Apparatus and method for polymer synthesis using arrays
Brennan, Thomas M.
1995-01-01
A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.
Apparatus and method for polymer synthesis using arrays
Brennan, Thomas M.
1996-01-01
A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.
Front propagation in a vortex lattice: dependence on boundary conditions and vortex depth.
Beauvier, E; Bodea, S; Pocheau, A
2016-11-04
We experimentally address the propagation of reaction-diffusion fronts in vortex lattices by combining, in a Hele-Shaw cell and at low Reynolds number, forced electroconvective flows and an autocatalytic reaction in solution. We consider both vortex chains and vortex arrays, the former referring to mixed free/rigid boundary conditions for vortices and the latter to free boundary conditions. Varying the depth of the fluid layer, we observe no variation of the mean front velocities for vortex arrays and a noticeable variation for vortex chains. This questions the two-dimensional character of front propagation in low Reynolds number vortex lattices, as well as the mechanisms of this dependence.
Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K
2016-11-01
Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp
2013-06-28
Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less
Highly exothermic and superhydrophobic Mg/fluorocarbon core/shell nanoenergetic arrays.
Zhou, Xiang; Xu, Daguo; Yang, Guangcheng; Zhang, Qiaobao; Shen, Jinpeng; Lu, Jian; Zhang, Kaili
2014-07-09
Mg/fluorocarbon core/shell nanoenergetic arrays are prepared onto silicon substrate, with Mg nanorods as the core and fluorocarbon as the shell. Mg nanorods are deposited by the glancing angle deposition technique, and the fluorocarbon layer is then prepared as a shell to encase the Mg nanorods by the magnetron sputtering deposition process. Scanning electron microscopy and transmission electron microscopy show the core/shell structure of the Mg/fluorocarbon arrays. X-ray energy-dispersive spectroscopy, X-ray diffraction, and Fourier transform infrared spectroscopy are used to characterize the structural composition of the Mg/fluorocarbon. It is found that the as-prepared fluorocarbon layer consists of shorter molecular chains compared to that of bulk polytetrafluoroethylene, which is proven beneficial to the low onset reaction temperature of Mg/fluorocarbon. Water contact angle test demonstrates the superhydrophobicity of the Mg/fluorocarbon arrays, and a static contact angle as high as 162° is achieved. Thermal analysis shows that the Mg/fluorocarbon material exhibits a very low onset reaction temperature of about 270 °C as well as an ultrahigh heat of reaction approaching 9 kJ/g. A preliminary combustion test reveals rapid combustion wave propagation, and a convective mechanism is adopted to explain the combustion behaviors.
Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R
2007-09-01
To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.
2009-01-01
Partin, P. C. Walsh, J. I. Epstein, and D. Sidransky, "Quantitative GSTP1 Methylation and the Detection of Prostate Adenocarcinoma in Sextant Biopsies...island methylation changes near the GSTP1 gene in prostatic carcinoma cells detected using the polymerase chain reaction: a new prostate cancer
NASA Astrophysics Data System (ADS)
Kim, Shin Ae; Byun, Kyung Min; Kim, Kyujung; Jang, Sung Min; Ma, Kyungjae; Oh, Youngjin; Kim, Donghyun; Kim, Sung Guk; Shuler, Michael L.; Kim, Sung June
2010-09-01
We demonstrated enhanced localized surface plasmon resonance (SPR) biosensing based on subwavelength gold nanoarrays built on a thin gold film. Arrays of nanogratings (1D) and nanoholes (2D) with a period of 200 nm were fabricated by electron-beam lithography and used for the detection of avian influenza DNA hybridization. Experimental results showed that both nanoarrays provided significant sensitivity improvement and, especially, 1D nanogratings exhibited higher SPR signal amplification compared with 2D nanohole arrays. The sensitivity enhancement is associated with changes in surface-limited reaction area and strong interactions between bound molecules and localized plasmon fields. Our approach is expected to improve both the sensitivity and sensing resolution and can be applicable to label-free detection of DNA without amplification by polymerase chain reaction.
High-spin structures in 132Xe and 133Xe and evidence for isomers along the N =79 isotones
NASA Astrophysics Data System (ADS)
Vogt, A.; Siciliano, M.; Birkenbach, B.; Reiter, P.; Hadyńska-Klek, K.; Wheldon, C.; Valiente-Dobón, J. J.; Teruya, E.; Yoshinaga, N.; Arnswald, K.; Bazzacco, D.; Blazhev, A.; Bracco, A.; Bruyneel, B.; Chakrawarthy, R. S.; Chapman, R.; Cline, D.; Corradi, L.; Crespi, F. C. L.; Cromaz, M.; de Angelis, G.; Eberth, J.; Fallon, P.; Farnea, E.; Fioretto, E.; Fransen, C.; Freeman, S. J.; Fu, B.; Gadea, A.; Gelletly, W.; Giaz, A.; Görgen, A.; Gottardo, A.; Hayes, A. B.; Hess, H.; Hetzenegger, R.; Hirsch, R.; Hua, H.; John, P. R.; Jolie, J.; Jungclaus, A.; Karayonchev, V.; Kaya, L.; Korten, W.; Lee, I. Y.; Leoni, S.; Liang, X.; Lunardi, S.; Macchiavelli, A. O.; Menegazzo, R.; Mengoni, D.; Michelagnoli, C.; Mijatović, T.; Montagnoli, G.; Montanari, D.; Müller-Gatermann, C.; Napoli, D.; Pearson, C. J.; Podolyák, Zs.; Pollarolo, G.; Pullia, A.; Queiser, M.; Recchia, F.; Regan, P. H.; Régis, J.-M.; Saed-Samii, N.; Şahin, E.; Scarlassara, F.; Seidlitz, M.; Siebeck, B.; Sletten, G.; Smith, J. F.; Söderström, P.-A.; Stefanini, A. M.; Stezowski, O.; Szilner, S.; Szpak, B.; Teng, R.; Ur, C.; Warner, D. D.; Wolf, K.; Wu, C. Y.; Zell, K. O.
2017-08-01
The transitional nuclei 132Xe and 133Xe are investigated after multinucleon-transfer (MNT) and fusion-evaporation reactions. Both nuclei are populated (i) in 136Xe+208Pb MNT reactions employing the high-resolution Advanced GAmma Tracking Array (AGATA) coupled to the magnetic spectrometer PRISMA, (ii) in the 136Xe+198Pt MNT reaction employing the GAMMASPHERE spectrometer in combination with the gas-detector array CHICO, and (iii) as an evaporation residue after a 130Te(α ,x n )134 -x nXe fusion-evaporation reaction employing the HORUS γ -ray array at the University of Cologne. The high-spin level schemes are considerably extended above the Jπ=(7-) and (10+) isomers in 132Xe and above the 11 /2- isomer in 133Xe. The results are compared to the high-spin systematics of the Z =54 as well as the N =78 and N =79 chains. Furthermore, evidence is found for a long-lived (T1 /2≫1 μ s ) isomer in 133Xe which closes a gap along the N =79 isotones. Shell-model calculations employing the SN100PN and PQM130 effective interactions reproduce the experimental findings and provide guidance to the interpretation of the observed high-spin features.
High-spin structures in Xe 132 and Xe 133 and evidence for isomers along the N = 79 isotones
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vogt, A.; Siciliano, M.; Birkenbach, B.
In this study, the transitional nuclei 132Xe and 133Xe are investigated after multinucleon-transfer (MNT) and fusion-evaporation reactions. Both nuclei are populated (i) in 136Xe + 208Pb MNT reactions employing the high-resolution Advanced GAmma Tracking Array (AGATA) coupled to the magnetic spectrometer PRISMA, (ii) in the 136Xe + 198Pt MNT reaction employing the GAMMASPHERE spectrometer in combination with the gas-detector array CHICO, and (iii) as an evaporation residue after a 130Te (α,xn) 134-xnXe fusion-evaporation reaction employing the HORUS γ -ray array at the University of Cologne. The high-spin level schemes are considerably extended above the J π = (7 -) andmore » (10 +) isomers in 132Xe and above the 11/2 - isomer in 133Xe. The results are compared to the high-spin systematics of the Z = 54 as well as the N = 78 and N = 79 chains. Furthermore, evidence is found for a long-lived (T 1/2 » 1 μs) isomer in 133Xe which closes a gap along the N = 79 isotones. Finally, shell-model calculations employing the SN100PN and PQM130 effective interactions reproduce the experimental findings and provide guidance to the interpretation of the observed high-spin features.« less
High-spin structures in Xe 132 and Xe 133 and evidence for isomers along the N = 79 isotones
Vogt, A.; Siciliano, M.; Birkenbach, B.; ...
2017-08-24
In this study, the transitional nuclei 132Xe and 133Xe are investigated after multinucleon-transfer (MNT) and fusion-evaporation reactions. Both nuclei are populated (i) in 136Xe + 208Pb MNT reactions employing the high-resolution Advanced GAmma Tracking Array (AGATA) coupled to the magnetic spectrometer PRISMA, (ii) in the 136Xe + 198Pt MNT reaction employing the GAMMASPHERE spectrometer in combination with the gas-detector array CHICO, and (iii) as an evaporation residue after a 130Te (α,xn) 134-xnXe fusion-evaporation reaction employing the HORUS γ -ray array at the University of Cologne. The high-spin level schemes are considerably extended above the J π = (7 -) andmore » (10 +) isomers in 132Xe and above the 11/2 - isomer in 133Xe. The results are compared to the high-spin systematics of the Z = 54 as well as the N = 78 and N = 79 chains. Furthermore, evidence is found for a long-lived (T 1/2 » 1 μs) isomer in 133Xe which closes a gap along the N = 79 isotones. Finally, shell-model calculations employing the SN100PN and PQM130 effective interactions reproduce the experimental findings and provide guidance to the interpretation of the observed high-spin features.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Riot, Vincent J.
The present disclosure provides a system and a method for measuring fluorescence of a sample. The sample may be a polymerase-chain-reaction (PCR) array, a loop-mediated-isothermal amplification array, etc. LEDs are used to excite the sample, and a photodiode is used to collect the sample's fluorescence. An electronic offset signal is used to reduce the effects of background fluorescence and the noises from the measurement system. An integrator integrates the difference between the output of the photodiode and the electronic offset signal over a given period of time. The resulting integral is then converted into digital domain for further processing andmore » storage.« less
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Møller, Jens Kjølseth
2012-01-01
Rapid clinical and laboratory diagnoses are the foundation for a successful management of serious infections with Neisseria meningitidis. A species-specific multiplex polymerase chain reaction (PCR) coupled with fluidic microarrays using microbeads (the Luminex xMAP™ Technology) can detect pathogens most frequently found in the cerebrospinal fluid of patients. The Luminex suspension array system uniquely combines flow cytometry, microspheres, laser technology, digital signal processing, and traditional chemistry. In this method, the reaction is carried out in one vessel, in which distinctly color-coded bead sets, each conjugated with a different specific nucleic acid reactant, are hybridized with the PCR products, and a reporter molecule is used to quantify the interaction. The flow-based Luminex array reader identifies each reaction (bead set) after excitation by a red classification laser. Reporter signals from each reaction are simultaneously quantified by fluorescence generated by a green reporter laser. This nonculture, multiplex assay may prove to be an important tool for optimal laboratory diagnosis, not only of meningococcal meningitis, but also of meningitis caused by other bacterial or viral pathogens.
Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo
2011-01-03
In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.
Consolandi, Clarissa
2009-01-01
One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.
System and method for measuring fluorescence of a sample
Riot, Vincent J
2015-03-24
The present disclosure provides a system and a method for measuring fluorescence of a sample. The sample may be a polymerase-chain-reaction (PCR) array, a loop-mediated-isothermal amplification array, etc. LEDs are used to excite the sample, and a photodiode is used to collect the sample's fluorescence. An electronic offset signal is used to reduce the effects of background fluorescence and the noises from the measurement system. An integrator integrates the difference between the output of the photodiode and the electronic offset signal over a given period of time. The resulting integral is then converted into digital domain for further processing and storage.
Fluorescence-based bioassays for the detection and evaluation of food materials.
Nishi, Kentaro; Isobe, Shin-Ichiro; Zhu, Yun; Kiyama, Ryoiti
2015-10-13
We summarize here the recent progress in fluorescence-based bioassays for the detection and evaluation of food materials by focusing on fluorescent dyes used in bioassays and applications of these assays for food safety, quality and efficacy. Fluorescent dyes have been used in various bioassays, such as biosensing, cell assay, energy transfer-based assay, probing, protein/immunological assay and microarray/biochip assay. Among the arrays used in microarray/biochip assay, fluorescence-based microarrays/biochips, such as antibody/protein microarrays, bead/suspension arrays, capillary/sensor arrays, DNA microarrays/polymerase chain reaction (PCR)-based arrays, glycan/lectin arrays, immunoassay/enzyme-linked immunosorbent assay (ELISA)-based arrays, microfluidic chips and tissue arrays, have been developed and used for the assessment of allergy/poisoning/toxicity, contamination and efficacy/mechanism, and quality control/safety. DNA microarray assays have been used widely for food safety and quality as well as searches for active components. DNA microarray-based gene expression profiling may be useful for such purposes due to its advantages in the evaluation of pathway-based intracellular signaling in response to food materials.
Fluorescence-Based Bioassays for the Detection and Evaluation of Food Materials
Nishi, Kentaro; Isobe, Shin-Ichiro; Zhu, Yun; Kiyama, Ryoiti
2015-01-01
We summarize here the recent progress in fluorescence-based bioassays for the detection and evaluation of food materials by focusing on fluorescent dyes used in bioassays and applications of these assays for food safety, quality and efficacy. Fluorescent dyes have been used in various bioassays, such as biosensing, cell assay, energy transfer-based assay, probing, protein/immunological assay and microarray/biochip assay. Among the arrays used in microarray/biochip assay, fluorescence-based microarrays/biochips, such as antibody/protein microarrays, bead/suspension arrays, capillary/sensor arrays, DNA microarrays/polymerase chain reaction (PCR)-based arrays, glycan/lectin arrays, immunoassay/enzyme-linked immunosorbent assay (ELISA)-based arrays, microfluidic chips and tissue arrays, have been developed and used for the assessment of allergy/poisoning/toxicity, contamination and efficacy/mechanism, and quality control/safety. DNA microarray assays have been used widely for food safety and quality as well as searches for active components. DNA microarray-based gene expression profiling may be useful for such purposes due to its advantages in the evaluation of pathway-based intracellular signaling in response to food materials. PMID:26473869
A novel miniaturized PCR multi-reactor array fabricated using flip-chip bonding techniques
NASA Astrophysics Data System (ADS)
Zou, Zhi-Qing; Chen, Xiang; Jin, Qing-Hui; Yang, Meng-Su; Zhao, Jian-Long
2005-08-01
This paper describes a novel miniaturized multi-chamber array capable of high throughput polymerase chain reaction (PCR). The structure of the proposed device is verified by using finite element analysis (FEA) to optimize the thermal performance, and then implemented on a glass-silicon substrate using a standard MEMS process and post-processing. Thermal analysis simulation and verification of each reactor cell is equipped with integrated Pt temperature sensors and heaters at the bottom of the reaction chamber for real-time accurate temperature sensing and control. The micro-chambers are thermally separated from each other, and can be controlled independently. The multi-chip array was packaged on a printed circuit board (PCB) substrate using a conductive polymer flip-chip bonding technique, which enables effective heat dissipation and suppresses thermal crosstalk between the chambers. The designed system has successfully demonstrated a temperature fluctuation of ±0.5 °C during thermal multiplexing of up to 2 × 2 chambers, a full speed of 30 min for 30 cycle PCR, as well as the capability of controlling each chamber digitally and independently.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srinivasan, G., E-mail: srinivas@oakland.edu; Sreenivasulu, G.; Benoit, Crystal
2015-05-07
Composites of ferromagnetic and ferroelectric are of interest for studies on mechanical strain mediated magneto-electric (ME) interactions and for useful technologies. Here, we report on magnetic-field-assisted-assembly of barium titanate (BTO)-nickel ferrite (NFO) core-shell particles into linear chains and 2D/3D arrays and measurements of ME effects in such assemblies. First, we synthesized the core-shell nano-particles with 50–600 nm BTO and 10–200 nm NFO by chemical self-assembly by coating the ferroic particles with complementary coupling groups and allowing them to self-assemble in the presence of a catalyst via the “click” reaction. The core-shell structure was confirmed with electron microscopy and scanning probe microscopy. Wemore » obtained superstructure of the core-shell particles by subjecting them to a magnetic field gradient that exerts an attractive force on the particles and align them toward the regions of high field strengths. At low particle concentration, linear chains were formed and they evolved into 2D and 3D arrays at high particle concentrations. Magnetoelectric characterization on unassembled films and assembled arrays has been performed through measurements of low-frequency ME voltage coefficient (MEVC) by subjecting the sample to a bias magnetic field and an ac magnetic field. The MEVC is higher for field-assembled samples than for unassembled films and is found to be sensitive to field orientation with a higher MEVC for magnetic fields parallel to the array direction than for magnetic fields perpendicular to the array. A maximum MEVC of 20 mV/cm Oe, one of the highest reported for any bulk nanocomposite, is measured across the array thickness. A model is provided for ME coupling in the superstructures of BTO-NFO particulate composites. First, we estimated the MEVC for a free-standing BTO-NFO core-shell particle and then extended the model to include an array of linear chains of the particles. The theoretical estimates are in qualitative agreement with the data.« less
NASA Astrophysics Data System (ADS)
Srinivasan, G.; Sreenivasulu, G.; Benoit, Crystal; Petrov, V. M.; Chavez, F.
2015-05-01
Composites of ferromagnetic and ferroelectric are of interest for studies on mechanical strain mediated magneto-electric (ME) interactions and for useful technologies. Here, we report on magnetic-field-assisted-assembly of barium titanate (BTO)-nickel ferrite (NFO) core-shell particles into linear chains and 2D/3D arrays and measurements of ME effects in such assemblies. First, we synthesized the core-shell nano-particles with 50-600 nm BTO and 10-200 nm NFO by chemical self-assembly by coating the ferroic particles with complementary coupling groups and allowing them to self-assemble in the presence of a catalyst via the "click" reaction. The core-shell structure was confirmed with electron microscopy and scanning probe microscopy. We obtained superstructure of the core-shell particles by subjecting them to a magnetic field gradient that exerts an attractive force on the particles and align them toward the regions of high field strengths. At low particle concentration, linear chains were formed and they evolved into 2D and 3D arrays at high particle concentrations. Magnetoelectric characterization on unassembled films and assembled arrays has been performed through measurements of low-frequency ME voltage coefficient (MEVC) by subjecting the sample to a bias magnetic field and an ac magnetic field. The MEVC is higher for field-assembled samples than for unassembled films and is found to be sensitive to field orientation with a higher MEVC for magnetic fields parallel to the array direction than for magnetic fields perpendicular to the array. A maximum MEVC of 20 mV/cm Oe, one of the highest reported for any bulk nanocomposite, is measured across the array thickness. A model is provided for ME coupling in the superstructures of BTO-NFO particulate composites. First, we estimated the MEVC for a free-standing BTO-NFO core-shell particle and then extended the model to include an array of linear chains of the particles. The theoretical estimates are in qualitative agreement with the data.
Performance studies of X3 silicon detectors for the future ELISSA array at ELI-NP
NASA Astrophysics Data System (ADS)
Chesnevskaya, S.; Balabanski, D. L.; Choudhury, D.; Constantin, P.; Filipescu, D. M.; Ghita, D. G.; Guardo, G. L.; Lattuada, D.; Matei, C.; Rotaru, A.; State, A.
2018-05-01
ELISSA is an array of silicon strip detectors under construction at the ELI-NP facility for measurements of photodissociation reactions using high-brilliance, quasi monoenergetic gamma beams. The detection system consists of 35 single-sided position-sensitive X3 detectors arranged in a cylindrical configuration and eight QQQ3 detectors as end-caps. A batch of forty X3 detectors have been tested at ELI-NP. The energy and position resolution, ballistic deficit, leakage currents, and depletion voltage were measured and analyzed. Measurements of the energy resolution were carried out using two read-out electronic chains, one based on multichannel preamplifiers and another based on multiplexers.
Tanoue, Ryota; Higuchi, Rintaro; Ikebe, Kiryu; Uemura, Shinobu; Kimizuka, Nobuo; Stieg, Adam Z; Gimzewski, James K; Kunitake, Masashi
2012-10-02
Two-dimensional (2D) arrays of π-conjugated aromatic polymers produced by surface-selective Schiff base coupling reactions between an aromatic diamine and an aromatic dialdehyde were investigated in detail using in situ scanning tunneling microscopy. Surface-selective coupling was achieved for almost all diamine/dialdehyde combinations attempted, although several combinations did not proceed even in homogeneous aqueous alkaline solution. Most of the combinations of an aromatic diamine and a dialdehyde, except the combinations of 4,4'-azodianiline with mono/bithiophenedicarboxaldehyde, formed highly ordered π-conjugated polymer arrays on an iodine-modified Au(111) surface in aqueous solution at a suitable pH. The simplest polymer of the various combinations tested, obtained from the combination of 1,4-diaminobenzene with terephthaldicarboxaldehyde, gave a 2D array consisting of linearly connected benzene units. Poly(azomethine) adlayers caused a positive shift in the electrochemical potential of the butterfly shaped oxidative adsorption and reductive desorption of iodine. The acceleration of the reductive desorption of iodine suggests the existence of a weak interaction between the polymer layer and iodine. Not only the first polymer adlayers but also partially adsorbed secondary adlayers with "on-top" epitaxial behavior were frequently observed for all polymer systems. The alignment of the polymer chains in the adlayers possessed a certain regularity in terms of a regular interval between polymer chains because of repulsive interpolymer interactions.
A multiple multicomponent approach to chimeric peptide-peptoid podands.
Rivera, Daniel G; León, Fredy; Concepción, Odette; Morales, Fidel E; Wessjohann, Ludger A
2013-05-10
The success of multi-armed, peptide-based receptors in supramolecular chemistry traditionally is not only based on the sequence but equally on an appropriate positioning of various peptidic chains to create a multivalent array of binding elements. As a faster, more versatile and alternative access toward (pseudo)peptidic receptors, a new approach based on multiple Ugi four-component reactions (Ugi-4CR) is proposed as a means of simultaneously incorporating several binding and catalytic elements into organizing scaffolds. By employing α-amino acids either as the amino or acid components of the Ugi-4CRs, this multiple multicomponent process allows for the one-pot assembly of podands bearing chimeric peptide-peptoid chains as appended arms. Tripodal, bowl-shaped, and concave polyfunctional skeletons are employed as topologically varied platforms for positioning the multiple peptidic chains formed by Ugi-4CRs. In a similar approach, steroidal building blocks with several axially-oriented isocyano groups are synthesized and utilized to align the chimeric chains with conformational constrains, thus providing an alternative to the classical peptido-steroidal receptors. The branched and hybrid peptide-peptoid appendages allow new possibilities for both rational design and combinatorial production of synthetic receptors. The concept is also expandable to other multicomponent reactions. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mano, Junichi; Shigemitsu, Natsuki; Futo, Satoshi; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Furui, Satoshi; Kitta, Kazumi
2009-01-14
We developed a novel type of real-time polymerase chain reaction (PCR) array with TaqMan chemistry as a platform for the comprehensive and semiquantitative detection of genetically modified (GM) crops. Thirty primer-probe sets for the specific detection of GM lines, recombinant DNA (r-DNA) segments, endogenous reference genes, and donor organisms were synthesized, and a 96-well PCR plate was prepared with a different primer-probe in each well as the real-time PCR array. The specificity and sensitivity of the array were evaluated. A comparative analysis with the data and publicly available information on GM crops approved in Japan allowed us to assume the possibility of unapproved GM crop contamination. Furthermore, we designed a Microsoft Excel spreadsheet application, Unapproved GMO Checker version 2.01, which helps process all the data of real-time PCR arrays for the easy assumption of unapproved GM crop contamination. The spreadsheet is available free of charge at http://cse.naro.affrc.go.jp/jmano/index.html .
The breakout of the Hot CNO cycle via ^18Ne resonant states
NASA Astrophysics Data System (ADS)
Almaraz-Calderon, S.; Tan, W.; Aprahamian, A.; Bucher, B.; Gorres, J.; Roberts, A.; Villano, A.; Wiescher, M.; Brune, C.; Heinen, Z.; Massey, T.; Ozkan, N.; Guray, R. T.; Mach, H.
2010-11-01
The energy generation rate in the HCNO cycle is limited by the β decay of the waiting point nuclei ^14O and ^15O. However, when the temperatures and densities are high enough (e.g. Novae and X-ray Bursts) it is possible to bypass them by p/α captures resulting in a thermonuclear runaway towards the rp-process. One of the two paths for breakouts from the HCNO cycle is the reaction chain ^14O(α,p)^17F(p,γ)^18Ne(α,p), which proceeds through resonant states on ^18Ne, making their reactions rates very sensitive on the partial and total widths, excitation energies and spins of such resonances. We studied the resonant states in ^18Ne via ^16O(^3He,n) reaction. The neutrons were measured with an array of liquid scintillators using Time-of-Flight and pulse-shape discrimination techniques. The charged particles were detected in coincidence with neutrons by an array of silicon detectors, allowing us to measure α, p, p' and 2p decay branching ratios. Tentative spin assignments were made in comparison with zero range DWBA calculations. This new information will be included in reaction network calculations to evaluate its impact on the nuclear energy generation that occurs in these stellar explosive environments.
Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva
2012-01-01
Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.
Rahal, M; Kervaire, B; Villard, J; Tiercy, J-M
2008-03-01
Human leukocyte antigen (HLA) typing by polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) hybridization on solid phase (microbead assay) or polymerase chain reaction-sequence-specific primers (PCR-SSP) requires interpretation softwares to detect all possible allele combinations. These programs propose allele calls by taking into account false-positive or false-negative signal(s). The laboratory has the option to validate typing results in the presence of strongly cross-reacting or apparent false-negative signals. Alternatively, these seemingly aberrant signals may disclose novel variants. We report here four new HLA-B (B*5620 and B*5716) and HLA-DRB1 alleles (DRB1*110107 and DRB1*1474) that were detected by apparent false-negative or -positive hybridization or amplification patterns, and ultimately resolved by sequencing. To avoid allele misassignments, a comprehensive evaluation of acquired data as documented in a quality assurance system is therefore required to confirm unambiguous typing interpretation.
The high-throughput synthesis and phase characterisation of amphiphiles: a sweet case study.
Feast, George C; Hutt, Oliver E; Mulet, Xavier; Conn, Charlotte E; Drummond, Calum J; Savage, G Paul
2014-03-03
A new method for the discovery of amphiphiles by using high-throughput (HT) methods to synthesise and characterise a library of galactose- and glucose-containing amphiphilic compounds is presented. The copper-catalysed azide–alkyne cycloaddition (CuAAC) “click” reaction between azide-tethered simple sugars and alkyne-substituted hydrophobic tails was employed to synthesise a library of compounds with systematic variations in chain length and unsaturation in a 24-vial array format. The liquid–crystalline phase behaviour was characterised in a HT manner by using synchrotron small-angle X-ray scattering (SSAXS). The observed structural variation with respect to chain parameters, including chain length and degree of unsaturation, is discussed, as well as hydration effects and degree of hydrogen bonding between head groups. The validity of our HT screening approach was verified by resynthesising a short-chain glucose amphiphile. A separate phase analysis of this compound confirmed the presence of numerous lyotropic liquid–crystalline phases.
Poritz, Mark A.; Blaschke, Anne J.; Byington, Carrie L.; Meyers, Lindsay; Nilsson, Kody; Jones, David E.; Thatcher, Stephanie A.; Robbins, Thomas; Lingenfelter, Beth; Amiott, Elizabeth; Herbener, Amy; Daly, Judy; Dobrowolski, Steven F.; Teng, David H. -F.; Ririe, Kirk M.
2011-01-01
The ideal clinical diagnostic system should deliver rapid, sensitive, specific and reproducible results while minimizing the requirements for specialized laboratory facilities and skilled technicians. We describe an integrated diagnostic platform, the “FilmArray”, which fully automates the detection and identification of multiple organisms from a single sample in about one hour. An unprocessed biologic/clinical sample is subjected to nucleic acid purification, reverse transcription, a high-order nested multiplex polymerase chain reaction and amplicon melt curve analysis. Biochemical reactions are enclosed in a disposable pouch, minimizing the PCR contamination risk. FilmArray has the potential to detect greater than 100 different nucleic acid targets at one time. These features make the system well-suited for molecular detection of infectious agents. Validation of the FilmArray technology was achieved through development of a panel of assays capable of identifying 21 common viral and bacterial respiratory pathogens. Initial testing of the system using both cultured organisms and clinical nasal aspirates obtained from children demonstrated an analytical and clinical sensitivity and specificity comparable to existing diagnostic platforms. We demonstrate that automated identification of pathogens from their corresponding target amplicon(s) can be accomplished by analysis of the DNA melting curve of the amplicon. PMID:22039434
Jiang, Z; Gui, S; Zhang, Y
2011-05-01
Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.
Fessehaie, Anania; De Boer, Solke H; Lévesque, C André
2003-03-01
ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.
Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials
NASA Astrophysics Data System (ADS)
Chapman, Peter Henry
Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are retained for M -˜ 2.7 and above.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
Copy Number Variations of TBK1 in Australian Patients With Primary Open-Angle Glaucoma
AWADALLA, MONA S.; FINGERT, JOHN H.; ROOS, BENJAMIN E.; CHEN, SIMON; HOLMES, RICHARD; GRAHAM, STUART L.; CHEHADE, MARK; GALANOPOLOUS, ANNA; RIDGE, BRONWYN; SOUZEAU, EMMANUELLE; ZHOU, TIGER; SIGGS, OWEN M.; HEWITT, ALEX W.; MACKEY, DAVID A.; BURDON, KATHRYN P.; CRAIG, JAMIE E.
2015-01-01
PURPOSE To investigate the presence of TBK1 copy number variations in a large, well-characterized Australian cohort of patients with glaucoma comprising both normal-tension glaucoma and high-tension glaucoma cases. DESIGN A retrospective cohort study. METHODS DNA samples from patients with normal-tension glaucoma and high-tension glaucoma and unaffected controls were screened for TBK1 copy number variations using real-time quantitative polymerase chain reaction. Samples with additional copies of the TBK1 gene were further tested using custom comparative genomic hybridization arrays. RESULTS Four out of 334 normal-tension glaucoma cases (1.2%) were found to carry TBK1 copy number variations using quantitative polymerase chain reaction. One extra dose of the TBK1 gene (duplication) was detected in 3 normal-tension glaucoma patients, while 2 extra doses of the gene (triplication) were detected in a fourth normal-tension glaucoma patient. The results were further confirmed by custom comparative genomic hybridization arrays. Further, the TBK1 copy number variation segregated with normal-tension glaucoma in the family members of the probands, showing an autosomal dominant pattern of inheritance. No TBK1 copy number variations were detected in 1045 Australian patients with high-tension glaucoma or in 254 unaffected controls. CONCLUSION We report the presence of TBK1 copy number variations in our Australian normal-tension glaucoma cohort, including the first example of more than 1 extra copy of this gene in glaucoma patients (gene triplication). These results confirm TBK1 to be an important cause of normal-tension glaucoma, but do not suggest common involvement in high-tension glaucoma. PMID:25284765
Genome-wide and digital polymerase chain reaction epigenetic assessments of alcohol consumption.
Philibert, Robert; Dogan, Meesha; Noel, Amanda; Miller, Shelly; Krukow, Brianna; Papworth, Emma; Cowley, Joseph; Knudsen, April; Beach, Steven R H; Black, Donald
2018-04-28
The lack of readily employable biomarkers of alcohol consumption is a problem for clinicians and researchers. In 2014, we published a preliminary DNA methylation signature of heavy alcohol consumption that remits as a function of abstinence. Herein, we present new genome-wide methylation findings from a cohort of additional subjects and a meta-analysis of the data. Using DNA from 47 consecutive heavy drinkers admitted for alcohol detoxification in the context of alcohol treatment and 47 abstinent controls, we replicate the 2014 results and show that 21,221 CpG residues are differentially methylated in active heavy drinkers. Meta-analysis of all data from the 448,058 probes common to the two methylation platforms shows a similarly profound signature with confirmation of findings from other groups. Principal components analyses show that genome-wide methylation changes in response to alcohol consumption load on two major factors with one component accounting at least 50% of the total variance in both smokers and nonsmoking alcoholics. Using data from the arrays, we derive a panel of five methylation probes that classifies use status with a receiver operator characteristic area under the curve (AUC) of 0.97. Finally, using droplet digital polymerase chain reaction (PCR), we convert these array-based findings to two marker assays with an AUC of 0.95 and a four marker set AUC of 0.98. We conclude that DNA methylation assessments are capable of quantifying alcohol use status and suggest that readily employable digital PCR approaches for substance consumption may find widespread use in alcohol-related research and patient care. © 2018 Wiley Periodicals, Inc.
Added clinical value of the inferior temporal EEG electrode chain.
Bach Justesen, Anders; Eskelund Johansen, Ann Berit; Martinussen, Noomi Ida; Wasserman, Danielle; Terney, Daniella; Meritam, Pirgit; Gardella, Elena; Beniczky, Sándor
2018-01-01
To investigate the diagnostic added value of supplementing the 10-20 EEG array with six electrodes in the inferior temporal chain. EEGs were recorded with 25 electrodes: 19 positions of the 10-20 system, and six additional electrodes in the inferior temporal chain (F9/10, T9/10, P9/10). Five-hundred consecutive standard and sleep EEG recordings were reviewed using the 10-20 array and the extended array. We identified the recordings with EEG abnormalities that had peak negativities at the inferior temporal electrodes, and those that only were visible at the inferior temporal electrodes. From the 286 abnormal recordings, the peak negativity was at the inferior temporal electrodes in 81 cases (28.3%) and only visible at the inferior temporal electrodes in eight cases (2.8%). In the sub-group of patients with temporal abnormalities (n = 134), these represented 59% (peak in the inferior chain) and 6% (only seen at the inferior chain). Adding six electrodes in the inferior temporal electrode chain to the 10-20 array improves the localization and identification of EEG abnormalities, especially those located in the temporal region. Our results suggest that inferior temporal electrodes should be added to the EEG array, to increase the diagnostic yield of the recordings. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Clapp, Jannine ; Mitchell, Laura M. ; Bolland, Daniel J. ; Fantes, Judy ; Corcoran, Anne E. ; Scotting, Paul J. ; Armour, John A. L. ; Hewitt, Jane E.
2007-01-01
Facioscapulohumeral muscular dystrophy (FSHD) is caused by deletions within the polymorphic DNA tandem array D4Z4. Each D4Z4 repeat unit has an open reading frame (ORF), termed “DUX4,” containing two homeobox sequences. Because there has been no evidence of a transcript from the array, these deletions are thought to cause FSHD by a position effect on other genes. Here, we identify D4Z4 homologues in the genomes of rodents, Afrotheria (superorder of elephants and related species), and other species and show that the DUX4 ORF is conserved. Phylogenetic analysis suggests that primate and Afrotherian D4Z4 arrays are orthologous and originated from a retrotransposed copy of an intron-containing DUX gene, DUXC. Reverse-transcriptase polymerase chain reaction and RNA fluorescence and tissue in situ hybridization data indicate transcription of the mouse array. Together with the conservation of the DUX4 ORF for >100 million years, this strongly supports a coding function for D4Z4 and necessitates re-examination of current models of the FSHD disease mechanism. PMID:17668377
Liao, Can; Fu, Fang; Yang, Xin; Sun, Yi-Min; Li, Dong-Zhi
2011-06-01
Primary ovarian insufficiency (POI) is defined as a primary ovarian defect characterized by absent menarche (primary amenorrhea) or premature depletion of ovarian follicles before the age of 40 years. The etiology of primary ovarian insufficiency in human female patients is still unclear. The purpose of this study is to investigate the potential genetic causes in primary amenorrhea patients by high resolution array based comparative genomic hybridization (array-CGH) analysis. Following the standard karyotyping analysis, genomic DNA from whole blood of 15 primary amenorrhea patients and 15 normal control women was hybridized with Affymetrix cytogenetic 2.7M arrays following the standard protocol. Copy number variations identified by array-CGH were confirmed by real time polymerase chain reaction. All the 30 samples were negative by conventional karyotyping analysis. Microdeletions on chromosome 17q21.31-q21.32 with approximately 1.3 Mb were identified in four patients by high resolution array-CGH analysis. This included the female reproductive secretory pathway related factor N-ethylmaleimide-sensitive factor (NSF) gene. The results of the present study suggest that there may be critical regions regulating primary ovarian insufficiency in women with a 17q21.31-q21.32 microdeletion. This effect might be due to the loss of function of the NSF gene/genes within the deleted region or to effects on contiguous genes.
Signal chain for the Airborne Visible/Infrared Imaging Spectrometer (AVIRIS)
NASA Technical Reports Server (NTRS)
Bunn, James S., Jr.
1988-01-01
The AVIRIS instrument has a separate dedicated analog signal processing chain for each of its four spectrometers. The signal chains amplify low-level focal-plane line array signals (5 to 10 mV full-scale span) in the presence of larger multiplexing signals (approx 150 mV) providing the data handling system a ten-bit digital word (for each spectrometer) each 1.3 microns. This signal chain provides automatic correction for the line array dark signal nonuniformity (which can approach the full-scale signal span).
Signal chain for the Airborne Visible/Infrared Imaging Spectrometer (AVIRIS)
NASA Technical Reports Server (NTRS)
Bunn, James S., Jr.
1987-01-01
The AVIRIS instrument has a separate dedicated analog signal processing chain for each of its four spectrometers. The signal chains amplify low-level focal-plane line array signals (5 to 10 mV full-scale span) in the presence of larger multiplexing signals (approx 150 mV) providing the data handling system a ten-bit digital word (for each spectrometer) each 1.3 microns. This signal chain provides automatic correction for the line array dark signal nonuniformity (which can approach the full-scale signal span).
Simple model of inhibition of chain-branching combustion processes
NASA Astrophysics Data System (ADS)
Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.
2017-11-01
A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.
[Comparative cost analysis of molecular biology methods in the diagnosis of sarcomas].
Baffert, Sandrine; Italiano, Antoine; Pierron, Gaëlle; Traoré, Marie-Angèle; Rapp, Jocelyn; Escande, Fabienne; Ghnassia, Jean-Pierre; Terrier, Philippe; Voegeli, Anne-Claire; Ranchere-Vince, Dominique; Coindre, Jean-Michel; Pedeutour, Florence
2013-10-01
Sarcomas represent a complex and heterogeneous group of rare malignant tumors and their correct diagnosis is often difficult. Recent molecular biological techniques have been of great diagnostic use and there is a need to assess the cost of these procedures in routine clinical practice. Using prospective and observational data from eight molecular biology laboratories in France, we used "microcosting" method to assess the cost of molecular biological techniques in the diagnosis of five types of sarcoma. The mean cost of fluorescence in situ hybridization (FISH) was 318 € (273-393) per sample; mean reverse transcription polymerase chain reaction (RT-PCR) cost ranged from 300 € (229-481) per formalin-fixed, paraffin-embedded specimen to 258 € (213-339) per frozen specimen; mean quantitative polymerase chain reaction (Q-PCR) cost was 184 € (112-229) and mean CGH-array cost was 332 € (329-335). The cost of these recently implemented techniques varied according to the type of sarcoma; the method of tissue collection and local organizational factors including the level of local expertise and investment. The cost of molecular diagnostic techniques needs to be balanced against their respective performance.
Saksono, Budi; Dewi, Beti Ernawati; Nainggolan, Leonardo; Suda, Yasuo
2015-01-01
We propose a novel method of detecting trace amounts of dengue virus (DENVs) from serum. Our method is based on the interaction between a sulfated sugar chain and a DENV surface glycoprotein. After capturing DENV with the sulfated sugar chain-immobilized gold nanoparticles (SGNPs), the resulting complex is precipitated and viral RNA content is measured using the reverse-transcription quantitative polymerase chain reaction SYBR Green I (RT-qPCR-Syb) method. Sugar chains that bind to DENVs were identified using the array-type sugar chain immobilized chip (Sugar Chip) and surface plasmon resonance (SPR) imaging. Heparin and low-molecular-weight dextran sulfate were identified as binding partners, and immobilized on gold nanoparticles to prepare 3 types of SGNPs. The capacity of these SGNPs to capture and concentrate trace amounts of DENVs was evaluated in vitro. The SGNP with greatest sensitivity was tested using clinical samples in Indonesia in 2013-2014. As a result, the novel method was able to detect low concentrations of DENVs using only 6 μL of serum, with similar sensitivity to that of a Qiagen RNA extraction kit using 140 μL of serum. In addition, this method allows for multiplex-like identification of serotypes of DENVs. This feature is important for good healthcare management of DENV infection in order to safely diagnose the dangerous, highly contagious disease quickly, with high sensitivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jinlong, Lv, E-mail: ljltsinghua@126.com; State Key Lab of New Ceramic and Fine Processing, Tsinghua University, Beijing 100084; Tongxiang, Liang, E-mail: txliang@mail.tsinghua.edu.cn
The effects of urea concentration on microstructures of Ni{sub 3}S{sub 2}formed on nickel foam and its hydrogen evolution reaction were investigated. The Ni{sub 3}S{sub 2} nanosheets with porous structure were formed on nickel foam during hydrothermal process due to low urea concentration. While high urea concentration facilitated the forming of Ni{sub 3}S{sub 2} nanotube arrays. The resulting Ni{sub 3}S{sub 2} nanotube arrays exhibited higher catalytic activity than Ni3S2nanosheets for hydrogen evolution reaction. This was mainly attributed to a fact that Ni{sub 3}S{sub 2} nanotube arrays facilitated diffusion of electrolyte for hydrogen evolution reaction. - Graphical abstract: The resulting Ni{sub 3}S{submore » 2} nanotube arrays exhibited higher catalytic activity than Ni{sub 3}S{sub 2} nanosheets for hydrogen evolution reaction. This was mainly attributed to a fact that Ni{sub 3}S{sub 2} nanotube arrays facilitated diffusion of electrolyte for hydrogen evolution reaction and hydrogen evolution. - Highlights: • Urea promoted to forming more Ni{sub 3}S{sub 2} nanotube arrays on nickel foam. • Ni{sub 3}S{sub 2} nanotube arrays showed higher catalytic activity in alkaline solution. • Ni{sub 3}S{sub 2} nanotube arrays promoted electron transport and reaction during the HER.« less
Code of Federal Regulations, 2010 CFR
2010-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Zhu, Tao; Gao, Wen; Chen, Xi; Zhang, Ying; Wu, Meijuan; Zhang, Ping; Wang, Shihua
2017-01-01
Early diagnosis of epithelial ovarian cancer is critical for patient survival. The objective of this pilot study is to identify a circulating micro (mi)RNA as a potential biomarker for epithelial ovarian cancer. A total of 135 epithelial ovarian cancer patients and 54 benign ovarian tumor patients were recruited for this study. Using customized TaqMan low density miRNA arrays, we first screened expression levels of 48 miRNAs in sera from 18 epithelial ovarian cancer patients and 16 benign ovarian tumor patients. The most significantly and differentially expressed miRNA was then further examined in all serum samples using real-time polymerase chain reaction. Its expression was further analyzed in relationship with clinicopathological factors and patient survival. Array screening data showed that expression levels of serum miRNA-20a, miRNA-125b, miRNA-126, miRNA-355, and let-7c were significantly different between malignant and benign ovarian tumor patients. Subsequent real-time polymerase chain reaction results showed that serum miRNA-125b levels were significantly higher in epithelial ovarian cancer patients compared to benign controls. Moreover, serum miRNA-125b levels were significantly higher in ovarian cancer patients in early stages I and II, and in patients having no residual tumor following surgery, but were not associated with differentiation and histological types of ovarian cancer. Notably, the higher level of miR-125b was significantly positively correlated with progression-free survival (P = 0.035) and marginally, with overall survival (P = 0.069). miRNA-125b plays an important role in the pathogenesis and progression of epithelial ovarian cancer. Circulating miRNA-125b has the potential to become a novel biomarker for early diagnosis and prognosis prediction of epithelial ovarian cancer.
Chiang, Han-Sun; Wu, Yi-No; Wu, Chien-Chih; Hwang, Jiann-Loung
2013-02-01
XX male is a rare sex chromosomal disorder in infertile men. The purpose of this study was to distinguish the clinical and genetic features of the 46,XX male syndrome from other more frequent, testicular-origin azoospermic causes of male infertility. To study 46,XX male syndrome, we compared clinical and endocrinological parameters to other groups with testicular-origin azoospermia, and to an age-matched group of healthy males and females as normal control. Fluorescent in situ hybridization for detection and localization of the sex-determining region of the Y gene (SRY), array-based comparative genomic hybridization screening, and real-time qualitative polymerase chain reaction of FGF9, WT1, NR5A1, and SPRY2 genes were performed in this genetic investigation. Our three patients with 46,XX male syndrome had a much higher follicular-stimulating hormone level, lower body height, lower testosterone level, and ambiguous external genitalia. One of the three patients with 46,XX male syndrome was SRY-negative. A further genetic study, including a comparative genomic hybridization array and real-time polymerase chain reaction, showed a gain of FGF9 copy numbers only in the SRY-negative 46,XX male. The genetic copy number of the FGF9 gene was duplicated in that case compared to the normal female control and was significantly lower than that of the normal male control. No such genomic gain was observed in the case of the two SRY-positive 46,XX males. Similar to clinical manifestations of 46,XX male syndrome, genetic evidence in this study suggests that FGF9 may contribute to sex reversal, but additional confirmation with more cases is still needed. Copyright © 2012. Published by Elsevier B.V.
Chain-reaction crash in traffic flow controlled by taillights
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2015-02-01
We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.
Small nickel nanoparticle arrays from long chain imidazolium ionic liquids
Yang, Mei; Campbell, Paul S.; Santini, Catherine C.; ...
2013-11-08
A series of six long chain alkyl mono- and bi-cationic imidazolium based salts with bis(trifluoromethylsulfonyl)imide (NTf 2–) as the anion were synthesized and characterized. Single crystal structure of 1-methyl-3-octadecylimidazolium bis(trifluoromethylsulfonyl)imide could be obtained by X-ray analysis. All these long chain alkyl imidazolium based ILs were applied in the synthesis of nickel nanoparticles via chemical decomposition of an organometallic precursor of nickel. In these media, spontaneous decomposition of Ni(COD) 2 (COD = 1,5-cyclooctadiene) in the absence of H 2 occurred giving small NPs (≤4 nm) with narrow size distributions. Interestingly, formation of regularly interspaced NP arrays was also observed in longmore » chain ILs. Lastly, such array formation could be interesting for potential applications such as carbon nanotube growth.« less
Study on the pyrolysis of cellulose for bio-oil with mesoporous molecular sieve catalysts.
Yu, Feng-wen; Ji, Deng-xiang; Nie, Yong; Luo, Yao; Huang, Cheng-jie; Ji, Jian-bing
2012-09-01
Mesoporous materials possess a hexagonal array of uniform mesopores, high surface areas, and moderate acidity. They are one of the important catalysts in the field of catalytic pyrolysis. In this paper, mesoporous materials of Al-MCM-41, La-Al-MCM-41, and Ce-Al-MCM-41 were synthesized, characterized, and tested as catalysts in the cellulose catalytic pyrolysis process using a fixed bed pyrolysis reactor. The results showed that mesoporous materials exhibited a strong influence on the pyrolytic behavior of cellulose. The presence of these mesoporous molecular sieve catalysts could vary the yield of products, which was that they could decrease the yield of liquid and char and increase the yield of gas product, and could promote high-carbon chain compounds to break into low-carbon chain compounds. Mesoporous molecular sieve catalysts were benefit to the reaction of dehydrogenation and deoxidation and the breakdown of carbon chain. Further, La-Al-MCM-41 and Ce-Al-MCM-41 catalysts can produce more toluene and 2-methoxy-phenol, as compared to the non-catalytic runs.
Anomalous complete opaqueness in a sparse array of gold nanoparticle chains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai Benfeng; Tsinghua-Foxconn Nanotechnology Research Center, Tsinghua University, Beijing 100084; Department of Physics and Mathematics, University of Eastern Finland, P.O. Box 111, FI-80101 Joensuu
2011-08-22
We report on an anomalous polarization-switching extinction effect in a sparse array of gold nanoparticle chains: under normal incidence of light, the array is almost transparent for one polarization; whereas it is fully opaque (with nearly zero transmittance) for the orthogonal polarization within a narrow band, even though the nanoparticles cover only a tiny fraction (say, 3.5%) of the transparent substrate surface. We reveal that the strong polarization-dependent short-range dipolar coupling and long-range radiative coupling of gold nanoparticles in this highly asymmetric array is responsible for this extraordinary effect.
ONR Far East Scientific Information Bulletin
1990-09-01
In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by
Graaf, Matthew D; Marquez, Bernadette V; Yeh, Nai-Hua; Lapi, Suzanne E; Moeller, Kevin D
2016-10-21
Cu(I)-catalyzed "click" reactions cannot be performed on a borate ester derived polymer coating on a microelectrode array because the Cu(II) precursor for the catalyst triggers background reactions between both acetylene and azide groups with the polymer surface. Fortunately, the Cu(II)-background reaction can itself be used to site-selectively add the acetylene and azide nucleophiles to the surface of the array. In this way, molecules previously functionalized for use in "click" reactions can be added directly to the array. In a similar fashion, activated esters can be added site-selectively to a borate ester coated array. The new chemistry can be used to explore new biological interactions on the arrays. Specifically, the binding of a v107 derived peptide with both human and murine VEGF was probed using a functionalized microelectrode array.
Effect of perception irregularity on chain-reaction crash in low visibility
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2015-06-01
We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.
Jiang, Zhiquan; Gui, Songbo; Zhang, Yazhuo
2010-09-01
Growth-hormone-secreting pituitary adenomas (GHomas) account for approximately 20% of all pituitary neoplasms. However, the pathogenesis of GHomas remains to be elucidated. To explore the possible pathogenesis of GHomas, we used bead-based fiber-optic arrays to examine the gene expression in five GHomas and compared them to three healthy pituitaries. Four differentially expressed genes were chosen randomly for validation by quantitative real-time reverse transcription-polymerase chain reaction. We then performed pathway analysis on the identified differentially expressed genes using the Kyoto Encyclopedia of Genes and Genomes. Array analysis showed significant increases in the expression of 353 genes and 206 expressed sequence tags (ESTs) and decreases in 565 genes and 29 ESTs. Bioinformatic analysis showed that the genes HIGD1B, HOXB2, ANGPT2, HPGD and BTG2 may play an important role in the tumorigenesis and progression of GHomas. Pathway analysis showed that the wingless-type signaling pathway and extracellular-matrix receptor interactions may play a key role in the tumorigenesis and progression of GHomas. Our data suggested that there are numerous aberrantly expressed genes and pathways involved in the pathogenesis of GHomas. Bead-based fiber-optic arrays combined with pathway analysis of differentially expressed genes appear to be a valid method for investigating the pathogenesis of tumors.
JIANG, ZHIQUAN; GUI, SONGBO; ZHANG, YAZHUO
2010-01-01
Growth-hormone-secreting pituitary adenomas (GHomas) account for approximately 20% of all pituitary neoplasms. However, the pathogenesis of GHomas remains to be elucidated. To explore the possible pathogenesis of GHomas, we used bead-based fiber-optic arrays to examine the gene expression in five GHomas and compared them to three healthy pituitaries. Four differentially expressed genes were chosen randomly for validation by quantitative real-time reverse transcription-polymerase chain reaction. We then performed pathway analysis on the identified differentially expressed genes using the Kyoto Encyclopedia of Genes and Genomes. Array analysis showed significant increases in the expression of 353 genes and 206 expressed sequence tags (ESTs) and decreases in 565 genes and 29 ESTs. Bioinformatic analysis showed that the genes HIGD1B, HOXB2, ANGPT2, HPGD and BTG2 may play an important role in the tumorigenesis and progression of GHomas. Pathway analysis showed that the wingless-type signaling pathway and extracellular-matrix receptor interactions may play a key role in the tumorigenesis and progression of GHomas. Our data suggested that there are numerous aberrantly expressed genes and pathways involved in the pathogenesis of GHomas. Bead-based fiber-optic arrays combined with pathway analysis of differentially expressed genes appear to be a valid method for investigating the pathogenesis of tumors. PMID:22993617
The raw disk i/o performance of compaq storage works RAID arrays under tru64 unix
DOE Office of Scientific and Technical Information (OSTI.GOV)
Uselton, A C
2000-10-19
We report on the raw disk i/o performance of a set of Compaq StorageWorks RAID arrays connected to our cluster of Compaq ES40 computers via Fibre Channel. The best cumulative peak sustained data rate is l17MB/s per node for reads and 77MB/s per node for writes. This value occurs for a configuration in which a node has two Fibre Channel interfaces to a switch, which in turn has two connections to each of two Compaq StorageWorks RAID arrays. Each RAID array has two HSG80 RAID controllers controlling (together) two 5+p RAID chains. A 10% more space efficient arrangement using amore » single 1l+p RAID chain in place of the two 5+P chains is 25% slower for reads and 40% slower for writes.« less
Chain-reaction crash on a highway in high visibility
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2016-05-01
We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.
Effect of vehicular size on chain-reaction crash
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2015-11-01
We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.
Kinetic aspects of chain growth in Fischer-Tropsch synthesis.
Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M
2017-04-28
Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.
Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.
2014-01-01
Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458
Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy
2015-01-01
Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.
NASA Astrophysics Data System (ADS)
Rahman, P. A.; D'K Novikova Freyre Shavier, G.
2018-03-01
This scientific paper is devoted to the analysis of the mean time to data loss of redundant disk arrays RAID-6 with alternation of data considering different failure rates of disks both in normal state of the disk array and in degraded and rebuild states, and also nonzero time of the disk replacement. The reliability model developed by the authors on the basis of the Markov chain and obtained calculation formula for estimation of the mean time to data loss (MTTDL) of the RAID-6 disk arrays are also presented. At last, the technique of estimation of the initial reliability parameters and examples of calculation of the MTTDL of the RAID-6 disk arrays for the different numbers of disks are also given.
Single-molecule optical-trapping measurements with DNA anchored to an array of gold nanoposts.
Paik, D Hern; Perkins, Thomas T
2012-01-01
Gold-thiol chemistry is one of the most successful chemistries for conjugating biomolecules to surfaces, but such chemistry has not been exploited in optical-trapping experiments because of laser-induced ablation of gold. In this work, we describe a method to combine these two separate technologies without undue heating using DNA anchored to gold nanostructures (r = 50-250 nm; h ≈ 20 nm). Moreover, we demonstrate a quantitative and mechanically robust (>100 pN) optical-trapping assay. By using three dithiol phosphoramidites (DTPAs) incorporated into a polymerase chain reaction (PCR) primer, the gold-DNA bond remained stable in the presence of excess thiolated compounds. This chemical robustness allowed us to reduce nonspecific sticking by passivating the unreacted gold with methoxy-(polyethylene glycol)-thiol (mPEG-SH). Overall, this surface conjugation of biomolecules onto an ordered array of gold nanostructures by chemically and mechanically robust bonds provides a unique way to carry out spatially controlled, repeatable measurements of single molecules.
Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays
NASA Astrophysics Data System (ADS)
Huber, F.; Lang, H. P.; Backmann, N.; Rimoldi, D.; Gerber, Ch.
2013-02-01
Malignant melanoma, the deadliest form of skin cancer, is characterized by a predominant mutation in the BRAF gene. Drugs that target tumours carrying this mutation have recently entered the clinic. Accordingly, patients are routinely screened for mutations in this gene to determine whether they can benefit from this type of treatment. The current gold standard for mutation screening uses real-time polymerase chain reaction and sequencing methods. Here we show that an assay based on microcantilever arrays can detect the mutation nanomechanically without amplification in total RNA samples isolated from melanoma cells. The assay is based on a BRAF-specific oligonucleotide probe. We detected mutant BRAF at a concentration of 500 pM in a 50-fold excess of the wild-type sequence. The method was able to distinguish melanoma cells carrying the mutation from wild-type cells using as little as 20 ng µl-1 of RNA material, without prior PCR amplification and use of labels.
Keddie, Daniel J
2014-01-21
The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.
Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun
2018-04-01
Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.
Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C
2008-10-06
Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.
Huang, Huan; Li, Shuo; Sun, Lizhou; Zhou, Guohua
2015-01-01
To simultaneously analyze mutations and expression levels of multiple genes on one detection platform, we proposed a method termed "multiplex ligation-dependent probe amplification-digital amplification coupled with hydrogel bead-array" (MLPA-DABA) and applied it to diagnose colorectal cancer (CRC). CRC cells and tissues were sampled to extract nucleic acid, perform MLPA with sequence-tagged probes, perform digital emulsion polymerase chain reaction (PCR), and produce a hydrogel bead-array to immobilize beads and form a single bead layer on the array. After hybridization with fluorescent probes, the number of colored beads, which reflects the abundance of expressed genes and the mutation rate, was counted for diagnosis. Only red or green beads occurred on the chips in the mixed samples, indicating the success of single-molecule PCR. When a one-source sample was analyzed using mixed MLPA probes, beads of only one color occurred, suggesting the high specificity of the method in analyzing CRC mutation and gene expression. In gene expression analysis of a CRC tissue from one CRC patient, the mutant percentage was 3.1%, and the expression levels of CRC-related genes were much higher than those of normal tissue. The highly sensitive MLPA-DABA succeeds in the relative quantification of mutations and gene expressions of exfoliated cells in stool samples of CRC patients on the same chip platform. MLPA-DABA coupled with hydrogel bead-array is a promising method in the non-invasive diagnosis of CRC.
Choi, Jin Soo; Kim, Seong-Rim; Jeon, Yang-Whan; Lee, Kweon-Haeng; Rha, Hyoung Kyun
2009-02-01
We aimed to use array comparative genomic hybridization (CGH) to identify chromosomal loci that contribute to the pathogenesis of ruptured intracranial aneurysms (IAs) in a Korean population and to confirm the results using real-time polymerase chain reaction (PCR). Twenty-three patients with ruptured IAs were enrolled in this study. Array CGH revealed copy number aberrations in 19 chromosomal regions. Chromosomal gains were identified at a high frequency in regions 1p12, 4q24, 5p15.31, 5p15.33, 6p12.2, 6q22.33, 7p21.1, 9q22.1, 10q24.32, 10q26.3, 12q13.13, 17p12, 18q12.3, 18q23, 19p13.3, 20q13.33, 21q11.2, and 21q22.3, whereas chromosomal losses were identified at 15q11.2 and 22q11.21. Real-time PCR confirmed the results of the array CGH studies of the COL6A2, GRIN3B, MUC17, and PRODH genes. This is the first study to identify candidate regions by array CGH in patients with IAs. The identification of genes that may predispose an individual to the development of IAs may lead to a better understanding of the mechanism of IA formation. Multicenter studies comparing cohorts of patients of different ethnicities are needed to better understand the mechanism of IA formation.
Qiao, Y; Tyson, C; Hrynchak, M; Lopez-Rangel, E; Hildebrand, J; Martell, S; Fawcett, C; Kasmara, L; Calli, K; Harvard, C; Liu, X; Holden, J J A; Lewis, S M E; Rajcan-Separovic, E
2013-02-01
Higher resolution whole-genome arrays facilitate the identification of smaller copy number variations (CNVs) and their integral genes contributing to autism and/or intellectual disability (ASD/ID). Our study describes the use of one of the highest resolution arrays, the Affymetrix(®) Cytogenetics 2.7M array, coupled with quantitative multiplex polymerase chain reaction (PCR) of short fluorescent fragments (QMPSF) for detection and validation of small CNVs. We studied 82 subjects with ASD and ID in total (30 in the validation and 52 in the application cohort) and detected putatively pathogenic CNVs in 6/52 cases from the application cohort. This included a 130-kb maternal duplication spanning exons 64-79 of the DMD gene which was found in a 3-year-old boy manifesting autism and mild neuromotor delays. Other pathogenic CNVs involved 4p14, 12q24.31, 14q32.31, 15q13.2-13.3, and 17p13.3. We established the optimal experimental conditions which, when applied to select small CNVs for QMPSF confirmation, reduced the false positive rate from 60% to 25%. Our work suggests that selection of small CNVs based on the function of integral genes, followed by review of array experimental parameters resulting in highest confirmation rate using multiplex PCR, may enhance the usefulness of higher resolution platforms for ASD and ID gene discovery. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.
Johnston, Jennifer J; Walker, Robert L; Davis, Sean; Facio, Flavia; Turner, Joyce T; Bick, David P; Daentl, Donna L; Ellison, Jay W; Meltzer, Paul S; Biesecker, Leslie G
2007-01-01
Contiguous gene syndromes cause disorders via haploinsufficiency for adjacent genes. Some contiguous gene syndromes (CGS) have stereotypical breakpoints, but others have variable breakpoints. In CGS that have variable breakpoints, the extent of the deletions may be correlated with severity. The Greig cephalopolysyndactyly contiguous gene syndrome (GCPS‐CGS) is a multiple malformation syndrome caused by haploinsufficiency of GLI3 and adjacent genes. In addition, non‐CGS GCPS can be caused by deletions or duplications in GLI3. Although fluorescence in situ hybridisation (FISH) can identify large deletion mutations in patients with GCPS or GCPS‐CGS, it is not practical for identification of small intragenic deletions or insertions, and it is difficult to accurately characterise the extent of the large deletions using this technique. We have designed a custom comparative genomic hybridisation (CGH) array that allows identification of deletions and duplications at kilobase resolution in the vicinity of GLI3. The array averages one probe every 730 bp for a total of about 14 000 probes over 10 Mb. We have analysed 16 individuals with known or suspected deletions or duplications. In 15 of 16 individuals (14 deletions and 1 duplication), the array confirmed the prior results. In the remaining patient, the normal CGH array result was correct, and the prior assessment was a false positive quantitative polymerase chain reaction result. We conclude that high‐density CGH array analysis is more sensitive than FISH analysis for detecting deletions and provides clinically useful results on the extent of the deletion. We suggest that high‐density CGH array analysis should replace FISH analysis for assessment of deletions and duplications in patients with contiguous gene syndromes caused by variable deletions. PMID:17098889
Code of Federal Regulations, 2010 CFR
2010-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.
Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat
2016-12-01
To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.
Press Releases | Argonne National Laboratory
Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18
DNA recognition by peptide nucleic acid-modified PCFs: from models to real samples
NASA Astrophysics Data System (ADS)
Selleri, S.; Coscelli, E.; Poli, F.; Passaro, D.; Cucinotta, A.; Lantano, C.; Corradini, R.; Marchelli, R.
2010-04-01
The increased concern, emerged in the last few years, on food products safety has stimulated the research on new techniques for traceability of raw food materials. DNA analysis is one of the most powerful tools for the certification of food quality, and it is presently performed through the polymerase chain reaction technique. Photonic crystal fibers, due to the presence of an array of air holes running along their length, can be exploited for performing DNA recognition by derivatizing hole surfaces and checking hybridization of complementary nucledotide chains in the sample. In this paper the application of a suspended core photonic crystal fiber in the recognition of DNA sequences is discussed. The fiber is characterized in terms of electromagnetic properties by means of a full-vector modal solver based on the finite element method. Then, the performances of the fiber in the recognition of mall synthetic oligonucleotides are discussed, together with a test of the possibility to extend this recognition to samples of DNA of applicative interest, such as olive leaves.
The search for new amphiphiles: synthesis of a modular, high-throughput library
Feast, George C; Lepitre, Thomas; Mulet, Xavier; Conn, Charlotte E; Hutt, Oliver E
2014-01-01
Summary Amphiphilic compounds are used in a variety of applications due to their lyotropic liquid-crystalline phase formation, however only a limited number of compounds, in a potentially limitless field, are currently in use. A library of organic amphiphilic compounds was synthesised consisting of glucose, galactose, lactose, xylose and mannose head groups and double and triple-chain hydrophobic tails. A modular, high-throughput approach was developed, whereby head and tail components were conjugated using the copper-catalysed azide–alkyne cycloaddition (CuAAC) reaction. The tails were synthesised from two core alkyne-tethered intermediates, which were subsequently functionalised with hydrocarbon chains varying in length and degree of unsaturation and branching, while the five sugar head groups were selected with ranging substitution patterns and anomeric linkages. A library of 80 amphiphiles was subsequently produced, using a 24-vial array, with the majority formed in very good to excellent yields. A preliminary assessment of the liquid-crystalline phase behaviour is also presented. PMID:25161714
The search for new amphiphiles: synthesis of a modular, high-throughput library.
Feast, George C; Lepitre, Thomas; Mulet, Xavier; Conn, Charlotte E; Hutt, Oliver E; Savage, G Paul; Drummond, Calum J
2014-01-01
Amphiphilic compounds are used in a variety of applications due to their lyotropic liquid-crystalline phase formation, however only a limited number of compounds, in a potentially limitless field, are currently in use. A library of organic amphiphilic compounds was synthesised consisting of glucose, galactose, lactose, xylose and mannose head groups and double and triple-chain hydrophobic tails. A modular, high-throughput approach was developed, whereby head and tail components were conjugated using the copper-catalysed azide-alkyne cycloaddition (CuAAC) reaction. The tails were synthesised from two core alkyne-tethered intermediates, which were subsequently functionalised with hydrocarbon chains varying in length and degree of unsaturation and branching, while the five sugar head groups were selected with ranging substitution patterns and anomeric linkages. A library of 80 amphiphiles was subsequently produced, using a 24-vial array, with the majority formed in very good to excellent yields. A preliminary assessment of the liquid-crystalline phase behaviour is also presented.
Design and integration of an all-in-one biomicrofluidic chip
Liu, Liyu; Cao, Wenbin; Wu, Jingbo; Wen, Weijia; Chang, Donald Choy; Sheng, Ping
2008-01-01
We demonstrate a highly integrated microfluidic chip with the function of DNA amplification. The integrated chip combines giant electrorheological-fluid actuated micromixer and micropump with a microheater array, all formed using soft lithography. Internal functional components are based on polydimethylsiloxane (PDMS) and silver∕carbon black-PDMS composites. The system has the advantages of small size with a high degree of integration, high polymerase chain reaction efficiency, digital control and simple fabrication at low cost. This integration approach shows promise for a broad range of applications in chemical synthesis and biological sensing∕analysis, as different components can be combined to target desired functionalities, with flexible designs of different microchips easily realizable through soft lithography. PMID:19693370
Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.
2000-12-01
Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less
Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.
2001-07-05
Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less
Introduction to Polymer Chemistry.
ERIC Educational Resources Information Center
Harris, Frank W.
1981-01-01
Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)
Polymerization as a Model Chain Reaction
ERIC Educational Resources Information Center
Morton, Maurice
1973-01-01
Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)
DOE R&D Accomplishments Database
Weinberg, Alvin M.; Noderer, L. C.
1951-05-15
The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.
Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins
NASA Astrophysics Data System (ADS)
Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John
2017-01-01
DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.
Application of array-comparative genomic hybridization in tetralogy of Fallot
Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Wu, Dong; Li, Tao; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng
2016-01-01
Abstract To explore the underlying pathogenesis and provide references for genetic counseling and prenatal gene diagnosis, we analyzed the chromosome karyotypes and genome-wide copy number variations (CNVs) in 86 patients with tetralogy of Fallot (TOF) by G-banding karyotype analysis and array-comparative genomic hybridization (aCGH), respectively. And then quantitative polymerase chain reaction was used to validate these candidate CNVs. Based on their different properties, CNVs were categorized into benign CNVs, suspiciously pathogenic CNVs, and indefinite CNVs. Data analysis was based on public databases such as UCSC, DECIPHER, DGV, ISCA, and OMIM. The karyotype was normal in all the 86 patients with TOF. CNVs were detected in 11 patients by aCGH and quantitative polymerase chain reaction. Patient no. 0001, 0010, and 0029 had 2.52-Mb deletion in the chromosome 22q11.21 region; patient no. 0008 had both 595- and 428-kb duplications, respectively, in 12p12.3p12.2 and 14q23.2q23.3 regions; patient no. 0009 had 1.46-Mb duplication in the 1q21.1q21.2 region; patient no. 0016 had 513-kb duplication in the 1q42.13 region; patient no. 0024 had 292-kb duplication in the 16q11.2 region; patient no. 0026 had 270-kb duplication in the 16q24.1 region; patient no. 0028 had 222-kb deletion in the 7q31.1 region; patient no. 0033 had 1.73-Mb duplication in the 17q12 region; and patient no. 0061 had 5.79-Mb deletion in the 1p36.33p36.31 region. aCGH can accurately detect CNVs in the patients with TOF. This is conducive to genetic counseling and prenatal diagnosis for TOF and provides a new clue and theoretical basis for exploring the pathogenesis of congenital heart disease. PMID:27930557
Application of array-comparative genomic hybridization in tetralogy of Fallot.
Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Wu, Dong; Li, Tao; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng
2016-12-01
To explore the underlying pathogenesis and provide references for genetic counseling and prenatal gene diagnosis, we analyzed the chromosome karyotypes and genome-wide copy number variations (CNVs) in 86 patients with tetralogy of Fallot (TOF) by G-banding karyotype analysis and array-comparative genomic hybridization (aCGH), respectively. And then quantitative polymerase chain reaction was used to validate these candidate CNVs. Based on their different properties, CNVs were categorized into benign CNVs, suspiciously pathogenic CNVs, and indefinite CNVs. Data analysis was based on public databases such as UCSC, DECIPHER, DGV, ISCA, and OMIM.The karyotype was normal in all the 86 patients with TOF. CNVs were detected in 11 patients by aCGH and quantitative polymerase chain reaction. Patient no. 0001, 0010, and 0029 had 2.52-Mb deletion in the chromosome 22q11.21 region; patient no. 0008 had both 595- and 428-kb duplications, respectively, in 12p12.3p12.2 and 14q23.2q23.3 regions; patient no. 0009 had 1.46-Mb duplication in the 1q21.1q21.2 region; patient no. 0016 had 513-kb duplication in the 1q42.13 region; patient no. 0024 had 292-kb duplication in the 16q11.2 region; patient no. 0026 had 270-kb duplication in the 16q24.1 region; patient no. 0028 had 222-kb deletion in the 7q31.1 region; patient no. 0033 had 1.73-Mb duplication in the 17q12 region; and patient no. 0061 had 5.79-Mb deletion in the 1p36.33p36.31 region.aCGH can accurately detect CNVs in the patients with TOF. This is conducive to genetic counseling and prenatal diagnosis for TOF and provides a new clue and theoretical basis for exploring the pathogenesis of congenital heart disease.
Chui, Amy; Gunatillake, Tilini; Brennecke, Shaun P; Ignjatovic, Vera; Monagle, Paul T; Whitelock, John M; van Zanten, Dagmar E; Eijsink, Jasper; Wang, Yao; Deane, James; Borg, Anthony J; Stevenson, Janet; Erwich, Jan Jaap; Said, Joanne M; Murthi, Padma
2017-06-01
Biglycan (BGN) has reduced expression in placentae from pregnancies complicated by fetal growth restriction (FGR). We used first trimester placental samples from pregnancies with later small for gestational age (SGA) infants as a surrogate for FGR. The functional consequences of reduced BGN and the downstream targets of BGN were determined. Furthermore, the expression of targets was validated in primary placental endothelial cells isolated from FGR or control pregnancies. APPROACH AND RESULTS: BGN expression was determined using real-time polymerase chain reaction in placental tissues collected during chorionic villous sampling performed at 10 to 12 weeks' gestation from pregnancies that had known clinical outcomes, including SGA. Short-interference RNA reduced BGN expression in telomerase-immortalized microvascular endothelial cells, and the effect on proliferation, angiogenesis, and thrombin generation was determined. An angiogenesis array identified downstream targets of BGN, and their expression in control and FGR primary placental endothelial cells was validated using real-time polymerase chain reaction. Reduced BGN expression was observed in SGA placental tissues. BGN reduction decreased network formation of telomerase-immortalized microvascular endothelial cells but did not affect thrombin generation or cellular proliferation. The array identified target genes, which were further validated: angiopoetin 4 ( ANGPT4 ), platelet-derived growth factor receptor α ( PDGFRA ), tumor necrosis factor superfamily member 15 ( TNFSF15 ), angiogenin ( ANG ), serpin family C member 1 ( SERPIN1 ), angiopoietin 2 ( ANGPT2 ), and CXC motif chemokine 12 ( CXCL12 ) in telomerase-immortalized microvascular endothelial cells and primary placental endothelial cells obtained from control and FGR pregnancies. This study reports a temporal relationship between altered placental BGN expression and subsequent development of SGA. Reduction of BGN in vascular endothelial cells leads to disrupted network formation and alterations in the expression of genes involved in angiogenesis. Therefore, differential expression of these may contribute to aberrant angiogenesis in SGA pregnancies. © 2017 American Heart Association, Inc.
Paulo Coelho, Joao; Osío Barcina, José; Aicart, Emilio; Tardajos, Gloria; Cruz-Gil, Pablo; Salgado, Cástor; Díaz-Núñez, Pablo
2018-01-01
Amphiphilic nonionic ligands, synthesized with a fixed hydrophobic moiety formed by a thiolated alkyl chain and an aromatic ring, and with a hydrophilic tail composed of a variable number of oxyethylene units, were used to functionalize spherical gold nanoparticles (AuNPs) in water. Steady-state and time-resolved fluorescence measurements of the AuNPs in the presence of α-cyclodextrin (α-CD) revealed the formation of supramolecular complexes between the ligand and macrocycle at the surface of the nanocrystals. The addition of α-CD induced the formation of inclusion complexes with a high apparent binding constant that decreased with the increasing oxyethylene chain length. The formation of polyrotaxanes at the surface of AuNPs, in which many α-CDs are trapped as hosts on the long and linear ligands, was demonstrated by the formation of large and homogeneous arrays of self-assembled AuNPs with hexagonal close packing, where the interparticle distance increased with the length of the oxyethylene chain. The estimated number of α-CDs per polyrotaxane suggests a high rigidization of the ligand upon complexation, allowing for nearly perfect control of the interparticle distance in the arrays. This degree of supramolecular control was extended to arrays formed by AuNPs stabilized with polyethylene glycol and even to binary arrays. Electromagnetic simulations showed that the enhancement and distribution of the electric field can be finely controlled in these plasmonic arrays. PMID:29547539
High-throughput microfluidic single-cell digital polymerase chain reaction.
White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L
2013-08-06
Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.
Design Study of DESCANT - DEuterated SCintillator Array for Neutron Tagging
NASA Astrophysics Data System (ADS)
Wong, James; Garrett, P. E.
2007-10-01
The fusion-evaporation reaction has been a useful tool for studying nuclei. A program of such reactions is being planned to take place at the TRIUMF facility in Vancouver, Canada using the TIGRESS array of gamma-ray detectors. A particular advantage of using these reactions is that they probe nuclei at moderate-to-high angular momenta. It would be of great interest to extend the study of high-spin states to neutron-rich systems. Following the formation of the fused compound system, the highly-excited state may lose energy by ``evaporating'' particles. Neutron evaporation is the predominant decay mode from neutron-rich compound systems so neutron detectors will be required. The probability of neutrons multiple scattering is quite high so a detector array must be able to differentiate between multiple neutrons evaporating from the reaction and a single neutron scattering multiple times. To address this issue we investigate the use of a novel neutron detector array -- one based on an array of deuterated liquid scintillators as neutron detectors. Results from early feasibility tests will be presented, along with the status of our GEANT4 simulations of the array performance.
Code of Federal Regulations, 2014 CFR
2014-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2013 CFR
2013-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2012 CFR
2012-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Emilio Segrè and Spontaneous Fission
fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as
Chain Reaction Polymerization.
ERIC Educational Resources Information Center
McGrath, James E.
1981-01-01
The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)
Characterizing Chain Processes in Visible Light Photoredox Catalysis
Cismesia, Megan A.
2015-01-01
The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708
Plasmonic graded-chains as deep-subwavelength light concentrators
NASA Astrophysics Data System (ADS)
Esteves-López, Natalia; Pastawski, Horacio M.; Bustos-Marún, Raúl A.
2015-04-01
We have studied the plasmonic properties of aperiodic arrays of identical nanoparticles (NPs) formed by two opposite and equal graded-chains (a chain where interactions change gradually). We found that these arrays concentrate the external electromagnetic fields even in the long wavelength limit. The phenomenon was understood by identifying the system with an effective cavity where plasmonics excitations are trapped between effective band edges, resulting from the change of passband with the NP's position. Dependence of excitation concentration on several system parameters was also assessed. This includes different gradings as well as NP couplings, damping, and resonant frequencies. In the spirit of the scaling laws in condensed matter physics, we developed a theory that allows us to rationalize all these system parameters into universal curves. The theory is quite general and can also be used in many other situations (different arrays for example). Additionally, we also provided an analytical solution, in the tight-binding limit, for the plasmonic response of homogeneous linear chains of NPs illuminated by a plane wave. Our results can find applications in sensing, near field imaging, plasmon-enhanced photodetectors, as well as to increase solar cell efficiency.
A Transmissible Plasmid Controlling Camphor Oxidation in Pseudomonas putida
Rheinwald, J. G.; Chakrabarty, A. M.; Gunsalus, I. C.
1973-01-01
Earlier papers demonstrated an extensive genetic exchange among fluorescent Pseudomonads; this one documents for genes specifying enzymes of peripheral dissimilation an extrachromosomal array, segregation, and frequent interstrain transfer. An hypothesis is presented of a general mechanism for the formation and maintenance of metabolic diversity. The example used, the path of oxidative cleavage of the carbocyclic rings of the bicyclic monoterpene D- and L-camphor, terminates in acetate release and isobutyrate chain debranching. By transduction, two gene linkage groups are shown for the reactions before and after isobutyrate. The group for reactions before isobutyrate is plasmid borne, contransferable by conjugation, mitomycin curable, and shows a higher segregation rate from cells that are multiplasmid rather than carrying a single plasmid. The genes that code for isobutyrate and essential anaplerotic and amphibolic metabolism are chromosomal. By conjugation plasmid-borne genes are transferred at a higher frequency than are chromosomal, and are transferred in homologous crosses more frequently than between heterologous species. Most isobutyrate-positive fluorescent pseudomonad strains will accept and express the camphor plasmid. PMID:4351810
Baschieri, Andrea; Pulvirenti, Luana; Muccilli, Vera; Amorati, Riccardo; Tringali, Corrado
2017-07-26
Chemical modification of magnolol, an uncommon dimeric neolignan contained in Magnolia genus trees, provides a unique array of polyphenols having interesting biological activity potentially related to radical scavenging. The chain-breaking antioxidant activity of four new hydroxylated and methoxylated magnolol derivatives was explored by experimental and computational methods. The measurement of the rate constant of the reaction with ROO˙ radicals (k inh ) in an apolar solvent showed that the introduction of hydroxyl groups ortho to the phenolic OH in magnolol increased the k inh value, being 2.4 × 10 5 M -1 s -1 and 3.3 × 10 5 M -1 s -1 for the mono and the dihydroxy derivatives respectively (k inh of magnolol is 6.1 × 10 4 M -1 s -1 ). The di-methoxylated derivative is less reactive than magnolol (k inh = 1.1 × 10 4 M -1 s -1 ), while the insertion of both hydroxyl and methoxyl groups showed no effect (6.0 × 10 4 M -1 s -1 ). Infrared spectroscopy and theoretical calculations allowed a rationalization of these results and pointed out the crucial role of intramolecular H-bonds. We also show that a correct estimation of the rate constant of the reaction with ROO˙ radicals, by using BDE(OH) calculations, requires that the geometry of the radical is as close as possible to that of the parent phenol.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru
2016-09-15
It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.
Die, Jose V; Baldwin, Ransom L; Rowland, Lisa J; Li, Robert; Oh, Sunghee; Li, Congjun; Connor, Erin E; Ranilla, Maria-Jose
2017-01-01
The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.
A review of current and future molecular diagnostic tests for use in the microbiology laboratory.
Jannes, Geert; De Vos, Daniel
2006-01-01
Nucleic acid-based diagnostics gradually are replacing or complementing culture-based, biochemical, and immunological assays in routine microbiology laboratories. Similar to conventional tests, the first-generation deoxyribonucleic acid assays determined only a single analyte. Recent improvements in detection technologies have paved the way for the development of multiparameter assays using macroarrays or micro-arrays, while the introduction of closed-tube real-time polymerase chain reaction systems has resulted in the development of rapid microbial diagnostics with a reduced contamination risk. The use of these new molecular technologies is not restricted to detection and identification of microbial pathogens but also can be used for genotyping, allowing one to determine antibiotic resistance or to perform microbial fingerprinting.
NASA Astrophysics Data System (ADS)
Magenau, Andrew Jackson David
The primary objectives of this research were twofold: (1) development of synthetic procedures for combining quasiliving carbocationic polymerization (QLCCP) of isobutylene (IB) and reversible addition fragmentation chain transfer (RAFT) polymerization for block copolymer synthesis; (2) utilization of efficient, robust, and modular chemistries for facile functionalization of polyisobutylene (PIB). In the first study block copolymers consisting of PIB, and either PMMA or PS block segments, were synthesized by a site transformation approach combining living cationic and reversible addition-fragmentation chain transfer (RAFT) polymerizations. The initial PIB block was synthesized via quasiliving cationic polymerization using the TMPCl/TiCl4 initiation system and was subsequently converted into a hydroxylterminated PIB. Site transformation of the hydroxyl-terminated PIB into a macro chain transfer agent (PIB-CTA) was accomplished by N,N'-dicyclohexylcarbodiimide/dimethylaminopyridine-catalyzed esterification with 4-cyano-4-(dodecylsulfanylthiocarbonylsulfanyl)pentanoic acid. In the second study another site transformation approach was developed to synthesize a novel block copolymer, composed of PIB and PNIPAM segments. The PIB block was prepared via quasiliving cationic polymerization and end functionalized by in-situ quenching to yield telechelic halogen-terminated PIB. Azido functionality was obtained by displacement of the terminal halogen through nucleophilic substitution, which was confirmed by both 1H and 13C NMR. Coupling of an alkyne-functional chain transfer agent (CTA) to azido PIB was successfully accomplished through a copper catalyzed click reaction. Structure of the resulting PIB-based macro-CTA was verified with 1H NMR, FTIR, and GPC; whereas coupling reaction kinetics were monitored by real time variable temperature (VT) 1H NMR. In a third study, a click chemistry functionalization procedure was developed based upon the azide-alkyne 1,3-dipolar cycloaddition reaction. 1-(o-Azidoalkyl)pyrrolyl-terminated PIB was successfully synthesized both by substitution of the terminal halide of 1-(o-haloalkyl)pyrrolyl-terminated PIB with sodium azide and by in situ quenching of quasiliving PIB with a 1-(o-azidoalkyl)pyrrole. GPC indicated the absence of coupled PIB under optimized conditions, confirming exclusive mono-substitution on each pyrrole ring. In a fourth study, radical thiol-ene hydrothiolation "Click" chemistry was explored and adapted to easily and rapidly modify exo -olefin PIB with an array of thiol compounds bearing useful functionalities, including primary halogen, primary amine, primary hydroxyl, and carboxylic acid. The thiol-ene "click" procedure was shown to be applicable to both mono and difunctional exo-olefin polyisobutylene. Telechelic mono- and difunctional exo-olefin PIBs were synthesized via quasiliving cationic polymerization followed by quenching with the hindered amine, 1,2,2,6,6-pentamethylpiperidine. Lower reaction temperatures were found to increase exo-olefin conversion to near quantitative amounts. In the fifth study, thiol-terminated polyisobutylene (PIB-SH) was synthesized by reaction of thiourea with alpha,o-bromine-terminated PIB in a three step one-pot procedure. First the alkylisothiouronium salt was produced using a 1:1 (v:v) DMF:heptane cosolvent mixture at 90°C. Hydrolysis of the salt by aqueous base produced thiolate chain ends, which were then acidified to form the desired thiol functional group. An extension of this reaction was performed by a sequential thiol-ene/thiol-yne procedure to produce tetra-hydroxy functionalized PIB. 1H NMR was used to confirm formation of both alkyne and tetrahydroxyl functional species. Further utility of PIB-SH was demonstrated by base catalyzed thiol-isocyanate reactions. A model reaction was conducted with phenyl isocyanate in THF using triethylamine as the catalyst. Last, conversion of PIB-SH directly into a RAFT macro-CTA was accomplished, as shown by 1H NMR, by treatment of PIB-SH with triethylamine in carbon disulfide and subsequent alkylation with 2-bromopropionic acid. (Abstract shortened by UMI.)
Simplified Microarray Technique for Identifying mRNA in Rare Samples
NASA Technical Reports Server (NTRS)
Almeida, Eduardo; Kadambi, Geeta
2007-01-01
Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.
Microfluidic droplet trapping array as nanoliter reactors for gas-liquid chemical reaction.
Zhang, Qingquan; Zeng, Shaojiang; Qin, Jianhua; Lin, Bingcheng
2009-09-01
This article presents a simple method for trapping arrays of droplets relying on the designed microstructures of the microfluidic device, and this has been successfully used for parallel gas-liquid chemical reaction. In this approach, the trapping structure is composed of main channel, lateral channel and trapping region. Under a negative pressure, array droplets can be generated and trapped in the microstructure simultaneously, without the use of surfactant and the precise control of the flow velocity. By using a multi-layer microdevice containing the microstructures, single (pH gradient) and multiple gas-liquid reactions (metal ion-NH3 complex reaction) can be performed in array droplets through the transmembrane diffusion of the gas. The droplets with quantitative concentration gradient can be formed by only replacing the specific membrane. The established method is simple, robust and easy to operate, demonstrating the potential of this device for droplet-based high-throughput screening.
NASA Astrophysics Data System (ADS)
Bolle, C. A.; Gammel, P. L.; Grier, D. G.; Murray, C. A.; Bishop, D. J.; Mitzi, D. B.; Kapitulnik, A.
1991-01-01
We report the observation of a novel flux-lattice structure, a commensurate array of flux-line chains. Our experiments consist of the magnetic decoration of the flux lattices in single crystals of Ba-Sr-Ca-Cu-O where the magnetic field is applied at an angle with respect to the conducting planes. For a narrow range of angles, the equilibrium structure is one with uniformly spaced chains with a higher line density of vortices than the background lattice. Our observations are in qualitative agreement with theories which suggest that, in strongly anisotropic materials the vortices develop an attractive interaction in tilted magnetic fields.
Photon transport in a dissipative chain of nonlinear cavities
NASA Astrophysics Data System (ADS)
Biella, Alberto; Mazza, Leonardo; Carusotto, Iacopo; Rossini, Davide; Fazio, Rosario
2015-05-01
By means of numerical simulations and the input-output formalism, we study photon transport through a chain of coupled nonlinear optical cavities subject to uniform dissipation. Photons are injected from one end of the chain by means of a coherent source. The propagation through the array of cavities is sensitive to the interplay between the photon hopping strength and the local nonlinearity in each cavity. We characterize photon transport by studying the populations and the photon correlations as a function of the cavity position. When complemented with input-output theory, these quantities provide direct information about photon transmission through the system. The position of single-photon and multiphoton resonances directly reflects the structure of the many-body energy levels. This shows how a study of transport along a coupled cavity array can provide rich information about the strongly correlated (many-body) states of light even in presence of dissipation. The numerical algorithm we use, based on the time-evolving block decimation scheme adapted to mixed states, allows us to simulate large arrays (up to 60 cavities). The scaling of photon transmission with the number of cavities does depend on the structure of the many-body photon states inside the array.
Peroxy radical detection by chemical amplification (PERCA)
NASA Technical Reports Server (NTRS)
Stedman, D. H.
1986-01-01
Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.
NASA Astrophysics Data System (ADS)
Yang, Fang; Li, Gang; Qi, Jian; Zhang, Song-Mei; Liu, Rong
2010-10-01
A series of trimeric n-alkylphenol polyoxyethylene surfactants (TAP) were successfully synthesized and the molecular structure were confirmed by NMR, FTIR spectrum and elemental analysis. Using the same synthesis route, the trimeric nonylphenol polyoxyethylene surfactant (TNP) was synthesized using industrial product nonylphenol and paraformaldehyde, and its molecular structure was characterized by 1HNMR, FTIR spectrum and elemental analysis. The optimal reaction conditions were established. The surface activity properties of TAP and TNP (such as the critical micelle concentration (cmc), the values of surface tension at the cmc ( γcmc), the maximum surface excess concentration ( Γcmc), and the minimum surface area per surfactant molecule ( Acmc)), were determined by means of Wilhelmy plate method and steady-state fluorescence probe method, respectively. The experimental results show that the lengths of the hydrophilic group oxyethylene (EO) chains and hydrophobic group methylene chains have an influence on the cmc, γcmc, Γcmc, and Acmc of series of surfactants. Furthermore, TAP are arranged to staggered three-dimensional array mode at the air-water interface, which has exhibited better surface properties, such as low cmc values, strong adsorption affinities and wet abilities.
Tangled nonlinear driven chain reactions of all optical singularities
NASA Astrophysics Data System (ADS)
Vasil'ev, V. I.; Soskin, M. S.
2012-03-01
Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.
Optical super-resolution and periodical focusing effects by dielectric microspheres
NASA Astrophysics Data System (ADS)
Darafsheh, Arash
Optical microscopy is one of the oldest and most important imaging techniques; however, its far-field resolution is diffraction-limited. In this dissertation, we proposed and developed a novel method of optical microscopy with super-resolution by using high-index dielectric microspheres immersed in liquid and placed on the surface of the structures under study. We used barium titanate glass microspheres with diameters of D~2-220 mum and refractive indices n˜1.9-2.1 to discern minimal feature sizes ˜lambda/4 (down to ˜lambda/7) of various photonic and plasmonic nanostructures, where lambda is the illumination wavelength. We studied the magnification, field of view, and resolving power, in detail, as a function of sphere sizes. We studied optical coupling, transport, focusing, and polarization properties of linear arrays of dielectric spheres. We showed that in arrays of spheres with refractive index n=3, a special type of rays with transverse magnetic (TM) polarization incident on the spheres under the Brewster's angle form periodically focused modes with radial polarization and 2D period, where D is the diameter of the spheres. We showed that the formation of periodically focused modes in arrays of dielectric spheres gives a physical explanation for beam focusing and extraordinarily small attenuation of light in such chains. We showed that the light propagation in such arrays is strongly polarization-dependent, indicating that such arrays can be used as filters of beams with radial polarization. The effect of forming progressively smaller focused beams was experimentally observed in chains of sapphire spheres in agreement with the theory. We studied optical coupling,transport, focusing, and polarization properties of linear arrays of dielectric spheres. We showed that in arrays of spheres with refractive index n=a3, a special type of rays with transverse magnetic (TM) polarization incident on the spheres under the Brewster's angle form periodically focused modes with radial polarization and 2D period, where D is the diameter of the spheres. We showed that the formation of periodically focused modes in arrays of dielectric spheres gives a physical explanation for beam focusing and extraordinarily small attenuation of light in such chains. We showed that the light propagation in such arrays is strongly polarization-dependent, indicating that such arrays can be used as filters of beams with radial polarization. The effect of forming progressively smaller focused beams was experimentally observed in chains of sapphire spheres in agreement with the theory.
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vasil'ev, Vasilii I; Soskin, M S
2013-02-28
A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less
NASA Astrophysics Data System (ADS)
Bradshaw, Darren; Rosseinsky, Matthew J.
2005-12-01
Reaction of Co(NO3)2ṡ6H2O with the multidentate ligands benzene-1,3,5-tricarboxylate (btc) and the flexible bipyridyl ligand 1,2-bis(4-pyridyl)ethane (bpe) affords the 3-dimensional coordination polymers [Co3(btc)2(bpe)3(eg)2]ṡ(guests) 1, where eg = ethylene glycol, and [Co2(Hbtc)2(bpe)2]ṡ(bpe) 2. Both phases are comprised of infinite metal-carboxylate dimer chains, linked into 2-dimensional sheets by the bpe ligands. These sheets are further linked to adjacent sheets through covalent interactions, 1, or through hydrogen-bonding interactions, 2, to yield the 3-dimensional structures. Phase 1 exhibits solvent filled 1-dimensional pores, whereas 2 is triply-interpenetrated to form a dense solid array.
Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J
2016-12-07
The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray ® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. © The American Society of Tropical Medicine and Hygiene.
Scherer, James R; Liu, Peng; Mathies, Richard A
2010-11-01
We have developed a compact, laser-induced fluorescence detection scanner, the multichannel capillary array electrophoresis portable scanner (McCAEPs) as a platform for electrophoretic detection and control of high-throughput, integrated microfluidic devices for genetic and other analyses. The instrument contains a confocal optical system with a rotary objective for detecting four different fluorescence signals, a pneumatic system consisting of two pressure/vacuum pumps and 28 individual addressable solenoid valves for control of on-chip microvalves and micropumps, four Polymerase Chain Reaction (PCR) temperature control systems, and four high voltage power supplies for electrophoresis. The detection limit of the instrument is ~20 pM for on-chip capillary electrophoresis of fluorescein dyes. To demonstrate the system performance for forensic short tandem repeat (STR) analysis, two experiments were conducted: (i) electrophoretic separation and detection of STR samples on a 96-lane microfabricated capillary array electrophoresis microchip. Fully resolved PowerPlex(®) 16 STR profiles amplified from 1 ng of 9947A female standard DNA were successfully obtained; (ii) nine-plex STR amplification, sample injection, separation, and fluorescence detection of 100-copy 9948 male standard DNA in a single integrated PCR- capillary electrophoresis microchip. These results demonstrate that the McCAEPs can be used as a versatile control and detection instrument that operates integrated microfluidic devices for high-performance forensic human identification.
Elevated NIBP/TRAPPC9 mediates tumorigenesis of cancer cells through NFκB signaling
Wang, Hong; Yang, Wensheng; Li, Fang; Yang, Fan; Yu, Daohai; Ramsey, Frederick V.; Tuszyski, George P.; Hu, Wenhui
2015-01-01
Regulatory mechanisms underlying constitutive and inducible NFκB activation in cancer remain largely unknown. Here we investigated whether a novel NIK- and IKK2-binding protein (NIBP) is required for maintaining malignancy of cancer cells in an NFκB-dependent manner. Real-time polymerase chain reaction analysis of a human cancer survey tissue-scan cDNA array, immunostaining of a human frozen tumor tissue array and immunoblotting of a high-density reverse-phase cancer protein lysate array showed that NIBP is extensively expressed in most tumor tissues, particularly in breast and colon cancer. Lentivirus-mediated NIBP shRNA knockdown significantly inhibited the growth/proliferation, invasion/migration, colony formation and xenograft tumorigenesis of breast (MDA-MB-231) or colon (HCT116) cancer cells. NIBP overexpression in HCT116 cells promoted cell proliferation, migration and colony formation. Mechanistically, NIBP knockdown in cancer cells inhibited cytokine-induced activation of NFκB luciferase reporter, thus sensitizing the cells to TNFα-induced apoptosis. Endogenous NIBP bound specifically to the phosphorylated IKK2 in a TNFα-dependent manner. NIBP knockdown transiently attenuated TNFα-stimulated phosphorylation of IKK2/p65 and degradation of IκBα. In contrast, NIBP overexpression enhanced TNFα-induced NFκB activation, thus inhibiting constitutive and TNFα-induced apoptosis. Collectively, our data identified important roles of NIBP in promoting tumorigenesis via NFκΒ signaling, spotlighting NIBP as a promising target in cancer therapeutic intervention. PMID:25704885
NASA Astrophysics Data System (ADS)
Scherer, James R.; Liu, Peng; Mathies, Richard A.
2010-11-01
We have developed a compact, laser-induced fluorescence detection scanner, the multichannel capillary array electrophoresis portable scanner (McCAEPs) as a platform for electrophoretic detection and control of high-throughput, integrated microfluidic devices for genetic and other analyses. The instrument contains a confocal optical system with a rotary objective for detecting four different fluorescence signals, a pneumatic system consisting of two pressure/vacuum pumps and 28 individual addressable solenoid valves for control of on-chip microvalves and micropumps, four Polymerase Chain Reaction (PCR) temperature control systems, and four high voltage power supplies for electrophoresis. The detection limit of the instrument is ˜20 pM for on-chip capillary electrophoresis of fluorescein dyes. To demonstrate the system performance for forensic short tandem repeat (STR) analysis, two experiments were conducted: (i) electrophoretic separation and detection of STR samples on a 96-lane microfabricated capillary array electrophoresis microchip. Fully resolved PowerPlex® 16 STR profiles amplified from 1 ng of 9947A female standard DNA were successfully obtained; (ii) nine-plex STR amplification, sample injection, separation, and fluorescence detection of 100-copy 9948 male standard DNA in a single integrated PCR- capillary electrophoresis microchip. These results demonstrate that the McCAEPs can be used as a versatile control and detection instrument that operates integrated microfluidic devices for high-performance forensic human identification.
Reliability of Ceramic Column Grid Array Interconnect Packages Under Extreme Temperatures
NASA Technical Reports Server (NTRS)
Ramesham, Rajeshuni
2011-01-01
A paper describes advanced ceramic column grid array (CCGA) packaging interconnects technology test objects that were subjected to extreme temperature thermal cycles. CCGA interconnect electronic package printed wiring boards (PWBs) of polyimide were assembled, inspected nondestructively, and, subsequently, subjected to ex - treme-temperature thermal cycling to assess reliability for future deep-space, short- and long-term, extreme-temperature missions. The test hardware consisted of two CCGA717 packages with each package divided into four daisy-chained sections, for a total of eight daisy chains to be monitored. The package is 33 33 mm with a 27 27 array of 80%/20% Pb/Sn columns on a 1.27-mm pitch. The change in resistance of the daisy-chained CCGA interconnects was measured as a function of the increasing number of thermal cycles. Several catastrophic failures were observed after 137 extreme-temperature thermal cycles, as per electrical resistance measurements, and then the tests were continued through 1,058 thermal cycles to corroborate and understand the test results. X-ray and optical inspection have been made after thermal cycling. Optical inspections were also conducted on the CCGA vs. thermal cycles. The optical inspections were conclusive; the x-ray images were not. Process qualification and assembly is required to optimize the CCGA assembly, which is very clear from the x-rays. Six daisy chains were open out of seven daisy chains, as per experimental test data reported. The daisy chains are open during the cold cycle, and then recover during the hot cycle, though some of them also opened during the hot thermal cycle..
National Array of Neutron Detectors (NAND): A versatile tool for nuclear reaction studies
NASA Astrophysics Data System (ADS)
Golda, K. S.; Jhingan, A.; Sugathan, P.; Singh, Hardev; Singh, R. P.; Behera, B. R.; Mandal, S.; Kothari, A.; Gupta, Arti; Zacharias, J.; Archunan, M.; Barua, P.; Venkataramanan, S.; Bhowmik, R. K.; Govil, I. M.; Datta, S. K.; Chatterjee, M. B.
2014-11-01
The first phase of the National Array of Neutron Detectors (NAND) consisting of 26 neutron detectors has been commissioned at the Inter University Accelerator Centre (IUAC), New Delhi. The motivation behind setting up of such a detector system is the need for more accurate and efficient study of reaction mechanisms in the projectile energy range of 5-8 MeV/n using heavy ion beams from a 15 UD Pelletron and an upgraded LINAC booster facility at IUAC. The above detector array can be used for inclusive as well as exclusive measurements of reaction products of which at least one product is a neutron. While inclusive measurements can be made using only the neutron detectors along with the time of flight technique and a pulsed beam, exclusive measurements can be performed by detecting neutrons in coincidence with charged particles and/or fission fragments detected with ancillary detectors. The array can also be used for neutron tagged gamma-ray spectroscopy in (HI, xn) reactions by detecting gamma-rays in coincidence with the neutrons in a compact geometrical configuration. The various features and the performance of the different aspects of the array are described in the present paper.
Non-Hermitian engineering of single mode two dimensional laser arrays
Teimourpour, Mohammad H.; Ge, Li; Christodoulides, Demetrios N.; El-Ganainy, Ramy
2016-01-01
A new scheme for building two dimensional laser arrays that operate in the single supermode regime is proposed. This is done by introducing an optical coupling between the laser array and lossy pseudo-isospectral chains of photonic resonators. The spectrum of this discrete reservoir is tailored to suppress all the supermodes of the main array except the fundamental one. This spectral engineering is facilitated by employing the Householder transformation in conjunction with discrete supersymmetry. The proposed scheme is general and can in principle be used in different platforms such as VCSEL arrays and photonic crystal laser arrays. PMID:27698355
Huang, Huan; Li, Shuo; Sun, Lizhou; Zhou, Guohua
2015-01-01
To simultaneously analyze mutations and expression levels of multiple genes on one detection platform, we proposed a method termed “multiplex ligation-dependent probe amplification–digital amplification coupled with hydrogel bead-array” (MLPA–DABA) and applied it to diagnose colorectal cancer (CRC). CRC cells and tissues were sampled to extract nucleic acid, perform MLPA with sequence-tagged probes, perform digital emulsion polymerase chain reaction (PCR), and produce a hydrogel bead-array to immobilize beads and form a single bead layer on the array. After hybridization with fluorescent probes, the number of colored beads, which reflects the abundance of expressed genes and the mutation rate, was counted for diagnosis. Only red or green beads occurred on the chips in the mixed samples, indicating the success of single-molecule PCR. When a one-source sample was analyzed using mixed MLPA probes, beads of only one color occurred, suggesting the high specificity of the method in analyzing CRC mutation and gene expression. In gene expression analysis of a CRC tissue from one CRC patient, the mutant percentage was 3.1%, and the expression levels of CRC-related genes were much higher than those of normal tissue. The highly sensitive MLPA–DABA succeeds in the relative quantification of mutations and gene expressions of exfoliated cells in stool samples of CRC patients on the same chip platform. MLPA–DABA coupled with hydrogel bead-array is a promising method in the non-invasive diagnosis of CRC. PMID:25880764
Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru
2017-11-28
Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.
Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh
2016-11-01
Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560-568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. © 2016 Peeters et al.
Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh
2016-01-01
Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560–568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. PMID:27881439
NASA Astrophysics Data System (ADS)
Pongs, Guido; Bresseler, Bernd; Bergs, Thomas; Menke, Gert
2012-10-01
Today isothermal precision molding of imaging glass optics has become a widely applied and integrated production technology in the optical industry. Especially in consumer electronics (e.g. digital cameras, mobile phones, Blu-ray) a lot of optical systems contain rotationally symmetrical aspherical lenses produced by precision glass molding. But due to higher demands on complexity and miniaturization of optical elements the established process chain for precision glass molding is not sufficient enough. Wafer based molding processes for glass optics manufacturing become more and more interesting for mobile phone applications. Also cylindrical lens arrays can be used in high power laser systems. The usage of unsymmetrical free-form optics allows an increase of efficiency in optical laser systems. Aixtooling is working on different aspects in the fields of mold manufacturing technologies and molding processes for extremely high complex optical components. In terms of array molding technologies, Aixtooling has developed a manufacturing technology for the ultra-precision machining of carbide molds together with European partners. The development covers the machining of multi lens arrays as well as cylindrical lens arrays. The biggest challenge is the molding of complex free-form optics having no symmetrical axis. A comprehensive CAD/CAM data management along the entire process chain is essential to reach high accuracies on the molded lenses. Within a national funded project Aixtooling is working on a consistent data handling procedure in the process chain for precision molding of free-form optics.
Morita, Clara; Tanuma, Hiromitsu; Kawai, Chika; Ito, Yuki; Imura, Yoshiro; Kawai, Takeshi
2013-02-05
A series of long-chain amidoamine derivatives with different alkyl chain lengths (CnAA where n is 12, 14, 16, or 18) were synthesized and studied with regard to their ability to form organogels and to act as soft templates for the production of Au nanomaterials. These compounds were found to self-assemble into lamellar structures and exhibited gelation ability in some apolar solvents. The gelation concentration, gel-sol phase transition temperature, and lattice spacing of the lamellar structures in organic solvent all varied on the basis of the alkyl chain length of the particular CnAA compound employed. The potential for these molecules to function as templates was evaluated through the synthesis of Au nanowires (NWs) in their organogels. Ultrathin Au NWs were obtained from all CnAA/toluene gel systems, each within an optimal temperature range. Interestingly, in the case of C12AA and C14AA, it was possible to fabricate ultrathin Au NWs at room temperature. In addition, two-dimensional parallel arrays of ultrathin Au NWs were self-assembled onto TEM copper grids as a result of the drying of dispersion solutions of these NWs. The use of CnAA compounds with differing alkyl chain lengths enabled precise tuning of the distance between the Au NWs in these arrays.
Step-by-step growth of epitaxially aligned polythiophene by surface-confined reaction
Lipton-Duffin, J. A.; Miwa, J. A.; Kondratenko, M.; Cicoira, F.; Sumpter, B. G.; Meunier, V.; Perepichka, D. F.; Rosei, F.
2010-01-01
One of the great challenges in surface chemistry is to assemble aromatic building blocks into ordered structures that are mechanically robust and electronically interlinked—i.e., are held together by covalent bonds. We demonstrate the surface-confined growth of ordered arrays of poly(3,4-ethylenedioxythiophene) (PEDOT) chains, by using the substrate (the 110 facet of copper) simultaneously as template and catalyst for polymerization. Copper acts as promoter for the Ullmann coupling reaction, whereas the inherent anisotropy of the fcc 110 facet confines growth to a single dimension. High resolution scanning tunneling microscopy performed under ultrahigh vacuum conditions allows us to simultaneously image PEDOT oligomers and the copper lattice with atomic resolution. Density functional theory calculations confirm an unexpected adsorption geometry of the PEDOT oligomers, which stand on the sulfur atom of the thiophene ring rather than lying flat. This polymerization approach can be extended to many other halogen-terminated molecules to produce epitaxially aligned conjugated polymers. Such systems might be of central importance to develop future electronic and optoelectronic devices with high quality active materials, besides representing model systems for basic science investigations. PMID:20534511
Supplement to Theory of Neutron Chain Reactions
DOE R&D Accomplishments Database
Weinberg, Alvin M.; Noderer, L. C.
1952-05-26
General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)
Zhou, Yu; Pearson, John E; Auerbach, Anthony
2005-12-01
We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.
Kufaishi, Hala; Alarab, May; Drutz, Harold; Lye, Stephen; Shynlova, Oksana
2016-08-01
Primary human vaginal cells derived from women with severe pelvic organ prolapse (POP-HVCs) demonstrate altered cellular characteristics as compared to cells derived from asymptomatic women (control-HVCs). Using computer-controllable Flexcell stretch unit, we examined whether POP-HVCs react differently to mechanical loading as compared to control-HVCs by the expression of extracellular matrix (ECM) components, cell-ECM adhesion proteins, and ECM degrading and maturating enzymes. Vaginal tissue biopsies from premenopausal patients with Pelvic Organ Prolapse Quantification System stage ≥3 (n = 8) and asymptomatic controls (n = 7) were collected during vaginal hysterectomy or repair. Human vaginal cells were isolated by enzymatic digestion, seeded on collagen (COLI)-coated plates, and stretched (24 hours, 25% elongation). Total RNA was extracted, and 84 genes were screened using Human ECM and Adhesion Molecules polymerase chain reaction array; selected genes were verified by quantitative reverse transcription-polymerase chain reaction. Stretch-conditioned media (SCM) were collected and analyzed by protein array, immunoblotting, and zymography. In mechanically stretched control-HVCs, transcript levels of integrins (ITGA1, ITGA4, ITGAV, and ITGB1) and matrix metalloproteinases (MMPs) 2, 8, and 13 were downregulated (P < .05); in POP-HVCs, MMP1, MMP3, and MMP10, ADAMTS8 and 13, tissue inhibitor of metalloproteinases (TIMPs) 1 to 3, ITGA2, ITGA4, ITGA6, ITGB1, contactin (CNTN1), catenins (A1 and B1), and laminins (A3 and C1) were significantly upregulated, whereas COLs (1, 4, 5, 6, 11, and 12) and LOXL1 were downregulated. Human vaginal cells massively secrete MMPs and TIMPs proteins; MMP1, MMP8, MMP9 protein expression and MMP2 gelatinase activity were increased, whereas TIMP2 decreased in SCM from POP-HVCs compared to control-HVCs. Primary human vaginal cells derived from women with severe pelvic organ prolapse and control-HVCs react differentially to in vitro mechanical stretch. Risk factors that induce stretch may alter ECM composition and cell-ECM interaction in pelvic floor tissue leading to the abatement of pelvic organ support and subsequent POP development. © The Author(s) 2016.
Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.
Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S
2017-11-01
Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.
Rapid ELISA Using a Film-Stack Reaction Field with Micropillar Arrays
Suzuki, Yuma; Morioka, Kazuhiro; Ohata, Soichiro; Nakajima, Hizuru; Uchiyama, Katsumi; Yang, Ming
2017-01-01
A film-stack reaction field with a micropillar array using a motor stirrer was developed for the high sensitivity and rapid enzyme-linked immunosorbent assay (ELISA) reaction. The effects of the incubation time of a protein (30 s, 5 min, and 10 min) on the fluorescence intensity in ELISAs were investigated using a reaction field with different micropillar array dimensions (5-µm, 10-µm and 50-µm gaps between the micropillars). The difference in fluorescence intensity between the well with the reaction field of 50-µm gap for the incubation time of 30 s and the well without the reaction field with for incubation time of 10 min was 6%. The trend of the fluorescence intensity in the gap between the micro pillars in the film-stack reaction field was different between the short incubation time and the long incubation time. The theoretical analysis of the physical parameters related with the biomolecule transport indicated that the reaction efficiency defined in this study was the dominant factor determining the fluorescence intensity for the short incubation time, whereas the volumetric rate of the circulating flow through the space between films and the specific surface area were the dominant factors for the long incubation time. PMID:28696378
Rapid ELISA Using a Film-Stack Reaction Field with Micropillar Arrays.
Suzuki, Yuma; Morioka, Kazuhiro; Ohata, Soichiro; Shimizu, Tetsuhide; Nakajima, Hizuru; Uchiyama, Katsumi; Yang, Ming
2017-07-11
A film-stack reaction field with a micropillar array using a motor stirrer was developed for the high sensitivity and rapid enzyme-linked immunosorbent assay (ELISA) reaction. The effects of the incubation time of a protein (30 s, 5 min, and 10 min) on the fluorescence intensity in ELISAs were investigated using a reaction field with different micropillar array dimensions (5-µm, 10-µm and 50-µm gaps between the micropillars). The difference in fluorescence intensity between the well with the reaction field of 50-µm gap for the incubation time of 30 s and the well without the reaction field with for incubation time of 10 min was 6%. The trend of the fluorescence intensity in the gap between the micro pillars in the film-stack reaction field was different between the short incubation time and the long incubation time. The theoretical analysis of the physical parameters related with the biomolecule transport indicated that the reaction efficiency defined in this study was the dominant factor determining the fluorescence intensity for the short incubation time, whereas the volumetric rate of the circulating flow through the space between films and the specific surface area were the dominant factors for the long incubation time.
An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.
Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján
2016-02-20
In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.
Umamaheswari, A; Venkateswarlu, K
2004-06-01
Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.
Doping Scheme in Atomic Chain Electronics
NASA Technical Reports Server (NTRS)
Toshishige, Yamada
1997-01-01
Due to the dramatic reduction in MOS size, there appear many unwanted effects. In these small devices, the number of dopant atoms in the channel is not macroscopic and electrons may suffer significantly different scattering from device to device since the spatial distribution of dopant atoms is no longer regarded as continuous. This prohibits integration, while it is impossible to control such dopant positions within atomic scale. A fundamental solution is to create electronics with simple but atomically precise structures, which could be fabricated with recent atom manipulation technology. All the constituent atoms are placed as planned, and then the device characteristics are deviation-free, which is mandatory for integration. Atomic chain electronics belongs to this category. Foreign atom chains or arrays form devices, and they are placed on the atomically flat substrate surface. We can design the band structure and the resultant Fermi energy of these structures by manipulating the lattice constant. Using the tight-binding theory with universal parameters, it has been predicted that isolated Si chains and arrays are metallic, Mg chains are insulating, and Mg arrays have metallic and insulating phases [1]. The transport properties along a metallic chain have been studied, emphasizing the role of the contact to electrodes [2]. For electronic applications, it is essential to establish a method to dope a semiconducting chain, which is to control the Fermi energy position without altering the original band structure. If we replace some of the chain atoms with dopant atoms randomly, the electrons will see random potential along die chain and will be localized strongly in space (Anderson localization). However, if we replace periodically, although the electrons can spread over the chain, there will generally appear new bands and band gaps reflecting the new periodicity of dopant atoms. This will change the original band structure significantly. In order to overcome this dilemma, we may place a dopant atom beside the chain at every N lattice periods (N > 1). Because of the periodic arrangement of pant atoms, we can avoid the unwanted Anderson localization. Moreover, since the dopant atoms do not constitute the chain, the overlap interaction between them is minimized, and the band structure modification can be made smallest. Some tight-binding results will be discussed to demonstrate the present idea.
Past and future detector arrays for complete event reconstruction in heavy-ion reactions
NASA Astrophysics Data System (ADS)
Cardella, G.; Acosta, L.; Auditore, L.; Boiano, C.; Castoldi, A.; D'Andrea, M.; De Filippo, E.; Dell'Aquila, D.; De Luca, S.; Fichera, F.; Giudice, N.; Gnoffo, B.; Grimaldi, A.; Guazzoni, C.; Lanzalone, G.; Librizzi, F.; Lombardo, I.; Maiolino, C.; Maffesanti, S.; Martorana, N. S.; Norella, S.; Pagano, A.; Pagano, E. V.; Papa, M.; Parsani, T.; Passaro, G.; Pirrone, S.; Politi, G.; Previdi, F.; Quattrocchi, L.; Rizzo, F.; Russotto, P.; Saccà, G.; Salemi, G.; Sciliberto, D.; Trifirò, A.; Trimarchi, M.; Vigilante, M.
2017-11-01
Complex and more and more complete detector arrays have been developed in the last two decades, or are in advanced design stage, in different laboratories. Such arrays are necessary to fully characterize nuclear reactions induced by stable and exotic beams. The need for contemporary detection of charged particles, and/or γ -rays, and/or neutrons, has been stressed in many fields of nuclear structure and reaction dynamics, with particular attention to the improvement of both high angular and energy resolution. Some examples of detection systems adapted to various energy ranges is discussed. Emphasis is given to the possible update of relatively old 4π detectors with new electronics and new detection methods.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Long Chain DNA Separation in a Sparse Nanopost Array
NASA Astrophysics Data System (ADS)
Ou, Jia; Joswiak, Mark; Dorfman, Kevin
2010-11-01
Long chain DNA separation is a challenge for gel lectrophoresis. Our previous DNA separation experiments and simulations demonstrated that a sparse micro post array can separate large DNA. However, the smaller DNA are not well resolved. We hypothesized that smaller posts will increase the collision frequency of the smaller DNA and thus the resolution. We successfully fabricated a hexagonal array of 350 nm diameter posts with a 3 μm spacing using an oxygen plasma etching method. Under an electric field of 10 V/cm, the mobilities of different species ranging from 10-48.5 kilobasepair (kbp) were normalized by the mobility of λ DNA (48.5 kbp), which was included in all experiments as a standard to correct for day-to-day variations in electroosmotic flow. The resolution of these DNA is markedly improved when compared with a 1 μm diameter micropost array. We demonstrate the robustness of the device by using the calibration curve to identify the peaks in a separation of the λ DNA-Mono Cut mix.
Mild and modular surface modification of cellulose via hetero Diels-Alder (HDA) cycloaddition.
Goldmann, Anja S; Tischer, Thomas; Barner, Leonie; Bruns, Michael; Barner-Kowollik, Christopher
2011-04-11
A combination of reversible addition-fragmentation chain transfer (RAFT) polymerization and hetero Diels-Alder (HDA) cycloaddition was used to effect, under mild (T ≈ 20 °C), fast, and modular conditions, the grafting of poly(isobornyl acrylate) (M(n) = 9800 g mol(-1), PDI = 1.19) onto a solid cellulose substrate. The active hydroxyl groups expressed on the cellulose fibers were converted to tosylate leaving groups, which were subsequently substituted by a highly reactive cyclopentadienyl functionality (Cp). By employing the reactive Cp-functionality as a diene, thiocarbonyl thio-capped poly(isobornyl acrylate) synthesized via RAFT polymerization (mediated by benzyl pyridine-2-yldithioformiate (BPDF)) was attached to the surface under ambient conditions by an HDA cycloaddition (reaction time: 15 h). The surface-modified cellulose samples were analyzed in-depth by X-ray photoelectron spectroscopy, scanning electron microscopy, elemental analysis, Fourier transform infrared (FT-IR) spectroscopy as well as Fourier transform infrared microscopy employing a focal plane array detector for imaging purposes. The analytical results provide strong evidence that the reaction of suitable dienophiles with Cp-functional cellulose proceeds under mild reaction conditions (T ≈ 20 °C) in an efficient fashion. In particular, the visualization of individual modified cellulose fibers via high-resolution FT-IR microscopy corroborates the homogeneous distribution of the polymer film on the cellulose fibers.
Yeh, Yin-Ting; Tang, Yi; Sebastian, Aswathy; Dasgupta, Archi; Perea-Lopez, Nestor; Albert, Istvan; Lu, Huaguang; Terrones, Mauricio; Zheng, Si-Yang
2016-01-01
Viral infectious diseases can erupt unpredictably, spread rapidly, and ravage mass populations. Although established methods, such as polymerase chain reaction, virus isolation, and next-generation sequencing have been used to detect viruses, field samples with low virus count pose major challenges in virus surveillance and discovery. We report a unique carbon nanotube size-tunable enrichment microdevice (CNT-STEM) that efficiently enriches and concentrates viruses collected from field samples. The channel sidewall in the microdevice was made by growing arrays of vertically aligned nitrogen-doped multiwalled CNTs, where the intertubular distance between CNTs could be engineered in the range of 17 to 325 nm to accurately match the size of different viruses. The CNT-STEM significantly improves detection limits and virus isolation rates by at least 100 times. Using this device, we successfully identified an emerging avian influenza virus strain [A/duck/PA/02099/2012(H11N9)] and a novel virus strain (IBDV/turkey/PA/00924/14). Our unique method demonstrates the early detection of emerging viruses and the discovery of new viruses directly from field samples, thus creating a universal platform for effectively remediating viral infectious diseases. PMID:27730213
Expression of Reactive Oxygen Species–Related Transcripts in Egyptian Children With Autism
Meguid, Nagwa A; Ghozlan, Said A S; Mohamed, Magda F; Ibrahim, Marwa K; Dawood, Reham M; Bader El Din, Noha G; Abdelhafez, Tawfeek H; Hemimi, Maha; El Awady, Mostafa K
2017-01-01
The molecular basis of the pathophysiological role of oxidative stress in autism is understudied. Herein, we used polymerase chain reaction (PCR) array to analyze transcriptional pattern of 84 oxidative stress genes in peripheral blood mononuclear cell pools isolated from 32 autistic patients (16 mild/moderate and 16 severe) and 16 healthy subjects (each sample is a pool from 4 autistic patients or 4 controls). The PCR array data were further validated by quantitative real-time PCR in 80 autistic children (55 mild/moderate and 25 severe) and 60 healthy subjects. Our data revealed downregulation in GCLM, SOD2, NCF2, PRNP, and PTGS2 transcripts (1.5, 3.8, 1.2, 1.7, and 2.2, respectively;P < .05 for all) in autistic group compared with controls. In addition, TXN and FTH1 exhibited 1.4- and 1.7-fold downregulation, respectively, in severe autistic patients when compared with mild/moderate group (P = .005 and .0008, respectively). This study helps in a better understanding of the underlying biology and related genetic factors of autism, and most importantly, it presents suggested candidate biomarkers for diagnosis and prognosis purposes as well as targets for therapeutic intervention. PMID:28469396
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Heat-enhanced peptide synthesis on Teflon-patterned paper.
Deiss, Frédérique; Yang, Yang; Matochko, Wadim L; Derda, Ratmir
2016-06-14
In this report, we describe the methodology for 96 parallel organic syntheses of peptides on Teflon-patterned paper assisted by heating with an infra-red lamp. SPOT synthesis is an important technology for production of peptide arrays on a paper-based support for rapid identification of peptide ligands, epitope mapping, and identification of bio-conjugation reactions. The major drawback of the SPOT synthesis methodology published to-date is suboptimal reaction conversion due to mass transport limitations in the unmixed reaction spot. The technology developed in this report overcomes these problems by changing the environment of the reaction from static to dynamic (flow-through), and further accelerating the reaction by selective heating of the reaction support in contact with activated amino acids. Patterning paper with Teflon allows for droplets of organic solvents to be confined in a zone on the paper array and flow through the paper at a well-defined rate and provide a convenient, power-free setup for flow-through solid-phase synthesis and efficient assembly of peptide arrays. We employed an infra-red (IR) lamp to locally heat the cellulosic support during the flow-through delivery of the reagents to each zone of the paper-based array. We demonstrate that IR-heating in solid phase peptide synthesis shortened the reaction time necessary for amide bond formation down to 3 minutes; in some couplings of alpha amino acids, conversion rates increased up to fifteen folds. The IR-heating improved the assembly of difficult sequences, such as homo-oligomers of all 20 natural amino acids.
Spin-state transfer in laterally coupled quantum-dot chains with disorders
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Song; Key Laboratory of Quantum Information, University of Science and Technology of China, Hefei 230026; Bayat, Abolfazl
2010-08-15
Quantum dot arrays are a promising medium for transferring quantum information between two distant points without resorting to mobile qubits. Here we study the two most common disorders, namely hyperfine interaction and exchange coupling fluctuations, in quantum dot arrays and their effects on quantum communication through these chains. Our results show that the hyperfine interaction is more destructive than the exchange coupling fluctuations. The average optimal time for communication is not affected by any disorder in the system and our simulations show that antiferromagnetic chains are much more resistive than the ferromagnetic ones against both kind of disorders. Even whenmore » time modulation of a coupling and optimal control is employed to improve the transmission, the antiferromagnetic chain performs much better. We have assumed the quasistatic approximation for hyperfine interaction and time-dependent fluctuations in the exchange couplings. Particularly for studying exchange coupling fluctuations we have considered the static disorder, white noise, and 1/f noise.« less
Whole genome amplification of DNA extracted from FFPE tissues.
Bosso, Mira; Al-Mulla, Fahd
2011-01-01
Whole genome amplification systems were developed to meet the increasing research demands on DNA resources and to avoid DNA shortage. The technology enables amplification of nanogram amounts of DNA into microgram quantities and is increasingly used in the amplification of DNA from multiple origins such as blood, fresh frozen tissue, formalin-fixed paraffin-embedded tissues, saliva, buccal swabs, bacteria, and plant and animal sources. This chapter focuses on the use of GenomePlex(®) tissue Whole Genome Amplification Kit, to amplify DNA directly from archived tissue. In addition, this chapter documents our unique experience with the utilization of GenomePlex(®) amplified DNA using several molecular techniques including metaphase Comparative Genomic Hybridization, array Comparative Genomic Hybridization, and real-time quantitative polymerase chain reaction assays. GenomePlex(®) is a registered trademark of Rubicon Genomics Incorporation.
Yang, Qianru; Domesle, Kelly J.
2018-01-01
Abstract Loop-mediated isothermal amplification (LAMP) has become a powerful alternative to polymerase chain reaction (PCR) for pathogen detection in clinical specimens and food matrices. Nontyphoidal Salmonella is a zoonotic pathogen of significant food and feed safety concern worldwide. The first study employing LAMP for the rapid detection of Salmonella was reported in 2005, 5 years after the invention of the LAMP technology in Japan. This review provides an overview of international efforts in the past decade on the development and application of Salmonella LAMP assays in a wide array of food and feed matrices. Recent progress in assay design, platform development, commercial application, and method validation is reviewed. Future perspectives toward more practical and wider applications of Salmonella LAMP assays in food and feed testing are discussed. PMID:29902082
Wong, Kwong-Kwok
2000-01-01
The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.
Electromagnetic transition rates in the N=80 nucleus 58138Ce
NASA Astrophysics Data System (ADS)
Alharbi, T.; Regan, P. H.; Mason, P. J. R.; Mărginean, N.; Podolyák, Zs.; Bruce, A. M.; Simpson, E. C.; Algora, A.; Alazemi, N.; Britton, R.; Bunce, M. R.; Bucurescu, D.; Cooper, N.; Deleanu, D.; Filipescu, D.; Gelletly, W.; Ghită, D.; Glodariu, T.; Ilie, G.; Kisyov, S.; Lintott, J.; Lalkovski, S.; Liddick, S.; Mihai, C.; Mulholland, K.; Mărginean, R.; Negret, A.; Nakhostin, M.; Nita, C. R.; Roberts, O. J.; Rice, S.; Smith, J. F.; Stroe, L.; Sava, T.; Townsley, C.; Wilson, E.; Werner, V.; Zhekova, M.; Zamfir, N. V.
2013-01-01
The half-life of the Iπ=6+ yrast state at Ex=2294 keV in 138Ce has been measured as T1/2=880(19) ps using the fast-timing γ-ray coincidence method with a mixed LaBr3(Ce)-HPGe array. The excited states in 138Ce have been populated by the 130Te(12C,4n) fusion-evaporation reaction at an incident beam energy of 56 MeV. The extracted B(E2;61+→41+)=0.101(24) W.u. value is compared with the predictions of truncated basis shell model calculations and with the systematics of the region. This shows an anomalous behavior compared to the neighboring isotonic and isotopic chains. Half-lives for the yrast 5-, 11+ and 14+ states in 138Ce have also been determined in this work.
Introduction to the Thematic Minireview Series: Redox metabolism and signaling.
Banerjee, Ruma
2017-10-13
Life on oxygen predisposes cells to reactive oxygen species (ROS) generation by electron slippage in the electron transfer chain. Aerobic metabolism also generates superoxide (O 2 ̇̄ ) and hydrogen peroxide (H 2 O 2 ) as bona fide products in reactions involving 1- or 2-electron reduction of O 2 Although often viewed as dangerous, ROS are now recognized as important messengers in redox signaling pathways. A delicate balance between needed versus excessive ROS production distinguishes health from an array of disease states. A collection of provocative reviews in this thematic series discusses the relative importance of mitochondrial sites for ROS production, ROS signaling-mediated regulation of cellular stress responses and thermogenesis, and how O 2 deficiency leads to metabolic reprograming in cancer. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Inhibition of inflammatory cytokine-induced response in human islet cells by withaferin A.
Peng, H; Olsen, G; Tamura, Y; Noguchi, H; Matsumoto, S; Levy, M F; Naziruddin, B
2010-01-01
After islet cell transplantation, a substantial mass of islets are lost owing to nonspecific inflammatory reactions. Cytokine exposure before or after transplantation can upregulate expression of proinflammatory genes via the nuclear factor-kappaB signaling pathway, eventually resulting in islet loss. To test the effects of a naturally occurring nuclear factor-kappaB inhibitor, withaferin A, on regulation of inflammatory genes in human islets. Human pancreatic islets were isolated using a modified Ricordi protocol. Purified islets were cultured for 2 days. The effect of withaferin A treatment on islet cell viability was examined using the fluorescein diacetate-propidium iodide dye exclusion test, and on function using a static glucose stimulation assay. Islet cells were treated with a cytokine mixture (50 U/mL of interleukin-1beta, 1000 U/mL of tumor necrosis factor-alpha, and 1000 U/mL of interferon-gamma) for 48 hours with or without withaferin A, 1 microg/mL. Treated islets were used for real-time polymerase chain reaction (PCR) array analysis for expression of inflammatory genes, and expression of other selected genes was analyzed using real-time PCR with single primers. Glucose stimulation and viability assays demonstrated that withaferin A was not toxic to islet cells. Of 84 inflammation-related genes examined using real-time PCR array analysis, 9 were significantly upregulated by cytokine treatment compared with the control group. However, addition of withaferin A to the culture significantly inhibited expression of all genes. Withaferin A significantly inhibits the inflammatory response of islet cells with cytokine exposure. Copyright 2010 Elsevier Inc. All rights reserved.
Supramolecular Polymers Based on Non-Coplanar AAA-DDD Hydrogen-Bonded Complexes.
Mendez, Iamnica J Linares; Wang, Hong-Bo; Yuan, Ying-Xue; Wisner, James A
2018-03-01
Non-coplanar triple-hydrogen-bond arrays are connected as telechelic groups to alkyl chains and their properties as AA/BB type supramolecular polymers are examined. Viscosity studies at three temperatures are used to study the ring-chain equilibrium and determine the critical concentrations where polymer chains are formed. It is observed that neither the temperature range studied nor the alkyl chain length of one component significantly affect the polymerization properties in this system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Wiktor, Peter; Brunner, Al; Kahn, Peter; Qiu, Ji; Magee, Mitch; Bian, Xiaofang; Karthikeyan, Kailash; Labaer, Joshua
2015-03-01
We report a device to fill an array of small chemical reaction chambers (microreactors) with reagent and then seal them using pressurized viscous liquid acting through a flexible membrane. The device enables multiple, independent chemical reactions involving free floating intermediate molecules without interference from neighboring reactions or external environments. The device is validated by protein expressed in situ directly from DNA in a microarray of ~10,000 spots with no diffusion during three hours incubation. Using the device to probe for an autoantibody cancer biomarker in blood serum sample gave five times higher signal to background ratio compared to standard protein microarray expressed on a flat microscope slide. Physical design principles to effectively fill the array of microreactors with reagent and experimental results of alternate methods for sealing the microreactors are presented.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Control and reduction of peak temperature in self-curing resins.
Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A
2009-07-01
INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.
Liu, Xujun; Guan, Leilei; Fu, Xiaoniu; Zhao, Yu; Wu, Jiada; Xu, Ning
2014-03-21
Light-absorbing and electrically conductive binary CNx nanocone (CNNC) arrays have been fabricated using a glow discharge plasma-assisted reaction deposition method. The intact CNNCs with amorphous structure and central nickel-filled pipelines could be vertically and neatly grown on nickel-covered substrates according to the catalyst-leading mode. The morphologies and composition of the as-grown CNNC arrays can be well controlled by regulating the methane/nitrogen mixture inlet ratio, and their optical absorption and resistivity strongly depend on their morphologies and composition. Beside large specific surface area, the as-grown CNNC arrays demonstrate high wideband absorption, good conduction, and nice wettability to polymer absorbers.
Burgos, Carmen Mesas; Uggla, Andreas Ringman; Fagerström-Billai, Fredrik; Eklöf, Ann-Christine; Frenckner, Björn; Nord, Magnus
2010-07-01
Pulmonary hypoplasia and persistent pulmonary hypertension are the main causes of mortality and morbidity in newborns with congenital diaphragmatic hernia (CDH). Nitrofen is well known to induce CDH and lung hypoplasia in a rat model, but the mechanism remains unknown. To increase the understanding of the underlying pathogenesis of CDH, we performed a global gene expression analysis using microarray technology. Pregnant rats were given 100 mg nitrofen on gestational day 9.5 to create CDH. On day 21, fetuses after nitrofen administration and control fetuses were removed; and lungs were harvested. Global gene expression analysis was performed using Affymetrix Platform and the RAE 230 set arrays. For validation of microarray data, we performed real-time polymerase chain reaction and Western blot analysis. Significantly decreased genes after nitrofen administration included several growth factors and growth factors receptors involved in lung development, transcription factors, water and ion channels, and genes involved in angiogenesis and extracellular matrix. These results could be confirmed with real-time polymerase chain reaction and protein expression studies. The pathogenesis of lung hypoplasia and CDH in the nitrofen model includes alteration at a molecular level of several pathways involved in lung development. The complexity of the nitrofen mechanism of action reminds of human CDH; and the picture is consistent with lung hypoplasia and vascular disease, both important contributors to the high mortality and morbidity in CDH. Increased understanding of the molecular mechanisms that control lung growth may be the key to develop novel therapeutic techniques to stimulate pre- and postnatal lung growth. Copyright 2010 Elsevier Inc. All rights reserved.
Arpornmaeklong, Premjit; Pressler, Michael J
2018-01-01
Extracellular matrix (ECM) and adhesion molecules play crucial roles in regulating growth and differentiation of stem cells. The current study aimed to investigate the effects of beta-tricalcium phosphate (ß-TCP) scaffolds on differentiation and expression of ECM and adhesion molecules of human embryonic stem cells (hESCs). Undifferentiated hESCs were seeded on ß-TCP scaffolds and cell culture plates and cultured in growth and osteogenic medium for 21 days. Scanning electron microscopy (SEM) displayed adhesion and growth of hESCs on the porous ß-TCP scaffolds. Histological analysis, immunohistochemical staining and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) demonstrated that the scaffolds supported growth and differentiation of hESCs. Expression levels of neural crest related genes (AP2a, FoxD3, HNK1, P75, Sox1, Sox10) and osteoblast-related genes (Runx2, SPP1 and BGLA) on the scaffolds in osteogenic medium were significantly higher than on the scaffolds in growth and cell culture plates in osteogenic medium, respectively (p<0.05). Polymerase chain reaction array experiments demonstrated increased expression of ECM and adhesion molecule-related genes on the scaffolds. In conclusion, osteoconductive scaffolds such as ß-TCP scaffolds promoted differentiation of hESCs, particularly expression of genes related to neural crest stem cell and osteoblastic differentiations. Beta-TCP scaffolds could be an alternative cell culture substrate for neural crest and osteogenic differentiation of hESCs. Optimization of culture medium may be necessary to enhance lineage restriction of hESCs on the ß-TCP scaffolds. Copyright © 2017 Elsevier GmbH. All rights reserved.
Dickinson, Brent A; Semus, Hillary M; Montgomery, Rusty L; Stack, Christianna; Latimer, Paul A; Lewton, Steven M; Lynch, Joshua M; Hullinger, Thomas G; Seto, Anita G; van Rooij, Eva
2013-06-01
Recent studies have shown that microRNAs (miRNAs), besides being potent regulators of gene expression, can additionally serve as circulating biomarkers of disease. The aim of this study is to determine if plasma miRNAs can be used as indicators of disease progression or therapeutic efficacy in hypertension-induced heart disease. In order to define circulating miRNAs that change during hypertension-induced heart failure and that respond to therapeutic treatment, we performed miRNA arrays on plasma RNA from hypertensive rats that show signs of heart failure. Array analysis indicated that approximately one-third of the miRNAs on the array are detectable in plasma. Quantitative real-time polymerase chain reaction (PCR) analysis for a selected panel of miRNAs indicated that circulating levels of miR-16, miR-20b, miR-93, miR-106b, miR-223, and miR-423-5p were significantly increased in response to hypertension-induced heart failure, while this effect was blunted in response to treatment with antimiR-208a as well as an ACE inhibitor. Moreover, treatment with antimiR-208a resulted in a dramatic increase in one miRNA, miR-19b. A time course study indicated that several of these miRNA changes track with disease progression. Circulating levels of miRNAs are responsive to therapeutic interventions and change during the progression of hypertension-induced heart disease.
Modeling competitive substitution in a polyelectrolyte complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu
2015-12-28
We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less
Day, I N; Humphries, S E
1994-11-01
Electrophoresis of DNA has been performed traditionally in either an agarose or acrylamide gel matrix. Considerable effort has been directed to improved quality agaroses capable of high resolution, but for small fragments, such as those from polymerase chain reaction (PCR) and post-PCR digests, acrylamide still offers the highest resolution. Although agarose gels can easily be prepared in an open-faced format to gain the conveniences of horizontal electrophoresis, acrylamide does not polymerize in the presence of air and the usual configurations for gel preparation lead to electrophoresis in the vertical dimension. We describe here a very simple device and method to prepare and manipulate horizontal polyacrylamide gels (H-PAGE). In addition, the open-faced horizontal arrangement enables loading of arrays of wells. Since many procedures are undertaken in standard 96-well microtiter plates, we have also designed a device which preserves the exact configuration of the 8 x 12 array and enables electrophoresis in tracks following a 71.6 degrees diagonal between wells (MADGE, microtiter array diagonal gel electrophoresis), using either acrylamide or agarose. This eliminates almost all of the staff time taken in setup, loading, and recordkeeping and offers high resolution for genotyping pattern recognition. The nature and size of the gels allow direct stacking of gels in one tank, so that a tank used typically to analyze 30-60 samples can readily be used to analyze 1000-2000 samples. The gels would also enable robotic loading. Electrophoresis allows analysis of size and charge, parameters inaccessible to liquid-phase methods: thus, genotyping size patterns, variable length repeats, and haplotypes is possible, as well as adaptability to typing of point variations using protocols which create a difference detectable by electrophoresis.
Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V
2011-03-14
Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Nagaoka, Sumiharu; Sasaki, Nobuya; Carninci, Piero; Konno, Hideaki; Akiyama, Junichi; Nishi, Katsuo; Kitsunai, Tokuji; Tashiro, Hideo; Itoh, Mari; Sumi, Noriko; Ishii, Yoshiyuki; Nakamura, Shin; Hazama, Makoto; Nishine, Tsutomu; Harada, Akira; Yamamoto, Rintaro; Matsumoto, Hiroyuki; Sakaguchi, Sumito; Ikegami, Takashi; Kashiwagi, Katsuya; Fujiwake, Syuji; Inoue, Kouji; Togawa, Yoshiyuki; Izawa, Masaki; Ohara, Eiji; Watahiki, Masanori; Yoneda, Yuko; Ishikawa, Tomokazu; Ozawa, Kaori; Tanaka, Takumi; Matsuura, Shuji; Kawai, Jun; Okazaki, Yasushi; Muramatsu, Masami; Inoue, Yorinao; Kira, Akira; Hayashizaki, Yoshihide
2000-01-01
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3′ end and 5′ end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month. PMID:11076861
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Release of free amino acids upon oxidation of peptides and proteins by hydroxyl radicals.
Liu, Fobang; Lai, Senchao; Tong, Haijie; Lakey, Pascale S J; Shiraiwa, Manabu; Weller, Michael G; Pöschl, Ulrich; Kampf, Christopher J
2017-03-01
Hydroxyl radical-induced oxidation of proteins and peptides can lead to the cleavage of the peptide, leading to a release of fragments. Here, we used high-performance liquid chromatography tandem mass spectrometry (HPLC-MS/MS) and pre-column online ortho-phthalaldehyde (OPA) derivatization-based amino acid analysis by HPLC with diode array detection and fluorescence detection to identify and quantify free amino acids released upon oxidation of proteins and peptides by hydroxyl radicals. Bovine serum albumin (BSA), ovalbumin (OVA) as model proteins, and synthetic tripeptides (comprised of varying compositions of the amino acids Gly, Ala, Ser, and Met) were used for reactions with hydroxyl radicals, which were generated by the Fenton reaction of iron ions and hydrogen peroxide. The molar yields of free glycine, aspartic acid, asparagine, and alanine per peptide or protein varied between 4 and 55%. For protein oxidation reactions, the molar yields of Gly (∼32-55% for BSA, ∼10-21% for OVA) were substantially higher than those for the other identified amino acids (∼5-12% for BSA, ∼4-6% for OVA). Upon oxidation of tripeptides with Gly in C-terminal, mid-chain, or N-terminal positions, Gly was preferentially released when it was located at the C-terminal site. Overall, we observe evidence for a site-selective formation of free amino acids in the OH radical-induced oxidation of peptides and proteins, which may be due to a reaction pathway involving nitrogen-centered radicals.
Silicon-based sleeve devices for chemical reactions
Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.
1996-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Silicon-based sleeve devices for chemical reactions
Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.
1996-12-31
A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.
A hydrodynamic mechanism for spontaneous formation of ordered drop arrays in confined shear flow
NASA Astrophysics Data System (ADS)
Singha, Sagnik; Zurita-Gotor, Mauricio; Loewenberg, Michael; Migler, Kalman; Blawzdziewicz, Jerzy
2017-11-01
It has been experimentally demonstrated that a drop monolayer driven by a confined shear flow in a Couette device can spontaneously arrange into a flow-oriented parallel chain microstructure. However, the hydrodynamic mechanism of this puzzling self-assembly phenomenon has so far eluded explanation. In a recent publication we suggested that the observed spontaneous drop ordering may arise from hydrodynamic interparticle interactions via a far-field quadrupolar Hele-Shaw flow associated with drop deformation. To verify this conjecture we have developed a simple numerical-simulation model that includes the far-field Hele-Shaw flow quadrupoles and a near-field short-range repulsion. Our simulations show that an initially disordered particle configuration self-organizes into a system of particle chains, similar to the experimentally observed drop-chain structures. The initial stage of chain formation is fast; subsequently, microstructural defects in a partially ordered system are removed by slow annealing, leading to an array of equally spaced parallel chains with a small number of defects. The microstructure evolution is analyzed using angular and spatial order parameters and correlation functions. Supported by NSF Grants No. CBET 1603627 and CBET 1603806.
Large format array controller (aLFA-C): tests and characterisation at ESA
NASA Astrophysics Data System (ADS)
Lemmel, Frédéric; ter Haar, Jörg; van der Biezen, John; Duvet, Ludovic; Nelms, Nick; Blommaert, Sander; Butler, Bart; van der Luijt, Cornelis; Heijnen, Jerko; Smit, Hans; Visser, Ivo
2016-08-01
For future near infrared astronomy missions, ESA is developing a complete detection and conversion chain (photon to SpaceWire chain system): Large Format Array (aLFA-N) based on MCT type detectors. aLFA-C (Astronomy Large Format Array Controller): a versatile cryogenic detector controller. An aLFA-C prototype was developed by Caeleste (Belgium) under ESA contract (400106260400). To validate independently the performances of the aLFA-C prototype and consolidate the definition of the follow-on activity, a dedicated test bench has been designed and developed in ESTEC/ESA within the Payload Technology Validation group. This paper presents the test setup and the performance validation of the first prototype of this controller at room and cryogenic temperature. Test setup and software needed to test the HAWAII-2RG and aLFA-N detectors with the aLFA-C prototype at cryogenic temperature will be also presented.
Nie, Bei; Yang, Min; Fu, Weiling; Liang, Zhiqing
2015-07-07
The surface invasive cleavage assay, because of its innate accuracy and ability for self-signal amplification, provides a potential route for the mapping of hundreds of thousands of human SNP sites. However, its performance on a high density DNA array has not yet been established, due to the unusual "hairpin" probe design on the microarray and the lack of chemical stability of commercially available substrates. Here we present an applicable method to implement a nanocrystalline diamond thin film as an alternative substrate for fabricating an addressable DNA array using maskless light-directed photochemistry, producing the most chemically stable and biocompatible system for genetic analysis and enzymatic reactions. The surface invasive cleavage reaction, followed by degenerated primer ligation and post-rolling circle amplification is consecutively performed on the addressable diamond DNA array, accurately mapping SNP sites from PCR-amplified human genomic target DNA. Furthermore, a specially-designed DNA array containing dual probes in the same pixel is fabricated by following a reverse light-directed DNA synthesis protocol. This essentially enables us to decipher thousands of SNP alleles in a single-pot reaction by the simple addition of enzyme, target and reaction buffers.
NASA Astrophysics Data System (ADS)
Bogdanov, Valery L.; Boyce-Jacino, Michael
1999-05-01
Confined arrays of biochemical probes deposited on a solid support surface (analytical microarray or 'chip') provide an opportunity to analysis multiple reactions simultaneously. Microarrays are increasingly used in genetics, medicine and environment scanning as research and analytical instruments. A power of microarray technology comes from its parallelism which grows with array miniaturization, minimization of reagent volume per reaction site and reaction multiplexing. An optical detector of microarray signals should combine high sensitivity, spatial and spectral resolution. Additionally, low-cost and a high processing rate are needed to transfer microarray technology into biomedical practice. We designed an imager that provides confocal and complete spectrum detection of entire fluorescently-labeled microarray in parallel. Imager uses microlens array, non-slit spectral decomposer, and high- sensitive detector (cooled CCD). Two imaging channels provide a simultaneous detection of localization, integrated and spectral intensities for each reaction site in microarray. A dimensional matching between microarray and imager's optics eliminates all in moving parts in instrumentation, enabling highly informative, fast and low-cost microarray detection. We report theory of confocal hyperspectral imaging with microlenses array and experimental data for implementation of developed imager to detect fluorescently labeled microarray with a density approximately 103 sites per cm2.
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing
2016-10-01
The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H
2002-07-01
Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.
Organic reactions mediated by electrochemically generated ArS+.
Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi
2011-04-21
Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.
Hsu, Hsun-Feng; Huang, Wan-Ru; Chen, Ting-Hsuan; Wu, Hwang-Yuan; Chen, Chun-An
2013-05-10
This work develops a method for growing Ni-silicide/Si heterostructured nanowire arrays by glancing angle Ni deposition and solid state reaction on ordered Si nanowire arrays. Samples of ordered Si nanowire arrays were fabricated by nanosphere lithography and metal-induced catalytic etching. Glancing angle Ni deposition deposited Ni only on the top of Si nanowires. When the annealing temperature was 500°C, a Ni3Si2 phase was formed at the apex of the nanowires. The phase of silicide at the Ni-silicide/Si interface depended on the diameter of the Si nanowires, such that epitaxial NiSi2 with a {111} facet was formed at the Ni-silicide/Si interface in Si nanowires with large diameter, and NiSi was formed in Si nanowires with small diameter. A mechanism that is based on flux divergence and a nucleation-limited reaction is proposed to explain this phenomenon of size-dependent phase formation.
2013-01-01
This work develops a method for growing Ni-silicide/Si heterostructured nanowire arrays by glancing angle Ni deposition and solid state reaction on ordered Si nanowire arrays. Samples of ordered Si nanowire arrays were fabricated by nanosphere lithography and metal-induced catalytic etching. Glancing angle Ni deposition deposited Ni only on the top of Si nanowires. When the annealing temperature was 500°C, a Ni3Si2 phase was formed at the apex of the nanowires. The phase of silicide at the Ni-silicide/Si interface depended on the diameter of the Si nanowires, such that epitaxial NiSi2 with a {111} facet was formed at the Ni-silicide/Si interface in Si nanowires with large diameter, and NiSi was formed in Si nanowires with small diameter. A mechanism that is based on flux divergence and a nucleation-limited reaction is proposed to explain this phenomenon of size-dependent phase formation. PMID:23663726
Wiktor, Peter; Brunner, Al; Kahn, Peter; Qiu, Ji; Magee, Mitch; Bian, Xiaofang; Karthikeyan, Kailash; LaBaer, Joshua
2015-01-01
We report a device to fill an array of small chemical reaction chambers (microreactors) with reagent and then seal them using pressurized viscous liquid acting through a flexible membrane. The device enables multiple, independent chemical reactions involving free floating intermediate molecules without interference from neighboring reactions or external environments. The device is validated by protein expressed in situ directly from DNA in a microarray of ~10,000 spots with no diffusion during three hours incubation. Using the device to probe for an autoantibody cancer biomarker in blood serum sample gave five times higher signal to background ratio compared to standard protein microarray expressed on a flat microscope slide. Physical design principles to effectively fill the array of microreactors with reagent and experimental results of alternate methods for sealing the microreactors are presented. PMID:25736721
Evans, Christopher M; Love, Alyssa M; Weiss, Emily A
2012-10-17
This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.
Kinetics of Chemical Reactions in Flames
NASA Technical Reports Server (NTRS)
Zeldovich, Y.; Semenov, N.
1946-01-01
In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
Wang, F; Zhang, Y Q; Ding, J; Yu, L X
2017-10-18
To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.
Conceptual design of the early implementation of the NEutron Detector Array (NEDA) with AGATA
NASA Astrophysics Data System (ADS)
Hüyük, Tayfun; Di Nitto, Antonio; Jaworski, Grzegorz; Gadea, Andrés; Javier Valiente-Dobón, José; Nyberg, Johan; Palacz, Marcin; Söderström, Pär-Anders; Jose Aliaga-Varea, Ramon; de Angelis, Giacomo; Ataç, Ayşe; Collado, Javier; Domingo-Pardo, Cesar; Egea, Francisco Javier; Erduran, Nizamettin; Ertürk, Sefa; de France, Gilles; Gadea, Rafael; González, Vicente; Herrero-Bosch, Vicente; Kaşkaş, Ayşe; Modamio, Victor; Moszynski, Marek; Sanchis, Enrique; Triossi, Andrea; Wadsworth, Robert
2016-03-01
The NEutron Detector Array (NEDA) project aims at the construction of a new high-efficiency compact neutron detector array to be coupled with large γ-ray arrays such as AGATA. The application of NEDA ranges from its use as selective neutron multiplicity filter for fusion-evaporation reaction to a large solid angle neutron tagging device. In the present work, possible configurations for the NEDA coupled with the Neutron Wall for the early implementation with AGATA has been simulated, using Monte Carlo techniques, in order to evaluate their performance figures. The goal of this early NEDA implementation is to improve, with respect to previous instruments, efficiency and capability to select multiplicity for fusion-evaporation reaction channels in which 1, 2 or 3 neutrons are emitted. Each NEDA detector unit has the shape of a regular hexagonal prism with a volume of about 3.23l and it is filled with the EJ301 liquid scintillator, that presents good neutron- γ discrimination properties. The simulations have been performed using a fusion-evaporation event generator that has been validated with a set of experimental data obtained in the 58Ni + 56Fe reaction measured with the Neutron Wall detector array.
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Modeling qRT-PCR dynamics with application to cancer biomarker quantification.
Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A
2017-01-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.
2016-01-01
Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
Improved On-Chip Measurement of Delay in an FPGA or ASIC
NASA Technical Reports Server (NTRS)
Chen, Yuan; Burke, Gary; Sheldon, Douglas
2007-01-01
An improved design has been devised for on-chip-circuitry for measuring the delay through a chain of combinational logic elements in a field-programmable gate array (FPGA) or application-specific integrated circuit (ASIC). In the improved design, the delay chain does not include input and output buffers and is not configured as an oscillator. Instead, the delay chain is made part of the signal chain of an on-chip pulse generator. The duration of the pulse is measured on-chip and taken to equal the delay.
Majewski, Stanislaw; Weisenberger, Andrew G.; Wojcik, Randolph F.; Steinbach, Daniela
1999-01-01
A high resolution gamma ray imaging device includes an aluminum housing, a lead screen collimator at an opened end of the housing, a crystal scintillator array mounted behind the lead screen collimator, a foam layer between the lead screen collimator and the crystal scintillator array, a photomultiplier window coupled to the crystal with optical coupling grease, a photomultiplier having a dynode chain body and a base voltage divider with anodes, anode wire amplifiers each connected to four anodes and a multi pin connector having pin connections to each anode wire amplifier. In one embodiment the crystal scintillator array includes a yttrium aluminum perovskite (YAP) crystal array. In an alternate embodiment, the crystal scintillator array includes a gadolinium oxyorthosilicate (GSO) crystal array.
Microfabricated electrochemiluminescence cell for chemical reaction detection
Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.
2003-01-01
A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions
NASA Astrophysics Data System (ADS)
Zlokazov, V. B.; Utyonkov, V. K.
2017-07-01
The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.
NASA Astrophysics Data System (ADS)
Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua
2017-08-01
Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.
2012-01-01
Background It is known from recent studies that more than 90% of human multi-exon genes are subject to Alternative Splicing (AS), a key molecular mechanism in which multiple transcripts may be generated from a single gene. It is widely recognized that a breakdown in AS mechanisms plays an important role in cellular differentiation and pathologies. Polymerase Chain Reactions, microarrays and sequencing technologies have been applied to the study of transcript diversity arising from alternative expression. Last generation Affymetrix GeneChip Human Exon 1.0 ST Arrays offer a more detailed view of the gene expression profile providing information on the AS patterns. The exon array technology, with more than five million data points, can detect approximately one million exons, and it allows performing analyses at both gene and exon level. In this paper we describe BEAT, an integrated user-friendly bioinformatics framework to store, analyze and visualize exon arrays datasets. It combines a data warehouse approach with some rigorous statistical methods for assessing the AS of genes involved in diseases. Meta statistics are proposed as a novel approach to explore the analysis results. BEAT is available at http://beat.ba.itb.cnr.it. Results BEAT is a web tool which allows uploading and analyzing exon array datasets using standard statistical methods and an easy-to-use graphical web front-end. BEAT has been tested on a dataset with 173 samples and tuned using new datasets of exon array experiments from 28 colorectal cancer and 26 renal cell cancer samples produced at the Medical Genetics Unit of IRCCS Casa Sollievo della Sofferenza. To highlight all possible AS events, alternative names, accession Ids, Gene Ontology terms and biochemical pathways annotations are integrated with exon and gene level expression plots. The user can customize the results choosing custom thresholds for the statistical parameters and exploiting the available clinical data of the samples for a multivariate AS analysis. Conclusions Despite exon array chips being widely used for transcriptomics studies, there is a lack of analysis tools offering advanced statistical features and requiring no programming knowledge. BEAT provides a user-friendly platform for a comprehensive study of AS events in human diseases, displaying the analysis results with easily interpretable and interactive tables and graphics. PMID:22536968
2018-01-01
All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity. PMID:29768011
Gao, Zhaoli; Xia, Han; Zauberman, Jonathan; Tomaiuolo, Maurizio; Ping, Jinglei; Zhang, Qicheng; Ducos, Pedro; Ye, Huacheng; Wang, Sheng; Yang, Xinping; Lubna, Fahmida; Luo, Zhengtang; Ren, Li; Johnson, Alan T Charlie
2018-06-13
All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity.
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...
Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten
2005-03-01
We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.
A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Advanced Precipitation Radar Antenna to Measure Rainfall From Space
NASA Technical Reports Server (NTRS)
Rahmat-Samii, Yahya; Lin, John; Huang, John; Im, Eastwood; Lou, Michael; Lopez, Bernardo; Durden, Stephen
2008-01-01
To support NASA s planned 20-year mission to provide sustained global precipitation measurement (EOS-9 Global Precipitation Measurement (GPM)), a deployable antenna has been explored with an inflatable thin-membrane structure. This design uses a 5.3 5.3-m inflatable parabolic reflector with the electronically scanned, dual-frequency phased array feeds to provide improved rainfall measurements at 2.0-km horizontal resolution over a cross-track scan range of up to 37 , necessary for resolving intense, isolated storm cells and for reducing the beam-filling and spatial sampling errors. The two matched radar beams at the two frequencies (Ku and Ka bands) will allow unambiguous retrieval of the parameters in raindrop size distribution. The antenna is inflatable, using rigidizable booms, deployable chain-link supports with prescribed curvatures, a smooth, thin-membrane reflecting surface, and an offset feed technique to achieve the precision surface tolerance (0.2 mm RMS) for meeting the low-sidelobe requirement. The cylindrical parabolic offset-feed reflector augmented with two linear phased array feeds achieves dual-frequency shared-aperture with wide-angle beam scanning and very low sidelobe level of -30 dB. Very long Ku and Ka band microstrip feed arrays incorporating a combination of parallel and series power divider lines with cosine-over-pedestal distribution also augment the sidelobe level and beam scan. This design reduces antenna mass and launch vehicle stowage volume. The Ku and Ka band feed arrays are needed to achieve the required cross-track beam scanning. To demonstrate the inflatable cylindrical reflector with two linear polarizations (V and H), and two beam directions (0deg and 30deg), each frequency band has four individual microstrip array designs. The Ku-band array has a total of 166x2 elements and the Ka-band has 166x4 elements with both bands having element spacing about 0.65 lambda(sub 0). The cylindrical reflector with offset linear array feeds reduces the complexity from "NxN" transmit/receive (T/R) modules of a conventional planar-phased array to just "N" T/R modules. The antenna uses T/R modules with electronic phase-shifters for beam steering. The offset reflector does not provide poor cross-polarization like a double- curved offset reflector would, and it allows the wide scan angle in one plane required by the mission. Also, the cylindrical reflector with two linear array feeds provides dual-frequency performance with a single, shared aperture. The aperture comprises a reflective surface with a focal length of 1.89 m and is made from aluminized Kapton film. The reflective surface is of uniform thickness in the range of a few thousandths of an inch and is attached to the chain-link support structure via an adjustable suspension system. The film aperture rolls up, together with the chain-link structure, for launch and can be deployed in space by the deployment of the chain-link structure.
Keil, Harry; Wasserman, David; Dawson, Charles R.
1944-01-01
1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415
Keil, H; Wasserman, D; Dawson, C R
1944-10-01
1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.
deWit, D; Wootton, M; Allan, B; Steyn, L
1993-01-01
A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752
Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude
2016-01-01
Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm(2) area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10(-1) to 4 × 10(-3) copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings.
Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude
2016-01-01
Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm2 area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10-1 to 4 × 10-3 copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings. PMID:27074005
Kettunen, Eeva; Anttila, Sisko; Seppänen, Jouni K; Karjalainen, Antti; Edgren, Henrik; Lindström, Irmeli; Salovaara, Reijo; Nissén, Anna-Maria; Salo, Jarmo; Mattson, Karin; Hollmén, Jaakko; Knuutila, Sakari; Wikman, Harriet
2004-03-01
The expression patterns of cancer-related genes in 13 cases of squamous cell lung cancer (SCC) were characterized and compared with those in normal lung tissue and 13 adenocarcinomas (AC), the other major type of nonsmall cell lung cancer (NSCLC). cDNA array was used to screen the gene expression levels and the array results were verified using a real-time reverse-transcriptase-polymerase chain reaction (RT-PCR). Thirty-nine percent of the 25 most upregulated and the 25 most downregulated genes were common to SCC and AC. Of these genes, DSP, HMGA1 (alias HMGIY), TIMP1, MIF, CCNB1, TN, MMP11, and MMP12 were upregulated and COPEB (alias CPBP), TYROBP, BENE, BMPR2, SOCS3, TIMP3, CAV1, and CAV2 were downregulated. The expression levels of several genes from distinct protein families (cytokeratins and hemidesmosomal proteins) were markedly increased in SCC compared with AC and normal lung. In addition, several genes, overexpressed in SCC, such as HMGA1, CDK4, IGFBP3, MMP9, MMP11, MMP12, and MMP14, fell into distinct chromosomal loci, which we have detected as gained regions on the basis of comparative genomic hybridization data. Our study revealed new candidate genes involved in NSCLC.
Sewer, Alain; Gubian, Sylvain; Kogel, Ulrike; Veljkovic, Emilija; Han, Wanjiang; Hengstermann, Arnd; Peitsch, Manuel C; Hoeng, Julia
2014-05-17
High-quality expression data are required to investigate the biological effects of microRNAs (miRNAs). The goal of this study was, first, to assess the quality of miRNA expression data based on microarray technologies and, second, to consolidate it by applying a novel normalization method. Indeed, because of significant differences in platform designs, miRNA raw data cannot be normalized blindly with standard methods developed for gene expression. This fundamental observation motivated the development of a novel multi-array normalization method based on controllable assumptions, which uses the spike-in control probes to adjust the measured intensities across arrays. Raw expression data were obtained with the Exiqon dual-channel miRCURY LNA™ platform in the "common reference design" and processed as "pseudo-single-channel". They were used to apply several quality metrics based on the coefficient of variation and to test the novel spike-in controls based normalization method. Most of the considerations presented here could be applied to raw data obtained with other platforms. To assess the normalization method, it was compared with 13 other available approaches from both data quality and biological outcome perspectives. The results showed that the novel multi-array normalization method reduced the data variability in the most consistent way. Further, the reliability of the obtained differential expression values was confirmed based on a quantitative reverse transcription-polymerase chain reaction experiment performed for a subset of miRNAs. The results reported here support the applicability of the novel normalization method, in particular to datasets that display global decreases in miRNA expression similarly to the cigarette smoke-exposed mouse lung dataset considered in this study. Quality metrics to assess between-array variability were used to confirm that the novel spike-in controls based normalization method provided high-quality miRNA expression data suitable for reliable downstream analysis. The multi-array miRNA raw data normalization method was implemented in an R software package called ExiMiR and deposited in the Bioconductor repository.
2014-01-01
Background High-quality expression data are required to investigate the biological effects of microRNAs (miRNAs). The goal of this study was, first, to assess the quality of miRNA expression data based on microarray technologies and, second, to consolidate it by applying a novel normalization method. Indeed, because of significant differences in platform designs, miRNA raw data cannot be normalized blindly with standard methods developed for gene expression. This fundamental observation motivated the development of a novel multi-array normalization method based on controllable assumptions, which uses the spike-in control probes to adjust the measured intensities across arrays. Results Raw expression data were obtained with the Exiqon dual-channel miRCURY LNA™ platform in the “common reference design” and processed as “pseudo-single-channel”. They were used to apply several quality metrics based on the coefficient of variation and to test the novel spike-in controls based normalization method. Most of the considerations presented here could be applied to raw data obtained with other platforms. To assess the normalization method, it was compared with 13 other available approaches from both data quality and biological outcome perspectives. The results showed that the novel multi-array normalization method reduced the data variability in the most consistent way. Further, the reliability of the obtained differential expression values was confirmed based on a quantitative reverse transcription–polymerase chain reaction experiment performed for a subset of miRNAs. The results reported here support the applicability of the novel normalization method, in particular to datasets that display global decreases in miRNA expression similarly to the cigarette smoke-exposed mouse lung dataset considered in this study. Conclusions Quality metrics to assess between-array variability were used to confirm that the novel spike-in controls based normalization method provided high-quality miRNA expression data suitable for reliable downstream analysis. The multi-array miRNA raw data normalization method was implemented in an R software package called ExiMiR and deposited in the Bioconductor repository. PMID:24886675
Microfabricated sleeve devices for chemical reactions
Northrup, M. Allen
2003-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Enzymatic preparation of structured oils containing short-chain fatty acids.
Kanda, Ayato; Namiki, Fusako; Hara, Setsuko
2010-01-01
Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.
Mosey, Nicholas J; Woo, Tom K
2006-09-04
The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.
The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...
29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.
Code of Federal Regulations, 2010 CFR
2010-07-01
... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...
Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."
ERIC Educational Resources Information Center
Phelps, Tara L.; And Others
1996-01-01
Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…
Determining Annealing Temperatures for Polymerase Chain Reaction
ERIC Educational Resources Information Center
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
USDA-ARS?s Scientific Manuscript database
A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...
Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.
Borkar, Santosh Ramdas; Aidhen, Indrapal Singh
2017-04-18
Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.
Everaers, Ralf; Rosa, Angelo
2012-01-07
The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.
Northrup, M. Allen
2003-08-05
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh
2014-01-01
Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.
Localized temperature and chemical reaction control in nanoscale space by nanowire array.
Jin, C Yan; Li, Zhiyong; Williams, R Stanley; Lee, K-Cheol; Park, Inkyu
2011-11-09
We introduce a novel method for chemical reaction control with nanoscale spatial resolution based on localized heating by using a well-aligned nanowire array. Numerical and experimental analysis shows that each individual nanowire could be selectively and rapidly Joule heated for local and ultrafast temperature modulation in nanoscale space (e.g., maximum temperature gradient 2.2 K/nm at the nanowire edge; heating/cooling time < 2 μs). By taking advantage of this capability, several nanoscale chemical reactions such as polymer decomposition/cross-linking and direct and localized hydrothermal synthesis of metal oxide nanowires were demonstrated.
Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-09-15
We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn
2015-01-01
Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198
Hong, Ie-Hong; Liao, Yung-Cheng; Tsai, Yung-Feng
2013-11-05
The perfectly ordered parallel arrays of periodic Ce silicide nanowires can self-organize with atomic precision on single-domain Si(110)-16 × 2 surfaces. The growth evolution of self-ordered parallel Ce silicide nanowire arrays is investigated over a broad range of Ce coverages on single-domain Si(110)-16 × 2 surfaces by scanning tunneling microscopy (STM). Three different types of well-ordered parallel arrays, consisting of uniformly spaced and atomically identical Ce silicide nanowires, are self-organized through the heteroepitaxial growth of Ce silicides on a long-range grating-like 16 × 2 reconstruction at the deposition of various Ce coverages. Each atomically precise Ce silicide nanowire consists of a bundle of chains and rows with different atomic structures. The atomic-resolution dual-polarity STM images reveal that the interchain coupling leads to the formation of the registry-aligned chain bundles within individual Ce silicide nanowire. The nanowire width and the interchain coupling can be adjusted systematically by varying the Ce coverage on a Si(110) surface. This natural template-directed self-organization of perfectly regular parallel nanowire arrays allows for the precise control of the feature size and positions within ±0.2 nm over a large area. Thus, it is a promising route to produce parallel nanowire arrays in a straightforward, low-cost, high-throughput process.
2013-01-01
The perfectly ordered parallel arrays of periodic Ce silicide nanowires can self-organize with atomic precision on single-domain Si(110)-16 × 2 surfaces. The growth evolution of self-ordered parallel Ce silicide nanowire arrays is investigated over a broad range of Ce coverages on single-domain Si(110)-16 × 2 surfaces by scanning tunneling microscopy (STM). Three different types of well-ordered parallel arrays, consisting of uniformly spaced and atomically identical Ce silicide nanowires, are self-organized through the heteroepitaxial growth of Ce silicides on a long-range grating-like 16 × 2 reconstruction at the deposition of various Ce coverages. Each atomically precise Ce silicide nanowire consists of a bundle of chains and rows with different atomic structures. The atomic-resolution dual-polarity STM images reveal that the interchain coupling leads to the formation of the registry-aligned chain bundles within individual Ce silicide nanowire. The nanowire width and the interchain coupling can be adjusted systematically by varying the Ce coverage on a Si(110) surface. This natural template-directed self-organization of perfectly regular parallel nanowire arrays allows for the precise control of the feature size and positions within ±0.2 nm over a large area. Thus, it is a promising route to produce parallel nanowire arrays in a straightforward, low-cost, high-throughput process. PMID:24188092
Nosanov, Lauren B.; Jo, Daniel Y.; Randad, Pranay R.; Moffatt, Lauren T.; Carney, Bonnie C.; Ortiz, Rachel T.
2017-01-01
Objective: Burn-injured patients are highly susceptible to infectious complications, which are often associated with increased morbidity and mortality. Rates of antibiotic resistance have increased, and resistant species such as methicillin-resistant Staphylococcus aureus provide additional challenges in the form of virulence factors. Proteins can disrupt local healing, leading to systemic immune disruption. To optimize outcomes, treatments that reduce pathogenicity must be identified. This study aims to compare a glycylcycline antibiotic—tigecycline—with clindamycin for effectiveness in treating superantigenic methicillin-resistant Staphylococcus aureus in burn wounds. Methods: Sprague-Dawley rats received paired 2 × 2-cm burn wounds, which were subsequently inoculated with known virulence factor–producing methicillin-resistant Staphylococcus aureus or media alone on postinjury day 1. Infected animals received twice-daily tigecycline (high or low dose), twice-daily clindamycin (high or low dose), or saline alone (positive controls). Daily sampling and imaging assessments were performed. Results: Bacterial counts and toxin levels were reduced significantly in antibiotic-treated groups relative to positive controls (P < .001). Results from day 7 showed measurable toxin levels in clindamycin-treated, but not tigecycline-treated, wounds. Imaging analysis revealed a return of wound perfusion in tigecycline-treated animals similar to the sham animals. Transcript analysis using polymerase chain reaction and polymerase chain reaction arrays demonstrated downregulation of gene expression in antibiotic-treated animals as compared with positive controls. Conclusions: Overall, this study supports the use of tigecycline in the treatment of methicillin-resistant Staphylococcus aureus–infected burn wounds. While both protein synthesis inhibitors are effective, tigecycline appears to be superior in controlling toxin levels, enabling better wound healing. PMID:28943993
Nosanov, Lauren B; Jo, Daniel Y; Randad, Pranay R; Moffatt, Lauren T; Carney, Bonnie C; Ortiz, Rachel T; Shupp, Jeffrey W
2017-01-01
Objective : Burn-injured patients are highly susceptible to infectious complications, which are often associated with increased morbidity and mortality. Rates of antibiotic resistance have increased, and resistant species such as methicillin-resistant Staphylococcus aureus provide additional challenges in the form of virulence factors. Proteins can disrupt local healing, leading to systemic immune disruption. To optimize outcomes, treatments that reduce pathogenicity must be identified. This study aims to compare a glycylcycline antibiotic-tigecycline-with clindamycin for effectiveness in treating superantigenic methicillin-resistant Staphylococcus aureus in burn wounds. Methods : Sprague-Dawley rats received paired 2 × 2-cm burn wounds, which were subsequently inoculated with known virulence factor-producing methicillin-resistant Staphylococcus aureus or media alone on postinjury day 1. Infected animals received twice-daily tigecycline (high or low dose), twice-daily clindamycin (high or low dose), or saline alone (positive controls). Daily sampling and imaging assessments were performed. Results : Bacterial counts and toxin levels were reduced significantly in antibiotic-treated groups relative to positive controls ( P < .001). Results from day 7 showed measurable toxin levels in clindamycin-treated, but not tigecycline-treated, wounds. Imaging analysis revealed a return of wound perfusion in tigecycline-treated animals similar to the sham animals. Transcript analysis using polymerase chain reaction and polymerase chain reaction arrays demonstrated downregulation of gene expression in antibiotic-treated animals as compared with positive controls. Conclusions : Overall, this study supports the use of tigecycline in the treatment of methicillin-resistant Staphylococcus aureus -infected burn wounds. While both protein synthesis inhibitors are effective, tigecycline appears to be superior in controlling toxin levels, enabling better wound healing.
Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard
2018-06-01
The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p < 0.008) in expression levels between paired pancreatic juice and tissue samples in pancreas cancer. In intraductal papillary mucinous neoplasms (IPMN), Matrix Metalloproteinase 7 (MMP7), showed significant correlation (p < 0.01) in the expression levels between paired pancreatic juice and tissue samples. This study confirms that RNA analysis of paired pancreatic juice and tissue samples and establishment of cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.
Zolochevska, Olga; Shearer, Joseph; Ellis, Jayne; Fokina, Valentina; Shah, Forum; Gimble, Jeffrey M; Figueiredo, Marxa L
2014-03-01
Adipose-derived mesenchymal stromal cells (ASCs) are promising tools for delivery of cytotherapy against cancer. However, ASCs can exert profound effects on biological behavior of tumor cells. Our study aimed to examine the influence of ASCs on gene expression and epigenetic methylation profiles of prostate cancer cells as well as the impact of expressing a therapeutic gene on modifying the interaction between ASCs and prostate cancer cells. ASCs were modified by lentiviral transduction to express either green fluorescent protein as a control or pigment epithelium-derived factor (PEDF) as a therapeutic molecule. PC3 prostate cancer cells were cultured in the presence of ASC culture-conditioned media (CCM), and effects on PC3 or DU145. Ras cells were examined by means of real-time quantitative polymerase chain reaction, EpiTect methyl prostate cancer-focused real-time quantitative polymerase chain reaction arrays, and luciferase reporter assays. ASCs transduced with lentiviral vectors were able to mediate expression of several tumor-inhibitory genes, some of which correlated with epigenetic methylation changes on cocultured PC3 prostate cancer cells. When PC3 cells were cultured with ASC-PEDF CCM, we observed a shift in the balance of gene expression toward tumor inhibition, which suggests that PEDF reduces the potential tumor-promoting activity of unmodified ASCs. These results suggest that ASC-PEDF CCM can promote reprogramming of tumor cells in a paracrine manner. An improved understanding of genetic and epigenetic events in prostate cancer growth in response to PEDF paracrine therapy would enable a more effective use of ASC-PEDF, with the goal of achieving safer yet more potent anti-tumor effects. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
C7LYC Scintillators and Fast Neutron Spectroscopy
NASA Astrophysics Data System (ADS)
Chowdhury, P.; Brown, T.; Doucet, E.; Lister, C. J.; Wilson, G. L.; D'Olympia, N.; Devlin, M.; Mosby, S.
2016-09-01
Cs2 LiYCl6 (CLYC) scintillators detect both gammas and neutrons with excellent pulse shape discrimination. At UML, fast neutron measurements with a 16-element 1''x1'' CLYC array show promise for low energy nuclear science. CLYC detects fast neutrons via the 35Cl (n,p) reaction (resolution < 10 % at < 8 MeV). In our 7Li-enriched C7LYC, the thermal neutron response from the 6Li(n, α)t reaction is virtually eliminated. The low intrinsic efficiency of CLYC for fast neutrons (< 1 %) is offset by increased solid angle with the array placed near the target, since TOF is not needed for energy resolution. The array was tested at LANL for measuring elastic and inelastic neutron scattering on 56Fe. The incident energy from the white neutron source was measured via TOF, and the scattered neutron energy via the pulse height in CLYC. The array was also tested at CARIBU for measuring beta-delayed neutrons. Larger CLYC crystals are now a reality. Measurements with the first 3'' x 3'' C7LYC crystal are in progress at UML. Results will be discussed in the context of constructing a C7LYC array at FRIB for reaction and decay spectroscopy of neutron-rich fragments. Supported by the NNSA Stewardship Science Academic Alliance Program under Grant DE-NA00013008.
An improved reaction path optimization method using a chain of conformations
NASA Astrophysics Data System (ADS)
Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro
2018-05-01
The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.
NASA Astrophysics Data System (ADS)
Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.
2018-05-01
It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.
Qu, Yayun; Hong, Ying; Huang, Yan; Zhang, Yiwen; Yang, Dayun; Zhang, Fudan; Xi, Tingfei; Zhang, Deyuan
2018-01-01
Abstract The purpose of this paper is to utilize the signaling pathway polymerase chain reaction (PCR) arrays to investigate the activation of two important biological signaling pathways in endothelial cell adhesion and growth mediated by adsorbed serum protein on the surface of bare and titanium nitride (TiN)-coated nickel titanium (NiTi) alloys. First, the endothelial cells were cultured on the bare and TiN-coated NiTi alloys and chitosan films as control for 4 h and 24 h, respectively. Then, the total RNA of the cells was collected and the PCR arrays were performed. After that, the differentially expressed genes in the transforming growth factor beta (TGF-β) signaling pathway and the regulation of actin cytoskeleton pathway were screened out; and the further bioinformatics analyses were performed. The results showed that both TGF-β signaling pathway and regulation of actin cytoskeleton pathway were activated in the cells after 4 h and 24 h culturing on the surface of bare and TiN-coated NiTi alloys compared to the chitosan group. The activated TGF-β signaling pathway promoted cell adhesion; the activated regulation of actin cytoskeleton pathway promoted cell adhesion, spreading, growth and motility. In addition, the activation of both pathways was much stronger in the cells cultured for 24 h versus 4 h, which indicated that cell adhesion and growth became more favorable with longer time on the surface of two NiTi alloy materials. PMID:29423265
Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun
2008-03-01
We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.
Alì, Greta; Borrelli, Nicla; Riccardo, Giannini; Proietti, Agnese; Pelliccioni, Serena; Niccoli, Cristina; Boldrini, Laura; Lucchi, Marco; Mussi, Alfredo; Fontanini, Gabriella
2013-11-01
Malignant pleural mesothelioma (MPM) is a highly aggressive neoplasm associated with asbestos exposure. Currently, the molecular mechanisms that induce MPM development are still unknown. The purpose of this study was to identify new molecular biomarkers for mesothelial carcinogenesis. We analyzed a panel of 84 genes involved in extracellular matrix remodeling and cell adhesion by polymerase chain reaction (PCR) array in 15 samples of epithelioid mesothelioma and 10 samples of reactive mesothelial hyperplasia (MH; 3 of 25 samples were inadequate for mRNA analysis). To validate the differentially expressed genes identified by PCR array, we analyzed 27 more samples by immunohistochemistry, in addition to the 25 samples already studied. Twenty-five genes were differentially expressed in MPM and MH by PCR array. Of these we studied matrix metalloproteinase 7 (MMP7), MMP14, CD44, and integrin, alpha3 expression by immunohistochemistry in 26 epithelioid MPM and 26 MH samples from the entire series of 52 cases. We observed higher MMP14 and integrin, alpha3 expression in MPM samples compared with MH samples (p = 0.000002 and p = 0.000002, respectively). Conversely, CD44 expression was low in most (57.7%) mesothelioma samples but only in 11.5% of the MH samples (p = 0.0013). As regards MMP7, we did not observe differential expression between MH and MPM samples. We have extensively studied genes involved in cell adhesion and extracellular matrix remodeling in MPM and MH samples, gaining new insight into the pathophysiology of mesothelioma. Moreover, our data suggest that these factors could be potential biomarkers for MPM.
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less
NASA Astrophysics Data System (ADS)
Ahn, Chang-Geun; Ah, Chil Seong; Kim, Tae-Youb; Park, Chan Woo; Yang, Jong-Heon; Kim, Ansoon; Sung, Gun Yong
2010-09-01
This paper introduces a photosensitive biosensor array system with a simple photodiode array that detects photocurrent changes caused by reactions between probe and target molecules. Using optical addressing, the addressing circuit on the array chip is removed for low-cost application, and real cell addressing is achieved using an externally located computer-controllable light-emitting diode array module. The fabricated biosensor array chip shows a good dynamic range of 1-100 ng/mL under prostate-specific antigen detection, with an on-chip resolution of roughly 1 ng/mL.
Low-cost solar array progress and plans
NASA Astrophysics Data System (ADS)
Callaghan, W. T.
It is pointed out that significant redirection has occurred in the U.S. Department of Energy (DOE) Photovoltaics Program, and thus in the Flat-Plate Solar Array Project (FSA), since the 3rd European Communities Conference. The Silicon Materials Task has now the objective to sponsor theoretical and experimental research on silicon material refinement technology suitable for photovoltaic flat-plate solar arrays. With respect to the hydrochlorination reaction, a process proof of concept was completed through definition of reaction kinetics, catalyst, and reaction characteristics. In connection with the dichlorosilane chemical vapor desposition process, a preliminary design was completed of an experimental process system development unit with a capacity of 100 to 200 MT/yr of Si.Attention is also given to the silicon-sheet formation research area, environmental isolation research, the cell and module formation task, the engineering sciences area, and the module performance and failure analysis area.
Ackerman, Paul J.; van de Lagemaat, Jao; Smalyukh, Ivan I.
2015-01-01
Some of the most exotic condensed matter phases, such as twist grain boundary and blue phases in liquid crystals and Abrikosov phases in superconductors, contain arrays of topological defects in their ground state. Comprised of a triangular lattice of double-twist tubes of magnetization, the so-called ‘A-phase’ in chiral magnets is an example of a thermodynamically stable phase with topologically nontrivial solitonic field configurations referred to as two-dimensional skyrmions, or baby-skyrmions. Here we report that three-dimensional skyrmions in the form of double-twist tori called ‘hopfions’, or ‘torons’ when accompanied by additional self-compensating defects, self-assemble into periodic arrays and linear chains that exhibit electrostriction. In confined chiral nematic liquid crystals, this self-assembly is similar to that of liquid crystal colloids and originates from long-range elastic interactions between particle-like skyrmionic torus knots of molecular alignment field, which can be tuned from isotropic repulsive to weakly or highly anisotropic attractive by low-voltage electric fields. PMID:25607778
Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei
2017-01-01
Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee
2012-07-09
Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
9 CFR 145.33 - Terminology and classification; flocks and products.
Code of Federal Regulations, 2010 CFR
2010-01-01
.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...
Andreasson-Ochsner, Mirjam; Fu, Zhikang; May, Sylvia; Xiu, Low Ying; Nallani, Madhavan; Sinner, Eva-Kathrin
2012-01-31
To improve the stability of cell membrane mimics, there has been growing interest in the use of block copolymers. Here, we present an easy approach to create an array of planar polymeric matrices capable of hosting membrane proteins. The array of polymeric matrices was formed by the selective deposition of triblock copolymers onto an array of hydrophilic islands situated within a hydrophobic background. The thickness of these matrices corresponds to the length of a single polymer chain. These polymeric matrices were used to host cell-free expressed membrane proteins, and offers a prototype from which a membrane protein array can be created for diagnostics or drug discovery purposes. © 2011 American Chemical Society
Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier
2005-01-01
A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Local Oscillator Sub-Systems for Array Receivers in the 1-3 THz Range
NASA Technical Reports Server (NTRS)
Mehdi, Imran; Siles, Jose V.; Maestrini, Alain; Lin, Robert; Lee, Choonsup; Schlecht, Erich; Chattopadhyay, Goutam
2012-01-01
Recent results from the Heterodyne Instrument for the Far-Infrared (HIFI) on the Herschel Space Telescope have confirmed the usefulness of high resolution spectroscopic data for a better understanding of our Universe. This paper will explore the current status of tunable local oscillator sources with emphasis on building a multi-pixel LO subsystem for the scientifically important CII line around 1908 GHz. Recent results have shown that over 50 microwatts of output power at 1.9 THz are possible with an optimized single pixel LO chain. These power levels are now sufficient to pump array receivers in this frequency range. Further power enhancement can be obtained by cooling the chain to 120 K or by utilizing in-phase power combining technology.
Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth
2010-04-01
To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.
D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J
2006-10-01
Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.
Organized one dimensional nanomaterials: From preparations to applications
NASA Astrophysics Data System (ADS)
Wen, Xiaogang
This thesis is mainly concerned with the development of organized one dimensional (1D) nanomaterials and their applications. We have synthesized Ag2S, Cu2S nanowires, Fe2O3 nanobelt and nanowire arrays and ZnO nanobelt arrays from corresponding metal substrate respectively via gas solid reaction methods under different growth conditions. The effect of various parameters including temperature, reaction time, composition of gas, surface pre-oxidation, size of source materials etc. on the growth of metal oxide/sulfide 1D nanostructure have been studied systemically. The size and morphology of these 1D nanomaterials could be rationally controlled by adjusting the growth conditions. A tip growth mechanism has been confirmed based our results. The properties including PL, Raman, field effect transistors, and field emission of these materials have been measured. Cu(OH)2 nanoribbons have been synthesized by a solution solid reaction method using Cu and Cu2S nanowires as precursors. Cu(OH) 2 nanoribbons can form well-aligned arrays on Cu substrate. Low temperature facilitate the formation of Cu(OH)2 nanoribbon arrays. Reaction conditions affect the morphology, crystal structure, even composition of the products much. CuO nanorod arrays of several nm in diameter could be synthesis in changed condition. Cu(OH)2 nanoribbon arrays are good sacrifice template for synthesizing other Cu-based 1D nanomaterials. It has been converted to CuO, Cu2O, Cu8S9, Cu etc. 1D nanostructure through different physical and chemical reaction process. Au/Cu2S core/sheath nanowires have been synthesized in solution phase via a simple template-induced redox deposition process, after removing the Cu2S template, Au nanotubes have been formed. The photoelectrochemistry (PEC) properties of it have been studied. Ag dendritic nanostructures have been prepared via solution reaction. We have revealed that the stem, branch, and sub-branch grow along <100>, <111> and <100> directions, respectively. Such a preferential growth pattern along <100> and <111> alternately lead to the formation of the Ag nanodendrites. In another development, we have synthesized unltrathin Zn nanowires (<5nm) by a vapor transport method. Small molecules are induced into the gas phase as capping reagents. In this process, the small molecules serve as capping reagents or templates to confine the lateral growth and facilitate the formation of ultrathin 1D nanostructures. (Abstract shortened by UMI.)
Field characteristics of an alvarez-type linac structure having chain-like electrode array
DOE Office of Scientific and Technical Information (OSTI.GOV)
Odera, M.; Goto, A.; Hemmi, M.
1985-10-01
A chain-like electrode configuration in an Alvarez-type linac cavity was studied by models. The structure has been devised to get a moderate shunt impedance together with simplicity of operation, in ion velocity region of more than a few percent of that of light by incorporating focusing scheme by high frequency quadrupolar fields into an TM-010 accelerating field of an Alvarez linac. It has a chain-like electrode array instead of drift tubes containing quadrupole lenses for ordinary linacs. The chain-like electrode structure generates along its central axis, high frequency acceleration and focusing fields alternately, separating the acceleration and focusing functions inmore » space. The separation discriminates this structure from spatially uniform acceleration and focusing scheme of the RFQs devised by Kapchinsky and Teplyakov. It gives beam acceleration effects different from those by conventional linacs and reveals possibility of getting a high acceleration efficiency. Resonant frequency spectrum was found relatively simple by measurements on high frequency models. Separation of unwanted modes from the TM-010 acceleration mode is large; a few 10 MHz, at least. Tilt of the acceleration field is not very sensitive to pertubation in gap capacitance for the TM-010 mode.« less
First data with the Hybrid Array of Gamma Ray Detector (HAGRiD)
NASA Astrophysics Data System (ADS)
Smith, K.; Baugher, T.; Burcher, S.; Carter, A. B.; Cizewski, J. A.; Chipps, K. A.; Febbraro, M.; Grzywacz, R.; Jones, K. L.; Munoz, S.; Pain, S. D.; Paulauskas, S. V.; Ratkiewicz, A.; Schmitt, K. T.; Thornsberry, C.; Toomey, R.; Walter, D.; Willoughby, H.
2018-01-01
The structure of nuclei provides insight into astrophysical reaction rates that are difficult to measure directly. These studies are often performed with transfer reactions and β-decay measurements. These experiments benefit from particle-γ coincidence measurements which provide information beyond that of particle detection alone. The Hybrid Array of Gamma Ray Detectors (HAGRiD) of LaBr3(Ce) scintillators has been designed with this purpose in mind. The design of the array permits it to be coupled with particle detector systems, such as the Oak Ridge Rutgers University Barrel Array (ORRUBA) of silicon detectors and the Versatile Array of Neutron Detectors at Low Energy (VANDLE). It is also designed to operate with the Jet Experiments in Nuclear Structure and Astrophysics (JENSA) advanced target system. HAGRiD's design avoids compromising the charged-particle angular resolution due to compact geometries which are often used to increase the γ efficiency in other systems. First experiments with HAGRiD coupled to VANDLE as well as ORRUBA and JENSA are discussed.
New polymer systems: Chain extension by dianhydrides
NASA Technical Reports Server (NTRS)
Rhein, R. A.; Ingham, J. D.
1972-01-01
The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.
Theoretical study of chain transfer to solvent reactions of alkyl acrylates.
Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud
2014-07-24
This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Transfer Reactions on Neutron-rich Nuclei at REX-ISOLDE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kroell, Th.; Physik-Department E12, Technische Universitaet Muenchen, Garching; Bildstein, V.
2009-08-26
We report on one- and two-neutron transfer reactions to study the single-particle properties of nuclei at the border of the ''island of inversion.'' The (d, p)- and (t, p)-reactions in inverse kinematics on the neutron-rich isotope {sup 30}Mg, delivered as radioactive beam by the REX-ISOLDE facility, have been investigated. The outgoing protons have been detected and identified by a newly built array of Si detectors. The {gamma}-decay of excited states has been detected in coincidence by the MINIBALL array. First results for {sup 31}Mg and from the search for the second, spherical, 0{sup +} state in {sup 32}Mg are presented.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
USDA-ARS?s Scientific Manuscript database
Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...
MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS
Wigner, E.P.; Weinberg, A.M.
1961-01-24
A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)
This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...
ERIC Educational Resources Information Center
Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary
2006-01-01
We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…
Adewale, B; Mafe, M A; Oyerinde, J P O
2005-01-01
Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang
2014-01-01
A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528
Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique
2013-01-01
To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Yi-Mu, E-mail: ymlee@nuu.edu.t; Yang, Hsi-Wen
2011-03-15
High-transparency and high quality ZnO nanorod arrays were grown on the ITO substrates by a two-step chemical bath deposition (CBD) method. The effects of processing parameters including reaction temperature (25-95 {sup o}C) and solution concentration (0.01-0.1 M) on the crystal growth, alignment, optical and electrical properties were systematically investigated. It has been found that these process parameters are critical for the growth, orientation and aspect ratio of the nanorod arrays, showing different structural and optical properties. Experimental results reveal that the hexagonal ZnO nanorod arrays prepared under reaction temperature of 95 {sup o}C and solution concentration of 0.03 M possessmore » highest aspect ratio of {approx}21, and show the well-aligned orientation and optimum optical properties. Moreover the ZnO nanorod arrays based heterojunction electrodes and the solid-state dye-sensitized solar cells (SS-DSSCs) were fabricated with an improved optoelectrical performance. -- Graphical abstract: The ZnO nanorod arrays demonstrate well-alignment, high aspect ratio (L/D{approx}21) and excellent optical transmittance by low-temperature chemical bath deposition (CBD). Display Omitted Research highlights: > Investigate the processing parameters of CBD on the growth of ZnO nanorod arrays. > Optimization of CBD process parameters: 0.03 M solution concentration and reaction temperature of 95 {sup o}C. > The prepared ZnO samples possess well-alignment and high aspect ratio (L/D{approx}21). > An n-ZnO/p-NiO heterojunction: great rectifying behavior and low leakage current. > SS-DSSC has J{sub SC} of 0.31 mA/cm{sup 2} and V{sub OC} of 590 mV, and an improved {eta} of 0.059%.« less
Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction
NASA Astrophysics Data System (ADS)
Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.
2018-01-01
We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.
Local oscillator chain for 1.55 to 1.75 THz with 100-(mu)W peak power
NASA Technical Reports Server (NTRS)
Maestrini, Alain; Ward, John S.; Javadi, Hamid; Tripon-Canseliet, Charlotte; Gill, John; Chattopadhyay, Goutam; Schlecht, Erich; Mehdi, Imran
2005-01-01
We report on the design and performance of a fix-tuned x2x 3x 3 frequency multiplier chain that covers 1.55-1.75 THz. The chain is nominally pumped with 100 mW at W-band. At 120 K the measured output power is larger than 4 (mu)W across the band with a peak power of 100 (mu) W at 1.665 THz. A similar chain operated at room temperature produced a peak power of 21 (mu)W. These power levels now make it possible to deploy multipixel heterodyne imaging arrays in this frequency range.
Kim, K. S.; Nakae, L. F.; Prasad, M. K.; ...
2017-07-31
We present that fast nanosecond timescale neutron and gamma-ray counting can be performed with a (liquid) scintillator array. Fission chains in metal evolve over a timescale of tens of nanoseconds. If the metal is surrounded by moderator, neutrons leaking from the metal can thermalize and diffuse in the moderator. With finite probability, the diffusing neutrons can return to the metal and restart the fast fission chain. The timescale for this restart process is microseconds. A theory describing time evolving fission chains for metal surrounded by moderator, including this restart process, is presented. Finally, this theory is sufficiently simple for itmore » to be implemented for real-time analysis.« less
Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi
2014-06-04
A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.
Pathogen detection in milk samples by ligation detection reaction-mediated universal array method.
Cremonesi, P; Pisoni, G; Severgnini, M; Consolandi, C; Moroni, P; Raschetti, M; Castiglioni, B
2009-07-01
This paper describes a new DNA chip, based on the use of a ligation detection reaction coupled to a universal array, developed to detect and analyze, directly from milk samples, microbial pathogens known to cause bovine, ovine, and caprine mastitis or to be responsible for foodborne intoxication or infection, or both. Probes were designed for the identification of 15 different bacterial groups: Staphylococcus aureus, Streptococcus agalactiae, nonaureus staphylococci, Streptococcus bovis, Streptococcus equi, Streptococcus canis, Streptococcus dysgalactiae, Streptococcus parauberis, Streptococcus uberis, Streptococcus pyogenes, Mycoplasma spp., Salmonella spp., Bacillus spp., Campylobacter spp., and Escherichia coli and related species. These groups were identified based on the 16S rRNA gene. For microarray validation, 22 strains from the American Type Culture Collection or other culture collections and 50 milk samples were tested. The results demonstrated high specificity, with sensitivity as low as 6 fmol. Moreover, the ligation detection reaction-universal array assay allowed for the identification of Mycoplasma spp. in a few hours, avoiding the long incubation times of traditional microbiological identification methods. The universal array described here is a versatile tool able to identify milk pathogens efficiently and rapidly.
Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.
Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin
2014-12-08
The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Technical Reports Server (NTRS)
Hablani, Hari B.
1993-01-01
This paper has a two-fold objective: determination of yearly momentum accumulation due to solar radiation pressure, and optimum reaction wheel sizing. The first objective is confronted while determining propellant consumption by the attitude control system over a spacecraft's lifetime. This, however, cannot be obtained from the daily momentum accumulation and treating that constant throughout the year, because the orientation of the solar arrays relative to the spacecraft changes over a wide range in a year, particularly if the spacecraft has two arrays, one normal and the other off-normal to different extent at different times to the sun rays. The paper first develops commands for the arrays for tracking the sun, the arrays articulated to earth-pointing spacecraft with two rotational degrees of freedom, and spacecraft in an arbitrary circular orbit. After developing expressions for solar radiation torque due to one or both arrays, arranged symmetrically or asymmetrically relative to the spacecraft bus, momentum accumulation over an orbit and then over a year are determined. The remainder of the paper is concerned with designing reaction wheel configurations. Four-, six-, and three-wheel configurations are considered, and for given torque and momentum requirements, their cant angles with the roll/yaw plane are optimized for minimum power consumption. Finally, their momentum and torque capacities are determined for one-wheel failure scenario, and six configurations are compared and contrasted.
Superconductivity of Ca2 InN with a layered structure embedding an anionic indium chain array
NASA Astrophysics Data System (ADS)
Jeong, Sehoon; Matsuishi, Satoru; Lee, Kimoon; Toda, Yoshitake; Wng Kim, Sung; Hosono, Hideo
2014-05-01
We report the emergence of superconductivity in Ca2InN consisting of a two-dimensional (2D) array of zigzag indium chains embedded between Ca2N layers. A sudden drop of resistivity and a specific heat (Cp) jump attributed to the superconducting transition were observed at 0.6 K. The Sommerfeld coefficient γ = 4.24 mJ mol-1K-2 and Debye temperature ΘD = 322 K were determined from the Cp of the normal conducting state and the superconducting volume fraction was estimated to be ˜80% from the Cp jump, assuming a BCS-type weak coupling. Density functional theory calculations demonstrated that the electronic bands near the Fermi level (EF) are mainly derived from In 5p orbitals with π and σ bonding states and the Fermi surface is composed of cylindrical parts, corresponding to the quasi-2D electronic state of the In-chain array. By integrating the projected density of states of the In-p component up to EF, a valence electron population of ˜1.6 electrons/In was calculated, indicating that partially anionic state of In. The In 3d binding energies observed in Ca2InN by x-ray photoemission spectroscopy were negatively shifted from that in In metal. The superconductivity of Ca2InN is associated with the p-p bonding states of the anionic In layer.
Cross-beam coherence of infrasonic signals at local and regional ranges.
Alberts, W C Kirkpatrick; Tenney, Stephen M
2017-11-01
Signals collected by infrasound arrays require continuous analysis by skilled personnel or by automatic algorithms in order to extract useable information. Typical pieces of information gained by analysis of infrasonic signals collected by multiple sensor arrays are arrival time, line of bearing, amplitude, and duration. These can all be used, often with significant accuracy, to locate sources. A very important part of this chain is associating collected signals across multiple arrays. Here, a pairwise, cross-beam coherence method of signal association is described that allows rapid signal association for high signal-to-noise ratio events captured by multiple infrasound arrays at ranges exceeding 150 km. Methods, test cases, and results are described.
An overview of dissolved organic carbon in groundwater and implications for drinking water safety
NASA Astrophysics Data System (ADS)
Regan, S.; Hynds, P.; Flynn, R.
2017-06-01
Dissolved organic carbon (DOC) is composed of a diverse array of compounds, predominantly humic substances, and is a near ubiquitous component of natural groundwater, notwithstanding climatic extremes such as arid and hyper-arid settings. Despite being a frequently measured parameter of groundwater quality, the complexity of DOC composition and reaction behaviour means that links between concentration and human health risk are difficult to quantify and few examples are reported in the literature. Measured concentrations from natural/unpolluted groundwater are typically below 4 mg C/l, whilst concentrations above these levels generally indicate anthropogenic influences and/or contamination issues and can potentially compromise water safety. Treatment processes are effective at reducing DOC concentrations, but refractory humic substance reaction with chlorine during the disinfection process produces suspected carcinogenic disinfectant by-products (DBPs). However, despite engineered artificial recharge systems being commonly used to remove DOC from recycled treated wastewaters, little research has been conducted on the presence of DBPs in potable groundwater systems. In recent years, the capacity to measure the influence of organic matter on colloidal contaminants and its influence on the mobility of pathogenic microorganisms has aided understanding of transport processes in aquifers. Additionally, advances in polymerase chain reaction techniques used for the detection, identification, and quantification of waterborne pathogens, provide a method to confidently investigate the behaviour of DOC and its effect on contaminant transfer in aquifers. This paper provides a summary of DOC occurrence in groundwater bodies and associated issues capable of indirectly affecting human health.
Subwavelength dielectric nanorod chains for energy transfer in the visible range.
Li, Dongdong; Zhang, Jingjing; Yan, Changchun; Xu, Zhengji; Zhang, Dao Hua
2017-10-15
We report a new type of energy transfer device, formed by a dielectric nanorod array embedded in a silver slab. Such dielectric chain structures allow surface plasmon wave guiding with large propagation length and highly suppressed crosstalk between adjacent transmission channels. The simulation results show that our proposed design can be used to enhance the energy transfer along the waveguide-like dielectric nanorod chains via coupled plasmons, where the energy spreading is effectively suppressed, and superior imaging properties in terms of resolution and energy transfer distance can be achieved.
Column Grid Array Rework for High Reliability
NASA Technical Reports Server (NTRS)
Mehta, Atul C.; Bodie, Charles C.
2008-01-01
Due to requirements for reduced size and weight, use of grid array packages in space applications has become common place. To meet the requirement of high reliability and high number of I/Os, ceramic column grid array packages (CCGA) were selected for major electronic components used in next MARS Rover mission (specifically high density Field Programmable Gate Arrays). ABSTRACT The probability of removal and replacement of these devices on the actual flight printed wiring board assemblies is deemed to be very high because of last minute discoveries in final test which will dictate changes in the firmware. The questions and challenges presented to the manufacturing organizations engaged in the production of high reliability electronic assemblies are, Is the reliability of the PWBA adversely affected by rework (removal and replacement) of the CGA package? and How many times can we rework the same board without destroying a pad or degrading the lifetime of the assembly? To answer these questions, the most complex printed wiring board assembly used by the project was chosen to be used as the test vehicle, the PWB was modified to provide a daisy chain pattern, and a number of bare PWB s were acquired to this modified design. Non-functional 624 pin CGA packages with internal daisy chained matching the pattern on the PWB were procured. The combination of the modified PWB and the daisy chained packages enables continuity measurements of every soldered contact during subsequent testing and thermal cycling. Several test vehicles boards were assembled, reworked and then thermal cycled to assess the reliability of the solder joints and board material including pads and traces near the CGA. The details of rework process and results of thermal cycling are presented in this paper.
Method for polymer synthesis in a reaction well
Brennan, Thomas M.
1998-01-01
A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).
Method for polymer synthesis in a reaction well
Brennan, T.M.
1998-09-29
A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.
Altered retinal microRNA expression profiles in early diabetic retinopathy: an in silico analysis.
Xiong, Fen; Du, Xinhua; Hu, Jianyan; Li, Tingting; Du, Shanshan; Wu, Qiang
2014-07-01
MicroRNAs (miRNAs) - as negative regulators of target genes - are associated with various human diseases, but their precise role(s) in diabetic retinopathy (DR) remains to be elucidated. The aim of this study was to elucidate the involvement of miRNAs in early DR using in silico analysis to explore their gene expression patterns. We used the streptozotocin (STZ)-induced diabetic rat to investigate the roles of miRNAs in early DR. Retinal miRNA expression profiles from diabetic versus healthy control rats were examined by miRNA array analysis. Based on several bioinformatic systems, specifically, gene ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, we identified signatures of the potential pathological processes, gene functions, and signaling pathways that are influenced by dysregulated miRNAs. We used quantitative real-time polymerase chain reaction (qRT-PCR) to validate six (i.e. those with significant changes in expression levels) of the 17 miRNAs that were detected in the miRNA array. We also describe the significant role of the miRNA-gene network, which is based on the interactions between miRNAs and target genes. GO analysis of the 17 miRNAs detected in the miRNA array analysis revealed the most prevalent miRNAs to be those related to biological processes, olfactory bulb development and axonogenesis. These miRNAs also exert significant influence on additional pathways, including the mitogen-activated protein and calcium signaling pathways. Six of the seventeen miRNAs were chosen for qRT-PCR validation. With the exception of a slight difference in miRNA-350, our results are in close agreement with the differential expressions detected by array analysis. This study, which describes miRNA expression during the early developmental phases of DR, revealed extensive miRNA interactions. Based on both their target genes and signaling pathways, we suggest that miRNAs perform critical regulatory functions during the early stages of DR evolution.
Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni
2013-01-01
Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID:23950653
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
A programmable computational image sensor for high-speed vision
NASA Astrophysics Data System (ADS)
Yang, Jie; Shi, Cong; Long, Xitian; Wu, Nanjian
2013-08-01
In this paper we present a programmable computational image sensor for high-speed vision. This computational image sensor contains four main blocks: an image pixel array, a massively parallel processing element (PE) array, a row processor (RP) array and a RISC core. The pixel-parallel PE is responsible for transferring, storing and processing image raw data in a SIMD fashion with its own programming language. The RPs are one dimensional array of simplified RISC cores, it can carry out complex arithmetic and logic operations. The PE array and RP array can finish great amount of computation with few instruction cycles and therefore satisfy the low- and middle-level high-speed image processing requirement. The RISC core controls the whole system operation and finishes some high-level image processing algorithms. We utilize a simplified AHB bus as the system bus to connect our major components. Programming language and corresponding tool chain for this computational image sensor are also developed.
The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics
NASA Astrophysics Data System (ADS)
McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.
2013-10-01
The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.
Performance verification of the FlashCam prototype camera for the Cherenkov Telescope Array
NASA Astrophysics Data System (ADS)
Werner, F.; Bauer, C.; Bernhard, S.; Capasso, M.; Diebold, S.; Eisenkolb, F.; Eschbach, S.; Florin, D.; Föhr, C.; Funk, S.; Gadola, A.; Garrecht, F.; Hermann, G.; Jung, I.; Kalekin, O.; Kalkuhl, C.; Kasperek, J.; Kihm, T.; Lahmann, R.; Marszalek, A.; Pfeifer, M.; Principe, G.; Pühlhofer, G.; Pürckhauer, S.; Rajda, P. J.; Reimer, O.; Santangelo, A.; Schanz, T.; Schwab, T.; Steiner, S.; Straumann, U.; Tenzer, C.; Vollhardt, A.; Wolf, D.; Zietara, K.; CTA Consortium
2017-12-01
The Cherenkov Telescope Array (CTA) is a future gamma-ray observatory that is planned to significantly improve upon the sensitivity and precision of the current generation of Cherenkov telescopes. The observatory will consist of several dozens of telescopes with different sizes and equipped with different types of cameras. Of these, the FlashCam camera system is the first to implement a fully digital signal processing chain which allows for a traceable, configurable trigger scheme and flexible signal reconstruction. As of autumn 2016, a prototype FlashCam camera for the medium-sized telescopes of CTA nears completion. First results of the ongoing system tests demonstrate that the signal chain and the readout system surpass CTA requirements. The stability of the system is shown using long-term temperature cycling.
Repertoire of human natural anti-glycan immunoglobulins. Do we have auto-antibodies?
Bovin, Nicolai; Obukhova, Polina; Shilova, Nadezhda; Rapoport, Evgenia; Popova, Inna; Navakouski, Maksim; Unverzagt, Carlo; Vuskovic, Marko; Huflejt, Margaret
2012-09-01
Profiling of donor's antibodies using glycan arrays demonstrated presence of antibodies capable of binding to >100 mammalian glycans or their fragments. For example, relatively high binding to Galα1-4Galβ1-4GlcNAc (P(1)), Galα1-4Galβ1-4Glc (P(k)), Galβ1-3GlcNAc (Le(c)), 4-O-SuGalβ1-4GlcNAc, and GalNAcα1-3GalNAc (Fs) was found in all tested individuals. Affinity isolation using hapten-specific chromatography in combination with epitope mapping revealed their glycotopes. Notably, a significant part of the antibodies was capable of recognizing a fragment of larger glycans, for example, -Galβ1-4Glc of glycolipids, or Fucα1-3GlcNAc motif of Le(X)/Le(Y) antigens. Their epitope specificity did not vary between different healthy individuals. Nominally, all the mentioned immunoglobulins could be classified as auto-antibodies. In this work we re-evaluated results published earlier and analyzed new data to address the question why autologous antibodies found in healthy individuals do not cause severe auto-immune reactions. In all cases the presumably "auto" antibodies were found to bind short fragments "subtracted" from larger glycans whereas recognition of the same fragment in the context of the whole natural chain was completely abolished. Thus, in spite of numerous formally positive signals observed on the printed glycan array, we are yet unable to identify in blood serum of healthy individuals true auto-antibodies capable of binding carbohydrate chains in their naturally occurring form. The identified natural anti-glycan antibodies were found to be specific, high-titer and population conservative immunoglobulins - all of this suggesting as yet unknown biological role(s) of the studied proteins. This article is part of a Special Issue entitled Glycoproteomics. Copyright © 2012 Elsevier B.V. All rights reserved.
Beyond the double banana: improved recognition of temporal lobe seizures in long-term EEG.
Rosenzweig, Ivana; Fogarasi, András; Johnsen, Birger; Alving, Jørgen; Fabricius, Martin Ejler; Scherg, Michael; Neufeld, Miri Y; Pressler, Ronit; Kjaer, Troels W; van Emde Boas, Walter; Beniczky, Sándor
2014-02-01
To investigate whether extending the 10-20 array with 6 electrodes in the inferior temporal chain and constructing computed montages increases the diagnostic value of ictal EEG activity originating in the temporal lobe. In addition, the accuracy of computer-assisted spectral source analysis was investigated. Forty EEG samples were reviewed by 7 EEG experts in various montages (longitudinal and transversal bipolar, common average, source derivation, source montage, current source density, and reference-free montages) using 2 electrode arrays (10-20 and the extended one). Spectral source analysis used source montage to calculate density spectral array, defining the earliest oscillatory onset. From this, phase maps were calculated for localization. The reference standard was the decision of the multidisciplinary epilepsy surgery team on the seizure onset zone. Clinical performance was compared with the double banana (longitudinal bipolar montage, 10-20 array). Adding the inferior temporal electrode chain, computed montages (reference free, common average, and source derivation), and voltage maps significantly increased the sensitivity. Phase maps had the highest sensitivity and identified ictal activity at earlier time-point than visual inspection. There was no significant difference concerning specificity. The findings advocate for the use of these digital EEG technology-derived analysis methods in clinical practice.
Nakazato, Kazuo
2014-03-28
By integrating chemical reactions on a large-scale integration (LSI) chip, new types of device can be created. For biomedical applications, monolithically integrated sensor arrays for potentiometric, amperometric and impedimetric sensing of biomolecules have been developed. The potentiometric sensor array detects pH and redox reaction as a statistical distribution of fluctuations in time and space. For the amperometric sensor array, a microelectrode structure for measuring multiple currents at high speed has been proposed. The impedimetric sensor array is designed to measure impedance up to 10 MHz. The multimodal sensor array will enable synthetic analysis and make it possible to standardize biosensor chips. Another approach is to create new functional devices by integrating molecular systems with LSI chips, for example image sensors that incorporate biological materials with a sensor array. The quantum yield of the photoelectric conversion of photosynthesis is 100%, which is extremely difficult to achieve by artificial means. In a recently developed process, a molecular wire is plugged directly into a biological photosynthetic system to efficiently conduct electrons to a gold electrode. A single photon can be detected at room temperature using such a system combined with a molecular single-electron transistor.
Zhou, Xiang; Xu, Daguo; Zhang, Qiaobao; Lu, Jian; Zhang, Kaili
2013-08-14
We report a facile green method for the in situ synthesis of Mg/CuO core/shell nanoenergetic arrays on silicon, with Mg nanorods as the core and CuO as the shell. Mg nanorods are first prepared by glancing angle deposition. CuO is then deposited around the Mg nanorods by reactive magnetron sputtering to realize the core/shell structure. Various characterization techniques are used to investigate the prepared Mg/CuO core/shell nanoenergetic arrays, including scanning electron microscopy, transmission electron microscopy, X-ray energy dispersive spectroscopy, X-ray diffraction, and thermal analysis. Uniform mixing and intimate contact between the Mg nanorods and CuO are confirmed from both visual inspection of the morphological images and analyses of the heat-release curves. The nanoenergetic arrays exhibit a low-onset reaction temperature (∼300 °C) and high heat of reaction (∼3400 J/g). Most importantly, the nanoenergetic arrays possess long-term storage stability resulting from the stable CuO shell. This study provides a potential general strategy for the synthesis of various Mg nanorod-based stable nanoenergetic arrays.
(Bio)Sensing Using Nanoparticle Arrays: On the Effect of Analyte Transport on Sensitivity.
Lynn, N Scott; Homola, Jiří
2016-12-20
There has recently been an extensive amount of work regarding the development of optical, electrical, and mechanical (bio)sensors employing planar arrays of surface-bound nanoparticles. The sensor output for these systems is dependent on the rate at which analyte is transported to, and interacts with, each nanoparticle in the array. There has so far been little discussion on the relationship between the design parameters of an array and the interplay of convection, diffusion, and reaction. Moreover, current methods providing such information require extensive computational simulation. Here we demonstrate that the rate of analyte transport to a nanoparticle array can be quantified analytically. We show that such rates are bound by both the rate to a single NP and that to a planar surface (having equivalent size as the array), with the specific rate determined by the fill fraction: the ratio between the total surface area used for biomolecular capture with respect to the entire sensing area. We characterize analyte transport to arrays with respect to changes in numerous parameters relevant to experiment, including variation of the nanoparticle shape and size, packing density, flow conditions, and analyte diffusivity. We also explore how analyte capture is dependent on the kinetic parameters related to an affinity-based biosensor, and furthermore, we classify the conditions under which the array might be diffusion- or reaction-limited. The results obtained herein are applicable toward the design and optimization of all (bio)sensors based on nanoparticle arrays.
Xu, Y; Ehringer, M; Yang, F; Sikela, J M
2001-06-01
Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.
Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen
NASA Astrophysics Data System (ADS)
Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.
2017-12-01
The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.
One Nucleon Transfer Reactions Around {sup 68}Ni at REX-ISOLDE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patronis, N.; Raabe, R.; Bree, N.
2008-05-12
The newly built position sensitive Si detectors array of nearly 4{pi} angular coverage which is going to be installed at the REX-ISOLDE facility at CERN is briefly presented. This setup will be combined with the Miniball detectors array, constituting a unique tool for the study of one-nucleon transfer reactions. The experimental study of d({sup 66}Ni,p){sup 67}Ni reaction will be proposed, as a starting point for a series of experiments aiming to the study of the single particle character of the levels of the odd mass neutron reach unstable Ni isotopes. In this contribution, the feasibility and sensitivity of the experimentmore » is presented.« less
Additional chain-branching pathways in the low-temperature oxidation of branched alkanes
Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...
2015-12-31
Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less
Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo
2005-01-01
Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi
2013-10-17
Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.
NASA Astrophysics Data System (ADS)
Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.
2015-07-01
Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.
A Bullet-Block Experiment that Explains the Chain Fountain
NASA Astrophysics Data System (ADS)
Pantaleone, J.; Smith, R.
2018-05-01
It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.
2010-01-01
Vertically aligned Zn2SiO4-SiOx(x < 2) core–shell nanotube arrays consisting of Zn2SiO4-nanoparticle chains encapsulated into SiOx nanotubes and SiOx-coated Zn2SiO4 coaxial nanotubes were synthesized via one-step thermal annealing process using ZnO nanowire (ZNW) arrays as templates. The appearance of different nanotube morphologies was due to size-dependent thermal instability and specific melting of ZNWs. With an increase in ZNW diameter, the formation mechanism changed from decomposition of “etching” to Rayleigh instability and then to Kirkendall effect, consequently resulting in polycrystalline Zn2SiO4-SiOx coaxial nanotubes, single-crystalline Zn2SiO4-nanoparticle-chain-embedded SiOx nanotubes, and single-crystalline Zn2SiO4-SiOx coaxial nanotubes. The difference in spatially resolved optical properties related to a particular morphology was efficiently documented by means of cathodoluminescence (CL) spectroscopy using a middle-ultraviolet emission at 310 nm from the Zn2SiO4 phase. PMID:20672064
Ackerman, P. J.; van de Lagemaat, J.; Smalyukh, I. I.
2015-01-21
Some of the most exotic condensed matter phases, such as twist grain boundary and blue phases in liquid crystals and Abrikosov phases in superconductors, contain arrays of topological defects in their ground state. Comprised of a triangular lattice of double-twist tubes of magnetization, the so-called ‘A-phase’ in chiral magnets is an example of a thermodynamically stable phase with topologically nontrivial solitonic field configurations referred to as two-dimensional skyrmions, or baby-skyrmions. Here we report that three-dimensional skyrmions in the form of double-twist tori called ‘hopfions’, or ‘torons’ when accompanied by additional self-compensating defects, self-assemble into periodic arrays and linear chains thatmore » exhibit electrostriction. In confined chiral nematic liquid crystals, this self-assembly is similar to that of liquid crystal colloids and originates from long-range elastic interactions between particle-like skyrmionic torus knots of molecular alignment field, which can be tuned from isotropic repulsive to weakly or highly anisotropic attractive by low-voltage electric fields.« less
Transcriptional profiling reveals regulated genes in the hippocampus during memory formation
NASA Technical Reports Server (NTRS)
Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.
2002-01-01
Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.
Fu, Qiang; Su, Zhixin; Cheng, Yuqiang; Wang, Zhaofei; Li, Shiyu; Wang, Heng'an; Sun, Jianhe; Yan, Yaxian
In order to investigate the diverse characteristics of clustered, regularly interspaced short palindromic repeat (CRISPR) arrays and the distribution of virulence factor genes in avian Escherichia coli, 80 E. coli isolates obtained from chickens with avian pathogenic E. coli (APEC) or avian fecal commensal E. coli (AFEC) were identified. Using the multiplex polymerase chain reaction (PCR), five genes were subjected to phylogenetic typing and examined for CRISPR arrays to study genetic relatedness among the strains. The strains were further analyzed for CRISPR loci and virulence factor genes to determine a possible association between their CRISPR elements and their potential virulence. The strains were divided into five phylogenetic groups: A, B1, B2, D and E. It was confirmed that two types of CRISPR arrays, CRISPR1 and CRISPR2, which contain up to 246 distinct spacers, were amplified in most of the strains. Further classification of the isolates was achieved by sorting them into nine CRISPR clusters based on their spacer profiles, which indicates a candidate typing method for E. coli. Several significant differences in invasion-associated gene distribution were found between the APEC isolates and the AFEC isolates. Our results identified the distribution of 11 virulence genes and CRISPR diversity in 80 strains. It was demonstrated that, with the exception of iucD and aslA, there was no sharp demarcation in the gene distribution between the pathogenic (APEC) and commensal (AFEC) strains, while the total number of indicated CRISPR spacers may have a positive correlation with the potential pathogenicity of the E. coli isolates. Copyright © 2016. Published by Elsevier Masson SAS.
Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K
2014-10-24
Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.
Development of an Influenza virus protein array using Sortagging technology
Sinisi, Antonia; Popp, Maximilian Wei-Lin; Antos, John M.; Pansegrau, Werner; Savino, Silvana; Nissum, Mikkel; Rappuoli, Rino; Ploegh, Hidde L.; Buti, Ludovico
2013-01-01
Protein array technology is an emerging tool that enables high throughput screening of protein-protein or protein-lipid interactions and identification of immunodominant antigens during the course of a bacterial or viral infection. In this work we developed an Influenza virus protein array using the sortase-mediated transpeptidation reaction known as “Sortagging”. LPETG-tagged Influenza virus proteins from bacterial and eukaryotic cellular extracts were immobilized at their carboxyl-termini onto a pre-activated amine-glass slide coated with a Gly3 linker. Immobilized proteins were revealed by specific antibodies and the newly generated Sortag-protein chip can be used as a device for antigen and/or antibody screening. The specificity of the Sortase A (SrtA) reaction avoids purification steps in array building and allows immobilization of proteins in an oriented fashion. Previously, this versatile technology has been successfully employed for protein labeling and protein conjugation. Here, the tool is implemented to covalently link proteins of a viral genome onto a solid support. The system could readily be scaled up to proteins of larger genomes in order to develop protein arrays for high throughput screening. PMID:22594688
Nonlinear Photochromic Switching in the Plasmonic Field of a Nanoparticle Array
NASA Astrophysics Data System (ADS)
Otolski, Christopher J.; Argyropoulos, Christos; Elles, Christopher G.
2017-06-01
Plasmonic nanostructures provide unique environments for non-resonant excitation and switching of photochromic compounds. In this study, photochromic diarylethene molecules were deposited on top of a periodically ordered array of gold nanorods (170 x 80 nm) and then irradiated with <100 fs laser pulses. Irradiation at 800 nm drives the plasmon resonance of the nanoparticle array and induces the photochromic conversion of molecules via non-resonant two-photon excitation. Transmission measurements using broadband continuum laser pulses probe the progress of the photochemical cycloreversion reaction as molecules switch from a visible-absorbing closed-ring structure to a transparent open-ring structure. The spatial dependence of the two-photon conversion of molecules in the plasmonic near field of the array is modeled using calculated field enhancements, and compared with similar measurements for a film of molecules on a glass substrate. Wavelength-dependent polarization effects in the near field of the array lead to interesting anisotropy results in the transmission signal. The results emphasize the importance of both the spatial dependence and anisotropy of the enhanced electric fields in driving non-resonant photochromic reactions.
New Complexity-Building Reactions of Alpha-Keto Esters
NASA Astrophysics Data System (ADS)
Bartlett, Samuel L.
I. Introduction: Importance of Asymmetric Catalysis and the Reactivity Patterns of alpha-Keto Esters. II. Synthesis of Complex Tertiary Glycolates by Enantioconvergent Arylation of Stereochemically Labile alpha-Keto Esters. Enantioconvergent arylation reactions of boronic acids and racemic ?-stereogenic alpha-keto esters have been developed. The reactions are catalyzed by a chiral (diene)Rh(I) complex and provide a wide array of beta-stereogenic tertiary aryl glycolate derivatives with high levels of diastereo- and enantioselectivity. Racemization studies employing a series of sterically differentiated tertiary amines suggest that the steric nature of the amine base additive exerts a significant influence on the rate of substrate racemization. III. Palladium-Catalyzed beta-Arylation of alpha-Keto Esters . A catalyst system derived from commercially available Pd2(dba) 3 and PtBu3 has been applied to the coupling of alpha-keto ester enolates and aryl bromides. The reaction provides access to an array of beta-stereogenic alpha-keto ester derivatives. When the air stable ligand precursor PtBu 3˙HBF4 is employed, the reaction can be carried out without use of a glovebox. The derived products are of broad interest given the prevalence of the alpha-keto acid substructure in biologically important molecules. IV. Catalytic Enantioselective [3+2] Cycloaddition of alpha-Keto Ester Enolates and Nitrile Oxides. An enantioselective [3+2] cycloaddition reaction between nitrile oxides and transiently generated enolates of alpha-keto esters has been developed. The catalyst system was found to be compatible with in situ nitrile oxide generation conditions. A versatile array of nitrile oxides and alpha-keto esters could participate in the cycloaddition, providing novel 5-hydroxy-2-isoxazolines in high chemical yield with high levels of diastereo- and enantioselectivity. Notably, the optimal reaction conditions circumvented concurrent reaction via O-imidoylation and hetero-[3+2] pathways.
Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides
NASA Astrophysics Data System (ADS)
Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.
Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.
The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...
Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio
2014-02-07
An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.
USDA-ARS?s Scientific Manuscript database
This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...
Study of near-stability nuclei populated as fission fragments in heavy-ion fusion reactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fotiadis, Nikolaos; Nelson, Ronald O; Devlin, Matthew
2010-01-01
Examples are presented to illustrate the power of prompt {gamma}-ray spectroscopy of fission fragments from compound nuclei with A {approx} 200 formed in fusion-evaporation reactions in experiments using the Gammasphere Ge-detector array. Complementary methods, such as Coulomb excitation and deep-inelastic processes, are also discussed. In other cases (n, xn{gamma}) reactions on stable isotopes have been used to establish neutron excitation functions for {gamma}-rays using a pulsed 'white'-neutron source, coupled to a high-energy-resolution germanium-detector array. The excitation functions can unambiguously assign {gamma}-rays to a specific reaction product. Results from all these methods bridge the gaps in the systematics of high-spin statesmore » between the neutron-deficient and neutron-rich nuclei. Results near shell closures should motivate new shell model calculations.« less
NASA Astrophysics Data System (ADS)
Huang, Ann; Miansari, Morteza; Friend, James
The growing interest in acoustic manipulation of particles in micro to nanofluidics using surface acoustic waves (SAW), together with the many applications of magnetic nanoparticles-whether individual or in arrays-underpins our discovery of how these forces can be used to rapidly, easily, and irreversibly form 1D chains and 2D films. These films and chains are currently difficult to produce yet offer many advantages over individual nanoparticles in suspension. Making use of the scale of the structures formed, 10-9 to 10-5 m, and by taking a balance of the relevant external and interparticle forces, the underlying mechanisms responsible for the phenomena become apparent. For 1D chains, the magnetic field alone is sufficient, though applying an acoustic field drives a topology change from loosely connected chains to loops of 10 -100 particles. Adding the acoustic field drives a transition from these looped structures to dense 2D arrays via interparticle Bjerknes forces. Inter-particle drainage of the surrounding fluid leaves these structures intact after removal of the externally applied forces. Clear morphology transitions are present and depend on the relative amplitude of the incident Brownian, Bjerknes, and magnetic forces. UCSD: Frontiers of Innovation Scholars Program (U-1024).
Detection of Serum microRNAs From Department of Defense Serum Repository
Woeller, Collynn F.; Thatcher, Thomas H.; Van Twisk, Daniel; Pollock, Stephen J.; Croasdell, Amanda; Kim, Nina; Hopke, Philip K.; Xia, Xiaoyan; Thakar, Juilee; Mallon, COL Timothy M.; Utell, Mark J.; Phipps, Richard P.
2017-01-01
Objective The aim of this study was to investigate whether serum samples from the Department of Defense Serum Repository (DoDSR) are of sufficient quality to detect microRNAs (miRNAs), cytokines, immunoglobulin E (IgE), and polycyclic aromatic hydrocarbons (PAHs). Methods MiRNAs were isolated and quantified by polymerase chain reaction (PCR) array. Cytokines and chemokines related to inflammation were measured using multiplex immunoassays. Cotinine and IgE were detected by enzyme-linked immunoassay (ELISA) and PAHs were detected by Liquid Chromatography/Mass Spectroscopy. Results We detected miRNAs, cytokines, IgE, and PAHs with high sensitivity. Eleven of 30 samples tested positive for cotinine suggesting tobacco exposure. Significant associations between serum cotinine, cytokine, IgE, PAHs, and miRNA were discovered. Conclusion We successfully quantified over 200 potential biomarkers of occupational exposure from DoDSR samples. The stored serum samples were not affected by hemolysis and represent a powerful tool for biomarker discovery and analysis in retrospective studies. PMID:27501106
Chronic myelogenous leukemia: laboratory diagnosis and monitoring.
Wang, Y L; Bagg, A; Pear, W; Nowell, P C; Hess, J L
2001-10-01
Rapid developments have occurred both in laboratory medicine and in therapeutic interventions for the management of patients with chronic myelogenous leukemia (CML). With a wide array of laboratory tests available, selecting the appropriate test for a specific diagnostic or therapeutic setting has become increasingly difficult. In this review, we first discuss, from the point of view of laboratory medicine, the advantages and disadvantages of several commonly used laboratory assays, including cytogenetics, fluorescence in situ hybridization (FISH), and qualitative and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We then discuss, from the point of view of clinical care, the test(s) of choice for the most common clinical scenarios, including diagnosis and monitoring of the therapeutic response and minimal residual disease in patients treated with different therapies. The purpose of this review is to help clinicians and laboratory physicians select appropriate tests for the diagnosis and monitoring of CML, with the ultimate goal of improving the cost-effective usage of clinical laboratories and improving patient care. Copyright 2001 Wiley-Liss, Inc.
Polymer-based microfluidic chips for isothermal amplification of nucleic acids
NASA Astrophysics Data System (ADS)
Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.
2017-11-01
Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.
Polymerase chain reaction with phase change as intrinsic thermal control
NASA Astrophysics Data System (ADS)
Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei
2013-04-01
This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.
Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku
2013-08-22
Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.
Array-Based Rational Design of Short Peptide Probe-Derived from an Anti-TNT Monoclonal Antibody.
Okochi, Mina; Muto, Masaki; Yanai, Kentaro; Tanaka, Masayoshi; Onodera, Takeshi; Wang, Jin; Ueda, Hiroshi; Toko, Kiyoshi
2017-10-09
Complementarity-determining regions (CDRs) are sites on the variable chains of antibodies responsible for binding to specific antigens. In this study, a short peptide probe for recognition of 2,4,6-trinitrotoluene (TNT), was identified by testing sequences derived from the CDRs of an anti-TNT monoclonal antibody. The major TNT-binding site in this antibody was identified in the heavy chain CDR3 by antigen docking simulation and confirmed by an immunoassay using a spot-synthesis based peptide array comprising amino acid sequences of six CDRs in the variable region. A peptide derived from heavy chain CDR3 (RGYSSFIYWF) bound to TNT with a dissociation constant of 1.3 μM measured by surface plasmon resonance. Substitution of selected amino acids with basic residues increased TNT binding while substitution with acidic amino acids decreased affinity, an isoleucine to arginine change showed the greatest improvement of 1.8-fold. The ability to create simple peptide binders of volatile organic compounds from sequence information provided by the immune system in the creation of an immune response will be beneficial for sensor developments in the future.
FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI
Ekstedt, Richard D.; Stollerman, Gene H.
1960-01-01
Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267
Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun
2014-05-28
3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.
Intact carbohydrate structures as part of the melanoidin skeleton.
Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W
2002-03-27
Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.
Sridharan, Vinod; Heimiller, Joseph; Robida, Mark D; Singh, Ravinder
2016-01-01
The Drosophila polypyrimidine tract-binding protein (dmPTB or hephaestus) plays an important role during spermatogenesis. The heph2 mutation in this gene results in a specific defect in spermatogenesis, causing aberrant spermatid individualization and male sterility. However, the array of molecular defects in the mutant remains uncharacterized. Using an unbiased high throughput sequencing approach, we have identified transcripts that are misregulated in this mutant. Aberrant transcripts show altered expression levels, exon skipping, and alternative 5' ends. We independently verified these findings by reverse-transcription and polymerase chain reaction (RT-PCR) analysis. Our analysis shows misregulation of transcripts that have been connected to spermatogenesis, including components of the actomyosin cytoskeletal apparatus. We show, for example, that the Myosin light chain 1 (Mlc1) transcript is aberrantly spliced. Furthermore, bioinformatics analysis reveals that Mlc1 contains a high affinity binding site(s) for dmPTB and that the site is conserved in many Drosophila species. We discuss that Mlc1 and other components of the actomyosin cytoskeletal apparatus offer important molecular links between the loss of dmPTB function and the observed developmental defect in spermatogenesis. This study provides the first comprehensive list of genes misregulated in vivo in the heph2 mutant in Drosophila and offers insight into the role of dmPTB during spermatogenesis.
NASA Astrophysics Data System (ADS)
Dhibar, M.; Mazumdar, I.; Chavan, P. B.; Patel, S. M.; Anil Kumar, G.
2018-03-01
LaBr3:Ce scintillators have recently become commercially available in sizes large enough for measurements of high energy gamma-rays. In this communication, we report our studies on properties and response of large volume square bars (2‧‧ ×2‧‧ ×8‧‧) of LaBr3:Ce detectors, individually, and in a compact array of four square bars, with gamma-rays up to 22.5 MeV. The properties studied are, uniformity of the crystal, internal radioactivity, energy resolution, timing resolution, linearity of the response and detection efficiencies. The response of the detectors for 22.5 MeV γ-rays produced from 11B(p , γ)12C capture reaction and for 15.1 MeV γ-rays produced from 12C(p ,p‧ γ)12C inelastic scattering reaction are studied in detail. The measured absolute efficiencies (both total detection and photo-peak) for 662 keV gamma-rays from 137Cs are compared to those obtained using realistic GEANT4 simulations. The primary aim of the array is to measure high energy gamma-rays (5-50 MeV) produced from the de-excitation of excited Giant Dipole Resonance (GDR) states, radiative capture reactions, nuclear Bremsstrahlung process and inelastic scattering process. The highly satisfactory performance of the array provides the impetus for future efforts toward building a bigger array.
Biodiesel production from triolein and short chain alcohols through biocatalysis.
Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo
2005-09-29
Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.
METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM
Fermi, E.; Leverett, M.C.
1957-11-12
This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.
Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods
NASA Technical Reports Server (NTRS)
Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.
1998-01-01
Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.
Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.
Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel
2008-04-01
Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.
Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere
2017-05-02
Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E
2013-08-01
Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael
2016-12-01
This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.
Brownholland, David P.
2017-01-01
A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584
Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H
2018-04-25
In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.
METHOD OF OPERATING NUCLEAR REACTORS
Untermyer, S.
1958-10-14
A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
NASA Astrophysics Data System (ADS)
Nakazumi, Tomoka; Hara, Yusuke
2017-09-01
We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.
Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R
2001-03-01
A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.
Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin
2016-05-01
A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Performance of the Versatile Array of Neutron Detectors at Low Energy (VANDLE)
Peters, W. A.; Ilyushkin, S.; Madurga, M.; ...
2016-08-26
The Versatile Array of Neutron Detectors at Low Energy (VANDLE) is a new, highly efficient plastic-scintillator array constructed for decay and transfer reaction experimental setups that require neutron detection. The versatile and modular design allows for customizable experimental setups including beta-delayed neutron spectroscopy and (d,n) transfer reactions in normal and inverse kinematics. The neutron energy and prompt-photon discrimination is determined through the time of flight technique. Fully digital data acquisition electronics and integrated triggering logic enables some VANDLE modules to achieve an intrinsic efficiency over 70% for 300-keV neutrons, measured through two different methods. A custom Geant4 simulation models aspectsmore » of the detector array and the experimental setups to determine efficiency and detector response. Lastly, a low detection threshold, due to the trigger logic and digitizing data acquisition, allowed us to measure the light-yield response curve from elastically scattered carbon nuclei inside the scintillating plastic from incident neutrons with kinetic energies below 2 MeV.« less
Gollapalli, Kishore; Ghantasala, Saicharan; Atak, Apurva; Rapole, Srikanth; Moiyadi, Aliasgar; Epari, Sridhar; Srivastava, Sanjeeva
2017-05-01
Gliomas are heterogeneous and most commonly occurring brain tumors. Blood-brain barrier restricts the entry of brain tumor proteins into blood stream thus limiting the usage of serum or plasma for proteomic analysis. Our study aimed at understanding the molecular basis of aggressiveness of various grades of brain tumors using isobaric tagging for relative and absolute quantification (iTRAQ) based mass spectrometry. Tissue proteomic analysis of various grades of gliomas was performed using four-plex iTRAQ. We labeled five sets (each set consists of control, grade-II, III, and IV tumor samples) of individual glioma patients using iTRAQ reagents. Significantly altered proteins were subjected to bioinformatics analysis using Database for Annotation, Visualization and Integrated Discovery (DAVID). Various metabolic pathways like glycolysis, TCA-cycle, electron transport chain, lactate metabolism, and blood coagulation pathways were majorly observed to be perturbed in gliomas. Most of the identified proteins involved in redox reactions, protein folding, pre-messenger RNA (mRNA) processing, antiapoptosis, and blood coagulation were found to be upregulated in gliomas. Transcriptomics data of glioblastoma multiforme (GBM), low-grade gliomas (LGGs), and controls were downloaded from The Cancer Genome Atlas (TCGA) data portal and further analyzed using BRB-Array tools. Expression levels of a few significantly altered proteins like lactate dehydrogenase, alpha-1 antitrypsin, fibrinogen alpha chain, nucleophosmin, annexin A5, thioredoxin, ferritin light chain, thymosin beta-4-like protein 3, superoxide dismutase-2, and peroxiredoxin-1 and 6 showed a positive correlation with increasing grade of gliomas thereby offering an insight into molecular basis behind their aggressive nature. Several proteins identified in different grades of gliomas are potential grade-specific markers, and perturbed pathways provide comprehensive overview of molecular cues involved in glioma pathogenesis.
Biological responses to PDGF-BB versus PDGF-DD in human mesangial cells.
van Roeyen, C R C; Ostendorf, T; Denecke, B; Bokemeyer, D; Behrmann, I; Strutz, F; Lichenstein, H S; LaRochelle, W J; Pena, C E; Chaudhuri, A; Floege, J
2006-04-01
Platelet-derived growth factor (PDGF)-BB and PDGF-DD mediate mesangial cell proliferation in vitro and in vivo. While PDGF-BB is a ligand for the PDGF alpha- and beta-receptor chains, PDGF-DD binds more selectively to the beta-chain, suggesting potential differences in the biological activities. Signal transduction and regulation of gene expression induced by PDGF-BB and -DD were compared in primary human mesangial cells (HMCs), which expressed PDGF alpha- and beta-receptor subunits. The growth factor concentrations used were chosen based on their equipotency in inducing HMCs proliferation and binding to the betabeta-receptor. Both growth factors, albeit at different concentrations induced phosphorylation and activation of extracellular signal-regulated kinase 1 (ERK1) and ERK2. In addition, PDGFs led to the phosphorylation and activation of signal transducers and activators of transcription 1 (STAT1) and STAT3. HMCs proliferation induced by either PDGF-BB or -DD could be blocked by signal transduction inhibitors of the mitogen-activated protein kinase-, Janus kinase (JAK)/STAT-, or phosphatidyl-inositol 3-kinase pathways. Using a gene chip array and subsequent verification by real-time reverse transcriptase (RT)-polymerase chain reaction, we found that in HMC genes for matrix metalloproteinase 13 (MMP-13) and MMP-14 and, to a low extent, cytochrome B5 and cathepsin L were exclusively regulated by PDGF-BB, whereas no exclusive gene regulation was detected by PDGF-DD. However, at the protein level, both MMP-13 and -14 were equally induced by PDGF-BB and -DD. PDGF-BB and -DD effect similar biological responses in HMCs albeit at different potencies. Rare apparently differential gene regulation did not result in different protein expression, suggesting that in HMCs both PDGFs exert their biological activity almost exclusively via the PDGF beta-receptor.
NASA Astrophysics Data System (ADS)
Zeng, Joy; Xu, Xiaoqing; Parameshwaran, Vijay; Baker, Jon; Bent, Stacey; Wong, H.-S. Philip; Clemens, Bruce
2018-02-01
Photoelectrochemical (PEC) hydrogen production makes possible the direct conversion of solar energy into chemical fuel. In this work, PEC photoanodes consisting of GaAs nanowire (NW) arrays were fabricated, characterized, and then demonstrated for the oxygen evolution reaction (OER). Uniform and periodic GaAs nanowire arrays were grown on a heavily n-doped GaAs substrates by metal-organic chemical vapor deposition selective area growth. The nanowire arrays were characterized using cyclic voltammetry and impedance spectroscopy in a non-aqueous electrochemical system using ferrocene/ferrocenium (Fc/Fc+) as a redox couple, and a maximum oxidation photocurrent of 11.1 mA/cm2 was measured. GaAs NW arrays with a 36 nm layer of nickel oxide (NiO x ) synthesized by atomic layer deposition were then used as photoanodes to drive the OER. In addition to acting as an electrocatalyst, the NiO x layer served to protect the GaAs NWs from oxidative corrosion. Using this strategy, GaAs NW photoanodes were successfully used for the oxygen evolution reaction. This is the first demonstration of GaAs NW arrays for effective OER, and the fabrication and protection strategy developed in this work can be extended to study any other nanostructured semiconductor materials systems for electrochemical solar energy conversion.
Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen
2012-01-01
Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.
Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.
Winkelmann, Kurt; Calhoun, Robert L; Mills, German
2006-12-28
Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.
ERIC Educational Resources Information Center
Gilbert, George L., Ed.
1983-01-01
Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…
Efficient discovery of bioactive scaffolds by activity-directed synthesis
NASA Astrophysics Data System (ADS)
Karageorgis, George; Warriner, Stuart; Nelson, Adam
2014-10-01
The structures and biological activities of natural products have often provided inspiration in drug discovery. The functional benefits of natural products to the host organism steers the evolution of their biosynthetic pathways. Here, we describe a discovery approach—which we term activity-directed synthesis—in which reactions with alternative outcomes are steered towards functional products. Arrays of catalysed reactions of α-diazo amides, whose outcome was critically dependent on the specific conditions used, were performed. The products were assayed at increasingly low concentration, with the results informing the design of a subsequent reaction array. Finally, promising reactions were scaled up and, after purification, submicromolar ligands based on two scaffolds with no previous annotated activity against the androgen receptor were discovered. The approach enables the discovery, in tandem, of both bioactive small molecules and associated synthetic routes, analogous to the evolution of biosynthetic pathways to yield natural products.
NASA Astrophysics Data System (ADS)
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Nakagawa, Yoshitaka; Kageyama, Hiroyuki; Oaki, Yuya; Imai, Hiroaki
2015-06-09
Monocrystalline architectures with well-defined shapes were achieved by bottom-up routes through epitaxial attachment of Mn3O4 nanocrystals. The crystallographically continuous 1D chains elongated in the a axis and 2D panels having large a or c faces were obtained by removal of the organic mediator from surfactant-mediated 1D and 2D arrays of Mn3O4 nanocrystals, respectively. Our basal approach indicates that the epitaxial attachment through the surfactant-mediated arrays is utilized for fabrication of a wide variety of micrometric architectures from nanometric crystalline units.
Evaluation of sensitivity and selectivity of piezoresistive cantilever-array sensors
NASA Astrophysics Data System (ADS)
Yoshikawa, Genki; Lang, Hans-Peter; Staufer, Urs; Vettiger, Peter; Sakurai, Toshio; Gerber, Christoph
2008-03-01
Microfabricated cantilever-array sensors have attracted much attention in recent years due to their real-time detection of low concentration of molecules. Since the piezoresistive cantilever-array sensors do not require a bulky and expensive optical read-out system, they possess many advantages compared with optical read-out cantilever-array sensors. They can be miniaturized and integrated into a match-box sized device. In this study, we present the piezoresistive cantilever-array sensor system and evaluate its sensitivity and selectivity using various vapors of molecules, including alkane molecules with different chain length from 5 (n-pentane) to 12 (n-dodecane). Piezoresistive cantilevers were coated with different polymers (PVP, PAAM, PEI, and PVA) using an inkjet spotter. Each cantilever has a reference cantilever, constituting a Wheatstone-bridge. Each vapor was mixed with a constant nitrogen gas flow and introduced into the measurement chamber. According to the principle component analysis of data obtained, each molecule can be clearly distinguished from others. We also confirmed that this piezoresistive cantilever-array sensor system has sub-ppm sensitivity.
Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.
Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C
2012-09-27
We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.
Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.
2015-10-27
In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.
2015-07-15
Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less
Brownholland, David P; Covey, Douglas F
2017-05-01
A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y
2014-04-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.
2014-01-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178
Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D
2011-11-01
The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
USDA-ARS?s Scientific Manuscript database
The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...
Spark Plasma Sintering for Nanostructured Smart Materials
2009-03-02
polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
NASA Astrophysics Data System (ADS)
Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin
Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0
Particle Identification in the NIMROD-ISiS Detector Array
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wuenschel, S.; Hagel, K.; May, L. W.
Interest in the influence of the neutron-to-proton (N/Z) ratio on multifragmenting nuclei has demanded an improvement in the capabilities of multi-detector arrays as well as the companion analysis methods. The particle identification method used in the NIMROD-ISiS 4{pi} array is described. Performance of the detectors and the analysis method are presented for the reaction of {sup 86}Kr+{sup 64}Ni at 35 MeV/u.
Light-Regulated Electrochemical Sensor Array for Efficiently Discriminating Hazardous Gases.
Liang, Hongqiu; Zhang, Xin; Sun, Huihui; Jin, Han; Zhang, Xiaowei; Jin, Qinghui; Zou, Jie; Haick, Hossam; Jian, Jiawen
2017-10-27
Inadequate detection limit and unsatisfactory discrimination features remain the challenging issues for the widely applied electrochemical gas sensors. Quite recently, we confirmed that light-regulated electrochemical reaction significantly enhanced the electrocatalytic activity, and thereby can potentially extend the detection limit to the parts per billion (ppb) level. Nevertheless, impact of the light-regulated electrochemical reaction on response selectivity has been discussed less. Herein, we systematically report on the effect of illumination on discrimination features via design and fabrication of a light-regulated electrochemical sensor array. Upon illumination (light on), response signal to the examined gases (C 3 H 6 , NO, and CO) is selectively enhanced, resulting in the sensor array demonstrating disparate response patterns when compared with that of the sensor array operated at light off. Through processing all the response patterns derived from both light on and light off with a pattern recognition algorithm, a satisfactory discrimination feature is observed. In contrast, apparent mutual interference between NO and CO is found when the sensor array is solely operated without illumination. The impact mechanism of the illumination is studied and it is deduced that the effect of the illumination on the discriminating features can be mainly attributed to the competition of electrocatalytic activity and gas-phase reactivity. If the enhanced electrocatalytic activity (to specific gas) dominates the whole sensing progress, enhancements in the corresponding response signal would be observed upon illumination. Otherwise, illumination gives a negligible impact. Hence, the response signal to part of the examined gases is selectively enhanced by illumination. Conclusively, light-regulated electrochemical reaction would provide an efficient approach to designing future smart sensing devices.
Methanol Cannon Demonstrations Revisited.
ERIC Educational Resources Information Center
Dolson, David A.; And Others
1995-01-01
Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)
Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain
NASA Astrophysics Data System (ADS)
Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration
2017-09-01
It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.
Investigation of High-Spin States in ^203Rn
NASA Astrophysics Data System (ADS)
Beausang, C. W.; Novak, J. R.; Caprio, M.; Casten, R. F.; Cederkall, J.; Cooper, J. R.; Krücken, R.; Wang, Z.; Zamfir, N. V.; Barton, C. J.
1999-10-01
High-spin states in ^203Rn were populated following the reaction ^34S + ^174Yb + 5n at beam energies ranging from 160 to 170 MeV. Gamma-rays were detected using the multi-Ge detector array YRAST Ball located at the Wright Nuclear Structure Laboratory. In addition the SCARY array, an array of 28 solar cell detectors, each 1 cm by 1 cm, was arranged around the target at backward angles. These were used to detect fission fragments and hence discriminate against the very large fission background encountered in this reaction. Following our excitation function measurement several transitions can be assigned to ^203Rn, where previously no information was available on excited states. Data analysis is continuing and preliminary results will be presented. This work is supported by the US-DOE under grant number DE-FG02-91ER-40609.
A chain reaction approach to modelling gene pathways.
Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen
2012-08-01
BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.
ERIC Educational Resources Information Center
Soares, Pedro; Fernandes, Carlos; Chavarria, Daniel; Borges, Fernanda
2015-01-01
In recent years, the use of boron-containing reagents in palladium-assisted C-C coupling reactions (the Suzuki reaction) has gained prominence due to the vast array of reagents commercially available. Consequently, the generation of carbon-carbon bonds, namely of functionalized biphenyl systems, is at present considered the backbone of organic…
Catalytic growth of vertically aligned SnS/SnS2 p-n heterojunctions
NASA Astrophysics Data System (ADS)
Degrauw, Aaron; Armstrong, Rebekka; Rahman, Ajara A.; Ogle, Jonathan; Whittaker-Brooks, Luisa
2017-09-01
Nanowire arrays of SnS/SnS2 p-n heterojunctions are grown on transparent indium tin oxide (ITO) coated-glass and Si/SiO2 substrates via chemical vapor transport (CVT). The nanowire arrays are comprised of individual SnS/SnS2 heterostructures that are highly oriented with their lengths and morphologies controlled by the CVT conditions (i.e. reaction temperature, flow rate, and reaction time). The growth and optoelectronic characterization of these well-defined SnS/SnS2 p-n heterostructures pave the way for the fabrication of highly efficient solar cell devices.
Technology for Solar Array Production on the Moon
NASA Technical Reports Server (NTRS)
Landis, Geoffrey A.
2002-01-01
Silicon, aluminum, and glass are the primary raw materials that will be required for production of solar arrays on the moon. A process sequence is proposed for producing these materials from lunar regolith is proposed, consisting of separating the required materials from lunar rock with fluorine. Fluorosilane produced by this process is reduced to silicon; the fluorine salts are reduced to metals by reaction with metallic potassium. Fluorine is recovered from residual MgF and CaF2 by reaction with K2O. Aluminum, calcium oxide, and magnesium oxide are recovered to manufacture structural materials and glass.
Progress on the Low Frequency All Sky Monitor
NASA Astrophysics Data System (ADS)
Ford, Anthony; Jenet, F.; Craig, J.; Creighton, T. D.; Dartez, L. P.; Hicks, B.; Hinojosa, J.; Jaramillo, R.; Kassim, N. E.; Lunsford, G.; Miller, R. B.; Murray, J.; Ray, P. S.; Rivera, J.; Taylor, G. B.
2013-01-01
The Low Frequency All Sky Monitor is a system of geographically separated radio arrays dedicated to the study of radio transients. LoFASM consists of four stations, each comprised of 12 cross-dipole antennas designed to operate between 5-88MHz. The antennas and front end electronics for LoFASM were designed by the Naval Research Laboratory for the Long Wavelength Array project. Over the last year, undergraduate students from the University of Texas at Brownsville’s Center for Advanced Radio Astronomy have been establishing these stations around the continental US, consisting of sites located in Port Mansfield, Texas, the LWA North Arm site of the LWA1 Radio Observatory in New Mexico, adjacent to the North Arm of the Very Large Array, the Green Bank Radio Observatory, West Virginia, and NASA’s Goldstone tracking complex in California. In combination with the establishment of these sites was the development of the analog hardware, which consists of commercial off-the-shelf RF splitter/combiners and a custom amplifier and filter chain designed by colleagues at the University of New Mexico. This poster will expound on progress in site installation and development of the analog signal chain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Casperson, R. J.; Burke, J. T.; Hughes, R. O.
Directly measuring (n,2n) cross sections on short-lived actinides presents a number of experimental challenges. The surrogate reaction technique is an experimental method for measuring cross sections on short-lived isotopes, and it provides a unique solution for measuring (n,2n) cross sections. This technique involves measuring a charged-particle reaction cross section, where the reaction populates the same compound nucleus as the reaction of interest. To perform these surrogate (n,2n) cross section measurements, a silicon telescope array has been placed along a beam line at the Texas A&M University Cyclotron Institute, which is surrounded by a large tank of gadolinium-doped liquid scintillator, whichmore » acts as a neutron detector. The combination of the charge-particle and neutron-detector arrays is referred to as NeutronSTARS. In the analysis procedure for calculating the (n,2n) cross section, the neutron detection efficiency and time structure plays an important role. Due to the lack of availability of isotropic, mono-energetic neutron sources, modeling is an important component in establishing this efficiency and time structure. This report describes the NeutronSTARS array, which was designed and commissioned during this project. It also describes the surrogate reaction technique, specifically referencing a 235U(n,2n) commissioning measurement that was fielded during the past year. Advanced multiplicity analysis techniques have been developed for this work, which should allow for efficient analysis of 241Pu(n,2n) and 239Pu(n,2n) cross section measurements« less
LIPID BIOMARKER CHARACTERIZATION OF BLOOM-RELATED DINOFLAGELLATES
Marine eukaryotic algae synthesize an array of lipids of chemotaxonomic utility that are potentially valuable in characterizing phytoplankton communities. Sterols and photopigments characteristic of dinoflagellates are rarely found in other algal classes. Long chain (C28) highly ...
Unraveling reaction pathways and specifying reaction kinetics for complex systems.
Vinu, R; Broadbelt, Linda J
2012-01-01
Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.
Combinatorial Libraries of Arrayable Single-Chain Antibodies
NASA Astrophysics Data System (ADS)
Benhar, Itai
Antibodies that bind their respective targets with high affinity and specificity have proven to be essential reagents for biological research. Antibody phage display has become the leading tool for the rapid isolation of single-chain variable fragment (scFv) antibodies in vitro for research applications, but there is usually a gap between scFv isolation and its application in an array format suitable for high-throughput proteomics. In this chapter, we present our antibody phage display system where antibody isolation and scFv immobilization are facilitated by the design of the phagemid vector used as platform. In our system, the scFvs are fused at their C-termini to a cellulose-binding domain (CBD) and can be immobilized onto cellulose-based filters. This made it possible to develop a unique filter lift screen that allowed the efficient screen for multiple binding specificities, and to directly apply library-derived scFvs in an antibody spotted microarray.
Perfect mixing of immiscible macromolecules at fluid interfaces
NASA Astrophysics Data System (ADS)
Sheiko, Sergei; Matyjaszewski, Krzysztof; Tsukruk, Vladimir; Carrillo, Jan-Michael; Rubinstein, Michael; Dobrynin, Andrey; Zhou, Jing
2014-03-01
Macromolecules typically phase separate unless their shapes and chemical compositions are tailored to explicitly drive mixing. But now our research has shown that physical constraints can drive spontaneous mixing of chemically different species. We have obtained long-range 2D arrays of perfectly mixed macromolecules having a variety of molecular architectures and chemistries, including linear chains, block-copolymer stars, and bottlebrush copolymers with hydrophobic, hydrophilic, and lipophobic chemical compositions. This is achieved by entropy-driven enhancement of steric repulsion between macromolecules anchored on a substrate. By monitoring the kinetics of mixing, we have proved that molecular intercalation is an equilibrium state. The array spacing is controlled by the length of the brush side chains. This entropic templating strategy opens new ways for generating patterns on sub-100 nm length scales with potential application in lithography, directed self-assembly, and biomedical assays. Financial support from the National Science Foundation DMR-0906985, DMR-1004576, DMR-1122483, and DMR-0907515.
NASA Technical Reports Server (NTRS)
Hicks, Yolanda R.; Heath, Christopher M.; Anderson, Robert C.; Tacina, Kathleen M.
2012-01-01
This paper explores recent results obtained during testing in an optically-accessible, JP8-fueled, flame tube combustor using baseline Lean Direct Injection (LDI) research hardware. The baseline LDI geometry has nine fuel/air mixers arranged in a 3 x 3 array. Results from this nine-element array include images of fuel and OH speciation via Planar Laser-Induced Fluorescence (PLIF), which describe fuel spray pattern and reaction zones. Preliminary combustion temperatures derived from Stokes/Anti-Stokes Spontaneous Raman Spectroscopy are also presented. Other results using chemiluminescence from major combustion radicals such as CH* and C2* serve to identify the primary reaction zone, while OH PLIF shows the extent of reaction further downstream. Air and fuel velocities and fuel drop size results are also reported.
Validation of SCT Methylation as a Hallmark Biomarker for Lung Cancers.
Zhang, Yu-An; Ma, Xiaotu; Sathe, Adwait; Fujimoto, Junya; Wistuba, Ignacio; Lam, Stephen; Yatabe, Yasushi; Wang, Yi-Wei; Stastny, Victor; Gao, Boning; Larsen, Jill E; Girard, Luc; Liu, Xiaoyun; Song, Kai; Behrens, Carmen; Kalhor, Neda; Xie, Yang; Zhang, Michael Q; Minna, John D; Gazdar, Adi F
2016-03-01
The human secretin gene (SCT) encodes secretin, a hormone with limited tissue distribution. Analysis of the 450k methylation array data in The Cancer Genome Atlas (TCGA) indicated that the SCT promoter region is differentially hypermethylated in lung cancer. Our purpose was to validate SCT methylation as a potential biomarker for lung cancer. We analyzed data from TCGA and developed and applied SCT-specific bisulfite DNA sequencing and quantitative methylation-specific polymerase chain reaction assays. The analyses of TCGA 450K data for 801 samples showed that SCT hypermethylation has an area under the curve (AUC) value greater than 0.98 that can be used to distinguish lung adenocarcinomas or squamous cell carcinomas from nonmalignant lung tissue. Bisulfite sequencing of lung cancer cell lines and normal blood cells allowed us to confirm that SCT methylation is highly discriminative. By applying a quantitative methylation-specific polymerase chain reaction assay, we found that SCT hypermethylation is frequently detected in all major subtypes of malignant non-small cell lung cancer (AUC = 0.92, n = 108) and small cell lung cancer (AUC = 0.93, n = 40) but is less frequent in lung carcinoids (AUC = 0.54, n = 20). SCT hypermethylation appeared in samples of lung carcinoma in situ during multistage pathogenesis and increased in invasive samples. Further analyses of TCGA 450k data showed that SCT hypermethylation is highly discriminative in most other types of malignant tumors but less frequent in low-grade malignant tumors. The only normal tissue with a high level of methylation was the placenta. Our findings demonstrated that SCT methylation is a highly discriminative biomarker for lung and other malignant tumors, is less frequent in low-grade malignant tumors (including lung carcinoids), and appears at the carcinoma in situ stage. Copyright © 2015 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
O’Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O’Driscoll, Lorraine
2018-01-01
Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p’s predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome. PMID:29507696
Chevillet, John R.; Khokhlova, Tatiana D.; Giraldez, Maria D.; Schade, George R.; Starr, Frank; Wang, Yak-Nam; Gallichotte, Emily N.; Wang, Kai; Hwang, Joo Ha
2017-01-01
Purpose To compare the abilities of three pulsed focused ultrasound regimes (that cause tissue liquefaction, permeabilization, or mild heating) to release tumor-derived microRNA into the circulation in vivo and to evaluate release dynamics. Materials and Methods All rat experiments were approved by the University of Washington Institutional Animal Care and Use Committee. Reverse-transcription quantitative polymerase chain reaction array profiling was used to identify candidate microRNA biomarkers in a rat solid tumor cell line. Rats subcutaneously grafted with these cells were randomly assigned among three pulsed focused ultrasound treatment groups: (a) local tissue liquefaction via boiling histotripsy, (b) tissue permeabilization via inertial cavitation, and (c) mild (<10°C) heating of tissue, as well as a sham-treated control group. Blood specimens were drawn immediately prior to treatment and serially over 24 hours afterward. Plasma microRNA was quantified with reverse-transcription quantitative polymerase chain reaction, and statistical significance was determined with one-way analysis of variance (Kruskal-Wallis and Friedman tests), followed by the Dunn multiple-comparisons test. Results After tissue liquefaction and cavitation treatments (but not mild heating), plasma quantities of candidate biomarkers increased significantly (P value range, <.0001 to .04) relative to sham-treated controls. A threefold to 32-fold increase occurred within 15 minutes after initiation of pulsed focused ultrasound tumor treatment, and these increases persisted for 3 hours. Histologic examination confirmed complete liquefaction of the targeted tumor area with boiling histotripsy, in addition to areas of petechial hemorrhage and tissue disruption by means of cavitation-based treatment. Conclusion Mechanical tumor tissue disruption with pulsed focused ultrasound–induced bubble activity significantly increases the plasma abundance of tumor-derived microRNA rapidly after treatment. © RSNA, 2016 Online supplemental material is available for this article. PMID:27802108
O'Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O'Driscoll, Lorraine
2018-02-06
Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p's predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome.
Gordon, Lavinia; Kapoor, Jada; Walker, Susan P.; Whitehead, Clare; Kaitu’u-Lino, Tu’uhevaha J.; Pell, Gabrielle; Hannan, Natalie J.; Tong, Stephen
2015-01-01
Background: Preterm prelabor rupture of the fetal membranes (PPROM) is a significant contributor to the morbidity and mortality of preterm birth, particularly in the setting of chorioamnionitis. No sensitive or specific diagnostic or predictive test currently exists for the accurate diagnosis of chorioamnionitis. Our aim was to measure messenger RNA (mRNA) coding cytokines in the maternal blood and examine whether they were increased in association with chorioamnionitis at delivery. Methods/Results: We performed a prospective cohort study of women recruited with PPROM at a mean gestational age of 28.9 weeks at risk of developing chorioamnionitis. Blood was sampled from participants, and the expression of mRNA coding for proinflammatory genes was measured in women with and without chorioamnionitis at the time of delivery as well as gestation-matched healthy controls. Expression was measured using quantitative polymerase chain reaction (PCR) and also digital PCR. Interleukin 1β (IL1B) mRNA expression in maternal blood was elevated in women with chorioamnionitis compared to gestation-matched controls. Importantly, among women admitted with PPROM, digital PCR confirmed a significant increase in IL1B expression in maternal blood in women with chorioamnionitis compared to women without chorioamnionitis. Polymerase chain reaction array revealed that CD14, nuclear factor of κ light polypeptide gene enhancer in B-cells 1 (NFKB1), and tumor necrosis factor receptor super family-interacting serine–threonine kinase 1 mRNA were significantly increased in women with chorioamnionitis compared to controls. Digital PCR confirmed that NFKB1 mRNA was significantly increased in patients with chorioamnionitis compared to controls and that CD14 levels increased over time in patients with PPROM having chorioamnionitis. Conclusion: Measuring circulating proinflammatory mRNA in women with PPROM may distinguish those with chorioamnionitis from those without, in turn providing better targeted therapies and appropriate timing of delivery. PMID:25616398
Impact of a rapid respiratory panel test on patient outcomes.
Rogers, Beverly B; Shankar, Prabhu; Jerris, Robert C; Kotzbauer, David; Anderson, Evan J; Watson, J Renee; O'Brien, Lauren A; Uwindatwa, Francine; McNamara, Kelly; Bost, James E
2015-05-01
Evolution of polymerase chain reaction testing for infectious pathogens has occurred concurrent with a focus on value-based medicine. To determine if implementation of the FilmArray rapid respiratory panel (BioFire Diagnostics, Salt Lake City, Utah) (hereafter RRP), with a shorter time to the test result and expanded panel, results in different outcomes for children admitted to the hospital with an acute respiratory tract illness. Patient outcomes were compared before implementation of the RRP (November 1, 2011, to January 31, 2012) versus after implementation of the RRP (November 1, 2012, to January 31, 2013). The study included inpatients 3 months or older with an acute respiratory tract illness, most admitted through the emergency department. Testing before RRP implementation used batched polymerase chain reaction analysis for respiratory syncytial virus and influenza A and B, with additional testing for parainfluenza 1 through 3 in approximately 11% of patients and for human metapneumovirus in less than 1% of patients. The RRP tested for respiratory syncytial virus, influenza A and B, parainfluenza 1 through 4, human metapneumovirus, adenovirus, rhinovirus/enterovirus, and coronavirus NL62. The pre-RRP group had 365 patients, and the post-RRP group had 771 patients. After RRP implementation, the mean time to the test result was shorter (383 minutes versus 1119 minutes, P < .001), and the percentage of patients with a result in the emergency department was greater (51.6% versus 13.4%, P < .001). There was no difference in whether antibiotics were prescribed, but the duration of antibiotic use was shorter after RRP implementation (P = .003) and was dependent on receiving test results within 4 hours. If the test result was positive, the inpatient length of stay (P = .03) and the time in isolation (P = .03) were decreased after RRP implementation compared with before RRP implementation. The RRP decreases the duration of antibiotic use, the length of inpatient stay, and the time in isolation.
Implementation of a noise reduction circuit for spaceflight IR spectrometers
NASA Technical Reports Server (NTRS)
Ramirez, L.; Hickok, R.; Pain, B.; Staller, C.
1992-01-01
The paper discusses the implementation and analysis of a correlated triple sampling circuit using analog subtractor/integrators. The software and test setup for noise measurements are also described. The correlation circuitry is part of the signal chain for a 256-element InSb line array used in the Visible and Infrared Mapping Spectrometer. Using a focal-plane array (FPA) simulator, system noise measurements of 0.7 DN are obtained. A test setup for FPA/SPE (signal processing electronics) characterization along with noise measurements is demonstrated.
2016-03-31
The SiGe receiver has two stages of programmable RF filtering and one stage of IF filtering. Each filter can be tuned in center frequency and...distribution unlimited. transmit, with an IF to RF upconversion chain that is split to programmable phase shifters and VGAs at each output port. Figure 2...These are optimized to run on medium grade Field Programmable Gate Arrays (FPGAs), such as the Altera Arria 10, and represent a few of the many
Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.
Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin
2006-10-16
The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.
Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T
2002-03-01
Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.
Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.
Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano
This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Detection of Trypanosoma cruzi by Polymerase Chain Reaction.
Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz
2016-01-01
American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.
Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang
2006-10-12
[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.
Law, Dennis K S; Tsang, Raymond S W
2013-05-01
A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.
A computational study of pyrolysis reactions of lignin model compounds
Thomas Elder
2010-01-01
Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...
A rare polyglycine type II-like helix motif in naturally occurring proteins.
Warkentin, Eberhard; Weidenweber, Sina; Schühle, Karola; Demmer, Ulrike; Heider, Johann; Ermler, Ulrich
2017-11-01
Common structural elements in proteins such as α-helices or β-sheets are characterized by uniformly repeating, energetically favorable main chain conformations which additionally exhibit a completely saturated hydrogen-bonding network of the main chain NH and CO groups. Although polyproline or polyglycine type II helices (PP II or PG II ) are frequently found in proteins, they are not considered as equivalent secondary structure elements because they do not form a similar self-contained hydrogen-bonding network of the main chain atoms. In this context our finding of an unusual motif of glycine-rich PG II -like helices in the structure of the acetophenone carboxylase core complex is of relevance. These PG II -like helices form hexagonal bundles which appear to fulfill the criterion of a (largely) saturated hydrogen-bonding network of the main-chain groups and therefore may be regarded in this sense as a new secondary structure element. It consists of a central PG II -like helix surrounded by six nearly parallel PG II -like helices in a hexagonal array, plus an additional PG II -like helix extending the array outwards. Very related structural elements have previously been found in synthetic polyglycine fibers. In both cases, all main chain NH and CO groups of the central PG II -helix are saturated by either intra- or intermolecular hydrogen-bonds, resulting in a self-contained hydrogen-bonding network. Similar, but incomplete PG II -helix patterns were also previously identified in a GTP-binding protein and an antifreeze protein. © 2017 Wiley Periodicals, Inc.
Uncovering the Roles of Oxygen in Cr(III) Photoredox Catalysis.
Higgins, Robert F; Fatur, Steven M; Shepard, Samuel G; Stevenson, Susan M; Boston, David J; Ferreira, Eric M; Damrauer, Niels H; Rappé, Anthony K; Shores, Matthew P
2016-04-27
A combined experimental and theoretical investigation aims to elucidate the necessary roles of oxygen in photoredox catalysis of radical cation based Diels-Alder cycloadditions mediated by the first-row transition metal complex [Cr(Ph2phen)3](3+), where Ph2phen = bathophenanthroline. We employ a diverse array of techniques, including catalysis screening, electrochemistry, time-resolved spectroscopy, and computational analyses of reaction thermodynamics. Our key finding is that oxygen acts as a renewable energy and electron shuttle following photoexcitation of the Cr(III) catalyst. First, oxygen quenches the excited Cr(3+)* complex; this energy transfer process protects the catalyst from decomposition while preserving a synthetically useful 13 μs excited state and produces singlet oxygen. Second, singlet oxygen returns the reduced catalyst to the Cr(III) ground state, forming superoxide. Third, the superoxide species reduces the Diels-Alder cycloadduct radical cation to the final product and reforms oxygen. We compare the results of these studies with those from cycloadditions mediated by related Ru(II)-containing complexes and find that the distinct reaction pathways are likely part of a unified mechanistic framework where the photophysical and photochemical properties of the catalyst species lead to oxygen-mediated photocatalysis for the Cr-containing complex but radical chain initiation for the Ru congener. These results provide insight into how oxygen can participate as a sustainable reagent in photocatalysis.
Liu, Liangqi; Wu, Wei; Tuo, Xiaoye; Geng, Wenxin; Zhao, Jie; Wei, Jing; Yan, Xingrong; Yang, Wei; Li, Liwen; Chen, Fulin
2010-05-01
Limited donor sites of cartilage and dedifferentiation of chondrocytes during expansion, low tissue reconstruction efficiency, and uncontrollable immune reactions to foreign materials are the main obstacles to overcome before cartilage tissue engineering can be widely used in the clinic. In the current study, we developed a novel strategy to fabricate tissue-engineered trachea cartilage grafts using marrow mesenchymal stem cell (MSC) macroaggregates and hydrolyzable scaffold of polylactic acid-polyglycolic acid copolymer (PLGA). Rabbit MSCs were continuously cultured to prepare macroaggregates in sheet form. The macroaggregates were studied for their potential for chondrogenesis. The macroaggregates were wrapped against the PLGA scaffold to make a tubular composite. The composites were incubated in spinner flasks for 4 weeks to fabricate trachea cartilage grafts. Histological observation and polymerase chain reaction array showed that MSC macroaggregates could obtain the optimal chondrogenic capacity under the induction of transforming growth factor-beta. Engineered trachea cartilage consisted of evenly spaced lacunae embedded in a matrix rich in proteoglycans. PLGA scaffold degraded totally during in vitro incubation and the engineered cartilage graft was composed of autologous tissue. Based on this novel, MSC macroaggregate and hydrolyzable scaffold composite strategy, ready-to-implant autologous trachea cartilage grafts could be successfully fabricated. The strategy also had the advantages of high efficiency in cell seeding and tissue regeneration, and could possibly be used in future in vivo experiments.
Hou, Jianwen; Cui, Lele; Chen, Runhai; Xu, Xiaodong; Chen, Jiayue; Yin, Ligang; Liu, Jingchuan; Shi, Qiang; Yin, Jinghua
2018-03-01
A versatile platform allowing capture and detection of normal and dysfunctional cells on the same patterned surface is important for accessing the cellular mechanism, developing diagnostic assays, and implementing therapy. Here, an original and effective method for fabricating binary polymer brushes pattern is developed for controlled cell adhesion. The binary polymer brushes pattern, composed of poly(N-isopropylacrylamide) (PNIPAAm) and poly[poly(ethylene glycol) methyl ether methacrylate] (POEGMA) chains, is simply obtained via a combination of surface-initiated photopolymerization and surface-activated free radical polymerization. This method is unique in that it does not utilize any protecting groups or procedures of backfilling with immobilized initiator. It is demonstrated that the precise and well-defined binary polymer patterns with high resolution are fabricated using this facile method. PNIPAAm chains capture and release cells by thermoresponsiveness, while POEGMA chains possess high capability to capture dysfunctional cells specifically, inducing a switch of normal red blood cells (RBCs) arrays to hemolytic RBCs arrays on the pattern with temperature. This novel platform composed of binary polymer brush pattern is smart and versatile, which opens up pathways to potential applications as microsensors, biochips, and bioassays. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Acetanilide mediated reversible assembly and disassembly of Au nanoparticles.
Murugadoss, A; Kar, Manoranjan; Chattopadhyay, Arun
2008-08-01
Herein we report the generation of Au nanoparticles (NPs) by sparingly soluble acetanilide in water. We also report the formation of linear chain-like superstructures of self-assembled Au NPs, in the presence of excess acetanilide. This was achieved in two different ways. In the first method, acetanilide was added, with increasing concentration, into aqueous HAuCl(4) to produce Au NPs as well as for the formation of assembly, which varied according to the concentration of acetanilide. The other route involved formation of spherical Au NPs at the lowest concentration of acetanilide, which was followed by the formation of assembly of various lengths upon further addition of variable amount of acetanilide. The assemblies were stable in aqueous solution for days with characteristic UV-vis absorption spectra consisting of two peaks. While the wavelength of the first peak remained the same, the position of the second peak changed to longer wavelength with increasing acetanilide concentration. Interestingly, the linear chain-like arrays could be broken into individual particles by first dilution of the solution concentration followed by treatment with ultrasonic waves. The individual Au NPs again formed linear chain-like arrays upon addition of excess acetanilide.
NASA Astrophysics Data System (ADS)
Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.
2005-12-01
Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.
Jung, Ae Ryang; Kim, Richard Y; Kim, Hyung Woo; Shrestha, Kshitiz Raj; Jeon, Seung Hwan; Cha, Kyoung Je; Park, Yong Hyun; Kim, Dong Sung; Lee, Ji Youl
2015-07-01
Human adipose-derived stem cells (hADSCs) can differentiate into various cell types depending on chemical and topographical cues. One topographical cue recently noted to be successful in inducing differentiation is the nanoengineered polystyrene surface containing nanopore array-patterned substrate (NP substrate), which is designed to mimic the nanoscale topographical features of the extracellular matrix. In this study, efficacies of NP and flat substrates in inducing neural differentiation of hADSCs were examined by comparing their substrate-cell adhesion rates, filopodia growth, nuclei elongation, and expression of neural-specific markers. The polystyrene nano Petri dishes containing NP substrates were fabricated by a nano injection molding process using a nickel electroformed nano-mold insert (Diameter: 200 nm. Depth of pore: 500 nm. Center-to-center distance: 500 nm). Cytoskeleton and filopodia structures were observed by scanning electron microscopy and F-actin staining, while cell adhesion was tested by vinculin staining after 24 and 48 h of seeding. Expression of neural specific markers was examined by real-time quantitative polymerase chain reaction and immunocytochemistry. Results showed that NP substrates lead to greater substrate-cell adhesion, filopodia growth, nuclei elongation, and expression of neural specific markers compared to flat substrates. These results not only show the advantages of NP substrates, but they also suggest that further study into cell-substrate interactions may yield great benefits for biomaterial engineering.
Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.
Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison
2008-03-01
Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.
1-Million droplet array with wide-field fluorescence imaging for digital PCR.
Hatch, Andrew C; Fisher, Jeffrey S; Tovar, Armando R; Hsieh, Albert T; Lin, Robert; Pentoney, Stephen L; Yang, David L; Lee, Abraham P
2011-11-21
Digital droplet reactors are useful as chemical and biological containers to discretize reagents into picolitre or nanolitre volumes for analysis of single cells, organisms, or molecules. However, most DNA based assays require processing of samples on the order of tens of microlitres and contain as few as one to as many as millions of fragments to be detected. Presented in this work is a droplet microfluidic platform and fluorescence imaging setup designed to better meet the needs of the high-throughput and high-dynamic-range by integrating multiple high-throughput droplet processing schemes on the chip. The design is capable of generating over 1-million, monodisperse, 50 picolitre droplets in 2-7 minutes that then self-assemble into high density 3-dimensional sphere packing configurations in a large viewing chamber for visualization and analysis. This device then undergoes on-chip polymerase chain reaction (PCR) amplification and fluorescence detection to digitally quantify the sample's nucleic acid contents. Wide-field fluorescence images are captured using a low cost 21-megapixel digital camera and macro-lens with an 8-12 cm(2) field-of-view at 1× to 0.85× magnification, respectively. We demonstrate both end-point and real-time imaging ability to perform on-chip quantitative digital PCR analysis of the entire droplet array. Compared to previous work, this highly integrated design yields a 100-fold increase in the number of on-chip digitized reactors with simultaneous fluorescence imaging for digital PCR based assays.
High-performance single cell genetic analysis using microfluidic emulsion generator arrays.
Zeng, Yong; Novak, Richard; Shuga, Joe; Smith, Martyn T; Mathies, Richard A
2010-04-15
High-throughput genetic and phenotypic analysis at the single cell level is critical to advance our understanding of the molecular mechanisms underlying cellular function and dysfunction. Here we describe a high-performance single cell genetic analysis (SCGA) technique that combines high-throughput microfluidic emulsion generation with single cell multiplex polymerase chain reaction (PCR). Microfabricated emulsion generator array (MEGA) devices containing 4, 32, and 96 channels are developed to confer a flexible capability of generating up to 3.4 x 10(6) nanoliter-volume droplets per hour. Hybrid glass-polydimethylsiloxane diaphragm micropumps integrated into the MEGA chips afford uniform droplet formation, controlled generation frequency, and effective transportation and encapsulation of primer functionalized microbeads and cells. A multiplex single cell PCR method is developed to detect and quantify both wild type and mutant/pathogenic cells. In this method, microbeads functionalized with multiple forward primers targeting specific genes from different cell types are used for solid-phase PCR in droplets. Following PCR, the droplets are lysed and the beads are pooled and rapidly analyzed by multicolor flow cytometry. Using Escherichia coli bacterial cells as a model, we show that this technique enables digital detection of pathogenic E. coli O157 cells in a high background of normal K12 cells, with a detection limit on the order of 1/10(5). This result demonstrates that multiplex SCGA is a promising tool for high-throughput quantitative digital analysis of genetic variation in complex populations.
Altered serum microRNAs as biomarkers for the early diagnosis of pulmonary tuberculosis infection
2012-01-01
Background Pulmonary tuberculosis (TB) is a highly lethal infectious disease and early diagnosis of TB is critical for the control of disease progression. The objective of this study was to profile a panel of serum microRNAs (miRNAs) as potential biomarkers for the early diagnosis of pulmonary TB infection. Methods Using TaqMan Low-Density Array (TLDA) analysis followed by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) validation, expression levels of miRNAs in serum samples from 30 patients with active tuberculosis and 60 patients with Bordetella pertussis (BP), varicella-zoster virus (VZV) and enterovirus (EV) were analyzed. Results The Low-Density Array data showed that 97 miRNAs were differentially expressed in pulmonary TB patient sera compared with healthy controls (90 up-regulated and 7 down-regulated). Following qRT-PCR confirmation and receiver operational curve (ROC) analysis, three miRNAs (miR-361-5p, miR-889 and miR-576-3p) were shown to distinguish TB infected patients from healthy controls and other microbial infections with moderate sensitivity and specificity (area under curve (AUC) value range, 0.711-0.848). Multiple logistic regression analysis of a combination of these three miRNAs showed an enhanced ability to discriminate between these two groups with an AUC value of 0.863. Conclusions Our study suggests that altered levels of serum miRNAs have great potential to serve as non-invasive biomarkers for early detection of pulmonary TB infection. PMID:23272999
Encinas, Paloma; Rodriguez-Milla, Miguel A; Novoa, Beatriz; Estepa, Amparo; Figueras, Antonio; Coll, Julio
2010-09-27
Despite rhabdoviral infections being one of the best known fish diseases, the gene expression changes induced at the surface tissues after the natural route of infection (infection-by-immersion) have not been described yet. This work describes the differential infected versus non-infected expression of proteins and immune-related transcripts in fins and organs of zebrafish Danio rerio shortly after infection-by-immersion with viral haemorrhagic septicemia virus (VHSV). Two-dimensional differential gel electrophoresis detected variations on the protein levels of the enzymes of the glycolytic pathway and cytoskeleton components but it detected very few immune-related proteins. Differential expression of immune-related gene transcripts estimated by quantitative polymerase chain reaction arrays and hybridization to oligo microarrays showed that while more transcripts increased in fins than in organs (spleen, head kidney and liver), more transcripts decreased in organs than in fins. Increased differential transcript levels in fins detected by both arrays corresponded to previously described infection-related genes such as complement components (c3b, c8 and c9) or class I histocompatibility antigens (mhc1) and to newly described genes such as secreted immunoglobulin domain (sid4), macrophage stimulating factor (mst1) and a cluster differentiation antigen (cd36). The genes described would contribute to the knowledge of the earliest molecular events occurring in the fish surfaces at the beginning of natural rhabdoviral infections and/or might be new candidates to be tested as adjuvants for fish vaccines.
Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins
NASA Astrophysics Data System (ADS)
Poshtiban, Somayyeh
Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.
Tsai, Pei-Chien; Breen, Matthew
2012-09-01
To identify suitable reference genes for normalization of real-time quantitative PCR (RT-qPCR) assay data for common tumors of dogs. Malignant lymph node (n = 8), appendicular osteosarcoma (9), and histiocytic sarcoma (12) samples and control samples of various nonneoplastic canine tissues. Array-based comparative genomic hybridization (aCGH) data were used to guide selection of 9 candidate reference genes. Expression stability of candidate reference genes and 4 commonly used reference genes was determined for tumor samples with RT-qPCR assays and 3 software programs. LOC611555 was the candidate reference gene with the highest expression stability among the 3 tumor types. Of the commonly used reference genes, expression stability of HPRT was high in histiocytic sarcoma samples, and expression stability of Ubi and RPL32 was high in osteosarcoma samples. Some of the candidate reference genes had higher expression stability than did the commonly used reference genes. Data for constitutively expressed genes with high expression stability are required for normalization of RT-qPCR assay results. Without such data, accurate quantification of gene expression in tumor tissue samples is difficult. Results of the present study indicated LOC611555 may be a useful RT-qPCR assay reference gene for multiple tissue types. Some commonly used reference genes may be suitable for normalization of gene expression data for tumors of dogs, such as lymphomas, osteosarcomas, or histiocytic sarcomas.
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
NASA Astrophysics Data System (ADS)
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
NASA Astrophysics Data System (ADS)
Price, R. A.; Benson, C.; Joyce, M. J.; Rodgers, K.
2004-08-01
We present the details of a new linear array dosimeter consisting of a chain of semiconductors mounted on an ultra-thin (50 /spl mu/m thick) flexible substrate and housed in an intracavitary catheter. The semiconductors, manufactured by NMRC Cork, have not been packaging and incorporate a passivation layer that allows them to be mounted on the substrate using flip-chip-bonding. This paper reports, for the first time, the construction of a multiple (ten) detector array suited to in vivo dosimetry in the rectum, esophagus and vagina during external beam radiotherapy, as well as being adaptable to in vivo dosimetry during brachytherapy and diagnostic radiology.
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki
2018-05-15
A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.
Chemical reactions directed Peptide self-assembly.
Rasale, Dnyaneshwar B; Das, Apurba K
2015-05-13
Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.
Chemical Reactions Directed Peptide Self-Assembly
Rasale, Dnyaneshwar B.; Das, Apurba K.
2015-01-01
Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603
Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus
Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.
2004-01-01
A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703
Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen
2014-02-21
In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.
He, Peng; He, Lin
2009-07-13
We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.
Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.
Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W
2007-04-01
Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.
Bridge, Julia A
2017-01-01
The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.
Reaction pathways of propene pyrolysis.
Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong
2010-05-01
The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Verma, Anand Mohan; Kishore, Nanda
2017-02-01
The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.
Developing the (d,p γ) reaction as a surrogate for (n, γ) in inverse kinematics
NASA Astrophysics Data System (ADS)
Lepailleur, Alexandre; Baugher, Travis; Cizewski, Jolie; Ratkiewicz, Andrew; Walter, David; Pain, Steven; Smith, Karl; Garland, Heather; Goddess Collaboration
2016-09-01
The r-process that proceeds via (n, γ) reactions on neutron-rich nuclei is responsible for the synthesis of about half of the elements heavier than iron. Because (n, γ) measurements on short-lived isotopes are not possible, the (d,p γ) reaction is being investigated as a surrogate for (n, γ). Of particular importance is validating a surrogate in inverse kinematics. Therefore, the 95Mo(d,p γ) reaction was measured in inverse kinematics with stable beams from ATLAS and CD2 targets. Reaction protons were measured in coincidence with gamma rays with GODDESS - Gammasphere ORRUBA: Dual Detectors for Experimental Structure Studies. The Oak Ridge Rutgers University Barrel Array (ORRUBA) of position-sensitive silicon strip detectors was augmented with annular arrays of segmented strip detectors at backward and forward angles, resulting in a high-angular coverage for light ejectiles. Preliminary results from the 95Mo(d,p γ) study will be presented. This work was supported in part by the U.S. Department of Energy and National Science Foundation.
Oil-encapsulated nanodroplet array for bio-molecular detection.
Qiao, Wen; Zhang, Tiantian; Yen, Tony; Ku, Ti-Hsuan; Song, Junlan; Lian, Ian; Lo, Yu-Hwa
2014-09-01
Detection of low abundance biomolecules is challenging for biosensors that rely on surface chemical reactions. For surface reaction based biosensors, it require to take hours or even days for biomolecules of diffusivities in the order of 10(-10-11) m2/s to reach the surface of the sensors by Brownian motion. In addition, often times the repelling Coulomb interactions between the molecules and the probes further defer the binding process, leading to undesirably long detection time for applications such as point-of-care in vitro diagnosis. In this work, we designed an oil encapsulated nanodroplet array microchip utilizing evaporation for pre-concentration of the targets to greatly shorten the reaction time and enhance the detection sensitivity. The evaporation process of the droplets is facilitated by the superhydrophilic surface and resulting nanodroplets are encapsulated by oil drops to form stable reaction chamber. Using this method, desirable droplet volumes, concentrations of target molecules, and reaction conditions (salt concentrations, reaction temperature, etc.) in favour of fast and sensitive detection are obtained. A linear response over 2 orders of magnitude in target concentration was achieved at 10 fM for protein targets and 100 fM for miRNA mimic oligonucleotides.
2008-09-01
HF facilities such as HAARP in Alaska, EISCAT in Norway, and Arecibo in Puerto Rico; (3) the chain of high latitude SuperDARN radars used for auroral...DF arrays, ground HF transmitters such as the Navy relocatable over the horizon radar (ROTHR) and the Air Force/Navy HAARP system would be employed...United States and Australia; (2) high power HF facilities such as HAARP in Alaska, EISCAT in Norway, and Arecibo in Puerto Rico; (3) the chain of high
CAKE: the coincidence array for K600 experiments
NASA Astrophysics Data System (ADS)
Adsley, P.; Neveling, R.; Papka, P.; Dyers, Z.; Brümmer, J. W.; Diget, C. Aa.; Hubbard, N. J.; Li, K. C. W.; Long, A.; Marin-Lambarri, D. J.; Pellegri, L.; Pesudo, V.; Pool, L. C.; Smit, F. D.; Triambak, S.
2017-02-01
The combination of a magnetic spectrometer and ancillary detectors such as silicon detectors is a powerful tool for the study of nuclear reactions and nuclear structure. This paper discusses the recently commissioned silicon array called the "CAKE" which is designed for use with the K600 magnetic spectrometer at iThemba LABS.
Hollow Nanospheres Array Fabrication via Nano-Conglutination Technology.
Zhang, Man; Deng, Qiling; Xia, Liangping; Shi, Lifang; Cao, Axiu; Pang, Hui; Hu, Song
2015-09-01
Hollow nanospheres array is a special nanostructure with great applications in photonics, electronics and biochemistry. The nanofabrication technique with high resolution is crucial to nanosciences and nano-technology. This paper presents a novel nonconventional nano-conglutination technology combining polystyrenes spheres (PSs) self-assembly, conglutination and a lift-off process to fabricate the hollow nanospheres array with nanoholes. A self-assembly monolayer of PSs was stuck off from the quartz wafer by the thiol-ene adhesive material, and then the PSs was removed via a lift-off process and the hollow nanospheres embedded into the thiol-ene substrate was obtained. Thiolene polymer is a UV-curable material via "click chemistry" reaction at ambient conditions without the oxygen inhibition, which has excellent chemical and physical properties to be attractive as the adhesive material in nano-conglutination technology. Using the technique, a hollow nanospheres array with the nanoholes at the diameter of 200 nm embedded into the rigid thiol-ene substrate was fabricated, which has great potential to serve as a reaction container, catalyst and surface enhanced Raman scattering substrate.
Pokhrel, Ankit; Samad, Leith; Meng, Fei; Jin, Song
2015-11-07
In order to utilize nanostructured materials for potential solar and other energy-harvesting applications, scalable synthetic techniques for these materials must be developed. Herein we use a vapor phase conversion approach to synthesize nanowire (NW) arrays of semiconducting barium silicide (BaSi2) in high yield for the first time for potential solar applications. Dense arrays of silicon NWs obtained by metal-assisted chemical etching were converted to single-crystalline BaSi2 NW arrays by reacting with Ba vapor at about 930 °C. Structural characterization by X-ray diffraction and high-resolution transmission electron microscopy confirm that the converted NWs are single-crystalline BaSi2. The optimal conversion reaction conditions allow the phase-pure synthesis of BaSi2 NWs that maintain the original NW morphology, and tuning the reaction parameters led to a controllable synthesis of BaSi2 films on silicon substrates. The optical bandgap and electrochemical measurements of these BaSi2 NWs reveal a bandgap and carrier concentrations comparable to previously reported values for BaSi2 thin films.
Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko
2013-05-01
Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Kinetics of the Br2-CH3CHO Photochemical Chain Reaction
NASA Technical Reports Server (NTRS)
Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.
1997-01-01
Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).
Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime
2014-01-01
ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331
Comparing the locking threshold for rings and chains of oscillators.
Ottino-Löffler, Bertrand; Strogatz, Steven H
2016-12-01
We present a case study of how topology can affect synchronization. Specifically, we consider arrays of phase oscillators coupled in a ring or a chain topology. Each ring is perfectly matched to a chain with the same initial conditions and the same random natural frequencies. The only difference is their boundary conditions: periodic for a ring and open for a chain. For both topologies, stable phase-locked states exist if and only if the spread or "width" of the natural frequencies is smaller than a critical value called the locking threshold (which depends on the boundary conditions and the particular realization of the frequencies). The central question is whether a ring synchronizes more readily than a chain. We show that it usually does, but not always. Rigorous bounds are derived for the ratio between the locking thresholds of a ring and its matched chain, for a variant of the Kuramoto model that also includes a wider family of models.
Comparing the locking threshold for rings and chains of oscillators
NASA Astrophysics Data System (ADS)
Ottino-Löffler, Bertrand; Strogatz, Steven H.
2016-12-01
We present a case study of how topology can affect synchronization. Specifically, we consider arrays of phase oscillators coupled in a ring or a chain topology. Each ring is perfectly matched to a chain with the same initial conditions and the same random natural frequencies. The only difference is their boundary conditions: periodic for a ring and open for a chain. For both topologies, stable phase-locked states exist if and only if the spread or "width" of the natural frequencies is smaller than a critical value called the locking threshold (which depends on the boundary conditions and the particular realization of the frequencies). The central question is whether a ring synchronizes more readily than a chain. We show that it usually does, but not always. Rigorous bounds are derived for the ratio between the locking thresholds of a ring and its matched chain, for a variant of the Kuramoto model that also includes a wider family of models.
NASA Astrophysics Data System (ADS)
Oleksandrov, Sergiy; Kwon, Jung Ho; Lee, Ki-chang; Sujin-Ku; Paek, Mun Cheol
2014-09-01
This work introduces a novel chip to be used in the future as a simple and cost-effective method for creating DNA arrays using light emission diode (LED) photolithography. The DNA chip platform contains 24 independent reaction sites, which allows for the testing of a corresponding amount of patients' samples in hospital. An array of commercial UV LEDs and lens systems was combined with a microfluidic flow system to provide patterning of 24 individual reaction sites, each with 64 independent probes. Using the LED array instead of conventional laser exposure systems or micro-mirror systems significantly reduces the cost of equipment. The microfluidic system together with microfluidic flow cells drastically reduces the amount of used reagents, which is important due to the high cost of commercial reagents. The DNA synthesis efficiency was verified by fluorescence labeling and conventional hybridization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koglin, J. D.; Burke, J. T.; Fisher, S. E.
Here, the Direct Excitation Angular Tracking pHotovoltaic-Silicon Telescope ARray (DEATH-STAR) combines a series of 12 silicon detectors in a ΔE–E configuration for charged particle identification with a large-area array of 56 photovoltaic (solar) cells for detection of fission fragments. The combination of many scattering angles and fission fragment detectors allows for an angular-resolved tool to study reaction cross sections using the surrogate method, anisotropic fission distributions, and angular momentum transfers through stripping, transfer, inelastic scattering, and other direct nuclear reactions. The unique photovoltaic detectors efficiently detect fission fragments while being insensitive to light ions and have a timing resolution ofmore » 15.63±0.37 ns. Alpha particles are detected with a resolution of 35.5 keV 1σ at 7.9 MeV. Measured fission fragment angular distributions are also presented.« less
NASA Astrophysics Data System (ADS)
Koglin, J. D.; Burke, J. T.; Fisher, S. E.; Jovanovic, I.
2017-05-01
The Direct Excitation Angular Tracking pHotovoltaic-Silicon Telescope ARray (DEATH-STAR) combines a series of 12 silicon detectors in a ΔE - E configuration for charged particle identification with a large-area array of 56 photovoltaic (solar) cells for detection of fission fragments. The combination of many scattering angles and fission fragment detectors allows for an angular-resolved tool to study reaction cross sections using the surrogate method, anisotropic fission distributions, and angular momentum transfers through stripping, transfer, inelastic scattering, and other direct nuclear reactions. The unique photovoltaic detectors efficiently detect fission fragments while being insensitive to light ions and have a timing resolution of 15.63±0.37 ns. Alpha particles are detected with a resolution of 35.5 keV 1σ at 7.9 MeV. Measured fission fragment angular distributions are also presented.
Koglin, J. D.; Burke, J. T.; Fisher, S. E.; ...
2017-02-20
Here, the Direct Excitation Angular Tracking pHotovoltaic-Silicon Telescope ARray (DEATH-STAR) combines a series of 12 silicon detectors in a ΔE–E configuration for charged particle identification with a large-area array of 56 photovoltaic (solar) cells for detection of fission fragments. The combination of many scattering angles and fission fragment detectors allows for an angular-resolved tool to study reaction cross sections using the surrogate method, anisotropic fission distributions, and angular momentum transfers through stripping, transfer, inelastic scattering, and other direct nuclear reactions. The unique photovoltaic detectors efficiently detect fission fragments while being insensitive to light ions and have a timing resolution ofmore » 15.63±0.37 ns. Alpha particles are detected with a resolution of 35.5 keV 1σ at 7.9 MeV. Measured fission fragment angular distributions are also presented.« less
Jung, In-Keun; Park, Sang-Chul; Bin, Sung-Ah; Roh, Young Sup; Lee, John Hwan; Kim, Boo-Min
2016-03-01
The Maillard reaction has been well researched and used in the food industry and the fields of environmental science and organic chemistry. Here, we induced the Maillard reaction inside human hair and analyzed its effects by using Fourier transform infrared spectroscopy with a focal-plane array (FTIR-FPA) detector. We used arginine (A), glycine (G), and D-xylose (X) to generate the Maillard reaction by dissolving them in purified water and heating it to 150 °C. This label-free process generated a complex compound (named AGX after its ingredients) with a monomer structure, which was determined by using nuclear magnetic resonance (NMR) and FTIR-FPA. This compound was stable in hair and substantially increased its tensile strength. To our knowledge, we are the first to report the formation of this monomer in human hair, and our study provides insights into a new method that could be used to improve the condition of damaged or aging hair.
NASA Astrophysics Data System (ADS)
Zhang, G. X.; Hu, S. P.; Zhang, G. L.; Zhang, H. Q.; Yao, Y. J.; Huang, Z.; Wang, M. L.; Sun, H. B.; Valiente-Dobòn, J. J.; Testov, D.; Goasduff, A.; John, P. R.; Siciliano, M.; Galtarosa, F.; Francesco, R.; Mengoni, D.; Bazzacco, D.; Li, E. T.; Hao, X.
2018-05-01
Investigation of the breakup and transfer effect of weakly bound nuclei on the fusion process has been an interesting research topic in the past several years. In comparison with radioactive ion beam (RIB), the beam intensities of stable weakly bound nuclei such as 6,7Li and 9Be, which have significant breakup probability, are orders of magnitude higher. Precise fusion measurements induced by these nuclei have already been performed. However, the conclusion of reaction dynamics was not clear and has contradiction. In order to have a proper understanding of the influence of breakup and transfer of weakly bound projectiles on the fusion process, the 6Li+89Y experiment with incident energies of 22 MeV and 34 MeV was performed on Galileo array in combination with Si-ball EUCLIDES at Legnaro National Laboratory (LNL) in Italy. Using the coincidence by the charged particles and γ-rays, the different reaction channels can be clearly identified.
LIPID BIOMARKER CHARACTERIZATION OF BLOOM-RELATED DINOFLAGELLATES AND OTHER EUKARYOTIC ALGAE
Marine eukaryotic algae synthesize an array of lipids of chemotaxonomic utility that are potentially valuable in characterizing phytoplankton communities. Sterols and photopigments characteristic of dinoflagellates are rarely found in other algal classes. Long chain (C28) highly ...
Vincent-Chong, Vui King; Salahshourifar, Iman; Woo, Kar Mun; Anwar, Arif; Razali, Rozaimi; Gudimella, Ranganath; Rahman, Zainal Ariff Abdul; Ismail, Siti Mazlipah; Kallarakkal, Thomas George; Ramanathan, Anand; Wan Mustafa, Wan Mahadzir; Abraham, Mannil Thomas; Tay, Keng Kiong; Zain, Rosnah Binti
2017-01-01
Background Cancers of the oral cavity are primarily oral squamous cell carcinomas (OSCCs). Many of the OSCCs present at late stages with an exceptionally poor prognosis. A probable limitation in management of patients with OSCC lies in the insufficient knowledge pertaining to the linkage between copy number alterations in OSCC and oral tumourigenesis thereby resulting in an inability to deliver targeted therapy. Objectives The current study aimed to identify copy number alterations (CNAs) in OSCC using array comparative genomic hybridization (array CGH) and to correlate the CNAs with clinico-pathologic parameters and clinical outcomes. Materials and methods Using array CGH, genome-wide profiling was performed on 75 OSCCs. Selected genes that were harboured in the frequently amplified and deleted regions were validated using quantitative polymerase chain reaction (qPCR). Thereafter, pathway and network functional analysis were carried out using Ingenuity Pathway Analysis (IPA) software. Results Multiple chromosomal regions including 3q, 5p, 7p, 8q, 9p, 10p, 11q were frequently amplified, while 3p and 8p chromosomal regions were frequently deleted. These findings were in confirmation with our previous study using ultra-dense array CGH. In addition, amplification of 8q, 11q, 7p and 9p and deletion of 8p chromosomal regions showed a significant correlation with clinico-pathologic parameters such as the size of the tumour, metastatic lymph nodes and pathological staging. Co-amplification of 7p, 8q, 9p and 11q regions that harbored amplified genes namely CCND1, EGFR, TPM2 and LRP12 respectively, when combined, continues to be an independent prognostic factor in OSCC. Conclusion Amplification of 3q, 5p, 7p, 8q, 9p, 10p, 11q and deletion of 3p and 8p chromosomal regions were recurrent among OSCC patients. Co-alteration of 7p, 8q, 9p and 11q was found to be associated with clinico-pathologic parameters and poor survival. These regions contain genes that play critical roles in tumourigenesis pathways. PMID:28384287
Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M
2016-10-02
Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic diagnosis rate of the patients with unexplained ID or DD. Combined use of these technologies can serve as a useful examinational method in assisting differential diagnosis of children with unexplained ID or DD.
Free-standing bimetallic nanorings and nanoring arrays made by on-wire lithography.
Liusman, Cipto; Li, Shuzhou; Chen, Xiaodong; Wei, Wei; Zhang, Hua; Schatz, George C; Boey, Freddy; Mirkin, Chad A
2010-12-28
This paper describes a new strategy for synthesizing free-standing bimetallic nanorings and nanoring arrays based upon on-wire lithography and a galvanic replacement reaction. The strategy allows one to tune the diameter, length, and therefore aspect ratio of the nanorings. In addition, it can be used to produce arrays of nanorings in high yield with control over number and spacing. Spectroscopic studies and discrete dipole approximation calculations show that nanoring dimers exhibit greater surface enhanced Raman scattering than the analogous nanodisk dimers.
Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am
NASA Astrophysics Data System (ADS)
Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.
2016-09-01
Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.
NASA Astrophysics Data System (ADS)
Parro, Víctor; Fernández-Calvo, Patricia; Rodríguez Manfredi, José A.; Moreno-Paz, Mercedes; Rivas, Luis A.; García-Villadangos, Miriam; Bonaccorsi, Rosalba; González-Pastor, José Eduardo; Prieto-Ballesteros, Olga; Schuerger, Andrew C.; Davidson, Mark; Gómez-Elvira, Javier; Stoker, Carol R.
2008-10-01
A field prototype of an antibody array-based life-detector instrument, Signs Of LIfe Detector (SOLID2), has been tested in a Mars drilling mission simulation called MARTE (Mars Astrobiology Research and Technology Experiment). As one of the analytical instruments on the MARTE robotic drilling rig, SOLID2 performed automatic sample processing and analysis of ground core samples (0.5 g) with protein microarrays that contained 157 different antibodies. Core samples from different depths (down to 5.5 m) were analyzed, and positive reactions were obtained in antibodies raised against the Gram-negative bacterium Leptospirillum ferrooxidans, a species of the genus Acidithiobacillus (both common microorganisms in the Río Tinto area), and extracts from biofilms and other natural samples from the Río Tinto area. These positive reactions were absent when the samples were previously subjected to a high-temperature treatment, which indicates the biological origin and structural dependency of the antibody-antigen reactions. We conclude that an antibody array-based life-detector instrument like SOLID2 can detect complex biological material, and it should be considered as a potential analytical instrument for future planetary missions that search for life.
Parro, Víctor; Fernández-Calvo, Patricia; Rodríguez Manfredi, José A; Moreno-Paz, Mercedes; Rivas, Luis A; García-Villadangos, Miriam; Bonaccorsi, Rosalba; González-Pastor, José Eduardo; Prieto-Ballesteros, Olga; Schuerger, Andrew C; Davidson, Mark; Gómez-Elvira, Javier; Stoker, Carol R
2008-10-01
A field prototype of an antibody array-based life-detector instrument, Signs Of LIfe Detector (SOLID2), has been tested in a Mars drilling mission simulation called MARTE (Mars Astrobiology Research and Technology Experiment). As one of the analytical instruments on the MARTE robotic drilling rig, SOLID2 performed automatic sample processing and analysis of ground core samples (0.5 g) with protein microarrays that contained 157 different antibodies. Core samples from different depths (down to 5.5 m) were analyzed, and positive reactions were obtained in antibodies raised against the Gram-negative bacterium Leptospirillum ferrooxidans, a species of the genus Acidithiobacillus (both common microorganisms in the Río Tinto area), and extracts from biofilms and other natural samples from the Río Tinto area. These positive reactions were absent when the samples were previously subjected to a high-temperature treatment, which indicates the biological origin and structural dependency of the antibody-antigen reactions. We conclude that an antibody array-based life-detector instrument like SOLID2 can detect complex biological material, and it should be considered as a potential analytical instrument for future planetary missions that search for life.
X ray photoelectron spectroscopy (XPS) analysis of Photosensitive ZrO2 array
NASA Astrophysics Data System (ADS)
Li, Y.; Zhao, G.; Zhu, R.; Kou, Z.
2018-03-01
Based on organic zirconium source as the starting material, by adding chemical modifiers which are made up with photosensitive ZrO2 sol. A uniformed ZrO2 array dot was fabricated with a mean diameter of around 800 nm. By using UV-vis spectra and X-ray photoelectron spectroscopy analysis method, studies the photosensitive ZrO2 gel film of photochemical reaction process and the photosensitive mechanism, to determine the zirconium atom centered chelate structure, reaction formed by metal chelate Zr atom for the center, and to establish the molecular model of the chelate. And studied the ultraviolet light in the process of the variation of the XPS spectra, Zr3d5/2 to 184.9 eV corresponding to the binding energy of the as the combination of state peak gradually reduce; By combining with the status of Zr-O peak gradually increase; The strength of the peak is gradually decline. This suggests that in the process of ultraviolet light photo chemical reaction happened. This study is of great significance to the micro fabrication of ZrO2 array not only to the memory devices but also to the optical devices.
Ren, Zheng; Wu, Zili; Gao, Puxian; ...
2015-06-09
Low temperature propane oxidation has been achieved by Co 3O 4-based nano-array catalysts featuring low catalytic materials loading. The Ni doping into the Co 3O 4 lattice has led to enhanced reaction kinetics at low temperature by promoting the surface lattice oxygen activity. In situ DRIFTS investigation in tandem with isotopic oxygen exchange reveals that the propane oxidation proceeds via Mars-van Krevelen mechanism where surface lattice oxygen acts as the active site whereas O 2 in the reaction feed does not directly participate in CO 2 formation. The Ni doping promotes the formation of less stable carbonates on the surfacemore » to facilitate the CO 2 desorption. The thermal stability of Ni doped Co 3O 4 decreases with increased Ni concentration while catalytic activity increases. A balance between enhanced activity and compromised thermal stability shall be considered in the Ni doped Co 3O 4 nano-array catalysts for low temperature hydrocarbon oxidation. This study provides useful and timely guidance for rational catalyst design toward low temperature catalytic oxidation.« less
Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S
1999-09-01
Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.
Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services
Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji
2012-01-01
Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499
Array-scale performance of TES X-ray Calorimeters Suitable for Constellation-X
NASA Technical Reports Server (NTRS)
Kilbourne, C. A.; Bandler, S. R.; Brown, A. D.; Chervenak, J. A.; Eckart, M. E.; Finkbeiner, F. M.; Iyomoto, N.; Kelley, R. L.; Porter, F. S.; Smith, S. J.;
2008-01-01
Having developed a transition-edge-sensor (TES) calorimeter design that enables high spectral resolution in high fill-factor arrays, we now present array-scale results from 32-pixel arrays of identical closely packed TES pixels. Each pixel in such an array contains a Mo/Au bilayer with a transition temperature of 0.1 K and an electroplated Au or Au/Bi xray absorber. The pixels in an array have highly uniform physical characteristics and performance. The arrays are easy to operate due to the range of bias voltages and heatsink temperatures over which solution better than 3 eV at 6 keV can be obtained. Resolution better than 3 eV has also been obtained with 2x8 time-division SQUID multiplexing. We will present the detector characteristics and show spectra acquired through the read-out chain from the multiplexer electronics through the demultiplexer software to real-time signal processing. We are working towards demonstrating this performance over the range of count rates expected in the observing program of the Constellation-X observatory. We mill discuss the impact of increased counting rate on spectral resolution, including the effects of crosstalk and optimal-filtering dead time.
Ionizing radiation-induced destruction of benzene and dienes in aqueous media.
Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E
2006-05-01
Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.
Analog bus driver and multiplexer
NASA Technical Reports Server (NTRS)
Pain, Bedabrata (Inventor); Hancock, Bruce (Inventor); Cunningham, Thomas J. (Inventor)
2012-01-01
For a source-follower signal chain, the ohmic drop in the selection switch causes unacceptable voltage offset, non-linearity, and reduced small signal gain. For an op amp signal chain, the required bias current and the output noise rises rapidly with increasing the array format due to a rapid increase in the effective capacitance caused by the Miller effect boosting up the contribution of the bus capacitance. A new switched source-follower signal chain circuit overcomes limitations of existing op-amp based or source follower based circuits used in column multiplexers and data readout. This will improve performance of CMOS imagers, and focal plane read-out integrated circuits for detectors of infrared or ultraviolet light.
NASA Astrophysics Data System (ADS)
Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune
1990-05-01
There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.
Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.
Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W
2016-08-08
Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.
USDA-ARS?s Scientific Manuscript database
Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...
Observations by Mid-continent Magnetoseismic Chain (McMAC) and their use in space weather research
NASA Astrophysics Data System (ADS)
Chi, P. J.; McMac Team
The Mid-continent Magnetoseismic Chain McMAC consists of nine magnetometer stations that line up across the U S and Mexico along the 330th magnetic meridian These systems sample at 2 Hz and monitor the fluctuations of the geomagnetic field caused by space weather phenomena and they are always on the Internet to allow rapid access of data The McMAC stations can connect to the Fort Churchill Line of the CARISMA Array and two IGPP-LANL stations at the same longitude and form a long magnetometer chain that spans the L-value range from 1 3 to 11 7 the greatest latitudinal coverage in all meridians One of the main advantages of this magnetometer chain is its close separation between adjacent stations enabling the use of the gradient technique to identify field line resonance FLR frequencies and to further estimate the plasma mass density in the magnetosphere The observations of FLR and the derived density can always be collected in the daytime and occasionally in the nighttime as well In this paper we present the observations by the newly completed McMAC and jointly by the CARISMA and IGPP-LANL Arrays The observed plasma density and its wide coverage in L-value can benefit space weather studies such as on magnetosphere-ionosphere coupling and on the wave-particle interaction for modeling the radiation belts Also discussed are other applications of the McMAC observations in space weather research including possible joint observations with satellite missions
NASA Astrophysics Data System (ADS)
Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun
2010-06-01
We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.
Ishiuchi, Yuri; Sato, Hitoshi; Tsujimura, Kazuki; Kawaguchi, Hideo; Matsuwaki, Takashi; Yamanouchi, Keitaro; Nishihara, Masugi; Nedachi, Taku
2018-01-01
Accumulating evidence indicates that skeletal muscle secrets proteins referred to as myokines and that exercise contributes to their regulation. In this study, we propose that chemokine (C-X-C motif) ligand 10 (CXCL10) functions as a novel myokine. Initially, we stimulated differentiated C2C12 myotubes with or without electrical pulse stimulation (EPS) to identify novel myokines. Cytokine array analysis revealed that CXCL10 secretion was significantly reduced by EPS, which was further confirmed by enzyme-linked immunosorbent assay and quantitative polymerase chain reaction analysis. Treadmill experiments in mice identified significant reduction of Cxcl10 gene expression in the soleus muscle. Additionally, contraction-dependent p38 MAPK activation appeared to be involved in this reduction. Furthermore, C2C12 conditioned medium obtained after applying EPS could induce survival of MSS31, a vascular endothelial cell model, which was partially attenuated by the addition of recombinant CXCL10. Overall, our findings suggest CXCL10 as a novel exercise-reducible myokine, to control endothelial cell viability.
Rodrigues, Simone M; Soares, Virgínia L F; de Oliveira, Tahise M; Gesteira, Abelmon S; Otoni, Wagner C; Costa, Marcio G C
2007-11-01
The tropical plant Bixa orellana L. (annatto) produces an array of natural products, including the pigment bixin used in the food and cosmetics industries. In order to understand the biochemical and molecular basis of the biosynthesis of these natural products, a reliable method for isolating high yields of high-quality RNA is required. Here we described a successful and reproducible method for isolation and purification of high-quantity and high-quality RNA from different tissues of annatto. This protocol overcomes the usual problems associated with large amounts of polyphenols, polysaccharides, pigments, and other secondary metabolites that are not easily removed by conventional extraction procedures. Furthermore, the proposed protocol can be easily carried out in any laboratory and it could also be extended to isolate RNA from other plant species showing similar abundance of compounds that interfere with RNA extractions. The yield and quality of the RNA were monitored by spectrophotometric analysis, separation on agarose gel, Reverse Transcription-Polymerase Chain Reaction (RT-PCR), and construction of a cDNA library.
High-speed RNA microextraction technology using magnetic oligo-dT beads and lateral magnetophoresis.
Lee, Hwanyong; Jung, Jinhee; Han, Song-I; Han, Ki-Ho
2010-10-21
This paper presents a high-speed RNA microextractor for the direct isolation of RNA from peripheral blood lysate using magnetic oligo-dT beads. The extraction is achieved through lateral magnetophoresis, generated by a ferromagnetic wire array inlaid on a glass substrate. This RNA microextractor separated more than 80% of magnetic beads with a flow rate up to 20 ml h(-1), and the overall extraction procedure was completed within 1 min. The absorbance ratio of RNA to protein (A(260)/A(280)) was >1.7, indicating that the extraction technology yielded nearly pure RNA. The feasibility of this technique was evaluated further for its applicability to reverse transcription polymerase chain reaction (RT-PCR) procedures by performing cDNA synthesis and PCR. The analysis verified that the RNA microextractor is a practical method for easy, rapid, and high-precision RT-PCR using minimal reagent volumes without requiring highly trained personnel. In addition, it can be readily incorporated into genetic analysis procedures for realizing automated on-chip genetic platforms in a micro format.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tschaplinski, Timothy J; Tsai, Chung-Jui; Harding, Scott A
Salicin-based phenolic glycosides, hydroxycinnamate derivatives and flavonoid-derived condensed tannins comprise up to one-third of Populus leaf dry mass. Genes regulating the abundance and chemical diversity of these substances have not been comprehensively analysed in tree species exhibiting this metabolically demanding level of phenolic metabolism. Here, shikimate-phenylpropanoid pathway genes thought to give rise to these phenolic products were annotated from the Populus genome, their expression assessed by semiquantitative or quantitative reverse transcription polymerase chain reaction (PCR), and metabolic evidence for function presented. Unlike Arabidopsis, Populus leaves accumulate an array of hydroxycinnamoyl-quinate esters, which is consistent with broadened function of the expandedmore » hydroxycinnamoyl-CoA transferase gene family. Greater flavonoid pathway diversity is also represented, and flavonoid gene families are larger. Consistent with expanded pathway function, most of these genes were upregulated during wound-stimulated condensed tannin synthesis in leaves. The suite of Populus genes regulating phenylpropanoid product accumulation should have important application in managing phenolic carbon pools in relation to climate change and global carbon cycling.« less
In vitro and in vivo anti-cancer activity of silymarin on oral cancer.
Won, Dong-Hoon; Kim, Lee-Han; Jang, Boonsil; Yang, In-Hyoung; Kwon, Hye-Jeong; Jin, Bohwan; Oh, Seung Hyun; Kang, Ju-Hee; Hong, Seong-Doo; Shin, Ji-Ae; Cho, Sung-Dae
2018-05-01
Silymarin, a standardized extract from milk thistle fruits has been found to exhibit anti-cancer effects against various cancers. Here, we explored the anti-cancer activity of silymarin and its molecular target in human oral cancer in vitro and in vivo. Silymarin dose-dependently inhibited the proliferation of HSC-4 oral cancer cells and promoted caspase-dependent apoptosis. A human apoptosis protein array kit showed that death receptor 5 may be involved in silymarin-induced apoptosis, which was also shown through western blotting, immunocytochemistry, and reverse transcription-polymerase chain reaction. Silymarin increased cleaved caspase-8 and truncated Bid, leading to accumulation of cytochrome c. In addition, silymarin activated death receptor 5/caspase-8 to induce apoptotic cell death in two other oral cancer cell lines (YD15 and Ca9.22). Silymarin also suppressed tumor growth and volume without any hepatic or renal toxicity in vivo. Taken together, these results provide in vitro and in vivo evidence supporting the anti-cancer effect of silymarin and death receptor 5, and caspase-8 may be essential players in silymarin-mediated apoptosis in oral cancer.
Chomiski, Verônica; Gragnani, Alfredo; Bonucci, Jéssica; Correa, Silvana Aparecida Alves; Noronha, Samuel Marcos Ribeiro de; Ferreira, Lydia Masako
2016-08-01
To evaluate the effect of keratinocyte growth factor (KGF) treatment on the expression of wound-healing-related genes in cultured keratinocytes from burn patients. Keratinocytes were cultured and divided into 4 groups (n=4 in each group): TKB (KGF-treated keratinocytes from burn patients), UKB (untreated keratinocytes from burn patients), TKC (KGF-treated keratinocytes from controls), and UKC (untreated keratinocytes from controls). Gene expression analysis using quantitative polymerase chain reaction (qPCR) array was performed to compare (1) TKC versus UKC, (2) UKB versus UKC, (3) TKB versus UKC, (4) TKB versus UKB, (5) TKB versus TKC, and (6) UKB versus TKC. Comparison 1 showed one down-regulated and one up-regulated gene; comparisons 2 and 3 resulted in the same five down-regulated genes; comparison 4 had no significant difference in relative gene expression; comparison 5 showed 26 down-regulated and 7 up-regulated genes; and comparison 6 showed 25 down-regulated and 11 up-regulated genes. There was no differential expression of wound-healing-related genes in cultured primary keratinocytes from burn patients treated with keratinocyte growth factor.
Stress-induced rearrangement of Fusarium retrotransposon sequences.
Anaya, N; Roncero, M I
1996-11-27
Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.
Conformational Study of Dibenzyl Ether
NASA Astrophysics Data System (ADS)
Hernandez-Castillo, Alicia O.; Abeysekera, Chamara; Hewett, Daniel M.; Zwier, Timothy S.
2017-06-01
Understanding the initial stages of polycyclic aromatic hydrocarbon (PAH) aggregation, the onset of soot formation, is an important goal on the pathway to cleaner combustion processes. PAHs with short alkyl chains, present in fuel-rich combustion environments, can undergo reactions that will chemically link aromatic rings together. One such example of a linked diaryl compound is dibenzyl ether, C_{6}H_{5}-CH_{2}-O-CH_{2}-C_{6}H_{5}. The -CH_{2}-O-CH_{2}- linkage has a length and flexibility well-suited to forming a π-stacked conformation between the two phenyl rings. In this talk, we will explore the single-conformation spectroscopy of dibenzyl ether under jet-cooled conditions in the gas phase. Laser-induced fluorescence, chirped pulse Fourier transform microwave (8-18 GHz region), and single-conformation infrared spectroscopy in the alkyl CH stretch region were all carried out on the molecule, thereby interrogating its full array of electronic, vibrational and rotational degrees of freedom. This work is the first step in a broader study to determine the extent of π-stacking in linked aryl compounds as a function of linkage and PAH size.
Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1
Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D
2010-01-01
Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650
Nucleic acid in-situ hybridization detection of infectious agents
NASA Astrophysics Data System (ADS)
Thompson, Curtis T.
2000-04-01
Limitations of traditional culture methods and newer polymerase chain reaction (PCR)-based methods for detection and speciation of infectious agents demonstrate the need for more rapid and better diagnostics. Nucleic acid hybridization is a detection technology that has gained wide acceptance in cancer and prenatal cytogenetics. Using a modification of the nucleic acid hybridization technique known as fluorescence in-situ hybridization, infectious agents can be detected in a variety of specimens with high sensitivity and specificity. The specimens derive from all types of human and animal sources including body fluids, tissue aspirates and biopsy material. Nucleic acid hybridization can be performed in less than one hour. The result can be interpreted either using traditional fluorescence microscopy or automated platforms such as micro arrays. This paper demonstrates proof of concept for nucleic acid hybridization detection of different infectious agents. Interpretation within a cytologic and histologic context is possible with fluorescence microscopic analysis, thereby providing confirmatory evidence of hybridization. With careful probe selection, nucleic acid hybridization promises to be a highly sensitive and specific practical diagnostic alternative to culture, traditional staining methods, immunohistochemistry and complicated nucleic acid amplification tests.
Bhanjadeo, Madhabi M.; Rath, Kalyani; Gupta, Dhirendra; Pradhan, Nilotpala; Biswal, Surendra K.; Mishra, Barada K.
2018-01-01
Since the sulfur specific cleavage is vital for the organic sulfur removal from fossil fuel, we explored potential bacterial strains of MTCC (Microbial Type Culture Collection) to desulfurize the Dibenzothiophene (DBT) through C-S bond cleavage (4-S pathway). MTCC strains Rhodococcus rhodochrous (3552), Arthrobacter sulfureus (3332), Gordonia rubropertincta (289), and Rhodococcus erythropolis (3951) capable of growing in 0.5 mM DBT were examined for their desulfurization ability. The presence of dsz genes as well as the metabolites was screened by polymerase chain reaction (PCR) and HPLC, respectively. All these strains showed > 99% DBT desulfurization with 10 days of incubation in minimal salt medium. From the HPLC analysis it was further revealed that these MTCC strains show differences in the end metabolites and desulfurize DBT differently following a variation in the regular 4-S pathway. These findings are also well corroborating with their respective organization of dszABC operons and their relative abundance. The above MTCC strains are capable of desulfurizing DBT efficiently and hence can be explored for biodesulfurization of petrochemicals and coal with an eco-friendly and energy economical process. PMID:29518089
Patel, Jaymin C; George, Josiah; Vuong, Jeni; Potts, Caelin C; Bozio, Catherine; Clark, Thomas A; Thomas, Jerry; Schier, Joshua; Chang, Arthur; Waller, Jessica L; Diaz, Maureen H; Whaley, Melissa; Jenkins, Laurel T; Fuller, Serena; Williams, Desmond E; Redd, John T; Arthur, Ray R; Taweh, Fahn; Vera Walker, Yatta; Hardy, Patrick; Freeman, Maxwell; Katawera, Victoria; Gwesa, Gulu; Gbanya, Miatta Z; Clement, Peter; Kohar, Henry; Stone, Mardia; Fallah, Mosoka; Nyenswah, Tolbert; Winchell, Jonas M; Wang, Xin; McNamara, Lucy A; Dokubo, E Kainne; Fox, LeAnne M
2017-10-27
On April 25, 2017, a cluster of unexplained illness and deaths among persons who had attended a funeral during April 21-22 was reported in Sinoe County, Liberia (1). Using a broad initial case definition, 31 cases were identified, including 13 (42%) deaths. Twenty-seven cases were from Sinoe County (1), and two cases each were from Grand Bassa and Monsterrado counties, respectively. On May 5, 2017, initial multipathogen testing of specimens from four fatal cases using the Taqman Array Card (TAC) assay identified Neisseria meningitidis in all specimens. Subsequent testing using direct real-time polymerase chain reaction (PCR) confirmed N. meningitidis in 14 (58%) of 24 patients with available specimens and identified N. meningitidis serogroup C (NmC) in 13 (54%) patients. N. meningitidis was detected in specimens from 11 of the 13 patients who died; no specimens were available from the other two fatal cases. On May 16, 2017, the National Public Health Institute of Liberia and the Ministry of Health of Liberia issued a press release confirming serogroup C meningococcal disease as the cause of this outbreak in Liberia.
Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.
Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri
2016-09-01
Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi
2008-03-01
Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.
Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation
NASA Astrophysics Data System (ADS)
Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki
2017-06-01
A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.
Fast and automated DNA assays on a compact disc (CD)-based microfluidic platform
NASA Astrophysics Data System (ADS)
Jia, Guangyao
Nucleic acid-based molecular diagnostics offers enormous potential for the rapid and accurate diagnosis of infectious diseases. However, most of the existing commercial tests are time-consuming and technically complicated, and are thus incompatible with the need for rapid identification of infectious agents. We have successfully developed a CD-based microfluidic platform for fast and automated DNA array hybridization and a low cost, disposable plastic microfluidic platform for polymerase chain reaction (PCR). These platforms have proved to be a promising approach to meet the requirements in terms of detection speed and operational convenience in diagnosis of infectious diseases. In the CD-based microfluidic platform for DNA hybridization, convection is introduced to the system to enhance mass transport so as to accelerate the hybridization rate since DNA hybridization is a diffusion limited reaction. Centrifugal force is utilized for sample propulsion and surface force is used for liquid gating. Standard microscope glass slides are used as the substrates for capture probes owing to their compatibility with commercially available instrumentation (e.g. laser scanners) for detection. Microfabricated polydimethylsiloxane (PDMS) structures are used to accomplish the fluidic functions required by the protocols for DNA hybridization. The assembly of the PDMS structure and the glass slide forms a flow-through hybridization unit that can be accommodated onto the CD platform for reagent manipulation. The above scheme has been validated with oligonucleotides as the targets using commercially available enzyme-labeled fluorescence (ELF 97) for detection of the hybridization events, and tested with amplicons of genomic staphylococcus DNA labeled with Cy dye. In both experiments, significantly higher fluorescence intensities were observed in the flow-through hybridization unit compared to the passive assays. The CD fluidic scheme was also adapted to the immobilization of thiolated oligonucleotides on gold surfaces and up to a 2.5 fold increase was observed for the rate of adsorption compared to passive immobilization. In order to reduce the reaction time for DNA amplification, a miniaturized fluidic platform was developed for rapid polymerase chain reaction (PCR). Commercially available, adhesive-coated aluminum foils and polypropylene films were laminated to structured polycarbonate films forming micro reactors in a card format. Ice valves were employed to seal the reaction chambers during thermal cycling and a Peltier-based thermal cycler was configured for rapid thermal cycling and ice valve actuation. Numerical modeling was conducted to optimize the design of the PCR reactor and explore the thermal gradient in the reaction chamber in the direction of sample depth. The PCR reactor was experimentally characterized by using thin foil thermocouples and validated by a successful amplification of 10 genome copies of E. coli ATCC 35401 tuf gene in 27 minutes. In the future, we will integrate sample preparation, PCR amplification and DNA detection into a single, centrifugal microfluidic disc that is practically affordable for molecular diagnostics.
Problem-Solving Test: Pyrosequencing
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2013-01-01
Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…
Hydrolysis of the amorphous cellulose in cotton-based paper.
Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E
2008-04-01
Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.
Dual phase multiplex polymerase chain reaction
Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL
2008-10-07
Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.
D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I
1993-01-01
The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.
NASA Astrophysics Data System (ADS)
Stebliy, Maxim; Ognev, Alexey; Samardak, Alexander; Chebotkevich, Ludmila; Verba, Roman; Melkov, Gennadiy; Tiberkevich, Vasil; Slavin, Andrei
2015-06-01
Magnetization reversal in finite chains and square arrays of closely packed cylindrical magnetic dots, having vortex ground state in the absence of the external bias field, has been studied experimentally by measuring static hysteresis loops, and also analyzed theoretically. It has been shown that the field Bn of a vortex nucleation in a dot as a function of the finite number N of dots in the array's side may exhibit a monotonic or an oscillatory behavior depending on the array geometry and the direction of the external bias magnetic field. The oscillations in the dependence Bn(N) are shown to be caused by the quantization of the collective soft spin wave mode, which corresponds to the vortex nucleation in a finite array of dots. These oscillations are directly related to the form and symmetry of the dispersion law of the soft SW mode: the oscillation could appear only if the minimum of the soft mode spectrum is not located at any of the symmetric points inside the first Brillouin zone of the array's lattice. Thus, the purely static measurements of the hysteresis loops in finite arrays of coupled magnetic dots can yield important information about the properties of the collective spin wave excitations in these arrays.
Non-volatile copolymer compositions for fabricating gel element microarrays
Golova, Julia B.; Chernov, Boris K.; Perov, Alexander N.; Reynolds, Jennifer; Linger, Yvonne L.; Kukhtin, Alexander; Chandler, Darrell P.
2011-01-01
By modifying polymer compositions and cross-linking reagents, we have developed a simple yet effective manufacturing strategy for copolymerized three-dimensional gel element arrays. A new gel-forming monomer (2-(hydroxyethyl) methacrylamide; HEMAA) was used that possesses low volatility and improves the stability of copolymerized gel element arrays to on-chip thermal cycling procedures relative to previously used monomers. Probe immobilization efficiency within the new polymer was 55%, equivalent to that obtained with acrylamide (AA) and methacrylamide (MA) monomers. Non-specific binding of single stranded targets was equivalent for all monomers. Increasing cross-linker chain length improved hybridization kinetics and end-point signal intensities relative to N,N-methylenebisacrylamide (Bis). The new copolymer formulation was successfully applied to a model orthopox array. Because HEMAA greatly simplifies gel element array manufacture, we expect it (in combination with new cross-linkers described herein) to find widespread application in microarray science. PMID:22033291
Tsai, David; John, Esha; Chari, Tarun; Yuste, Rafael; Shepard, Kenneth
2015-01-01
We present a system for large-scale electrophysiological recording and stimulation of neural tissue with a planar topology. The recording system has 65,536 electrodes arranged in a 256 × 256 grid, with 25.5 μm pitch, and covering an area approximately 42.6 mm(2). The recording chain has 8.66 μV rms input-referred noise over a 100 ~ 10k Hz bandwidth while providing up to 66 dB of voltage gain. When recording from all electrodes in the array, it is capable of 10-kHz sampling per electrode. All electrodes can also perform patterned electrical microstimulation. The system produces ~ 1 GB/s of data when recording from the full array. To handle, store, and perform nearly real-time analyses of this large data stream, we developed a framework based around Xilinx FPGAs, Intel x86 CPUs and the NVIDIA Streaming Multiprocessors to interface with the electrode array.
Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A
2002-02-28
The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.