Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

PubMed

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

PubMed

Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

2015-02-01

The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Characterization of milled solid residue from cypress liquefaction in sub- and super ethanol.

PubMed

Liu, Hua-Min; Liu, Yu-Lan

2014-01-01

Cypress liquefaction in sub- and super ethanol was carried out in an autoclave at various temperatures. Milled solid residue (MSR) was isolated from solid residue remaining from the liquefaction process, and its chemical characteristics was comparatively investigated with milled wood lignin (MWL) of cypress by sugar analysis, elemental analysis, FT-IR analysis, gel permeation chromatography, and NMR analysis. Results showed that there were two reactions (de-polymerization and re-polymerization) during the cypress liquefaction in sub- and super ethanol and the re-polymerization reactions were the main reaction at 220-260°C. Considering the stability of side-chain, the stability of lignin side-chain in cypress during liquefaction process in ethanol could be sequenced as follows: β-5>β-β'>β-O-4'. The MSR were mainly from the decomposition and re-polymerization of lignin. This study suggests that characterization of MSR provides a promising method to investigate the mechanisms of cypress liquefaction in ethanol. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

Simple model of inhibition of chain-branching combustion processes

NASA Astrophysics Data System (ADS)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

NASA Astrophysics Data System (ADS)

Nakazumi, Tomoka; Hara, Yusuke

2017-09-01

We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Amy Cha-Tien; Downes, Paula Sue; Heinen, Russell

Analysis of chemical supply chains is an inherently complex task, given the dependence of these supply chains on multiple infrastructure systems (e.g., the petroleum sector, transportation, etc.). This effort requires data and information at various levels of resolution, ranging from network-level distribution systems to individual chemical reactions. Sandia National Laboratories (Sandia) has integrated its existing simulation and infrastructure analysis capabilities with chemical data models to analyze the chemical supply chains of several nationally critical chemical commodities. This paper describes how Sandia models the ethylene supply chain; that is, the supply chain for the most widely used raw material for plasticsmore » production including a description of the types of data and modeling capabilities that are required to represent the ethylene supply chain. The paper concludes with a description of Sandia's use the model to project how the supply chain would be affected by and adapt to a disruptive scenario hurricane.« less

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

USDA-ARS?s Scientific Manuscript database

The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

PubMed

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials

NASA Astrophysics Data System (ADS)

Chapman, Peter Henry

Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are retained for M -˜ 2.7 and above.

A new assessment of the alleged link between element 115 and element 117 decay chains

NASA Astrophysics Data System (ADS)

Forsberg, U.; Rudolph, D.; Fahlander, C.; Golubev, P.; Sarmiento, L. G.; Åberg, S.; Block, M.; Düllmann, Ch. E.; Heßberger, F. P.; Kratz, J. V.; Yakushev, A.

2016-09-01

A novel rigorous statistical treatment is applied to available data (May 9, 2016) from search and spectroscopy experiments on the elements with atomic numbers Z = 115 and Z = 117. The present analysis implies that the hitherto proposed cross-reaction link between α-decay chains associated with the isotopes 293117 and 289115 is highly improbable.

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

PubMed Central

Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

2013-01-01

Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

PubMed

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

PubMed

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Endogenous ethanol affects biopolyester molecular weight in recombinant Escherichia coli.

PubMed

Hiroe, Ayaka; Hyakutake, Manami; Thomson, Nicholas M; Sivaniah, Easan; Tsuge, Takeharu

2013-11-15

In biopolyester synthesis, polyhydroxyalkanoate (PHA) synthase (PhaC) catalyzes the polymerization of PHA in bacterial cells, followed by a chain transfer (CT) reaction in which the PHA polymer chain is transferred from PhaC to a CT agent. Accordingly, the frequency of CT reaction determines PHA molecular weight. Previous studies have shown that exogenous alcohols are effective CT agents. This study aimed to clarify the effect of endogenous ethanol as a CT agent for poly[(R)-3-hydroxybutyrate] [P(3HB)] synthesis in recombinant Escherichia coli, by comparing with that of exogenous ethanol. Ethanol supplementation to the culture medium reduced P(3HB) molecular weights by up to 56% due to ethanol-induced CT reaction. NMR analysis of P(3HB) polymers purified from the culture supplemented with (13)C-labeled ethanol showed the formation of a covalent bond between ethanol and P(3HB) chain at the carboxyl end. Cultivation without ethanol supplementation resulted in the reduction of P(3HB) molecular weight with increasing host-produced ethanol depending on culture aeration. On the other hand, production in recombinant BW25113(ΔadhE), an alcohol dehydrogenase deletion strain, resulted in a 77% increase in molecular weight. Analysis of five E. coli strains revealed that the estimated number of CT reactions was correlated with ethanol production. These results demonstrate that host-produced ethanol acts as an equally effective CT agent as exogenous ethanol, and the control of ethanol production is important to regulate the PHA molecular weight.

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

PubMed

Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

2000-01-01

Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

In Site Analysis of a High Temperature Cure Reaction in Real Time Using Modulated Fiber-Optic FT-Raman Spectroscopy

NASA Technical Reports Server (NTRS)

Cooper, John; Aust, Jeffrey F.; Wise, Kent L.; Jensen, Brian J.

1999-01-01

The vibrational spectrum of a high temperature (330 C) polymerization reaction was successfully monitored in real time using a modulated fiber-optic FT-Raman spectrometer. A phenylethynyl terminated monomer was cured, and spectral evidence for two different reaction products was acquired. The products are a conjugated polyene chain and a cyclized trimer. This is the first report describing the use of FT-Raman spectroscopy to monitor a high temperature (greater than 250 C) reaction in real time.

In Situ Analysis of a High-Temperature Cure Reaction in Real Time Using Modulated Fiber-Optic FT-Raman Spectroscopy

NASA Technical Reports Server (NTRS)

Aust, Jeffrey F.; Cooper, John B.; Wise, Kent L.; Jensen, Brian J.

1999-01-01

The vibrational spectrum of a high-temperature (330 C) polymerization reaction was successfully monitored in real time with the use of a modulated fiber-optic Fourier transform (FT)-Raman spectrometer. A phenylethynyl-terminated monomer was cured, and spectral evidence for two different reaction products was acquired. The products are a conjugated polyene chain and a cyclized trimer. This is the first report describing the use of FT-Raman spectroscopy to monitor a high temperature (greater than 250 C) reaction in real time.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Food Fish Identification from DNA Extraction through Sequence Analysis

ERIC Educational Resources Information Center

Hallen-Adams, Heather E.

2015-01-01

This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

Using newly developed multiplex polymerase chain reaction and melting curve analysis for detection and discrimination of β-lactamases in Escherichia coli isolates from intensive care patients.

PubMed

Chromá, Magdaléna; Hricová, Kristýna; Kolář, Milan; Sauer, Pavel; Koukalová, Dagmar

2011-11-01

A total of 78 bacterial strains with known β-lactamases were used to optimize a rapid detection system consisting of multiplex polymerase chain reaction and melting curve analysis to amplify and identify blaTEM, blaSHV, and blaCTX-M genes in a single reaction. Additionally, to evaluate the applicability of this method, 32 clinical isolates of Escherichia coli displaying an extended-spectrum β-lactamase phenotype from patients hospitalized at intensive care units were tested. Results were analyzed by the Rotor-Gene operating software and Rotor-Gene ScreenClust HRM Software. The individual melting curves differed by a temperature shift or curve shape, according to the presence of β-lactamase genes. With the use of this method and direct sequencing, blaCTX-M-15-like was identified as the most prevalent β-lactamase gene. In conclusion, this novel detection system seems to be a suitable tool for rapid detection of present β-lactamase genes and their characterization. Copyright © 2011 Elsevier Inc. All rights reserved.

Bond Graph Modeling of Chemiosmotic Biomolecular Energy Transduction.

PubMed

Gawthrop, Peter J

2017-04-01

Engineering systems modeling and analysis based on the bond graph approach has been applied to biomolecular systems. In this context, the notion of a Faraday-equivalent chemical potential is introduced which allows chemical potential to be expressed in an analogous manner to electrical volts thus allowing engineering intuition to be applied to biomolecular systems. Redox reactions, and their representation by half-reactions, are key components of biological systems which involve both electrical and chemical domains. A bond graph interpretation of redox reactions is given which combines bond graphs with the Faraday-equivalent chemical potential. This approach is particularly relevant when the biomolecular system implements chemoelectrical transduction - for example chemiosmosis within the key metabolic pathway of mitochondria: oxidative phosphorylation. An alternative way of implementing computational modularity using bond graphs is introduced and used to give a physically based model of the mitochondrial electron transport chain To illustrate the overall approach, this model is analyzed using the Faraday-equivalent chemical potential approach and engineering intuition is used to guide affinity equalisation: a energy based analysis of the mitochondrial electron transport chain.

MAMMALIAN DNA IN PCR REAGENTS

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

PubMed

Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

2005-01-01

A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

PubMed

Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

2005-01-01

The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Electrically controlled microvalves to integrate microchip polymerase chain reaction and capillary electrophoresis.

PubMed

Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J

2008-07-01

Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.

Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

PubMed

Bullard, K M; Hietpas, P B; Ewing, A G

1998-01-01

Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

PubMed

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

PubMed

Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

2017-07-01

To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Forensic Analysis of Canine DNA Samples in the Undergraduate Biochemistry Laboratory

ERIC Educational Resources Information Center

Carson, Tobin M.; Bradley, Sharonda Q.; Fekete, Brenda L.; Millard, Julie T.; LaRiviere, Frederick J.

2009-01-01

Recent advances in canine genomics have allowed the development of highly distinguishing methods of analysis for both nuclear and mitochondrial DNA. We describe a laboratory exercise suitable for an undergraduate biochemistry course in which the polymerase chain reaction is used to amplify hypervariable regions of DNA from dog hair and saliva…

Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula)

USDA-ARS?s Scientific Manuscript database

Quantitative real-time polymerase chain reaction (qRT-PCR) is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference gene...

Microfluidic Gel Electrophoresis in the Undergraduate Laboratory Applied to Food Analysis

ERIC Educational Resources Information Center

Chao, Tzu-Chiao; Bhattacharya, Sanchari; Ros, Alexandra

2012-01-01

A microfluidics-based laboratory experiment for the analysis of DNA fragments in an analytical undergraduate course is presented. The experiment is set within the context of food species identification via amplified DNA fragments. The students are provided with berry samples from which they extract DNA and perform polymerase chain reaction (PCR)…

Thermal Theory of Combustion and Explosion. 3; Theory of Normal Flame Propagation

NASA Technical Reports Server (NTRS)

Semenov, N. N.

1942-01-01

The technical memorandum covers experimental data on flame propagation, the velocity of flame propagation, analysis of the old theoretical views of flame propagation, confirmation of the theory for simple reactions (theory of combustion of explosive substances and in particular nitroglycol), and check of the theory by example of a chain oxidizing reaction (theory of flame propagation in carbon monoxide, air and carbon monoxide - oxygen mixtures).

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

Enhanced analysis of real-time PCR data by using a variable efficiency model: FPK-PCR

PubMed Central

Lievens, Antoon; Van Aelst, S.; Van den Bulcke, M.; Goetghebeur, E.

2012-01-01

Current methodology in real-time Polymerase chain reaction (PCR) analysis performs well provided PCR efficiency remains constant over reactions. Yet, small changes in efficiency can lead to large quantification errors. Particularly in biological samples, the possible presence of inhibitors forms a challenge. We present a new approach to single reaction efficiency calculation, called Full Process Kinetics-PCR (FPK-PCR). It combines a kinetically more realistic model with flexible adaptation to the full range of data. By reconstructing the entire chain of cycle efficiencies, rather than restricting the focus on a ‘window of application’, one extracts additional information and loses a level of arbitrariness. The maximal efficiency estimates returned by the model are comparable in accuracy and precision to both the golden standard of serial dilution and other single reaction efficiency methods. The cycle-to-cycle changes in efficiency, as described by the FPK-PCR procedure, stay considerably closer to the data than those from other S-shaped models. The assessment of individual cycle efficiencies returns more information than other single efficiency methods. It allows in-depth interpretation of real-time PCR data and reconstruction of the fluorescence data, providing quality control. Finally, by implementing a global efficiency model, reproducibility is improved as the selection of a window of application is avoided. PMID:22102586

The Function of Neuroendocrine Cells in Prostate Cancer

DTIC Science & Technology

2013-04-01

integration site. We then performed deep sequencing and aligned reads to the genome. Our analysis revealed that both histological phenotypes are derived from...lentiviral integration site analysis . (B) Laser capture microdissection was performed on individual glands containing both squamous and...lentiviral integration site analysis . LTR: long terminal repeat (viral DNA), PCR: polymerase chain reaction. (D) Venn diagrams depict shared lentiviral

The value of routine polymerase chain reaction analysis of intraocular fluid specimens in the diagnosis of infectious posterior uveitis.

PubMed

Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel

2013-01-01

To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

Violence and vulnerability of female migrants in drop houses in Arizona: the predictable outcome of a chain reaction of violence.

PubMed

Simmons, William Paul; Menjívar, Cecilia; Téllez, Michelle

2015-05-01

This qualitative research study examines the experiences of immigrant women crossing the U.S./Mexico border and the proliferation of "drop houses" in Arizona as a new phenomenon, one that is often marked by kidnappings and sexual assault. Little research has been published on the violence women face on their journey, and the drop houses have almost completely escaped scholarly analysis. We argue that the drop houses must be seen as a consequence of a "state of emergency" declared by policy makers that led to changes in U.S. national and local immigration policies that fueled what we call a "chain reaction of violence." © The Author(s) 2015.

Geographic variation in marine turtle fibropapillomatosis

USGS Publications Warehouse

Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

2005-01-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Geographic variation in marine turtle fibropapillomatosis.

PubMed

Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

2005-09-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

Apparatus Notes.

ERIC Educational Resources Information Center

Eaton, Bruce G., Ed.

1980-01-01

This collection of notes describes (1) an optoelectronic apparatus for classroom demonstrations of mechanical laws, (2) a more efficient method for demonstrated nuclear chain reactions using electrically energized "traps" and ping-pong balls, and (3) an inexpensive demonstration for qualitative analysis of temperature-dependent resistance. (CS)

Introductory Laboratory Exercises in Radiobiology

ERIC Educational Resources Information Center

Williams, J. R. Parry; Servant, D. M.

1970-01-01

Describes experiments suitable for introducing use of radioisotopes in biology. Includes demonstrations of tracing food chains, uptake of ions by plants, concentration of elements by insects, tracing photosynthetic reactions, activation analysis of copper, and somatic and genetic effects. Uses autoradiographic and counting techniques. (AL)

ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

PubMed

Adamski, Mateusz G; Gumann, Patryk; Baird, Alison E

2014-01-01

Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR) have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR) and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells) and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA)) permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1) the achievement of absolute quantification and (2) a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Oxidative transformation of tunichromes - Model studies with 1,2-dehydro-N-acetyldopamine and N-acetylcysteine.

PubMed

Kuang, Qun F; Abebe, Adal; Evans, Jason; Sugumaran, Manickam

2017-08-01

Tunichromes are 1,2-dehydrodopa containing bioactive peptidyl derivatives found in blood cells of several tunicates. They have been implicated in metal sequestering, tunic formation, wound healing and defense reaction. Earlier studies conducted on these compounds indicate their extreme liability, high reactivity and easy oxidative polymerization. Their reactions are also complicated by the presence of multiple dehydrodopyl units. Since they have been invoked in crosslinking and covalent binding, to understand the reactivities of these novel compounds, we have taken a simple model compound that possess the tunichrome reactive group viz., 1,2-dehydro-N-acetyldopamine (Dehydro NADA) and examined its reaction with N-acetylcysteine in presence of oxygen under both enzymatic and nonenzymatic conditions. Ultraviolet and visible spectral studies of reaction mixtures containing dehydro NADA and N-acetylcysteine in different molar ratios indicated the production of side chain and ring adducts of N-acetylcysteine to dehydro NADA. Liquid chromatography and mass spectral studies supported this contention and confirmed the production of several different products. Mass spectral analysis of these products show the potentials of dehydro NADA to form side chain adducts that can lead to polymeric products. This is the first report demonstrating the ability of dehydro dopyl units to form adducts and crosslinks with amino acid side chains. Copyright © 2017 Elsevier Inc. All rights reserved.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Granulomatous herpes simplex encephalitis in an infant with multicystic encephalopathy: a distinct clinicopathologic entity?

PubMed

Schutz, Peter W; Fauth, Clarissa T; Al-Rawahi, Ghada N; Pugash, Denise; White, Valerie A; Stockler, Sylvia; Dunham, Christopher P

2014-04-01

Herpes simplex virus encephalitis can manifest as a range of clinical presentations including classic adult, neonatal, and biphasic chronic-granulomatous herpes encephalitis. We report an infant with granulomatous herpes simplex virus type 2 encephalitis with a subacute course and multicystic encephalopathy. A 2-month-old girl presented with lethargy and hypothermia. Computed tomography scan of the head showed multicystic encephalopathy and calcifications. Cerebrospinal fluid analysis by polymerase chain reaction testing for herpes simplex virus 1 and 2, enterovirus, and cytomegalovirus was negative. Normal cerebrospinal fluid interferon-α levels argued against Aicardi-Goutières syndrome. The patient died 2 weeks after presentation. At autopsy, multicystic encephalopathy was confirmed with bilateral gliosis, granulomatous inflammation with multinucleated giant cells, and calcifications. Bilateral healing necrotizing retinitis suggested a viral etiology, but retina and brain were free of viral inclusions and immunohistochemically negative for herpes simplex virus-2 and cytomegalovirus. However, polymerase chain reaction analysis showed herpes simplex virus-2 DNA in four cerebral paraffin blocks. Subsequent repeat testing of the initial cerebrospinal fluid sample using a different polymerase chain reaction assay was weakly positive for herpes simplex virus-2 DNA. Granulomatous herpes simplex virus encephalitis in infants can present with subacute course and result in multicystic encephalopathy with mineralization and minimal cerebrospinal fluid herpes simplex virus DNA load. Infectious etiologies should be carefully investigated in the differential diagnosis of multicystic encephalopathy with mineralization, in particular if multinucleated giant cells are present. Copyright © 2014 Elsevier Inc. All rights reserved.

COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

EPA Science Inventory

Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

FECAL INDICATOR BACTERIA MEASUREMENTS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS IN FRESH ARCHIVED DNA EXTRACT OF WATER SAMPLE FILTRATES

EPA Science Inventory

The U.S. EPA has initiated a new recreational water study to evaluate the correlation between illness rates in swimmers and Enterococcus concentrations determined by the mEI agar membrane filter (MF) method and several new technologies including QPCR analysis. Results of this stu...

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

PubMed

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

Integrated polymerase chain reaction/electrophoresis instrument

DOEpatents

Andresen, Brian D.

2000-01-01

A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

Short relaxation times but long transient times in both simple and complex reaction networks

PubMed Central

Henry, Adrien; Martin, Olivier C.

2016-01-01

When relaxation towards an equilibrium or steady state is exponential at large times, one usually considers that the associated relaxation time τ, i.e. the inverse of the decay rate, is the longest characteristic time in the system. However, that need not be true, other times such as the lifetime of an infinitesimal perturbation can be much longer. In the present work, we demonstrate that this paradoxical property can arise even in quite simple systems such as a linear chain of reactions obeying mass action (MA) kinetics. By mathematical analysis of simple reaction networks, we pin-point the reason why the standard relaxation time does not provide relevant information on the potentially long transient times of typical infinitesimal perturbations. Overall, we consider four characteristic times and study their behaviour in both simple linear chains and in more complex reaction networks taken from the publicly available database ‘Biomodels’. In all these systems, whether involving MA rates, Michaelis–Menten reversible kinetics, or phenomenological laws for reaction rates, we find that the characteristic times corresponding to lifetimes of tracers and of concentration perturbations can be significantly longer than τ. PMID:27411726

Clonal T-Cell Receptor γ-Chain Gene Rearrangements in Differential Diagnosis of Lymphomatoid Papulosis From Skin Metastasis of Nodal Anaplastic Large-Cell Lymphoma

PubMed Central

Akilov, Oleg E.; Pillai, Raju K.; Grandinetti, Lisa M.; Kant, Jeffrey A.; Geskin, Larisa

2012-01-01

Background In patients with a history of nodal anaplastic large-cell lymphoma (ALCL), differentiation of type C lymphomatoid papulosis from cutaneous involvement of systemic ALCL may be challenging because the 2 entities may exhibit identical histologic features. Although metastatic ALCL generally carries the same clone as the primary lymphoma, expression of a distinct clone likely represents a distinct process. Observations A 54-year-old white man had a history of anaplastic lymphoma kinase 1–negative ALCL in the right inguinal lymph node 6 years ago. A complete response was achieved after 6 cycles of CHOP (cyclophosphamide, doxorubicin, vincristine [Oncovin], and prednisone administered in 21-day cycles) and radiation therapy. After 3½ years, the patient observed waxing and waning papules and nodules. Examination of the biopsy specimen revealed a dense CD30+ lymphocytic infiltrate; no evidence of systemic malignancy was evident on positron emission tomography. Although clinically the presentation was consistent with lymphomatoid papulosis, metastatic ALCL had to be excluded. Polymerase chain reaction analysis with T-cell receptor γ-chain gene rearrangement (TCR-γR) was performed on the original lymph node and new skin lesions. Results of the TCR-γR analysis were positive for clonality in both lesions. However, separate clonal processes were identified. The identification of distinct clones supported the clinical impression of lymphomatoid papulosis. Conclusion Polymerase chain reaction analysis of TCR-γR is a useful method for distinguishing different clonal processes and is recommended when differentiation of primary and secondary lymphoproliferative disorders is required. PMID:21844453

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

USGS Publications Warehouse

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

Synthesis, magnetic properties and electronic structure of the S  =  ½ uniform spin chain system InCuPO5

NASA Astrophysics Data System (ADS)

Koteswararao, B.; Hazra, Binoy K.; Rout, Dibyata; Srinivasarao, P. V.; Srinath, S.; Panda, S. K.

2017-07-01

We have studied the structural and magnetic properties and electronic structure of the compound InCuPO5 synthesized by a solid state reaction method. The structure of InCuPO5 comprises S  =  ½ uniform spin chains formed by corner-shared CuO4 units. Magnetic susceptibility (χ(T)) data show a broad maximum at about 65 K, a characteristic feature of one-dimensional (1D) magnetism. The χ(T) data are fitted to the coupled S  =  ½ Heisenberg antiferromagnetic (HAFM) uniform chain model that gives the intra-chain coupling (J/k B) between nearest-neighbor Cu2+ ions as  -100 K and the ratio of inter-chain to intra-chain coupling (J‧/J) as about 0.07. The exchange couplings estimated from the magnetic data analysis are in good agreement with the values computed from the electronic structure calculations based on the density functional theory  +  Hubbard U (DFT  +  U) approach. The combination of theoretical and experimental analysis confirms that InCuPO5 is a candidate material for weakly coupled S  = ½ uniform chains. A detailed theoretical analysis of the electronic structure further reveals that the system is insulating with a gap of 2.4 eV and a local moment of 0.70 µ B/Cu.

A Model for the Interfacial Kinetics of Phospholipase D Activity on Long-Chain Lipids

DTIC Science & Technology

2013-07-01

we extend this model to account for the interaction between PLD and its reaction product, phosphatidic acid (PA), which is a long-chain lipid and... phosphatidic acid , and lecithin/ phosphatidic acid fixed monolayers: a Langmuit film balance study. J. Colloid Interface Sci. 79:319–338. 55. Morris, A...Dennis. 1988. Kinetic analysis of the Ca2þ-dependent, membrane-bound, macrophage phospholipase A2 and the effects of arachidonic acid . J. Biol. Chem. 263

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

PubMed

Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

2014-02-01

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

Reaction Paths and Chemical Activation Reactions of 2-Methyl-5-Furanyl Radical with 3O2.

PubMed

Hudzik, Jason M; Bozzelli, Joseph W

2017-10-05

Interest in high-energy substituted furans has been increasing due to their occurrence in biofuel production and their versatility in conversion to other useful products. Methylfurans are the simplest substituted furans and understanding their reaction pathways, thermochemical properties, including intermediate species stability, and chemical kinetics would aid in the study of larger furans. Furan ring C-H bonds have been shown to be extremely strong, approximately 120 kcal mol -1 , due in part to the placement of the oxygen atom and aromatic-like resonance, both within the ring. The thermochemistry and kinetics of the oxidation of 2-methyfuran radical at position 5 of the furan ring, 2-methyl-5-furanyl radical (2MF5j), is analyzed. The resulting chemically activated species, 2MF5OOj radical, has a well depth of 51 kcal mol -1 below the 2MF5j + O 2 reactants; this is 4-5 kcal mol -1 deeper than that of phenyl and vinyl radical plus O 2 , with both of these reactions known to undergo chain branching. Important, low-energy reaction pathways include chain branching dissociations, intramolecular abstractions, group transfers, and radical oxygen additions. Enthalpies of formation, entropies, and heat capacities for the stable molecules, radicals, and transition-state species are analyzed using computational methods. Calculated ΔH ° f 298 values were determined using an isodesmic work reaction from the CBS-QB3 composite method. Elementary rate parameters are from saddle point transition-state structures and compared to variational transition-state analysis for the barrierless reactions. Temperature- and pressure-dependent rate constants which are calculated using QRRK and master equation analysis is used for falloff and stabilization.

Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

NASA Astrophysics Data System (ADS)

Aravindran, S.; Sahilah, A. M.; Aminah, A.

2014-09-01

Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

PubMed

Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

1998-02-01

A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

Simplified transient isotachophoresis/capillary gel electrophoresis method for highly sensitive analysis of polymerase chain reaction samples on a microchip with laser-induced fluorescence detection.

PubMed

Liu, Dayu; Ou, Ziyou; Xu, Mingfei; Wang, Lihui

2008-12-19

We present a sensitive, simple and robust on-chip transient isotachophoresis/capillary gel electrophoresis (tITP/CGE) method for the analysis of polymerase chain reaction (PCR) samples. Using chloride ions in the PCR buffer and N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) in the background electrolyte, respectively, as the leading and terminating electrolytes, the tITP preconcentration was coupled with CGE separation with double-T shaped channel network. The tITP/CGE separation was carried out with a single running buffer. The separation process involved only two steps that were performed continuously with the sequential switching of four voltage outputs. The tITP/CGE method showed an analysis time and a separation efficiency comparable to those of standard CGE, while the signal intensity was enhanced by factors of over 20. The limit of detection of the chip-based tITP/CGE method was estimated to be 1.1 ng/mL of DNA in 1x PCR buffer using confocal fluorescence detection following 473 nm laser excitation.

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

PubMed

Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

2017-02-01

A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

The role of acyl carrier protein isoforms from Cuphea lanceolata seeds in the de-novo biosynthesis of medium-chain fatty acids.

PubMed

Schütt, B S; Brummel, M; Schuch, R; Spener, F

1998-06-01

To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.

Molecular Diagnostic Analysis of Outbreak Scenarios

ERIC Educational Resources Information Center

Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.

2012-01-01

In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

Single quantum dot analysis enables multiplexed point mutation detection by gap ligase chain reaction.

PubMed

Song, Yunke; Zhang, Yi; Wang, Tza-Huei

2013-04-08

Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and a tedious assay processes. In this report, an assay technology is proposed which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single-molecule coincidence detection, and the superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single-molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

PubMed

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Mechanism of the coupling of diazonium to single-walled carbon nanotubes and its consequences.

PubMed

Schmidt, Grégory; Gallon, Salomé; Esnouf, Stéphane; Bourgoin, Jean-Philippe; Chenevier, Pascale

2009-01-01

On the tube: The coupling of diazonium ions onto single-walled carbon nanotubes is shown to proceed through a radical chain reaction by kinetic analysis of the absorption peak drop (see picture). Radical species are also revealed by ESR. Metallic (m) nanotubes play a special catalytic role in the functionalization of semiconducting (sc) nanotubes.Due to its simplicity and versatility, diazonium coupling is the most widely used method for carbon nanotube (CNT) functionalization to increase CNT processability and add new functionalities. Yet, its mechanism is so far mostly unknown. Herein, we use kinetic analysis to shed light on this complex mechanism. A free-radical chain reaction is revealed by absorption spectroscopy and ESR. Metallic CNTs are shown to play an unexpected catalytic role. The step determining the selectivity towards metallic CNTs is identified by a Hammett correlation. A mechanistic model is proposed that predicts reactivity and selectivity as a function of diazonium electrophilicity and metallic-to-semiconducting CNT ratio, thus opening perspectives of controlled high-yield functionalization and purification.

Cutin-derived CuO reaction products from purified cuticles and tree leaves

NASA Astrophysics Data System (ADS)

Goñi, Miguel A.; Hedges, John I.

1990-11-01

Long chain (C 16-C 18) hydroxy fatty acids are obtained among the nonlignin-derived reaction products from the CuO oxidation of a variety of geochemical samples. In order to investigate the origin of these acids, the CuO reaction products of isolated cuticles and whole leaves were investigated. The reaction products from the CuO oxidation of purified apple ( Malus pumila) cuticle include 16-hydroxy-hexadecanoic acid, 10,16-dihydroxyhexadecanoic acid, 9,10,18-trihydroxyoctadec-12-enoic acid, and 9,10,18-trihydroxyoctadecanoic acid as major components. The distribution of these cutin-derived CuO reaction products is similar to the monomer compositions deduced from traditional methods of cutin analysis. Oxidation of whole English Holly ( Ilex aquifolium) leaves yields cutin-derived acidic reaction products (in addition to lignin-derived phenols) similar to those obtained from oxidation of the corresponding isolated cuticles, indicating that CuO oxidation of bulk plant tissue is a viable procedure of cutin analysis in geochemical applications.

In Situ Solid-State Reactions Monitored by X-ray Absorption Spectroscopy: Temperature-Induced Proton Transfer Leads to Chemical Shifts.

PubMed

Stevens, Joanna S; Walczak, Monika; Jaye, Cherno; Fischer, Daniel A

2016-10-24

The dramatic colour and phase alteration with the solid-state, temperature-dependent reaction between squaric acid and 4,4'-bipyridine has been probed in situ with X-ray absorption spectroscopy. The electronic and chemical sensitivity to the local atomic environment through chemical shifts in the near-edge X-ray absorption fine structure (NEXAFS) revealed proton transfer from the acid to the bipyridine base through the change in nitrogen protonation state in the high-temperature form. Direct detection of proton transfer coupled with structural analysis elucidates the nature of the solid-state process, with intermolecular proton transfer occurring along an acid-base chain followed by a domino effect to the subsequent acid-base chains, leading to the rapid migration along the length of the crystal. NEXAFS thereby conveys the ability to monitor the nature of solid-state chemical reactions in situ, without the need for a priori information or long-range order. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

PubMed

Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

1996-03-01

Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

PubMed

Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

2017-06-01

Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

Quantitative analysis of pork and chicken products by droplet digital PCR.

PubMed

Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

2014-01-01

In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

High-throughput microfluidic single-cell digital polymerase chain reaction.

PubMed

White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

2013-08-06

Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

Synthesis and characterisation of new types of side chain cholesteryl polymers.

PubMed

Wang, Bin; Du, Haiyan; Zhang, Junhua

2011-01-01

A series of cholesterol derivatives have been synthesised via the alkylation reaction of the 3-hydroxyl group with the aliphatic bromide compounds with different chain lengths, namely 3β-alkyloxy-cholesterol. The double bond between the C5 and C6 positions in these cholesterol derivatives was oxidised into epoxy, followed by an epoxy-ring-opening reaction with the treatment with acrylic acid, resulting in a series of 3β-alkyloxy-5α-hydroxy-6β-acryloyloxycholesterol, C(n)OCh (n=1, 2, 4, 6, 8, 10, 12), The acrylate group is connected to the C6 position, which is confirmed by the single crystal structure analysis. The corresponding polymers, PC(n)OCh, were prepared via free radical polymerisation. The structure of monomers and the resulting polymers were characterised with nuclear magnetic resonance (NMR), Fourier transform infrared spectroscopy (FT-IR) and gel permeation chromatography (GPC). The thermal properties of PC(n)OCh were studied using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). To determine the secondary structure of polymers, circular dichroism (CD) spectra were performed. It was found that not all monomers produce high-molecular-weight polymers because of steric hindrance. However, all polymers have a helical structure, which can be enhanced by increasing the alkoxy chain length. In addition, increasing the alkoxy chain length decreases the glass transition temperature and increases the decomposition temperature of the polymers. Copyright © 2010 Elsevier Inc. All rights reserved.

Structure-guided mutational analysis of the nucleotidyltransferase domain of Escherichia coli NAD+-dependent DNA ligase (LigA).

PubMed

Zhu, Hui; Shuman, Stewart

2005-04-01

NAD+-dependent DNA ligase (LigA) is essential for bacterial growth and a potential target for antimicrobial drug discovery. Here we queried the role of 14 conserved amino acids of Escherichia coli LigA by alanine scanning and thereby identified five new residues within the nucleotidyltransferase domain as being essential for LigA function in vitro and in vivo. Structure activity relationships were determined by conservative mutagenesis for the Glu-173, Arg-200, Arg-208, and Arg-277 side chains, as well as four other essential side chains that had been identified previously (Lys-115, Asp-117, Asp-285, and Lys-314). In addition, we identified Lys-290 as important for LigA activity. Reference to the structure of Enterococcus faecalis LigA allowed us to discriminate three classes of essential/important side chains that: (i) contact NAD+ directly (Lys-115, Glu-173, Lys-290, and Lys-314); (ii) comprise the interface between the NMN-binding domain (domain Ia) and the nucleotidyltransferase domain or comprise part of a nick-binding site on the surface of the nucleotidyltransferase domain (Arg-200 and Arg-208); or (iii) stabilize the active site fold of the nucleotidyltransferase domain (Arg-277). Analysis of mutational effects on the isolated ligase adenylylation and phosphodiester formation reactions revealed different functions for essential side chains at different steps of the DNA ligase pathway, consistent with the proposal that the active site is serially remodeled as the reaction proceeds.

Optimization of lipase-catalyzed synthesis of ginsenoside Rb1 esters using response surface methodology.

PubMed

Hu, Jiang-Ning; Lee, Jeung-Hee; Zhu, Xue-Mei; Shin, Jung-Ah; Adhikari, Prakash; Kim, Jae-Kyung; Lee, Ki-Teak

2008-11-26

In the lipase (Novozyme 435)-catalyzed synthesis of ginsenoside Rb1 esters, different acyl donors were found to affect not only the degree of conversion but also the regioselectivity. The reaction of acyl donors with short carbon chain was more effective, showing higher conversion than those with long carbon chain. Among the three solvent systems, the reaction in tert-amyl alcohol showed the highest conversion rate, while the reaction in the mixed solvent of t-BuOH and pyridine (1:1) had the lowest conversion rate. To allow the increase of GRb1 lipophilicity, we decided to further study the optimal condition of synthesis of GRb1 with vinyl decanoate with 10 carbon chain fatty acids in tert-amyl alcohol. Response surface methodology (RSM) was employed to optimize the synthesis condition. From the ridge analysis with maximum responses, the maximum GRb1 conversion was predicted to be 61.51% in a combination of factors (40.2 h, 52.95 degrees C, substrate mole ratio 275.57, and enzyme amount 39.81 mg/mL). Further, the adequacy of the predicted model was examined by additional independent experiments at the predicted maximum synthesis conditions. Results showed that the RSM was effective to optimize a combination of factors for lipase-catalyzed synthesis of ginsenoside Rb1 with vinyl decanoate.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

PubMed

Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

2017-07-17

Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

A real-time polymerase chain reaction-based protocol for low/medium-throughput Y-chromosome microdeletions analysis.

PubMed

Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe

2012-12-01

We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

Long-time behavior and Turing instability induced by cross-diffusion in a three species food chain model with a Holling type-II functional response.

PubMed

Haile, Dawit; Xie, Zhifu

2015-09-01

In this paper, we study a strongly coupled reaction-diffusion system describing three interacting species in a food chain model, where the third species preys on the second one and simultaneously the second species preys on the first one. An intra-species competition b2 among the second predator is introduced to the food chain model. This parameter produces some very interesting result in linear stability and Turing instability. We first show that the unique positive equilibrium solution is locally asymptotically stable for the corresponding ODE system when the intra-species competition exists among the second predator. The positive equilibrium solution remains linearly stable for the reaction diffusion system without cross diffusion, hence it does not belong to the classical Turing instability scheme. But it becomes linearly unstable only when cross-diffusion also plays a role in the reaction-diffusion system, hence the instability is driven solely from the effect of cross diffusion. Our results also exhibit some interesting combining effects of cross-diffusion, intra-species competitions and inter-species interactions. Numerically, we conduct a one parameter analysis which illustrate how the interactions change the existence of stable equilibrium, limit cycle, and chaos. Some interesting dynamical phenomena occur when we perform analysis of interactions in terms of self-production of prey and intra-species competition of the middle predator. By numerical simulations, it illustrates the existence of nonuniform steady solutions and new patterns such as spot patterns, strip patterns and fluctuations due to the diffusion and cross diffusion in two-dimension. Published by Elsevier Inc.

High-resolution melting analysis of sequence variations in the cytidine deaminase gene (CDA) in patients with cancer treated with gemcitabine.

PubMed

Raynal, Caroline; Ciccolini, Joseph; Mercier, Cédric; Boyer, Jean-Christophe; Polge, Anne; Lallemant, Benjamin; Mouzat, Kévin; Lumbroso, Serge; Brouillet, Jean-Paul; Evrard, Alexandre

2010-02-01

Gemcitabine (2',2'-difluorodeoxycytidine) is a major antimetabolite cytotoxic drug with a wide spectrum of activity against solid tumors. Hepatic elimination of gemcitabine depends on a catabolic pathway through a deamination step driven by the enzyme cytidine deaminase (CDA). Severe hematologic toxicity to gemcitabine was reported in patients harboring genetic polymorphisms in CDA gene. High-resolution melting (HRM) analysis of polymerase chain reaction amplicon emerges today as a powerful technique for both genotyping and gene scanning strategies. In this study, 46 DNA samples from gemcitabine-treated patients were subjected to HRM analysis on a LightCycler 480 platform. Residual serum CDA activity was assayed as a surrogate marker for the overall functionality of this enzyme. Genotyping of three well-described single nucleotide polymorphisms in coding region (c.79A>C, c.208G>A and c.435C>T) was successfully achieved by HRM analysis of small polymerase chain reaction fragments, whereas unknown single nucleotide polymorphisms were searched by a gene scanning strategy with longer amplicons (up to 622 bp). The gene scanning strategy allowed us to find a new intronic mutation c.246+37G>A in a female patient displaying marked CDA deficiency and who had an extreme toxic reaction with a fatal outcome to gemcitabine treatment. Our work demonstrates that HRM-based methods, owing to their simplicity, reliability, and speed, are useful tools for diagnosis of CDA deficiency and could be of interest for personalized medicine.

Protein side chain rotational isomerization: A minimum perturbation mapping study

NASA Astrophysics Data System (ADS)

Haydock, Christopher

1993-05-01

A theory of the rotational isomerization of the indole side chain of tryptophan-47 of variant-3 scorpion neurotoxin is presented. The isomerization potential energy, entropic part of the isomerization free energy, isomer probabilities, transition state theory reaction rates, and indole order parameters are calculated from a minimum perturbation mapping over tryptophan-47 χ1×χ2 torsion space. A new method for calculating the fluorescence anisotropy from molecular dynamics simulations is proposed. The method is based on an expansion that separates transition dipole orientation from chromophore dynamics. The minimum perturbation potential energy map is inverted and applied as a bias potential for a 100 ns umbrella sampling simulation. The entropic part of the isomerization free energy as calculated by minimum perturbation mapping and umbrella sampling are in fairly close agreement. Throughout, the approximation is made that two glutamine and three tyrosine side chains neighboring tryptophan-47 are truncated at the Cβ atom. Comparison with the previous combination thermodynamic perturbation and umbrella sampling study suggests that this truncated neighbor side chain approximation leads to at least a qualitatively correct theory of tryptophan-47 rotational isomerization in the wild type variant-3 scorpion neurotoxin. Analysis of van der Waals interactions in a transition state region indicates that for the simulation of barrier crossing trajectories a linear combination of three specially defined dihedral angles will be superior to a simple side chain dihedral reaction coordinate.

Cyclopentadienone Oxidation Reaction Kinetics and Thermochemistry for the Alcohols, Hydroperoxides, and Vinylic, Alkoxy, and Alkylperoxy Radicals.

PubMed

Yommee, Suriyakit; Bozzelli, Joseph W

2016-01-28

Cyclopentadienone has one carbonyl and two olefin groups resulting in 4n + 2 π-electrons in a cyclic five-membered ring structure. Thermochemical and kinetic parameters for the initial reactions of cyclopentadienone radicals with O2 and the thermochemical properties for cyclopentadienone-hydroperoxides, alcohols, and alkenyl, alkoxy, and peroxy radicals were determined by use of computational chemistry. The CBS-QB3 composite and B3LYP density functional theory methods were used to determine the enthalpies of formation (ΔfH°298) using the isodesmic reaction schemes with several work reactions for each species. Entropy and heat capacity, S°(T) and Cp°(T) (50 K ≤ T ≤ 5000 K) are determined using geometric parameters, internal rotor potentials, and frequencies from B3LYP/6-31G(d,p) calculations. Standard enthalpies of formation are reported for parent molecules as cyclopentadienone, cyclopentadienone with alcohol, hydroperoxide substituents, and the cyclopentadienone-yl vinylic, alkoxy, and peroxy radicals corresponding to loss of a hydrogen atom from the carbon and oxygen sites. Entropy and heat capacity vs temperature also are reported for the parent molecules and for radicals. The thermochemical analysis shows The R(•) + O2 well depths are deep, on the order of 50 kcal mol(-1), and the R(•) + O2 reactions to RO + O (chain branching products) for cyclopentadienone-2-yl and cyclopentadienone-3-yl have unusually low reaction (ΔHrxn) enthalpies, some 20 or so kcal/mol below the entrance channels. Chemical activation kinetics using quantum RRK analysis for k(E) and master equation for falloff are used to show that significant chain branching as a function of temperature and pressure can occur when these vinylic radicals are formed.

Tuberculous otitis media: a resurgence?

PubMed

Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

2017-09-01

Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Comparison of Enterococcus qPCR analysis results from fresh and marine waters on two real-tme instruments

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) will be recommending a quantitativ e polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality. A practical consideration for widespread implementation of this o...

A SIMPLE POLYMERASE CHAIN REACTION-SEQUENCING ANALYSIS CAPABLE OF IDENTIFYING MULTIPLE MEDICALLY RELEVANT FILAMENTOUS FUNGAL SPECIES

EPA Science Inventory

Due to the accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on building surfaces, it is necessary to accurately determine the organisms responsible for these m...

NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

EPA Science Inventory

Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

Modeling enterococcus densities measured by quantitative polymerase chain reaction and membrane filtration using environmental conditions at four Great Lakes beaches

EPA Science Inventory

Data collected by the US Environmental Protection Agency (EPA) during the summer months of 2003 and 2004 at four US Great Lakes beaches were analyzed using regression analysis to identify relationships between meteorological, physical water characteristics, and beach characterist...

REAL TIME PCR ANALYSIS OF INDOOR MOLDS: PRINCIPLES, PROCEDURES AND APPLICATIONS

EPA Science Inventory

This presentation will endeavor to present an overview of the real time polymerase chain reaction method developed for indoor mold detection and quantification by the EPA. It will begin with a brief discussion of the PCR technology that provides the basis for this method and how ...

Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

Treesearch

Ningxia Du; Paula M. Pijut

2010-01-01

An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

RAPID MEASUREMENT OF BACTERIAL FECAL INDICATORS IN SURFACE WATERS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS

EPA Science Inventory

Current methods for determining fecal contamination of recreational waters rely on the culture of bacterial indicators and require at least 24 hours to determine whether the water is unsafe for use. By the time monitoring results are available, exposures have already occurred. N...

Comparison of Enterococcus qPCR analysis results from fresh and marine water samples on two real-time instruments - poster

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality. A practical consideration for widespread implementation of this or ...

Checking of individuality by DNA profiling.

PubMed

Brdicka, R; Nürnberg, P

1993-08-25

A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

NMR-based conformational analysis of perezone and analogues.

PubMed

Zepeda, L Gerardo; Burgueño-Tapia, Eleuterio; Pérez-Hernández, Nury; Cuevas, Gabriel; Joseph-Nathan, Pedro

2013-04-01

Complete assignment of the (1)H NMR chemical shift and coupling constant values of perezone (1), O-methylperezone (2) and 6-hydroxyperezone (3) was carried out by total-line-shape-fitting calculations using the PERCH iterative spectra analysis software (PERCH Solutions Ltd., Kuopio, Finland). The resulting simulated spectra for the three compounds showed strong similarity to their corresponding experimental spectra. Particularly, all vicinal, allylic and homoallylic coupling constant values for the side chain of the three compounds were very similar, thus revealing that the conformation of these three molecules in solution is indeed almost identical. This fact is in agreement with extended side chain conformations over folded chain conformations because 1, 2 and 3 undergo completely different intramolecular cycloaddition reactions. In addition, results of double pulsed field gradient spin echo NOESY 1D experiments performed on perezone (1) were unable to provide evidence for folded conformers. Copyright © 2013 John Wiley & Sons, Ltd.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goni, M.A.; Hedges, J.I.

Long chain (C{sub 16}-C{sub 18}) hydroxy fatty acids are obtained among the nonlignin-derived reaction products from the CuO oxidation of a variety of geochemical samples. In order to investigate the origin of these acids, the CuO reaction products of isolated cuticles and whole leaves were investigated. The reaction products from the CuO oxidation of purified apple (Malus pumila) cuticle include 16-hydroxyhexadecanoic acid, 10,16-dihydroxyhexadecanoic acid, 9,10,18-trihydroxyoctadec-12-enoic acid, and 9,10,18-trihydroxyoctadecanoic acid as major components. The distribution of these cutin-derived CuO reaction products is similar to the monomer compositions deduced from traditional methods of cutin analysis. Oxidation of whole English Holly (Ilex aquifolium)more » leaves yields cutin-derived acidic reaction products (in addition to lignin-derived phenols) similar to those obtained from oxidation of the corresponding isolated cuticles, indicating that CuO oxidation of bulk plant tissue is a viable procedure of cutin analysis in geochemical applications.« less

Structured Mono- and Diacylglycerols with a High Content of Medium Chain Fatty Acids.

PubMed

Esperón-Rojas, Alaina A; Baeza-Jiménez, R; Cano-Sarmiento, Cynthia; García, Hugo S

2017-09-01

In the present work, direct enzyme-catalysed esterification of medium chain fatty acids (MCFA) from three different sources (Medium chain triacylglycerols, MCT; saponified MCT and a mixture of free MCFA) was evaluated to obtain structured mono- and diacylglycerols. The esterifications were carried out mixing the different sources of MCFA with glycerol at two weight ratios (1:1 and 4:1, w/w), using three immobilized lipases: Novozym 435, Lipozyme RM IM and Lipozyme TL IM; different reaction times (t = 0, 15, 30, 60, 120 min); enzyme loadings (5, 10 or 15% with respect to the total weight of substrates). The extent of esterification was determined by gas chromatography (GC) analysis of the acylglycerols produced. The highest incorporation of free MCFA into glycerol was obtained for a 1:1 (w/w) glycerol to free MCFA ratio, 5% of Novozym 435, at 50°C, 300 rpm, 10% of molecular sieves and a commercial MCFA mixture as starting material. Under these conditions, incorporation of at least 90% of MCFA into glycerol was achieved after 30 min of reaction.

A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

PubMed

Kidd, I M; Clark, D A; Emery, V C

2000-06-01

Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

PubMed Central

Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

2015-01-01

The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

Visualizing changes in electron distribution in coupled chains of cytochrome bc(1) by modifying barrier for electron transfer between the FeS cluster and heme c(1).

PubMed

Cieluch, Ewelina; Pietryga, Krzysztof; Sarewicz, Marcin; Osyczka, Artur

2010-02-01

Cytochrome c(1) of Rhodobacter (Rba.) species provides a series of mutants which change barriers for electron transfer through the cofactor chains of cytochrome bc(1) by modifying heme c(1) redox midpoint potential. Analysis of post-flash electron distribution in such systems can provide useful information about the contribution of individual reactions to the overall electron flow. In Rba. capsulatus, the non-functional low-potential forms of cytochrome c(1) which are devoid of the disulfide bond naturally present in this protein revert spontaneously by introducing a second-site suppression (mutation A181T) that brings the potential of heme c(1) back to the functionally high levels, yet maintains it some 100 mV lower from the native value. Here we report that the disulfide and the mutation A181T can coexist in one protein but the mutation exerts a dominant effect on the redox properties of heme c(1) and the potential remains at the same lower value as in the disulfide-free form. This establishes effective means to modify a barrier for electron transfer between the FeS cluster and heme c(1) without breaking disulfide. A comparison of the flash-induced electron transfers in native and mutated cytochrome bc(1) revealed significant differences in the post-flash equilibrium distribution of electrons only when the connection of the chains with the quinone pool was interrupted at the level of either of the catalytic sites by the use of specific inhibitors, antimycin or myxothiazol. In the non-inhibited system no such differences were observed. We explain the results using a kinetic model in which a shift in the equilibrium of one reaction influences the equilibrium of all remaining reactions in the cofactor chains. It follows a rather simple description in which the direction of electron flow through the coupled chains of cytochrome bc(1) exclusively depends on the rates of all reversible partial reactions, including the Q/QH2 exchange rate to/from the catalytic sites. 2009 Elsevier B.V. All rights reserved.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

PubMed Central

Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

2009-01-01

Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Application of multiplex PCR, pulsed-field gel electrophoresis (PFGE), and BOX-PCR for molecular analysis of enterococci

USDA-ARS?s Scientific Manuscript database

The objective of the study was to use band-based molecular methods including BOX-PCR (Polymerase Chain Reaction) and Pulsed-Field Gel Electrophoresis (PFGE) to determine if genetically related enterococci were found among different stores, food types, or years. Enterococci were also characterized f...

Comparison of Enterococcus qPCR analysis results from fresh and marine water samples on two real-time instruments -

EPA Science Inventory

EPA is currently considering a quantitative polymerase chain reaction (qPCR) method, targeting Enterococcus spp., for beach monitoring. Improvements in the method’s cost-effectiveness may be realized by the use of newer instrumentation such as the Applied Biosystems StepOneTM a...

Detection of Neorickettsia risticii, the agent of Potomac horse fever, in a Gypsy Vanner stallion from Manitoba.

PubMed

Durán, María Carolina; Marqués, Fernando J

2016-03-01

A horse with colitis from Manitoba referred to the Veterinary Medical Centre, Western College of Veterinary Medicine, was diagnosed with Potomac horse fever (PHF). Polymerase chain reaction analysis of the feces confirmed Neorickettsia risticii infection. This is the first reported case of PHF in Manitoba.

Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

ERIC Educational Resources Information Center

Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

2010-01-01

This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

Occurrence of Cryptosporidium andersoni in Brazilian cattle

USDA-ARS?s Scientific Manuscript database

Feces were collected from 68 cattle, 1 to 12 mo of age, on 12 farms in the municipality of Campos dos Goytacazes, Rio de Janeiro, Brazil, and examined for the presence of Cryptosporidium sp. All samples were subjected to molecular analysis by polymerase chain reaction (nested PCR) of the 18S rRNA. F...

'Candidatus Phytoplasma sudamericanum' a novel taxon from diseased passion fruit (Passiflora edulis f. flavicarpa Deg.)

USDA-ARS?s Scientific Manuscript database

Symptoms of abnormal proliferation of shoots resulting in formation of witches’ broom growths were observed in diseased plants of passion fruit (Passiflora edulis f. flavicarpa Deg.) in Brazil. RFLP analysis of 16S rRNA gene sequences amplified in polymerase chain reactions containing template DNAs...

EVALUATION OF QUANTITATIVE REAL TIME PCR FOR THE MEASUREMENT OF HELICOBATER PYLORI AT LOW CONCENTRATIONS IN DRINKING WATER

EPA Science Inventory

Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.

Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...

Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

USDA-ARS?s Scientific Manuscript database

Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

Gut content analysis of arthropod predators of codling moth in Washington apple orchards

USDA-ARS?s Scientific Manuscript database

More than 70% of pome fruits in the USA are produced in central Washington State. The codling moth, Cydia pomonella (L.) is consistently the most damaging pest. We used polymerase chain reaction (PCR) to amplify codling moth DNA in 2591 field-collected arthropod predators to estimate predation in s...

Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

PubMed

Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

2013-11-27

The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

Down-regulation of FcepsilonRI expression by Houttuynia cordata Thunb extract in human basophilic KU812F cells.

PubMed

Shim, Sun-Yup; Seo, Young-Kook; Park, Jeong-Ro

2009-04-01

Human basophilic KU812F cells express a high-affinity immunoglobulin (Ig) E receptor, FcepsilonRI, which plays an important role in IgE-mediated allergic reactions. Houttuynia cordata Thunb (Family Saururaceae), which is rich in polyphenols, has been shown to have various physiological properties, including antiviral, antioxidative, anticancer, and anti-inflammatory activities. The effect of H. cordata extract on the expression of FcepsilonRI in human KU812F cells was examined. Flow cytometric analysis showed that the FcepsilonRI expression and the IgE binding activity were suppressed when the cells were cultured with H. cordata extract. Reverse transcription-polymerase chain reaction analysis showed that levels of the mRNAs for FcepsilonRI alpha- and gamma-chains were decreased by the treatment of H. cordata extract. Addition of H. cordata extract to culture medium was also observed to result in a reduction in the release of histamine from the cells. These results suggest that H. cordata extract may exert its anti-allergic activity through down-regulation of FcepsilonRI expression and a subsequent decrease in histamine release.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

PubMed Central

Pérez, Lester J.; de Arce, Heidy Díaz

2009-01-01

Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

PubMed

Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

1998-01-01

To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

Pentynyl dextran as a support matrix for immobilization of serine protease subtilisin Carlsberg and its use for transesterification of N-acetyl-L-phenylalanine ethyl ester in organic media.

PubMed

Tahir, Muhammad Nazir; Cho, Eunae; Mischnick, Petra; Lee, Jae Yung; Yu, Jae-Hyuk; Jung, Seunho

2014-04-01

In this study, serine protease (subtilisin Carlsberg) was immobilized on pentynyl dextran (PyD, O-alkynyl ether of dextran, 1) and used for the transesterification of N-acetyl-L-phenylalanine ethyl ester (2) with different aliphatic (1-propanol, 1-butanol, 1-pentanol, 1-hexanol) and aromatic (benzyl alcohol, 2-phenyl ethanol, 4-phenyl-1-butanol) alcohols in tetrahydrofuran (THF). The effect of carbon chain length in aliphatic and aromatic alcohols on initial and average transesterification rate, transesterification activity of immobilized enzyme and yield of the reaction under selected reaction conditions was investigated. The transesterification reactivity of the enzyme and yield of the reaction increased as the chain length of the alcohols decreased. Furthermore, almost no change in yield was observed when the immobilized enzyme was repeatedly used for selected alcohols over six cycles. Intrinsic fluorescence analysis showed that the catalytic activity of the immobilized enzyme in THF was maintained due to retention of the tertiary structure of the enzyme after immobilization on PyD (1).

Kinematic Analysis of Four Plyometric Push-Up Variations

PubMed Central

MOORE, LAURA H.; TANKOVICH, MICHAEL J.; RIEMANN, BRYAN L.; DAVIES, GEORGE J.

2012-01-01

Plyometric research in the upper extremity is limited, with the effects of open-chain plyometric exercises being studied most. Kinematic and ground reaction force data concerning closed-chain upper extremity plyometrics has yet to be examined. Twenty-one recreationally active male subjects performed four variations of plyometric push-ups in a counterbalanced order. These included box drop push-ups from 3.8 cm, 7.6 cm, 11.4 cm heights, and clap push-ups. Kinematics of the trunk, dominant extremity and both hands were collected to examine peak flight, elbow flexion at ground contact, elbow displacement, and hand separation. Additionally peak vertical ground reaction force was measured under the dominant extremity. The 11.4 cm and clap push-ups had significantly higher peak flight than the other variations (P<.001). At ground contact, the elbow was in significantly greater flexion for the 3.8 cm and clap push-up compared to the other variations (P<.001). The clap push-up had significantly more elbow displacement than the other variations (P<.001) while hand separation was not significantly different between variations (P=.129). Peak vertical ground reaction force was significantly greater for the clap push-ups than for all other variations (P< .001). Despite similar flight heights between the 11.4 cm and clap push-ups, the greater peak vertical ground reaction force and elbow displacement of the clap push-ups indicates the clap push-up is the most intense of the variations examined. Understanding the kinematic variables involved will aid in the creation of a closed chain upper-extremity plyometric progression. PMID:27182390

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Numerical simulation of transport and sequential biodegradation of chlorinated aliphatic hydrocarbons using CHAIN_2D

NASA Astrophysics Data System (ADS)

Schaerlaekens, J.; Mallants, D.; Imûnek, J.; van Genuchten, M. Th.; Feyen, J.

1999-12-01

Microbiological degradation of perchloroethylene (PCE) under anaerobic conditions follows a series of chain reactions, in which, sequentially, trichloroethylene (TCE), cis-dichloroethylene (c-DCE), vinylchloride (VC) and ethene are generated. First-order degradation rate constants, partitioning coefficients and mass exchange rates for PCE, TCE, c-DCE and VC were compiled from the literature. The parameters were used in a case study of pump-and-treat remediation of a PCE-contaminated site near Tilburg, The Netherlands. Transport, non-equilibrium sorption and biodegradation chain processes at the site were simulated using the CHAIN_2D code without further calibration. The modelled PCE compared reasonably well with observed PCE concentrations in the pumped water. We also performed a scenario analysis by applying several increased reductive dechlorination rates, reflecting different degradation conditions (e.g. addition of yeast extract and citrate). The scenario analysis predicted considerably higher concentrations of the degradation products as a result of enhanced reductive dechlorination of PCE. The predicted levels of the very toxic compound VC were now an order of magnitude above the maximum permissible concentration levels.

Expression and function of CD8 alpha/beta chains on rat and human mast cells.

PubMed

Kim, Mi-Sun; Kim, Sung-Hoon; Lee, Hye-Jung; Kim, Hyung-Min

2004-03-01

The expression and functional role of CD8 glycoprotein, a marker of cytotoxic/suppressor T lymphocytes and NK cells, were not studied on freshly isolated connective tissue type rat peritoneal mast cells, a rat mucosal type mast cell line (RBL 2H3), or human mast cell line (HMC-1). We used the reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis, immunohistochemistry and enzyme-linked immunosorbent assay. RT-PCR and Western blot analysis identified the presence of CD8 alpha/beta chains on the mast cells, and immunohistochemistry confirmed CD8alpha expression on rat or human mast cells. Functional studies demonstrated that stimulation of CD8 alpha/beta chains on rat mast cells induced the secretion of tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6), which are regarded as important mediators during infection. However, co-stimulation with stem cell factor had no effect on CD8-induced mediator secretion. Our findings demonstrate novel biological roles of CD8 molecules in mast cells.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

PubMed

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

PubMed

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

PubMed

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

NASA Astrophysics Data System (ADS)

Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

2016-08-01

In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Effect of acyl chain length on selective biocatalytic deacylation on O-aryl glycosides and separation of anomers.

PubMed

Aggarwal, Neha; Arya, Anu; Mathur, Divya; Singh, Sukhdev; Tyagi, Abhilash; Kumar, Rajesh; Rana, Neha; Singh, Rajendra; Prasad, Ashok K

2014-04-01

It has been demonstrated that Lipozyme® TL IM (Thermomyces lanuginosus lipase immobilised on silica) can selectively deacylate the ester function involving the C-5' hydroxyl group of α-anomers over the other acyl functions of anomeric mixture of peracylated O-aryl α,β-D-ribofuranoside. The analysis of results of biocatalytic deacylation reaction revealed that the reaction time decreases with the increase in the acyl chain length from C1 to C4. The unique selectivity of Lipozyme® TL IM has been harnessed for the separation of anomeric mixture of peracylated O-aryl α,β-D-ribofuranosides, The lipase mediated selective deacylation methodology has been used for the synthesis of O-aryl α-D-ribofuranosides and O-aryl β-D-ribofuranosides in pure forms, which can be used as chromogenic substrate for the detection of pathogenic microbial parasites containing glycosidases. Copyright © 2014. Published by Elsevier Inc.

Local recurrence as immunoglobulin G4 (IgG4)-related disease 10 years after radiotherapy to ocular adnexal extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue.

PubMed

Matsuo, Toshihiko; Ichimura, Kouichi; Yoshino, Tadashi

2011-01-01

In 2000, a 48-year-old woman developed a left orbital mass with lacrimal gland involvement and then, in 2003, a right orbital mass with lacrimal gland involvement, both of which were diagnosed as extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue (MALT lymphoma). She underwent 30 Gy external beam radiation to bilateral orbital lesions. The lymphoma cells in both lesions did not share the same clonality, as shown by amplification by polymerase chain reaction of the immunoglobulin heavy chain gene. Immunoglobulin light chain analysis by immunohistochemistry and messenger RNA in situ hybridization showed λ chain monotype in the left orbital lesion but κ chain monotype in the right orbital lesion. She developed recurrent left orbital mass with high uptake on fluorodeoxyglucose positron emission tomography fused with computed tomography in 2010, and excisional biopsy disclosed the formation of follicles and infiltration with immunoglobulin G4 (IgG4)-positive plasma cells mainly in interfollicular areas. The immunoglobulin light chain analysis showed the λ chain and κ chain bitype. With the immunohistopathological diagnosis of IgG4-related disease, the serum IgG4 level was found to show elevation at 376 mg/dL, and the patient chose observation. This is the first reported case of development of IgG4-related disease after bilataral orbital MALT lymphoma with external beam radiotherapy.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

[The development of molecular human genetics and its significance for perspectives of modern medicine].

PubMed

Coutelle, C; Speer, A; Grade, K; Rosenthal, A; Hunger, H D

1989-01-01

The introduction of molecular human genetics has become a paradigma for the application of genetic engineering in medicine. The main principles of this technology are the isolation of molecular probes, their application in hybridization reactions, specific gene-amplification by the polymerase chain reaction, and DNA sequencing reactions. These methods are used for the analysis of monogenic diseases by linkage studies and the elucidation of the molecular defect causing these conditions, respectively. They are also the basis for genomic diagnosis of monogenic diseases, introduced into the health care system of the GDR by a national project on Duchenne/Becker muscular dystrophy, Cystic Fibrosis and Phenylketonuria. The rapid development of basic research on the molecular analysis of the human genome and genomic diagnosis indicates, that human molecular genetics is becoming a decisive basic discipline of modern medicine.

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Measurements and analysis of alpha-induced reactions of importance for nuclear astrophysics

NASA Astrophysics Data System (ADS)

de Messieres, Genevieve Escande

2011-11-01

Reactions during stellar helium burning are of primary importance for understanding nucleosynthesis. A detailed understanding of the critical reaction chain 4He(2alpha, gamma)12C( alpha, gamma)16O(alpha, gamma) 20Ne is necessary both because it is the primary energy source and because it determines the ratio of 12C to 16O produced, which in turn significantly effects subsequent nucleosynthesis. Also during Helium burning, the reactions 22Ne(alpha, n)25Mg and 22Ne(alpha, gamma )26Mg are crucial in determining the amount of neutrons available for the astrophysical s-process. This thesis presents new experimental results concerning the 16O(alpha, gamma) 20Ne, 22Ne(alpha, n)25Mg, and 22Ne(alpha, gamma)26Mg reaction rates. These results are then applied to the calculation of the associated stellar reaction rates in order to achieve better accuracy.

Estimates of production and structure of nuclei with Z = 119

NASA Astrophysics Data System (ADS)

Adamian, G. G.; Antonenko, N. V.; Lenske, H.

2018-02-01

The comparative analysis of the hot fusion reactions 50Ti +247-249Bk and 51V +246-248Cm for synthesis of element 119 is made with the dinuclear system model and the prediction of nuclear properties of the microscopic-macroscopic approach, where the closed proton shell at Z ≥ 120 is expected. The quasiparticle structures of nuclei in the α-decay chain of 295119 and a possible spread of alpha energies are studied. The calculated values of Qα are compared with available experimental data. The termination of the α-decay chain of 295119 is revealed.

Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

PubMed

Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

2002-02-01

We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

Selective Transformation of β-Lactam Antibiotics by Peroxymonosulfate: Reaction Kinetics and Nonradical Mechanism.

PubMed

Chen, Jiabin; Fang, Cong; Xia, Wenjun; Huang, Tianyin; Huang, Ching-Hua

2018-02-06

While the β-lactam antibiotics are known to be susceptible to oxidative degradation by sulfate radical (SO 4 •- ), here we report that peroxymonosulfate (PMS) exhibits specific high reactivity toward β-lactam antibiotics without SO 4 •- generation for the first time. Apparent second-order reaction constants (k 2,app ) were determined for the reaction of PMS with three penicillins, five cephalosporins, two carbapenems, and several structurally related chemicals. The pH-dependency of k 2,app could be well modeled based on species-specific reactions. On the basis of reaction kinetics, stoichiometry, and structure-activity assessment, the thioether sulfur, on the six- or five-membered rings (penicillins and cephalosporins) and the side chain (carbapenems), was the main reaction site for PMS oxidation. Cephalosporins were more reactive toward PMS than penicillins and carbapenems, and the presence of a phenylglycine side chain significantly enhanced cephalosporins' reactivity toward PMS. Product analysis indicated oxidation of β-lactam antibiotics to two stereoisomeric sulfoxides. A radical scavenging study and electron paramagnetic resonance (EPR) technique confirmed lack of involvement of radical species (e.g., SO 4 •- ). Thus, the PMS-induced oxidation of β-lactam antibiotics was proposed to proceed through a nonradical mechanism involving direct two-electron transfer along with the heterolytic cleavage of the PMS peroxide bond. The new findings of this study are important for elimination of β-lactam antibiotic contamination, because PMS exhibits specific high reactivity and suffers less interference from the water matrix than the radical process.

Fluidics platform and method for sample preparation and analysis

DOEpatents

Benner, W. Henry; Dzenitis, John M.; Bennet, William J.; Baker, Brian R.

2014-08-19

Herein provided are fluidics platform and method for sample preparation and analysis. The fluidics platform is capable of analyzing DNA from blood samples using amplification assays such as polymerase-chain-reaction assays and loop-mediated-isothermal-amplification assays. The fluidics platform can also be used for other types of assays and analyzes. In some embodiments, a sample in a sealed tube can be inserted directly. The following isolation, detection, and analyzes can be performed without a user's intervention. The disclosed platform may also comprises a sample preparation system with a magnetic actuator, a heater, and an air-drying mechanism, and fluid manipulation processes for extraction, washing, elution, assay assembly, assay detection, and cleaning after reactions and between samples.

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

The use of real-time polymerase chain reaction with high resolution melting (real-time PCR-HRM) analysis for the detection and discrimination of nematodes Bursaphelenchus xylophilus and Bursaphelenchus mucronatus.

PubMed

Filipiak, Anna; Hasiów-Jaroszewska, Beata

2016-04-01

The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. Copyright © 2016 Elsevier Ltd. All rights reserved.

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Bioinformatic analysis of variability of Newcastle disease virus diagnostic primers and probes and the potential for false negative detection

USDA-ARS?s Scientific Manuscript database

The use of reverse transcriptase polymerase chain reaction (RT-PCR) or other molecular diagnostic methods is commonly used for the primary diagnosis of Newcastle disease virus (NDV). However, NDV in nature has a range of virulence, and the low virulence viruses must be differentiated from virulent ...

Group specific quantitative real-time polymerase chain reaction (qRT-PCR) analysis of methanogenic archaea in stored swine manure

USDA-ARS?s Scientific Manuscript database

Consolidated storage of swine manure is associated with the production of a variety of odors and emissions which result from anaerobic digestion of materials present in the manure. Methanogenic archaea are a diverse group of anaerobic microorganisms responsible for the production of methane. In th...

Detection of Neorickettsia risticii, the agent of Potomac horse fever, in a Gypsy Vanner stallion from Manitoba

PubMed Central

Durán, María Carolina; Marqués, Fernando J.

2016-01-01

A horse with colitis from Manitoba referred to the Veterinary Medical Centre, Western College of Veterinary Medicine, was diagnosed with Potomac horse fever (PHF). Polymerase chain reaction analysis of the feces confirmed Neorickettsia risticii infection. This is the first reported case of PHF in Manitoba. PMID:26933267

Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

Treesearch

Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

2018-01-01

Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

EPA Science Inventory

The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

Influences of sample interference and interference controls on quantification of enterococci fecal indicator bacteria in surface water samples by the qPCR method

EPA Science Inventory

A quantitative polymerase chain reaction (qPCR) method for the detection of entercocci fecal indicator bacteria has been shown to be generally applicable for the analysis of temperate fresh (Great Lakes) and marine coastal waters and for providing risk-based determinations of wat...

Cryptic and Asymptomatic Opisthorchis felineus Infections

PubMed Central

Armignacco, Orlando; Ferri, Fabrizio; Gomez-Morales, Maria Angeles; Caterini, Luciano; Pozio, Edoardo

2013-01-01

We describe the diagnostic difficulties experienced during an opisthorchiasis outbreak. Of 31 infected individuals, 61.3% were asymptomatic, and in the 12 symptomatic individuals, the duration of non-pathognomonic symptoms was shorter than 4 weeks. Serology by enzyme-linked immunosorbent assay and polymerase chain reaction fecal analysis were shown to be the most sensitive diagnostic tools. PMID:23249682

Cowpox Virus Transmission from Rats to Monkeys, the Netherlands

PubMed Central

Martina, Byron E.E.; van Doornum, Gerard; Dorrestein, Gerry M.; Niesters, Hubert G.M.; Stittelaar, Koert J.; Wolters, Marno A.B.I.; van Bolhuis, Hester G.H.

2006-01-01

We report an outbreak of cowpox virus among monkeys at a sanctuary for exotic animals. Serologic analysis and polymerase chain reaction were performed on blood and swab samples from different rodent species trapped at the sanctuary during the outbreak. Sequence comparison and serologic results showed that brown rats (Rattus norvegicus) transmitted the virus to monkeys. PMID:16707063

A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

ERIC Educational Resources Information Center

Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

2012-01-01

We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

Blowing dust and highway safety in the southwestern United States: Characteristics of dust emission "hotspots" and management implications

USDA-ARS?s Scientific Manuscript database

Despite the widespread media attention of chain-reaction traffic incidents and property damage caused by windblown dust in the U.S. and elsewhere in the world, very few studies have provided in-depth analysis on this issue. Remote sensing and field observations reveal that wind erosion in the southw...

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

The role of living/controlled radical polymerization in the formation of improved imprinted polymers.

PubMed

Salian, Vishal D; Vaughan, Asa D; Byrne, Mark E

2012-06-01

In this work, living/controlled radical polymerization (LRP) is compared with conventional free radical polymerization in the creation of highly and weakly cross-linked imprinted poly(methacrylic acid-co-ethylene glycol dimethacrylate) networks. It elucidates, for the first time, the effect of LRP on the chain level and begins to explain why the efficiency of the imprinting process is improved using LRP. Imprinted polymers produced via LRP exhibited significantly higher template affinity and capacity compared with polymers prepared using conventional methods. The use of LRP in the creation of highly cross-linked imprinted polymers resulted in a fourfold increase in binding capacity without a decrease in affinity; whereas weakly cross-linked gels demonstrated a nearly threefold increase in binding capacity at equivalent affinity when LRP was used. In addition, by adjusting the double bond conversion, we can choose to increase either the capacity or the affinity in highly cross-linked imprinted polymers, thus allowing the creation of imprinted polymers with tailorable binding parameters. Using free radical polymerization in the creation of polymer chains, as the template-monomer ratio increased, the average molecular weight of the polymer chains decreased despite a slight increase in the double bond conversion. Thus, the polymer chains formed were shorter but greater in number. Using LRP neutralized the effect of the template. The addition of chain transfer agent resulted in slow, uniform, simultaneous chain growth, resulting in the formation of longer more monodisperse chains. Reaction analysis revealed that propagation time was extended threefold in the formation of highly cross-linked polymers when LRP techniques were used. This delayed the transition to the diffusion-controlled stage of the reaction, which in turn led to the observed enhanced binding properties, decreased polydispersity in the chains, and a more homogeneous macromolecular architecture. Copyright © 2012 John Wiley & Sons, Ltd.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Need of a consistent and convenient nucleus identification in ENDF files for the automatic construction of the depletion chains

NASA Astrophysics Data System (ADS)

Mosca, Pietro; Mounier, Claude

2016-03-01

The automatic construction of evolution chains recently implemented in GALILEE system is based on the analysis of several ENDF files : the multigroup production cross sections present in the GENDF files processed by NJOY from the ENDF evaluation, the decay file and the fission product yields (FPY) file. In this context, this paper highlights the importance of the nucleus identification to properly interconnect the data mentioned above. The first part of the paper describes the present status of the nucleus identification among the several ENDF files focusing, in particular, on the use of the excited state number and of the isomeric state number. The second part reviews the problems encountered during the automatic construction of the depletion chains using recent ENDF data. The processing of the JEFF-3.1.1, ENDF/B-VII.0 (decay and FPY) and the JEFF-3.2 (production cross section) points out problems about the compliance or not of the nucleus identifiers with the ENDF-6 format and sometimes the inconsistencies among the various ENDF files. In addition, the analysis of EAF-2003 and EAF-2010 shows some incoherence between the ZA product identifier and the reaction identifier MT for the reactions (n, pα) and (n, 2np). As a main result of this work, our suggestion is to change the ENDF format using systematically the isomeric state number to identify the nuclei. This proposal is already compliant to a huge amount ENDF data that are not in agreement with the present ENDF format. This choice is the most convenient because, ultimately, it allows one to give human readable names to the nuclei of the depletion chains.

Stability analysis and stabilization strategies for linear supply chains

NASA Astrophysics Data System (ADS)

Nagatani, Takashi; Helbing, Dirk

2004-04-01

Due to delays in the adaptation of production or delivery rates, supply chains can be dynamically unstable with respect to perturbations in the consumption rate, which is known as “bull-whip effect”. Here, we study several conceivable production strategies to stabilize supply chains, which is expressed by different specifications of the management function controlling the production speed in dependence of the stock levels. In particular, we will investigate, whether the reaction to stock levels of other producers or suppliers has a stabilizing effect. We will also demonstrate that the anticipation of future stock levels can stabilize the supply system, given the forecast horizon τ is long enough. To show this, we derive linear stability conditions and carry out simulations for different control strategies. The results indicate that the linear stability analysis is a helpful tool for the judgement of the stabilization effect, although unexpected deviations can occur in the non-linear regime. There are also signs of phase transitions and chaotic behavior, but this remains to be investigated more thoroughly in the future.

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

NASA Astrophysics Data System (ADS)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

Oxidation reaction of polyether-based material and its suppression in lithium rechargeable battery using 4 V class cathode, LiNi1/3Mn1/3Co1/3O2.

PubMed

Kobayashi, Takeshi; Kobayashi, Yo; Tabuchi, Masato; Shono, Kumi; Ohno, Yasutaka; Mita, Yuichi; Miyashiro, Hajime

2013-12-11

The all solid-state lithium battery with polyether-based solid polymer electrolyte (SPE) is regarded as one of next-generation lithium batteries, and has potential for sufficient safety because of the flammable-electrolyte-free system. It has been believed that polyether-based SPE is oxidized at the polymer/electrode interface with 4 V class cathodes. Therefore, it has been used for electric devices such as organic transistor, and lithium battery under 3 V. We estimated decomposition reaction of polyether used as SPE of all solid-state lithium battery. We first identified the decomposed parts of polyether-based SPE and the conservation of most main chain framework, considering the results of SPE analysis after long cycle operations. The oxidation reaction was found to occur slightly at the ether bond in the main chain with the branched side chain. Moreover, we resolved the issue by introducing a self-sacrificing buffer layer at the interface. The introduction of sodium carboxymethyl cellulose (CMC) to the 4 V class cathode surface led to the suppression of SPE decomposition at the interface as a result of the preformation of a buffer layer from CMC, which was confirmed by the irreversible exothermic reaction during the first charge, using electrochemical calorimetry. The attained 1500 cycle operation is 1 order of magnitude longer than those of previously reported polymer systems, and compatible with those of reported commercial liquid systems. The above results indicate to proceed to an intensive research toward the realization of 4 V class "safe" lithium polymer batteries without flammable liquid electrolyte.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

PubMed

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Clinical characteristics of children with viral single- and co-infections and a petechial rash.

PubMed

Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

2013-05-01

Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

PubMed

Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

2018-04-04

Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Analysis of the major epitope of the alpha2 chain of bovine type I collagen in children with bovine gelatin allergy.

PubMed

Hori, Hisae; Hattori, Shunji; Inouye, Sakae; Kimura, Akinori; Irie, Shinkichi; Miyazawa, Hiroshi; Sakaguchi, Masahiro

2002-10-01

Anaphylaxis to measles, mumps, and rubella vaccines has been reported. It has been found that most of these reactions to live vaccines are caused by type I allergy with the bovine gelatin present in the vaccines as an allergen. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. We previously reported that allergic reactions to gelatin are caused by the type I collagen alpha2 (alpha2[I]) chain. To aid in the development of gelatin that has little or no allergenicity in human subjects, we investigated epitopes of bovine alpha2(I) chain with use of IgE in gelatin-sensitive children. Serum samples were collected from 15 patients who had systemic allergic reactions to vaccines and high levels of specific IgE to bovine gelatin. Eleven overlapping recombinant proteins that cover bovine alpha2(I) were prepared with a bacterial expression vector. We examined IgE reactivity to these recombinant proteins by means of ELISA. Fifteen peptides covering a major reactive recombinant protein were synthesized. The IgE-reacting epitope was identified by means of IgE-ELISA inhibition with these synthetic peptides and pooled serum from the patients. We found that of the 15 patients, 13 showed IgE reactivity to a recombinant protein (no. 3) spanning the central region of the collagenous domain ((418)Gly-(662)Pro). Furthermore, all 13 patients showed IgE reactivity to the 4-kd recombinant protein (no. 3a) spanning the region from (461)Pro to (500)Glu. In IgE-ELISA inhibition we found that a minimum IgE epitope of gelatin allergen was composed of the 10-amino-acid sequence (485)Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro(494). This sequence is not observed in the human type I collagen alpha1 and alpha2 chains, nor is it found in the bovine type I collagen alpha1 chain. We found that Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro is a major IgE epitope of the alpha2 chain of bovine type I collagen in patients with gelatin allergy. The degree of anaphylaxis to gelatin in vaccines might be reduced by digestion of this IgE-binding site in gelatin.

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

PubMed

Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

2018-04-01

Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

PubMed

Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

1993-10-01

A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

PubMed

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

Efficiency of photochemical stages of photosynthesis in purple bacteria (a critical survey).

PubMed

Borisov, A Yu

2014-03-01

Based on currently available data, the energy transfer efficiency in the successive photophysical and photochemical stages has been analyzed for purple bacteria. This analysis covers the stages starting from migration of the light-induced electronic excitations from the bulk antenna pigments to the reaction centers up to irreversible stage of the electron transport along the transmembrane chain of cofactors-carriers. Some natural factors are revealed that significantly increase the rates of efficient processes in these stages. The influence on their efficiency by the "bottleneck" in the energy migration chain is established. The overall quantum yield of photosynthesis in these stages is determined.

DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

PubMed Central

Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

1997-01-01

To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

Quick detection of Leifsonia xyli subsp. xyli by PCR and necleotide sequence analysis of PCR amplicons from Chinese Leifsonia xyli subsp. xyli isolates

USDA-ARS?s Scientific Manuscript database

A quick polymerase chain reaction (PCR) assay was developed for the detection of Leifsonia xyli subsp. xyli (Lxx), the bacterial causal agent of ratoon stunting disease (RSD) of sugarcane, in crude juice samples from stalks. After removal of abiotic impurities and large molecular weight microorgani...

VLSI Microsystem for Rapid Bioinformatic Pattern Recognition

NASA Technical Reports Server (NTRS)

Fang, Wai-Chi; Lue, Jaw-Chyng

2009-01-01

A system comprising very-large-scale integrated (VLSI) circuits is being developed as a means of bioinformatics-oriented analysis and recognition of patterns of fluorescence generated in a microarray in an advanced, highly miniaturized, portable genetic-expression-assay instrument. Such an instrument implements an on-chip combination of polymerase chain reactions and electrochemical transduction for amplification and detection of deoxyribonucleic acid (DNA).

Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

PubMed

Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

2001-01-01

A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of <5% (w/w) guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei

2008-12-01

We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less

Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

PubMed

Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

2016-06-01

We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

Disappearance of Ph1 chromosome with intensive chemotherapy and detection of minimal residual disease by polymerase chain reaction in a patient with blast crisis of chronic myelogenous leukemia.

PubMed

Honda, H; Miyagawa, K; Endo, M; Takaku, F; Yazaki, Y; Hirai, H

1993-06-01

We diagnosed a patient with chronic myelogenous leukemia (CML) in chronic phase (CP) on the basis of clinical findings, Ph1 chromosome detected by cytogenetic analysis, and bcr-abl fusion mRNA detected by reverse transcriptase-dependent polymerase chain reaction (RT-PCR). One month after diagnosis, the patient developed extramedullary blast crisis in the lymph nodes, and then medullary blast crisis in the bone marrow, in which different surface markers were shown. Combination chemotherapy with BH-AC, VP16, and mitoxantrone was administered; this resulted in rapid disappearance of the lymphadenopathy, restoration of normal hematopoiesis, and no Ph1 chromosome being detected by cytogenetic analysis. RT-PCR performed to detect the residual Ph1 clone revealed that although the Ph1 clone was preferentially suppressed, it was still residual. The intensive chemotherapy regimen preferentially suppressed the Ph1-positive clone and led to both clinical and cytogenetic remission in this patient with BC of CML; we suggest that RT-PCR is a sensitive and useful method for detecting minimal residual disease during the clinical course of this disease.

Expression of Fra-1 in human hepatocellular carcinoma and its prognostic significance.

PubMed

Gao, Xiao-Qiang; Ge, Yong-Sheng; Shu, Qing-Hua; Ma, Hua-Xing

2017-06-01

This study aimed to explore the clinical significance and prognostic value of Fra-1 in hepatocellular carcinoma patients after curative resection. Fra-1 expression was investigated using a combination of techniques: immunohistochemistry for 66 samples of hepatocellular carcinoma and quantitative real-time polymerase chain reaction and western blotting assays for 19 matched hepatocellular carcinoma specimens. Fra-1 was present in 38 of 66 (57.6%) tumor tissues, with intense staining in the nuclei. There was also positive staining in 14 of 66 (21.2%) adjacent peritumoral tissues, with weak staining in the cytoplasm. Quantitative real-time polymerase chain reaction and western blotting assays confirmed higher expression of Fra-1 messenger RNA and Fra-1 protein in tumor tissues than adjacent non-tumor tissues for 19 hepatocellular carcinoma samples (p < 0.001). Positive expression of Fra-1 was significantly related to vascular invasion and serum alpha-fetoprotein. Kaplan-Meier survival analysis found that overexpressed Fra-1 was correlated with poor overall survival and disease-free survival. Multivariate analysis identified Fra-1 as an independent prognostic factor. Fra-1 may be involved in the progress of hepatocellular carcinoma and could be a promising molecular candidate in the diagnosis and treatment of hepatocellular carcinoma.

Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis.

PubMed

Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

2003-01-01

To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive.

Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis

PubMed Central

Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

2003-01-01

Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268

Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

PubMed

Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

2015-08-01

HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Kinetic Analysis for the Multistep Profiles of Organic Reactions: Significance of the Conformational Entropy on the Rate Constants of the Claisen Rearrangement.

PubMed

Sumiya, Yosuke; Nagahata, Yutaka; Komatsuzaki, Tamiki; Taketsugu, Tetsuya; Maeda, Satoshi

2015-12-03

The significance of kinetic analysis as a tool for understanding the reactivity and selectivity of organic reactions has recently been recognized. However, conventional simulation approaches that solve rate equations numerically are not amenable to multistep reaction profiles consisting of fast and slow elementary steps. Herein, we present an efficient and robust approach for evaluating the overall rate constants of multistep reactions via the recursive contraction of the rate equations to give the overall rate constants for the products and byproducts. This new method was applied to the Claisen rearrangement of allyl vinyl ether, as well as a substituted allyl vinyl ether. Notably, the profiles of these reactions contained 23 and 84 local minima, and 66 and 278 transition states, respectively. The overall rate constant for the Claisen rearrangement of allyl vinyl ether was consistent with the experimental value. The selectivity of the Claisen rearrangement reaction has also been assessed using a substituted allyl vinyl ether. The results of this study showed that the conformational entropy in these flexible chain molecules had a substantial impact on the overall rate constants. This new method could therefore be used to estimate the overall rate constants of various other organic reactions involving flexible molecules.

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Hybrid quantum chemical studies for the methanol formation reaction assisted by the proton transfer mechanism in supercritical water: CH3Cl+nH2O-->CH3OH+HCl+(n-1)H2O

NASA Astrophysics Data System (ADS)

Hori, T.; Takahashi, H.; Nitta, T.

2003-10-01

The proton transfer along the chain of hydrogen bonds is involved in many chemical reactions in aqueous solution and known to play a decisive role. We have performed the hybrid quantum chemical simulations for the methanol formation reaction catalyzed by the proton transfer mechanism [CH3Cl+nH2O→CH3OH+HCl+(n-1)H2O, n=3] in supercritical water (SCW) to investigate the role of water solvent on the reaction. In the simulation, the electronic state of the chemically active solutes (CH3Cl+3H2O) has been determined quantum mechanically, while the static water solvent has been represented by a classical model. The activation free energy for the water-catalytic reaction in SCW has been found to be 9.6 kcal/mol, which is much lower than that in the gas phase (29.2 kcal/mol). The fractional charge analysis has revealed that the notable charge separation in the solute complex takes place at the transition state (TS) and the resulting huge dipole gives rise to the considerable stabilization of the TS as compared to the reactant. It has been shown that the reaction assisted by the proton transfer mechanism is energetically much favored than the ionic SN2 reaction (CH3Cl+OH-→CH3OH+Cl-, 18.8 kcal/mol). The present calculations suggest that the proton migrations through the chain of hydrogen bonds can be regarded as a probable candidate responsible for the anomalous reactivities observed in SCW.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Quantitation of cytokine mRNA expression as an endpoint for prediction and diagnosis of xenobiotic-induced hypersensitivity reactions.

PubMed

Gaspard, I; Kerdine, S; Pallardy, M; Lebrec, H

1999-09-01

Xenobiotic-induced hypersensitivity reactions are immune-mediated effects that involve specific antibodies and/or effector and regulatory T lymphocytes. Cytokines are key mediators of such responses and must be considered as possible endpoints for predicting sensitizing potency of drugs and chemicals, as well as for helping diagnosis of allergy. Detecting cytokine production at the protein level has been shown to not be always sensitive enough. This paper describes three examples of the utilization of semiquantitative or competitive reverse transcription polymerase chain reaction analysis of interleukin-4, interferon gamma, and interleukin-1beta mRNAs as endpoints for assessing T-cell or dendritic cell responses to sensitizing drugs (beta-lactam antibiotics) or chemicals (dinitrochlorobenzene). Copyright 1999 Academic Press.

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Chromosome rearrangements in canine fibrosarcomas.

PubMed

Sargan, D R; Milne, B S; Hernandez, J Aguirre; O'Brien, P C M; Ferguson-Smith, M A; Hoather, T; Dobson, J M

2005-01-01

We have previously reported the use of six- and seven-color paint sets in the analysis of canine soft tissue sarcomas. Here we combine this technique with flow sorting of translocation chromosomes, reverse painting, and polymerase chain reaction (PCR) analysis of the gene content of the reverse paint in order to provide a more detailed analysis of cytogenetic abnormalities in canine tumors. We examine two fibrosarcomas, both from female Labrador retrievers, and show abnormalities in chromosomes 11 and 30 in both cases. Evidence of involvement of TGFBR1 is presented for one tumor.

Rapid, direct extraction of DNA from soils for PCR analysis using polyvinylpolypyrrolidone spin columns.

PubMed

Berthelet, M; Whyte, L G; Greer, C W

1996-04-15

Polyvinylpolypyrrolidone spin columns were used to rapidly purify crude soil DNA extracts from humic materials for polymerase chain reaction (PCR) analysis. The PCR detection limit for the tfdC gene, encoding chlorocatechol dioxygenase from the 2,4-dichlorophenoxyacetic acid degradation pathway, was 10(1)-10(2) cells/g soil in inoculated soils. The procedure could be applied to the amplification of biodegradative genes from indigenous microbial populations from a wide variety of soil types, and the entire analysis could be performed within 8 h.

The biomechanical and perceptual influence of chain resistance on the performance of the olympic clean.

PubMed

Berning, Joseph M; Coker, Cheryl A; Briggs, Doug

2008-03-01

Proponents of chain training suggest that using chains hung from the ends of barbells rather than using conventional barbells alone enhances strength, power, and neuromuscular adaptations. The purpose of this study was to determine whether a conventional barbell with chains compared to a conventional barbell without chains would affect the performance of an Olympic Clean. The subjects were also asked regarding their perception of how chains affected their lifting. Four male and 3 female competitive weightlifters who used chains as part of their training participated in the study. The testing protocol compared the subjects' lifting 80% and 85% of their 1 repetition maximum (1RM) using conventional barbells and their lifting 80% and 85% of their 1RM using chains (75% conventional barbells + 5% chains and 80% conventional barbells + 5% chains, respectively). Video analysis evaluated the bar's vertical displacement and velocity and the rate of force production. Vertical ground reaction forces for the first-pull, unweighting, and second-pull phases of the lift were evaluated by using a force plate. After testing, the subjects completed a 2-item questionnaire asking individual perception of the effects of the chains. The results showed no significant difference for condition for any of the variables examined. In contrast, all subjects perceived that the chains required a greater effort. In conclusion, the results indicated that the addition of chains provided no greater value over lifting conventional barbells alone in the performance of the Olympic Clean, although the subjects perceived the chains to have a positive effect.

Polymerase chain reaction analysis for viruses in paraffin-embedded myocardium from dogs with dilated cardiomyopathy or myocarditis.

PubMed

Maxson, T R; Meurs, K M; Lehmkuhl, L B; Magnon, A L; Weisbrode, S E; Atkins, C E

2001-01-01

To perform polymerase chain reaction (PCR) analysis on paraffin-embedded myocardium from dogs with dilated cardiomyopathy (DCM) and dogs with myocarditis to screen for canine parvovirus, adenovirus types 1 and 2, and herpesvirus. Myocardial specimens from 18 dogs with an antemortem diagnosis of DCM and 9 dogs with a histopathologic diagnosis of myocarditis were evaluated. Paraffin-embedded myocardial specimens were screened for viral genome by PCR analysis. Positive-control specimens were developed from cell cultures as well as paraffin-embedded tissue specimens from dogs with clinical and histopathologic diagnoses of viral infection with canine parvovirus, adenovirus types 1 and 2, and herpesvirus. The histologic characteristics of all myocardial specimens were classified regarding extent, location, and type of inflammation and fibrosis. Canine adenovirus type 1 was amplified from 1 specimen from a dog with DCM. Canine parvovirus, adenovirus type 2, and herpesvirus were not amplified from any myocardial specimens. Histologic analysis of specimens from dogs with DCM revealed variable amounts of fibrosis; myocardial inflammation was observed in 1 affected dog. Histopathologic analysis of specimens from dogs with myocarditis disclosed variable degrees of inflammation and fibrosis. Viral agents canine parvovirus, adenovirus types 1 and 2, and herpesvirus are not commonly associated with DCM or active myocarditis in dogs. Additional studies evaluating for nucleic acid from viruses that less commonly affect dogs or different types of infectious agents may be warranted to gain insight into the cause of DCM and myocarditis in dogs.

Rectal Lymphogranuloma Venereum in HIV-infected Patients Can Mimic Lymphoma.

PubMed

Crickx, Etienne; Meignin, Véronique; Gérard, Laurence; Plantier-Colcher, Isabelle; Walker-Combrouze, Francine; Boutboul, David; Galicier, Lionel; Fieschi, Claire; Oksenhendler, Eric

2016-01-01

An outbreak of rectal lymphogranuloma venereum (LGV) has been reported since 2003 in men who have sex with men, most of them being infected with human immunodeficiency virus. In these patients, unusual clinical presentations such as rectal tumor or intense lymphoproliferation on rectal biopsies may lead to an erroneous diagnosis of aggressive non-Hodgkin lymphoma. Three patients were referred to our center for the management of rectal B-cell non-Hodgkin lymphoma on the basis of a rectal pathologic specimen showing intense lymphoproliferation, the very suspect of lymphoma. Because of anamnesis of anal intercourses and venereal diseases, additional study revealed that all 3 had a positive Chlamydia trachomatis polymerase chain reaction on the rectal biopsy specimen. Rectal LGV was therefore considered and successfully treated with antibiotics. We propose that all patients presenting with a suspected rectal lymphoma should have a careful anamnesis of sexual behavior and a specific detection of C. trachomatis using polymerase chain reaction analysis on biopsy specimen to rule out the possibility of rectal LGV.

[The implementation of polymerase chain reaction technique: the real time to reveal and differentiate the viruses of human papilloma of high carcinogenic risk].

PubMed

Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A

2011-07-01

The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.

Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

PubMed

Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

2017-09-01

To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

PubMed

Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

2017-01-01

To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

Allele and genotype frequencies of polymorphisms in cytokine genes in ethnic Russian individuals from Moscow, Russia.

PubMed

Shadrina, Alexandra; Voronina, Elena; Zolotukhin, Igor; Filipenko, Maxim

2017-02-01

Two hundred and twenty eight ethnic Russian individuals from Moscow, Russia, were genotyped at 14 single nucleotide polymorphisms CCL2 A-2578G; VEGFA C-2578A, G-634C, and C+936T; TNF G+419A and G-308A; IL1A G-889A; IL1RN T+1018C; IL6G-174C and G-572C; IFNG T+874A; IL1B C-511T; IL10 A+1082G; TGFB1 C-509T. Genotypes were determined using real-time polymerase chain reaction with TaqMan probes and polymerase chain reaction followed by melting analysis of dual-labeled probe. Genotype distribution was in accordance with Hardy-Weinberg equilibrium for all studied polymorphisms. Genotype data are available in the Allele Frequencies Net Database under identifier AFND 3367 and the population name "Russia Moscow Cytokine". Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

The Collaborative Ocular Tuberculosis Study (COTS)-1 Report 3: Polymerase Chain Reaction in the Diagnosis and Management of Tubercular Uveitis: Global Trends.

PubMed

Agarwal, Aniruddha; Agrawal, Rupesh; Gunasekaran, Dinesh Visva; Raje, Dhananjay; Gupta, Bhaskar; Aggarwal, Kanika; Murthy, Somasheila L; Westcott, Mark; Chee, Soon Phaik; Mccluskey, Peter; Su Ling, Ho; Teoh, Stephen; Cimino, Luca; Biswas, Jyotirmay; Narain, Shishir; Agarwal, Manisha; Mahendradas, Padmamalini; Khairallah, Moncef; Jones, Nicholas; Tugal-Tutkun, Ilknur; Babu, Kalpana; Basu, Soumayava; Carreño, Ester; Lee, Richard; Al-Dhibi, Hassan; Bodaghi, Bahram; Invernizzi, Alessandro; Goldstein, Debra A; Herbort, Carl P; Barisani-Asenbauer, Talin; González-López, Julio J; Androudi, Sofia; Bansal, Reema; Moharana, Bruttendu; Mahajan, Sarakshi; Esposti, Simona; Tasiopoulou, Anastasia; Nadarajah, Sengal; Agarwal, Mamta; Abraham, Sharanya; Vala, Ruchi; Singh, Ramandeep; Sharma, Aman; Sharma, Kusum; Zierhut, Manfred; Kon, Onn Min; Cunningham, Emmett; Nguyen, Quan Dong; Pavesio, Carlos; Gupta, Vishali

2017-12-20

To analyze the role of polymerase chain reaction (PCR) of ocular fluids in management of tubercular (TB) anterior, intermediate, posterior, and panuveitis. In Collaborative Ocular Tuberculosis Study (COTS)-1 (25 centers, n = 962), patients with TB-related uveitis were included. 59 patients undergoing PCR of intraocular fluids (18 females; 53 Asian Indians) were included. 59 (6.13%) of COTS-1 underwent PCR analysis. PCR was positive for Mycobacterium TB in 33 patients (23 males; all Asian Indians). 26 patients were PCR negative (18 males). Eight patients with negative PCR had systemic TB. Anti-TB therapy was given in 18 negative and 31 PCR cases. At 1-year follow-up, five patients with positive PCR (15.15%) and three with negative PCR (11.54%) had persistence/worsening of inflammation. Data from COTS-1 suggest that PCR is not commonly done for diagnosing intraocular TB and positive/negative results may not influence management or treatment outcomes in the real world scenario.

Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

PubMed

Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

2018-01-18

Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

Transcriptional Changes That Characterize the Immune Reactions of Leprosy

PubMed Central

Dupnik, Kathryn M.; Bair, Thomas B.; Maia, Andressa O.; Amorim, Francianne M.; Costa, Marcos R.; Keesen, Tatjana S. L.; Valverde, Joanna G.; Queiroz, Maria do Carmo A. P.; Medeiros, Lúcio L.; de Lucena, Nelly L.; Wilson, Mary E.; Nobre, Mauricio L.; Johnson, Warren D.; Jeronimo, Selma M. B.

2015-01-01

Background. Leprosy morbidity is increased by 2 pathologic immune reactions, reversal reaction (RR) and erythema nodosum leprosum (ENL). Methods. To discover host factors related to immune reactions, global transcriptional profiles of peripheral blood mononuclear cells were compared between 11 RR, 11 ENL, and 19 matched control patients, with confirmation by quantitative polymerase chain reaction. Encoded proteins were investigated in skin biopsy specimens by means of immunohistochemistry. Results. There were 275 genes differentially expressed in RR and 517 differentially expressed in ENL on the microarray. Pathway analysis showed immunity-related pathways represented in RR and ENL transcriptional profiles, with the “complement and coagulation” pathway common to both. Interferon γ was identified as a significant upstream regulator of the expression changes for RR and ENL. Immunohistochemical staining of skin lesions showed increased C1q in both RR and ENL. Conclusions. These data suggest a previously underrecognized role for complement in the pathogenesis of both RR and ENL, and we propose new hypotheses for reaction pathogenesis. PMID:25398459

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

{sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd elastic scattering and systematic investigation of elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.

2011-06-15

The elastic scattering cross sections for the reactions {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd at energies above and below the Coulomb barrier are presented to provide a sensitive test for the {alpha}-nucleus optical potential parameter sets. Additional constraints for the optical potential are taken from the analysis of elastic scattering excitation functions at backward angles which are available in literature. Moreover, the variation of the elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chain is investigated by the study of the ratios of the {sup 106,110,116}Cd({alpha},{alpha}){sup 106,110,116}Cd scattering cross sections at E{sub cm{approx_equal}}15.6and18.8 MeV and the ratio of themore » {sup 110}Cd({alpha},{alpha}){sup 110}Cd and {sup 112}Sn({alpha},{alpha}){sup 112}Sn reaction cross sections at E{sub cm{approx_equal}}18.8 MeV, respectively. These ratios are sensitive probes for the {alpha}-nucleus optical potential parametrizations. The potentials under study are a basic prerequisite for the prediction of {alpha}-induced reaction cross sections (e.g., for the calculation of stellar reaction rates in the astrophysical p or {gamma} process).« less

The high-throughput synthesis and phase characterisation of amphiphiles: a sweet case study.

PubMed

Feast, George C; Hutt, Oliver E; Mulet, Xavier; Conn, Charlotte E; Drummond, Calum J; Savage, G Paul

2014-03-03

A new method for the discovery of amphiphiles by using high-throughput (HT) methods to synthesise and characterise a library of galactose- and glucose-containing amphiphilic compounds is presented. The copper-catalysed azide–alkyne cycloaddition (CuAAC) “click” reaction between azide-tethered simple sugars and alkyne-substituted hydrophobic tails was employed to synthesise a library of compounds with systematic variations in chain length and unsaturation in a 24-vial array format. The liquid–crystalline phase behaviour was characterised in a HT manner by using synchrotron small-angle X-ray scattering (SSAXS). The observed structural variation with respect to chain parameters, including chain length and degree of unsaturation, is discussed, as well as hydration effects and degree of hydrogen bonding between head groups. The validity of our HT screening approach was verified by resynthesising a short-chain glucose amphiphile. A separate phase analysis of this compound confirmed the presence of numerous lyotropic liquid–crystalline phases.

Characterization of a novel debranching enzyme from Nostoc punctiforme possessing a high specificity for long branched chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Ji-Hye; Lee, Heeseob; Kim, Young-Wan

2009-01-09

A novel debranching enzyme from Nostoc punctiforme PCC73102 (NPDE) exhibits hydrolysis activity toward both {alpha}-(1,6)- and {alpha}-(1,4)-glucosidic linkages. The action patterns of NPDE revealed that branched chains are released first, and the resulting maltooligosaccharides are then hydrolyzed. Analysis of the reaction with maltooligosaccharide substrates labeled with {sup 14}C-glucose at the reducing end shows that NPDE specifically liberates glucose from the reducing end. Kinetic analyses showed that the hydrolytic activity of NPDE is greatly affected by the length of the substrate. The catalytic efficiency of NPDE increased considerably upon using substrates that can occupy at least eight glycone subsites such asmore » maltononaose and maltooctaosyl-{alpha}-(1,6)-{beta}-cyclodextrin. These results imply that NPDE has a unique subsite structure consisting of -8 to +1 subsites. Given its unique subsite structure, side chains shorter than maltooctaose in amylopectin were resistant to hydrolysis by NPDE, and the population of longer side chains was reduced.« less

Molecular Characterization and Functional Analysis of a Ferritin Heavy Chain Subunit from the Eri-Silkworm, Samia cynthia ricini

PubMed Central

Yu, Hai-Zhong; Zhang, Shang-Zhi; Ma, Yan; Fei, Dong-Qiong; Li, Bing; Yang, Li-Ang; Wang, Jie; Li, Zhen; Muhammad, Azharuddin; Xu, Jia-Ping

2017-01-01

Ferritins are conserved iron-binding proteins that are primarily involved in iron storage, detoxification and the immune response. Despite the importance of ferritin in organisms, little is known about their roles in the eri-silkworm (Samia cynthia ricini). We previously identified a ferritin heavy chain subunit named ScFerHCH in the S. c. ricini transcriptome database. The full-length S. c. ricini ferritin heavy chain subunit (ScFerHCH) was 1863 bp and encoded a protein of 231 amino acids with a deduced molecular weight of 25.89 kDa. Phylogenetic analysis revealed that ScFerHCH shared a high amino acid identity with the Bombyx mori and Danaus plexippus heavy chain subunits. Higher ScFerHCH expression levels were found in the silk gland, fat body and midgut of S. c. ricini by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blotting. Injection of Staphylococcus aureus and Pseudomonas aeruginosa was associated with an upregulation of ScFerHCH in the midgut, fat body and hemolymph, indicating that ScFerHCH may contribute to the host’s defense against invading pathogens. In addition, the anti-oxidation activity and iron-binding capacity of recombinant ScFerHCH protein were examined. Taken together, our results suggest that the ferritin heavy chain subunit from eri-silkworm may play critical roles not only in innate immune defense, but also in organismic iron homeostasis. PMID:29036914

Oligomerization of uridine phosphorimidazolides on montmorillonite: a model for the prebiotic synthesis of RNA on minerals

NASA Technical Reports Server (NTRS)

Ding, P. Z.; Kawamura, K.; Ferris, J. P.

1996-01-01

The 5'-phosphorimidazolide of uridine reacts on Na(+)-montmorillonite 22A in aqueous solution to give oligomers as long as 7 mers. The maximum chain length increases to 9 mers and the overall oligomer yield increases when 9:1 ImpU, A5' ppA mixtures react under the same conditions. The oligomer yield and maximum chain length decreases with the structure of the added pyrophosphate in the order A5' ppA > A5' ppU > U5' ppU. Structure analysis of individual oligomer fractions was performed by selective enzymatic hydrolyses followed by HPLC analysis of the products. The regioselectivity for 3',5'-bond formation is 80-90% in the 9:1 ImpU, A5' ppA reaction, a percentage comparable to that observed in the 9:1 ImpA, A5' ppA reaction. Oligomerization of ImpU is inhibited by addition of dA5' ppdA, and MeppA. No oligomers containing A5' ppU were products of the 9:1 ImpU,A5' ppA reaction, a finding consistent with the simple addition of the ImpU to the A5' ppA and not the rearrangement of an ImpU-A5' ppA adduct. Concentrations of lysine or arginine which were close to that of the ImpU did not inhibit oligomer formation. Treatment of Na(+)-montmorillonite with 1 M arginine yielded arginine-montmorillonite, an amino acid-mineral adduct which did not catalyze ImpU oligomerization. Neither the 4-9 mers formed in the 9:1 ImpU, A5' ppA reaction nor the 4-9 mers formed by the base hydrolysis of poly(U) served as templates for the formation of oligo(A)s.

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

PubMed

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

64Cu-DOTATATE PET/MRI for Detection of Activated Macrophages in Carotid Atherosclerotic Plaques: Studies in Patients Undergoing Endarterectomy.

PubMed

Pedersen, Sune Folke; Sandholt, Benjamin Vikjær; Keller, Sune Høgild; Hansen, Adam Espe; Clemmensen, Andreas Ettrup; Sillesen, Henrik; Højgaard, Liselotte; Ripa, Rasmus Sejersten; Kjær, Andreas

2015-07-01

A feature of vulnerable atherosclerotic plaques of the carotid artery is high activity and abundance of lesion macrophages. There is consensus that this is of importance for plaque vulnerability, which may lead to clinical events, such as stroke and transient ischemic attack. We used positron emission tomography (PET) and the novel PET ligand [(64)Cu] [1,4,7,10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid]-d-Phe1,Tyr3-octreotate ((64)Cu-DOTATATE) to specifically target macrophages via the somatostatin receptor subtype-2 in vivo. Ten patients underwent simultaneous PET/MRI to measure (64)Cu-DOTATATE uptake in carotid artery plaques before carotid endarterectomy. (64)Cu-DOTATATE uptake was significantly higher in symptomatic plaque versus the contralateral carotid artery (P<0.001). Subsequently, a total of 62 plaque segments were assessed for gene expression of selected markers of plaque vulnerability using real-time quantitative polymerase chain reaction. These results were compared with in vivo (64)Cu-DOTATATE uptake calculated as the mean standardized uptake value. Univariate analysis of real-time quantitative polymerase chain reaction and PET showed that cluster of differentiation 163 (CD163) and CD68 gene expression correlated significantly but weakly with mean standardized uptake value in scans performed 85 minutes post injection (P<0.001 and P=0.015, respectively). Subsequent multivariate analysis showed that CD163 correlated independently with (64)Cu-DOTATATE uptake (P=0.031) whereas CD68 did not contribute significantly to the final model. The novel PET tracer (64)Cu-DOTATATE accumulates in atherosclerotic plaques of the carotid artery. CD163 gene expression correlated independently with (64)Cu-DOTATATE uptake measured by real-time quantitative polymerase chain reaction in the final multivariate model, indicating that (64)Cu-DOTATATE PET is detecting alternatively activated macrophages. This association could potentially improve noninvasive identification and characterization of vulnerable plaques. © 2015 The Authors.

Homochiral coordination polymers with helixes and metal clusters based on lactate derivatives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Zhong-Xuan, E-mail: xuzhongxuan4201@163.com; Ma, Yu-Lu; Lv, Guo-ling

2017-05-15

Utilizing the lactic acid derivatives (R)-4-(1-carboxyethoxy)benzoic acid (denoted: (R)-H{sub 2}CBA) and (S)-4-(1-carboxyethoxy)benzoic acid (denoted: (S)-H{sub 2}CBA)as chiral linkers to self-assemble with 4, 4′-bipyridine (denoted: BIP) and Cd(II) ions, a couple of three-dimensional homochiral coordination polymers, namely [Cd{sub 3}((R)-CBA){sub 3} (BIP){sub 2}(H{sub 2}O)]·xGuest (1-D) and [Cd{sub 3}((S)-CBA){sub 3}(BIP){sub 2}(H{sub 2}O)]·xGuest (1-L), have been synthesized under solvothermal reaction condition. Single crystal X-ray diffraction analysis reveals the two complexes contain single helical chains based on enantiopure ligands and cadmium clusters. Moreover, some physical characteristics such as PXRD, thermal stability, solid-state circular dichroism (CD) and luminescent were also investigated. - Graphical abstract: Utilizing enantiomericmore » lactic acid derivatives (R)-H{sub 2}CBA and (S)-H{sub 2}CBA to assemble with Cd{sup 2+} ions and ancillary BIP ligands, a couple of 3D homochiral coordination polymers with metal clusters and helical chains have been prepared by hydrothermal reaction. - Highlights: • Chiral lactic acid derivative. • Enantiomeric coordination polymer. • Helical chain. • Trinuclear cadmium cluster.« less

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

PubMed

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

Molecular Detection and Identification of Rickettsia Species in Ixodes pacificus in California

PubMed Central

Phan, Jimmy Ninh; Lu, Casey Roy; Bender, William Garrett; Smoak, Robert Marion

2011-01-01

Abstract We amplified 16S rRNA, gltA, and ompA genes from Ixodes pacificus by polymerase chain reaction. Sequencing, BLAST analysis, and phylogenetic constructions indicated that two Rickettsia phylotypes are present in I. pacificus. While phylotype G021 has high homology to Ixodes scapularis endosymbiotic Rickettsia, phylotype G022 is a deeply branched novel spotted fever group Rickettsia. PMID:21413886

Cryptosporidium canis in Two Mexican Toddlers.

PubMed

González-Díaz, Mariana; Urrea-Quezada, Alejandro; Villegas-Gómez, Isaac; Durazo, María; Garibay-Escobar, Adriana; Hernández, Jesús; Xiao, Lihua; Valenzuela, Olivia

2016-11-01

Cryptosporidium canis is reported for the first time in 2 toddlers in Northwestern Mexico. The 2 toddlers (33 and 34 months old) were symptomatic at diagnosis, presenting diarrhea and fever, and 1 case presented chronic malnutrition. Both toddlers were HIV-negative. C. canis was identified by SspI and VspI restriction enzyme digestion of the 18S rRNA polymerase chain reaction products and confirmed by sequence analysis.

Targeting Conserved Genes in Penicillium Species.

PubMed

Peterson, Stephen W

2017-01-01

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

PubMed

van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

2012-05-01

A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

Nucleophilic Influences and Origin of the SN2 Allylic Effect.

PubMed

Galabov, Boris; Koleva, Gergana; Schaefer, Henry F; Allen, Wesley D

2018-05-27

The potential energy surfaces for the SN2 reactions of allyl and propyl chlorides with 21 anionic and neutral nucleophiles have been studied using ωB97X-D/6-311++G(3df,2pd) computations. The "allylic effect" on SN2 barriers is well manifested for all reactions and ranges between -0.2 and -4.5 kcal mol-1 in the gas phase. Strong correlations of the SN2 net activation barriers with cation affinities, proton affinities, and electrostatic potentials at nuclei (EPN) demonstrate the powerful influence of electrostatics on these reactions. For the reactions of anionic (but not neutral) nucleophiles with allyl chloride, some of the incoming negative charge (0.2% - 18%) migrates into the carbon chains, which may provide some secondary stabilization of the SN2 transition states. Activation strain analysis provides additional insight into the allylic effect by showing that the energy of geometric distortion for the reactants to reach the SN2 transition state (ΔEstrain) is smaller for each allylic reaction in comparison to its propyl analogue. In many cases the interaction energies (ΔEint) between the substrate and nucleophile in this analysis are more favorable for propyl chloride reactions, but this compensation does not overcome the predominant strain energy effect. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

Analysis of the thermal reaction products of para polyphenylene by combined gas chromatography-mass spectrometry

NASA Technical Reports Server (NTRS)

Fewell, L. L.

1976-01-01

Analysis of the volatiles and sublimate produced when para-polyphenylene is pyrolyzed to constant weight under vacuum in the temperature range from 380 to 1000 C indicates that the polymer undergoes thermal degradation in two stages. The first stage involved dehydrohalogenation, which is essentially a curing reaction that produces crosslinking between polyphenylene chains resulting from the loss of chlorine from the polymer in the form of hydrogen chloride. The second stage of the thermal degradation is dehydrogenation because hydrogen is the major volatile species. Increasing amounts of polycyclic aromatic hydrocarbons (phenanthrene and 9, 10 benzphenanthrene) in the sublimate, concomitant with increasing C/H ratios of the polymeric residue with pyrolysis temperature, is consistent with the buildup of polynuclear structures in the polymer matrix.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

NASA Astrophysics Data System (ADS)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Detection of central nervous system leukemia in children with acute lymphoblastic leukemia by real-time polymerase chain reaction.

PubMed

Pine, Sharon R; Yin, Changhong; Matloub, Yousif H; Sabaawy, Hatem E; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M Fevzi; Jayabose, Somasundaram

2005-02-01

Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification.

Detection of Central Nervous System Leukemia in Children with Acute Lymphoblastic Leukemia by Real-Time Polymerase Chain Reaction

PubMed Central

Pine, Sharon R.; Yin, Changhong; Matloub, Yousif H.; Sabaawy, Hatem E.; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M. Fevzi; Jayabose, Somasundaram

2005-01-01

Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification. PMID:15681484

Rheological analysis of irradiated crosslinkable and scissionable polymers used for medical devices under different radiation conditions

NASA Astrophysics Data System (ADS)

Satti, A. J.; Ressia, J. A.; Cerrada, M. L.; Andreucetti, N. A.; Vallés, E. M.

2018-03-01

The effects on different synthetic polymers of distinct types of radiation, gamma rays and electron beam, under different atmospheres are followed by changes in their viscoelastic behavior. Taking into account the two main radioinduced reactions, crosslinking and scissioning of polymeric chains, liquid polydimethylsiloxane has been used as example of crosslinkable polymer and semi crystalline polypropylene as example of scissionable polymer. Propylene - 1-hexene copolymers have been also evaluated, and the effects of both reactions were clearly noticed. Accordingly, samples of those aforementioned polymers have been irradiated with 60Co gamma irradiation in air and under vacuum, and also with electron beam, at similar doses. Sinusoidal dynamic oscillation experiments showed a significant increase in branching and crosslinking reactions when specimens are irradiated under vacuum, while scissioning reactions were observed for the different polymers when irradiation takes place under air with either gamma irradiation or electron beam.

The impact of chimerism in DNA-based forensic sex determination analysis.

PubMed

George, Renjith; Donald, Preethy Mary; Nagraj, Sumanth Kumbargere; Idiculla, Jose Joy; Hj Ismail, Rashid

2013-01-01

Sex determination is the most important step in personal identification in forensic investigations. DNA-based sex determination analysis is comparatively more reliable than the other conventional methods of sex determination analysis. Advanced technology like real-time polymerase chain reaction (PCR) offers accurate and reproducible results and is at the level of legal acceptance. But still there are situations like chimerism where an individual possess both male and female specific factors together in their body. Sex determination analysis in such cases can give erroneous results. This paper discusses the phenomenon of chimerism and its impact on sex determination analysis in forensic investigations.

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

PubMed

Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

2014-02-07

An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

NASA Astrophysics Data System (ADS)

Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

1989-06-01

The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

Genome shuffling of Saccharomyces cerevisiae for enhanced glutathione yield and relative gene expression analysis using fluorescent quantitation reverse transcription polymerase chain reaction.

PubMed

Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming

2016-08-01

Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of genetic diversity of certain species of Piper using RAPD-based molecular markers.

PubMed

Chowdhury, Utpal; Tanti, Bhaben; Rethy, Parakkal; Gajurel, Padma Raj

2014-09-01

The utility of RAPD markers in assessing genetic diversity and phenetic relationships of six different species of Piper from Northeast India was investigated. Polymerase chain reaction (PCR) with four arbitrary 10-mer oligonucleotide primers applied to the six species produced a total of 195 marker bands, of which, 159 were polymorphic. On average, six RAPD fragments were amplified per reaction. In the UPGMA phenetic dendrogram based on Jaccard's coefficient, the different accessions of Piper showed a high level of genetic variation. This study may be useful in identifying diverse genetic stocks of Piper, which may then be conserved on a priority basis.

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

PubMed Central

Ekstedt, Richard D.; Stollerman, Gene H.

1960-01-01

Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

PubMed

Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

2014-05-28

3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

Intact carbohydrate structures as part of the melanoidin skeleton.

PubMed

Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

2002-03-27

Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

Characterization of phenol and cresol biodegradation by compound-specific stable isotope analysis.

PubMed

Wei, Xi; Gilevska, Tetyana; Wetzig, Felix; Dorer, Conrad; Richnow, Hans-Hermann; Vogt, Carsten

2016-03-01

Microbial degradation of phenol and cresols can occur under oxic and anoxic conditions by different degradation pathways. One recent technique to take insight into reaction mechanisms is compound-specific isotope analysis (CSIA). While enzymes and reaction mechanisms of several degradation pathways have been characterized in (bio)chemical studies, associated isotope fractionation patterns have been rarely reported, possibly due to constraints in current analytical methods. In this study, carbon enrichment factors and apparent kinetic isotope effects (AKIEc) of the initial steps of different aerobic and anaerobic phenol and cresols degradation pathways were analyzed by isotope ratio mass spectrometry connected with liquid chromatography (LC-IRMS). Significant isotope fractionation was detected for aerobic ring hydroxylation, anoxic side chain hydroxylation, and anoxic fumarate addition, while anoxic carboxylation reactions produced small and inconsistent fractionation. The results suggest that several microbial degradation pathways of phenol and cresols are detectable in the environment by CSIA. Copyright © 2015 Elsevier Ltd. All rights reserved.

Parallel replica dynamics method for bistable stochastic reaction networks: Simulation and sensitivity analysis

NASA Astrophysics Data System (ADS)

Wang, Ting; Plecháč, Petr

2017-12-01

Stochastic reaction networks that exhibit bistable behavior are common in systems biology, materials science, and catalysis. Sampling of stationary distributions is crucial for understanding and characterizing the long-time dynamics of bistable stochastic dynamical systems. However, simulations are often hindered by the insufficient sampling of rare transitions between the two metastable regions. In this paper, we apply the parallel replica method for a continuous time Markov chain in order to improve sampling of the stationary distribution in bistable stochastic reaction networks. The proposed method uses parallel computing to accelerate the sampling of rare transitions. Furthermore, it can be combined with the path-space information bounds for parametric sensitivity analysis. With the proposed methodology, we study three bistable biological networks: the Schlögl model, the genetic switch network, and the enzymatic futile cycle network. We demonstrate the algorithmic speedup achieved in these numerical benchmarks. More significant acceleration is expected when multi-core or graphics processing unit computer architectures and programming tools such as CUDA are employed.

High-throughput multiplex HLA-typing by ligase detection reaction (LDR) and universal array (UA) approach.

PubMed

Consolandi, Clarissa

2009-01-01

One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.

Vulcanization characteristics and dynamic mechanical behavior of natural rubber reinforced with silane modified silica.

PubMed

Chonkaew, Wunpen; Minghvanish, Withawat; Kungliean, Ulchulee; Rochanawipart, Nutthaya; Brostow, Witold

2011-03-01

Two silane coupling agents were used for hydrolysis-condensation reaction modification of nanosilica surfaces. The surface characteristics were analyzed using Fourier transform infrared spectroscopy (FTIR). The vulcanization kinetics of natural rubber (NR) + silica composites was studied and compared to behavior of the neat NR using differential scanning calorimetry (DSC) in the dynamic scan mode. Dynamic mechanical analysis (DMA) was performed to evaluate the effects of the surface modification. Activation energy E(a) values for the reaction are obtained. The presence of silica, modified or otherwise, inhibits the vulcanization reaction of NR. The neat silica containing system has the lowest cure rate index and the highest activation energy for the vulcanization reaction. The coupling agent with longer chains causes more swelling and moves the glass transition temperature T(g) downwards. Below the glass transition region, silica causes a lowering of the dynamic storage modulus G', a result of hindering the cure reaction. Above the glass transition, silica-again modified or otherwise-provides the expected reinforcement effect.

Biodiesel production from triolein and short chain alcohols through biocatalysis.

PubMed

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

DOEpatents

Fermi, E.; Leverett, M.C.

1957-11-12

This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

High-Resolution Mass Spectrometric Analysis of Secondary Organic Aerosol Produced by Ozonation of Limonene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walser, Maggie L.; Dessiaterik, Yury; Laskin, Julia

2008-02-08

Secondary organic aerosol (SOA) particles formed from the ozone-initiated oxidation of limonene are characterized by high-resolution electrospray ionization mass spectrometry in both the positive and negative ion modes. The mass spectra reveal a large number of both monomeric (m/z < 300) and oligomeric (m/z > 300) products of oxidation. A combination of high resolving power (m/Δm ~60,000) and Kendrick mass defect analysis makes it possible to unambiguously determine the composition for hundreds of individual compounds in SOA samples. Van Krevelen analysis shows that the SOA compounds are heavily oxidized, with average O:C ratios of 0.43 and 0.50 determined from themore » positive and negative ion mode spectra, respectively. An extended reaction mechanism for the formation of the first generation SOA molecular components is proposed. The mechanism includes known isomerization and addition reactions of the carbonyl oxide intermediates generated during the ozonation of limonene, and numerous isomerization pathways for alkoxy radicals resulting from the decomposition of unstable carbonyl oxides. The isomerization reactions yield numerous products with a progressively increasing number of alcohol and carbonyl groups, whereas C-C bond scission reactions in alkoxy radicals shorten the carbon chain. Together these reactions yield a large number of isomeric products with broadly distributed masses. A qualitative agreement is found between the number and degree of oxidation of the predicted and measured reaction products in the monomer range.« less

Marzipan: polymerase chain reaction-driven methods for authenticity control.

PubMed

Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

2011-11-23

According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

PubMed Central

Latha, C.; Anu, C. J.; Ajaykumar, V. J.; Sunil, B.

2017-01-01

Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR) method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349), chicken (n=325), pork (n=310), chevon (n=50), and meat products (n=100) were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7%) was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost. PMID:28919685

Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

NASA Technical Reports Server (NTRS)

Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

1998-01-01

Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

Identification and analysis of Escherichia albertii isolates from chicken rinses using polymerase chain reaction, pulse field gel electrophoresis and sequencing a 610bp section of the rpoB gene

USDA-ARS?s Scientific Manuscript database

Escherichia albertii is a recently described organism that has been associated with diarrhea in humans and with infection and death in birds. It has also been found in healthy birds. E. albertii has been found in two healthy chickens from Australia and a dead chicken from Washington state. The pr...

Controlled Synthesis of Polyenes by Catalytic Methods. Progress Report, December 1, 1992 -- November 30, 1993

DOE R&D Accomplishments Database

Schrock, R. R.

1993-12-01

Four studies are reported: living cyclopolymerization of diethyl dipropargylmalonate by Mo(CH-t-Bu)(NAr)[OCMe(CF{sub 3}){sub 2}]{sub 2} in dimethoxyethane, effect of chain length on conductivity of polyacetylene, nonlinear optical analysis of a series of triblock copolymers containing model polyenes, and synthesis of bifunctional hexafluoro-t-butoxide Mo species and their use as initiators in ROMP reactions.

Chloroplast and nuclear DNA studies in a few members of the Brassica oleracea L. group using PCR-RFLP and ISSR-PCR markers: a population genetic analysis.

PubMed

Panda, S; Martín, J P; Aguinagalde, I

2003-04-01

A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude.

Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

PubMed

Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

1994-02-01

We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

Commercial enzyme-linked immunosorbent assay versuspolymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis.

PubMed

Brasil, Pedro Emmanuel Alvarenga Americano do; Castro, Rodolfo; Castro, Liane de

2016-01-01

Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects.

Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

PubMed Central

Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

1999-01-01

WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

PubMed Central

2011-01-01

In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV), a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP). We selected an 829 bp fragment of the nucleoprotein (N) gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively. PMID:21352564

Nested polymerase chain reaction on blood clots for gene encoding 56 kDa antigen and serology for the diagnosis of scrub typhus.

PubMed

Prakash, J A J; Kavitha, M L; Mathai, E

2011-01-01

Scrub typhus is a zoonotic illness endemic in the Asia-Pacific region. Early diagnosis and appropriate management contribute significantly to preventing adverse outcomes including mortality. Serology is widely used for diagnosing scrub typhus. Recent reports suggest that polymerase chain reaction (PCR) could be a rapid and reliable alternative. This study assessed the utility of these tests for scrub typhus diagnosis. Nested PCR to detect the 56 kDa antigen gene of O. tsutsugamushi was performed on blood clots from 87 individuals with clinically suspected scrub typhus. Weil-Felix test and scrub typhus IgM ELISA were performed on serum samples from the same patients. As a gold standard reference test was not available, latent class analysis (LCA) was used to assess the performance of the three tests. The LCA analysis showed the sensitivity of Weil-Felix test, IgM ELISA and PCR to be 59%, 100% and 58% respectively. The specificity of ELISA was only 73%, whereas those of the Weil-Felix test and PCR were 94% and 100% respectively. Nested PCR using blood clots while specific, lacked sensitivity as compared to IgM ELISA. In resource-poor settings Weil-Felix test still remains valuable despite its moderate sensitivity.

Commercial enzyme-linked immunosorbent assay versus polymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

PubMed Central

do Brasil, Pedro Emmanuel Alvarenga Americano; Castro, Rodolfo; de Castro, Liane

2016-01-01

Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects. PMID:26814640

Assessing the cost of implementing the 2011 Society of Obstetricians and Gynecologists of Canada and Canadian College of Medical Genetics practice guidelines on the detection of fetal aneuploidies.

PubMed

Lilley, Margaret; Hume, Stacey; Karpoff, Nina; Maire, Georges; Taylor, Sherry; Tomaszewski, Robert; Yoshimoto, Maisa; Christian, Susan

2017-09-01

The Society of Obstetricians and Gynecologists of Canada and the Canadian College of Medical Genetics published guidelines, in 2011, recommending replacement of karyotype with quantitative fluorescent polymerase chain reaction when prenatal testing is performed because of an increased risk of a common aneuploidy. This study's objective is to perform a cost analysis following the implementation of quantitative fluorescent polymerase chain reaction as a stand-alone test. A total of 658 samples were received between 1 April 2014 and 31 August 2015: 576 amniocentesis samples and 82 chorionic villi sampling. A chromosome abnormality was identified in 14% (93/658) of the prenatal samples tested. The implementation of the 2011 Society of Obstetricians and Gynecologists of Canada and the Canadian College of Medical Genetics guidelines in Edmonton and Northern Alberta resulted in a cost savings of $46 295.80. The replacement of karyotype with chromosomal microarray for some indications would be associated with additional costs. The implementation of new test methods may provide cost savings or added costs. Cost analysis is important to consider during the implementation of new guidelines or technologies. © 2017 John Wiley & Sons, Ltd. © 2017 John Wiley & Sons, Ltd.

Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

PubMed

Xia, Minghui; Qi, Qingguo

2013-01-01

We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

Selection of single chain antibody fragments binding to the extracellular domain of 4-1BB receptor by phage display technology.

PubMed

Bagheri, Salman; Yousefi, Mehdi; Safaie Qamsari, Elmira; Riazi-Rad, Farhad; Abolhassani, Mohsen; Younesi, Vahid; Dorostkar, Ruhollah; Movassaghpour, Ali Akbar; Sharifzadeh, Zahra

2017-03-01

The 4-1BB is a surface glycoprotein that pertains to the tumor necrosis factor-receptor family. There is compelling evidence suggesting important roles for 4-1BB in the immune response, including cell activation and proliferation and also cytokine induction. Because of encouraging results of different agonistic monoclonal antibodies against 4-1BB in the treatment of cancer, infectious, and autoimmune diseases, 4-1BB has been suggested as an attractive target for immunotherapy. In this study, single chain variable fragment phage display libraries, Tomlinson I+J, were screened against specific synthetic oligopeptides (peptides I and II) designed from 4-1BB extracellular domain. Five rounds of panning led to selection of four 4-1BB specific single chain variable fragments (PI.12, PI.42, PII.16, and PII.29) which showed specific reaction to relevant peptides in phage enzyme-linked immunosorbent assay. The selected clones were successfully expressed in Escherichia coli Rosetta-gami 2, and their expression was confirmed by western blot analysis. Enzyme-linked immunosorbent assay experiments indicated that these antibodies were able to specifically recognize 4-1BB without any cross-reactivity with other antigens. Flow cytometry analysis demonstrated an acceptable specific binding of the single chain variable fragments to 4-1BB expressed on CCRF-CEM cells, while no binding was observed with an irrelevant antibody. Anti-4-1BB single chain variable fragments enhanced surface CD69 expression and interleukin-2 production in stimulated CCRF-CEM cells which confirmed the agonistic effect of the selected single chain variable fragments. The data from this study have provided a rationale for further experiments involving the biological functions of anti-4-1BB single chain variable fragments in future studies.

Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

PubMed

Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

2008-04-01

Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

PubMed

Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

2017-05-02

Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

PubMed Central

Brownholland, David P.

2017-01-01

A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

METHOD OF OPERATING NUCLEAR REACTORS

DOEpatents

Untermyer, S.

1958-10-14

A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

PubMed

Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

2016-05-01

A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

High-sensitivity analysis of naturally occurring sugar chains, using a novel fluorescent linker molecule.

PubMed

Sato, Masaki; Ito, Yuji; Arima, Naomichi; Baba, Masanori; Sobel, Michael; Wakao, Masahiro; Suda, Yasuo

2009-07-01

To analyse the binding of sugar chains to proteins, viruses and cells, the surface plasmon resonance (SPR) technique is very convenient and effective because it is a real-time, non-destructive detection system. Key to this method is linker compounds for immobilization of the sugar chains to the gold-coated chip for SPR. Also, well-designed fluorescent labelling reagents are essential when analysing the structure of trace amounts of sugar chains derived from natural sources, such as glycoproteins on the surface of specific cells. In this report, we developed a novel linker molecule, named 'f-mono', which has both of these properties: simple immobilization chemistry and a fluorescent label. Since the molecule contains a 2,5-diaminopyridyl group and a thioctic acid group, conjugation with sugar chains can be achieved using the well-established reductive amination reaction. This conjugate of sugar chain and fluorescent linker (fluorescent ligand-conjugate, FLC) has fluorescent properties (ex. 335 nm, em. 380 nm), and as little as 1 microg of FLC can be easily purified using HPLC with a fluorescent detector. MS and MS/MS analysis of the FLC is also possible. As a +2 Da larger MS peak ([M + H + 2](+) ion) was always associated with the theoretical MS peak ([M + H](+)) (due to the reduction of the thioctic acid moiety), the MS peaks of the FLC were easily found, even using unfractionated crude samples. Immobilization of the FLC onto gold-coated chips, and their subsequent SPR analyses were successively accomplished, as had been performed previously using non-fluorescent ligand conjugates.

Effects of aging on the structural, mechanical, and thermal properties of the silicone rubber current transformer insulation bushing for a 500 kV substation.

PubMed

Wang, Zhigao; Zhang, Xinghai; Wang, Fangqiang; Lan, Xinsheng; Zhou, Yiqian

2016-01-01

In order to analyze the cracking and aging reason of the silicone rubber current transformer (CT) insulation bushing used for 8 years from a 500 kV alternating current substation, characteristics including Fourier transform infrared (FTIR) spectroscopy, mechanical properties analysis, hardness, and thermo gravimetric analysis have been carried out. The FTIR results indicated that the external surface of the silicone rubber CT insulation bushing suffered from more serious aging than the internal part, fracture of side chain Si-C bond was much more than the backbone. Mechanical properties and thermal stability results illustrated that the main aging reasons were the breakage of side chain Si-C bond and the excessive cross-linking reaction of the backbone. This study can provide valuable basis for evaluating degradation mechanism and aging state of the silicone rubber insulation bushing in electric power field.

Clinical manifestation and molecular genetic characterization of MYH9 disorders.

PubMed

Provaznikova, Dana; Geierova, Vera; Kumstyrova, Tereza; Kotlin, Roman; Mikulenkova, Dana; Zurkova, Kamila; Matoska, Vaclav; Hrachovinova, Ingrid; Rittich, Simon

2009-08-01

Currently, the May-Hegglin anomaly (MHA), Sebastian (SBS), Fechtner (FTNS) and Epstein (EPS) syndrome are considered to be distinct clinical manifestations of a single disease caused by mutations of the MYH9 gene encoding the heavy chain of non-muscle myosin IIA (NMMHC-IIA). Manifestations of these disorders include giant platelets, thrombocytopenia and combinations of the presence of granulocyte inclusions, deafness, cataracts and renal failure. We examined 15 patients from 10 unrelated families on whom we performed immunostaining of NMMHC-IIA in blood samples. Polymerase chain reaction (PCR) analysis of selected exons of the MYH9 gene revealed mutations in nine samples with one novel mutation. Results of fluorescence and mutational analysis were compared with clinical manifestations of the MYH9 disorder. We also determined the number of glycoprotein sites on the surface of platelets. Most patients had an increased number of glycoproteins, which could be due to platelet size.

Controlled Shape Memory Behavior of a Smectic Main-Chain Liquid Crystalline Elastomer

DOE PAGES

Li, Yuzhan; Pruitt, Cole; Rios, Orlando; ...

2015-04-10

Here, we describe how a smectic main-chain liquid crystalline elastomer (LCE), with controlled shape memory behavior, is synthesized by polymerizing a biphenyl-based epoxy monomer with an aliphatic carboxylic acid curing agent. Microstructures of the LCEs, including their liquid crystallinity and cross-linking density, are modified by adjusting the stoichiometric ratio of the reactants to tailor the thermomechanical properties and shape memory behavior of the material. Thermal and liquid crystalline properties of the LCEs, characterized using differential scanning calorimetry and dynamic mechanical analysis, and structural analysis, performed using small-angle and wide-angle X-ray scattering, show that liquid crystallinity, cross-linking density, and network rigiditymore » are strongly affected by the stoichiometry of the curing reaction. With appropriate structural modifications it is possible to tune the thermal, dynamic mechanical, and thermomechanical properties as well as the shape memory and thermal degradation behavior of LCEs.« less

Controlled Shape Memory Behavior of a Smectic Main-Chain Liquid Crystalline Elastomer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yuzhan; Pruitt, Cole; Rios, Orlando

Here, we describe how a smectic main-chain liquid crystalline elastomer (LCE), with controlled shape memory behavior, is synthesized by polymerizing a biphenyl-based epoxy monomer with an aliphatic carboxylic acid curing agent. Microstructures of the LCEs, including their liquid crystallinity and cross-linking density, are modified by adjusting the stoichiometric ratio of the reactants to tailor the thermomechanical properties and shape memory behavior of the material. Thermal and liquid crystalline properties of the LCEs, characterized using differential scanning calorimetry and dynamic mechanical analysis, and structural analysis, performed using small-angle and wide-angle X-ray scattering, show that liquid crystallinity, cross-linking density, and network rigiditymore » are strongly affected by the stoichiometry of the curing reaction. With appropriate structural modifications it is possible to tune the thermal, dynamic mechanical, and thermomechanical properties as well as the shape memory and thermal degradation behavior of LCEs.« less

Fatal septicemia caused by the zoonotic bacterium Streptococcus iniae during an outbreak in Caribbean reef fish.

PubMed

Keirstead, N D; Brake, J W; Griffin, M J; Halliday-Simmonds, I; Thrall, M A; Soto, E

2014-09-01

An outbreak of Streptococcus iniae occurred in the early months of 2008 among wild reef fish in the waters of the Federation of St Kitts and Nevis, lasting almost 2 months. Moribund and dead fish were collected for gross, histological, bacteriological, and molecular analysis. Necropsy findings included diffuse fibrinous pericarditis, pale friable livers, and serosal petechiation. Cytological and histological analysis revealed granulocytic and granulomatous inflammation with abundant coccoid bacterial organisms forming long chains. Necrosis, inflammation, and vasculitis were most severe in the pericardium, meninges, liver, kidneys, and gills. Bacterial isolates revealed β-hemolytic, Gram-positive coccoid bacteria identified as S. iniae by amplification and 16S ribosomal RNA gene sequencing. Results from biochemical and antimicrobial susceptibility analysis, together with repetitive element palindromic polymerase chain reaction fingerprinting, suggest that a single strain was responsible for the outbreak. The inciting cause for this S. iniae-associated cluster of mortalities is unknown. © The Author(s) 2013.

Bromine atom production and chain propagation during springtime Arctic ozone depletion events in Barrow, Alaska

NASA Astrophysics Data System (ADS)

Thompson, Chelsea R.; Shepson, Paul B.; Liao, Jin; Huey, L. Greg; Cantrell, Chris; Flocke, Frank; Orlando, John

2017-03-01

Ozone depletion events (ODEs) in the Arctic are primarily controlled by a bromine radical-catalyzed destruction mechanism that depends on the efficient production and recycling of Br atoms. Numerous laboratory and modeling studies have suggested the importance of heterogeneous recycling of Br through HOBr reaction with bromide on saline surfaces. On the other hand, the gas-phase regeneration of bromine atoms through BrO-BrO radical reactions has been assumed to be an efficient, if not dominant, pathway for Br reformation and thus ozone destruction. Indeed, it has been estimated that the rate of ozone depletion is approximately equal to twice the rate of the BrO self-reaction. Here, we use a zero-dimensional, photochemical model, largely constrained to observations of stable atmospheric species from the 2009 Ocean-Atmosphere-Sea Ice-Snowpack (OASIS) campaign in Barrow, Alaska, to investigate gas-phase bromine radical propagation and recycling mechanisms of bromine atoms for a 7-day period during late March. This work is a continuation of that presented in Thompson et al. (2015) and utilizes the same model construct. Here, we use the gas-phase radical chain length as a metric for objectively quantifying the efficiency of gas-phase recycling of bromine atoms. The gas-phase bromine chain length is determined to be quite small, at < 1.5, and highly dependent on ambient O3 concentrations. Furthermore, we find that Br atom production from photolysis of Br2 and BrCl, which is predominately emitted from snow and/or aerosol surfaces, can account for between 30 and 90 % of total Br atom production. This analysis suggests that condensed-phase production of bromine is at least as important as, and at times greater than, gas-phase recycling for the occurrence of Arctic ODEs. Therefore, the rate of the BrO self-reaction is not a sufficient estimate for the rate of O3 depletion.

Detection of monoclonal immunoglobulin heavy chain gene rearrangement (FR3) in Thai malignant lymphoma by High Resolution Melting curve analysis.

PubMed

Kummalue, Tanawan; Chuphrom, Anchalee; Sukpanichanant, Sanya; Pongpruttipan, Tawatchai; Sukpanichanant, Sathien

2010-05-19

Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Detection of antigen receptor gene rearrangement including T cell receptor (TCR) and immunoglobulin heavy chain (IgH) by polymerase chain reaction followed by heteroduplex has currently become standard whereas fluorescent fragment analysis (GeneScan) has been used for confirmation test. In this study, three techniques had been compared: thermocycler polymerase chain reaction (PCR) followed by heteroduplex and polyacrylamide gel electrophoresis, GeneScan analysis, and real time PCR with High Resolution Melting curve analysis (HRM). The comparison was carried out with DNA extracted from paraffin embedded tissues diagnosed as B- cell non-Hodgkin lymphoma. Specific PCR primers sequences for IgH gene variable region 3, including fluorescence labeled IgH primers were used and results were compared with HRM. In conclusion, the detection IgH gene rearrangement by HRM in the LightCycler System showed potential for distinguishing monoclonality from polyclonality in B-cell non-Hodgkin lymphoma. Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The incidence rate as reported by Ministry of Public Health is 3.1 per 100,000 population in female whereas the rate in male is 4.5 per 100,000 population 1. At Siriraj Hospital, the new cases diagnosed as malignant lymphoma were 214.6 cases/year 2. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Therefore, detection of antigen receptor gene rearrangement including T cell receptor (TCR) and immunoglobulin heavy chain (IgH) by polymerase chain reaction (PCR) assay has recently become a standard laboratory test for discrimination of reactive from malignant clonal lymphoproliferation 34. Analyzing DNA extracted from formalin-fixed, paraffin-embedded tissues by multiplex PCR techniques is more rapid, accurate and highly sensitive. Measuring the size of the amplicon from PCR analysis could be used to diagnose malignant lymphoma with monoclonal pattern showing specific and distinct bands detected on acrylamide gel electrophoresis. However, this technique has some limitations and some patients might require a further confirmation test such as GeneScan or fragment analysis 56.GeneScan technique or fragment analysis reflects size and peak of DNA by using capillary gel electrophoresis. This technique is highly sensitive and can detect 0.5-1% of clonal lymphoid cells. It measures the amplicons by using various fluorescently labeled primers at forward or reverse sides and a specific size standard. Using a Genetic Analyzer machine and GeneMapper software (Applied Bioscience, USA), the monoclonal pattern revealed one single, sharp and high peak at the specific size corresponding to acrylamide gel pattern, whereas the polyclonal pattern showed multiple and small peak condensed at the same size standard. This technique is the most sensitive and accurate technique; however, it usually requires high technical experience and is also of high cost 7. Therefore, rapid and more cost effective technique are being sought.LightCycler PCR performs the diagnostic detection of amplicon via melting curve analysis within 2 hours with the use of a specific dye 89. This dye consists of two types: one known as SYBR-Green I which is non specific and the other named as High Resolution Melting analysis (HRM) which is highly sensitive, more accurate and stable. Several reports demonstrated that this new instrument combined with DNA intercalating dyes can be used to discriminate sequence changes in PCR amplicon without manual handling of PCR product 1011. Therefore, current investigations using melting curve analysis are being developed 1213.In this study, three different techniques were compared to evaluate the suitability of LightCycler PCR with HRM as the clonal diagnostic tool for IgH gene rearrangement in B-cell non-Hogdkin lymphoma, i.e. thermocycler PCR followed by heteroduplex analysis and PAGE, GeneScan analysis and LightCycler PCR with HRM.

Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

PubMed

Winkelmann, Kurt; Calhoun, Robert L; Mills, German

2006-12-28

Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

Tested Demonstrations.

ERIC Educational Resources Information Center

Gilbert, George L., Ed.

1983-01-01

Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

SOME CHARACTERISTICS OF THE ORAL CAVITY AND TEETH OF COSMONAUTS ON MISSIONS TO THE INTERNATIONAL SPACE STATION.

PubMed

Ilyin, V K; Shumilina, G A; Solovieva, Z O; Nosovsky, A M; Kaminskaya, E V

Earlier studies were furthered by examination of parodentium anaerobic microbiota and investigation of gingival liquid immunological factors in space flight. Immunoglobulins were measured using the .enzyme immunoassay (EM). The qualitative content of keya parodentium pathogens is determined with state-of-the-art molecular biology technologies such as the polymerase chain reaction. Statistical data processing was performed using the principle component analysis and ensuing standard statistical analysis. Thereupon, recommendations on cosmonaut's oral and dental hygiene during space mission were developed.

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

A cis-prenyltransferase from Methanosarcina acetivorans catalyzes both head-to-tail and nonhead-to-tail prenyl condensation.

PubMed

Ogawa, Takuya; Emi, Koh-Ichi; Koga, Kazushi; Yoshimura, Tohru; Hemmi, Hisashi

2016-06-01

Cis-prenyltransferase usually consecutively catalyzes the head-to-tail condensation reactions of isopentenyl diphosphate to allylic prenyl diphosphate in the production of (E,Z-mixed) polyprenyl diphosphate, which is the precursor of glycosyl carrier lipids. Some recently discovered homologs of the enzyme, however, catalyze the nonhead-to-tail condensation reactions between allylic prenyl diphosphates. In this study, we characterize a cis-prenyltransferase homolog from a methanogenic archaeon, Methanosarcina acetivorans, to obtain information on the biosynthesis of the glycosyl carrier lipids within it. This enzyme catalyzes both head-to-tail and nonhead-to-tail condensation reactions. The kinetic analysis shows that the main reaction of the enzyme is consecutive head-to-tail prenyl condensation reactions yielding polyprenyl diphosphates, while the chain lengths of the major products seem shorter than expected for the precursor of glycosyl carrier lipids. On the other hand, a subsidiary reaction of the enzyme, i.e., nonhead-to-tail condensation between dimethylallyl diphosphate and farnesyl diphosphate, gives a novel diterpenoid compound, geranyllavandulyl diphosphate. © 2016 Federation of European Biochemical Societies.

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2015-10-27

In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

Surface radical chain-transfer reaction in deep eutectic solvents for preparation of silica-grafted stationary phases in hydrophilic interaction chromatography.

PubMed

Yang, Beibei; Cai, Tianpei; Li, Zhan; Guan, Ming; Qiu, Hongdeng

2017-12-01

In this paper, deep eutectic solvents (DESs) were firstly used as new and green solvents for the preparation of polymer-grafted silica stationary phases. 1-Vinylimidazole and acrylic acid were homopolymerized and copolymerized on silica via surface radical chain-transfer reaction in the DESs. Three stationary phases including poly(1-vinylimidazole)-, poly(acrylic acid)-, poly(1-vinylimidazole-co-acrylic acid)-grafted silica were obtained and characterized by elemental analysis and Fourier transform infrared spectroscopy. Their hydrophilic interaction chromatographic properties were investigated for separation of nucleosides, nucleobases, saccharides and amino acids. The retention changes of nucleosides and nucleobases on these columns were investigated under different chromatographic conditions including acetonitrile content, salt concentration, pH of mobile phase and column temperature. The repeatability of these columns was also investigated. The results demonstrate that DESs can be used as new media for the synthesis of silica-based stationary phases by homopolymerization and copolymerization on the surface of porous silica particles. Copyright © 2017 Elsevier B.V. All rights reserved.

Exact dynamic properties of molecular motors

NASA Astrophysics Data System (ADS)

Boon, N. J.; Hoyle, R. B.

2012-08-01

Molecular motors play important roles within a biological cell, performing functions such as intracellular transport and gene transcription. Recent experimental work suggests that there are many plausible biochemical mechanisms that molecules such as myosin-V could use to achieve motion. To account for the abundance of possible discrete-stochastic frameworks that can arise when modeling molecular motor walks, a generalized and straightforward graphical method for calculating their dynamic properties is presented. It allows the calculation of the velocity, dispersion, and randomness ratio for any proposed system through analysis of its structure. This article extends work of King and Altman ["A schematic method of deriving the rate laws of enzyme-catalyzed reactions," J. Phys. Chem. 60, 1375-1378 (1956)], 10.1021/j150544a010 on networks of enzymatic reactions by calculating additional dynamic properties for spatially hopping systems. Results for n-state systems are presented: single chain, parallel pathway, divided pathway, and divided pathway with a chain. A novel technique for combining multiple system architectures coupled at a reference state is also demonstrated. Four-state examples illustrate the effectiveness and simplicity of these methods.

DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

PubMed

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

Cell death in a harmful algal bloom causing species Alexandrium tamarense upon an algicidal bacterium induction.

PubMed

Zhang, Huajun; Lv, Jinglin; Peng, Yun; Zhang, Su; An, Xinli; Xu, Hong; Zhang, Jun; Tian, Yun; Zheng, Wei; Zheng, Tianling

2014-09-01

Harmful algal blooms occur throughout the world, destroying aquatic ecosystems and threatening human health. The culture supernatant of the marine algicidal bacteria DHQ25 was able to lysis dinoflagellate Alexandrium tamarense. Loss of photosynthetic pigments, accompanied by a decline in Photosystem II (PSII) photochemical efficiency (Fv/Fm), in A. tamarense was detected under bacterial supernatant stress. Transmission electron microscope analysis showed obvious morphological modifications of chloroplast dismantling as a part of the algicidal process. The PSII electron transport chain was seriously blocked, with its reaction center damaged. This damage was detected in a relative transcriptional level of psbA and psbD genes, which encode the D1 and D2 proteins in the PSII reaction center. And the block in the electron transport chain of PSII might generate excessive reactive oxygen species (ROS) which could destroy the membrane system and pigment synthesis and activated enzymic antioxidant systems including superoxide dismutase (SOD) and catalase (CAT). This study indicated that marine bacteria with indirect algicidal activity played an important role in the changes of photosynthetic process in a harmful algal bloom species.

Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

2009-08-01

A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

PubMed

Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

1998-10-01

In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P < .001). HIV-1 DNA was detected by PCR in ulcers of 6 (50%) of 12 HIV-positive patients. Multivariate analysis indicated that men with chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

PubMed

Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

2017-09-01

Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

From Metal Thiobenzoates to Metal Sulfide Nanocrystals: An Experimental and Theoretical Investigation

PubMed Central

Zhang, Zhihua; Lim, Wen Pei; Wong, Chiong Teck; Xu, Hairuo; Yin, Fenfang; Chin, Wee Shong

2012-01-01

A simple preparation of metal sulfide nanoparticles via the decomposition of thiobenzoate precursors at room temperature is presented and discussed. Long chain alkylamines were found to mediate the breakdown of metal thiobenzoates, such as those containing Ag, Cu, In and Cd, to produce uniform Ag2S, Cu2−xS, In2S3 and CdS nanoparticles respectively. The long chain amines are assumed to play dual roles as the nucleophilic reagent and the capping agent. It was found that sizes of the nanoparticles can be controlled by changing the type of amine used, as well as the molar ratio between amine and the precursor. We performed DFT calculations on a proposed mechanism involving an initial nucleophilic addition of amine molecule onto the thiocarboxylates. The proposed reaction was also confirmed through the analysis of by-products via infrared spectroscopy. On the basis of this understanding, we propose to manipulate the stability of the precursors by coordination with suitable stabilizing groups, such that the reaction kinetics can be modified to generate different nanostructures of interest. PMID:28348299

Extranodal marginal zone lymphoma of mucosa-associated lymphoid tissue type arising in the pleura with pleural fibrous plaques in a lathe worker.

PubMed

Nakatsuka, Shin-ichi; Nagano, Teruaki; Kimura, Hayato; Hanada, Shoji; Inoue, Hidetoshi; Iwata, Takashi

2012-06-01

Our patient was an 86-year-old man who had worked as a lathe operator for 40 years. He had no history of tuberculosis, pyothorax, or autoimmune disease. He had not been exposed to asbestos. He was asymptomatic, but an imaging study showed gradually increasing pleural plaques. A biopsy specimen of a pleural lesion showed sclerosis of the pleura and diffuse infiltration of small- to medium-sized B lymphocytes. Polymerase chain reaction-based analysis detected monoclonal rearrangement of immunoglobulin heavy-chain genes. Histologic diagnosis was extranodal marginal zone lymphoma of mucosa-associated lymphoid tissue type (MALT lymphoma). The lymphoma was negative for Epstein-Barr virus. We report a rare case of a metal worker with MALT lymphoma arising in the pleura with pleural fibrous plaques. It is speculated that MALT lymphoma might develop in the background of pneumoconiosis. Inflammatory and/or immunologic reactions to metal particles might contribute to the oncogenesis of this tumor. Copyright © 2012 Elsevier Inc. All rights reserved.

11S Storage globulin from pumpkin seeds: regularities of proteolysis by papain.

PubMed

Rudakova, A S; Rudakov, S V; Kakhovskaya, I A; Shutov, A D

2014-08-01

Limited proteolysis of the α- and β-chains and deep cleavage of the αβ-subunits by the cooperative (one-by-one) mechanism was observed in the course of papain hydrolysis of cucurbitin, an 11S storage globulin from seeds of the pumpkin Cucurbita maxima. An independent analysis of the kinetics of the limited and cooperative proteolyses revealed that the reaction occurs in two successive steps. In the first step, limited proteolysis consisting of detachments of short terminal peptides from the α- and β-chains was observed. The cooperative proteolysis, which occurs as a pseudo-first order reaction, started at the second step. Therefore, the limited proteolysis at the first step plays a regulatory role, impacting the rate of deep degradation of cucurbitin molecules by the cooperative mechanism. Structural alterations of cucurbitin induced by limited proteolysis are suggested to generate its susceptibility to cooperative proteolysis. These alterations are tentatively discussed on the basis of the tertiary structure of the cucurbitin subunit pdb|2EVX in comparison with previously obtained data on features of degradation of soybean 11S globulin hydrolyzed by papain.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Novel surface-active oligofructose fatty acid mono-esters by enzymatic esterification.

PubMed

van Kempen, Silvia E H J; Boeriu, Carmen G; Schols, Henk A; de Waard, Pieter; van der Linden, Erik; Sagis, Leonard M C

2013-06-01

This article describes the synthesis of a series of oligofructose monoesters with fatty acids of different chain length (C8, C12, C16 and C18) to obtain food-grade surfactants with a range of amphiphilicity. Reactions were performed in a mixture of DMSO/Bu(t)OH (10/90 v/v) at 60°C and catalysed by immobilised Candida antarctica lipase B. MALDI-TOF-MS analysis showed that the crude reaction products were mixtures of unmodified oligofructose and mostly mono-esters. The conversion into mono-esters increased with the length of the fatty acid chain, reflecting the specificity of the lipase towards more lipophilic substrates. Reverse phase solid phase extraction was used to fractionate the products, which lead to sufficient purity (>93%) of the fatty acid esters for functionality testing. It was shown that derivatives of longer (C16 and C18) fatty acids were more efficient in lowering surface tension and gave a much higher dilatational modulus than derivatives of the shorter (C8 and C12) fatty acids. Copyright © 2012 Elsevier Ltd. All rights reserved.

Development and inter-laboratory transfer of a decaplex polymerase chain reaction assay combined with capillary electrophoresis for the simultaneous detection of ten food allergens.

PubMed

Cheng, Fang; Wu, Jiajie; Zhang, Jin; Pan, Aihu; Quan, Sheng; Zhang, Dabing; Kim, HaeYeong; Li, Xiang; Zhou, Shan; Yang, Litao

2016-05-15

Food allergies cause health risks to susceptible consumers and regulations on labeling of food allergen contents have been implemented in many countries and regions. To achieve timely and accurate food allergen labeling, the development of fast and effective allergen detection methods is very important. Herein, a decaplex polymerase chain reaction (PCR) assay combined with capillary electrophoresis was developed to detect simultaneously 10 common food allergens from hazelnut, pistachio, oat, sesame, peanut, cashew, barley, wheat, soybean and pecan. The absolute limit of detection (LODa) of this system is between 2 and 20 copies of haploid genome, and the relative LOD (LODr) is as low as 0.005% (w/w) in simulated food mixtures. The developed assay was subsequently applied to 20 commercial food products and verified the allergen ingredients stated on the labels. Furthermore, results using this decaplex PCR assay was successfully replicated in three other laboratories, demonstrating the repeatability and applicability of this assay in routine analysis of the 10 food allergens. Copyright © 2015 Elsevier Ltd. All rights reserved.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

2015-07-15

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

PubMed

Brownholland, David P; Covey, Douglas F

2017-05-01

A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Alcoholytic Cleavage of Polyhydroxyalkanoate Chains by Class IV Synthases Induced by Endogenous and Exogenous Ethanol

PubMed Central

Hyakutake, Manami; Tomizawa, Satoshi; Mizuno, Kouhei; Abe, Hideki

2014-01-01

Polyhydroxyalkanoate (PHA)-producing Bacillus strains express class IV PHA synthase, which is composed of the subunits PhaR and PhaC. Recombinant Escherichia coli expressing PHA synthase from Bacillus cereus strain YB-4 (PhaRCYB-4) showed an unusual reduction of the molecular weight of PHA produced during the stationary phase of growth. Nuclear magnetic resonance analysis of the low-molecular-weight PHA revealed that its carboxy end structure was capped by ethanol, suggesting that the molecular weight reduction was the result of alcoholytic cleavage of PHA chains by PhaRCYB-4 induced by endogenous ethanol. This scission reaction was also induced by exogenous ethanol in both in vivo and in vitro assays. In addition, PhaRCYB-4 was observed to have alcoholysis activity for PHA chains synthesized by other synthases. The PHA synthase from Bacillus megaterium (PhaRCBm) from another subgroup of class IV synthases was also assayed and was shown to have weak alcoholysis activity for PHA chains. These results suggest that class IV synthases may commonly share alcoholysis activity as an inherent feature. PMID:24334666

A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.

PubMed

Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang

2009-09-25

We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.

Spark Plasma Sintering for Nanostructured Smart Materials

DTIC Science & Technology

2009-03-02

polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

PubMed

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Polymeric cobalt(ii) thiolato complexes - syntheses, structures and properties of [Co(SMes)2] and [Co(SPh)2NH3].

PubMed

Eichhöfer, Andreas; Buth, Gernot

2016-11-01

Reactions of [Co(N(SiMe 3 ) 2 ) 2 thf] with 2.1 equiv. of MesSH (Mes = C 6 H 2 -2,4,6-(CH 3 ) 3 ) yield dark brown crystals of the one dimensional chain compound [Co(SMes) 2 ]. In contrast reactions of [Co(N(SiMe 3 ) 2 ) 2 thf] with 2.1 equiv. of PhSH result in the formation of a dark brown almost X-ray amorphous powder of 'Co(SPh) 2 '. Addition of aliquots of CH 3 OH to the latter reaction resulted in the almost quantitative formation of crystalline ammonia thiolato complexes either [Co(SPh) 2 (NH 3 ) 2 ] or [Co(SPh) 2 NH 3 ]. Single crystal XRD reveals that [Co(SPh) 2 NH 3 ] forms one-dimensional chains in the crystal via μ 2 -SPh bridges whereas [Co(SPh) 2 (NH 3 ) 2 ] consists at a first glance of isolated distorted tetrahedral units. Magnetic measurements suggest strong antiferromagnetic coupling for the two chain compounds [Co(SMes) 2 ] (J = -38.6 cm -1 ) and [Co(SPh) 2 NH 3 ] (J = -27.1 cm -1 ). Interestingly, also the temperature dependence of the susceptibility of tetrahedral [Co(SPh) 2 (NH 3 ) 2 ] shows an antiferromagnetic transition at around 6 K. UV-Vis-NIR spectra display d-d bands in the NIR region between 500 and 2250 nm. Thermal gravimetric analysis of [Co(SPh) 2 (NH 3 ) 2 ] and [Co(SPh) 2 NH 3 ] reveals two well separated cleavage processes for NH 3 and SPh 2 upon heating accompanied by the stepwise formation of 'Co(SPh) 2 ' and cobalt sulfide.

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

Oxytetracycline induces DNA damage and epigenetic changes: a possible risk for human and animal health?

PubMed

Gallo, Adriana; Landi, Rosaria; Rubino, Valentina; Di Cerbo, Alessandro; Giovazzino, Angela; Palatucci, Anna Teresa; Centenaro, Sara; Guidetti, Gianandrea; Canello, Sergio; Cortese, Laura; Ruggiero, Giuseppina; Alessandrini, Andrea; Terrazzano, Giuseppe

2017-01-01

Oxytetracycline (OTC), which is largely employed in zootechnical and veterinary practices to ensure wellness of farmed animals, is partially absorbed within the gastrointestinal tract depositing in several tissues. Therefore, the potential OTC toxicity is relevant when considering the putative risk derived by the entry and accumulation of such drug in human and pet food chain supply. Despite scientific literature highlights several OTC-dependent toxic effects on human and animal health, the molecular mechanisms of such toxicity are still poorly understood. Here, we evaluated DNA damages and epigenetic alterations by quantitative reverse transcription polymerase chain reaction, quantitative polymerase chain reaction, chromatin immuno-precipitation and Western blot analysis. We observed that human peripheral blood mononuclear cells (PBMCs) expressed DNA damage features (activation of ATM and p53, phosphorylation of H2AX and modifications of histone H3 methylation of lysine K4 in the chromatin) after the in vitro exposure to OTC. These changes are linked to a robust inflammatory response indicated by an increased expression of Interferon (IFN)- γ and type 1 superoxide dismutase (SOD1). Our data reveal an unexpected biological in vitro activity of OTC able to modify DNA and chromatin in cultured human PBMC. In this regard, OTC presence in foods of animal origin could represent a potential risk for both the human and animal health.

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

Atom Transfer Radical Polymerization of Functionalized Vinyl Monomers Using Perylene as a Visible Light Photocatalyst

PubMed Central

Theriot, Jordan C.; Ryan, Matthew D.; French, Tracy A.; Pearson, Ryan M.; Miyake, Garret M.

2016-01-01

A standardized technique for atom transfer radical polymerization of vinyl monomers using perylene as a visible-light photocatalyst is presented. The procedure is performed under an inert atmosphere using air- and water-exclusion techniques. The outcome of the polymerization is affected by the ratios of monomer, initiator, and catalyst used as well as the reaction concentration, solvent, and nature of the light source. Temporal control over the polymerization can be exercised by turning the visible light source off and on. Low dispersities of the resultant polymers as well as the ability to chain-extend to form block copolymers suggest control over the polymerization, while chain end-group analysis provides evidence supporting an atom-transfer radical polymerization mechanism. PMID:27166728

Methanol Cannon Demonstrations Revisited.

ERIC Educational Resources Information Center

Dolson, David A.; And Others

1995-01-01

Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

Asymptotic study of pulsating evolution of overdriven and CJ detonation with a chain-branching kinetics model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Short, Mark; Chliquete, Carlos

2011-01-20

The pulsating dynamics of gaseous detonations with a model two-step chain-branching kinetic mechanism are studied both numerically and asymptotically. The model studied here was also used in [4], [3] and [2] and mimics the attributes of some chain-branching reaction mechanisms. Specifically, the model comprises a chain-initiationlbranching zone with an Arrhenius temperature-sensitive rate behind the detonation shock where fuel is converted into chain-radical with no heat release. This is followed by a chain-termination zone having a temperature insensitive rate where the exothermic heat of reaction is released. The lengths of these two zones depend on the relative rates of each stage.more » It was determined in [4] and [3] via asymptotic and numerical analysis that the ratio of the length of the chain-branching zone to that of the chain-initation zone relative to the size of the von Neumann state scaled activation energy in the chain initiation/branching zone has a primary influence of the stability of one-dimensional pulsating instability behavior for this model. In [2], the notion of a specific stability parameter related to this ratio was proposed that determines the boundary between stable and unstable waves. In [4], a slow-time varying asymptotic study was conducted of pulsating instability of Chapman-Jouguet (CJ) detonations with the above two-step rate model, assuming a large activation energy for the chain-initiation zone and a chain-termination zone longer than the chain-initiation zone. Deviations D{sub n}{sup (1)} ({tau}) of the detonation velocity from Chapman-Jouguet were of the order of the non-dimensional activation energy. Solutions were sought for a pulsation timescale of the order of the non-dimensional activation energy times the particle transit time through the induction zone. On this time-scale, the evolution of the chain-initation zone is quasi-steady. In [4], a time-dependent non-linear evolution equation for D{sub n}{sup (1)} ({tau}) was then constructed via a perturbation procedure for cases where the ratio of the length of the chain-termination zone to chain-initiation zone was less than the non-dimensional activation energy. To leading order, the steady CJ detonation was found to be unstable; higher-order corrections lead to the construction of a stability limit between stable and unsteady pulsating solutions. One conclusion from this study is that for a stability limit to occur at leading order, the period of pulsation of the detonation must occur on the time scale of particle passage through the longer chain-termination zone, while the length of the chain-termination zone must be of order of the non-dimensional activation energy longer than the chain-initiation zone. The relevance of these suggested scalings was verified via numerical solutions of the full Euler system in [3], and formed the basis of the stability parameter criteria suggested in [2]. In the following, we formulate an asymptotic study based on these new suggested scales, studying the implications for describing pulsating behavior in gaseous chain-branching detonations. Specifically, we find that the chain-induction zone structure is the same as that studied in [4]. However, the study of unsteady evolution in the chain-termination region is now governed by a set of asymptotically derived nonlinear POEs. Equations for the linear stablity behavior of this set of POE's is obtained, while the nonlinear POEs are solved numerically using a shock-attached, shock-fitting method developed by Henrick et aJ. [1]. The results thus far show that the stability threshold calculated using the new ratio of the chain-termination zone length to that of the chain-initiation zone yields a marked improvement over [2]. Additionally, solutions will be compared with predictions obtained from the solution of the full Euler system. Finally, the evolution equation previously derived in [4] has been generalized to consider both arbitrary reaction orders and any degree of overdrive.« less

Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

NASA Astrophysics Data System (ADS)

Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

2017-09-01

It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

A Human Factors Analysis of USAF Remotely Piloted Aircraft Mishaps

DTIC Science & Technology

2013-06-01

conditions or unsafe acts, where their respective removal would prevent a chain reaction from propagating, thus preventing the accident . This model...Force Col. Anthony Tvaryanas stated that “If you 19 really wanted to make a dent in preventing RPA accidents , the DoD needs to look at how they do...REFERENCES Greenwood, M. & Woods, H.M. (1919). The incidence of industrial accidents upon individuals with special reference to multiple accidents . (British

Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

Treesearch

Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

2016-01-01

Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

Unraveling reaction pathways and specifying reaction kinetics for complex systems.

PubMed

Vinu, R; Broadbelt, Linda J

2012-01-01

Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

PubMed

Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

2014-03-01

The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis.

PubMed

Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

2015-03-01

A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).

Selection and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Studies in Mossy Maze Polypore, Cerrena unicolor (Higher Basidiomycetes).

PubMed

Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun

2016-01-01

With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.

Unique vaginal microbiota that includes an unknown Mycoplasma-like organism is associated with Trichomonas vaginalis infection.

PubMed

Martin, David H; Zozaya, Marcela; Lillis, Rebecca A; Myers, Leann; Nsuami, M Jacques; Ferris, Michael J

2013-06-15

The prevalence of Trichomonas vaginalis infection is highest in women with intermediate Nugent scores. We hypothesized that the vaginal microbiota in T. vaginalis-infected women differs from that in T. vaginalis-uninfected women. Vaginal samples from 30 T. vaginalis-infected women were matched by Nugent score to those from 30 T. vaginalis-uninfected women. Equal numbers of women with Nugent scores categorized as normal, intermediate, and bacterial vaginosis were included. The vaginal microbiota was assessed using 454 pyrosequencing analysis of polymerase chain reaction-amplified 16S ribosomal RNA gene sequences. The 16S ribosomal RNA gene sequence of an unknown organism was obtained by universal bacterial polymerase chain reaction amplification, cloning, and sequencing. Principal coordinates analysis of the pyrosequencing data showed divergence of the vaginal microbiota in T. vaginalis-infected and T. vaginalis-uninfected patients among women with normal and those with intermediate Nugent scores but not among women with bacterial vaginosis. Cluster analysis revealed 2 unique groups of T. vaginalis-infected women. One had high abundance of Mycoplasma hominis and other had high abundance of an unknown Mycoplasma species. Women in the former group had clinical evidence of enhanced vaginal inflammation. T. vaginalis may alter the vaginal microbiota in a manner that is favorable to its survival and/or transmissibility. An unknown Mycoplasma species plays a role in some of these transformations. In other cases, these changes may result in a heightened host inflammatory response.

Comparisons of serum miRNA expression profiles in patients with diabetic retinopathy and type 2 diabetes mellitus.

PubMed

Ma, Jianping; Wang, Jufang; Liu, Yanfen; Wang, Changyi; Duan, Donghui; Lu, Nanjia; Wang, Kaiyue; Zhang, Lu; Gu, Kaibo; Chen, Sihan; Zhang, Tao; You, Dingyun; Han, Liyuan

2017-02-01

The aim of this study was to compare the expression levels of serum miRNAs in diabetic retinopathy and type 2 diabetes mellitus. Serum miRNA expression profiles from diabetic retinopathy cases (type 2 diabetes mellitus patients with diabetic retinopathy) and type 2 diabetes mellitus controls (type 2 diabetes mellitus patients without diabetic retinopathy) were examined by miRNA-specific microarray analysis. Quantitative real-time polymerase chain reaction was used to validate the significantly differentially expressed serum miRNAs from the microarray analysis of 45 diabetic retinopathy cases and 45 age-, sex-, body mass index- and duration-of-diabetes-matched type 2 diabetes mellitus controls. The relative changes in serum miRNA expression levels were analyzed using the 2-ΔΔCt method. A total of 5 diabetic retinopathy cases and 5 type 2 diabetes mellitus controls were included in the miRNA-specific microarray analysis. The serum levels of miR-3939 and miR-1910-3p differed significantly between the two groups in the screening stage; however, quantitative real-time polymerase chain reaction did not reveal significant differences in miRNA expression for 45 diabetic retinopathy cases and their matched type 2 diabetes mellitus controls. Our findings indicate that miR-3939 and miR-1910-3p may not play important roles in the development of diabetic retinopathy; however, studies with a larger sample size are needed to confirm our findings.

Numerical verification of three point bending experiment of magnetorheological elastomer (MRE) in magnetic field

NASA Astrophysics Data System (ADS)

Miedzinska, Danuta; Boczkowska, Anna; Zubko, Konrad

2010-07-01

In the article a method of numerical verification of experimental results for magnetorheological elastomer samples (MRE) is presented. The samples were shaped into cylinders with diameter of 8 mm and height of 20 mm with various carbonyl iron volume shares (1,5%, 11,5% and 33%). The diameter of soft ferromagnetic substance particles ranged from 6 to 9 μm. During the experiment, initially bended samples were exposed to the magnetic field with intensity levels at 0,1T, 0,3T, 0,5T, 0,7 and 1T. The reaction of the sample to the field action was measured as a displacement of a specimen. Numerical calculation was carried out with the MSC Patran/Marc computer code. For the purpose of numerical analysis the orthotropic material model with the material properties of magnetorheological elastomer along the iron chains, and of the pure elastomer along other directions, was applied. The material properties were obtained from the experimental tests. During the numerical analysis, the initial mechanical load resulting from cylinder deflection was set. Then, the equivalent external force, that was set on the basis of analytical calculations of intermolecular reaction within iron chains in the specific magnetic field, was put on the bended sample. Correspondence of such numerical model with results of the experiment was verified. Similar results of the experiments and both theoretical and FEM analysis indicates that macroscopic modeling of magnetorheological elastomer mechanical properties as orthotropic material delivers accurate enough description of the material's behavior.

The diagnostic value of polymerase chain reaction for Mycobacterium tuberculosis to distinguish intestinal tuberculosis from crohn's disease: A meta-analysis.

PubMed

Jin, Ting; Fei, Baoying; Zhang, Yu; He, Xujun

2017-01-01

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are important differential diagnoses that can be difficult to distinguish. Polymerase chain reaction (PCR) for Mycobacterium tuberculosis (MTB) is an efficient and promising tool. This meta-analysis was performed to systematically and objectively assess the potential diagnostic accuracy and clinical value of PCR for MTB in distinguishing ITB from CD. We searched PubMed, Embase, Web of Science, Science Direct, and the Cochrane Library for eligible studies, and nine articles with 12 groups of data were identified. The included studies were subjected to quality assessment using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. The summary estimates were as follows: sensitivity 0.47 (95% CI: 0.42-0.51); specificity 0.95 (95% CI: 0.93-0.97); the positive likelihood ratio (PLR) 10.68 (95% CI: 6.98-16.35); the negative likelihood ratio (NLR) 0.49 (95% CI: 0.33-0.71); and diagnostic odds ratio (DOR) 21.92 (95% CI: 13.17-36.48). The area under the curve (AUC) was 0.9311, with a Q* value of 0.8664. Heterogeneity was found in the NLR. The heterogeneity of the studies was evaluated by meta-regression analysis and subgroup analysis. The current evidence suggests that PCR for MTB is a promising and highly specific diagnostic method to distinguish ITB from CD. However, physicians should also keep in mind that negative results cannot exclude ITB for its low sensitivity. Additional prospective studies are needed to further evaluate the diagnostic accuracy of PCR.

Gene expression analysis in hypoplastic lungs in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Burgos, Carmen Mesas; Uggla, Andreas Ringman; Fagerström-Billai, Fredrik; Eklöf, Ann-Christine; Frenckner, Björn; Nord, Magnus

2010-07-01

Pulmonary hypoplasia and persistent pulmonary hypertension are the main causes of mortality and morbidity in newborns with congenital diaphragmatic hernia (CDH). Nitrofen is well known to induce CDH and lung hypoplasia in a rat model, but the mechanism remains unknown. To increase the understanding of the underlying pathogenesis of CDH, we performed a global gene expression analysis using microarray technology. Pregnant rats were given 100 mg nitrofen on gestational day 9.5 to create CDH. On day 21, fetuses after nitrofen administration and control fetuses were removed; and lungs were harvested. Global gene expression analysis was performed using Affymetrix Platform and the RAE 230 set arrays. For validation of microarray data, we performed real-time polymerase chain reaction and Western blot analysis. Significantly decreased genes after nitrofen administration included several growth factors and growth factors receptors involved in lung development, transcription factors, water and ion channels, and genes involved in angiogenesis and extracellular matrix. These results could be confirmed with real-time polymerase chain reaction and protein expression studies. The pathogenesis of lung hypoplasia and CDH in the nitrofen model includes alteration at a molecular level of several pathways involved in lung development. The complexity of the nitrofen mechanism of action reminds of human CDH; and the picture is consistent with lung hypoplasia and vascular disease, both important contributors to the high mortality and morbidity in CDH. Increased understanding of the molecular mechanisms that control lung growth may be the key to develop novel therapeutic techniques to stimulate pre- and postnatal lung growth. Copyright 2010 Elsevier Inc. All rights reserved.

Isolation of Separate Ureaplasma Species From Endotracheal Secretions of Twin Patients.

PubMed

Beeton, Michael L; Maxwell, Nicola C; Chalker, Victoria J; Brown, Rebecca J; Aboklaish, Ali F; Spiller, O Brad

2016-08-01

Isolation of Ureaplasma spp. from preterm neonates and the association with development of bronchopulmonary dysplasia has been previously investigated. However, few studies have contrasted the nature of infection in twins. In this article, we report that dizygotic twins (1 girl, 1 boy) born at 24 weeks gestation both yielded culturable Ureaplasma from endotracheal secretions. The samples were part of a serial blind collection cohort of ventilated premature neonates, and analysis of repeat cultures showed stable, separate infections over a period of 17 and 21 days, respectively. Immunoblot and probe-specific quantitative polymerase chain reaction analysis determined that Twin 1 was solely infected with Ureaplasma parvum (specifically, serovar 6 by gene sequencing), whereas Twin 2 was solely infected with Ureaplasma urealyticum (specifically, genotype A- serovars 2, 5, and 8 by gene sequencing). Immunoblot analysis found that the major surface antigen (multiple-banded antigen) altered relative mass for both strains during the course of infection. Quantitative polymerase chain reaction analysis of extracted endotracheal aspirates confirmed no evidence of mixed infection for either twin. Failure of sentinel ventilated preterm infants on the same ward to acquire Ureaplasma infection after the first week of birth suggests no cot-to-cot transfer of Ureaplasma infection occurred. This study demonstrated not only a contrasting clinical outcome for a set of twins infected with 2 separate species of Ureaplasma, but also the first real-time demonstration of multiple-banded antigen alteration and evolution of Ureaplasma over the course of a clinical infection. Copyright © 2016 by the American Academy of Pediatrics.

Trypanosoma cruzi infection of squirrel monkeys: comparison of blood smear examination, commercial enzyme-linked immunosorbent assay, and polymerase chain reaction analysis as screening tests for evaluation of monkey-related injuries.

PubMed

Ndao, M; Kelly, N; Normandin, D; Maclean, J D; Whiteman, A; Kokoskin, E; Arevalo, I; Ward, B J

2000-12-01

Wild-caught New World monkeys (NWM) from Central or South America are often infected with Trypanosoma species, including T. cruzi. In humans, T. cruzi causes Chagas' disease. Even in closed monkey colonies, T. cruzi can be propagated by blood-to-blood exposure, sexual activity, and transplacental transmission. Animal handlers and laboratory staff who deal with blood and tissues from infected NWM are at riskfor acquiring Chagas' disease via accidental exposure. We screened 162 blood samples from wild-caught Saimiri sp. monkeys for Trypanosoma species infections by use of blood smear examination, ELISA, and polymerase chain reaction (PCR) analysis. Blood samples from 19 employees with recent history of monkey-associated injuries also were tested. Six percent (10/162) of the monkey samples were T. cruzi positive on the basis of blood smear examination results, 10.4% (17/162) were positive by ELISA results, and 26.5% (43/162) were positive by PCR results. Other organisms identified by PCR analysis included T. rangeli in two animals, Plasmodium spp. in two animals (P. malariae confirmed by PCR results) and microfilariae in one animal (morphologically, Mansonella perstans). Evidence of trypanosome infection was not found in the 19 employee samples on the basis of results of any of the three aforementioned tests. Close attention must be paid to worker safety where wild-caught NWM are used. The PCR analysis has a clear advantage over conventional techniques (ELISA, blood smear) for screening NWM for trypanosome infections during quarantine and after employee injury.

Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

PubMed

Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

1994-03-01

Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

PubMed

Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

2006-10-12

[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

A computational study of pyrolysis reactions of lignin model compounds

Treesearch

Thomas Elder

2010-01-01

Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

Analysis of charge transport in gels containing polyoxometallates using methods of different sensitivity to migration.

PubMed

Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R

2006-08-04

Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.

THE RADIATIVE NEUTRON CAPTURE ON 2H, 6Li, 7Li, 12C AND 13C AT ASTROPHYSICAL ENERGIES

NASA Astrophysics Data System (ADS)

Dubovichenko, Sergey; Dzhazairov-Kakhramanov, Albert; Burkova, Natalia

2013-05-01

The continued interest in the study of radiative neutron capture on atomic nuclei is due, on the one hand, to the important role played by this process in the analysis of many fundamental properties of nuclei and nuclear reactions, and, on the other hand, to the wide use of the capture cross-section data in the various applications of nuclear physics and nuclear astrophysics, and, also, to the importance of the analysis of primordial nucleosynthesis in the Universe. This paper is devoted to the description of results for the processes of the radiative neutron capture on certain light atomic nuclei at thermal and astrophysical energies. The consideration of these processes is done within the framework of the potential cluster model (PCM), general description of which was given earlier. The methods of usage of the results obtained, based on the phase shift analysis intercluster potentials, are demonstrated in calculations of the radiative capture characteristics. The considered capture reactions are not part of stellar thermonuclear cycles, but involve in the basic reaction chain of primordial nucleosynthesis in the course of the Universe formation.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

NASA Astrophysics Data System (ADS)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

[THE TECHNOLOGY "CELL BLOCK" IN CYTOLOGICAL PRACTICE].

PubMed

Volchenko, N N; Borisova, O V; Baranova, I B

2015-08-01

The article presents summary information concerning application of "cell block" technology in cytological practice. The possibilities of implementation of various modern techniques (immune cytochemnical analysis. FISH, CISH, polymerase chain reaction) with application of "cell block" method are demonstrated. The original results of study of "cell block" technology made with gelatin, AgarCyto and Shadon Cyoblock set are presented. The diagnostic effectiveness of "cell block" technology and common cytological smear and also immune cytochemical analysis on samples of "cell block" technology and fluid cytology were compared. Actually application of "cell block" technology is necessary for ensuring preservation of cell elements for subsequent immune cytochemical and molecular genetic analysis.

Age- and Activity-Related Differences in the Abundance of Myosin Essential and Regulatory Light Chains in Human Muscle

PubMed Central

Cobley, James N.; Ab. Malik, Zulezwan; Morton, James P.; Close, Graeme L.; Edwards, Ben J.; Burniston, Jatin G.

2016-01-01

Traditional methods for phenotyping skeletal muscle (e.g., immunohistochemistry) are labor-intensive and ill-suited to multixplex analysis, i.e., assays must be performed in a series. Addressing these concerns represents a largely unmet research need but more comprehensive parallel analysis of myofibrillar proteins could advance knowledge regarding age- and activity-dependent changes in human muscle. We report a label-free, semi-automated and time efficient LC-MS proteomic workflow for phenotyping the myofibrillar proteome. Application of this workflow in old and young as well as trained and untrained human skeletal muscle yielded several novel observations that were subsequently verified by multiple reaction monitoring (MRM). We report novel data demonstrating that human ageing is associated with lesser myosin light chain 1 content and greater myosin light chain 3 content, consistent with an age-related reduction in type II muscle fibers. We also disambiguate conflicting data regarding myosin regulatory light chain, revealing that age-related changes in this protein more closely reflect physical activity status than ageing per se. This finding reinforces the need to control for physical activity levels when investigating the natural process of ageing. Taken together, our data confirm and extend knowledge regarding age- and activity-related phenotypes. In addition, the MRM transitions described here provide a methodological platform that can be fine-tuned to suite multiple research needs and thus advance myofibrillar phenotyping. PMID:28248225

Syntheses, structures and magnetic properties of four coordination polymers based on nitrobenzene dicarboxylate and various N-donor coligands

NASA Astrophysics Data System (ADS)

Li, Gui-Lian; Yin, Wei-Dong; Liu, Guang-Zhen; Ma, Lu-Fang; Wang, Li-Ya

2014-12-01

Four new coordination polymers {[Ni(4-Nbdc)(bpa)(H2O)]}n (1), {[Co(4-Nbdc)(bpp) (H2O)]}n (2), {[Ni(4-Nbdc)(bpp)(H2O)]·H2O}n (3), and {[Mn2(3-Nbdc)2(bib)3]·2H2O}n (4) (4-Nbdc=4-nitrobenzene-1,2-dicarboxylate, 3-Nbdc=3-nitrobenzene-1,2-dicarboxylate, bpa=1,2-bi(4-pyridyl)ethane, bpp=1,3-bis(4-pyridyl)propane, and bib=1,4-bis(1-imidazoly)benzene), were synthesized by hydrothermal reactions, and characterized by single-crystal X-ray diffractions, elemental analysis, FT-IR, PXRD, TGA and magnetic analysis. Complexes 1 and 2 display quasi-trapezoidal chain and brick-wall layer, and both of them contain metal-carboxylate binuclear units. Complexes 3 and 4 exhibit three-dimensional frameworks with the (66) dia topology and (44.610.8)(44.62) fsc topology, and both of them contain metal-carboxylate chains. The carboxyl groups with syn-anti coordination mode mediate effectively the weak ferromagnetic coupling interaction within Ni(II)-carboxylate binuclear in 1 (J=1.27 cm-1) and Ni(II)-carboxylate chain in 3 (J=1.44 cm-1), respectively, and the carboxyl groups with anti-anti coordination mode leads to the classic antiferromagnetic coupling interaction within Mn(II)-carboxylate chain in 4 (J=-0.77 cm-1).

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Norovirus and Rotavirus Disease Severity in Children: Systematic Review and Meta-analysis.

PubMed

Riera-Montes, Margarita; O'Ryan, Miguel; Verstraeten, Thomas

2018-06-01

Rotaviruses (RVs) and noroviruses (NoVs) are the most common causes of severe acute gastroenteritis in children. It is generally accepted that RVs cause severe acute gastroenteritis in a higher proportion of cases compared with NoVs. To our knowledge, there are no systematic reviews and meta-analyses comparing the severity of NoV and RV disease. We searched MEDLINE for studies reporting data for NoV and RV medically attended disease severity in children. We included studies where all children had been tested for both NoV (reverse transcription polymerase chain reaction) and RV (enzyme-linked immunosorbent assay or reverse transcription polymerase chain reaction) and that reported disease severity using the Vesikari or modified Vesikari score, or provided clinical information on severity. We generated pooled estimates of the mean with 95% confidence intervals using random effects meta-analysis. We identified 266 publications, of which 31 were retained for qualitative analysis and 26 for quantitative analysis. Fourteen studies provided data on severity score for the meta-analysis. The pooled mean severity scores (95% confidence interval) among outpatients were 10 (8-12) and 11 (8-14) for NoV and RV, respectively. Among inpatients, they were 11 (9-13) for NoV and 12 (10-14) for RV. The difference was statistically significant among inpatients, but relatively small (1 point in a 20-point scale). About 20% more children with RV required rehydration when compared with children with NoV. NoV causes moderate to severe disease similar to RV in young children. This information should be useful for future evaluations of an eventual introduction of NoV vaccines in national immunization programs.

O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction.

PubMed

Brell, Marta; Ibáñez, Javier; Tortosa, Avelina

2011-01-26

The DNA repair protein O6-Methylguanine-DNA methyltransferase (MGMT) confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP) the most commonly used for promoter methylation study, while immunohistochemistry (IHC) has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. A computer-aided search of MEDLINE (1950-October 2009), EBSCO (1966-October 2009) and EMBASE (1974-October 2009) was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Of 254 studies identified as eligible for full-text review, 52 (20.5%) met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others) was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably.

One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

PubMed

Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

2014-02-21

In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Reaction pathways of propene pyrolysis.

PubMed

Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

2010-05-01

The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

NASA Astrophysics Data System (ADS)

Verma, Anand Mohan; Kishore, Nanda

2017-02-01

The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

Ultrasensitive Faraday cage-type electrochemiluminescence assay for femtomolar miRNA-141 via graphene oxide and hybridization chain reaction-assisted cascade amplification.

PubMed

Lu, Jing; Wu, Lin; Hu, Yufang; Wang, Sui; Guo, Zhiyong

2018-06-30

In this study, a novel electrochemiluminescence (ECL) biosensor for sensitive detection of femtomolar miRNA-141 was constructed on the basis of Faraday cage-type strategy via graphene oxide (GO) and hybridization chain reaction (HCR)-assisted cascade amplification. A capture probe (CP) was immobilized on Fe 3 O 4 @SiO 2 @Au nanoparticles as capture unit, which could catch the miRNA-141, and the immobilization of the signal unit (Ru(phen) 3 2+ -HCR/GO) was allowed via nucleic acid hybridization. The prepared biosensor exhibited two advantages for signal amplification: firstly, GO could lap on the electrode surface directly, extending Outer Helmholtz Plane (OHP) of the sensor due to the large surface area and good electronic transport property; secondly, HCR-assisted cascade amplification was designed by anchoring all HCR products on the GO surface, then embedding Ru(phen) 3 2+ as a signal readout pathway. All these signal molecules could take part in electrochemical reactions, thus further enhancing the ECL signal drastically. Therefore, the proposed sensor constructed by integrating HCR with Faraday cage-type strategy displayed an ultrasensitive detection platform for the miRNA-141 with a low detection limit of 0.03 fM. In addition, this proposed biosensor provides a universal platform for analysis of other microRNAs. Copyright © 2018 Elsevier B.V. All rights reserved.

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

PubMed

Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

2016-11-01

Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560-568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. © 2016 Peeters et al.

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis

PubMed Central

Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh

2016-01-01

Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560–568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. PMID:27881439

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

PubMed Central

Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-01-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

Kinetics and inhibition of cyclomaltodextrinase from alkalophilic Bacillus sp. I-5.

PubMed

Kim, M J; Park, W S; Lee, H S; Kim, T J; Shin, J H; Yoo, S H; Cheong, T K; Ryu, S; Kim, J C; Kim, J W; Moon, T W; Robyt, J F; Park, K H

2000-01-01

The cyclomaltodextrinase from alkalophilic Bacillus sp. I-5 (CDase I-5) was expressed in Escherichia coli and the purified enzyme was used for characterization of the enzyme action. The hydrolysis products were monitored by both HPLC and high-performance ion chromatography analysis that enable the kinetic analysis of the cyclomaltodextrin (CD)-degrading reaction. Analysis of the kinetics of cyclomaltodextrin hydrolysis by CDase I-5 indicated that ring-opening of the cyclomaltodextrin was the major limiting step and that CDase I-5 preferentially degraded the linear maltodextrin chain by removing the maltose unit. The substrate binding affinity of the enzyme was almost same for those of cyclomaltodextrins while the rate of ring-opening was the fastest for cyclomaltoheptaose. Acarbose and methyl 6-amino-6-deoxy-alpha-d-glucopyranoside were relatively strong competitive inhibitors with K(i) values of 1.24 x 10(-3) and 8.44 x 10(-1) mM, respectively. Both inhibitors are likely to inhibit the ring-opening step of the CD degradation reaction. Copyright 2000 Academic Press.

Distemper outbreak and its effect on African wild dog conservation.

PubMed

van de Bildt, Marco W G; Kuiken, Thijs; Visee, Aart M; Lema, Sangito; Fitzjohn, Tony R; Osterhaus, Albert D M E

2002-02-01

In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.

Determination of Clinical and Demographic Predictors of Laboratory-confirmed Influenza with Subtype Analysis

DTIC Science & Technology

2012-06-07

Advisory Committee on Immunization Practicies (ACIP). vol. 57th edition. Atlanta, GA: MMWR; 2008:1–59. 3. Cox NJ, Subbarao K : Influenza. Lancet 1999...to April 2008. Reverse-transcriptase polymerase chain reaction testing and viral culture for influenza A and B with subtyping were performed on all...REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 RESEARCH

Detection of bovine meat and bone meal in animal feed at a level of 0.1%.

PubMed

Aarts, Henk J M; Bouw, El M; Buntjer, Jaap B; Lenstra, Johannes A; Van Raamsdonk, Leo W D

2006-01-01

For the control of the transmission of bovine spongiform encephalopathy in cattle via feedstuff, a real-time polymerase chain reaction assay was developed with ruminant-specific Bov-B SINE primers, SYBR Green fluorescence detection, and melting curve analysis. In formulated cattle and chicken feed samples spiked with pure bovine and sheep meat and bone meal heated at 133 degrees C for 20 min, a contamination level of 0.1% was detected.

Structural properties of films and rheology of film-forming solutions of chitosan gallate for food packaging.

PubMed

Wu, Chunhua; Tian, Jinhu; Li, Shan; Wu, Tiantian; Hu, Yaqin; Chen, Shiguo; Sugawara, Tatsuya; Ye, Xingqian

2016-08-01

The chitosan gallates (CG) were obtained by free-radical-initiated grafting of gallic acid (GA) onto chitosan (CS) in this work. The chemical structures of the CG were corroborated by UV-vis, GPC and (1)H NMR analysis. The grafting reaction was accompanied with a degradation of the CS molecule. The shear-thinning flow behavior of CG film-forming solutions (CG FFS) decreased with the grafting amount of GA into CS chain, while the CG FFS grafted at a lower GA value behaved like a networks containing entangled or cross-linked polymer chains with a more elastic behavior. The increasing of GA grafting onto the CS chain led to a reduction of tensile strength, elongation at break and water resistance in the corresponding films, but increases in the antioxidant and antimicrobial activities were observed. The microstructure of the film was investigated using scanning electron and atomic force microscope, and the results were closely related to the observed film properties. Copyright © 2016 Elsevier Ltd. All rights reserved.

Massively parallel single-molecule and single-cell emulsion reverse transcription polymerase chain reaction using agarose droplet microfluidics.

PubMed

Zhang, Huifa; Jenkins, Gareth; Zou, Yuan; Zhu, Zhi; Yang, Chaoyong James

2012-04-17

A microfluidic device for performing single copy, emulsion Reverse Transcription Polymerase Chain Reaction (RT-PCR) within agarose droplets is presented. A two-aqueous-inlet emulsion droplet generator was designed and fabricated to produce highly uniform monodisperse picoliter agarose emulsion droplets with RT-PCR reagents in carrier oil. Template RNA or cells were delivered from one inlet with RT-PCR reagents/cell lysis buffer delivered separately from the other. Efficient RNA/cell encapsulation and RT-PCR at the single copy level was achieved in agarose-in-oil droplets, which, after amplification, can be solidified into agarose beads for further analysis. A simple and efficient method to graft primer to the polymer matrix using 5'-acrydite primer was developed to ensure highly efficient trapping of RT-PCR products in agarose. High-throughput single RNA molecule/cell RT-PCR was demonstrated in stochastically diluted solutions. Our results indicate that single-molecule RT-PCR can be efficiently carried out in agarose matrix. Single-cell RT-PCR was successfully performed which showed a clear difference in gene expression level of EpCAM, a cancer biomarker gene, at the single-cell level between different types of cancer cells. This work clearly demonstrates for the first time, single-copy RT-PCR in agarose droplets. We believe this will open up new possibilities for viral RNA detection and single-cell transcription analysis.

Comprehensive in Vitro Analysis of Acyltransferase Domain Exchanges in Modular Polyketide Synthases and Its Application for Short-Chain Ketone Production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yuzawa, Satoshi; Deng, Kai; Wang, George

2016-08-22

Type I modular polyketide synthases (PKSs) are polymerases that utilize acyl-CoAs as substrates. Each polyketide elongation reaction is catalyzed by a set of protein domains called a module. Each module usually contains an acyltransferase (AT) domain, which determines the specific acyl-CoA incorporated into each condensation reaction. Although a successful exchange of individual AT domains can lead to the biosynthesis of a large variety of novel compounds, hybrid PKS modules often show significantly decreased activities. Using monomodular PKSs as models, we have systematically analyzed in this paper the segments of AT domains and associated linkers in AT exchanges in vitro andmore » have identified the boundaries within a module that can be used to exchange AT domains while maintaining protein stability and enzyme activity. Importantly, the optimized domain boundary is highly conserved, which facilitates AT domain replacements in most type I PKS modules. To further demonstrate the utility of the optimized AT domain boundary, we have constructed hybrid PKSs to produce industrially important short-chain ketones. Our in vitro and in vivo analysis demonstrated production of predicted ketones without significant loss of activities of the hybrid enzymes. Finally, these results greatly enhance the mechanistic understanding of PKS modules and prove the benefit of using engineered PKSs as a synthetic biology tool for chemical production.« less

A novel EML4-ALK variant: exon 6 of EML4 fused to exon 19 of ALK.

PubMed

Penzel, Roland; Schirmacher, Peter; Warth, Arne

2012-07-01

Cytotoxic chemotherapy remains the mainstay of treatment for most patients with advanced disease. Recently, anaplastic lymphoma kinase (ALK) expression as a major target for successful treatment with ALK inhibitors was detected in a subset of non-small-cell lung carcinomas, usually as a result of echinoderm microtubule-associated protein-like 4 (EML4)-ALK rearrangements. Although the chromosomal breakpoint within the EML4 gene varied, the breakpoint within ALK was most frequently reported within intron 19 or rarely in exon 20. Therefore, the different EML4-ALK variants so far contain the same 3' portion of ALK starting with exon 20. Here, we report a novel EML4-ALK variant detected by reverse transcription polymerase chain reaction analysis. Subsequent sequencing revealed an EML4-ALK fusion variant in which exon 6 of EML4 was fused to exon 19 of ALK. It occurred in a predominant solid pulmonary adenocarcinoma of a 65-year-old woman with a clear split signal of ALK in fluorescence in situ hybridization analysis and a weakly homogeneous ALK expression in immunohistochemical staining. Because of the growing number of fusion variants a primary reverse transcription polymerase chain reaction-based screening for ALK-positive non-small-cell lung carcinoma patients may not be sufficient for predictive diagnostics but transcript-based approaches and sequencing of ALK fusion variants might finally contribute to an optimized selection of patients.