve model predictions in nonlinear and non-Gaussian dynamical systems. The implication of dual state and parameter estimation by means of data assimilation in hydrology and geoscience has evolved since 2005 from SIR-PF to PF-MCMC and now to the most effective and robust framework through evolutionary PF approach based on Genetic Algorithm (GA) and Markov Chain Monte Carlo (MCMC), the so-called EPF-MCMC. In this framework, the posterior distribution undergoes an evolutionary process to update an ensemble of prior states that more closely resemble realistic posterior probability distribution. The premise of this approach is that the particles move to optimal position using the GA optimization coupled with MCMC increasing the number of effective particles, hence the particle degeneracy is avoided while the particle diversity is improved. The proposed algorithm is applied on a conceptual and highly nonlinear hydrologic model and the effectiveness, robustness and reliability of the method in jointly estimating the states and parameters and also reducing the uncertainty is demonstrated for few river basins across the United States.
Time-Dependent Solid State Polymorphism of a Series of Donor-Acceptor Dyads
Peebles, Cameron; Alvey, Paul M.; Lynch, Vincent; Iverson, Brent L.
2014-01-01
In order to exploit the use of favorable electrostatic interactions between aromatic units in directing the assembly of donor-acceptor (D-A) dyads, the present work examines the ability of conjugated aromatic D-A dyads with symmetric side chains to exhibit solid-state polymorphism as a function of time during the solid formation process. Four such dyads were synthesized and their packing in the solid-state from either slower (10-20 days) or faster (1-2 days) evaporation from solvent was investigated using single crystal X-ray analysis and powder X-ray diffraction. Two of the dyads exhibited tail-to-tail (A-A) packing upon slower evaporation from solvent and head-to-tail (D-A) packing upon faster evaporation from solvent. A combination of single crystal analysis and XRD patterns were used to create models wherein a packing model for the other two dyads is proposed. Our findings suggest that while side chain interactions in asymmetric aromatic dyads can play an important role in enforcing segregated D-A dyad assembly, slowly evaporating symmetrically substituted aromatic dyads allows for favorable electrostatic interactions between the aromatic moieties to facilitate the organization of the dyads in the solid-state. PMID:24678269
Markov and semi-Markov switching linear mixed models used to identify forest tree growth components.
Chaubert-Pereira, Florence; Guédon, Yann; Lavergne, Christian; Trottier, Catherine
2010-09-01
Tree growth is assumed to be mainly the result of three components: (i) an endogenous component assumed to be structured as a succession of roughly stationary phases separated by marked change points that are asynchronous among individuals, (ii) a time-varying environmental component assumed to take the form of synchronous fluctuations among individuals, and (iii) an individual component corresponding mainly to the local environment of each tree. To identify and characterize these three components, we propose to use semi-Markov switching linear mixed models, i.e., models that combine linear mixed models in a semi-Markovian manner. The underlying semi-Markov chain represents the succession of growth phases and their lengths (endogenous component) whereas the linear mixed models attached to each state of the underlying semi-Markov chain represent-in the corresponding growth phase-both the influence of time-varying climatic covariates (environmental component) as fixed effects, and interindividual heterogeneity (individual component) as random effects. In this article, we address the estimation of Markov and semi-Markov switching linear mixed models in a general framework. We propose a Monte Carlo expectation-maximization like algorithm whose iterations decompose into three steps: (i) sampling of state sequences given random effects, (ii) prediction of random effects given state sequences, and (iii) maximization. The proposed statistical modeling approach is illustrated by the analysis of successive annual shoots along Corsican pine trunks influenced by climatic covariates. © 2009, The International Biometric Society.
NASA Astrophysics Data System (ADS)
Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.
2018-07-01
A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.
Copula-based analysis of rhythm
NASA Astrophysics Data System (ADS)
García, J. E.; González-López, V. A.; Viola, M. L. Lanfredi
2016-06-01
In this paper we establish stochastic profiles of the rhythm for three languages: English, Japanese and Spanish. We model the increase or decrease of the acoustical energy, collected into three bands coming from the acoustic signal. The number of parameters needed to specify a discrete multivariate Markov chain grows exponentially with the order and dimension of the chain. In this case the size of the database is not large enough for a consistent estimation of the model. We apply a strategy to estimate a multivariate process with an order greater than the order achieved using standard procedures. The new strategy consist on obtaining a partition of the state space which is constructed from a combination of the partitions corresponding to the three marginal processes, one for each band of energy, and the partition coming from to the multivariate Markov chain. Then, all the partitions are linked using a copula, in order to estimate the transition probabilities.
Simple model of sickle hemogloblin
NASA Astrophysics Data System (ADS)
Shiryayev, Andrey; Li, Xiaofei; Gunton, J. D.
2006-07-01
A microscopic model is proposed for the interactions between sickle hemoglobin molecules based on information from the protein data bank. A solution of this model, however, requires accurate estimates of the interaction parameters which are currently unavailable. Therefore, as a first step toward a molecular understanding of the nucleation mechanisms in sickle hemoglobin, a Monte Carlo simulation of a simplified two patch model is carried out. A gradual transition from monomers to one dimensional chains is observed as one varies the density of molecules at fixed temperature, somewhat similar to the transition from monomers to polymer fibers in sickle hemoglobin molecules in solution. An observed competition between chain formation and crystallization for the model is also discussed. The results of the simulation of the equation of state are shown to be in excellent agreement with a theory for a model of globular proteins, for the case of two interacting sites.
Harrington, Charlene; Olney, Brian; Carrillo, Helen; Kang, Taewoon
2012-02-01
To compare staffing levels and deficiencies of the 10 largest U.S. for-profit nursing home chains with five other ownership groups and chain staffing and deficiencies before and after purchase by four private equity (PE) companies. Facilities for the largest for-profit chains were identified through Internet searches and company reports and matched with federal secondary data for 2003-2008 for each ownership group. Descriptive statistics and generalized estimation equation panel regression models examined staffing and deficiencies by ownership groups in the 2003-2008 period, controlling for facility characteristics, resident acuity, and market factors with state fixed effects. The top 10 for-profit chains had lower registered nurse and total nurse staffing hours than government facilities, controlling for other factors. The top 10 chains received 36 percent higher deficiencies and 41 percent higher serious deficiencies than government facilities. Other for-profit facilities also had lower staffing and higher deficiencies than government facilities. The chains purchased by PE companies showed little change in staffing levels, but the number of deficiencies and serious deficiencies increased in some postpurchase years compared with the prepurchase period. There is a need for greater study of large for-profit chains as well as those chains purchased by PE companies. © Health Research and Educational Trust.
Effects of ignoring baseline on modeling transitions from intact cognition to dementia
Yu, Lei; Tyas, Suzanne L.; Snowdon, David A.; Kryscio, Richard J.
2009-01-01
This paper evaluates the effect of ignoring baseline when modeling transitions from intact cognition to dementia with mild cognitive impairment (MCI) and global impairment (GI) as intervening cognitive states. Transitions among states are modeled by a discrete-time Markov chain having three transient (intact cognition, MCI, and GI) and two competing absorbing states (death and dementia). Transition probabilities depend on two covariates, age and the presence/absence of an apolipoprotein E-ε4 allele, through a multinomial logistic model with shared random effects. Results are illustrated with an application to the Nun Study, a cohort of 678 participants 75+ years of age at baseline and followed longitudinally with up to ten cognitive assessments per nun. PMID:20161282
Spin and topological order in a periodically driven spin chain
NASA Astrophysics Data System (ADS)
Russomanno, Angelo; Friedman, Bat-el; Dalla Torre, Emanuele G.
2017-07-01
The periodically driven quantum Ising chain has recently attracted a large attention in the context of Floquet engineering. In addition to the common paramagnet and ferromagnet, this driven model can give rise to new topological phases. In this work, we systematically explore its quantum phase diagram by examining the properties of its Floquet ground state. We specifically focus on driving protocols with time-reversal invariant points, and demonstrate the existence of an infinite number of distinct phases. These phases are separated by second-order quantum phase transitions, accompanied by continuous changes of local and string order parameters, as well as sudden changes of a topological winding number and of the number of protected edge states. When one of these phase transitions is adiabatically crossed, the correlator associated to the order parameter is nonvanishing over a length scale which shows a Kibble-Zurek scaling. In some phases, the Floquet ground state spontaneously breaks the discrete time-translation symmetry of the Hamiltonian. Our findings provide a better understanding of topological phases in periodically driven clean integrable models.
NASA Astrophysics Data System (ADS)
Bala, Vaneeta; Tripathi, S. K.; Kumar, Ranjan
2015-02-01
Density functional theory has been applied to study cadmium sulphide-polyvinyl alcohol nanocomposite film. Structural models of two isotactic-polyvinyl alcohol (I-PVA) chains around one cadmium sulphide nanoparticle is considered in which each chain consists three monomer units of [-(CH2CH(OH))-]. All of the hydroxyl groups in I-PVA chains are directed to cadmium sulphide nanoparticle. Electronic and structural properties are investigated using ab-intio density functional code, SIESTA. Structural optimizations are done using local density approximations (LDA). The exchange correlation functional of LDA is parameterized by the Ceperley-Alder (CA) approach. The core electrons are represented by improved Troulier-Martins pseudopotentials. Densities of states clearly show the semiconducting nature of cadmium sulphide polyvinyl alcohol nanocomposite.
New construction of eigenstates and separation of variables for SU( N) quantum spin chains
NASA Astrophysics Data System (ADS)
Gromov, Nikolay; Levkovich-Maslyuk, Fedor; Sizov, Grigory
2017-09-01
We conjecture a new way to construct eigenstates of integrable XXX quantum spin chains with SU( N) symmetry. The states are built by repeatedly acting on the vacuum with a single operator B good( u) evaluated at the Bethe roots. Our proposal serves as a compact alternative to the usual nested algebraic Bethe ansatz. Furthermore, the roots of this operator give the separated variables of the model, explicitly generalizing Sklyanin's approach to the SU( N) case. We present many tests of the conjecture and prove it in several special cases. We focus on rational spin chains with fundamental representation at each site, but expect many of the results to be valid more generally.
Interacting with an artificial partner: modeling the role of emotional aspects.
Cattinelli, Isabella; Goldwurm, Massimiliano; Borghese, N Alberto
2008-12-01
In this paper we introduce a simple model based on probabilistic finite state automata to describe an emotional interaction between a robot and a human user, or between simulated agents. Based on the agent's personality, attitude, and nature, and on the emotional inputs it receives, the model will determine the next emotional state displayed by the agent itself. The probabilistic and time-varying nature of the model yields rich and dynamic interactions, and an autonomous adaptation to the interlocutor. In addition, a reinforcement learning technique is applied to have one agent drive its partner's behavior toward desired states. The model may also be used as a tool for behavior analysis, by extracting high probability patterns of interaction and by resorting to the ergodic properties of Markov chains.
Convergent mechanisms favor fast amyloid formation in two lambda 6a Ig light chain mutants.
Valdés-García, Gilberto; Millán-Pacheco, César; Pastor, Nina
2017-08-01
Extracellular deposition as amyloids of immunoglobulin light chains causes light chain amyloidosis. Among the light chain families, lambda 6a is one of the most frequent in light chain amyloidosis patients. Its germline protein, 6aJL2, and point mutants, R24G and P7S, are good models to study fibrillogenesis, because their stability and fibril formation characteristics have been described. Both mutations make the germline protein unstable and speed up its ability to aggregate. To date, there is no molecular mechanism that explains how these differences in amyloidogenesis can arise from a single mutation. To look into the structural and dynamical differences in the native state of these proteins, we carried out molecular dynamics simulations at room temperature. Despite the structural similarity of the germline protein and the mutants, we found differences in their dynamical signatures that explain the mutants' increased tendency to form amyloids. The contact network alterations caused by the mutations, though different, converge in affecting two anti-aggregation motifs present in light chain variable domains, suggesting a different starting point for aggregation in lambda chains compared to kappa chains. © 2017 Wiley Periodicals, Inc.
Polymer scaling and dynamics in steady-state sedimentation at infinite Péclet number.
Lehtola, V; Punkkinen, O; Ala-Nissila, T
2007-11-01
We consider the static and dynamical behavior of a flexible polymer chain under steady-state sedimentation using analytic arguments and computer simulations. The model system comprises a single coarse-grained polymer chain of N segments, which resides in a Newtonian fluid as described by the Navier-Stokes equations. The chain is driven into nonequilibrium steady state by gravity acting on each segment. The equations of motion for the segments and the Navier-Stokes equations are solved simultaneously using an immersed boundary method, where thermal fluctuations are neglected. To characterize the chain conformation, we consider its radius of gyration RG(N). We find that the presence of gravity explicitly breaks the spatial symmetry leading to anisotropic scaling of the components of RG with N along the direction of gravity RG, parallel and perpendicular to it RG, perpendicular, respectively. We numerically estimate the corresponding anisotropic scaling exponents nu parallel approximately 0.79 and nu perpendicular approximately 0.45, which differ significantly from the equilibrium scaling exponent nue=0.588 in three dimensions. This indicates that on the average, the chain becomes elongated along the sedimentation direction for large enough N. We present a generalization of the Flory scaling argument, which is in good agreement with the numerical results. It also reveals an explicit dependence of the scaling exponents on the Reynolds number. To study the dynamics of the chain, we compute its effective diffusion coefficient D(N), which does not contain Brownian motion. For the range of values of N used here, we find that both the parallel and perpendicular components of D increase with the chain length N, in contrast to the case of thermal diffusion in equilibrium. This is caused by the fluid-driven fluctuations in the internal configuration of the polymer that are magnified as polymer size becomes larger.
Dudev, Todor; Doudeva, Lyudmila
2017-02-01
The effect of the extra methylene group on the ligation properties of glutamic (Glu) vs. aspartic (Asp) acid, and glutamine (Gln) vs. asparagine (Asn) amino acids-two pairs of protein building blocks differing by the length of their side chains-has been studied by employing DFT calculations combined with polarizable continuum model (PCM) computations. Complexes of the nominal species with partner ligands of various structures, charge states, and degree of solvent exposure have been examined. The results obtained reveal that the difference in the alkyl chain length of these amino acid residues does not affect the mode of their binding. This, however, influences the thermodynamics of the ligand-ligand and ligand-metal recognition thus bestowing unique ligation characteristics on the competing entities. The calculations reveal that the competition between the longer-chain and shorter-chain analogs is entropy driven and that the differential electronic effects are of minor importance for the process. Thus, the outcome of the rivalry between Asp and Glu, and Asn and Gln is almost unaffected by the nature of the partner ligand, its charge state and, in most cases, the dielectric properties of the binding site. The longer-chain Glu, as opposed to its shorter-chain Asp counterpart, is the preferred partner ligand in various protein binding sites. Contrariwise, the shorter-chain Asn binds more favorably to the respective binding sites than its longer-chain Gln analog. The results obtained shed additional light on the intimate mechanism of the ligand-ligand and ligand-metal recognition in proteins and could be employed as guidelines in protein engineering and design.
Collective effects on activated segmental relaxation in supercooled polymer melts
NASA Astrophysics Data System (ADS)
Mirigian, Stephen; Schweizer, Kenneth
2013-03-01
We extend the polymer nonlinear Langevin equation (NLE) theory of activated segmental dynamics in supercooled polymer melts in two new directions. First, a well-defined mapping from real monomers to a freely-jointed chain is formulated that retains information about chain stiffness, monomer volume, and the amplitude of thermal density fluctuations. Second, collective effects beyond the local cage scale are included based on an elastic solid-state perspective in the ``shoving model'' spirit which accounts for longer range contributions to the activation barrier. In contrast to previous phenomenological treatments of this model, we formulate an explicit microscopic picture of the hopping event, and derive, not assume, that the collective barrier is directly related to the elastic shear modulus. Local hopping is thus renormalized by collective motions of the surroundings that are required to physically accommodate it. Using the PRISM theory of structure, and known compressibility and chain statistics information, quantitative applications of the new theory to predict the temperature and chain length dependence of the alpha time, shear modulus, and fragility are carried out for a range of real polymer liquids and compared to experiment.
Liu, Xin; Ohta, Takeshi; Kawabata, Takeshi; Kawai, Fusako
2013-01-01
Ethoxy (EO) chain nonylphenol dehydrogenase (NPEO-DH) from Ensifer sp. AS08 and EO chain octylphenol dehydrogenase from Pseudomonas putida share common molecular characteristics with polyethylene glycol (PEG) dehydrogenases (PEG-DH) and comprise a PEG-DH subgroup in the family of glucose-methanol-choline (GMC) oxidoreductases that includes glucose/alcohol oxidase and glucose/choline dehydrogenase. Three-dimensional (3D) molecular modeling suggested that differences in the size, secondary structure and hydropathy in the active site caused differences in their substrate specificities toward EO chain alkylphenols and free PEGs. Based on 3D molecular modeling, site-directed mutagenesis was utilized to introduce mutations into potential catalytic residues of NPEO-DH. From steady state and rapid kinetic characterization of wild type and mutant NPEO-DHs, we can conclude that His465 and Asn507 are directly involved in the catalysis. Asn507 mediates the transfer of proton from a substrate to FAD and His465 transfers the same proton from the reduced flavin to an electron acceptor. PMID:23306149
Liu, Xin; Ohta, Takeshi; Kawabata, Takeshi; Kawai, Fusako
2013-01-10
Ethoxy (EO) chain nonylphenol dehydrogenase (NPEO-DH) from Ensifer sp. AS08 and EO chain octylphenol dehydrogenase from Pseudomonas putida share common molecular characteristics with polyethylene glycol (PEG) dehydrogenases (PEG-DH) and comprise a PEG-DH subgroup in the family of glucose-methanol-choline (GMC) oxidoreductases that includes glucose/alcohol oxidase and glucose/choline dehydrogenase. Three-dimensional (3D) molecular modeling suggested that differences in the size, secondary structure and hydropathy in the active site caused differences in their substrate specificities toward EO chain alkylphenols and free PEGs. Based on 3D molecular modeling, site-directed mutagenesis was utilized to introduce mutations into potential catalytic residues of NPEO-DH. From steady state and rapid kinetic characterization of wild type and mutant NPEO-DHs, we can conclude that His465 and Asn507 are directly involved in the catalysis. Asn507 mediates the transfer of proton from a substrate to FAD and His465 transfers the same proton from the reduced flavin to an electron acceptor.
Predicting hepatitis B monthly incidence rates using weighted Markov chains and time series methods.
Shahdoust, Maryam; Sadeghifar, Majid; Poorolajal, Jalal; Javanrooh, Niloofar; Amini, Payam
2015-01-01
Hepatitis B (HB) is a major global mortality. Accurately predicting the trend of the disease can provide an appropriate view to make health policy disease prevention. This paper aimed to apply three different to predict monthly incidence rates of HB. This historical cohort study was conducted on the HB incidence data of Hamadan Province, the west of Iran, from 2004 to 2012. Weighted Markov Chain (WMC) method based on Markov chain theory and two time series models including Holt Exponential Smoothing (HES) and SARIMA were applied on the data. The results of different applied methods were compared to correct percentages of predicted incidence rates. The monthly incidence rates were clustered into two clusters as state of Markov chain. The correct predicted percentage of the first and second clusters for WMC, HES and SARIMA methods was (100, 0), (84, 67) and (79, 47) respectively. The overall incidence rate of HBV is estimated to decrease over time. The comparison of results of the three models indicated that in respect to existing seasonality trend and non-stationarity, the HES had the most accurate prediction of the incidence rates.
On a Result for Finite Markov Chains
ERIC Educational Resources Information Center
Kulathinal, Sangita; Ghosh, Lagnojita
2006-01-01
In an undergraduate course on stochastic processes, Markov chains are discussed in great detail. Textbooks on stochastic processes provide interesting properties of finite Markov chains. This note discusses one such property regarding the number of steps in which a state is reachable or accessible from another state in a finite Markov chain with M…
NASA Astrophysics Data System (ADS)
Zvyagin, A. A.
2018-04-01
Based on the results of exact analytic calculations, we show that topological edge states and impurities in quantum dimerized chains manifest themselves in various local static and dynamical characteristics, which can be measured in experiments. In particular, topological edge states can be observed in the magnetic field behavior of the local magnetization or magnetic susceptibility of dimerized spin chains as jumps (for the magnetization) and features (for the static susceptibility) at zero field. In contrast, impurities reveal themselves in similar jumps and features, however, at nonzero values of the critical field. We also show that dynamical characteristics of dimerized quantum chains also manifest the features, related to the topological edge states and impurities. Those features, as a rule, can be seen more sharply than the manifestation of bulk extended states in, e.g., the dynamical local susceptibility. Such peculiarities can be observed in one-dimensional dimerized spin chains, e.g., in NMR experiments, or in various realizations of quantum dimerized chains in optical experiments.
Modeling individual effects in the Cormack-Jolly-Seber Model: A state-space formulation
Royle, J. Andrew
2008-01-01
In population and evolutionary biology, there exists considerable interest in individual heterogeneity in parameters of demographic models for open populations. However, flexible and practical solutions to the development of such models have proven to be elusive. In this article, I provide a state-space formulation of open population capture-recapture models with individual effects. The state-space formulation provides a generic and flexible framework for modeling and inference in models with individual effects, and it yields a practical means of estimation in these complex problems via contemporary methods of Markov chain Monte Carlo. A straightforward implementation can be achieved in the software package WinBUGS. I provide an analysis of a simple model with constant parameter detection and survival probability parameters. A second example is based on data from a 7-year study of European dippers, in which a model with year and individual effects is fitted.
Managing perceived operational risk factors for effective supply-chain management
NASA Astrophysics Data System (ADS)
Sylla, Cheickna
2014-12-01
This research is part of a large scale comprehensive mathematical and empirical modeling investigation projects aimed at developing a better understanding of supply-chain risk management by offering a comprehensive framework including theoretical elements and empirical evidence based on managers' perception of improved organizational level of preparedness to safeguard against the threats of disruptions, delays and stoppage in the supply chain. More specifically, this paper reports the empirical investigation conducted using 92 companies in several eastern USA regions involved in international trades with global supply chains. Among the 56 general hypotheses investigated, the results support that managers strive to balance their control and decision impacts to mold their responses to risk factors with knowledge of the extent of cost consequences as stated in previous research. However, the results also propose new findings which significantly vary from previous research reports.
Precise Nanoelectronics with Adatom Chains
NASA Technical Reports Server (NTRS)
Yamada, Toshishige
1999-01-01
Adatom chains on an atomically regulated substrate will be building components in future precise nanoelectronics. Adatoms need to be secured with chemical bonding, but then electronic isolation between the adatom and substrate systems is not guaranteed. A one-dimensional model shows that good isolation with existence of surface states is expected on an s-p crossing substrate such as Si, Ge, or GaAs, reflecting the bulk nature of the substrate. Isolation is better if adatoms are electronically similar to the substrate atoms, and can be manipulated by hydrogenation. Chain structures with group IV adatoms with two chemical bonds, or group III adatoms with one chemical bond, are semiconducting, reflecting the surface nature of the substrate. These structures are unintentionally doped due to the charge transfer across the chemical bonds. Physical properties of adatom chains have to be determined for the unified adatom-substrate system.
A visible light photocatalyst: effects of vanadium substitution on ETS-10.
Marie Shough, Anne; Lobo, Raul F; Doren, Douglas J
2007-10-07
Hybrid density functional theory/molecular mechanics (DFT/MM) methods have been used to investigate the effects of vanadium substitution in ETS-10. Models have been developed to contain varying concentrations of V(IV) and V(V) within the O-M-O (M = Ti, V) chain. Most of the V-substituted models have a localized mid-gap state. The occupation of this localized state depends upon the dopant oxidation state, leading to the addition of multiple low energy transitions. A linear correlation has been identified between band gap energies estimated using ground state orbital energies and those calculated using the more accurate and computationally demanding time-dependent DFT (TDDFT) method for a variety of transition metal substituted models of ETS-10. Consistent with experimental data for V substitution, our models predict a decrease in the optical band gap with increasing [V], due to a lowering of the delocalized d-orbital states at the bottom of the conduction band with increasing V d-orbital character. This effect is more pronounced in the case of V(V) substitution than V(IV). Excitation energies for the V-doped models, calculated with TDDFT methods correlate well with experimental data, allowing for the assignment of specific optical transitions to experimental UV-Vis spectra. The electronic structure of V-substituted ETS-10 at high V concentration demonstrates band gap energies within the visible range of the spectrum. Additionally, at high [V] the band gap energy and presence of low energy electron traps can be controlled by the relative concentration of V(IV) and V(V) along the O-M-O chain, establishing V-substituted ETS-10 as a promising visible light photocatalyst.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sandor, Debra; Fulton, Sadie; Engel-Cox, Jill
Renewable energy, produced with widely available low-cost energy resources, is often included as a component of national strategies to address energy security and sustainability. Market and political forces cannot disrupt the sun or wind, unlike oil and gas supplies. However, the cost of renewable energy is highly dependent on technologies manufactured through global supply chains in leading manufacturing countries. The countries that contribute to the global supply chains may take actions that, directly or indirectly, influence global access to materials and components. For example, high-purity polysilicon, a key material in solar photovoltaics, has experienced significant price fluctuations, affecting the manufacturingmore » capacity and cost of both polysilicon and solar panels. This study has developed and validated an initial system dynamics framework to gain insights into global trade in polysilicon. The model represents an initial framework for exploration. Three regions were modeled-China, the United States, and the rest of the world - for a range of trade scenarios to understand the impacts of import duties and non-price drivers on the relative volumes of imports and domestic supply. The model was validated with the historical case of China imposing an import duty on polysilicon from the United States, the European Union, and South Korea, which altered the regional flows of polysilicon - in terms of imports, exports, and domestic production-to varying degrees. As expected, the model tracked how regional demand shares and influx volumes decrease as a duty on a region increases. Using 2016 as a reference point, in the scenarios examined for U.S. exports to China, each 10% increase in the import duty results in a 40% decrease in import volume. The model also indicates that, under the scenarios investigated, once a duty has been imposed on a region, the demand share from that region declines and does not achieve pre-duty levels, even as global demand increases. Adding additional countries and other components in the photovoltaic supply chain (panels, cells, wafers) to this model could enable policymakers to better understand the relative impact of trade measures across the entire photovoltaic module manufacturing supply chain and the conditions that encourage industry evolution and competitiveness.« less
Sandor, Debra; Fulton, Sadie; Engel-Cox, Jill; ...
2018-01-11
Renewable energy, produced with widely available low-cost energy resources, is often included as a component of national strategies to address energy security and sustainability. Market and political forces cannot disrupt the sun or wind, unlike oil and gas supplies. However, the cost of renewable energy is highly dependent on technologies manufactured through global supply chains in leading manufacturing countries. The countries that contribute to the global supply chains may take actions that, directly or indirectly, influence global access to materials and components. For example, high-purity polysilicon, a key material in solar photovoltaics, has experienced significant price fluctuations, affecting the manufacturingmore » capacity and cost of both polysilicon and solar panels. This study has developed and validated an initial system dynamics framework to gain insights into global trade in polysilicon. The model represents an initial framework for exploration. Three regions were modeled-China, the United States, and the rest of the world - for a range of trade scenarios to understand the impacts of import duties and non-price drivers on the relative volumes of imports and domestic supply. The model was validated with the historical case of China imposing an import duty on polysilicon from the United States, the European Union, and South Korea, which altered the regional flows of polysilicon - in terms of imports, exports, and domestic production-to varying degrees. As expected, the model tracked how regional demand shares and influx volumes decrease as a duty on a region increases. Using 2016 as a reference point, in the scenarios examined for U.S. exports to China, each 10% increase in the import duty results in a 40% decrease in import volume. The model also indicates that, under the scenarios investigated, once a duty has been imposed on a region, the demand share from that region declines and does not achieve pre-duty levels, even as global demand increases. Adding additional countries and other components in the photovoltaic supply chain (panels, cells, wafers) to this model could enable policymakers to better understand the relative impact of trade measures across the entire photovoltaic module manufacturing supply chain and the conditions that encourage industry evolution and competitiveness.« less
Structural changes and fluctuations of proteins. I. A statistical thermodynamic model.
Ikegami, A
1977-01-01
A general theory of the structural changes and fluctuations of proteins has been proposed based on statistical thermodynamic considerations at the chain level. The "structure" of protein was assumed to be characterized by the state of secondary bonds between unique pairs of specific sites on peptide chains. Every secondary bond changes between the bonded and unbonded states by thermal agitation and the "structure" is continuously fluctuating. The free energy of the "structural state" that is defined by the fraction of secondary bonds in the bonded state has been expressed by the bond energy, the cooperative interaction between bonds, the mixing entropy of bonds, and the entropy of polypeptide chains. The most probable "structural state" can be simply determined by graphical analysis and the effect of temperature or solvent composition on it is discussed. The temperature dependence of the free energy, the probability distribution of structural states and the specific heat have been calculted for two examples of structural change. The theory predicts two different types of structural changes from the ordered to disorderd state, a "structured transition" and a "gradual structural change" with rising temperature. In the "structural transition", the probability distribution has two maxima in the temperature range of transition. In the "gradual structural change", the probabilty distribution has only one maximum during the change. A considerable fraction of secondary bonds is in the unbounded state and is always fluctuating even in the ordered state at room temperature. Such structural flucutations in a single protein molecule have been discussed quantitatively. The theory is extended to include small molecules which bind to the protein molecule and affect the structural state. The changes of structural state caused by specific and non-specific binding and allosteric effects are explained in a unified manner.
Stochastic Kuramoto oscillators with discrete phase states.
Jörg, David J
2017-09-01
We present a generalization of the Kuramoto phase oscillator model in which phases advance in discrete phase increments through Poisson processes, rendering both intrinsic oscillations and coupling inherently stochastic. We study the effects of phase discretization on the synchronization and precision properties of the coupled system both analytically and numerically. Remarkably, many key observables such as the steady-state synchrony and the quality of oscillations show distinct extrema while converging to the classical Kuramoto model in the limit of a continuous phase. The phase-discretized model provides a general framework for coupled oscillations in a Markov chain setting.
Stochastic Kuramoto oscillators with discrete phase states
NASA Astrophysics Data System (ADS)
Jörg, David J.
2017-09-01
We present a generalization of the Kuramoto phase oscillator model in which phases advance in discrete phase increments through Poisson processes, rendering both intrinsic oscillations and coupling inherently stochastic. We study the effects of phase discretization on the synchronization and precision properties of the coupled system both analytically and numerically. Remarkably, many key observables such as the steady-state synchrony and the quality of oscillations show distinct extrema while converging to the classical Kuramoto model in the limit of a continuous phase. The phase-discretized model provides a general framework for coupled oscillations in a Markov chain setting.
Modeling the polydomain-monodomain transition of liquid crystal elastomers.
Whitmer, Jonathan K; Roberts, Tyler F; Shekhar, Raj; Abbott, Nicholas L; de Pablo, Juan J
2013-02-01
We study the mechanism of the polydomain-monodomain transition in liquid crystalline elastomers at the molecular scale. A coarse-grained model is proposed in which mesogens are described as ellipsoidal particles. Molecular dynamics simulations are used to examine the transition from a polydomain state to a monodomain state in the presence of uniaxial strain. Our model demonstrates soft elasticity, similar to that exhibited by side-chain elastomers in the literature. By analyzing the growth dynamics of nematic domains during uniaxial extension, we provide direct evidence that at a molecular level the polydomain-monodomain transition proceeds through cluster rotation and domain growth.
Koda, Shin-ichi
2016-03-21
We theoretically investigate a possibility that the symmetry of the repetitively branched structure of light-harvesting dendrimers creates the energy gradient descending toward inner generations (layers of pigment molecules) of the dendrimers. In the first half of this paper, we define a model system using the Frenkel exciton Hamiltonian that focuses only on the topology of dendrimers and numerically show that excitation energy tends to gather at inner generations of the model system at a thermal equilibrium state. This indicates that an energy gradient is formed in the model system. In the last half, we attribute this result to the symmetry of the model system and propose two symmetry-origin mechanisms creating the energy gradient. The present analysis and proposition are based on the theory of the linear chain (LC) decomposition [S. Koda, J. Chem. Phys. 142, 204112 (2015)], which equivalently transforms the model system into a set of one-dimensional systems on the basis of the symmetry of dendrimers. In the picture of the LC decomposition, we find that energy gradient is formed both in each linear chain and among linear chains, and these two mechanisms explain the numerical results well.
NASA Astrophysics Data System (ADS)
Koda, Shin-ichi
2016-03-01
We theoretically investigate a possibility that the symmetry of the repetitively branched structure of light-harvesting dendrimers creates the energy gradient descending toward inner generations (layers of pigment molecules) of the dendrimers. In the first half of this paper, we define a model system using the Frenkel exciton Hamiltonian that focuses only on the topology of dendrimers and numerically show that excitation energy tends to gather at inner generations of the model system at a thermal equilibrium state. This indicates that an energy gradient is formed in the model system. In the last half, we attribute this result to the symmetry of the model system and propose two symmetry-origin mechanisms creating the energy gradient. The present analysis and proposition are based on the theory of the linear chain (LC) decomposition [S. Koda, J. Chem. Phys. 142, 204112 (2015)], which equivalently transforms the model system into a set of one-dimensional systems on the basis of the symmetry of dendrimers. In the picture of the LC decomposition, we find that energy gradient is formed both in each linear chain and among linear chains, and these two mechanisms explain the numerical results well.
Model-based Clustering of Categorical Time Series with Multinomial Logit Classification
NASA Astrophysics Data System (ADS)
Frühwirth-Schnatter, Sylvia; Pamminger, Christoph; Winter-Ebmer, Rudolf; Weber, Andrea
2010-09-01
A common problem in many areas of applied statistics is to identify groups of similar time series in a panel of time series. However, distance-based clustering methods cannot easily be extended to time series data, where an appropriate distance-measure is rather difficult to define, particularly for discrete-valued time series. Markov chain clustering, proposed by Pamminger and Frühwirth-Schnatter [6], is an approach for clustering discrete-valued time series obtained by observing a categorical variable with several states. This model-based clustering method is based on finite mixtures of first-order time-homogeneous Markov chain models. In order to further explain group membership we present an extension to the approach of Pamminger and Frühwirth-Schnatter [6] by formulating a probabilistic model for the latent group indicators within the Bayesian classification rule by using a multinomial logit model. The parameters are estimated for a fixed number of clusters within a Bayesian framework using an Markov chain Monte Carlo (MCMC) sampling scheme representing a (full) Gibbs-type sampler which involves only draws from standard distributions. Finally, an application to a panel of Austrian wage mobility data is presented which leads to an interesting segmentation of the Austrian labour market.
NASA Astrophysics Data System (ADS)
Drenscko, Mihaela
Polymers and lipid membranes are both essential soft materials. The structure and hydrophobicity/hydrophilicity of polymers, as well as the solvent they are embedded in, ultimately determines their size and shape. Understating the variation of shape of the polymer as well as its interactions with model biological membranes can assist in understanding the biocompatibility of the polymer itself. Computer simulations, in particular molecular dynamics, can aid in characterization of the interaction of polymers with solvent, as well as polymers with model membranes. In this thesis, molecular dynamics serve to describe polymer interactions with a solvent (water) and with a lipid membrane. To begin with, we characterize the hydrophobic collapse of single polystyrene chains in water using molecular dynamics simulations. Specifically, we calculate the potential of mean force for the collapse of a single polystyrene chain in water using metadynamics, comparing the results between all atomistic with coarse-grained molecular simulation. We next explore the scaling behavior of the collapsed globular shape at the minimum energy configuration, characterized by the radius of gyration, as a function of chain length. The exponent is close to one third, consistent with that predicted for a polymer chain in bad solvent. We also explore the scaling behavior of the Solvent Accessible Surface Area (SASA) as a function of chain length, finding a similar exponent for both all-atomistic and coarse-grained simulations. Furthermore, calculation of the local water density as a function of chain length near the minimum energy configuration suggests that intermediate chain lengths are more likely to form dewetted states, as compared to shorter or longer chain lengths. Next, in order to investigate the molecular interactions between single hydrophobic polymer chains and lipids in biological membranes and at lipid membrane/solvent interface, we perform a series of molecular dynamics simulations of small membranes using all atomistic and coarse-grained methods. The molecular interaction between common polymer chains used in biomedical applications and the cell membrane is unknown. This interaction may affect the biocompatibility of the polymer chains. Molecular dynamics simulations offer an emerging tool to characterize the interaction between common degradable polymer chains used in biomedical applications, such as polycaprolactone, and model cell membranes. We systematically characterize with long-time all-atomistic molecular dynamics simulations the interaction between single polycaprolactone chains of varying chain lengths with a model phospholipid membrane. We find that the length of polymer chain greatly affects the nature of interaction with the membrane, as well as the membrane properties. Furthermore, we next utilize advanced sampling techniques in molecular dynamics to characterize the two-dimensional free energy surface for the interaction of varying polymer chain lengths (short, intermediate, and long) with model cell membranes. We find that the free energy minimum shifts from the membrane-water interface to the hydrophobic core of the phospholipid membrane as a function of chain length. These results can be used to design polymer chain lengths and chemistries to optimize their interaction with cell membranes at the molecular level.
Using hidden Markov models to align multiple sequences.
Mount, David W
2009-07-01
A hidden Markov model (HMM) is a probabilistic model of a multiple sequence alignment (msa) of proteins. In the model, each column of symbols in the alignment is represented by a frequency distribution of the symbols (called a "state"), and insertions and deletions are represented by other states. One moves through the model along a particular path from state to state in a Markov chain (i.e., random choice of next move), trying to match a given sequence. The next matching symbol is chosen from each state, recording its probability (frequency) and also the probability of going to that state from a previous one (the transition probability). State and transition probabilities are multiplied to obtain a probability of the given sequence. The hidden nature of the HMM is due to the lack of information about the value of a specific state, which is instead represented by a probability distribution over all possible values. This article discusses the advantages and disadvantages of HMMs in msa and presents algorithms for calculating an HMM and the conditions for producing the best HMM.
Effects of predation efficiencies on the dynamics of a tritrophic food chain.
Cassinari, Maria Paola; Groppi, Maria; Tebaldi, Claudio
2007-07-01
In this paper the dynamics of a tritrophic food chain (resource, consumer, top predator) is investigated, with particular attention not only to equilibrium states but also to cyclic behaviours that the system may exhibit. The analysis is performed in terms of two bifurcation parameters, denoted by p and q, which measure the efficiencies of the interaction processes. The persistence of the system is discussed, characterizing in the (p; q) plane the regions of existence and stability of biologically significant steady states and those of existence of limit cycles. The bifurcations occurring are discussed, and their implications with reference to biological control problems are considered. Examples of the rich dynamics exhibited by the model, including a chaotic regime, are described.
Chaotic itinerancy and power-law residence time distribution in stochastic dynamical systems.
Namikawa, Jun
2005-08-01
Chaotic itinerant motion among varieties of ordered states is described by a stochastic model based on the mechanism of chaotic itinerancy. The model consists of a random walk on a half-line and a Markov chain with a transition probability matrix. The stability of attractor ruin in the model is investigated by analyzing the residence time distribution of orbits at attractor ruins. It is shown that the residence time distribution averaged over all attractor ruins can be described by the superposition of (truncated) power-law distributions if the basin of attraction for each attractor ruin has a zero measure. This result is confirmed by simulation of models exhibiting chaotic itinerancy. Chaotic itinerancy is also shown to be absent in coupled Milnor attractor systems if the transition probability among attractor ruins can be represented as a Markov chain.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Study of fracture and stress-induced morphological instabilities in polymeric materials
NASA Astrophysics Data System (ADS)
Sabouri-Ghomi, Mohsen
We study the phenomena of fracture in polymers at the molecular and continuum level. At a molecular level, we study the failure of polymer/polymer interfaces. Our main focus is on a specific mode of failure known as chain pull-out fracture, which is common to weak adhesive junctions, and polymer blends and mixtures. In the case of the interface between incompatible polymers, reinforcement is achieved by adding a block copolymer to the interface. We introduce a microscopic model based on Brownian dynamics to investigate the effect of the polymerization index N, of the block connector chain, on fracture toughness of such reinforced polymeric junctions. We consider the mushroom regime, where connector chains are grafted with low surface density, for the case of large pulling velocity. We find that for short chains the interface fracture toughness depends linearly on the polymerization index N of the connector chains, while for longer chains the dependence becomes N 3/2. We propose a scaling argument, based on the geometry of the initial configuration, that accounts for both short and long chains and the crossover between them. At the continuum level, we study the pattern selection mechanism of finger-like crack growth phenomena in gradient driven growth problems in general, and the structure of stress-induced morphological instabilities in crazing of polymer glasses in particular. We simulate solidification in a narrow channel through the use of a phase-field model with an adaptive grid. By tuning a dimensionless parameter, the Peclet number, we show a continuous crossover from a free dendrite at high Peclet numbers to anisotropic viscous fingering at low Peclet numbers. At low Peclet numbers we find good agreement between our results, theoretical predictions, and experiment, providing the first quantitative test of solvability theory for anisotropic viscous fingers. For high undercoolings, we find new phenomena, a solid forger which satisfies stability and thermodynamic criterion. We further provide an analytical form for the shape of these fingers, based on local models of solidification, which fits our numerical results from simulation. Later we study the growth of crazes in polymer glasses by deriving the equations of motion of plastic flow at the craze tip, and the steady-state velocity profile of this flow. By developing a phenomenological model, we solve the full time-dependent equations of motion of this highly non-linear phenomena. Our simulation produces the steady-state cellular pattern observed in experiments. We further show that polymer glasses with lower yield stress produce cellular patterns with sharper tips and more cells, indicating instabilities with smaller wavelengths.
NASA Astrophysics Data System (ADS)
Ye, Jing; Dang, Yaoguo; Li, Bingjun
2018-01-01
Grey-Markov forecasting model is a combination of grey prediction model and Markov chain which show obvious optimization effects for data sequences with characteristics of non-stationary and volatility. However, the state division process in traditional Grey-Markov forecasting model is mostly based on subjective real numbers that immediately affects the accuracy of forecasting values. To seek the solution, this paper introduces the central-point triangular whitenization weight function in state division to calculate possibilities of research values in each state which reflect preference degrees in different states in an objective way. On the other hand, background value optimization is applied in the traditional grey model to generate better fitting data. By this means, the improved Grey-Markov forecasting model is built. Finally, taking the grain production in Henan Province as an example, it verifies this model's validity by comparing with GM(1,1) based on background value optimization and the traditional Grey-Markov forecasting model.
Two-Dimensional Model of Scrolled Packings of Molecular Nanoribbons
NASA Astrophysics Data System (ADS)
Savin, A. V.; Mazo, M. A.
2018-04-01
A simplified model of the in-plane molecular chain, allowing the description of folded and scrolled packings of molecular nanoribbons of different structures, is proposed. Using this model, possible steady states of single-layer nanoribbons scrolls of graphene, graphane, fluorographene, and fluorographane (graphene hydrogenated on the one side and fluorinated on the other side) are obtained. Their stability is demonstrated and their energy is calculated as a function of the nanoribbon length. It is shown that the scrolled packing is the most energetically favorable nanoribbon conformation at long lengths. The existences of scrolled packings for fluorographene nanoribbons and the existence of two different scroll types corresponding to left- and right-hand Archimedean spirals for fluorographane nanoribbons in the chain model are shown for the first time. The simplicity of the proposed model makes it possible to consider the dynamics of scrolls of rather long molecular nanoribbons at long enough time intervals.
Modeling Uncertainty in Military Supply Chain Management Decisions
2014-06-23
a compound probability distribution (Eppen and Martin, 1988; Lau and Lau , 2003; Lin, 2008). This paper will incorporate the previously described...distribution with and is selected for the regular state and the N (0.27,0.19) is chosen for state 2. The demand in each state for a given lead...supplier receives orders of size Q from the buyer and purchases inventory from its vendors in a quantity that is an integer multiple N of the buyer’s
Tamashiro, M N; Barbetta, C; Germano, R; Henriques, V B
2011-09-01
We propose a statistical model to account for the gel-fluid anomalous phase transitions in charged bilayer- or lamellae-forming ionic lipids. The model Hamiltonian comprises effective attractive interactions to describe neutral-lipid membranes as well as the effect of electrostatic repulsions of the discrete ionic charges on the lipid headgroups. The latter can be counterion dissociated (charged) or counterion associated (neutral), while the lipid acyl chains may be in gel (low-temperature or high-lateral-pressure) or fluid (high-temperature or low-lateral-pressure) states. The system is modeled as a lattice gas with two distinct particle types--each one associated, respectively, with the polar-headgroup and the acyl-chain states--which can be mapped onto an Ashkin-Teller model with the inclusion of cubic terms. The model displays a rich thermodynamic behavior in terms of the chemical potential of counterions (related to added salt concentration) and lateral pressure. In particular, we show the existence of semidissociated thermodynamic phases related to the onset of charge order in the system. This type of order stems from spatially ordered counterion association to the lipid headgroups, in which charged and neutral lipids alternate in a checkerboard-like order. Within the mean-field approximation, we predict that the acyl-chain order-disorder transition is discontinuous, with the first-order line ending at a critical point, as in the neutral case. Moreover, the charge order gives rise to continuous transitions, with the associated second-order lines joining the aforementioned first-order line at critical end points. We explore the thermodynamic behavior of some physical quantities, like the specific heat at constant lateral pressure and the degree of ionization, associated with the fraction of charged lipid headgroups.
Magnetization process and low-temperature thermodynamics of a spin-1/2 Heisenberg octahedral chain
NASA Astrophysics Data System (ADS)
Strečka, Jozef; Richter, Johannes; Derzhko, Oleg; Verkholyak, Taras; Karľová, Katarína
2018-05-01
Low-temperature magnetization curves and thermodynamics of a spin-1/2 Heisenberg octahedral chain with the intra-plaquette and monomer-plaquette interactions are examined within a two-component lattice-gas model of hard-core monomers, which takes into account all low-lying energy modes in a highly frustrated parameter space involving the monomer-tetramer, localized many-magnon and fully polarized ground states. It is shown that the developed lattice-gas model satisfactorily describes all pronounced features of the low-temperature magnetization process and the magneto-thermodynamics such as abrupt changes of the isothermal magnetization curves, a double-peak structure of the specific heat or a giant magnetocaloric effect.
A modified Lotka-Volterra model for the evolution of coordinate symbiosis in energy enterprise
NASA Astrophysics Data System (ADS)
Zhou, Li; Wang, Teng; Lyu, Xiaohuan; Yu, Jing
2018-02-01
Recent developments in energy markets make the operating industries more dynamic and complex, and energy enterprises cooperate more closely in the industrial chain and symbiosis. In order to further discuss the evolution of coordinate symbiosis in energy enterprises, a modified Lotka-Volterra equation is introduced to develop a symbiosis analysis model of energy groups. According to the equilibrium and stability analysis, a conclusion is obtained that if the upstream energy group and the downstream energy group are in symbiotic state, the growth of their utility will be greater than their independent value. Energy enterprises can get mutual benefits and positive promotions in industrial chain by their cooperation.
Park, Jungkap; Saitou, Kazuhiro
2014-09-18
Multibody potentials accounting for cooperative effects of molecular interactions have shown better accuracy than typical pairwise potentials. The main challenge in the development of such potentials is to find relevant structural features that characterize the tightly folded proteins. Also, the side-chains of residues adopt several specific, staggered conformations, known as rotamers within protein structures. Different molecular conformations result in different dipole moments and induce charge reorientations. However, until now modeling of the rotameric state of residues had not been incorporated into the development of multibody potentials for modeling non-bonded interactions in protein structures. In this study, we develop a new multibody statistical potential which can account for the influence of rotameric states on the specificity of atomic interactions. In this potential, named "rotamer-dependent atomic statistical potential" (ROTAS), the interaction between two atoms is specified by not only the distance and relative orientation but also by two state parameters concerning the rotameric state of the residues to which the interacting atoms belong. It was clearly found that the rotameric state is correlated to the specificity of atomic interactions. Such rotamer-dependencies are not limited to specific type or certain range of interactions. The performance of ROTAS was tested using 13 sets of decoys and was compared to those of existing atomic-level statistical potentials which incorporate orientation-dependent energy terms. The results show that ROTAS performs better than other competing potentials not only in native structure recognition, but also in best model selection and correlation coefficients between energy and model quality. A new multibody statistical potential, ROTAS accounting for the influence of rotameric states on the specificity of atomic interactions was developed and tested on decoy sets. The results show that ROTAS has improved ability to recognize native structure from decoy models compared to other potentials. The effectiveness of ROTAS may provide insightful information for the development of many applications which require accurate side-chain modeling such as protein design, mutation analysis, and docking simulation.
Light neutron-rich hypernuclei from the importance-truncated no-core shell model
NASA Astrophysics Data System (ADS)
Wirth, Roland; Roth, Robert
2018-04-01
We explore the systematics of ground-state and excitation energies in singly-strange hypernuclei throughout the helium and lithium isotopic chains - from He5Λ to He11Λ and from Li7Λ to Li12Λ - in the ab initio no-core shell model with importance truncation. All calculations are based on two- and three-baryon interaction from chiral effective field theory and we employ a similarity renormalization group transformation consistently up to the three-baryon level to improve the model-space convergence. While the absolute energies of hypernuclear states show a systematic variation with the regulator cutoff of the hyperon-nucleon interaction, the resulting neutron separation energies are very stable and in good agreement with available data for both nucleonic parents and their daughter hypernuclei. We provide predictions for the neutron separation energies and the spectra of neutron-rich hypernuclei that have not yet been observed experimentally. Furthermore, we find that the neutron drip lines in the helium and lithium isotopic chains are not changed by the addition of a hyperon.
Benoit, Julia S; Chan, Wenyaw; Doody, Rachelle S
2015-01-01
Parameter dependency within data sets in simulation studies is common, especially in models such as Continuous-Time Markov Chains (CTMC). Additionally, the literature lacks a comprehensive examination of estimation performance for the likelihood-based general multi-state CTMC. Among studies attempting to assess the estimation, none have accounted for dependency among parameter estimates. The purpose of this research is twofold: 1) to develop a multivariate approach for assessing accuracy and precision for simulation studies 2) to add to the literature a comprehensive examination of the estimation of a general 3-state CTMC model. Simulation studies are conducted to analyze longitudinal data with a trinomial outcome using a CTMC with and without covariates. Measures of performance including bias, component-wise coverage probabilities, and joint coverage probabilities are calculated. An application is presented using Alzheimer's disease caregiver stress levels. Comparisons of joint and component-wise parameter estimates yield conflicting inferential results in simulations from models with and without covariates. In conclusion, caution should be taken when conducting simulation studies aiming to assess performance and choice of inference should properly reflect the purpose of the simulation.
Acquisition of choice in concurrent chains: Assessing the cumulative decision model.
Grace, Randolph C
2016-05-01
Concurrent chains is widely used to study pigeons' choice between terminal links that can vary in delay, magnitude, or probability of reinforcement. We review research on the acquisition of choice in this procedure. Acquisition has been studied with a variety of research designs, and some studies have incorporated no-food trials to allow for timing and choice to be observed concurrently. Results show that: Choice can be acquired rapidly within sessions when terminal links change unpredictably; under steady-state conditions, acquisition depends on both initial- and terminal-link schedules; and initial-link responding is mediated by learning about the terminal-link stimulus-reinforcer relations. The cumulative decision model (CDM) proposed by Christensen and Grace (2010) and Grace and McLean (2006, 2015) provides a good description of within-session acquisition, and correctly predicts the effects of initial and terminal-link schedules in steady-state designs (Grace, 2002a). Questions for future research include how abrupt shifts in preference within individual sessions and temporal control of terminal-link responding can be modeled. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Hauke, Philipp; Roscilde, Tommaso; Murg, Valentin; Cirac, J. Ignacio; Schmied, Roman
2011-07-01
We study the ground-state phases of the S=1/2 Heisenberg quantum antiferromagnet on the spatially anisotropic triangular lattice (SATL) and on the square lattice with up to next-next-nearest-neighbor coupling (the J1J2J3 model), making use of Takahashi's modified spin-wave (MSW) theory supplemented by ordering vector optimization. We compare the MSW results with exact diagonalization and projected-entangled-pair-states calculations, demonstrating their qualitative and quantitative reliability. We find that the MSW theory correctly accounts for strong quantum effects on the ordering vector of the magnetic phases of the models under investigation: in particular, collinear magnetic order is promoted at the expense of non-collinear (spiral) order, and several spiral states that are stable at the classical level disappear from the quantum phase diagram. Moreover, collinear states and non-collinear ones are never connected continuously, but they are separated by parameter regions in which the MSW theory breaks down, signaling the possible appearance of a non-magnetic ground state. In the case of the SATL, a large breakdown region appears also for weak couplings between the chains composing the lattice, suggesting the possible occurrence of a large non-magnetic region continuously connected with the spin-liquid state of the uncoupled chains. This shows that the MSW theory is—despite its apparent simplicity—a versatile tool for finding candidate regions in the case of spin-liquid phases, which are among prime targets for relevant quantum simulations.
De Sa Peixoto, Paulo; Laurent, Guillaume; Azaïs, Thierry; Mosser, Gervaise
2013-01-01
In vivo, collagen I, the major structural protein in human body, is found assembled into fibrils. In the present work, we study a high concentrated collagen sample in its soluble, fibrillar, and denatured states using one and two dimensional {1H}-13C solid-state NMR spectroscopy. We interpret 13C chemical shift variations in terms of dihedral angle conformation changes. Our data show that fibrillogenesis increases the side chain and backbone structural complexity. Nevertheless, only three to five rotameric equilibria are found for each amino acid residue, indicating a relatively low structural heterogeneity of collagen upon fibrillogenesis. Using side chain statistical data, we calculate equilibrium constants for a great number of amino acid residues. Moreover, based on a 13C quantitative spectrum, we estimate the percentage of residues implicated in each equilibrium. Our data indicate that fibril formation greatly affects hydroxyproline and proline prolyl pucker ring conformation. Finally, we discuss the implication of these structural data and propose a model in which the attractive force of fibrillogenesis comes from a structural reorganization of 10 to 15% of the amino acids. These results allow us to further understand the self-assembling process and fibrillar structure of collagen. PMID:23341452
Covariate adjustment of event histories estimated from Markov chains: the additive approach.
Aalen, O O; Borgan, O; Fekjaer, H
2001-12-01
Markov chain models are frequently used for studying event histories that include transitions between several states. An empirical transition matrix for nonhomogeneous Markov chains has previously been developed, including a detailed statistical theory based on counting processes and martingales. In this article, we show how to estimate transition probabilities dependent on covariates. This technique may, e.g., be used for making estimates of individual prognosis in epidemiological or clinical studies. The covariates are included through nonparametric additive models on the transition intensities of the Markov chain. The additive model allows for estimation of covariate-dependent transition intensities, and again a detailed theory exists based on counting processes. The martingale setting now allows for a very natural combination of the empirical transition matrix and the additive model, resulting in estimates that can be expressed as stochastic integrals, and hence their properties are easily evaluated. Two medical examples will be given. In the first example, we study how the lung cancer mortality of uranium miners depends on smoking and radon exposure. In the second example, we study how the probability of being in response depends on patient group and prophylactic treatment for leukemia patients who have had a bone marrow transplantation. A program in R and S-PLUS that can carry out the analyses described here has been developed and is freely available on the Internet.
Kosevich, Yuriy A; Gann, Vladimir V
2013-06-19
We study the localization of magnon states in finite defect-free Heisenberg spin-1/2 ferromagnetic chains placed in an inhomogeneous magnetic field with a constant spatial gradient. Continuous transformation from the extended magnon states to the localized Wannier-Zeeman states in a finite spin chain placed in an inhomogeneous field is described both analytically and numerically. We describe for the first time the non-monotonic dependence of the energy levels of magnons, both long and short wavelength, on the magnetic field gradient, which is a consequence of magnon localization in a finite spin chain. We show that, in contrast to the destruction of the magnon band and the establishment of the Wannier-Stark ladder in a vanishingly small field gradient in an infinite chain, the localization of magnon states at the chain ends preserves the memory of the magnon band. Essentially, the localization at the lower- or higher-field chain end resembles the localization of the positive- or negative-effective-mass band quasiparticles. We also show how the beat dynamics of coherent superposition of extended spin waves in a finite chain in a homogeneous or weakly inhomogeneous field transforms into magnon Bloch oscillations of the superposition of localized Wannier-Zeeman states in a strongly inhomogeneous field. We provide a semiclassical description of the magnon Bloch oscillations and show that the correspondence between the quantum and semiclassical descriptions is most accurate for Bloch oscillations of the magnon coherent states, which are built from a coherent superposition of a large number of the nearest-neighbour Wannier-Zeeman states.
A nonaffine network model for elastomers undergoing finite deformations
NASA Astrophysics Data System (ADS)
Davidson, Jacob D.; Goulbourne, N. C.
2013-08-01
In this work, we construct a new physics-based model of rubber elasticity to capture the strain softening, strain hardening, and deformation-state dependent response of rubber materials undergoing finite deformations. This model is unique in its ability to capture large-stretch mechanical behavior with parameters that are connected to the polymer chemistry and can also be easily identified with the important characteristics of the macroscopic stress-stretch response. The microscopic picture consists of two components: a crosslinked network of Langevin chains and an entangled network with chains confined to a nonaffine tube. These represent, respectively, changes in entropy due to thermally averaged chain conformations and changes in entropy due to the magnitude of these conformational fluctuations. A simple analytical form for the strain energy density is obtained using Rubinstein and Panyukov's single-chain description of network behavior. The model only depends on three parameters that together define the initial modulus, extent of strain softening, and the onset of strain hardening. Fits to large stretch data for natural rubber, silicone rubber, VHB 4905 (polyacrylate rubber), and b186 rubber (a carbon black-filled rubber) are presented, and a comparison is made with other similar constitutive models of large-stretch rubber elasticity. We demonstrate that the proposed model provides a complete description of elastomers undergoing large deformations for different applied loading configurations. Moreover, since the strain energy is obtained using a clear set of physical assumptions, this model may be tested and used to interpret the results of computer simulation and experiments on polymers of known microscopic structure.
Vrancken, Bram; Suchard, Marc A; Lemey, Philippe
2017-07-01
Analyses of virus evolution in known transmission chains have the potential to elucidate the impact of transmission dynamics on the viral evolutionary rate and its difference within and between hosts. Lin et al. (2015, Journal of Virology , 89/7: 3512-22) recently investigated the evolutionary history of hepatitis B virus in a transmission chain and postulated that the 'colonization-adaptation-transmission' model can explain the differential impact of transmission on synonymous and non-synonymous substitution rates. Here, we revisit this dataset using a full probabilistic Bayesian phylogenetic framework that adequately accounts for the non-independence of sequence data when estimating evolutionary parameters. Examination of the transmission chain data under a flexible coalescent prior reveals a general inconsistency between the estimated timings and clustering patterns and the known transmission history, highlighting the need to incorporate host transmission information in the analysis. Using an explicit genealogical transmission chain model, we find strong support for a transmission-associated decrease of the overall evolutionary rate. However, in contrast to the initially reported larger transmission effect on non-synonymous substitution rate, we find a similar decrease in both non-synonymous and synonymous substitution rates that cannot be adequately explained by the colonization-adaptation-transmission model. An alternative explanation may involve a transmission/establishment advantage of hepatitis B virus variants that have accumulated fewer within-host substitutions, perhaps by spending more time in the covalently closed circular DNA state between each round of viral replication. More generally, this study illustrates that ignoring phylogenetic relationships can lead to misleading evolutionary estimates.
NASA Astrophysics Data System (ADS)
Lam, C. Y.; Ip, W. H.
2012-11-01
A higher degree of reliability in the collaborative network can increase the competitiveness and performance of an entire supply chain. As supply chain networks grow more complex, the consequences of unreliable behaviour become increasingly severe in terms of cost, effort and time. Moreover, it is computationally difficult to calculate the network reliability of a Non-deterministic Polynomial-time hard (NP-hard) all-terminal network using state enumeration, as this may require a huge number of iterations for topology optimisation. Therefore, this paper proposes an alternative approach of an improved spanning tree for reliability analysis to help effectively evaluate and analyse the reliability of collaborative networks in supply chains and reduce the comparative computational complexity of algorithms. Set theory is employed to evaluate and model the all-terminal reliability of the improved spanning tree algorithm and present a case study of a supply chain used in lamp production to illustrate the application of the proposed approach.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, Jiyun; Jeon, SuKyung; Kim, Janice J.
2014-07-24
Oligomeric thiophenes are commonly-used components in organic electronics and solar cells. These molecules stack and/or aggregate readily under the processing conditions used to form thin films for these applications, significantly altering their optical and charge-transport properties. To determine how these effects depend on the substitution pattern of the thiophene main chains, nano-aggregates of three sexi-thiophene (6T) oligomers having different alkyl substitution patterns were formed using solvent poisoning techniques and studied using steady-state and time-resolved emission spectroscopy. The results indicate the substantial role played by the side-chain substituents in determining the emissive properties of these species. Both the measured spectral changesmore » and their dependence on substitution are well modeled by combined quantum chemistry and molecular dynamics simulations. The simulations connect the side-chain-induced disorder, which determines the favorable chain packing configurations within the aggregates, with their measured electronic spectra.« less
Offshore Wind Jobs and Economic Development Impacts in the United States: Four Regional Scenarios
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tegen, S.; Keyser, D.; Flores-Espino, F.
This report uses the offshore wind Jobs and Economic Development Impacts (JEDI) model and provides four case studies of potential offshore deployment scenarios in different regions of the United States: the Southeast, the Great Lakes, the Gulf Coast, and the Mid-Atlantic. Researchers worked with developers and industry representatives in each region to create potential offshore wind deployment and supply chain growth scenarios, specific to their locations. These scenarios were used as inputs into the offshore JEDI model to estimate jobs and other gross economic impacts in each region.
Zigmond, Jessica
2006-12-11
A new "boutique" chain is roaring out the gate with $1 billion to spend and plans for 10 hospitals. University General Hospital Systems, which aspires to offer the feel of a luxury hotel in its facilities, is wading into the thick of some of the most controversial issues in healthcare. All but one of its hospitals are planned for states without CON laws, according to W.J. "Bill" Burk, left.
Magnuson, M; Schmitt, T; Strocov, V N; Schlappa, J; Kalabukhov, A S; Duda, L-C
2014-11-12
The interplay between the quasi 1-dimensional CuO-chains and the 2-dimensional CuO2 planes of YBa(2)Cu(3)O(6+x) (YBCO) has been in focus for a long time. Although the CuO-chains are known to be important as charge reservoirs that enable superconductivity for a range of oxygen doping levels in YBCO, the understanding of the dynamics of its temperature-driven metal-superconductor transition (MST) remains a challenge. We present a combined study using x-ray absorption spectroscopy and resonant inelastic x-ray scattering (RIXS) revealing how a reconstruction of the apical O(4)-derived interplanar orbitals during the MST of optimally doped YBCO leads to substantial hole-transfer from the chains into the planes, i.e. self-doping. Our ionic model calculations show that localized divalent charge-transfer configurations are expected to be abundant in the chains of YBCO. While these indeed appear in the RIXS spectra from YBCO in the normal, metallic, state, they are largely suppressed in the superconducting state and, instead, signatures of Cu trivalent charge-transfer configurations in the planes become enhanced. In the quest for understanding the fundamental mechanism for high-Tc-superconductivity (HTSC) in perovskite cuprate materials, the observation of such an interplanar self-doping process in YBCO opens a unique novel channel for studying the dynamics of HTSC.
Harrington, Charlene; Olney, Brian; Carrillo, Helen; Kang, Taewoon
2012-01-01
Objective To compare staffing levels and deficiencies of the 10 largest U.S. for-profit nursing home chains with five other ownership groups and chain staffing and deficiencies before and after purchase by four private equity (PE) companies. Data Sources Facilities for the largest for-profit chains were identified through Internet searches and company reports and matched with federal secondary data for 2003–2008 for each ownership group. Study Design Descriptive statistics and generalized estimation equation panel regression models examined staffing and deficiencies by ownership groups in the 2003–2008 period, controlling for facility characteristics, resident acuity, and market factors with state fixed effects. Principal Findings The top 10 for-profit chains had lower registered nurse and total nurse staffing hours than government facilities, controlling for other factors. The top 10 chains received 36 percent higher deficiencies and 41 percent higher serious deficiencies than government facilities. Other for-profit facilities also had lower staffing and higher deficiencies than government facilities. The chains purchased by PE companies showed little change in staffing levels, but the number of deficiencies and serious deficiencies increased in some postpurchase years compared with the prepurchase period. Conclusions There is a need for greater study of large for-profit chains as well as those chains purchased by PE companies. PMID:22091627
NASA Astrophysics Data System (ADS)
Sheth, Swapnil Suhas
Narrow molecular weight fractions of poly(epsilon-caprolactone) were successfully obtained using the successive precipitation fractionation technique with toluene/n-heptane as a solvent/nonsolvent pair. Calorimetric studies of the melting behavior of fractions that were crystallized either isothermally or under constant cooling rate conditions suggested that the isothermal crystallization of the samples should be used for a proper evaluation of the molecular weight dependence of the observed melting temperature and degree of crystallinity in PCL. The molecular weight and temperature dependence of the spherulitic growth rate of fractions was studied in the context of the Lauritzen-Hoffman two-phase model and the Strobl three-phase model of polymer crystallization. The zero-growth rate temperatures, determined from spherulitic growth rates using four different methods, are consistent with each other and increase with chain length. The concomitant increase in the apparent secondary nucleation constant was attributed to two factors. First, for longer chains there is an increase in the probability that crystalline stems belong to loose chain-folds, hence, an increase in fold surface free energy. It is speculated that the increase in loose folding and resulting decrease in crystallinity with increasing chain length are associated with the ester group registration requirement in PCL crystals. The second contribution to the apparent nucleation constant arises from chain friction associated with segmental transport across the melt/crystal interface. These factors were responsible for the much stronger chain length dependence of spherulitic growth rates at fixed undercooling observed here with PCL than previously reported for PE and PEO. In the case of PCL, the scaling exponent associated with the chain length dependence of spherulitic growth rates exceeds the upper theoretical bound of 2 predicted from the Brochard- DeGennes chain pullout model. Observation that zero-growth and equilibrium melting temperature values are identical with each other within the uncertainty of their determinations casts serious doubt on the validity of Strobl three-phase model. A novel method is proposed to determine the Porod constant necessary to extrapolate the small angle X-ray scattering intensity data to large scattering vectors. The one-dimensional correlation function determined using this Porod constant yielded the values of lamellar crystal thickness, which were similar to these estimated using the Hosemann-Bagchi Paracrystalline Lattice model. The temperature dependence of the lamellar crystal thickness was consistent with both LH and the Strobl model of polymer crystallization. However, in contrast to the predictions of Strobl's model, the value of the mesomorph-to-crystal equilibrium transition temperature was very close to the zero-growth temperature. Moreover, the lateral block sizes (obtained using wide angle X-ray diffraction) and the lamellar thicknesses were not found to be controlled by the mesomorph-to-crystal equilibrium transition temperature. Hence, we concluded that the crystallization of PCL is not mediated by a mesophase. Metallocene-catalyzed linear low-density (m-LLDPE with 3.4 mol% 1-octene) and conventional low-density (LDPE) polyethylene blends of different compositions were investigated for their melt-state miscibility and concurrent crystallization tendency. Differential scanning calorimetric studies and morphological studies using atomic force microscopy confirm that these blends are miscible in the melt-state for all compositions. LDPE chains are found to crystallize concurrently with m-LLDPE chains during cooling in the m-LLDPE crystallization temperature range. While the extent of concurrent crystallization was found to be optimal in .. .. iv blends with highest m-LLDPE content studied, strong evidence was uncovered for the existence of a saturation effect in the concurrent crystallization behavior. This observation leads us to suggest that co-crystallization, rather than mere concurrent crystallization, of LDPE with m- LLDPE can indeed take place. Matching of the respective sequence length distributions in LDPE and m-LLDPE is suggested to control the extent of co-crystallization.
NASA Astrophysics Data System (ADS)
Piroli, Lorenzo; Pozsgay, Balázs; Vernier, Eric
2017-12-01
Inspired by classical results in integrable boundary quantum field theory, we propose a definition of integrable initial states for quantum quenches in lattice models. They are defined as the states which are annihilated by all local conserved charges that are odd under space reflection. We show that this class includes the states which can be related to integrable boundary conditions in an appropriate rotated channel, in loose analogy with the picture in quantum field theory. Furthermore, we provide an efficient method to test integrability of given initial states. We revisit the recent literature of global quenches in several models and show that, in all of the cases where closed-form analytical results could be obtained, the initial state is integrable according to our definition. In the prototypical example of the XXZ spin-s chains we show that integrable states include two-site product states but also larger families of matrix product states with arbitrary bond dimension. We argue that our results could be practically useful for the study of quantum quenches in generic integrable models.
Effect of equilibration on primitive path analyses of entangled polymers.
Hoy, Robert S; Robbins, Mark O
2005-12-01
We use recently developed primitive path analysis (PPA) methods to study the effect of equilibration on entanglement density in model polymeric systems. Values of Ne for two commonly used equilibration methods differ by a factor of 2-4 even though the methods produce similar large-scale chain statistics. We find that local chain stretching in poorly equilibrated samples increases entanglement density. The evolution of Ne with time shows that many entanglements are lost through fast processes such as chain retraction as the local stretching relaxes. Quenching a melt state into a glass has little effect on Ne. Equilibration-dependent differences in short-scale structure affect the craze extension ratio much less than expected from the differences in PPA values of Ne.
Proteins aggregation and human diseases
NASA Astrophysics Data System (ADS)
Hu, Chin-Kun
2015-04-01
Many human diseases and the death of most supercentenarians are related to protein aggregation. Neurodegenerative diseases include Alzheimer's disease (AD), Huntington's disease (HD), Parkinson's disease (PD), frontotemporallobar degeneration, etc. Such diseases are due to progressive loss of structure or function of neurons caused by protein aggregation. For example, AD is considered to be related to aggregation of Aβ40 (peptide with 40 amino acids) and Aβ42 (peptide with 42 amino acids) and HD is considered to be related to aggregation of polyQ (polyglutamine) peptides. In this paper, we briefly review our recent discovery of key factors for protein aggregation. We used a lattice model to study the aggregation rates of proteins and found that the probability for a protein sequence to appear in the conformation of the aggregated state can be used to determine the temperature at which proteins can aggregate most quickly. We used molecular dynamics and simple models of polymer chains to study relaxation and aggregation of proteins under various conditions and found that when the bending-angle dependent and torsion-angle dependent interactions are zero or very small, then protein chains tend to aggregate at lower temperatures. All atom models were used to identify a key peptide chain for the aggregation of insulin chains and to find that two polyQ chains prefer anti-parallel conformation. It is pointed out that in many cases, protein aggregation does not result from protein mis-folding. A potential drug from Chinese medicine was found for Alzheimer's disease.
Self-Assembly of Emulsion Droplets into Polymer Chains
NASA Astrophysics Data System (ADS)
Bargteil, Dylan; McMullen, Angus; Brujic, Jasna
We experimentally investigate `beads-on-a-string' models of polymers using the spontaneous assembly of emulsion droplets into linear chains. Droplets functionalized with surface-mobile DNA allow for programmable 'monomers' through which we can influence the three-dimensional structure of the assembled 'polymer'. Such model polymers can be used to study conformational changes of polypeptides and the principles governing protein folding. In our system, we find that droplets bind via complementary DNA strands that are recruited into adhesion patches. Recruitment is driven by the DNA hybridization energy, and is limited by the energy cost of surface deformation and the entropy loss of the mobile linkers, yielding adhesion patches of a characteristic size with a given number of linkers. By tuning the initial surface coverage of linkers, we control valency between the droplets to create linear or branched polymer chains. We additionally control the flexibility of the model polymers by varying the salt concentration and study their dynamics between extended and collapsed states. This system opens the possibility of programming stable three-dimensional structures, such as those found within folded proteins.
Canonical Structure and Orthogonality of Forces and Currents in Irreversible Markov Chains
NASA Astrophysics Data System (ADS)
Kaiser, Marcus; Jack, Robert L.; Zimmer, Johannes
2018-03-01
We discuss a canonical structure that provides a unifying description of dynamical large deviations for irreversible finite state Markov chains (continuous time), Onsager theory, and Macroscopic Fluctuation Theory (MFT). For Markov chains, this theory involves a non-linear relation between probability currents and their conjugate forces. Within this framework, we show how the forces can be split into two components, which are orthogonal to each other, in a generalised sense. This splitting allows a decomposition of the pathwise rate function into three terms, which have physical interpretations in terms of dissipation and convergence to equilibrium. Similar decompositions hold for rate functions at level 2 and level 2.5. These results clarify how bounds on entropy production and fluctuation theorems emerge from the underlying dynamical rules. We discuss how these results for Markov chains are related to similar structures within MFT, which describes hydrodynamic limits of such microscopic models.
Copula-based prediction of economic movements
NASA Astrophysics Data System (ADS)
García, J. E.; González-López, V. A.; Hirsh, I. D.
2016-06-01
In this paper we model the discretized returns of two paired time series BM&FBOVESPA Dividend Index and BM&FBOVESPA Public Utilities Index using multivariate Markov models. The discretization corresponds to three categories, high losses, high profits and the complementary periods of the series. In technical terms, the maximal memory that can be considered for a Markov model, can be derived from the size of the alphabet and dataset. The number of parameters needed to specify a discrete multivariate Markov chain grows exponentially with the order and dimension of the chain. In this case the size of the database is not large enough for a consistent estimation of the model. We apply a strategy to estimate a multivariate process with an order greater than the order achieved using standard procedures. The new strategy consist on obtaining a partition of the state space which is constructed from a combination, of the partitions corresponding to the two marginal processes and the partition corresponding to the multivariate Markov chain. In order to estimate the transition probabilities, all the partitions are linked using a copula. In our application this strategy provides a significant improvement in the movement predictions.
A stochastic Markov chain model to describe lung cancer growth and metastasis.
Newton, Paul K; Mason, Jeremy; Bethel, Kelly; Bazhenova, Lyudmila A; Nieva, Jorge; Kuhn, Peter
2012-01-01
A stochastic Markov chain model for metastatic progression is developed for primary lung cancer based on a network construction of metastatic sites with dynamics modeled as an ensemble of random walkers on the network. We calculate a transition matrix, with entries (transition probabilities) interpreted as random variables, and use it to construct a circular bi-directional network of primary and metastatic locations based on postmortem tissue analysis of 3827 autopsies on untreated patients documenting all primary tumor locations and metastatic sites from this population. The resulting 50 potential metastatic sites are connected by directed edges with distributed weightings, where the site connections and weightings are obtained by calculating the entries of an ensemble of transition matrices so that the steady-state distribution obtained from the long-time limit of the Markov chain dynamical system corresponds to the ensemble metastatic distribution obtained from the autopsy data set. We condition our search for a transition matrix on an initial distribution of metastatic tumors obtained from the data set. Through an iterative numerical search procedure, we adjust the entries of a sequence of approximations until a transition matrix with the correct steady-state is found (up to a numerical threshold). Since this constrained linear optimization problem is underdetermined, we characterize the statistical variance of the ensemble of transition matrices calculated using the means and variances of their singular value distributions as a diagnostic tool. We interpret the ensemble averaged transition probabilities as (approximately) normally distributed random variables. The model allows us to simulate and quantify disease progression pathways and timescales of progression from the lung position to other sites and we highlight several key findings based on the model.
Automatic Traffic-Based Internet Control Message Protocol (ICMP) Model Generation for ns-3
2015-12-01
through visiting the inferred automata o Fuzzing of an implementation by generating altered message formats We tested with 3 versions of Netzob. First...relationships. Afterwards, we used the Automata module to generate state machines using different functions: “generateChainedStateAutomata...The “generatePTAAutomata” takes as input several communication sessions and then identifies common paths and merges these into a single automata . The
Nonequilibrium electronic transport in a one-dimensional Mott insulator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heidrich-Meisner, F.; Gonzalez, Ivan; Al-Hassanieh, K. A.
2010-01-01
We calculate the nonequilibrium electronic transport properties of a one-dimensional interacting chain at half filling, coupled to noninteracting leads. The interacting chain is initially in a Mott insulator state that is driven out of equilibrium by applying a strong bias voltage between the leads. For bias voltages above a certain threshold we observe the breakdown of the Mott insulator state and the establishment of a steady-state elec- tronic current through the system. Based on extensive time-dependent density-matrix renormalization-group simulations, we show that this steady-state current always has the same functional dependence on voltage, independent of the microscopic details of themore » model and we relate the value of the threshold to the Lieb-Wu gap. We frame our results in terms of the Landau-Zener dielectric breakdown picture. Finally, we also discuss the real-time evolution of the current, and characterize the current-carrying state resulting from the breakdown of the Mott insulator by computing the double occupancy, the spin structure factor, and the entanglement entropy.« less
Kinetics of Contact Formation and End-to-End Distance Distributions of Swollen Disordered Peptides
Soranno, Andrea; Longhi, Renato; Bellini, Tommaso; Buscaglia, Marco
2009-01-01
Unstructured polypeptide chains are subject to various degrees of swelling or compaction depending on the combination of solvent condition and amino acid sequence. Highly denatured proteins generally behave like random-coils with excluded volume repulsion, whereas in aqueous buffer more compact conformations have been observed for the low-populated unfolded state of globular proteins as well as for naturally disordered sequences. To quantitatively account for the different mechanisms inducing the swelling of polypeptides, we have examined three 14-residues peptides in aqueous buffer and in denaturant solutions, including the well characterized AGQ repeat as a reference and two variants, in which we have successively introduced charged side chains and removed the glycines. Quenching of the triplet state of tryptophan by close contact with cysteine has been used in conjunction with Förster resonance energy transfer to study the equilibrium and kinetic properties of the peptide chains. The experiments enable accessing end-to-end root mean-square distance, probability of end-to-end contact formation and intrachain diffusion coefficient. The data can be coherently interpreted on the basis of a simple chain model with backbone angles obtained from a library of coil segments of proteins and hard sphere repulsion at each Cα position. In buffered water, we find that introducing charges in a glycine-rich sequence induces a mild chain swelling and a significant speed-up of the intrachain dynamics, whereas the removal of the glycines results in almost a two-fold increase of the chain volume and a drastic slowing down. In denaturants we observe a pronounced swelling of all the chains, with significant differences between the effect of urea and guanidinium chloride. PMID:19217868
Experimental study of the lifetime and phase transition in neutron-rich
NASA Astrophysics Data System (ADS)
Ansari, S.; Régis, J.-M.; Jolie, J.; Saed-Samii, N.; Warr, N.; Korten, W.; Zielińska, M.; Salsac, M.-D.; Blanc, A.; Jentschel, M.; Köster, U.; Mutti, P.; Soldner, T.; Simpson, G. S.; Drouet, F.; Vancraeyenest, A.; de France, G.; Clément, E.; Stezowski, O.; Ur, C. A.; Urban, W.; Regan, P. H.; Podolyák, Zs.; Larijani, C.; Townsley, C.; Carroll, R.; Wilson, E.; Mach, H.; Fraile, L. M.; Paziy, V.; Olaizola, B.; Vedia, V.; Bruce, A. M.; Roberts, O. J.; Smith, J. F.; Scheck, M.; Kröll, T.; Hartig, A.-L.; Ignatov, A.; Ilieva, S.; Lalkovski, S.; Mǎrginean, N.; Otsuka, T.; Shimizu, N.; Togashi, T.; Tsunoda, Y.
2017-11-01
Rapid shape changes are observed for neutron-rich nuclei with A around 100. In particular, a sudden onset of ground-state deformation is observed in the Zr and Sr isotopic chains at N = 60: Low-lying states in N ≤58 nuclei are nearly spherical, while those with N ≥60 have a rotational character. Nuclear lifetimes as short as a few picoseconds can be measured using fast-timing techniques with LaBr3(Ce) scintillators, yielding a key ingredient in the systematic study of the shape evolution in this region. We used neutron-induced fission of 241Pu and 235U to study lifetimes of excited states in fission fragments in the A ˜100 region with the EXILL-FATIMA array located at the PF1B cold neutron beam line at the Institut Laue-Langevin. In particular, we applied the generalized centroid difference method to deduce lifetimes of low-lying states for the nuclei 98Zr (N = 58), 100Zr, and 102Zr (N ≥60 ). The results are discussed in the context of the presumed phase transition in the Zr chain by comparing the experimental transition strengths with the theoretical calculations using the interacting boson model and the Monte Carlo shell model.
Bifurcation of the Yellowstone plume driven by subduction-induced mantle flow
NASA Astrophysics Data System (ADS)
Kincaid, C.; Druken, K. A.; Griffiths, R. W.; Stegman, D. R.
2013-05-01
The causes of volcanism in the northwestern United States over the past 20 million years are strongly contested. Three drivers have been proposed: melting associated with plate subduction; tectonic extension and magmatism resulting from rollback of a subducting slab; or the Yellowstone mantle plume. Observations of the opposing age progression of two neighbouring volcanic chains--the Snake River Plain and High Lava Plains--are often used to argue against a plume origin for the volcanism. Plumes are likely to occur near subduction zones, yet the influence of subduction on the surface expression of mantle plumes is poorly understood. Here we use experiments with a laboratory model to show that the patterns of volcanism in the northwestern United States can be explained by a plume upwelling through mantle that circulates in the wedge beneath a subduction zone. We find that the buoyant plume may be stalled, deformed and partially torn apart by mantle flow induced by the subducting plate. Using plausible model parameters, bifurcation of the plume can reproduce the primary volcanic features observed in the northwestern United States, in particular the opposite progression of two volcanic chains. Our results support the presence of the Yellowstone plume in the northwestern United States, and also highlight the power of plume-subduction interactions to modify surface geology at convergent plate margins.
Efficient Learning of Continuous-Time Hidden Markov Models for Disease Progression
Liu, Yu-Ying; Li, Shuang; Li, Fuxin; Song, Le; Rehg, James M.
2016-01-01
The Continuous-Time Hidden Markov Model (CT-HMM) is an attractive approach to modeling disease progression due to its ability to describe noisy observations arriving irregularly in time. However, the lack of an efficient parameter learning algorithm for CT-HMM restricts its use to very small models or requires unrealistic constraints on the state transitions. In this paper, we present the first complete characterization of efficient EM-based learning methods for CT-HMM models. We demonstrate that the learning problem consists of two challenges: the estimation of posterior state probabilities and the computation of end-state conditioned statistics. We solve the first challenge by reformulating the estimation problem in terms of an equivalent discrete time-inhomogeneous hidden Markov model. The second challenge is addressed by adapting three approaches from the continuous time Markov chain literature to the CT-HMM domain. We demonstrate the use of CT-HMMs with more than 100 states to visualize and predict disease progression using a glaucoma dataset and an Alzheimer’s disease dataset. PMID:27019571
Analysis of supply chain management of shallots in Medan
NASA Astrophysics Data System (ADS)
Alam, M. C.; Supriana, T.
2018-02-01
Supply chain is important for business. One of supply chain that needs to be studied is the shallots supply chain. Medan have high demand while the supply of shallots is limited. This study aims to analyze the flow of shallots supply chain distribution in Medan. The method used was survey by using questionnaires to shallots producers, collecting traders, distributors, traders as well as government involved in shallots supply chain. Descriptive analysis was used to explain the shallots supply chain distribution flow. The results showed that there are two shallots supply chain model in Medan that was local shallots model and imported shallots model. Local shallots model could be distinguished based on three producer area, those were models of Medan Marelan, Samosir, and Simalungun. Medan Marelan and Simalungun models have seven supply chains, while the Samosir Model has eight supply chains. This condition indicates that the local shallots supply chain management in Medan was not efficient because of the length of the distribution channel. Supply chain imported shallots was more efficient because it had a shorter distribution flow with five supply chains.
Characterization of binary string statistics for syntactic landmine detection
NASA Astrophysics Data System (ADS)
Nasif, Ahmed O.; Mark, Brian L.; Hintz, Kenneth J.
2011-06-01
Syntactic landmine detection has been proposed to detect and classify non-metallic landmines using ground penetrating radar (GPR). In this approach, the GPR return is processed to extract characteristic binary strings for landmine and clutter discrimination. In our previous work, we discussed the preprocessing methodology by which the amplitude information of the GPR A-scan signal can be effectively converted into binary strings, which identify the impedance discontinuities in the signal. In this work, we study the statistical properties of the binary string space. In particular, we develop a Markov chain model to characterize the observed bit sequence of the binary strings. The state is defined as the number of consecutive zeros between two ones in the binarized A-scans. Since the strings are highly sparse (the number of zeros is much greater than the number of ones), defining the state this way leads to fewer number of states compared to the case where each bit is defined as a state. The number of total states is further reduced by quantizing the number of consecutive zeros. In order to identify the correct order of the Markov model, the mean square difference (MSD) between the transition matrices of mine strings and non-mine strings is calculated up to order four using training data. The results show that order one or two maximizes this MSD. The specification of the transition probabilities of the chain can be used to compute the likelihood of any given string. Such a model can be used to identify characteristic landmine strings during the training phase. These developments on modeling and characterizing the string statistics can potentially be part of a real-time landmine detection algorithm that identifies landmine and clutter in an adaptive fashion.
Dissipative Quantum Control of a Spin Chain
NASA Astrophysics Data System (ADS)
Morigi, Giovanna; Eschner, Jürgen; Cormick, Cecilia; Lin, Yiheng; Leibfried, Dietrich; Wineland, David J.
2015-11-01
A protocol is discussed for preparing a spin chain in a generic many-body state in the asymptotic limit of tailored nonunitary dynamics. The dynamics require the spectral resolution of the target state, optimized coherent pulses, engineered dissipation, and feedback. As an example, we discuss the preparation of an entangled antiferromagnetic state, and argue that the procedure can be applied to chains of trapped ions or Rydberg atoms.
Dual chain perturbation theory: A new equation of state for polyatomic molecules
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marshall, Bennett D., E-mail: bennett.d.marshall@exxonmobil.com
In the development of equations of state for polyatomic molecules, thermodynamic perturbation theory (TPT) is widely used to calculate the change in free energy due to chain formation. TPT is a simplification of a more general and exact multi-density cluster expansion for associating fluids. In TPT, all contributions to the cluster expansion which contain chain–chain interactions are neglected. That is, all inter-chain interactions are treated at the reference fluid level. This allows for the summation of the cluster theory in terms of reference system correlation functions only. The resulting theory has been shown to be accurate and has been widelymore » employed as the basis of many engineering equations of state. While highly successful, TPT has many handicaps which result from the neglect of chain–chain contributions. The subject of this document is to move beyond the limitations of TPT and include chain–chain contributions to the equation of state.« less
Song, Malin; Wang, Shuhong
2017-01-01
This study examined the stimulative effects of Chinese enterprises' participation in the global value chain (GVC) on the progress of their green technologies. Using difference-in-difference panel models with big data of Chinese enterprises, we measured influencing factors such as enterprise participation degree, enterprise scale, corporate ownership, and research and development (R&D) investment. The results revealed that participation in the GVC can considerably improve the green technology levels in all enterprises, except state-owned ones. However, the older an enterprise, the higher the sluggishness is likely to be in its R&D activities; this is particularly true for state-owned enterprises. The findings provide insights into the strategy of actively addressing Chinese enterprises' predicament of being restricted to the lower end of the GVC.
NASA Astrophysics Data System (ADS)
Rahman, P. A.; D'K Novikova Freyre Shavier, G.
2018-03-01
This scientific paper is devoted to the analysis of the mean time to data loss of redundant disk arrays RAID-6 with alternation of data considering different failure rates of disks both in normal state of the disk array and in degraded and rebuild states, and also nonzero time of the disk replacement. The reliability model developed by the authors on the basis of the Markov chain and obtained calculation formula for estimation of the mean time to data loss (MTTDL) of the RAID-6 disk arrays are also presented. At last, the technique of estimation of the initial reliability parameters and examples of calculation of the MTTDL of the RAID-6 disk arrays for the different numbers of disks are also given.
A model of airport security work flow based on petri net
NASA Astrophysics Data System (ADS)
Dong, Xinming
2017-09-01
Extremely long lines at airports in the United States have been sharply criticized. In order to find out the bottleneck in the existing security system and put forward reasonable improvement plans and proposal, the Petri net model and the Markov Chain are introduced in this paper. This paper uses data collected by transportation Security Agency (TSA), assuming the data can represent the average level of all airports in the Unites States, to analysis the performance of security check system. By calculating the busy probabilities and the utilization probabilities, the bottleneck is found. Moreover, recommendation is given based on the parameters’ modification in Petri net model.
Universality of entropy scaling in one dimensional gapless models.
Korepin, V E
2004-03-05
We consider critical models in one dimension. We study the ground state in the thermodynamic limit (infinite lattice). We are interested in an entropy of a subsystem. We calculate the entropy of a part of the ground state from a space interval (0,x). At zero temperature it describes the entanglement of the part of the ground state from this interval with the rest of the ground state. We obtain an explicit formula for the entropy of the subsystem at any temperature. At zero temperature our formula reproduces a logarithmic formula, discovered by Vidal, Latorre, Rico, and Kitaev for spin chains. We prove our formula by means of conformal field theory and the second law of thermodynamics. Our formula is universal. We illustrate it for a Bose gas with a delta interaction and for the Hubbard model.
NASA Astrophysics Data System (ADS)
Fatollahi, Amir H.; Khorrami, Mohammad; Shariati, Ahmad; Aghamohammadi, Amir
2011-04-01
A complete classification is given for one-dimensional chains with nearest-neighbor interactions having two states in each site, for which a matrix product ground state exists. The Hamiltonians and their corresponding matrix product ground states are explicitly obtained.
Chained Bell Inequality Experiment with High-Efficiency Measurements
NASA Astrophysics Data System (ADS)
Tan, T. R.; Wan, Y.; Erickson, S.; Bierhorst, P.; Kienzler, D.; Glancy, S.; Knill, E.; Leibfried, D.; Wineland, D. J.
2017-03-01
We report correlation measurements on two 9Be+ ions that violate a chained Bell inequality obeyed by any local-realistic theory. The correlations can be modeled as derived from a mixture of a local-realistic probabilistic distribution and a distribution that violates the inequality. A statistical framework is formulated to quantify the local-realistic fraction allowable in the observed distribution without the fair-sampling or independent-and-identical-distributions assumptions. We exclude models of our experiment whose local-realistic fraction is above 0.327 at the 95% confidence level. This bound is significantly lower than 0.586, the minimum fraction derived from a perfect Clauser-Horne-Shimony-Holt inequality experiment. Furthermore, our data provide a device-independent certification of the deterministically created Bell states.
On the transfer matrix of the supersymmetric eight-vertex model. I. Periodic boundary conditions
NASA Astrophysics Data System (ADS)
Hagendorf, Christian; Liénardy, Jean
2018-03-01
The square-lattice eight-vertex model with vertex weights a, b, c, d obeying the relation (a^2+ab)(b^2+ab) = (c^2+ab)(d^2+ab) and periodic boundary conditions is considered. It is shown that the transfer matrix of the model for L = 2n + 1 vertical lines and periodic boundary conditions along the horizontal direction possesses the doubly degenerate eigenvalue \\Thetan = (a+b){\\hspace{0pt}}2n+1 . This proves a conjecture by Stroganov from 2001. The proof uses the supersymmetry of a related XYZ spin-chain Hamiltonian. The eigenstates of the transfer matrix corresponding to \\Thetan are shown to be the ground states of the spin-chain Hamiltonian. Moreover, for positive vertex weights \\Thetan is the largest eigenvalue of the transfer matrix.
Chauvin, C; Clement, C; Bruneau, M; Pommeret, D
2007-07-16
This article describes the use of Markov chains to explore the time-patterns of antimicrobial exposure in broiler poultry. The transition in antimicrobial exposure status (exposed/not exposed to an antimicrobial, with a distinction between exposures to the different antimicrobial classes) in extensive data collected in broiler chicken flocks from November 2003 onwards, was investigated. All Markov chains were first-order chains. Mortality rate, geographical location and slaughter semester were sources of heterogeneity between transition matrices. Transitions towards a 'no antimicrobial' exposure state were highly predominant, whatever the initial state. From a 'no antimicrobial' exposure state, the transition to beta-lactams was predominant among transitions to an antimicrobial exposure state. Transitions between antimicrobial classes were rare and variable. Switches between antimicrobial classes and repeats of a particular class were both observed. Application of Markov chains analysis to the database of the nation-wide antimicrobial resistance monitoring programme pointed out that transition probabilities between antimicrobial exposure states increased with the number of resistances in Escherichia coli strains.
Myosin conformational states determined by single fluorophore polarization
Warshaw, David M.; Hayes, Eric; Gaffney, Donald; Lauzon, Anne-Marie; Wu, Junru; Kennedy, Guy; Trybus, Kathleen; Lowey, Susan; Berger, Christopher
1998-01-01
Muscle contraction is powered by the interaction of the molecular motor myosin with actin. With new techniques for single molecule manipulation and fluorescence detection, it is now possible to correlate, within the same molecule and in real time, conformational states and mechanical function of myosin. A spot-confocal microscope, capable of detecting single fluorophore polarization, was developed to measure orientational states in the smooth muscle myosin light chain domain during the process of motion generation. Fluorescently labeled turkey gizzard smooth muscle myosin was prepared by removal of endogenous regulatory light chain and re-addition of the light chain labeled at cysteine-108 with the 6-isomer of iodoacetamidotetramethylrhodamine (6-IATR). Single myosin molecule fluorescence polarization data, obtained in a motility assay, provide direct evidence that the myosin light chain domain adopts at least two orientational states during the cyclic interaction of myosin with actin, a randomly disordered state, most likely associated with myosin whereas weakly bound to actin, and an ordered state in which the light chain domain adopts a finite angular orientation whereas strongly bound after the powerstroke. PMID:9653135
sdg boson model in the SU(3) scheme
NASA Astrophysics Data System (ADS)
Akiyama, Yoshimi
1985-02-01
Basic properties of the interacting boson model with s-, d- and g-bosons are investigated in rotational nuclei. An SU(3)-seniority scheme is found for the classification of physically important states according to a group reduction chain U(15) ⊃ SU(3). The capability of describing rotational bands increases enormously in comparison with the ordinary sd interacting boson model. The sdg boson model is shown to be able to describe the so-called anharmonicity effect recently observed in the 168Er nucleus.
Dynamical modelling of coordinated multiple robot systems
NASA Technical Reports Server (NTRS)
Hayati, Samad
1987-01-01
The state of the art in the modeling of the dynamics of coordinated multiple robot manipulators is summarized and various problems related to this subject are discussed. It is recognized that dynamics modeling is a component used in the design of controllers for multiple cooperating robots. As such, the discussion addresses some problems related to the control of multiple robots. The techniques used to date in the modeling of closed kinematic chains are summarized. Various efforts made to date for the control of coordinated multiple manipulators is summarized.
Stoniute, Julija; Mott, David John; Shen, Jing
2018-05-01
The time trade-off (TTO) technique is commonly used to elicit health state utilities. Nevertheless, when the health states being valued are temporary, the TTO approach may be unsuitable. A variant of TTO- chained TTO-has been suggested to be used when the health states are temporary, but little research has been done on how chained TTO should be conducted. To systematically review the use of chained TTO in valuing temporary health states. A systematic literature search was conducted using the following major databases: Ovid MEDLINE(R), Embase, EBM Reviews, and PsycINFO. Abstracts (full articles if necessary) were screened by two independent reviewers, with a third reviewer resolving any disagreements. The resulting number of articles for review was low (n = 9). All the reviewed studies used face-to-face interviews, most had small sample sizes (<100), and all studies valued a small number of health states (<7), with time horizons typically ranging from 4 weeks to 1 year. All studies discussed methodological issues of using chained TTO, and some compared the results with those generated using other preference elicitation methods. Chained TTO appears to be feasible, consistent, and responsive and allows the valuation of temporary health states that would improve the efficiency and accuracy of decision making in health and health care. Nevertheless, the evidence is limited due to the low number of relevant studies in the literature. Further research is needed to examine the performance and validity of chained TTO compared with conventional TTO in the valuation of temporary health states. Copyright © 2017 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.
Molecular dynamics simulations of fluoropolymers in the solid state
NASA Astrophysics Data System (ADS)
Holt, David Bryan
1998-10-01
Molecular mechanics and dynamics simulations have been utilized to address the behavior of helix reversal defects in fluoropolymers. The results of the simulations confirm that helix reversals do form and migrate in PTFE crystals. The most important defect structure is a helix reversal band: two helix reversals which bracker a small chain segment (typically 6-7 backbone atoms) having the opposite helical sense from the parent molecule. Small reversal bands had velocities ranging between 100 m/s (low temperature)-250 m/s (high temperature). The size of this reversal band defect is dependent upon the helical conformation and is equal to approximately half of the helical repeat unit in the low and intermediate temperature phases. In the high temperature phase where intermolecular effects are diminished, a wider distribution of reversal band sizes was observed during the simulations. A mechanism is identified by which significant reorientation of a chain segment about the molecular axis can occur when it is bracketed by two helix reversal bands. Simulations with a model containing a perfluoromethyl (PFM) group at low temperature showed that the presence of the PFM group significantly restricts chain mobility locally. However, a significant reduction in the helix reversal defect density was observed on neighboring chains as well. During simulations in which a shear deformation was applied to the models with and without a PFM group, an increase in reversal defect density was observed. However, the helix reversal density in the sheared model containing the PFM branch was less than that in the model without a PFM branch under no shear. These data implicate helix reversal defects and associated chain segment motions in the mechanical behavior of fluoropolymer materials.
van der Fels-Klerx, H J; Booij, C J H
2010-06-01
This article provides an overview of available systems for management of Fusarium mycotoxins in the cereal grain supply chain, with an emphasis on the use of predictive mathematical modeling. From the state of the art, it proposes future developments in modeling and management and their challenges. Mycotoxin contamination in cereal grain-based feed and food products is currently managed and controlled by good agricultural practices, good manufacturing practices, hazard analysis critical control points, and by checking and more recently by notification systems and predictive mathematical models. Most of the predictive models for Fusarium mycotoxins in cereal grains focus on deoxynivalenol in wheat and aim to help growers make decisions about the application of fungicides during cultivation. Future developments in managing Fusarium mycotoxins should include the linkage between predictive mathematical models and geographical information systems, resulting into region-specific predictions for mycotoxin occurrence. The envisioned geographically oriented decision support system may incorporate various underlying models for specific users' demands and regions and various related databases to feed the particular models with (geographically oriented) input data. Depending on the user requirements, the system selects the best fitting model and available input information. Future research areas include organizing data management in the cereal grain supply chain, developing predictive models for other stakeholders (taking into account the period up to harvest), other Fusarium mycotoxins, and cereal grain types, and understanding the underlying effects of the regional component in the models.
NASA Model of "Threat and Error" in Pediatric Cardiac Surgery: Patterns of Error Chains.
Hickey, Edward; Pham-Hung, Eric; Nosikova, Yaroslavna; Halvorsen, Fredrik; Gritti, Michael; Schwartz, Steven; Caldarone, Christopher A; Van Arsdell, Glen
2017-04-01
We introduced the National Aeronautics and Space Association threat-and-error model to our surgical unit. All admissions are considered flights, which should pass through stepwise deescalations in risk during surgical recovery. We hypothesized that errors significantly influence risk deescalation and contribute to poor outcomes. Patient flights (524) were tracked in real time for threats, errors, and unintended states by full-time performance personnel. Expected risk deescalation was wean from mechanical support, sternal closure, extubation, intensive care unit (ICU) discharge, and discharge home. Data were accrued from clinical charts, bedside data, reporting mechanisms, and staff interviews. Infographics of flights were openly discussed weekly for consensus. In 12% (64 of 524) of flights, the child failed to deescalate sequentially through expected risk levels; unintended increments instead occurred. Failed deescalations were highly associated with errors (426; 257 flights; p < 0.0001). Consequential errors (263; 173 flights) were associated with a 29% rate of failed deescalation versus 4% in flights with no consequential error (p < 0.0001). The most dangerous errors were apical errors typically (84%) occurring in the operating room, which caused chains of propagating unintended states (n = 110): these had a 43% (47 of 110) rate of failed deescalation (versus 4%; p < 0.0001). Chains of unintended state were often (46%) amplified by additional (up to 7) errors in the ICU that would worsen clinical deviation. Overall, failed deescalations in risk were extremely closely linked to brain injury (n = 13; p < 0.0001) or death (n = 7; p < 0.0001). Deaths and brain injury after pediatric cardiac surgery almost always occur from propagating error chains that originate in the operating room and are often amplified by additional ICU errors. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.
Improving Markov Chain Models for Road Profiles Simulation via Definition of States
2012-04-01
wavelet transform in pavement profile analysis," Vehicle System Dynamics: International Journal of Vehicle Mechanics and Mobility, vol. 47, no. 4...34Estimating Markov Transition Probabilities from Micro -Unit Data," Journal of the Royal Statistical Society. Series C (Applied Statistics), pp. 355-371
Structural transitions in vortex systems with anisotropic interactions
Olszewski, Maciej W.; Eskildsen, M. R.; Reichhardt, Charles; ...
2017-12-29
We introduce a model of vortices in type-II superconductors with a four-fold anisotropy in the vortex–vortex interaction potential. Using numerical simulations we show that the vortex lattice undergoes structural transitions as the anisotropy is increased, with a triangular lattice at low anisotropy, a rhombic intermediate state, and a square lattice for high anisotropy. In some cases we observe a multi-q state consisting of an Archimedean tiling that combines square and triangular local ordering. At very high anisotropy, domains of vortex chain states appear. We discuss how this model can be generalized to higher order anisotropy as well as its applicabilitymore » to other particle-based systems with anisotropic particle–particle interactions.« less
Thermomechanical Properties and Glass Dynamics of Polymer-Tethered Colloidal Particles and Films
2017-01-01
Polymer-tethered colloidal particles (aka “particle brush materials”) have attracted interest as a platform for innovative material technologies and as a model system to elucidate glass formation in complex structured media. In this contribution, Brillouin light scattering is used to sequentially evaluate the role of brush architecture on the dynamical properties of brush particles in both the individual and assembled (film) state. In the former state, the analysis reveals that brush–brush interactions as well as global chain relaxation sensitively depend on grafting density; i.e., more polymer-like behavior is observed in sparse brush systems. This is interpreted to be a consequence of more extensive chain entanglement. In contrast, the local relaxation of films does not depend on grafting density. The results highlight that relaxation processes in particle brush-based materials span a wider range of time and length scales as compared to linear chain polymers. Differentiation between relaxation on local and global scale is necessary to reveal the influence of molecular structure and connectivity on the aging behavior of these complex systems. PMID:29755139
Thermomechanical Properties and Glass Dynamics of Polymer-Tethered Colloidal Particles and Films.
Cang, Yu; Reuss, Anna N; Lee, Jaejun; Yan, Jiajun; Zhang, Jianan; Alonso-Redondo, Elena; Sainidou, Rebecca; Rembert, Pascal; Matyjaszewski, Krzysztof; Bockstaller, Michael R; Fytas, George
2017-11-14
Polymer-tethered colloidal particles (aka "particle brush materials") have attracted interest as a platform for innovative material technologies and as a model system to elucidate glass formation in complex structured media. In this contribution, Brillouin light scattering is used to sequentially evaluate the role of brush architecture on the dynamical properties of brush particles in both the individual and assembled (film) state. In the former state, the analysis reveals that brush-brush interactions as well as global chain relaxation sensitively depend on grafting density; i.e., more polymer-like behavior is observed in sparse brush systems. This is interpreted to be a consequence of more extensive chain entanglement. In contrast, the local relaxation of films does not depend on grafting density. The results highlight that relaxation processes in particle brush-based materials span a wider range of time and length scales as compared to linear chain polymers. Differentiation between relaxation on local and global scale is necessary to reveal the influence of molecular structure and connectivity on the aging behavior of these complex systems.
Effect of molecular properties on the performance of polymer light-emitting diodes
NASA Astrophysics Data System (ADS)
Ramos, Marta M. D.; Almeida, A. M.; Correia, Helena M. G.; Ribeiro, R. Mendes; Stoneham, A. M.
2004-11-01
The performance of a single layer polymer light-emitting diode depends on several interdependent factors, although recombination between electrons and holes within the polymer layer is believed to play an important role. Our aim is to carry out computer experiments in which bipolar charge carriers are injected in polymer networks made of poly(p-phenylene vinylene) chains randomly oriented. In these simulations, we follow the charge evolution in time from some initial state to the steady state. The intra-molecular properties of the polymer molecules obtained from self-consistent quantum molecular dynamics calculations are used in the mesoscopic model. The purpose of the present work is to clarify the effects of intra-molecular charge mobility and energy disorder on recombination efficiency. In particular, we find that charge mobility along the polymer chains has a serious influence on recombination within the polymer layer. Our results also show that energy disorder due to differences in ionization potential and electron affinity of neighbouring molecules affects mainly recombinations that occur near the electrodes at polymer chains parallel to them.
Inverse participation ratios in the XX spin chain
NASA Astrophysics Data System (ADS)
Tsukerman, Emmanuel
2017-03-01
We continue the study of the inverse participation ratios (IPRs) of the XXZ Heisenberg spin chain initiated by Stéphan, Furukawa, Misguich, and Pasquier (2009) and continued by Misguich, Pasquier, and Luck (2016) by focusing on the case of the XX Heisenberg spin chain. For the ground state, Stéphan et al. note that calculating the IPR is equivalent to Dyson's constant term ex-conjecture. We express the IPRs of excited states as an apparently new "discrete" Hall inner product. We analyze this inner product using the theory of symmetric functions (Jack polynomials, Schur polynomials, the standard Hall inner product, and ωq ,t) to determine some exact expressions and asymptotics for IPRs. We show that IPRs can be indexed by partitions, and asymptotically the IPR of a partition is equal to that of the conjugate partition. We relate the IPRs to two other models from physics, namely, the circular symplectic ensemble of Dyson and the Dyson-Gaudin two-dimensional Coulomb lattice gas. Finally, we provide a description of the IPRs in terms of a signed count of diagonals of permutohedra.
On the possibility of complete revivals after quantum quenches to a critical point
NASA Astrophysics Data System (ADS)
Najafi, K.; Rajabpour, M. A.
2017-07-01
In a recent letter [J. Cardy, Phys. Rev. Lett. 112, 220401 (2014), 10.1103/PhysRevLett.112.220401], the author made a very interesting observation that complete revivals of quantum states after quantum quench can happen in a period that is a fraction of the system size. This is possible for critical systems that can be described by minimal conformal field theories with central charge c <1 . In this paper, we show that these complete revivals are impossible in microscopic realizations of those minimal models. We will prove the absence of the mentioned complete revivals for the critical transverse field Ising chain analytically, and present numerical results for the critical line of the XY chain. In particular, for the considered initial states, we will show that criticality has no significant effect in partial revivals. We also comment on the applicability of quasiparticle picture to determine the period of the partial revivals qualitatively. In particular, we detect a regime in the phase diagram of the XY chain in which one can not determine the period of the partial revivals using the quasiparticle picture.
Optimal clinical trial design based on a dichotomous Markov-chain mixed-effect sleep model.
Steven Ernest, C; Nyberg, Joakim; Karlsson, Mats O; Hooker, Andrew C
2014-12-01
D-optimal designs for discrete-type responses have been derived using generalized linear mixed models, simulation based methods and analytical approximations for computing the fisher information matrix (FIM) of non-linear mixed effect models with homogeneous probabilities over time. In this work, D-optimal designs using an analytical approximation of the FIM for a dichotomous, non-homogeneous, Markov-chain phase advanced sleep non-linear mixed effect model was investigated. The non-linear mixed effect model consisted of transition probabilities of dichotomous sleep data estimated as logistic functions using piecewise linear functions. Theoretical linear and nonlinear dose effects were added to the transition probabilities to modify the probability of being in either sleep stage. D-optimal designs were computed by determining an analytical approximation the FIM for each Markov component (one where the previous state was awake and another where the previous state was asleep). Each Markov component FIM was weighted either equally or by the average probability of response being awake or asleep over the night and summed to derive the total FIM (FIM(total)). The reference designs were placebo, 0.1, 1-, 6-, 10- and 20-mg dosing for a 2- to 6-way crossover study in six dosing groups. Optimized design variables were dose and number of subjects in each dose group. The designs were validated using stochastic simulation/re-estimation (SSE). Contrary to expectations, the predicted parameter uncertainty obtained via FIM(total) was larger than the uncertainty in parameter estimates computed by SSE. Nevertheless, the D-optimal designs decreased the uncertainty of parameter estimates relative to the reference designs. Additionally, the improvement for the D-optimal designs were more pronounced using SSE than predicted via FIM(total). Through the use of an approximate analytic solution and weighting schemes, the FIM(total) for a non-homogeneous, dichotomous Markov-chain phase advanced sleep model was computed and provided more efficient trial designs and increased nonlinear mixed-effects modeling parameter precision.
Large scale shell model study of nuclear spectroscopy in nuclei around 132Sn
NASA Astrophysics Data System (ADS)
Lo Iudice, N.; Bianco, D.; Andreozzi, F.; Porrino, A.; Knapp, F.
2012-10-01
The properties of low-lying 2+ states in chains of nuclei in the proximity of the magic number N=82 are investigated within a new shell model approach exploiting an iterative algorithm alternative to Lanczos. The calculation yields levels and transition strengths in overall good agreement with experiments. The comparative analysis of the E2 and M1 transitions supports, in many cases, the scheme provided by the interacting boson model.
On a common critical state in localized and diffuse failure modes
NASA Astrophysics Data System (ADS)
Zhu, Huaxiang; Nguyen, Hien N. G.; Nicot, François; Darve, Félix
2016-10-01
Accurately modeling the critical state mechanical behavior of granular material largely relies on a better understanding and characterizing the critical state fabric in different failure modes, i.e. localized and diffuse failure modes. In this paper, a mesoscopic scale is introduced, in which the organization of force-transmission paths (force-chains) and cells encompassed by contacts (meso-loops) can be taken into account. Numerical drained biaxial tests using a discrete element method are performed with different initial void ratios, in order to investigate the critical state fabric on the meso-scale in both localized and diffuse failure modes. According to the displacement and strain fields extracted from tests, the failure mode and failure area of each specimen are determined. Then convergent critical state void ratios are observed in failure area of specimens. Different mechanical features of two kinds of meso-structures (force-chains and meso-loops) are investigated, to clarify whether there exists a convergent meso-structure inside the failure area of granular material, as the signature of critical state. Numerical results support a positive answer. Failure area of both localized and diffuse failure modes therefore exhibits the same fabric in critical state. Hence, these two failure modes prove to be homological with respect to the concept of the critical state.
RFID in the healthcare supply chain: usage and application.
Kumar, Sameer; Swanson, Eric; Tran, Thuy
2009-01-01
The purposes of this study are to first, determine the most efficient and cost effective portions of the healthcare supply chain in which radio frequency identification devices (RFID) can be implemented. Second, provide specific examples of RFID implementation and show how these business applications will add to the effectiveness of the healthcare supply chain. And third, to describe the current state of RFID technology and to give practical information for managers in the healthcare sector to make sound decisions about the possible implementation of RFID technology within their organizations. Healthcare industry literature was reviewed and examples of specific instances of RFID implementation were examined using an integrated simulation model developed with Excel, @Risk and Visio software tools. Analysis showed that the cost of implementing current RFID technology is too expensive for broad and sweeping implementation within the healthcare sector at this time. However, several example applications have been identified in which this technology can be effectively leveraged in a cost-effective way. This study shows that RFID technology has come a long way in the recent past and has potential to improve healthcare sector productivity and efficiency. Implementation by large companies such as Wal-mart has helped to make the technology become much more economical in its per unit cost as well as its supporting equipment and training costs. The originality of this study lies in the idea that few practical and pragmatic approaches have been taken within the academic field of study for the implementation of RFID into the healthcare supply chain. Much of the research has focused on specific companies or portions of the supply chain and not the entire supply chain. Also, many of the papers have discussed the future of the supply chain that is heavily dependent on advances in RFID technology. A few viable applications of how RFID technology can be implemented in the healthcare supply chain are presented and how the current state of technology limits the broad use and implementation of this technology in the healthcare industry.
Periodic box Fermi hypernetted chain calculations of neutron star crustal matter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bassan, Nicola; Fantoni, Stefano; Schmidt, Kevin E.
2011-09-15
Neutron star crustal matter, whose properties are relevant in many models aimed at explaining observed astrophysical phenomena, has so far always been studied using a mean-field approach. To check the results obtained in this way, a sensible next step is to make use of a realistic nuclear potential. The present paper extends the periodic box Fermi hypernetted chain method to include longitudinal-isospin dependence of the correlations, making feasible a study of asymmetric crustal matter. Results are presented for the symmetry energy, the low-density neutron star equation of state, and the single-particle neutron and proton energies.
Wei, Shaoceng; Kryscio, Richard J.
2015-01-01
Continuous-time multi-state stochastic processes are useful for modeling the flow of subjects from intact cognition to dementia with mild cognitive impairment and global impairment as intervening transient, cognitive states and death as a competing risk (Figure 1). Each subject's cognition is assessed periodically resulting in interval censoring for the cognitive states while death without dementia is not interval censored. Since back transitions among the transient states are possible, Markov chains are often applied to this type of panel data. In this manuscript we apply a Semi-Markov process in which we assume that the waiting times are Weibull distributed except for transitions from the baseline state, which are exponentially distributed and in which we assume no additional changes in cognition occur between two assessments. We implement a quasi-Monte Carlo (QMC) method to calculate the higher order integration needed for likelihood estimation. We apply our model to a real dataset, the Nun Study, a cohort of 461 participants. PMID:24821001
Wei, Shaoceng; Kryscio, Richard J
2016-12-01
Continuous-time multi-state stochastic processes are useful for modeling the flow of subjects from intact cognition to dementia with mild cognitive impairment and global impairment as intervening transient cognitive states and death as a competing risk. Each subject's cognition is assessed periodically resulting in interval censoring for the cognitive states while death without dementia is not interval censored. Since back transitions among the transient states are possible, Markov chains are often applied to this type of panel data. In this manuscript, we apply a semi-Markov process in which we assume that the waiting times are Weibull distributed except for transitions from the baseline state, which are exponentially distributed and in which we assume no additional changes in cognition occur between two assessments. We implement a quasi-Monte Carlo (QMC) method to calculate the higher order integration needed for likelihood estimation. We apply our model to a real dataset, the Nun Study, a cohort of 461 participants. © The Author(s) 2014.
NASA Astrophysics Data System (ADS)
Champagne, Benoı̂t; Mennucci, Benedetta; Cossi, Maurizio; Cammi, Roberto; Tomasi, Jacopo
1998-11-01
The solvent effects upon the longitudinal polarizability ( αL) and second hyperpolarizability ( γL) of small all-trans polyacetylene (PA) chains ranging from C 2H 4 to C 10H 12 have been evaluated at the time-dependent Hartree-Fock (TDHF) level within the framework of the polarizable continuum model. The solvent effects, which correspond to the solvent-induced modifications of the solute properties, result in large increases of the linear and nonlinear responses even for solvents with low dielectric constants. When the dielectric constant is increased, the αL values tend to saturate at values 30%-40% larger than in vacuo, whereas for γL it ranges from 100% to 400% depending upon the nonlinear optical process and the length of the PA chain. These solvent-induced αL and γL enhancements can partially be accounted for by the corresponding decrease of the energy of the lowest optically-allowed electronic excitation. The geometrical parameters of the ground state of the PA chains are almost unaffected by the solvent. This shows that the solvent effects are mainly of electronic nature. In addition, the local field factors, which relate the macroscopic or Maxwell field to the field experienced by the solute, tend towards unity with increasing chain length for the longitudinal PA axis.
Olivares-Quiroz, L
2016-07-01
A coarse-grained statistical mechanics-based model for ideal heteropolymer proteinogenic chains of non-interacting residues is presented in terms of the size K of the chain and the set of helical propensities [Formula: see text] associated with each residue j along the chain. For this model, we provide an algorithm to compute the degeneracy tensor [Formula: see text] associated with energy level [Formula: see text] where [Formula: see text] is the number of residues with a native contact in a given conformation. From these results, we calculate the equilibrium partition function [Formula: see text] and characteristic temperature [Formula: see text] at which a transition from a low to a high entropy states is observed. The formalism is applied to analyze the effect on characteristic temperatures [Formula: see text] of single-point mutations and deletions of specific amino acids [Formula: see text] along the chain. Two probe systems are considered. First, we address the case of a random heteropolymer of size K and given helical propensities [Formula: see text] on a conformational phase space. Second, we focus our attention to a particular set of neuropentapeptides, [Met-5] and [Leu-5] enkephalins whose thermodynamic stability is a key feature on their coupling to [Formula: see text] and [Formula: see text] receptors and the triggering of biochemical responses.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Short, Mark; Chliquete, Carlos
2011-01-20
The pulsating dynamics of gaseous detonations with a model two-step chain-branching kinetic mechanism are studied both numerically and asymptotically. The model studied here was also used in [4], [3] and [2] and mimics the attributes of some chain-branching reaction mechanisms. Specifically, the model comprises a chain-initiationlbranching zone with an Arrhenius temperature-sensitive rate behind the detonation shock where fuel is converted into chain-radical with no heat release. This is followed by a chain-termination zone having a temperature insensitive rate where the exothermic heat of reaction is released. The lengths of these two zones depend on the relative rates of each stage.more » It was determined in [4] and [3] via asymptotic and numerical analysis that the ratio of the length of the chain-branching zone to that of the chain-initation zone relative to the size of the von Neumann state scaled activation energy in the chain initiation/branching zone has a primary influence of the stability of one-dimensional pulsating instability behavior for this model. In [2], the notion of a specific stability parameter related to this ratio was proposed that determines the boundary between stable and unstable waves. In [4], a slow-time varying asymptotic study was conducted of pulsating instability of Chapman-Jouguet (CJ) detonations with the above two-step rate model, assuming a large activation energy for the chain-initiation zone and a chain-termination zone longer than the chain-initiation zone. Deviations D{sub n}{sup (1)} ({tau}) of the detonation velocity from Chapman-Jouguet were of the order of the non-dimensional activation energy. Solutions were sought for a pulsation timescale of the order of the non-dimensional activation energy times the particle transit time through the induction zone. On this time-scale, the evolution of the chain-initation zone is quasi-steady. In [4], a time-dependent non-linear evolution equation for D{sub n}{sup (1)} ({tau}) was then constructed via a perturbation procedure for cases where the ratio of the length of the chain-termination zone to chain-initiation zone was less than the non-dimensional activation energy. To leading order, the steady CJ detonation was found to be unstable; higher-order corrections lead to the construction of a stability limit between stable and unsteady pulsating solutions. One conclusion from this study is that for a stability limit to occur at leading order, the period of pulsation of the detonation must occur on the time scale of particle passage through the longer chain-termination zone, while the length of the chain-termination zone must be of order of the non-dimensional activation energy longer than the chain-initiation zone. The relevance of these suggested scalings was verified via numerical solutions of the full Euler system in [3], and formed the basis of the stability parameter criteria suggested in [2]. In the following, we formulate an asymptotic study based on these new suggested scales, studying the implications for describing pulsating behavior in gaseous chain-branching detonations. Specifically, we find that the chain-induction zone structure is the same as that studied in [4]. However, the study of unsteady evolution in the chain-termination region is now governed by a set of asymptotically derived nonlinear POEs. Equations for the linear stablity behavior of this set of POE's is obtained, while the nonlinear POEs are solved numerically using a shock-attached, shock-fitting method developed by Henrick et aJ. [1]. The results thus far show that the stability threshold calculated using the new ratio of the chain-termination zone length to that of the chain-initiation zone yields a marked improvement over [2]. Additionally, solutions will be compared with predictions obtained from the solution of the full Euler system. Finally, the evolution equation previously derived in [4] has been generalized to consider both arbitrary reaction orders and any degree of overdrive.« less
Bernard, Clémence; Vincent, Clémentine; Testa, Damien; Bertini, Eva; Ribot, Jérôme; Di Nardo, Ariel A; Volovitch, Michel; Prochiantz, Alain
2016-05-01
During postnatal life the cerebral cortex passes through critical periods of plasticity allowing its physiological adaptation to the environment. In the visual cortex, critical period onset and closure are influenced by the non-cell autonomous activity of the Otx2 homeoprotein transcription factor, which regulates the maturation of parvalbumin-expressing inhibitory interneurons (PV cells). In adult mice, the maintenance of a non-plastic adult state requires continuous Otx2 import by PV cells. An important source of extra-cortical Otx2 is the choroid plexus, which secretes Otx2 into the cerebrospinal fluid. Otx2 secretion and internalization requires two small peptidic domains that are part of the DNA-binding domain. Thus, mutating these "transfer" sequences also modifies cell autonomous transcription, precluding this approach to obtain a cell autonomous-only mouse. Here, we develop a mouse model with inducible secretion of an anti-Otx2 single-chain antibody to trap Otx2 in the extracellular milieu. Postnatal secretion of this single-chain antibody by PV cells delays PV maturation and reduces plasticity gene expression. Induced adult expression of this single-chain antibody in cerebrospinal fluid decreases Otx2 internalization by PV cells, strongly induces plasticity gene expression and reopens physiological plasticity. We provide the first mammalian genetic evidence for a signaling mechanism involving intercellular transfer of a homeoprotein transcription factor. Our single-chain antibody mouse model is a valid strategy for extracellular neutralization that could be applied to other homeoproteins and signaling molecules within and beyond the nervous system.
Spectroscopic Studies of the Super Relaxed State of Skeletal Muscle
Naber, Nariman; Pate, Edward; Canton, Marcella; Reggiani, Carlo; Cooke, Roger
2016-01-01
In the super-relaxed state of myosin, ATPase activity is strongly inhibited by binding of the myosin heads to the core of the thick filament in a structure known as the interacting-heads motif. In the disordered relaxed state myosin heads are not bound to the core of the thick filament and have an ATPase rate that is 10 fold greater. In the interacting-heads motif the two regulatory light chains appear to bind to each other. We have made single cysteine mutants of the regulatory light chain, placed both paramagnetic and fluorescent probes on them, and exchanged them into skinned skeletal muscle fibers. Many of the labeled light chains tended to disrupt the stability of the super-relaxed state, and showed spectral changes in the transition from the disordered relaxed state to the super-relaxed state. These data support the putative interface between the two regulatory light chains identified by cryo electron microscopy and show that both the divalent cation bound to the regulatory light chain and the N-terminus of the regulatory light chain play a role in the stability of the super-relaxed state. One probe showed a shift to shorter wavelengths in the super-relaxed state such that a ratio of intensities at 440nm to that at 520nm provided a measure of the population of the super-relaxed state amenable for high throughput screens for finding potential pharmaceuticals. The results provide a proof of concept that small molecules that bind to this region can destabilize the super-relaxed state and provide a method to search for small molecules that do so leading to a potentially effective treatment for Type 2 diabetes and obesity. PMID:27479128
Quantum phase transition with dissipative frustration
NASA Astrophysics Data System (ADS)
Maile, D.; Andergassen, S.; Belzig, W.; Rastelli, G.
2018-04-01
We study the quantum phase transition of the one-dimensional phase model in the presence of dissipative frustration, provided by an interaction of the system with the environment through two noncommuting operators. Such a model can be realized in Josephson junction chains with shunt resistances and resistances between the chain and the ground. Using a self-consistent harmonic approximation, we determine the phase diagram at zero temperature which exhibits a quantum phase transition between an ordered phase, corresponding to the superconducting state, and a disordered phase, corresponding to the insulating state with localized superconducting charge. Interestingly, we find that the critical line separating the two phases has a nonmonotonic behavior as a function of the dissipative coupling strength. This result is a consequence of the frustration between (i) one dissipative coupling that quenches the quantum phase fluctuations favoring the ordered phase and (ii) one that quenches the quantum momentum (charge) fluctuations leading to a vanishing phase coherence. Moreover, within the self-consistent harmonic approximation, we analyze the dissipation induced crossover between a first and second order phase transition, showing that quantum frustration increases the range in which the phase transition is second order. The nonmonotonic behavior is reflected also in the purity of the system that quantifies the degree of correlation between the system and the environment, and in the logarithmic negativity as an entanglement measure that encodes the internal quantum correlations in the chain.
Zhang, Hua; Zhang, Tuo; Gao, Jianzhao; Ruan, Jishou; Shen, Shiyi; Kurgan, Lukasz
2012-01-01
Proteins fold through a two-state (TS), with no visible intermediates, or a multi-state (MS), via at least one intermediate, process. We analyze sequence-derived factors that determine folding types by introducing a novel sequence-based folding type predictor called FOKIT. This method implements a logistic regression model with six input features which hybridize information concerning amino acid composition and predicted secondary structure and solvent accessibility. FOKIT provides predictions with average Matthews correlation coefficient (MCC) between 0.58 and 0.91 measured using out-of-sample tests on four benchmark datasets. These results are shown to be competitive or better than results of four modern predictors. We also show that FOKIT outperforms these methods when predicting chains that share low similarity with the chains used to build the model, which is an important advantage given the limited number of annotated chains. We demonstrate that inclusion of solvent accessibility helps in discrimination of the folding kinetic types and that three of the features constitute statistically significant markers that differentiate TS and MS folders. We found that the increased content of exposed Trp and buried Leu are indicative of the MS folding, which implies that the exposure/burial of certain hydrophobic residues may play important role in the formation of the folding intermediates. Our conclusions are supported by two case studies.
NASA Astrophysics Data System (ADS)
Zhang, Shijie; Ren, Zhiyong; He, Suqing; Zhu, Yan; Zhu, Chengshen
2007-01-01
Six polyurethane-urea model hard segments (PUUMHS) were prepared by a solution method based, respectively, on two isocyanates: 4,4'-methylene-diphenyl-diisocyanate (MDI), 4,4'-methylene-dicyclohexyl diisocyanate (HMDI) and three amine chain extenders: ethylene diamine (EDA), methylene-bis-ortho-chloroaniline (MOCA), 2,4-diamino-3,5-dimethylsuphylchlorobenzene (DDSCB). FTIR was used to study their spectroscopic characterization. The main FTIR bands of the six samples were assigned and compared. It was found that most of N-H and C dbnd O are H-bonded in these PUUMHS. However, the N-H in three MDI based PUUMHS is all in the stronger H-bond state than that in their corresponding HMDI based while the C dbnd O in three HMDI based PUUMHS is all in the stronger H-bond state than that in their corresponding MDI based, respectively. In addition, the order of the H-bond strength in HMDI based PUUMHS is MOCA, DDSCB and EDA whether according to νN sbnd H or νC dbnd O band wavenumbers, which is, however, different from that in MDI based PUUMHS. Moreover, the HMDI based PUUMHS shows obvious double amide III bands while the MDI based has only prominent one. The results are discussed according mainly to the different characteristics of the three chain extenders as well as the structure difference between MDI and HMDI.
Remarks towards the spectrum of the Heisenberg spin chain type models
NASA Astrophysics Data System (ADS)
Burdík, Č.; Fuksa, J.; Isaev, A. P.; Krivonos, S. O.; Navrátil, O.
2015-05-01
The integrable close and open chain models can be formulated in terms of generators of the Hecke algebras. In this review paper, we describe in detail the Bethe ansatz for the XXX and the XXZ integrable close chain models. We find the Bethe vectors for two-component and inhomogeneous models. We also find the Bethe vectors for the fermionic realization of the integrable XXX and XXZ close chain models by means of the algebraic and coordinate Bethe ansatz. Special modification of the XXZ closed spin chain model ("small polaron model") is considered. Finally, we discuss some questions relating to the general open Hecke chain models.
NASA Technical Reports Server (NTRS)
Smith, Grant D.; Jaffe, R. L.; Yoon, D. Y.; Arnold, James O. (Technical Monitor)
1994-01-01
Molecular dynamics simulations of POE melts have been performed utilizing a potential force field parameterized to reproduce conformer energies and rotational energy barriers in dimethoxyethane as determined from ab initio electronic structure calculations. Chain conformations and dimensions of POE from the simulations were found to be in good agreement with predictions of a rotational isomeric state (RIS) model based upon the ab initio conformational. energies. The melt chains were found to be somewhat extended relative to chains at theta conditions. This effect will be discussed in light of neutron scattering experiments which indicate that POE chains are extended in the melt relative to theta solutions. The conformational characteristics of POE chains will also be compared with those of other poly (alkylethers), namely poly(oxymethylene), poly(oxytrimethylene) and poly(oxytetramethylene). Local conformational dynamics were found to be more rapid than in polymethylene. Calculated C-H vector correlation times were found to be in reasonable agreement with experimental values from C-13 NMR spin-lattice relaxation times. The influence of ionic salts on local conformations and dynamics will also be discussed.
Studies of biaxial mechanical properties and nonlinear finite element modeling of skin.
Shang, Xituan; Yen, Michael R T; Gaber, M Waleed
2010-06-01
The objective of this research is to conduct mechanical property studies of skin from two individual but potentially connected aspects. One is to determine the mechanical properties of the skin experimentally by biaxial tests, and the other is to use the finite element method to model the skin properties. Dynamic biaxial tests were performed on 16 pieces of abdominal skin specimen from rats. Typical biaxial stress-strain responses show that skin possesses anisotropy, nonlinearity and hysteresis. To describe the stress-strain relationship in forms of strain energy function, the material constants of each specimen were obtained and the results show a high correlation between theory and experiments. Based on the experimental results, a finite element model of skin was built to model the skin's special properties including anisotropy and nonlinearity. This model was based on Arruda and Boyce's eight-chain model and Bischoff et al.'s finite element model of skin. The simulation results show that the isotropic, nonlinear eight-chain model could predict the skin's anisotropic and nonlinear responses to biaxial loading by the presence of an anisotropic prestress state.
NASA Astrophysics Data System (ADS)
Tracy, James L., Jr.
A study of ground state binding energy values listed in the Atomic Mass Evaluation 2012 (AME2012) using an interpretive approach, as opposed to the exploratory methods of previous models, is presented. This model is based on a postulate requiring all protons to pair with available neutrons to form bound alpha clusters as the ground state for an N = Z core upon which excess neutrons are added. For each core, the trend of the binding energy as a function of excess neutrons in the isotopic chain can be fit with a three-term quadratic function. The quadratic parameter reveals a smooth decaying exponential function. By re-envisioning the determination of mass excess, the constant-term fit parameters, representing N = Z nuclei, reveal a near-symmetry around Z = 50. The linear fit parameters exhibit trends which are linear functions of core size. A neutron drip-line prediction is compared against current models. By considering the possibility of an alpha-cluster core, a new ground-state structure grouping scheme is presented; nucleon-nucleon pairing is shown to have a greater role in level filling. This model, referred to as the Alpha-Deuteron-Neutron Model, yields promising first results when considering root-mean-square variances from the AME2012. The beta-decay of the neutron-rich isotope 74Cu has been studied using three high-purity Germanium clover detectors at the Holifield Radioactive Ion Beam Facility at Oak Ridge National Laboratory. A high-resolution mass separator greatly improved the purity of the 74Cu beam by removing isobaric contaminants, thus allowing decay through its isobar chain to the stable 74Ge at the center of the LeRIBSS detector array without any decay chain member dominating. Using coincidence gating techniques, 121 gamma-rays associated with 74Cu were isolated from the collective singles spectrum. Eighty-seven of these were placed in an expanded level scheme, and updated beta-feeding level intensities and log( ft) values are presented based on multiple newly-placed excited states up to 6.8 MeV. The progression of simulated Total Absorption gamma-ray Spectroscopy (TAGS) based on known levels and beta feeding values from previous measurements to this evaluation are presented and demonstrate the need for a TAGS measurement of this isotope to gain a more complete understanding of its decay scheme.
Return probability after a quench from a domain wall initial state in the spin-1/2 XXZ chain
NASA Astrophysics Data System (ADS)
Stéphan, Jean-Marie
2017-10-01
We study the return probability and its imaginary (τ) time continuation after a quench from a domain wall initial state in the XXZ spin chain, focusing mainly on the region with anisotropy \\vert Δ\\vert < 1 . We establish exact Fredholm determinant formulas for those, by exploiting a connection to the six-vertex model with domain wall boundary conditions. In imaginary time, we find the expected scaling for a partition function of a statistical mechanical model of area proportional to τ2 , which reflects the fact that the model exhibits the limit shape phenomenon. In real time, we observe that in the region \\vert Δ\\vert <1 the decay for long time t is nowhere continuous as a function of anisotropy: it is Gaussian at roots of unity and exponential otherwise. We also determine that the front moves as x_f(t)=t\\sqrt{1-Δ^2} , by the analytic continuation of known arctic curves in the six-vertex model. Exactly at \\vert Δ\\vert =1 , we find the return probability decays as e-\\zeta(3/2) \\sqrt{t/π}t1/2O(1) . It is argued that this result provides an upper bound on spin transport. In particular, it suggests that transport should be diffusive at the isotropic point for this quench.
On Condensation Properties of Bethe Roots Associated with the XXZ Chain
NASA Astrophysics Data System (ADS)
Kozlowski, Karol K.
2018-02-01
I prove that the Bethe roots describing either the ground state or a certain class of "particle-hole" excited states of the XXZ spin-1/2 chain in any sector with magnetisation m \\in [0;1/2] exist, are uniquely defined, and form, in the infinite volume limit, a dense distribution on a subinterval of R. The results hold for any value of the anisotropy {Δ ≥ -1}. In fact, I establish an even stronger result, namely the existence of an all order asymptotic expansion of the counting function associated with such roots. As a corollary, these results allow one to prove the existence and form of the infinite volume limit of various observables attached to the model -the excitation energy, momentum, the zero temperature correlation functions, so as to name a few- that were argued earlier in the literature.
Quasi-soliton scattering in quantum spin chains
NASA Astrophysics Data System (ADS)
Vlijm, R.; Ganahl, M.; Fioretto, D.; Brockmann, M.; Haque, M.; Evertz, H. G.; Caux, J.-S.
2015-12-01
The quantum scattering of magnon bound states in the anisotropic Heisenberg spin chain is shown to display features similar to the scattering of solitons in classical exactly solvable models. Localized colliding Gaussian wave packets of bound magnons are constructed from string solutions of the Bethe equations and subsequently evolved in time, relying on an algebraic Bethe ansatz based framework for the computation of local expectation values in real space-time. The local magnetization profile shows the trajectories of colliding wave packets of bound magnons, which obtain a spatial displacement upon scattering. Analytic predictions on the displacements for various values of anisotropy and string lengths are derived from scattering theory and Bethe ansatz phase shifts, matching time-evolution fits on the displacements. The time-evolved block decimation algorithm allows for the study of scattering displacements from spin-block states, showing similar scattering displacement features.
Quasi-soliton scattering in quantum spin chains
NASA Astrophysics Data System (ADS)
Fioretto, Davide; Vljim, Rogier; Ganahl, Martin; Brockmann, Michael; Haque, Masud; Evertz, Hans-Gerd; Caux, Jean-Sébastien
The quantum scattering of magnon bound states in the anisotropic Heisenberg spin chain is shown to display features similar to the scattering of solitons in classical exactly solvable models. Localized colliding Gaussian wave packets of bound magnons are constructed from string solutions of the Bethe equations and subsequently evolved in time, relying on an algebraic Bethe ansatz based framework for the computation of local expectation values in real space-time. The local magnetization profile shows the trajectories of colliding wave packets of bound magnons, which obtain a spatial displacement upon scattering. Analytic predictions on the displacements for various values of anisotropy and string lengths are derived from scattering theory and Bethe ansatz phase shifts, matching time evolution fits on the displacements. The TEBD algorithm allows for the study of scattering displacements from spin-block states, showing similar displacement scattering features.
A new way of visualising quantum fields
NASA Astrophysics Data System (ADS)
Linde, Helmut
2018-05-01
Quantum field theory (QFT) is the basis of some of the most fundamental theories in modern physics, but it is not an easy subject to learn. In the present article we intend to pave the way from quantum mechanics to QFT for students at early graduate or advanced undergraduate level. More specifically, we propose a new way of visualising the wave function Ψ of a linear chain of interacting quantum harmonic oscillators, which can be seen as a model for a simple one-dimensional bosonic quantum field. The main idea is to draw randomly chosen classical states of the chain superimposed upon each other and use a grey scale to represent the value of Ψ at the corresponding coordinates of the quantised system. Our goal is to establish a better intuitive understanding of the mathematical objects underlying quantum field theories and solid state physics.
Smart polymers as surface modifiers for bioanalytical devices and biomaterials: theory and practice
NASA Astrophysics Data System (ADS)
Ivanov, A. E.; Zubov, V. P.
2016-06-01
Smart, or responsive polymers can reversibly change their state of aggregation, thus switching from water-soluble to insoluble state, in response to minor changes in temperature, pH or solvent composition. Grafting of these polymers to solid surfaces imparts the surfaces with controllable wettability and adsorption behaviour. The review summarizes the theoretical models and the results of physical measurements of the conformational transitions in grafted polymer chains and polymer brushes. Primary attention is paid to the grafting density and the length and spatial arrangement of grafted chains, the role of polystyrene, organosilane or alkanethiol sublayers and their effects on adsorption of proteins and adhesion of cells. The key applications of grafted smart polymers such as cell culture and tissue engineering, cell and protein separation, biosensing and targeted drug delivery are surveyed. The bibliography includes 174 references.
Magnetic helices as metastable states of finite XY ferromagnetic chains: An analytical study
NASA Astrophysics Data System (ADS)
Popov, Alexander P.; Pini, Maria Gloria
2018-04-01
We investigated a simple but non trivial model, consisting of a chain of N classical XY spins with nearest neighbor ferromagnetic interaction, where each of the two end-point spins is assumed to be exchange-coupled to a fully-pinned fictitious spin. In the mean field approximation, the system might be representative of a soft ferromagnetic film sandwiched between two magnetically hard layers. We show that, while the ground state is ferromagnetic and collinear, the system can attain non-collinear metastable states in the form of magnetic helices. The helical solutions and their stability were studied analytically in the absence of an external magnetic field. There are four possible classes of solutions. Only one class is metastable, and its helical states contain an integer number of turns. Among the remaining unstable classes, there is a class of helices which contain an integer number of turns. Therefore, an integer number of turns in a helical configuration is a necessary, but not a sufficient, condition for metastability. These results may be useful to devise future applications of metastable magnetic helices as energy-storing elements.
NASA Astrophysics Data System (ADS)
Straus, D. M.
2006-12-01
The transitions between portions of the state space of the large-scale flow is studied from daily wintertime data over the Pacific North America region using the NCEP reanalysis data set (54 winters) and very large suites of hindcasts made with the COLA atmospheric GCM with observed SST (55 members for each of 18 winters). The partition of the large-scale state space is guided by cluster analysis, whose statistical significance and relationship to SST is reviewed (Straus and Molteni, 2004; Straus, Corti and Molteni, 2006). The determination of the global nature of the flow through state space is studied using Markov Chains (Crommelin, 2004). In particular the non-diffusive part of the flow is contrasted in nature (small data sample) and the AGCM (large data sample). The intrinsic error growth associated with different portions of the state space is studied through sets of identical twin AGCM simulations. The goal is to obtain realistic estimates of predictability times for large-scale transitions that should be useful in long-range forecasting.
NASA Astrophysics Data System (ADS)
Karľová, Katarína; Strečka, Jozef; Lyra, Marcelo L.
2018-03-01
The spin-1/2 Ising-Heisenberg pentagonal chain is investigated with use of the star-triangle transformation, which establishes a rigorous mapping equivalence with the effective spin-1/2 Ising zigzag ladder. The investigated model has a rich ground-state phase diagram including two spectacular quantum antiferromagnetic ground states with a fourfold broken symmetry. It is demonstrated that these long-period quantum ground states arise due to a competition between the effective next-nearest-neighbor and nearest-neighbor interactions of the corresponding spin-1/2 Ising zigzag ladder. The concurrence is used to quantify the bipartite entanglement between the nearest-neighbor Heisenberg spin pairs, which are quantum-mechanically entangled in two quantum ground states with or without spontaneously broken symmetry. The pair correlation functions between the nearest-neighbor Heisenberg spins as well as the next-nearest-neighbor and nearest-neighbor Ising spins were investigated with the aim to bring insight into how a relevant short-range order manifests itself at low enough temperatures. It is shown that the specific heat displays temperature dependencies with either one or two separate round maxima.
Direct calculation of liquid-vapor phase equilibria from transition matrix Monte Carlo simulation
NASA Astrophysics Data System (ADS)
Errington, Jeffrey R.
2003-06-01
An approach for directly determining the liquid-vapor phase equilibrium of a model system at any temperature along the coexistence line is described. The method relies on transition matrix Monte Carlo ideas developed by Fitzgerald, Picard, and Silver [Europhys. Lett. 46, 282 (1999)]. During a Monte Carlo simulation attempted transitions between states along the Markov chain are monitored as opposed to tracking the number of times the chain visits a given state as is done in conventional simulations. Data collection is highly efficient and very precise results are obtained. The method is implemented in both the grand canonical and isothermal-isobaric ensemble. The main result from a simulation conducted at a given temperature is a density probability distribution for a range of densities that includes both liquid and vapor states. Vapor pressures and coexisting densities are calculated in a straightforward manner from the probability distribution. The approach is demonstrated with the Lennard-Jones fluid. Coexistence properties are directly calculated at temperatures spanning from the triple point to the critical point.
NASA Astrophysics Data System (ADS)
Gálisová, Lucia; Jakubczyk, Dorota
2017-01-01
Ground-state and magnetocaloric properties of a double-tetrahedral chain, in which nodal lattice sites occupied by the localized Ising spins regularly alternate with triangular clusters half filled with mobile electrons, are exactly investigated by using the transfer-matrix method in combination with the construction of the Nth tensor power of the discrete Fourier transformation. It is shown that the ground state of the model is formed by two non-chiral phases with the zero residual entropy and two chiral phases with the finite residual entropy S = NkB ln 2. Depending on the character of the exchange interaction between the localized Ising spins and mobile electrons, one or three magnetization plateaus can be observed in the magnetization process. Their heights basically depend on the values of Landé g-factors of the Ising spins and mobile electrons. It is also evidenced that the system exhibits both the conventional and inverse magnetocaloric effect depending on values of the applied magnetic field and temperature.
A Markovian model of evolving world input-output network
Isacchini, Giulio
2017-01-01
The initial theoretical connections between Leontief input-output models and Markov chains were established back in 1950s. However, considering the wide variety of mathematical properties of Markov chains, so far there has not been a full investigation of evolving world economic networks with Markov chain formalism. In this work, using the recently available world input-output database, we investigated the evolution of the world economic network from 1995 to 2011 through analysis of a time series of finite Markov chains. We assessed different aspects of this evolving system via different known properties of the Markov chains such as mixing time, Kemeny constant, steady state probabilities and perturbation analysis of the transition matrices. First, we showed how the time series of mixing times and Kemeny constants could be used as an aggregate index of globalization. Next, we focused on the steady state probabilities as a measure of structural power of the economies that are comparable to GDP shares of economies as the traditional index of economies welfare. Further, we introduced two measures of systemic risk, called systemic influence and systemic fragility, where the former is the ratio of number of influenced nodes to the total number of nodes, caused by a shock in the activity of a node, and the latter is based on the number of times a specific economic node is affected by a shock in the activity of any of the other nodes. Finally, focusing on Kemeny constant as a global indicator of monetary flow across the network, we showed that there is a paradoxical effect of a change in activity levels of economic nodes on the overall flow of the world economic network. While the economic slowdown of the majority of nodes with high structural power results to a slower average monetary flow over the network, there are some nodes, where their slowdowns improve the overall quality of the network in terms of connectivity and the average flow of the money. PMID:29065145
Multi-chain Markov chain Monte Carlo methods for computationally expensive models
NASA Astrophysics Data System (ADS)
Huang, M.; Ray, J.; Ren, H.; Hou, Z.; Bao, J.
2017-12-01
Markov chain Monte Carlo (MCMC) methods are used to infer model parameters from observational data. The parameters are inferred as probability densities, thus capturing estimation error due to sparsity of the data, and the shortcomings of the model. Multiple communicating chains executing the MCMC method have the potential to explore the parameter space better, and conceivably accelerate the convergence to the final distribution. We present results from tests conducted with the multi-chain method to show how the acceleration occurs i.e., for loose convergence tolerances, the multiple chains do not make much of a difference. The ensemble of chains also seems to have the ability to accelerate the convergence of a few chains that might start from suboptimal starting points. Finally, we show the performance of the chains in the estimation of O(10) parameters using computationally expensive forward models such as the Community Land Model, where the sampling burden is distributed over multiple chains.
Camargo, Manuel; Téllez, Gabriel
2008-04-07
The renormalized charge of a simple two-dimensional model of colloidal suspension was determined by solving the hypernetted chain approximation and Ornstein-Zernike equations. At the infinite dilution limit, the asymptotic behavior of the correlation functions is used to define the effective interactions between the components of the system and these effective interactions were compared to those derived from the Poisson-Boltzmann theory. The results we obtained show that, in contrast to the mean-field theory, the renormalized charge does not saturate, but exhibits a maximum value and then decays monotonically as the bare charge increases. The results also suggest that beyond the counterion layer near to the macroion surface, the ionic cloud is not a diffuse layer which can be handled by means of the linearized theory, as the two-state model claims, but a more complex structure is settled by the correlations between microions.
Auxiliary Parameter MCMC for Exponential Random Graph Models
NASA Astrophysics Data System (ADS)
Byshkin, Maksym; Stivala, Alex; Mira, Antonietta; Krause, Rolf; Robins, Garry; Lomi, Alessandro
2016-11-01
Exponential random graph models (ERGMs) are a well-established family of statistical models for analyzing social networks. Computational complexity has so far limited the appeal of ERGMs for the analysis of large social networks. Efficient computational methods are highly desirable in order to extend the empirical scope of ERGMs. In this paper we report results of a research project on the development of snowball sampling methods for ERGMs. We propose an auxiliary parameter Markov chain Monte Carlo (MCMC) algorithm for sampling from the relevant probability distributions. The method is designed to decrease the number of allowed network states without worsening the mixing of the Markov chains, and suggests a new approach for the developments of MCMC samplers for ERGMs. We demonstrate the method on both simulated and actual (empirical) network data and show that it reduces CPU time for parameter estimation by an order of magnitude compared to current MCMC methods.
NASA Astrophysics Data System (ADS)
Lee, Allen
The recent natural gas boom has opened much discussion about the potential of natural gas and specifically Liquefied Natural Gas (LNG) in the United States transportation sector. The switch from diesel to natural gas vehicles would reduce foreign dependence on oil, spur domestic economic growth, and potentially reduce greenhouse gas emissions. LNG provides the most potential for the medium to heavy-duty vehicle market partially due to unstable oil prices and stagnant natural gas prices. As long as the abundance of unconventional gas in the United States remains cheap, fuel switching to natural gas could provide significant cost savings for long haul freight industry. Amid a growing LNG station network and ever increasing demand for freight movement, LNG heavy-duty truck sales are less than anticipated and the industry as a whole is less economic than expected. In spite of much existing and mature natural gas infrastructure, the supply chain for LNG is different and requires explicit and careful planning. This thesis proposes research to explore the claim that the largest obstacle to widespread LNG market penetration is sub-optimal infrastructure planning. No other study we are aware of has explicitly explored the LNG transportation fuel supply chain for heavy-duty freight trucks. This thesis presents a novel methodology that links a network infrastructure optimization model (represents supply side) with a vehicle stock and economic payback model (represents demand side). The model characterizes both a temporal and spatial optimization model of future LNG transportation fuel supply chains in the United States. The principal research goal is to assess the economic feasibility of the current LNG transportation fuel industry and to determine an optimal pathway to achieve ubiquitous commercialization of LNG vehicles in the heavy-duty transport sector. The results indicate that LNG is not economic as a heavy-duty truck fuel until 2030 under current market conditions unless a significant station capital subsidy, upwards of 50 percent and even then it might not be enough. However, a doubling of LNG truck demand will initialize network commercialization in the modeling base year, 2012 (the same year Clean Energy Corp. launched their national LNG network) in California and then gradually establish in other hotspot regions in Mid-West and Mid-Atlantic throughout the time horizon. The model shows that trucking routes in California are highly commercial due to high traffic volume and regional advantages. The model can be used by industry to inform necessary policies and to plan future infrastructure deployment along trucking routes that are likely to provide the highest returns.
Quantum gap and spin-wave excitations in the Kitaev model on a triangular lattice
NASA Astrophysics Data System (ADS)
Avella, Adolfo; Di Ciolo, Andrea; Jackeli, George
2018-05-01
We study the effects of quantum fluctuations on the dynamical generation of a gap and on the evolution of the spin-wave spectra of a frustrated magnet on a triangular lattice with bond-dependent Ising couplings, analog of the Kitaev honeycomb model. The quantum fluctuations lift the subextensive degeneracy of the classical ground-state manifold by a quantum order-by-disorder mechanism. Nearest-neighbor chains remain decoupled and the surviving discrete degeneracy of the ground state is protected by a hidden model symmetry. We show how the four-spin interaction, emergent from the fluctuations, generates a spin gap shifting the nodal lines of the linear spin-wave spectrum to finite energies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aaboud, M.; Aad, G.; Abbott, B.
The analysis of the momentum difference between charged hadrons in high-energy proton-proton collisions is performed in order to study coherent particle production. The observed correlation pattern agrees with a model of a helical QCD string fragmenting into a chain of ground-state hadrons. A threshold momentum difference in the production of adjacent pairs of charged hadrons is observed, in agreement with model predictions. The presence of low-mass hadron chains also explains the emergence of charge-combination-dependent two-particle correlations commonly attributed to Bose-Einstein interference. Here, the data sample consists of 190 μb –1 of minimum-bias events collected with proton-proton collisions at a center-of-massmore » energy √s=7 TeV in the early low-luminosity data taking with the ATLAS detector at the LHC.« less
Many-body delocalization with random vector potentials
NASA Astrophysics Data System (ADS)
Cheng, Chen; Mondaini, Rubem
2016-11-01
We study the ergodic properties of excited states in a model of interacting fermions in quasi-one-dimensional chains subjected to a random vector potential. In the noninteracting limit, we show that arbitrarily small values of this complex off-diagonal disorder trigger localization for the whole spectrum; the divergence of the localization length in the single-particle basis is characterized by a critical exponent ν which depends on the energy density being investigated. When short-range interactions are included, the localization is lost, and the system is ergodic regardless of the magnitude of disorder in finite chains. Our numerical results suggest a delocalization scheme for arbitrary small values of interactions. This finding indicates that the standard scenario of the many-body localization cannot be obtained in a model with random gauge fields.
Takaki, Koki; Wade, Andrew J; Collins, Chris D
2017-02-01
New models for estimating bioaccumulation of persistent organic pollutants in the agricultural food chain were developed using recent improvements to plant uptake and cattle transfer models. One model named AgriSim was based on K OW regressions of bioaccumulation in plants and cattle, while the other was a steady-state mechanistic model, AgriCom. The two developed models and European Union System for the Evaluation of Substances (EUSES), as a benchmark, were applied to four reported food chain (soil/air-grass-cow-milk) scenarios to evaluate the performance of each model simulation against the observed data. The four scenarios considered were as follows: (1) polluted soil and air, (2) polluted soil, (3) highly polluted soil surface and polluted subsurface and (4) polluted soil and air at different mountain elevations. AgriCom reproduced observed milk bioaccumulation well for all four scenarios, as did AgriSim for scenarios 1 and 2, but EUSES only did this for scenario 1. The main causes of the deviation for EUSES and AgriSim were the lack of the soil-air-plant pathway and the ambient air-plant pathway, respectively. Based on the results, it is recommended that soil-air-plant and ambient air-plant pathway should be calculated separately and the K OW regression of transfer factor to milk used in EUSES be avoided. AgriCom satisfied the recommendations that led to the low residual errors between the simulated and the observed bioaccumulation in agricultural food chain for the four scenarios considered. It is therefore recommended that this model should be incorporated into regulatory exposure assessment tools. The model uncertainty of the three models should be noted since the simulated concentration in milk from 5th to 95th percentile of the uncertainty analysis often varied over two orders of magnitude. Using a measured value of soil organic carbon content was effective to reduce this uncertainty by one order of magnitude.
Riley, P.; Tikoff, B.; Hildreth, Wes
2012-01-01
The Long Valley region of eastern California (United States) is the site of abundant late Tertiary–present magmatism, including three geochemically distinct stages of magmatism since ca. 3 Ma: Mammoth Mountain, the Mono-Inyo volcanic chain, and Long Valley Caldera. We propose two tectonic models, one explaining the Mammoth Mountain–Mono-Inyo magmatism and the other explaining the presence of Long Valley Caldera. First, the ongoing Mammoth Mountain–Mono-Inyo volcanic chain magmatism is explained by a ridge-transform-ridge system, with the Mono-Inyo volcanic chain acting as one ridge segment and the South Moat fault acting as a transform fault. Implicit in this first model is that this region of eastern California is beginning to act as an incipient plate boundary. Second, the older Long Valley Caldera system is hypothesized to occur in a region of enhanced extension resulting from regional fault block rotation, specifically involving activation of the sinistral faults of the Mina deflection. The tectonic models are consistent with observed spatial and temporal differences in the geochemistry of the regional magmas, and the westward progression of magmatism since ca. 12 Ma.
Brissette, Ian; Lowenfels, Ann; Noble, Corina; Spicer, Deborah
2013-01-01
To examine purchase patterns at fast-food restaurants and their relation to restaurant characteristics, customer characteristics, and use of calorie information. Cross-sectional survey. Fast-food restaurants in New York State. Adult fast-food restaurant customers (n = 1,094). Restaurant characteristics (fast-food chain type, presence of calorie labels, and poverty of location), participant characteristics (demographics, calorie knowledge, awareness, and use), and customer purchasing patterns (ordering low-calorie or no beverage, small or no fries, or < 3 items) were used as predictors of total calories purchased. Multiple regression. In a regression model including restaurant and customer characteristics, fast-food chain customer age, sex, calorie use, and calorie awareness were independently associated with total calories purchased (all P < .05; model R2 = .19). When 3 purchasing patterns were added to the model, calorie use (P = .005), but not calorie awareness, remained associated with total calories purchased. The 3 purchase patterns collectively accounted for the majority of variance in calorie totals (Δ model R2 = .40). Promoting use of calorie information, purchase strategies, and calorie awareness represents complementary ways to support lower-calorie choices at fast-food chains. Copyright © 2013 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.
Free energy landscape of protein-like chains with discontinuous potentials
NASA Astrophysics Data System (ADS)
Movahed, Hanif Bayat; van Zon, Ramses; Schofield, Jeremy
2012-06-01
In this article the configurational space of two simple protein models consisting of polymers composed of a periodic sequence of four different kinds of monomers is studied as a function of temperature. In the protein models, hydrogen bond interactions, electrostatic repulsion, and covalent bond vibrations are modeled by discontinuous step, shoulder, and square-well potentials, respectively. The protein-like chains exhibit a secondary alpha helix structure in their folded states at low temperatures, and allow a natural definition of a configuration by considering which beads are bonded. Free energies and entropies of configurations are computed using the parallel tempering method in combination with hybrid Monte Carlo sampling of the canonical ensemble of the discontinuous potential system. The probability of observing the most common configuration is used to analyze the nature of the free energy landscape, and it is found that the model with the least number of possible bonds exhibits a funnel-like free energy landscape at low enough temperature for chains with fewer than 30 beads. For longer proteins, the free landscape consists of several minima, where the configuration with the lowest free energy changes significantly by lowering the temperature and the probability of observing the most common configuration never approaches one due to the degeneracy of the lowest accessible potential energy.
Hobolth, Asger; Stone, Eric A
2009-09-01
Analyses of serially-sampled data often begin with the assumption that the observations represent discrete samples from a latent continuous-time stochastic process. The continuous-time Markov chain (CTMC) is one such generative model whose popularity extends to a variety of disciplines ranging from computational finance to human genetics and genomics. A common theme among these diverse applications is the need to simulate sample paths of a CTMC conditional on realized data that is discretely observed. Here we present a general solution to this sampling problem when the CTMC is defined on a discrete and finite state space. Specifically, we consider the generation of sample paths, including intermediate states and times of transition, from a CTMC whose beginning and ending states are known across a time interval of length T. We first unify the literature through a discussion of the three predominant approaches: (1) modified rejection sampling, (2) direct sampling, and (3) uniformization. We then give analytical results for the complexity and efficiency of each method in terms of the instantaneous transition rate matrix Q of the CTMC, its beginning and ending states, and the length of sampling time T. In doing so, we show that no method dominates the others across all model specifications, and we give explicit proof of which method prevails for any given Q, T, and endpoints. Finally, we introduce and compare three applications of CTMCs to demonstrate the pitfalls of choosing an inefficient sampler.
2014-12-01
appears that UML is becoming the de facto MBD language. OMG® states the following on the MDA® FAQ page: “Although not formally required [for MBD], UML...a known limitation [42], so UML users should plan accordingly, especially for safety-critical programs. For example, “models are not used to...description of the MBD tool chain can be produced. That description could be resident in a Plan for Software Aspects of Certification (PSAC) or Software
Primitive Path Analysis and Stress Distribution in Highly Strained Macromolecules
2017-01-01
Polymer material properties are strongly affected by entanglement effects. For long polymer chains and composite materials, they are expected to be at the origin of many technically important phenomena, such as shear thinning or the Mullins effect, which microscopically can be related to topological constraints between chains. Starting from fully equilibrated highly entangled polymer melts, we investigate the effect of isochoric elongation on the entanglement structure and force distribution of such systems. Theoretically, the related viscoelastic response usually is discussed in terms of the tube model. We relate stress relaxation in the linear and nonlinear viscoelastic regimes to a primitive path analysis (PPA) and show that tension forces both along the original paths and along primitive paths, that is, the backbone of the tube, in the stretching direction correspond to each other. Unlike homogeneous relaxation along the chain contour, the PPA reveals a so far not observed long-lived clustering of topological constraints along the chains in the deformed state. PMID:29503762
Analysis of a first order phase locked loop in the presence of Gaussian noise
NASA Technical Reports Server (NTRS)
Blasche, P. R.
1977-01-01
A first-order digital phase locked loop is analyzed by application of a Markov chain model. Steady state loop error probabilities, phase standard deviation, and mean loop transient times are determined for various input signal to noise ratios. Results for direct loop simulation are presented for comparison.
Modeling species occurrence dynamics with multiple states and imperfect detection
MacKenzie, D.I.; Nichols, J.D.; Seamans, M.E.; Gutierrez, R.J.
2009-01-01
Recent extensions of occupancy modeling have focused not only on the distribution of species over space, but also on additional state variables (e.g., reproducing or not, with or without disease organisms, relative abundance categories) that provide extra information about occupied sites. These biologist-driven extensions are characterized by ambiguity in both species presence and correct state classification, caused by imperfect detection. We first show the relationships between independently published approaches to the modeling of multistate occupancy. We then extend the pattern-based modeling to the case of sampling over multiple seasons or years in order to estimate state transition probabilities associated with system dynamics. The methodology and its potential for addressing relevant ecological questions are demonstrated using both maximum likelihood (occupancy and successful reproduction dynamics of California Spotted Owl) and Markov chain Monte Carlo estimation approaches (changes in relative abundance of green frogs in Maryland). Just as multistate capture-recapture modeling has revolutionized the study of individual marked animals, we believe that multistate occupancy modeling will dramatically increase our ability to address interesting questions about ecological processes underlying population-level dynamics. ?? 2009 by the Ecological Society of America.
Dynamic models for problems of species occurrence with multiple states
MacKenzie, D.I.; Nichols, J.D.; Seamans, M.E.; Gutierrez, R.J.
2009-01-01
Recent extensions of occupancy modeling have focused not only on the distribution of species over space, but also on additional state variables (e.g., reproducing or not, with or without disease organisms, relative abundance categories) that provide extra information about occupied sites. These biologist-driven extensions are characterized by ambiguity in both species presence and correct state classification, caused by imperfect detection. We first show the relationships between independently published approaches to the modeling of multistate occupancy. We then extend the pattern-based modeling to the case of sampling over multiple seasons or years in order to estimate state transition probabilities associated with system dynamics. The methodology and its potential for addressing relevant ecological questions are demonstrated using both maximum likelihood (occupancy and successful reproduction dynamics of California Spotted Owl) and Markov chain Monte Carlo estimation approaches (changes in relative abundance of green frogs in Maryland). Just as multistate capture?recapture modeling has revolutionized the study of individual marked animals, we believe that multistate occupancy modeling will dramatically increase our ability to address interesting questions about ecological processes underlying population-level dynamics.
Markov Chain Monte Carlo in the Analysis of Single-Molecule Experimental Data
NASA Astrophysics Data System (ADS)
Kou, S. C.; Xie, X. Sunney; Liu, Jun S.
2003-11-01
This article provides a Bayesian analysis of the single-molecule fluorescence lifetime experiment designed to probe the conformational dynamics of a single DNA hairpin molecule. The DNA hairpin's conformational change is initially modeled as a two-state Markov chain, which is not observable and has to be indirectly inferred. The Brownian diffusion of the single molecule, in addition to the hidden Markov structure, further complicates the matter. We show that the analytical form of the likelihood function can be obtained in the simplest case and a Metropolis-Hastings algorithm can be designed to sample from the posterior distribution of the parameters of interest and to compute desired estiamtes. To cope with the molecular diffusion process and the potentially oscillating energy barrier between the two states of the DNA hairpin, we introduce a data augmentation technique to handle both the Brownian diffusion and the hidden Ornstein-Uhlenbeck process associated with the fluctuating energy barrier, and design a more sophisticated Metropolis-type algorithm. Our method not only increases the estimating resolution by several folds but also proves to be successful for model discrimination.
Conformational Dynamics of Insulin
Hua, Qing-Xin; Jia, Wenhua; Weiss, Michael A.
2011-01-01
We have exploited a prandial insulin analog to elucidate the underlying structure and dynamics of insulin as a monomer in solution. A model was provided by insulin lispro (the active component of Humalog®; Eli Lilly and Co.). Whereas NMR-based modeling recapitulated structural relationships of insulin crystals (T-state protomers), dynamic anomalies were revealed by amide-proton exchange kinetics in D2O. Surprisingly, the majority of hydrogen bonds observed in crystal structures are only transiently maintained in solution, including key T-state-specific inter-chain contacts. Long-lived hydrogen bonds (as defined by global exchange kinetics) exist only at a subset of four α-helical sites (two per chain) flanking an internal disulfide bridge (cystine A20–B19); these sites map within the proposed folding nucleus of proinsulin. The anomalous flexibility of insulin otherwise spans its active surface and may facilitate receptor binding. Because conformational fluctuations promote the degradation of pharmaceutical formulations, we envisage that “dynamic re-engineering” of insulin may enable design of ultra-stable formulations for humanitarian use in the developing world. PMID:22649374
Probability distributions for Markov chain based quantum walks
NASA Astrophysics Data System (ADS)
Balu, Radhakrishnan; Liu, Chaobin; Venegas-Andraca, Salvador E.
2018-01-01
We analyze the probability distributions of the quantum walks induced from Markov chains by Szegedy (2004). The first part of this paper is devoted to the quantum walks induced from finite state Markov chains. It is shown that the probability distribution on the states of the underlying Markov chain is always convergent in the Cesaro sense. In particular, we deduce that the limiting distribution is uniform if the transition matrix is symmetric. In the case of a non-symmetric Markov chain, we exemplify that the limiting distribution of the quantum walk is not necessarily identical with the stationary distribution of the underlying irreducible Markov chain. The Szegedy scheme can be extended to infinite state Markov chains (random walks). In the second part, we formulate the quantum walk induced from a lazy random walk on the line. We then obtain the weak limit of the quantum walk. It is noted that the current quantum walk appears to spread faster than its counterpart-quantum walk on the line driven by the Grover coin discussed in literature. The paper closes with an outlook on possible future directions.
Tada, Toshifumi; Kumada, Takashi; Toyoda, Hidenori; Ohisa, Masayuki; Akita, Tomoyuki; Tanaka, Junko
2018-04-19
The relationship between the hepatitis B e antigen (HBeAg) seroconversion and the long-term natural history of liver disease has not been sufficiently investigated. A total of 408 [4352 person-year (PY) units] patients with chronic hepatitis B virus (HBV) without antiviral therapy were enrolled. The study patients were divided into three groups, as follows: Group A (2666 PY units), seroconverted of HBeAg at age < 40; Group B (413 PY units), seroconverted of HBeAg at age ≥ 40; Group C (1273 PY units), persistently HBeAg positive. Yearly transition probabilities from each liver state [chronic HBV infection, chronic hepatitis B, cirrhosis, hepatocellular carcinoma (HCC), and hepatitis B surface antigen (HBsAg) negativity] were calculated using the Markov chain model. In the analysis of 1 year liver disease state transition probabilities, the liver states remained almost the same in Group A. In Groups B and C, each liver state tended to progress to a worse state. Assuming a chronic hepatitis B state at age 40 as the starting condition for simulation over the next 40 years, the chronic hepatitis B state accounted for approximately 60% of males aged ≥ 50 and approximately 40% of females aged ≥ 60 in Group A, and the HBsAg-negative state accounted for approximately 30-40% of males and females aged ≥ 60. In Groups B and C, the probabilities of patients with cirrhosis and HCC gradually increased with age. Not only patients with persistent HBeAg positive, but also patients with delayed HBeAg seroconversion showed poor prognosis of liver-related natural history.
Lattice vibrations in the Frenkel-Kontorova model. I. Phonon dispersion, number density, and energy
NASA Astrophysics Data System (ADS)
Meng, Qingping; Wu, Lijun; Welch, David O.; Zhu, Yimei
2015-06-01
We studied the lattice vibrations of two interpenetrating atomic sublattices via the Frenkel-Kontorova (FK) model of a linear chain of harmonically interacting atoms subjected to an on-site potential using the technique of thermodynamic Green's functions based on quantum field-theoretical methods. General expressions were deduced for the phonon frequency-wave-vector dispersion relations, number density, and energy of the FK model system. As the application of the theory, we investigated in detail cases of linear chains with various periods of the on-site potential of the FK model. Some unusual but interesting features for different amplitudes of the on-site potential of the FK model are discussed. In the commensurate structure, the phonon spectrum always starts at a finite frequency, and the gaps of the spectrum are true ones with a zero density of modes. In the incommensurate structure, the phonon spectrum starts from zero frequency, but at a nonzero wave vector; there are some modes inside these gap regions, but their density is very low. In our approximation, the energy of a higher-order commensurate state of the one-dimensional system at a finite temperature may become indefinitely close to the energy of an incommensurate state. This finding implies that the higher-order incommensurate-commensurate transitions are continuous ones and that the phase transition may exhibit a "devil's staircase" behavior at a finite temperature.
Müller, Erich A; Mejía, Andrés
2017-10-24
The statistical associating fluid theory of variable range employing a Mie potential (SAFT-VR-Mie) proposed by Lafitte et al. (J. Chem Phys. 2013, 139, 154504) is one of the latest versions of the SAFT family. This particular version has been shown to have a remarkable capability to connect experimental determinations, theoretical calculations, and molecular simulations results. However, the theoretical development restricts the model to chains of beads connected in a linear fashion. In this work, the capabilities of the SAFT-VR Mie equation of state for modeling phase equilibria are extended for the case of planar ring compounds. This modification proposed replaces the Helmholtz energy of chain formation by an empirical contribution based on a parallelism to the second-order thermodynamic perturbation theory for hard sphere trimers. The proposed expression is given in terms of an extra parameter, χ, that depends on the number of beads, m s , and the geometry of the ring. The model is used to describe the phase equilibrium for planar ring compounds formed of Mie isotropic segments for the cases of m s equals to 3, 4, 5 (two configurations), and 7 (two configurations). The resulting molecular model is further parametrized, invoking a corresponding states principle resulting in sets of parameters that can be used indistinctively in theoretical calculations or in molecular simulations without any further refinements. The extent and performance of the methodology has been exemplified by predicting the phase equilibria and vapor pressure curves for aromatic hydrocarbons (benzene, hexafluorobenzene, toluene), heterocyclic molecules (2,5-dimethylfuran, sulfolane, tetrahydro-2H-pyran, tetrahydrofuran), and polycyclic aromatic hydrocarbons (naphthalene, pyrene, anthracene, pentacene, and coronene). An important aspect of the theory is that the parameters of the model can be used directly in molecular dynamics (MD) simulations to calculate equilibrium phase properties and interfacial tensions with an accuracy that rivals other coarse grained and united atom models, for example, liquid densities, are predicted, with a maximum absolute average deviation of 3% from both the theory and the MD simulations, while the interfacial tension is predicted, with a maximum absolute average of 8%. The extension to mixtures is exemplified by considering a binary system of hexane (chain fluid) and tetrahydro-2H-pyran (ring fluid).
NASA Technical Reports Server (NTRS)
Trivedi, K. S.; Geist, R. M.
1981-01-01
The CARE 3 reliability model for aircraft avionics and control systems is described by utilizing a number of examples which frequently use state-of-the-art mathematical modeling techniques as a basis for their exposition. Behavioral decomposition followed by aggregration were used in an attempt to deal with reliability models with a large number of states. A comprehensive set of models of the fault-handling processes in a typical fault-tolerant system was used. These models were semi-Markov in nature, thus removing the usual restrictions of exponential holding times within the coverage model. The aggregate model is a non-homogeneous Markov chain, thus allowing the times to failure to posses Weibull-like distributions. Because of the departures from traditional models, the solution method employed is that of Kolmogorov integral equations, which are evaluated numerically.
System Dynamics Modeling for Supply Chain Information Sharing
NASA Astrophysics Data System (ADS)
Feng, Yang
In this paper, we try to use the method of system dynamics to model supply chain information sharing. Firstly, we determine the model boundaries, establish system dynamics model of supply chain before information sharing, analyze the model's simulation results under different changed parameters and suggest improvement proposal. Then, we establish system dynamics model of supply chain information sharing and make comparison and analysis on the two model's simulation results, to show the importance of information sharing in supply chain management. We wish that all these simulations would provide scientific supports for enterprise decision-making.
Dynamics Sampling in Transition Pathway Space.
Zhou, Hongyu; Tao, Peng
2018-01-09
The minimum energy pathway contains important information describing the transition between two states on a potential energy surface (PES). Chain-of-states methods were developed to efficiently calculate minimum energy pathways connecting two stable states. In the chain-of-states framework, a series of structures are generated and optimized to represent the minimum energy pathway connecting two states. However, multiple pathways may exist connecting two existing states and should be identified to obtain a full view of the transitions. Therefore, we developed an enhanced sampling method, named as the direct pathway dynamics sampling (DPDS) method, to facilitate exploration of a PES for multiple pathways connecting two stable states as well as addition minima and their associated transition pathways. In the DPDS method, molecular dynamics simulations are carried out on the targeting PES within a chain-of-states framework to directly sample the transition pathway space. The simulations of DPDS could be regulated by two parameters controlling distance among states along the pathway and smoothness of the pathway. One advantage of the chain-of-states framework is that no specific reaction coordinates are necessary to generate the reaction pathway, because such information is implicitly represented by the structures along the pathway. The chain-of-states setup in a DPDS method greatly enhances the sufficient sampling in high-energy space between two end states, such as transition states. By removing the constraint on the end states of the pathway, DPDS will also sample pathways connecting minima on a PES in addition to the end points of the starting pathway. This feature makes DPDS an ideal method to directly explore transition pathway space. Three examples demonstrate the efficiency of DPDS methods in sampling the high-energy area important for reactions on the PES.
Electronic excitations in finite and infinite polyenes
NASA Astrophysics Data System (ADS)
Tavan, Paul; Schulten, Klaus
1987-09-01
We study electronic excitations in long polyenes, i.e., in one-dimensional strongly correlated electron systems which are neither infinite nor small. The excitations are described within Hubbard and Pariser-Parr-Pople (PPP) models by means of a multiple-reference double-excitation expansion [P. Tavan and K. Schulten, J. Chem. Phys. 85, 6602 (1986)]. We find that quantized ``transition'' momenta can be assigned to electronic excitations in finite chains. These momenta link excitation energies of finite chains to dispersion relations of infinite chains, i.e., they bridge the gap between finite and infinite systems. A key result is the following: Excitation energies E in polyenes with N carbon atoms are described very accurately by the formula Eβ=ΔEβ0+αβk(N)q, q=1,2,..., where β denotes the excitation class, ΔEβ0 the energy gap in the infinite system [αβk(N)>0], and k(N) the elementary transition momentum. The parameters ΔEβ0 and αβ are determined for covalent and ionic excitations in alternating and nonalternating polyenes. The covalent excitations are combinations of triplet excitations T, i.e., T, TT, TTT, . . . . The lowest singlet excitations in the infinite polyene, e.g., in polyacetylene or polydiacetylene, are TT states. Available evidence proves that these states can dissociate into separate triplets. The bond structure of TT states is that of a neutral soliton-antisoliton pair. The level density of TT states in long polyenes is high enough to allow dissociation into separate solitons.
a Probability Model for Drought Prediction Using Fusion of Markov Chain and SAX Methods
NASA Astrophysics Data System (ADS)
Jouybari-Moghaddam, Y.; Saradjian, M. R.; Forati, A. M.
2017-09-01
Drought is one of the most powerful natural disasters which are affected on different aspects of the environment. Most of the time this phenomenon is immense in the arid and semi-arid area. Monitoring and prediction the severity of the drought can be useful in the management of the natural disaster caused by drought. Many indices were used in predicting droughts such as SPI, VCI, and TVX. In this paper, based on three data sets (rainfall, NDVI, and land surface temperature) which are acquired from MODIS satellite imagery, time series of SPI, VCI, and TVX in time limited between winters 2000 to summer 2015 for the east region of Isfahan province were created. Using these indices and fusion of symbolic aggregation approximation and hidden Markov chain drought was predicted for fall 2015. For this purpose, at first, each time series was transformed into the set of quality data based on the state of drought (5 group) by using SAX algorithm then the probability matrix for the future state was created by using Markov hidden chain. The fall drought severity was predicted by fusion the probability matrix and state of drought severity in summer 2015. The prediction based on the likelihood for each state of drought includes severe drought, middle drought, normal drought, severe wet and middle wet. The analysis and experimental result from proposed algorithm show that the product of this algorithm is acceptable and the proposed algorithm is appropriate and efficient for predicting drought using remote sensor data.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mendes, Milrian S.; Felinto, Daniel
2011-12-15
We analyze the efficiency and scalability of the Duan-Lukin-Cirac-Zoller (DLCZ) protocol for quantum repeaters focusing on the behavior of the experimentally accessible measures of entanglement for the system, taking into account crucial imperfections of the stored entangled states. We calculate then the degradation of the final state of the quantum-repeater linear chain for increasing sizes of the chain, and characterize it by a lower bound on its concurrence and the ability to violate the Clausner-Horne-Shimony-Holt inequality. The states are calculated up to an arbitrary number of stored excitations, as this number is not fundamentally bound for experiments involving large atomicmore » ensembles. The measurement by avalanche photodetectors is modeled by ''ON/OFF'' positive operator-valued measure operators. As a result, we are able to consistently test the approximation of the real fields by fields with a finite number of excitations, determining the minimum number of excitations required to achieve a desired precision in the prediction of the various measured quantities. This analysis finally determines the minimum purity of the initial state that is required to succeed in the protocol as the size of the chain increases. We also provide a more accurate estimate for the average time required to succeed in each step of the protocol. The minimum purity analysis and the new time estimates are then combined to trace the perspectives for implementation of the DLCZ protocol in present-day laboratory setups.« less
NASA Astrophysics Data System (ADS)
Mendes, Milrian S.; Felinto, Daniel
2011-12-01
We analyze the efficiency and scalability of the Duan-Lukin-Cirac-Zoller (DLCZ) protocol for quantum repeaters focusing on the behavior of the experimentally accessible measures of entanglement for the system, taking into account crucial imperfections of the stored entangled states. We calculate then the degradation of the final state of the quantum-repeater linear chain for increasing sizes of the chain, and characterize it by a lower bound on its concurrence and the ability to violate the Clausner-Horne-Shimony-Holt inequality. The states are calculated up to an arbitrary number of stored excitations, as this number is not fundamentally bound for experiments involving large atomic ensembles. The measurement by avalanche photodetectors is modeled by “ON/OFF” positive operator-valued measure operators. As a result, we are able to consistently test the approximation of the real fields by fields with a finite number of excitations, determining the minimum number of excitations required to achieve a desired precision in the prediction of the various measured quantities. This analysis finally determines the minimum purity of the initial state that is required to succeed in the protocol as the size of the chain increases. We also provide a more accurate estimate for the average time required to succeed in each step of the protocol. The minimum purity analysis and the new time estimates are then combined to trace the perspectives for implementation of the DLCZ protocol in present-day laboratory setups.
Wen, Wu; Xia, Xinghui; Hu, Diexuan; Zhou, Dong; Wang, Haotian; Zhai, Yawei; Lin, Hui
2017-11-07
Short- and long-chain perfluoroalkyl acids (PFAAs), ubiquitously coexisting in the environment, can be accumulated in organisms by binding with proteins and their binding affinities generally increase with their chain length. Therefore, we hypothesized that long-chain PFAAs will affect the bioconcentration of short-chain PFAAs in organisms. To testify this hypothesis, the bioconcentration and tissue distribution of five short-chain PFAAs (linear C-F = 3-6) were investigated in zebrafish in the absence and presence of six long-chain PFAAs (linear C-F = 7-11). The results showed that the concentrations of the short-chain PFAAs in zebrafish tissues increased with exposure time until steady states reached in the absence of long-chain PFAAs. However, in the presence of long-chain PFAAs, these short-chain PFAAs in tissues increased until peak values reached and then decreased until steady states, and the uptake and elimination rate constants of short-chain PFAAs declined in all tissues and their BCF ss decreased by 24-89%. The inhibitive effect of long-chain PFAAs may be attributed to their competition for transporters and binding sites of proteins in zebrafish with short-chain PFAAs. These results suggest that the effect of long-chain PFAAs on the bioconcentration of short-chain PFAAs should be taken into account in assessing the ecological and environmental effects of short-chain PFAAs.
Information scrambling at an impurity quantum critical point
NASA Astrophysics Data System (ADS)
Dóra, Balázs; Werner, Miklós Antal; Moca, Cǎtǎlin Paşcu
2017-10-01
The two-channel Kondo impurity model realizes a local non-Fermi-liquid state with finite residual entropy. The competition between the two channels drives the system to an impurity quantum critical point. We show that the out-of-time-ordered (OTO) commutator for the impurity spin reveals markedly distinct behavior depending on the low-energy impurity state. For the one-channel Kondo model with Fermi-liquid ground state, the OTO commutator vanishes for late times, indicating the absence of the butterfly effect. For the two channel case, the impurity OTO commutator is completely temperature independent and saturates quickly to its upper bound 1/4, and the butterfly effect is maximally enhanced. These compare favorably to numerics on spin chain representation of the Kondo model. Our results imply that a large late time value of the OTO commutator does not necessarily diagnose quantum chaos.
Application of Markov chain model to daily maximum temperature for thermal comfort in Malaysia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nordin, Muhamad Asyraf bin Che; Hassan, Husna
2015-10-22
The Markov chain’s first order principle has been widely used to model various meteorological fields, for prediction purposes. In this study, a 14-year (2000-2013) data of daily maximum temperatures in Bayan Lepas were used. Earlier studies showed that the outdoor thermal comfort range based on physiologically equivalent temperature (PET) index in Malaysia is less than 34°C, thus the data obtained were classified into two state: normal state (within thermal comfort range) and hot state (above thermal comfort range). The long-run results show the probability of daily temperature exceed TCR will be only 2.2%. On the other hand, the probability dailymore » temperature within TCR will be 97.8%.« less
Momentum-Based Dynamics for Spacecraft with Chained Revolute Appendages
NASA Technical Reports Server (NTRS)
Queen, Steven; London, Ken; Gonzalez, Marcelo
2005-01-01
An efficient formulation is presented for a sub-class of multi-body dynamics problems that involve a six degree-of-freedom base body and a chain of N rigid linkages connected in series by single degree-of-freedom revolute joints. This general method is particularly well suited for simulations of spacecraft dynamics and control that include the modeling of an orbiting platform with or without internal degrees of freedom such as reaction wheels, dampers, and/or booms. In the present work, particular emphasis is placed on dynamic simulation of multi-linkage robotic manipulators. The differential equations of motion are explicitly given in terms of linear and angular momentum states, which can be evaluated recursively along a serial chain of linkages for an efficient real-time solution on par with the best of the O(N3) methods.
Inelastic electron injection in a water chain
Rizzi, Valerio; Todorov, Tchavdar N.; Kohanoff, Jorge J.
2017-01-01
Irradiation of biological matter triggers a cascade of secondary particles that interact with their surroundings, resulting in damage. Low-energy electrons are one of the main secondary species and electron-phonon interaction plays a fundamental role in their dynamics. We have developed a method to capture the electron-phonon inelastic energy exchange in real time and have used it to inject electrons into a simple system that models a biological environment, a water chain. We simulated both an incoming electron pulse and a steady stream of electrons and found that electrons with energies just outside bands of excited molecular states can enter the chain through phonon emission or absorption. Furthermore, this phonon-assisted dynamical behaviour shows great sensitivity to the vibrational temperature, highlighting a crucial controlling factor for the injection and propagation of electrons in water. PMID:28350013
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bush, B.
2015-03-23
The Biomass Scenario Model (BSM) is a unique, carefully validated, state-of-the-art fourth-generation model of the domestic bioenergy supply chain which explicitly focuses on policy issues and their potential side effects. It integrates resource availability, behavior, policy, and physical, technological, and economic constraints. The BSM uses system-dynamics simulation to model dynamic interactions across the supply chain; it tracks the deployment of biofuels given technological development and the reaction of the investment community to those technologies in the context of land availability, the competing oil market, consumer demand for biofuels, and government policies over time. It places a strong emphasis on themore » behavior and decision-making of various economic agents. The model treats the major infrastructure-compatible fuels. Scenario analysis based on the BSM shows that the biofuels industry tends not to rapidly thrive without significant external actions in the early years of its evolution. An initial focus for jumpstarting the industry typically has strongest results in the BSM in areas where effects of intervention have been identified to be multiplicative. In general, we find that policies which are coordinated across the whole supply chain have significant impact in fostering the growth of the biofuels industry and that the production of tens of billions of gallons of biofuels may occur under sufficiently favorable conditions.« less
Reduced atomic pair-interaction design (RAPID) model for simulations of proteins.
Ni, Boris; Baumketner, Andrij
2013-02-14
Increasingly, theoretical studies of proteins focus on large systems. This trend demands the development of computational models that are fast, to overcome the growing complexity, and accurate, to capture the physically relevant features. To address this demand, we introduce a protein model that uses all-atom architecture to ensure the highest level of chemical detail while employing effective pair potentials to represent the effect of solvent to achieve the maximum speed. The effective potentials are derived for amino acid residues based on the condition that the solvent-free model matches the relevant pair-distribution functions observed in explicit solvent simulations. As a test, the model is applied to alanine polypeptides. For the chain with 10 amino acid residues, the model is found to reproduce properly the native state and its population. Small discrepancies are observed for other folding properties and can be attributed to the approximations inherent in the model. The transferability of the generated effective potentials is investigated in simulations of a longer peptide with 25 residues. A minimal set of potentials is identified that leads to qualitatively correct results in comparison with the explicit solvent simulations. Further tests, conducted for multiple peptide chains, show that the transferable model correctly reproduces the experimentally observed tendency of polyalanines to aggregate into β-sheets more strongly with the growing length of the peptide chain. Taken together, the reported results suggest that the proposed model could be used to succesfully simulate folding and aggregation of small peptides in atomic detail. Further tests are needed to assess the strengths and limitations of the model more thoroughly.
Fast Preparation of Critical Ground States Using Superluminal Fronts
NASA Astrophysics Data System (ADS)
Agarwal, Kartiek; Bhatt, R. N.; Sondhi, S. L.
2018-05-01
We propose a spatiotemporal quench protocol that allows for the fast preparation of ground states of gapless models with Lorentz invariance. Assuming the system initially resides in the ground state of a corresponding massive model, we show that a superluminally moving "front" that locally quenches the mass, leaves behind it (in space) a state arbitrarily close to the ground state of the gapless model. Importantly, our protocol takes time O (L ) to produce the ground state of a system of size ˜Ld (d spatial dimensions), while a fully adiabatic protocol requires time ˜O (L2) to produce a state with exponential accuracy in L . The physics of the dynamical problem can be understood in terms of relativistic rarefaction of excitations generated by the mass front. We provide proof of concept by solving the proposed quench exactly for a system of free bosons in arbitrary dimensions, and for free fermions in d =1 . We discuss the role of interactions and UV effects on the free-theory idealization, before numerically illustrating the usefulness of the approach via simulations on the quantum Heisenberg spin chain.
Proactive Supply Chain Performance Management with Predictive Analytics
Stefanovic, Nenad
2014-01-01
Today's business climate requires supply chains to be proactive rather than reactive, which demands a new approach that incorporates data mining predictive analytics. This paper introduces a predictive supply chain performance management model which combines process modelling, performance measurement, data mining models, and web portal technologies into a unique model. It presents the supply chain modelling approach based on the specialized metamodel which allows modelling of any supply chain configuration and at different level of details. The paper also presents the supply chain semantic business intelligence (BI) model which encapsulates data sources and business rules and includes the data warehouse model with specific supply chain dimensions, measures, and KPIs (key performance indicators). Next, the paper describes two generic approaches for designing the KPI predictive data mining models based on the BI semantic model. KPI predictive models were trained and tested with a real-world data set. Finally, a specialized analytical web portal which offers collaborative performance monitoring and decision making is presented. The results show that these models give very accurate KPI projections and provide valuable insights into newly emerging trends, opportunities, and problems. This should lead to more intelligent, predictive, and responsive supply chains capable of adapting to future business environment. PMID:25386605
Proactive supply chain performance management with predictive analytics.
Stefanovic, Nenad
2014-01-01
Today's business climate requires supply chains to be proactive rather than reactive, which demands a new approach that incorporates data mining predictive analytics. This paper introduces a predictive supply chain performance management model which combines process modelling, performance measurement, data mining models, and web portal technologies into a unique model. It presents the supply chain modelling approach based on the specialized metamodel which allows modelling of any supply chain configuration and at different level of details. The paper also presents the supply chain semantic business intelligence (BI) model which encapsulates data sources and business rules and includes the data warehouse model with specific supply chain dimensions, measures, and KPIs (key performance indicators). Next, the paper describes two generic approaches for designing the KPI predictive data mining models based on the BI semantic model. KPI predictive models were trained and tested with a real-world data set. Finally, a specialized analytical web portal which offers collaborative performance monitoring and decision making is presented. The results show that these models give very accurate KPI projections and provide valuable insights into newly emerging trends, opportunities, and problems. This should lead to more intelligent, predictive, and responsive supply chains capable of adapting to future business environment.
Automated side-chain model building and sequence assignment by template matching.
Terwilliger, Thomas C
2003-01-01
An algorithm is described for automated building of side chains in an electron-density map once a main-chain model is built and for alignment of the protein sequence to the map. The procedure is based on a comparison of electron density at the expected side-chain positions with electron-density templates. The templates are constructed from average amino-acid side-chain densities in 574 refined protein structures. For each contiguous segment of main chain, a matrix with entries corresponding to an estimate of the probability that each of the 20 amino acids is located at each position of the main-chain model is obtained. The probability that this segment corresponds to each possible alignment with the sequence of the protein is estimated using a Bayesian approach and high-confidence matches are kept. Once side-chain identities are determined, the most probable rotamer for each side chain is built into the model. The automated procedure has been implemented in the RESOLVE software. Combined with automated main-chain model building, the procedure produces a preliminary model suitable for refinement and extension by an experienced crystallographer.
Deformation of nuclei as a function of angular momentum in the U(6) ⊃ SU(3) model
NASA Astrophysics Data System (ADS)
Partensky, A.; Quesne, C.
1981-10-01
In the framework of a hybrid rotational model, proposed recently by Moshinsky as a consequence of a comparison between the Gneuss and Greiner extension of the Bohr and Mottelson model and the interacting boson model, we study the shape of nuclei by calculating the average of the expectation value of the square of the deformation parameter β with respect to the rotational states with the same angular momentum belonging to a given irreducible representation of SU(3). This work generalises to three dimensions the corresponding analysis carried out in two dimensions by Chacón, Moshinsky, and Vanagas. We use the canonical chain for U(3), i.e., the chain U(6) ⊃ U(3) ⊃ U(2) ⊃ U(1), to obtain an analytical formula for the quantity studied. We bring out the overall stretching effect of the angular momentum on the shape of nuclei. The influence of other parameters, such as the boson number and the irreducible representation of SU(3), is also studied.
Markov-modulated Markov chains and the covarion process of molecular evolution.
Galtier, N; Jean-Marie, A
2004-01-01
The covarion (or site specific rate variation, SSRV) process of biological sequence evolution is a process by which the evolutionary rate of a nucleotide/amino acid/codon position can change in time. In this paper, we introduce time-continuous, space-discrete, Markov-modulated Markov chains as a model for representing SSRV processes, generalizing existing theory to any model of rate change. We propose a fast algorithm for diagonalizing the generator matrix of relevant Markov-modulated Markov processes. This algorithm makes phylogeny likelihood calculation tractable even for a large number of rate classes and a large number of states, so that SSRV models become applicable to amino acid or codon sequence datasets. Using this algorithm, we investigate the accuracy of the discrete approximation to the Gamma distribution of evolutionary rates, widely used in molecular phylogeny. We show that a relatively large number of classes is required to achieve accurate approximation of the exact likelihood when the number of analyzed sequences exceeds 20, both under the SSRV and among site rate variation (ASRV) models.
Hydrolysis of short-chain phosphatidylcholines by bee venom phospholipase A2.
Raykova, D; Blagoev, B
1986-01-01
In order to find out the aggregation state of the substrate, preferred by bee venom phospholipase A2 (EC 3.1.1.4), its action on short-chain phosphatidylcholines with two identical (C6-C10) fatty acids has been tested. The rate of hydrolysis as a function of acyl chain length showed a maximum at dioctanoylphosphatidylcholine. The effects of alcohols, NaCl and Triton X-100, which affect the aggregation state of phospholipids in water, were also studied. The addition of n-alcohol led to a significant inhibition of the hydrolysis of the substrates present in micellar form and activated the hydrolysis of substrates which form liposomes. The inhibitory effect increased with increasing length of the aliphatic carbon chain of the alcohol. Triton X-100 at low Triton/phospholipid molar ratios enhanced enzyme activity. These results do not agree with the accepted idea that bee venom phospholipase A2 hydrolyzes short-chain lecithins in their molecularly dispersed form and that micelles cannot act as substrates. The data indicate that short-chain lecithins in the aggregated state are hydrolyzed and that the requirements of bee venom phospholipase A2 for the aggregation state of the substrate are not strict.
A System-Oriented Approach for the Optimal Control of Process Chains under Stochastic Influences
NASA Astrophysics Data System (ADS)
Senn, Melanie; Schäfer, Julian; Pollak, Jürgen; Link, Norbert
2011-09-01
Process chains in manufacturing consist of multiple connected processes in terms of dynamic systems. The properties of a product passing through such a process chain are influenced by the transformation of each single process. There exist various methods for the control of individual processes, such as classical state controllers from cybernetics or function mapping approaches realized by statistical learning. These controllers ensure that a desired state is obtained at process end despite of variations in the input and disturbances. The interactions between the single processes are thereby neglected, but play an important role in the optimization of the entire process chain. We divide the overall optimization into two phases: (1) the solution of the optimization problem by Dynamic Programming to find the optimal control variable values for each process for any encountered end state of its predecessor and (2) the application of the optimal control variables at runtime for the detected initial process state. The optimization problem is solved by selecting adequate control variables for each process in the chain backwards based on predefined quality requirements for the final product. For the demonstration of the proposed concept, we have chosen a process chain from sheet metal manufacturing with simplified transformation functions.
Network evolution model for supply chain with manufactures as the core.
Fang, Haiyang; Jiang, Dali; Yang, Tinghong; Fang, Ling; Yang, Jian; Li, Wu; Zhao, Jing
2018-01-01
Building evolution model of supply chain networks could be helpful to understand its development law. However, specific characteristics and attributes of real supply chains are often neglected in existing evolution models. This work proposes a new evolution model of supply chain with manufactures as the core, based on external market demand and internal competition-cooperation. The evolution model assumes the external market environment is relatively stable, considers several factors, including specific topology of supply chain, external market demand, ecological growth and flow conservation. The simulation results suggest that the networks evolved by our model have similar structures as real supply chains. Meanwhile, the influences of external market demand and internal competition-cooperation to network evolution are analyzed. Additionally, 38 benchmark data sets are applied to validate the rationality of our evolution model, in which, nine manufacturing supply chains match the features of the networks constructed by our model.
Network evolution model for supply chain with manufactures as the core
Jiang, Dali; Fang, Ling; Yang, Jian; Li, Wu; Zhao, Jing
2018-01-01
Building evolution model of supply chain networks could be helpful to understand its development law. However, specific characteristics and attributes of real supply chains are often neglected in existing evolution models. This work proposes a new evolution model of supply chain with manufactures as the core, based on external market demand and internal competition-cooperation. The evolution model assumes the external market environment is relatively stable, considers several factors, including specific topology of supply chain, external market demand, ecological growth and flow conservation. The simulation results suggest that the networks evolved by our model have similar structures as real supply chains. Meanwhile, the influences of external market demand and internal competition-cooperation to network evolution are analyzed. Additionally, 38 benchmark data sets are applied to validate the rationality of our evolution model, in which, nine manufacturing supply chains match the features of the networks constructed by our model. PMID:29370201
Sound Clocks and Sonic Relativity
NASA Astrophysics Data System (ADS)
Todd, Scott L.; Menicucci, Nicolas C.
2017-10-01
Sound propagation within certain non-relativistic condensed matter models obeys a relativistic wave equation despite such systems admitting entirely non-relativistic descriptions. A natural question that arises upon consideration of this is, "do devices exist that will experience the relativity in these systems?" We describe a thought experiment in which `acoustic observers' possess devices called sound clocks that can be connected to form chains. Careful investigation shows that appropriately constructed chains of stationary and moving sound clocks are perceived by observers on the other chain as undergoing the relativistic phenomena of length contraction and time dilation by the Lorentz factor, γ , with c the speed of sound. Sound clocks within moving chains actually tick less frequently than stationary ones and must be separated by a shorter distance than when stationary to satisfy simultaneity conditions. Stationary sound clocks appear to be length contracted and time dilated to moving observers due to their misunderstanding of their own state of motion with respect to the laboratory. Observers restricted to using sound clocks describe a universe kinematically consistent with the theory of special relativity, despite the preferred frame of their universe in the laboratory. Such devices show promise in further probing analogue relativity models, for example in investigating phenomena that require careful consideration of the proper time elapsed for observers.
Enhancing hydrologic data assimilation by evolutionary Particle Filter and Markov Chain Monte Carlo
NASA Astrophysics Data System (ADS)
Abbaszadeh, Peyman; Moradkhani, Hamid; Yan, Hongxiang
2018-01-01
Particle Filters (PFs) have received increasing attention by researchers from different disciplines including the hydro-geosciences, as an effective tool to improve model predictions in nonlinear and non-Gaussian dynamical systems. The implication of dual state and parameter estimation using the PFs in hydrology has evolved since 2005 from the PF-SIR (sampling importance resampling) to PF-MCMC (Markov Chain Monte Carlo), and now to the most effective and robust framework through evolutionary PF approach based on Genetic Algorithm (GA) and MCMC, the so-called EPFM. In this framework, the prior distribution undergoes an evolutionary process based on the designed mutation and crossover operators of GA. The merit of this approach is that the particles move to an appropriate position by using the GA optimization and then the number of effective particles is increased by means of MCMC, whereby the particle degeneracy is avoided and the particle diversity is improved. In this study, the usefulness and effectiveness of the proposed EPFM is investigated by applying the technique on a conceptual and highly nonlinear hydrologic model over four river basins located in different climate and geographical regions of the United States. Both synthetic and real case studies demonstrate that the EPFM improves both the state and parameter estimation more effectively and reliably as compared with the PF-MCMC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belenkov, E. A., E-mail: belenkov@csu.ru; Mavrinskii, V. V.; Belenkova, T. E.
2015-05-15
A model scheme is proposed for obtaining layered compounds consisting of carbon atoms in the sp- and (vnsp){sup 2}-hybridized states. This model is used to find the possibility of existing the following seven basic structural modifications of graphyne: α-, β1-, β2-, β3-, γ1-, γ2-, and γ3-graphyne. Polymorphic modifications β3 graphyne and γ3 graphyne are described. The basic structural modifications of graphyne contain diatomic polyyne chains and consist only of carbon atoms in two different crystallographically equivalent states. Other nonbasic structural modifications of graphyne can be formed via the elongation of the carbyne chains that connect three-coordinated carbon atoms and viamore » the formation of graphyne layers with a mixed structure consisting of basic layer fragments, such as α-β-graphyne, α-γ-graphyne, and β-γ-graphyne. The semiempirical quantum-mechanical MNDO, AM1, and PM3 methods and ab initio STO6-31G basis calculations are used to find geometrically optimized structures of the basic graphyne layers, their structural parameters, and energies of their sublimation. The energy of sublimation is found to be maximal for γ2-graphyne, which should be the most stable structural modification of graphyne.« less
Kannan, Srinivasaraghavan; Zacharias, Martin
2014-01-01
The 20 residue Trp-cage mini-protein is one of smallest proteins that adopt a stable folded structure containing also well-defined secondary structure elements. The hydrophobic core is arranged around a single central Trp residue. Despite several experimental and simulation studies the detailed folding mechanism of the Trp-cage protein is still not completely understood. Starting from fully extended as well as from partially folded Trp-cage structures a series of molecular dynamics simulations in explicit solvent and using four different force fields was performed. All simulations resulted in rapid collapse of the protein to on average relatively compact states. The simulations indicate a significant dependence of the speed of folding to near-native states on the side chain rotamer state of the central Trp residue. Whereas the majority of intermediate start structures with the central Trp side chain in a near-native rotameric state folded successfully within less than 100 ns only a fraction of start structures reached near-native folded states with an initially non-native Trp side chain rotamer state. Weak restraining of the Trp side chain dihedral angles to the state in the folded protein resulted in significant acceleration of the folding both starting from fully extended or intermediate conformations. The results indicate that the side chain conformation of the central Trp residue can create a significant barrier for controlling transitions to a near native folded structure. Similar mechanisms might be of importance for the folding of other protein structures. PMID:24563686
Chains are more flexible under tension
Carrillo, Jan-Michael Y.; Rubinstein, Michael
2010-01-01
The mechanical response of networks, gels, and brush layers is a manifestation of the elastic properties of the individual macromolecules. Furthermore, the elastic response of macromolecules to an applied force is the foundation of the single-molecule force spectroscopy techniques. The two main classes of models describing chain elasticity include the worm-like and freely-jointed chain models. The selection between these two classes of models is based on the assumptions about chain flexibility. In many experimental situations the choice is not clear and a model describing the crossover between these two limiting classes is therefore in high demand. We are proposing a unified chain deformation model which describes the force-deformation curve in terms of the chain bending constant K and bond length b. This model demonstrates that the worm-like and freely-jointed chain models correspond to two different regimes of polymer deformation and the crossover between these two regimes depends on the chain bending rigidity and the magnitude of the applied force. Polymer chains with bending constant K>1 behave as a worm-like chain under tension in the interval of the applied forces f ≤ KkBT/b and as a freely-jointed chain for f ≥ KkBT/b (kB is the Boltzmann constant and T is the absolute temperature). The proposed crossover expression for chain deformation is in excellent agreement with the results of the molecular dynamics simulations of chain deformation and single-molecule deformation experiments of biological and synthetic macromolecules. PMID:21415940
Li, Xianfeng; Murthy, Sanjeeva; Latour, Robert A.
2011-01-01
A new empirical sampling method termed “temperature intervals with global exchange of replicas and reduced radii” (TIGER3) is presented and demonstrated to efficiently equilibrate entangled long-chain molecular systems such as amorphous polymers. The TIGER3 algorithm is a replica exchange method in which simulations are run in parallel over a range of temperature levels at and above a designated baseline temperature. The replicas sampled at temperature levels above the baseline are run through a series of cycles with each cycle containing four stages – heating, sampling, quenching, and temperature level reassignment. The method allows chain segments to pass through one another at elevated temperature levels during the sampling stage by reducing the van der Waals radii of the atoms, thus eliminating chain entanglement problems. Atomic radii are then returned to their regular values and re-equilibrated at elevated temperature prior to quenching to the baseline temperature. Following quenching, replicas are compared using a Metropolis Monte Carlo exchange process for the construction of an approximate Boltzmann-weighted ensemble of states and then reassigned to the elevated temperature levels for additional sampling. Further system equilibration is performed by periodic implementation of the previously developed TIGER2 algorithm between cycles of TIGER3, which applies thermal cycling without radii reduction. When coupled with a coarse-grained modeling approach, the combined TIGER2/TIGER3 algorithm yields fast equilibration of bulk-phase models of amorphous polymer, even for polymers with complex, highly branched structures. The developed method was tested by modeling the polyethylene melt. The calculated properties of chain conformation and chain segment packing agreed well with published data. The method was also applied to generate equilibrated structural models of three increasingly complex amorphous polymer systems: poly(methyl methacrylate), poly(butyl methacrylate), and DTB-succinate copolymer. Calculated glass transition temperature (Tg) and structural parameter profile (S(q)) for each resulting polymer model were found to be in close agreement with experimental Tg values and structural measurements obtained by x-ray diffraction, thus validating that the developed methods provide realistic models of amorphous polymer structure. PMID:21769156
Motta, Mario; Ceperley, David M.; Chan, Garnet Kin-Lic; ...
2017-09-28
We present numerical results for the equation of state of an infinite chain of hydrogen atoms. A variety of modern many-body methods are employed, with exhaustive cross-checks and validation. Approaches for reaching the continuous space limit and the thermodynamic limit are investigated, proposed, and tested. The detailed comparisons provide a benchmark for assessing the current state of the art in many-body computation, and for the development of new methods. The ground-state energy per atom in the linear chain is accurately determined versus bond length, with a confidence bound given on all uncertainties.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Motta, Mario; Ceperley, David M.; Chan, Garnet Kin-Lic
We present numerical results for the equation of state of an infinite chain of hydrogen atoms. A variety of modern many-body methods are employed, with exhaustive cross-checks and validation. Approaches for reaching the continuous space limit and the thermodynamic limit are investigated, proposed, and tested. The detailed comparisons provide a benchmark for assessing the current state of the art in many-body computation, and for the development of new methods. The ground-state energy per atom in the linear chain is accurately determined versus bond length, with a confidence bound given on all uncertainties.
Edler, Eileen; Stein, Matthias
2017-10-25
The small GTPase Rab5 is the key regulator of early endosomal fusion. It is post-translationally modified by covalent attachment of two geranylgeranyl (GG) chains to adjacent cysteine residues of the C-terminal hypervariable region (HVR). The GDP dissociation inhibitor (GDI) recognizes membrane-associated Rab5(GDP) and serves to release it into the cytoplasm where it is kept in a soluble state. A detailed new structural and dynamic model for human Rab5(GDP) recognition and binding with human GDI at the early endosome membrane and in its dissociated state is presented. In the cytoplasm, the GDI protein accommodates the GG chains in a transient hydrophobic binding pocket. In solution, two different binding modes of the isoprenoid chains inserted into the hydrophobic pocket of the Rab5(GDP):GDI complex can be identified. This equilibrium between the two states helps to stabilize the protein-protein complex in solution. Interprotein contacts between the Rab5 switch regions and characteristic patches of GDI residues from the Rab binding platform (RBP) and the C-terminus coordinating region (CCR) reveal insight on the formation of such a stable complex. GDI binding to membrane-anchored Rab5(GDP) is initially mediated by the solvent accessible switch regions of the Rab-specific RBP. Formation of the membrane-associated Rab5(GDP):GDI complex induces a GDI reorientation to establish additional interactions with the Rab5 HVR. These results allow to devise a detailed structural model for the process of extraction of GG-Rab5(GDP) by GDI from the membrane and the dissociation from targeting factors and effector proteins prior to GDI binding.
[Succession caused by beaver (Castor fiber L.) life activity: II. A refined Markov model].
Logofet; Evstigneev, O I; Aleinikov, A A; Morozova, A O
2015-01-01
The refined Markov model of cyclic zoogenic successions caused by beaver (Castor fiber L.) life activity represents a discrete chain of the following six states: flooded forest, swamped forest, pond, grassy swamp, shrubby swamp, and wet forest, which correspond to certain stages of succession. Those stages are defined, and a conceptual scheme of probable transitions between them for one time step is constructed from the knowledge of beaver behaviour in small river floodplains of "Bryanskii Les" Reserve. We calibrated the corresponding matrix of transition probabilities according to the optimization principle: minimizing differences between the model outcome and reality; the model generates a distribution of relative areas corresponding to the stages of succession, that has to be compared to those gained from case studies in the Reserve during 2002-2006. The time step is chosen to equal 2 years, and the first-step data in the sum of differences are given various weights, w (between 0 and 1). The value of w = 0.2 is selected due to its optimality and for some additional reasons. By the formulae of finite homogeneous Markov chain theory, we obtained the main results of the calibrated model, namely, a steady-state distribution of stage areas, indexes of cyclicity, and the mean durations (M(j)) of succession stages. The results of calibration give an objective quantitative nature to the expert knowledge of the course of succession and get a proper interpretation. The 2010 data, which are not involved in the calibration procedure, enabled assessing the quality of prediction by the homogeneous model in short-term (from the 2006 situation): the error of model area distribution relative to the distribution observed in 2010 falls into the range of 9-17%, the best prognosis being given by the least optimal matrices (rejected values of w). This indicates a formally heterogeneous nature of succession processes in time. Thus, the refined version of the homogeneous Markov chain has not eliminated all the contradictions between the model results and expert knowledge, which suggests a further model development towards a "logically inhomogeneous" version or/and refusal to postulate the Markov property in the conceptual scheme of succession.
A Markov chain model for studying suicide dynamics: an illustration of the Rose theorem
2014-01-01
Background High-risk strategies would only have a modest effect on suicide prevention within a population. It is best to incorporate both high-risk and population-based strategies to prevent suicide. This study aims to compare the effectiveness of suicide prevention between high-risk and population-based strategies. Methods A Markov chain illness and death model is proposed to determine suicide dynamic in a population and examine its effectiveness for reducing the number of suicides by modifying certain parameters of the model. Assuming a population with replacement, the suicide risk of the population was estimated by determining the final state of the Markov model. Results The model shows that targeting the whole population for suicide prevention is more effective than reducing risk in the high-risk tail of the distribution of psychological distress (i.e. the mentally ill). Conclusions The results of this model reinforce the essence of the Rose theorem that lowering the suicidal risk in the population at large may be more effective than reducing the high risk in a small population. PMID:24948330
A kinetic model for chemical neurotransmission
NASA Astrophysics Data System (ADS)
Ramirez-Santiago, Guillermo; Martinez-Valencia, Alejandro; Fernandez de Miguel, Francisco
Recent experimental observations in presynaptic terminals at the neuromuscular junction indicate that there are stereotyped patterns of cooperativeness in the fusion of adjacent vesicles. That is, a vesicle in hemifusion process appears on the side of a fused vesicle and which is followed by another vesicle in a priming state while the next one is in a docking state. In this talk we present a kinetic model for this morphological pattern in which each vesicle state previous to the exocytosis is represented by a kinetic state. This chain states kinetic model can be analyzed by means of a Master equation whose solution is simulated with the stochastic Gillespie algorithm. With this approach we have reproduced the responses to the basal release in the absence of stimulation evoked by the electrical activity and the phenomena of facilitation and depression of neuromuscular synapses. This model offers new perspectives to understand the underlying phenomena in chemical neurotransmission based on molecular interactions that result in the cooperativity between vesicles during neurotransmitter release. DGAPA Grants IN118410 and IN200914 and Conacyt Grant 130031.
NASA Astrophysics Data System (ADS)
Sharma, Ankita; Tiwari, Priyanka; Dutt Konar, Anita
2018-06-01
Peptide self-assembled nanostructures have attracted attention recently owing to their promising applications in diversified avenues. To validate the importance of sidechains in supramolecular architectural stabilization, herein this report describes the self-assembly propensities involving weak interactions in a series of model tripeptides Boc-Xaa-Aib-Yaa-OMe I-IV, (where Xaa = 4-F-Phe/NMeSer/Ile & Yaa = Tyr in peptide I-III respectively and Xaa = 4-F-Phe & Yaa = Ile in peptide IV) differing in terminal side chains. The solid state structural analysis reveals that tripeptide (I) displays supramolecular preference for double helical architecture. However, when slight modification has been introduced in the N-terminal side chains disfavour the double helical organisation (Peptide II and III). Indeed the peptides display sheet like ensemble within the framework. Besides replacement of C-terminal Tyr by Ile in peptide I even do not promote the architecture, emphasizing the dominant role of balance of side chains in stabilizing double helical organisation. The CD measurements, concentration dependant studies, NMR titrations and ROESY spectra are well in agreement with the solid state conformational investigation. Moreover the morphological experiments utilizing FE-SEM, support the heterogeneity present in the peptides. Thus this work may not only hold future promise in understanding the structure and function of neurodegenerative diseases but also assist in rational design of protein modification in biologically active peptides.
Liquid crystalline phase behavior in systems of hard-sphere chains
NASA Astrophysics Data System (ADS)
Williamson, Dave C.; Jackson, George
1998-06-01
A study of the liquid crystalline phase transitions in a system of hard-sphere chains is presented. The chains comprise m=7 tangentially bonded hard-sphere segments in a linear conformation (LHSC). The isothermal-isobaric Monte Carlo simulation technique is used to obtain the equation of state of the system both by compressing the isotropic (I) liquid and by expanding the solid (K). As well as the usual isotropic and solid phases, nematic and smectic-A liquid crystalline states are seen. A large degree of hysteresis is found in the neighborhood of the I-N transition. The results for the rigid LHSC system were compared with existing data for the corresponding semiflexible hard-sphere chains (FHSC): the flexibility has a large destabilizing effect on the nematic phase and consequently it postpones the I-N transition. The results of the simulations are also compared with rescaled Onsager theories for the I-N transition. It is rather surprising to find that the Parsons approach, which has been so successful for other hard-core models such as spherocylinders and ellipsoids, gives very poor results. The related approach of Vega and Lago gives a good description of the I-N phase transition. The procedure of Vega and Lago, as with all two-body resummations of the Onsager theory, only gives a qualitative description of the nematic order.
NASA Astrophysics Data System (ADS)
Mussardo, G.; Giudici, G.; Viti, J.
2017-03-01
In this paper we introduce and study the coprime quantum chain, i.e. a strongly correlated quantum system defined in terms of the integer eigenvalues n i of the occupation number operators at each site of a chain of length M. The n i ’s take value in the interval [2,q] and may be regarded as S z eigenvalues in the spin representation j = (q - 2)/2. The distinctive interaction of the model is based on the coprimality matrix \\boldsymbolΦ : for the ferromagnetic case, this matrix assigns lower energy to configurations where occupation numbers n i and n i+1 of neighbouring sites share a common divisor, while for the anti-ferromagnetic case it assigns a lower energy to configurations where n i and n i+1 are coprime. The coprime chain, both in the ferro and anti-ferromagnetic cases, may present an exponential number of ground states whose values can be exactly computed by means of graph theoretical tools. In the ferromagnetic case there are generally also frustration phenomena. A fine tuning of local operators may lift the exponential ground state degeneracy and, according to which operators are switched on, the system may be driven into different classes of universality, among which the Ising or Potts universality class. The paper also contains an appendix by Don Zagier on the exact eigenvalues and eigenvectors of the coprimality matrix in the limit q\\to ∞ .
Quantitative risk stratification in Markov chains with limiting conditional distributions.
Chan, David C; Pollett, Philip K; Weinstein, Milton C
2009-01-01
Many clinical decisions require patient risk stratification. The authors introduce the concept of limiting conditional distributions, which describe the equilibrium proportion of surviving patients occupying each disease state in a Markov chain with death. Such distributions can quantitatively describe risk stratification. The authors first establish conditions for the existence of a positive limiting conditional distribution in a general Markov chain and describe a framework for risk stratification using the limiting conditional distribution. They then apply their framework to a clinical example of a treatment indicated for high-risk patients, first to infer the risk of patients selected for treatment in clinical trials and then to predict the outcomes of expanding treatment to other populations of risk. For the general chain, a positive limiting conditional distribution exists only if patients in the earliest state have the lowest combined risk of progression or death. The authors show that in their general framework, outcomes and population risk are interchangeable. For the clinical example, they estimate that previous clinical trials have selected the upper quintile of patient risk for this treatment, but they also show that expanded treatment would weakly dominate this degree of targeted treatment, and universal treatment may be cost-effective. Limiting conditional distributions exist in most Markov models of progressive diseases and are well suited to represent risk stratification quantitatively. This framework can characterize patient risk in clinical trials and predict outcomes for other populations of risk.
Supercurrent as a probe for topological superconductivity in magnetic adatom chains
NASA Astrophysics Data System (ADS)
Mohanta, Narayan; Kampf, Arno P.; Kopp, Thilo
2018-06-01
A magnetic adatom chain, proximity coupled to a conventional superconductor with spin-orbit coupling, exhibits locally an odd-parity, spin-triplet pairing amplitude. We show that the singlet-triplet junction, thus formed, leads to a net spin accumulation in the near vicinity of the chain. The accumulated spins are polarized along the direction of the local d vector for triplet pairing and generate an enhanced persistent current flowing around the chain. The spin polarization and the "supercurrent" reverse their directions beyond a critical exchange coupling strength at which the singlet superconducting order changes its sign on the chain. The current is strongly enhanced in the topological superconducting regime where Majorana bound states appear at the chain ends. The current and the spin profile offer alternative routes to characterize the topological superconducting state in adatom chains and islands.
Scaling of the polarization amplitude in quantum many-body systems in one dimension
NASA Astrophysics Data System (ADS)
Kobayashi, Ryohei; Nakagawa, Yuya O.; Fukusumi, Yoshiki; Oshikawa, Masaki
2018-04-01
Resta proposed a definition of the electric polarization in one-dimensional systems in terms of the ground-state expectation value of the large gauge transformation operator. Vanishing of the expectation value in the thermodynamic limit implies that the system is a conductor. We study Resta's polarization amplitude (expectation value) in the S =1 /2 XXZ chain and its several generalizations, in the gapless conducting Tomonaga-Luttinger liquid phase. We obtain an analytical expression in the lowest-order perturbation theory about the free fermion point (XY chain) and an exact result for the Haldane-Shastry model with long-range interactions. We also obtain numerical results, mostly using the exact diagonalization method. We find that the amplitude exhibits a power-law scaling in the system size (chain length) and vanishes in the thermodynamic limit. On the other hand, the exponent depends on the model even when the low-energy limit is described by the Tomonaga-Luttinger liquid with the same Luttinger parameter. We find that a change in the exponent occurs when the Umklapp term(s) are eliminated, suggesting the importance of the Umklapp terms.