Sample records for chain reaction based

  1. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  2. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  3. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  4. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  5. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  6. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  7. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  8. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  9. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  10. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  11. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  12. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  13. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  14. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  15. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  16. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  17. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  19. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  20. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  1. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  2. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  3. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  4. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  5. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  6. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  7. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  8. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  10. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  11. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  12. Hydrolysis of the amorphous cellulose in cotton-based paper.

    PubMed

    Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

    2008-04-01

    Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

  13. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  14. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  15. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  16. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  17. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  18. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  19. RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schramm, V.L.

    1996-05-01

    The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

  20. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  1. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  2. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  3. Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

    PubMed

    Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

    2017-03-01

    The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

  4. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  5. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  6. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  7. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  8. Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

    PubMed Central

    Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

    2014-01-01

    A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

  9. Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

    NASA Astrophysics Data System (ADS)

    Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

    2016-03-01

    Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the `reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed `reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams.

  10. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  11. Chemical reactions directed Peptide self-assembly.

    PubMed

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  12. Chemical Reactions Directed Peptide Self-Assembly

    PubMed Central

    Rasale, Dnyaneshwar B.; Das, Apurba K.

    2015-01-01

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

  13. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  14. On fundamental quality of fission chain reaction to oppose rapid runaways of nuclear reactors

    NASA Astrophysics Data System (ADS)

    Kulikov, G. G.; Shmelev, A. N.; Apse, V. A.; Kulikov, E. G.

    2017-01-01

    It has been shown that the in-hour equation characterizes the barriers and resistibility of fission chain reaction (FCR) against rapid runaways in nuclear reactors. Traditionally, nuclear reactors are characterized by the presence of barriers based on delayed and prompt neutrons. A new barrier based on the reflector neutrons that can occur when the fast reactor core is surrounded by a weakly absorbing neutron reflector with heavy atomic weight was proposed. It has been shown that the safety of this fast reactor is substantially improved, and considerable elongation of prompt neutron lifetime "devalues" the role of delayed neutron fraction as the maximum permissible reactivity for the reactor safety.

  15. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  16. DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

    NASA Astrophysics Data System (ADS)

    Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

    2017-06-01

    The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

  17. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  18. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  19. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  20. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  1. In Situ Solid-State Reactions Monitored by X-ray Absorption Spectroscopy: Temperature-Induced Proton Transfer Leads to Chemical Shifts.

    PubMed

    Stevens, Joanna S; Walczak, Monika; Jaye, Cherno; Fischer, Daniel A

    2016-10-24

    The dramatic colour and phase alteration with the solid-state, temperature-dependent reaction between squaric acid and 4,4'-bipyridine has been probed in situ with X-ray absorption spectroscopy. The electronic and chemical sensitivity to the local atomic environment through chemical shifts in the near-edge X-ray absorption fine structure (NEXAFS) revealed proton transfer from the acid to the bipyridine base through the change in nitrogen protonation state in the high-temperature form. Direct detection of proton transfer coupled with structural analysis elucidates the nature of the solid-state process, with intermolecular proton transfer occurring along an acid-base chain followed by a domino effect to the subsequent acid-base chains, leading to the rapid migration along the length of the crystal. NEXAFS thereby conveys the ability to monitor the nature of solid-state chemical reactions in situ, without the need for a priori information or long-range order. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Apparatus and method for polymer synthesis using arrays

    DOEpatents

    Brennan, Thomas M.

    1995-01-01

    A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

  3. Apparatus and method for polymer synthesis using arrays

    DOEpatents

    Brennan, Thomas M.

    1996-01-01

    A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

  4. The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David

    Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

  5. The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes.

    PubMed

    Giovannitti, Alexander; Maria, Iuliana P; Hanifi, David; Donahue, Mary J; Bryant, Daniel; Barth, Katrina J; Makdah, Beatrice E; Savva, Achilleas; Moia, Davide; Zetek, Matyáš; Barnes, Piers R F; Reid, Obadiah G; Inal, Sahika; Rumbles, Garry; Malliaras, George G; Nelson, Jenny; Rivnay, Jonathan; McCulloch, Iain

    2018-05-08

    We report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performance in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.

  6. The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

    DOE PAGES

    Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David; ...

    2018-04-24

    Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

  7. Unraveling reaction pathways and specifying reaction kinetics for complex systems.

    PubMed

    Vinu, R; Broadbelt, Linda J

    2012-01-01

    Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

  8. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  9. Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

    PubMed Central

    Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

    2012-01-01

    Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

  10. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  11. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  12. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    PubMed

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

    NASA Astrophysics Data System (ADS)

    Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

    2017-06-01

    A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

  14. Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

    PubMed

    Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

    2013-08-22

    Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

  15. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  16. Molecular implementation of molecular shift register memories

    NASA Technical Reports Server (NTRS)

    Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

    1991-01-01

    An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

  17. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  18. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  19. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  20. SuFEx-Based Polysulfonate Formation from Ethenesulfonyl Fluoride-Amine Adducts

    DOE PAGES

    Wang, Hua; Zhou, Feng; Ren, Gerui; ...

    2017-05-18

    In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less

  1. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  2. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Hua; Zhou, Feng; Ren, Gerui

    In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less

  4. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  5. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  7. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  8. A multiple multicomponent approach to chimeric peptide-peptoid podands.

    PubMed

    Rivera, Daniel G; León, Fredy; Concepción, Odette; Morales, Fidel E; Wessjohann, Ludger A

    2013-05-10

    The success of multi-armed, peptide-based receptors in supramolecular chemistry traditionally is not only based on the sequence but equally on an appropriate positioning of various peptidic chains to create a multivalent array of binding elements. As a faster, more versatile and alternative access toward (pseudo)peptidic receptors, a new approach based on multiple Ugi four-component reactions (Ugi-4CR) is proposed as a means of simultaneously incorporating several binding and catalytic elements into organizing scaffolds. By employing α-amino acids either as the amino or acid components of the Ugi-4CRs, this multiple multicomponent process allows for the one-pot assembly of podands bearing chimeric peptide-peptoid chains as appended arms. Tripodal, bowl-shaped, and concave polyfunctional skeletons are employed as topologically varied platforms for positioning the multiple peptidic chains formed by Ugi-4CRs. In a similar approach, steroidal building blocks with several axially-oriented isocyano groups are synthesized and utilized to align the chimeric chains with conformational constrains, thus providing an alternative to the classical peptido-steroidal receptors. The branched and hybrid peptide-peptoid appendages allow new possibilities for both rational design and combinatorial production of synthetic receptors. The concept is also expandable to other multicomponent reactions. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Synthesis, Characterization and Application of Thermoresponsive Polyhydroxyalkanoate-graft-Poly(N-isopropylacrylamide).

    PubMed

    Ma, Yi-Ming; Wei, Dai-Xu; Yao, Hui; Wu, Lin-Ping; Chen, Guo-Qiang

    2016-08-08

    A thermoresponsive graft copolymer polyhydroxyalkanoate-g-poly(N-isopropylacrylamide) or short as PHA-g-PNIPAm, was successfully synthesized via a three-step reaction. First, PNIPAm oligomer with a trithiocarbonate-based chain transfer agent (CTA), short as PNIPAm-CTA, with designed polymerization degree was synthesized via reversible addition-fragmentation chain transfer (RAFT) polymerization. Subsequently, the PNIPAm-CTA was treated with n-butylamine for aminolysis in order to obtain a pendant thiol group at the end of the chain (PNIPAm-SH). Finally, the PNIPAm-SH was grafted onto unsaturated P(3HDD-co-3H10U), a random copolymer of 3-hydroxydodecanoate (3HDD) and 3-hydroxy-10-undecylenate (3H10U), via a thiol-ene click reaction. Enhanced hydrophilicity and thermoresponsive property of the resulted PHA-g-PNIPAm were confirmed by water contact angle studies. The biocompatibility of PHA-g-PNIPAm was comparable to poly-3-hydroxybutyrate (PHB). The graft copolymer PHA-g-PNIPAm based on biopolyester PHA could be a promising material for biomedical applications.

  10. Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

    PubMed

    Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

    2007-12-01

    Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

  11. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  12. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE PAGES

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  13. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  14. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  15. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  16. Bioinspired synthesis of pentalene-based chromophores from an oligoketone chain.

    PubMed

    Saito, Yuki; Higuchi, Masayuki; Yoshioka, Shota; Senboku, Hisanori; Inokuma, Yasuhide

    2018-04-24

    We report a bioinspired synthesis of 2,5-dihydropentalene-based chromophores from an aliphatic oligoketone bearing 1,3- and 1,4-diketone subunits. Unlike the natural polyketone sequence, fused five-membered rings were formed via an intramolecular aldol condensation. A subsequent Knoevenagel condensation reaction with malononitrile furnished a multiply cross-conjugated π-system with low-lying LUMO levels. Furthermore, pentalenes obtained from a non-conjugated aliphatic chain exhibited visible absorption and solid-state fluorescence.

  17. Oxidation reaction of polyether-based material and its suppression in lithium rechargeable battery using 4 V class cathode, LiNi1/3Mn1/3Co1/3O2.

    PubMed

    Kobayashi, Takeshi; Kobayashi, Yo; Tabuchi, Masato; Shono, Kumi; Ohno, Yasutaka; Mita, Yuichi; Miyashiro, Hajime

    2013-12-11

    The all solid-state lithium battery with polyether-based solid polymer electrolyte (SPE) is regarded as one of next-generation lithium batteries, and has potential for sufficient safety because of the flammable-electrolyte-free system. It has been believed that polyether-based SPE is oxidized at the polymer/electrode interface with 4 V class cathodes. Therefore, it has been used for electric devices such as organic transistor, and lithium battery under 3 V. We estimated decomposition reaction of polyether used as SPE of all solid-state lithium battery. We first identified the decomposed parts of polyether-based SPE and the conservation of most main chain framework, considering the results of SPE analysis after long cycle operations. The oxidation reaction was found to occur slightly at the ether bond in the main chain with the branched side chain. Moreover, we resolved the issue by introducing a self-sacrificing buffer layer at the interface. The introduction of sodium carboxymethyl cellulose (CMC) to the 4 V class cathode surface led to the suppression of SPE decomposition at the interface as a result of the preformation of a buffer layer from CMC, which was confirmed by the irreversible exothermic reaction during the first charge, using electrochemical calorimetry. The attained 1500 cycle operation is 1 order of magnitude longer than those of previously reported polymer systems, and compatible with those of reported commercial liquid systems. The above results indicate to proceed to an intensive research toward the realization of 4 V class "safe" lithium polymer batteries without flammable liquid electrolyte.

  18. Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

    PubMed

    Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

    1994-12-01

    Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

  19. Bio-based phenolic-branched-chain fatty acid isomers synthesized from vegetable oils and natural monophenols using modified h+-ferrierite zeolite

    USDA-ARS?s Scientific Manuscript database

    A new group of phenolic branched-chain fatty acids (n-PBC-FA), hybrid molecules of natural monophenols (i.e., thymol, carvacrol and creosote) and mixed fatty acid (i.e., derived from soybean and safflower oils), were efficiently produced through a process known as arylation. The reaction involves a...

  20. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  1. Bond Graph Modeling of Chemiosmotic Biomolecular Energy Transduction.

    PubMed

    Gawthrop, Peter J

    2017-04-01

    Engineering systems modeling and analysis based on the bond graph approach has been applied to biomolecular systems. In this context, the notion of a Faraday-equivalent chemical potential is introduced which allows chemical potential to be expressed in an analogous manner to electrical volts thus allowing engineering intuition to be applied to biomolecular systems. Redox reactions, and their representation by half-reactions, are key components of biological systems which involve both electrical and chemical domains. A bond graph interpretation of redox reactions is given which combines bond graphs with the Faraday-equivalent chemical potential. This approach is particularly relevant when the biomolecular system implements chemoelectrical transduction - for example chemiosmosis within the key metabolic pathway of mitochondria: oxidative phosphorylation. An alternative way of implementing computational modularity using bond graphs is introduced and used to give a physically based model of the mitochondrial electron transport chain To illustrate the overall approach, this model is analyzed using the Faraday-equivalent chemical potential approach and engineering intuition is used to guide affinity equalisation: a energy based analysis of the mitochondrial electron transport chain.

  2. Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

    PubMed

    Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

    1995-01-01

    Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

  3. The Synergize effect of Chain extender to Phosporic acid catalyst to the ultimate property of Soy-Polyurethane

    NASA Astrophysics Data System (ADS)

    Elvistia Firdaus, Flora

    2016-04-01

    The polyurethanes (PUs) foam were made from vegetable oil; a soybean based polyol. The foams were categorized into flexible and semi rigid. This research is manufacturally designed polyurethane foams by a process requiring the reaction of mixture of 2, 4- and 2, 6-Toluene di Isocyanate isomers, soy polyol in the presence of other ingredients. The objective of this work was to functionalized soy-polyol using phosporic acid catalyst and chain extender, study their collaborative reaction in producing ultimate property of PU foam. Correlates the foam morphology images in accordance to mechanical properties of foams.

  4. A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

    PubMed

    Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

    2013-05-01

    A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

  5. Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

    PubMed

    Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

    2018-04-01

    Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

  6. Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

    PubMed

    Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

    2018-06-01

    Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

  7. Enzyme-free and isothermal detection of microRNA based on click-chemical ligation-assisted hybridization coupled with hybridization chain reaction signal amplification.

    PubMed

    Oishi, Motoi

    2015-05-01

    An enzyme-free and isothermal microRNA (miRNA) detection method has been developed based on click-chemical ligation-assisted hybridization coupled with hybridization chain reaction (HCR) on magnetic beads (MBs). The click-chemical ligation between an azide-modified probe DNA and a dibenzocyclooctyne-modified probe DNA occurred through the hybridization of target miRNA (miR-141). HCR on MBs was performed by the addition of DNA hairpin monomers (H1 and H2). After magnetic separation and denaturation/rehybridization of HCR products ([H1/H2] n ), the resulting HCR products were analyzed by the fluorescence emitted from an intercalative dye, allowing amplification of the fluorescent signal. The proposed assay had a limit of detection of 0.55 fmol, which was 230-fold more sensitive than that of the HCR on the MBs coupled with a conventional sandwich hybridization assay (without click-chemical ligation) (limit of detection 127 fmol). Additionally, the proposed assay could discriminate between miR-141 and other miR-200 family members. In contrast to quantitative reverse transcription polymerase chain reaction techniques using enzymes and thermal cycling, this is an enzyme-free assay that can be conducted under isothermal conditions and can specifically detect miR-141 in fetal bovine serum.

  8. Network Polymers Formed Under Nonideal Conditions.

    DTIC Science & Technology

    1986-12-01

    the system or the limited ability of the statistical model to account for stochastic correlations. The viscosity of the reacting system was measured as...based on competing reactions (ring, chain) and employs equilibrium chain statistics . The work thus far has been limited to single cycle growth on an...polymerizations, because a large number of differential equations must be solved. The Makovian approach (sometimes referred to as the statistical or

  9. Removing systematic errors in interionic potentials of mean force computed in molecular simulations using reaction-field-based electrostatics

    PubMed Central

    Baumketner, Andrij

    2009-01-01

    The performance of reaction-field methods to treat electrostatic interactions is tested in simulations of ions solvated in water. The potential of mean force between sodium chloride pair of ions and between side chains of lysine and aspartate are computed using umbrella sampling and molecular dynamics simulations. It is found that in comparison with lattice sum calculations, the charge-group-based approaches to reaction-field treatments produce a large error in the association energy of the ions that exhibits strong systematic dependence on the size of the simulation box. The atom-based implementation of the reaction field is seen to (i) improve the overall quality of the potential of mean force and (ii) remove the dependence on the size of the simulation box. It is suggested that the atom-based truncation be used in reaction-field simulations of mixed media. PMID:19292522

  10. Molecular diagnostics of periodontitis.

    PubMed

    Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

    2017-01-28

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  11. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  12. Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

    PubMed

    Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

    2016-08-08

    Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

  13. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  14. Population Based Assessment of MHC Class 1 Antigens Down Regulation as Marker in Increased Risk for Development and Progression of Breast Cancer From Benign Breast Lesions

    DTIC Science & Technology

    2006-01-01

    isolated using a routine salting-out method (DNA E-Z Prepkit, Orchid Diagnostics Europe, St Katelijne Waver, Belgium). Sequence based typing In...electrophoresis using ethidiumbromide to show the single 2 KB band before sequencing. Next, sequencing reactions were performed separately for exons 2, 3...Multiplex reverse transcription-polymerase chain reaction for simultaneous screening of 29 translocations and chromosomal aberrations in acute

  15. Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

    NASA Astrophysics Data System (ADS)

    Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

    2005-12-01

    Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

  16. An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

    PubMed

    Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

    2017-08-07

    A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

  17. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    PubMed

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance.

  18. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance. PMID:27380028

  19. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  20. EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

    EPA Pesticide Factsheets

    In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

  1. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rongle Zhang; Jie Chang; Yuanyuan Xu

    A new kinetic model of the Fischer-Tropsch synthesis (FTS) is proposed to describe the non-Anderson-Schulz-Flory (ASF) product distribution. The model is based on the double-polymerization monomers hypothesis, in which the surface C{sub 2}{asterisk} species acts as a chain-growth monomer in the light-product range, while C{sub 1}{asterisk} species acts as a chain-growth monomer in the heavy-product range. The detailed kinetic model in the Langmuir-Hinshelwood-Hougen-Watson type based on the elementary reactions is derived for FTS and the water-gas-shift reaction. Kinetic model candidates are evaluated by minimization of multiresponse objective functions with a genetic algorithm approach. The model of hydrocarbon product distribution ismore » consistent with experimental data (

  3. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    PubMed

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  4. Preparation of core-shell molecularly imprinted polymer via the combination of reversible addition-fragmentation chain transfer polymerization and click reaction.

    PubMed

    Chang, Limin; Li, Ying; Chu, Jia; Qi, Jingyao; Li, Xin

    2010-11-08

    In this paper, we demonstrated an efficient and robust route to the preparation of well-defined molecularly imprinted polymer based on reversible addition-fragmentation chain transfer (RAFT) polymerization and click chemistry. The alkyne terminated RAFT chain transfer agent was first synthesized, and then click reaction was used to graft RAFT agent onto the surface of silica particles which was modified by azide. Finally, imprinted thin film was prepared in the presence of 2,4-dichlorophenol as the template. The imprinted beads were demonstrated with a homogeneous polymer films (thickness of about 2.27 nm), and exhibited thermal stability under 255°C. The as-synthesized product showed obvious molecular imprinting effects towards the template, fast template rebinding kinetics and an appreciable selectivity over structurally related compounds. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Determining the thickness of aliphatic alcohol monolayers covalently attached to silicon oxide surfaces using angle-resolved X-ray photoelectron spectroscopy

    NASA Astrophysics Data System (ADS)

    Lee, Austin W. H.; Kim, Dongho; Gates, Byron D.

    2018-04-01

    The thickness of alcohol based monolayers on silicon oxide surfaces were investigated using angle-resolved X-ray photoelectron spectroscopy (ARXPS). Advantages of using alcohols as building blocks for the formation of monolayers include their widespread availability, ease of handling, and stability against side reactions. Recent progress in microwave assisted reactions demonstrated the ease of forming uniform monolayers with alcohol based reagents. The studies shown herein provide a detailed investigation of the thickness of monolayers prepared from a series of aliphatic alcohols of different chain lengths. Monolayers of 1-butanol, 1-hexanol, 1-octanol, 1-decanol, and 1-dodecanol were each successfully formed through microwave assisted reactions and characterized by ARXPS techniques. The thickness of these monolayers consistently increased by ∼1.0 Å for every additional methylene (CH2) within the hydrocarbon chain of the reagents. Tilt angles of the molecules covalently attached to silicon oxide surfaces were estimated to be ∼35° for each type of reagent. These results were consistent with the observations reported for thiol based or silane based monolayers on either gold or silicon oxide surfaces, respectively. The results of this study also suggest that the alcohol based monolayers are uniform at a molecular level.

  6. Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

    PubMed

    Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

    2018-04-18

    Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

  7. Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

    PubMed

    Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

    2018-04-17

    A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

  8. Toluene nitration in irradiated nitric acid and nitrite solutions

    NASA Astrophysics Data System (ADS)

    Elias, Gracy; Mincher, Bruce J.; Mezyk, Stephen P.; Muller, Jim; Martin, Leigh R.

    2011-04-01

    The kinetics, mechanisms, and stable products produced for the nitration of aryl alkyl mild ortho-para director toluene in irradiated nitric acid and neutral nitrite solutions were investigated using γ and pulse radiolysis. Electron pulse radiolysis was used to determine the bimolecular rate constants for the reaction of toluene with different transient species produced by irradiation. HPLC with UV detection, GC-MS and LC-MS, were used to assess the stable reaction products. Free-radical based nitration reaction products were found in irradiated acidic and neutral media. In 6.0 M HNO3, ring substitution, side chain substitution, and oxidation, produced different nitrated toluene products. For ring substitution, nitrogen oxide radicals were added mainly to cyclohexadienyl radicals, whereas for side chain substitution, these radicals were added to the carbon-centered benzyl radical produced by H-atom abstraction. In neutral nitrite solutions, radiolytically-induced ring nitration products approached a statistically random distribution, suggesting a direct free-radical reaction involving addition of the rad NO2 radical.

  9. Effects of macromolecular crowding on biochemical reaction equilibria: a molecular thermodynamic perspective.

    PubMed

    Hu, Zhongqiao; Jiang, Jianwen; Rajagopalan, Raj

    2007-09-01

    A molecular thermodynamic model is developed to investigate the effects of macromolecular crowding on biochemical reactions. Three types of reactions, representing protein folding/conformational isomerization, coagulation/coalescence, and polymerization/association, are considered. The reactants, products, and crowders are modeled as coarse-grained spherical particles or as polymer chains, interacting through hard-sphere interactions with or without nonbonded square-well interactions, and the effects of crowder size and chain length as well as product size are examined. The results predicted by this model are consistent with experimentally observed crowding effects based on preferential binding or preferential exclusion of the crowders. Although simple hard-core excluded-volume arguments do in general predict the qualitative aspects of the crowding effects, the results show that other intermolecular interactions can substantially alter the extent of enhancement or reduction of the equilibrium and can even change the direction of the shift. An advantage of the approach presented here is that competing reactions can be incorporated within the model.

  10. Synthesis of lipase-catalysed silicone-polyesters and silicone-polyamides at elevated temperatures.

    PubMed

    Frampton, Mark B; Zelisko, Paul M

    2013-10-18

    More and more enzymes are being explored as alternatives to conventional catalysts in chemical reactions. To utilize these biocatalysts to their fullest, it is incumbent on researchers to gain a complete understanding of the reaction conditions that particular enzymes will tolerate. To this end siloxane-containing polyesters and polyamides have been produced via N435-mediated catalysis at temperatures well above the normal denaturation temperature for free CalB. Low molecular weight disiloxane-based acceptors release the enzyme from its acylated state with equal proficiency while longer chain siloxanes favours polyester synthesis. The thermal tolerance of the enzyme catalyst is increased using longer chain diesters and generally more hydrophobic substrates.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krotov, V.V.; Staroverov, S.M.; Nesterenko, P.N.

    A series of heterogeneous catalysts for asymmetric Michael additions was synthesized based on ephedrine chemically bound to the surface of silica. The length of the hydrocarbon chain binding the active center to the support surface affects the sign of rotation of the reaction product from the asymmetric addition of thiophenol to benzylideneacetophenone. Grafting ephedrine to the silica surface via a short hydrocarbon chain results in a change in the configuration of the reaction product. Silanol groups on the silica surface are involved in the transition state, as evidenced by data obtained using silica which has been exhaustively treated with trimethylchlorosilane.more » The absolute specific rotation of 1,3-diphenyl-3-thiophenylpropan-1-one has been established.« less

  12. Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

    PubMed Central

    Bej, A K; McCarty, S C; Atlas, R M

    1991-01-01

    Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

  13. Mannich Bases: An Important Pharmacophore in Present Scenario

    PubMed Central

    Sharma, Neha; Kajal, Anu; Saini, Vipin

    2014-01-01

    Mannich bases are the end products of Mannich reaction and are known as beta-amino ketone carrying compounds. Mannich reaction is a carbon-carbon bond forming nucleophilic addition reaction and is a key step in synthesis of a wide variety of natural products, pharmaceuticals, and so forth. Mannich reaction is important for the construction of nitrogen containing compounds. There is a number of aminoalkyl chain bearing Mannich bases like fluoxetine, atropine, ethacrynic acid, trihexyphenidyl, and so forth with high curative value. The literature studies enlighten the fact that Mannich bases are very reactive and recognized to possess potent diverse activities like anti-inflammatory, anticancer, antifilarial, antibacterial, antifungal, anticonvulsant, anthelmintic, antitubercular, analgesic, anti-HIV, antimalarial, antipsychotic, antiviral activities and so forth. The biological activity of Mannich bases is mainly attributed to α, β-unsaturated ketone which can be generated by deamination of hydrogen atom of the amine group. PMID:25478226

  14. Colorimetric detection of mercury ion based on unmodified gold nanoparticles and target-triggered hybridization chain reaction amplification

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Yang, Xiaohan; Yang, Xiaohai; Liu, Pei; Wang, Kemin; Huang, Jin; Liu, Jianbo; Song, Chunxia; Wang, Jingjing

    2015-02-01

    A novel unmodified gold nanoparticles (AuNPs)-based colorimetric strategy for label-free, specific and sensitive mercury ion (Hg2+) detection was demonstrated by using thymine-Hg2+-thymine (T-Hg2+-T) recognition mechanism and hybridization chain reaction (HCR) amplification strategy. In this protocol, a structure-switching probe (H0) was designed to recognize Hg2+ and then propagated a chain reaction of hybridization events between two other hairpin probes (H1 and H2). In the absence of Hg2+, all hairpin probes could stably coexist in solution, the exposed sticky ends of hairpin probes were capable of stabilizing AuNPs. As a result, salt-induced AuNPs aggregation could be effectively prevented. In the presence of Hg2+, thymine bases of H0 could specifically interact with Hg2+ to form stable T-Hg2+-T complex. Consequently, the hairpin structure of H0 probe was changed. As H1/H2 probes were added, the HCR process could be triggered and nicked double-helixes were formed. Since it was difficult for the formed nicked double-helixes to inhibit salt-induced AuNPs aggregation, a red-to-blue color change was observed in the colloid solution as the salt concentration increased. With the elegant amplification effect of HCR, a detection limit of around 30 nM was achieved (S/N = 3), which was about 1-2 orders of magnitudes lower than that of previous unmodified AuNPs-based colorimetric methods. By using the T-Hg2+-T recognition mechanism, high selectivity was also obtained. As an unmodified AuNPs-based colorimetric strategy, the system was simple in design, convenient in operation, and eliminated the requirements of separation processes, chemical modifications, and sophisticated instrumentations.

  15. Enumeration of Ring–Chain Tautomers Based on SMIRKS Rules

    PubMed Central

    2015-01-01

    A compound exhibits (prototropic) tautomerism if it can be represented by two or more structures that are related by a formal intramolecular movement of a hydrogen atom from one heavy atom position to another. When the movement of the proton is accompanied by the opening or closing of a ring it is called ring–chain tautomerism. This type of tautomerism is well observed in carbohydrates, but it also occurs in other molecules such as warfarin. In this work, we present an approach that allows for the generation of all ring–chain tautomers of a given chemical structure. Based on Baldwin’s Rules estimating the likelihood of ring closure reactions to occur, we have defined a set of transform rules covering the majority of ring–chain tautomerism cases. The rules automatically detect substructures in a given compound that can undergo a ring–chain tautomeric transformation. Each transformation is encoded in SMIRKS line notation. All work was implemented in the chemoinformatics toolkit CACTVS. We report on the application of our ring–chain tautomerism rules to a large database of commercially available screening samples in order to identify ring–chain tautomers. PMID:25158156

  16. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  17. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robinson, N.A.; Wood, H.G.

    1986-05-01

    Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

  19. Compositional and stable carbon isotopic fractionation during non-autocatalytic thermochemical sulfate reduction by gaseous hydrocarbons

    USGS Publications Warehouse

    Xia, Xinyu; Ellis, Geoffrey S.; Ma, Qisheng; Tang, Yongchun

    2014-01-01

    The possibility of autocatalysis during thermochemical sulfate reduction (TSR) by gaseous hydrocarbons was investigated by examination of previously reported laboratory and field data. This reaction was found to be a kinetically controlled non-autocatalytic process, and the apparent lack of autocatalysis is thought to be due to the absence of the required intermediate species. Kinetic parameters for chemical and carbon isotopic fractionations of gaseous hydrocarbons affected by TSR were calculated and found to be consistent with experimentally derived values for TSR involving long-chain hydrocarbons. Model predictions based on these kinetic values indicate that TSR by gaseous hydrocarbon requires high-temperature conditions. The oxidation of C2–5 hydrocarbons by sulfate reduction is accompanied by carbon isotopic fractionation with the residual C2–5 hydrocarbons becoming more enriched in 13C. Kinetic parameters were calculated for the stable carbon isotopic fractionation of gaseous hydrocarbons that have experienced TSR. Model predictions based on these kinetics indicate that it may be difficult to distinguish the effects of TSR from those of thermal maturation at lower levels of hydrocarbon oxidation; however, unusually heavy δ13C2+ values (>−10‰) can be diagnostic of high levels of conversion (>50%). Stoichiometric and stable carbon isotopic data show that methane is stable under the investigated reaction conditions and is likely a product of TSR by other gaseous hydrocarbons rather than a significant reactant. These results indicate that the overall TSR reaction mechanism for oxidation of organic substrates containing long-chain hydrocarbons involves three distinct phases as follows: (1) an initial slow and non-autocatalytic stage characterized by the reduction of reactive sulfate by long-chain saturated hydrocarbons; (2) a second autocatalytic reaction phase dominated by reactions involving reduced sulfur species and partially oxidized hydrocarbons; (3) and a final, or late-stage, TSR reaction in which hydrocarbon oxidation continues at a slower rate via the non-autocatalytic reduction of sulfate by gaseous hydrocarbons.

  20. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  1. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    PubMed

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  2. Polyisobutylene chain end transformations: Block copolymer synthesis and click chemistry functionalizations

    NASA Astrophysics Data System (ADS)

    Magenau, Andrew Jackson David

    The primary objectives of this research were twofold: (1) development of synthetic procedures for combining quasiliving carbocationic polymerization (QLCCP) of isobutylene (IB) and reversible addition fragmentation chain transfer (RAFT) polymerization for block copolymer synthesis; (2) utilization of efficient, robust, and modular chemistries for facile functionalization of polyisobutylene (PIB). In the first study block copolymers consisting of PIB, and either PMMA or PS block segments, were synthesized by a site transformation approach combining living cationic and reversible addition-fragmentation chain transfer (RAFT) polymerizations. The initial PIB block was synthesized via quasiliving cationic polymerization using the TMPCl/TiCl4 initiation system and was subsequently converted into a hydroxylterminated PIB. Site transformation of the hydroxyl-terminated PIB into a macro chain transfer agent (PIB-CTA) was accomplished by N,N'-dicyclohexylcarbodiimide/dimethylaminopyridine-catalyzed esterification with 4-cyano-4-(dodecylsulfanylthiocarbonylsulfanyl)pentanoic acid. In the second study another site transformation approach was developed to synthesize a novel block copolymer, composed of PIB and PNIPAM segments. The PIB block was prepared via quasiliving cationic polymerization and end functionalized by in-situ quenching to yield telechelic halogen-terminated PIB. Azido functionality was obtained by displacement of the terminal halogen through nucleophilic substitution, which was confirmed by both 1H and 13C NMR. Coupling of an alkyne-functional chain transfer agent (CTA) to azido PIB was successfully accomplished through a copper catalyzed click reaction. Structure of the resulting PIB-based macro-CTA was verified with 1H NMR, FTIR, and GPC; whereas coupling reaction kinetics were monitored by real time variable temperature (VT) 1H NMR. In a third study, a click chemistry functionalization procedure was developed based upon the azide-alkyne 1,3-dipolar cycloaddition reaction. 1-(o-Azidoalkyl)pyrrolyl-terminated PIB was successfully synthesized both by substitution of the terminal halide of 1-(o-haloalkyl)pyrrolyl-terminated PIB with sodium azide and by in situ quenching of quasiliving PIB with a 1-(o-azidoalkyl)pyrrole. GPC indicated the absence of coupled PIB under optimized conditions, confirming exclusive mono-substitution on each pyrrole ring. In a fourth study, radical thiol-ene hydrothiolation "Click" chemistry was explored and adapted to easily and rapidly modify exo -olefin PIB with an array of thiol compounds bearing useful functionalities, including primary halogen, primary amine, primary hydroxyl, and carboxylic acid. The thiol-ene "click" procedure was shown to be applicable to both mono and difunctional exo-olefin polyisobutylene. Telechelic mono- and difunctional exo-olefin PIBs were synthesized via quasiliving cationic polymerization followed by quenching with the hindered amine, 1,2,2,6,6-pentamethylpiperidine. Lower reaction temperatures were found to increase exo-olefin conversion to near quantitative amounts. In the fifth study, thiol-terminated polyisobutylene (PIB-SH) was synthesized by reaction of thiourea with alpha,o-bromine-terminated PIB in a three step one-pot procedure. First the alkylisothiouronium salt was produced using a 1:1 (v:v) DMF:heptane cosolvent mixture at 90°C. Hydrolysis of the salt by aqueous base produced thiolate chain ends, which were then acidified to form the desired thiol functional group. An extension of this reaction was performed by a sequential thiol-ene/thiol-yne procedure to produce tetra-hydroxy functionalized PIB. 1H NMR was used to confirm formation of both alkyne and tetrahydroxyl functional species. Further utility of PIB-SH was demonstrated by base catalyzed thiol-isocyanate reactions. A model reaction was conducted with phenyl isocyanate in THF using triethylamine as the catalyst. Last, conversion of PIB-SH directly into a RAFT macro-CTA was accomplished, as shown by 1H NMR, by treatment of PIB-SH with triethylamine in carbon disulfide and subsequent alkylation with 2-bromopropionic acid. (Abstract shortened by UMI.)

  3. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  4. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  5. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    PubMed

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  6. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    NASA Astrophysics Data System (ADS)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-08-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  7. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

    PubMed

    Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

    2003-02-01

    A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

  8. Design and preparation of novel polyarylene ether materials based on Diels-Alder reaction as the crosslinker for electrooptical modulators

    NASA Astrophysics Data System (ADS)

    Gao, Wu; Hou, Wenjun; Zhen, Zhen; Liu, Xinhou; Liu, Jialei; Fedorchuk, A. A.; Czaja, P.

    2016-07-01

    Novel crosslinkable organic linear electro-optical (EO) material based on polyarylene ether as the main chain host polymer was designed and prepared. The host polymer with rigid aromatic has demonstrated a good compatibility with the guest chromophore. Long side chain with anthracene ensured the crosslinkable reaction and appropriate glass transition temperature of the host polymer (55 °C). The EO r33 tensor coefficient for this novel EO material has been magnitude of 66 pm/V at 1310 nm and the excellent long term stability at 85 °C. These parameters permit to consider their application in fabrication of organic electro optical devices. The semi-empirical and DFT quantum chemical simulations were performed for 4 principal chromophores to clarify a role of cross-linker in the enhancement of the ground state dipole moments and effective hyperpolarizabilities.

  9. Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

    PubMed

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-03-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

  10. Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

    PubMed Central

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-01-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

  11. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  12. Bio-barcode gel assay for microRNA

    NASA Astrophysics Data System (ADS)

    Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min

    2014-02-01

    MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.

  13. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  14. Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

    PubMed

    Treff, Nathan R; Scott, Richard T

    2013-03-15

    Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  15. Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

    PubMed

    Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

    1999-10-01

    Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.

  16. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  17. ReaDDy - A Software for Particle-Based Reaction-Diffusion Dynamics in Crowded Cellular Environments

    PubMed Central

    Schöneberg, Johannes; Noé, Frank

    2013-01-01

    We introduce the software package ReaDDy for simulation of detailed spatiotemporal mechanisms of dynamical processes in the cell, based on reaction-diffusion dynamics with particle resolution. In contrast to other particle-based reaction kinetics programs, ReaDDy supports particle interaction potentials. This permits effects such as space exclusion, molecular crowding and aggregation to be modeled. The biomolecules simulated can be represented as a sphere, or as a more complex geometry such as a domain structure or polymer chain. ReaDDy bridges the gap between small-scale but highly detailed molecular dynamics or Brownian dynamics simulations and large-scale but little-detailed reaction kinetics simulations. ReaDDy has a modular design that enables the exchange of the computing core by efficient platform-specific implementations or dynamical models that are different from Brownian dynamics. PMID:24040218

  18. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  19. Mitochondrial respiratory chain complexes as sources and targets of thiol-based redox-regulation.

    PubMed

    Dröse, Stefan; Brandt, Ulrich; Wittig, Ilka

    2014-08-01

    The respiratory chain of the inner mitochondrial membrane is a unique assembly of protein complexes that transfers the electrons of reducing equivalents extracted from foodstuff to molecular oxygen to generate a proton-motive force as the primary energy source for cellular ATP-synthesis. Recent evidence indicates that redox reactions are also involved in regulating mitochondrial function via redox-modification of specific cysteine-thiol groups in subunits of respiratory chain complexes. Vice versa the generation of reactive oxygen species (ROS) by respiratory chain complexes may have an impact on the mitochondrial redox balance through reversible and irreversible thiol-modification of specific target proteins involved in redox signaling, but also pathophysiological processes. Recent evidence indicates that thiol-based redox regulation of the respiratory chain activity and especially S-nitrosylation of complex I could be a strategy to prevent elevated ROS production, oxidative damage and tissue necrosis during ischemia-reperfusion injury. This review focuses on the thiol-based redox processes involving the respiratory chain as a source as well as a target, including a general overview on mitochondria as highly compartmentalized redox organelles and on methods to investigate the redox state of mitochondrial proteins. This article is part of a Special Issue entitled: Thiol-Based Redox Processes. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  1. Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

    PubMed

    Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

    2017-01-01

    Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

  2. Dual-component system dimethyl sulfoxide/LiCl as a solvent and catalyst for homogeneous ring-opening grafted polymerization of ε-caprolactone onto xylan.

    PubMed

    Zhang, Xue-Qin; Chen, Ming-Jie; Liu, Chuan-Fu; Sun, Run-Cang

    2014-01-22

    The preparation of xylan-graft-poly(ε-caprolactone) (xylan-g-PCL) copolymers was investigated by homogeneous ring-opening polymerization (ROP) in a dual-component system containing Lewis base LiCl and strong polar aprotic solvent dimethyl sulfoxide (DMSO). DMSO/LiCl acted as solvent, base, and catalyst for the ROP reaction. The effects of the parameters, including the reaction temperature, molar ratio of ε-caprolactone (ε-CL) to anhydroxylose units (AXU) in xylan, and reaction time, on the degree of substitution (DS) and weight percent of PCL side chain (WPCL) were investigated. The results showed that xylan-g-PCL copolymers with low DS in the range of 0.03-0.39 were obtained under the given conditions. The Fourier transform infrared spectroscopy (FTIR), (1)H nuclear magnetic resonance (NMR), (13)C NMR, (1)H-(1)H correlation spectroscopy (COSY), and (1)H-(13)C correlation two-dimensional (2D) NMR [heteronuclear single-quantum coherence (HSQC)] characterization provided more evidence of the attachment of side chains onto xylan. Only one ε-CL was confirmed to be attached onto xylan with each side chain. Integration of resonances assigned to the substituted C2 and C3 in the HSQC spectrum also indicated 69.23 and 30.77% of PCL side chains attached to AXU at C3 and C2 positions, respectively. Although the attachment of PCL onto xylan led to the decreased thermal stability of xylan, the loss of unrecovered xylan fractions with low molecular weight because of the high solubility of xylan in DMSO/LiCl resulted in the increased thermal stability of the samples. This kind of xylan derivative has potential application in environmentally friendly and biodegradable materials considering the good biodegradability of xylan and PCL.

  3. [Radiation therapy and redox imaging].

    PubMed

    Matsumoto, Ken-ichiro

    2015-01-01

    Radiation therapy kills cancer cells in part by flood of free radicals. Radiation ionizes and/or excites water molecules to create highly reactive species, i.e. free radicals and/or reactive oxygen species. Free radical chain reactions oxidize biologically important molecules and thereby disrupt their function. Tissue oxygen and/or redox status, which can influence the course of the free radical chain reaction, can affect the efficacy of radiation therapy. Prior observation of tissue oxygen and/or redox status is helpful for planning a safe and efficient course of radiation therapy. Magnetic resonance-based redox imaging techniques, which can estimate tissue redox status non-invasively, have been developed not only for diagnostic information but also for estimating the efficacy of treatment. Redox imaging is now spotlighted to achieve radiation theranostics.

  4. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  6. Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

    PubMed

    Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

    2010-06-01

    Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

  7. Exploiting the CNC side chain in heterocyclic rearrangements: synthesis of 4(5)-acylamino-imidazoles.

    PubMed

    Piccionello, Antonio Palumbo; Buscemi, Silvestre; Vivona, Nicolò; Pace, Andrea

    2010-08-06

    A new variation on the Boulton-Katritzky reaction is reported, namely, involving use of a CNC side chain. A novel Montmorillonite-K10 catalyzed nonreductive transamination of a 3-benzoyl-1,2,4-oxadiazole afforded a 3-(alpha-aminobenzyl)-1,2,4-oxadiazole, which was condensed with benzaldehydes to afford the corresponding imines. In the presence of strong base, these imines underwent Boulton-Katritzky-type rearrangement to afford novel 4(5)-acylaminoimidazoles.

  8. NASBA: A detection and amplification system uniquely suited for RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sooknanan, R.; Malek, L.T.

    1995-06-01

    The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

  9. Inquiry-Based Experiments for Large-Scale Introduction to PCR and Restriction Enzyme Digests

    ERIC Educational Resources Information Center

    Johanson, Kelly E.; Watt, Terry J.

    2015-01-01

    Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are…

  10. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  11. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    NASA Astrophysics Data System (ADS)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  12. A Combined Photochemical and Multicomponent Reaction Approach to Precision Oligomers.

    PubMed

    Konrad, Waldemar; Bloesser, Fabian R; Wetzel, Katharina S; Boukis, Andreas C; Meier, Michael A R; Barner-Kowollik, Christopher

    2018-03-07

    We introduce the convergent synthesis of linear monodisperse sequence-defined oligomers through a unique approach, combining the Passerini three-component reaction (P-3CR) and a Diels-Alder (DA) reaction based on photocaged dienes. A set of oligomers is prepared resting on a Passerini linker unit carrying an isocyano group for chain extension by P-3CR and a maleimide moiety for photoenol conjugation enabling a modular approach for chain growth. Monodisperse oligomers are accessible in a stepwise fashion by switching between both reaction types. Employing sebacic acid as a core unit allows the synthesis of a library of symmetric sequence-defined oligomers. The oligomers consist of alternating P-3CR and photoblocks with molecular weights up to 3532.16 g mol -1 , demonstrating the successful switching from P-3CR to photoenol conjugation. In-depth characterization was carried out including size-exclusion chromatography (SEC), high-resolution electrospray ionization mass spectrometry (ESI-MS) and NMR spectroscopy, evidencing the monodisperse nature of the precision oligomers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

    NASA Astrophysics Data System (ADS)

    Persat, Alexandre; Santiago, Juan

    2008-11-01

    We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

  14. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    PubMed Central

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-01-01

    To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

  15. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

    PubMed

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-04-01

    To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

  16. DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

    EPA Science Inventory

    We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

  17. QUALITY ASSURANCE FOR PCR

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

  18. DETECTION OF PATHOGENS IN DRINKING WATER (SEER 2)

    EPA Science Inventory

    Project investigators developed a polymerase chain reaction (PCR)-based technique to detect E. coli 0157:H7 cells in environmental samples using previously reported PCR primers for the specific detection of genes involved in biosynthesis of 0157 polysacchari...

  19. On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

    PubMed

    Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

    2017-02-01

    A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

  20. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  1. Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

    PubMed Central

    Liu, Rui; Liang, Xiao; Xiang, Dandan; Guo, Yirong; Liu, Yihua; Zhu, Guonian

    2016-01-01

    Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv) antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb) against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL) to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples. PMID:27338340

  2. Amyloid fibril formation by the chain B subunit of monellin occurs by a nucleation-dependent polymerization mechanism.

    PubMed

    Sabareesan, A T; Udgaonkar, Jayant B

    2014-02-25

    Proteins possessing very different structures, or even no structure, form amyloid fibrils that are very similar in internal structure. This suggests that the mechanisms by which amyloid fibrils form might be very similar, irrespective of whether the fibrils are associated with disease or with normal cellular function, or even if they have no physiological importance. In this context, it is important to have a model protein system whose amyloid fibril formation is robust in its reproducibility, which can reveal the fundamentals of the amyloid fibril reaction that may be applicable to all proteins. In this study, the aggregation mechanism of amyloid fibril formation by chain B of the heterodimeric protein monellin has been elucidated in detail. It is shown that the aggregation reaction meets all the stringent kinetic criteria of a homogeneous nucleation-dependent polymerization mechanism, which is valid over a wide range of protein concentrations. Quantitative analyses of the kinetic data using one approach based on features of the entire kinetic curve, and another based on only the initial rate of aggregation, indicate that the thermodynamic nucleus is a dimer. Spherical oligomers are observed by atomic force microscopy to form transiently early during fibril formation but are off-pathway to the direct fibril formation pathway. It is shown that amyloid fibril formation can be prevented by the addition of chain A of monellin at early stages of chain B aggregation: the two free chains combine to form native monellin, which leads to the dissociation of early aggregates.

  3. Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

    NASA Astrophysics Data System (ADS)

    Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

    2018-01-01

    ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

  4. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  5. Prediction of Chain Propagation Rate Constants of Polymerization Reactions in Aqueous NIPAM/BIS and VCL/BIS Systems.

    PubMed

    Kröger, Leif C; Kopp, Wassja A; Leonhard, Kai

    2017-04-06

    Microgels have a wide range of possible applications and are therefore studied with increasing interest. Nonetheless, the microgel synthesis process and some of the resulting properties of the microgels, such as the cross-linker distribution within the microgels, are not yet fully understood. An in-depth understanding of the synthesis process is crucial for designing tailored microgels with desired properties. In this work, rate constants and reaction enthalpies of chain propagation reactions in aqueous N-isopropylacrylamide/N,N'-methylenebisacrylamide and aqueous N-vinylcaprolactam/N,N'-methylenebisacrylamide systems are calculated to identify the possible sources of an inhomogeneous cross-linker distribution in the resulting microgels. Gas-phase reaction rate constants are calculated from B2PLYPD3/aug-cc-pVTZ energies and B3LYPD3/tzvp geometries and frequencies. Then, solvation effects based on COSMO-RS are incorporated into the rate constants to obtain the desired liquid-phase reaction rate constants. The rate constants agree with experiments within a factor of 2-10, and the reaction enthalpies deviate less than 5 kJ/mol. Further, the effect of rate constants on the microgel growth process is analyzed, and it is shown that differences in the magnitude of the reaction rate constants are a source of an inhomogeneous cross-linker distribution within the resulting microgel.

  6. Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

    PubMed

    Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

    2007-09-01

    Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

  7. Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

    PubMed

    Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

    1996-05-01

    Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

  8. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  9. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  10. Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

    EPA Science Inventory

    EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

  11. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  12. A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

    PubMed

    Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

    2017-12-01

    A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

  13. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  15. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  16. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  17. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  18. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  19. *A FASTER METHOD OF MEASURING RECREATIONAL WATER QUALITY FOR BETTER PROTECTION OF SWIMMER'S HEALTH

    EPA Science Inventory

    We previously reported that a faster method (< 2 hours) of measuring fecal indicator bacteria (FIB), based on Quantitative Polymerase Chain Reaction (QPCR), was predictive of swimming associated gastrointestinal illness. Using data from two additional beaches, we examined the re...

  20. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  2. Identification of the people from whom engorged Aedes aegypti took blood meals in Florida, Puerto Rico, using polymerase chain reaction-based DNA profiling.

    PubMed

    De Benedictis, John; Chow-Shaffer, Esther; Costero, Adriana; Clark, Gary G; Edman, John D; Scott, Thomas W

    2003-04-01

    We used polymerase chain reaction-based DNA profiling to construct allelic profiles for residents and visitors of 22 houses in Florida, Puerto Rico, and human DNA from blood meals in Aedes aegypti that were collected in those homes. Complete profiles were obtained for < or = 2 days after blood ingestion. Eighteen percent of the meals came from two different people. There was no evidence of meals from > or = 2 people. Eighty percent of the meal sources were identified, > 70% were taken from residents of the collection house, and > 90% were from residents of the study community. Across the community, feeding was non-random with a bias towards young adults and males. Three people accounted for 56% of the meals. Our results confirm that multiple feeding on different people is an important component in the role of Ae. aegypti in dengue virus transmission and help explain the spatial distribution of dengue cases in a previous epidemic in Florida, Puerto Rico.

  3. Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

    PubMed

    Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

    2013-06-01

    Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

  4. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  5. Momentum-Based Dynamics for Spacecraft with Chained Revolute Appendages

    NASA Technical Reports Server (NTRS)

    Queen, Steven; London, Ken; Gonzalez, Marcelo

    2005-01-01

    An efficient formulation is presented for a sub-class of multi-body dynamics problems that involve a six degree-of-freedom base body and a chain of N rigid linkages connected in series by single degree-of-freedom revolute joints. This general method is particularly well suited for simulations of spacecraft dynamics and control that include the modeling of an orbiting platform with or without internal degrees of freedom such as reaction wheels, dampers, and/or booms. In the present work, particular emphasis is placed on dynamic simulation of multi-linkage robotic manipulators. The differential equations of motion are explicitly given in terms of linear and angular momentum states, which can be evaluated recursively along a serial chain of linkages for an efficient real-time solution on par with the best of the O(N3) methods.

  6. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  7. Protein side chain rotational isomerization: A minimum perturbation mapping study

    NASA Astrophysics Data System (ADS)

    Haydock, Christopher

    1993-05-01

    A theory of the rotational isomerization of the indole side chain of tryptophan-47 of variant-3 scorpion neurotoxin is presented. The isomerization potential energy, entropic part of the isomerization free energy, isomer probabilities, transition state theory reaction rates, and indole order parameters are calculated from a minimum perturbation mapping over tryptophan-47 χ1×χ2 torsion space. A new method for calculating the fluorescence anisotropy from molecular dynamics simulations is proposed. The method is based on an expansion that separates transition dipole orientation from chromophore dynamics. The minimum perturbation potential energy map is inverted and applied as a bias potential for a 100 ns umbrella sampling simulation. The entropic part of the isomerization free energy as calculated by minimum perturbation mapping and umbrella sampling are in fairly close agreement. Throughout, the approximation is made that two glutamine and three tyrosine side chains neighboring tryptophan-47 are truncated at the Cβ atom. Comparison with the previous combination thermodynamic perturbation and umbrella sampling study suggests that this truncated neighbor side chain approximation leads to at least a qualitatively correct theory of tryptophan-47 rotational isomerization in the wild type variant-3 scorpion neurotoxin. Analysis of van der Waals interactions in a transition state region indicates that for the simulation of barrier crossing trajectories a linear combination of three specially defined dihedral angles will be superior to a simple side chain dihedral reaction coordinate.

  8. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  9. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  10. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  11. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  12. Homochiral coordination polymers with helixes and metal clusters based on lactate derivatives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Zhong-Xuan, E-mail: xuzhongxuan4201@163.com; Ma, Yu-Lu; Lv, Guo-ling

    2017-05-15

    Utilizing the lactic acid derivatives (R)-4-(1-carboxyethoxy)benzoic acid (denoted: (R)-H{sub 2}CBA) and (S)-4-(1-carboxyethoxy)benzoic acid (denoted: (S)-H{sub 2}CBA)as chiral linkers to self-assemble with 4, 4′-bipyridine (denoted: BIP) and Cd(II) ions, a couple of three-dimensional homochiral coordination polymers, namely [Cd{sub 3}((R)-CBA){sub 3} (BIP){sub 2}(H{sub 2}O)]·xGuest (1-D) and [Cd{sub 3}((S)-CBA){sub 3}(BIP){sub 2}(H{sub 2}O)]·xGuest (1-L), have been synthesized under solvothermal reaction condition. Single crystal X-ray diffraction analysis reveals the two complexes contain single helical chains based on enantiopure ligands and cadmium clusters. Moreover, some physical characteristics such as PXRD, thermal stability, solid-state circular dichroism (CD) and luminescent were also investigated. - Graphical abstract: Utilizing enantiomericmore » lactic acid derivatives (R)-H{sub 2}CBA and (S)-H{sub 2}CBA to assemble with Cd{sup 2+} ions and ancillary BIP ligands, a couple of 3D homochiral coordination polymers with metal clusters and helical chains have been prepared by hydrothermal reaction. - Highlights: • Chiral lactic acid derivative. • Enantiomeric coordination polymer. • Helical chain. • Trinuclear cadmium cluster.« less

  13. A versatile platform for precise synthesis of asymmetric molecular brush in one shot.

    PubMed

    Xu, Binbin; Feng, Chun; Huang, Xiaoyu

    2017-08-24

    Asymmetric molecular brushes emerge as a unique class of nanostructured polymers, while their versatile synthesis keeps a challenge for chemists. Here we show the synthesis of well-defined asymmetric molecular double-brushes comprising two different side chains linked to the same repeat unit along the backbone by one-pot concurrent atom transfer radical polymerization (ATRP) and Cu-catalyzed azide/alkyne cycloaddition (CuAAC) reaction. The double-brushes are based on a poly(Br-acrylate-alkyne) homopolymer possessing an alkynyl for CuAAC reaction and a 2-bromopropionate initiating group for ATRP in each repeat unit. The versatility of this one-shot approach is demonstrated by CuAAC reaction of alkynyl/poly(ethylene oxide)-N 3 and ATRP of various monomers. We also show the quantitative conversion of pentafluorophenyl ester groups to amide groups in side chains, allowing for the further fabrication of diverse building blocks. This work provides a versatile platform for facile synthesis of Janus-type double-brushes with structural and functional control, in a minimum number of reactions.Producing well-defined polymer compositions and structures facilitates their use in many different applications. Here the authors show the synthesis of well-defined asymmetric double-brushes by a one-pot concurrent atom transfer radical polymerization and Cu-catalyzed Click reaction.

  14. DEVELOPMENT AND EVALUATION OF A MICROARRAY APPROACH TO DETECT AND GENOTYPE NOROVIRUSES IN WATER

    EPA Science Inventory

    Noroviruses are the leading cause of nonbacterial gastroenteritis outbreaks in the United States, some of which are caused by the ingestion of contaminated water. These viruses are usually detected and genotyped using reverse transcription-polymerase chain reaction (RT-PCR) base...

  15. New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

    EPA Science Inventory

    Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

  16. DEVELOPMENT OF MOLECULAR METHODS TO DETECT EMERGING VIRUSES

    EPA Science Inventory

    A large number of human enteric viruses are known to cause gastrointestinal illness and waterborne outbreaks. Many of these are emerging viruses that do not grow or grow poorly in cell culture and so molecular detectoin methods based on the polymerase chain reaction (PCR) are be...

  17. Detection of foodborne pathogens using microarray technology

    USDA-ARS?s Scientific Manuscript database

    Assays based on the polymerase chain reaction (PCR) are now accepted methods for rapidly confirming the presence or absence of specific pathogens in foods and other types of samples. Conventional PCR requires the use of agarose gel electrophoresis to detect the PCR product; whereas, real-time PCR c...

  18. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  19. Peroxy radical measurements with NCAR's chemical amplifier

    NASA Technical Reports Server (NTRS)

    Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

    1994-01-01

    The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

  20. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  1. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  2. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  3. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  4. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  5. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  6. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  7. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

    PubMed

    Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

    2000-01-01

    Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

  8. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  9. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  11. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    PubMed

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  12. Nuclear Data Sheets for A = 222

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, S.; Tuli, J.; Jain,A.K.

    The ENSDF evaluation for A=222 mass chain (1996El01) has been updated on the basis of the experimental results, since September 1995 (literature cutoff date in 1996El01), from various reaction and decay studies for all nuclides in A=222 mass chain (Z=84 to 92). A new nuclide ({sup 222}Po) has since been observed. In addition, new measurements have been reported in Rn, Th and Ra nuclides. The results obtained from various theoretical studies are given as comments. The updated level and decay schemes, and experimental decay and reaction data on which they are based, are summarized and presented for all the nuclidesmore » with mass number A=222. The adopted values of level energies, level spins and parities are given, and {gamma}-ray energies, intensities, as well as other nuclear properties are presented.« less

  13. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  14. Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

    PubMed Central

    Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

    1997-01-01

    We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619

  15. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  16. Genomic DNA-based absolute quantification of gene expression in Vitis

    USDA-ARS?s Scientific Manuscript database

    Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., an...

  17. Relationship and Variation of qPCR and Culturable Enterococci Estimates in Ambient Surface Waters Are Predictable

    EPA Science Inventory

    The quantitative polymerase chain reaction (qPCR) method provides rapid estimates of fecal indicator bacteria densities that have been indicated to be useful in the assessment of water quality. Primarily because this method provides faster results than standard culture-based meth...

  18. Use of DNA markers in forest tree improvement research

    Treesearch

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  19. NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

    EPA Science Inventory

    Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

  20. Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

    DTIC Science & Technology

    2006-06-01

    51 Appendix C. Promega Restriction Digest Protocol ....................................................53...Rsa1 Restriction Digest Results............................................................................180 9. DNA Base Pair Comparison...particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme (Edwards

  1. The Design, Development, Demonstration and Transfer of Advanced Command and Control (C2) Computer-Based Systems

    DTIC Science & Technology

    1980-09-30

    typography is voluminous and directly applicable. Research dealing directly with the line printer used in computer output is scanty, but consistent with...available to the researcher. While this may stimulate rapid software production, it often creates sets of chain- reaction problems. Accordingly

  2. 9 CFR 145.14 - Testing.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

  3. 9 CFR 145.14 - Testing.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

  4. 9 CFR 145.14 - Testing.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

  5. DISTRIBUTION OF SIX VIRULENCE FACTORS IN AEROMONAS SPECIES ISOLATED FROM US DRINKING WATER UTILITIES: A PCR IDENTIFICATION

    EPA Science Inventory

    Surveys of finished drinking water conducted by the U.S. EPA during 2000-2001, revealed 7 out of 16 water utilities encompassing four states, were contaminated with Aeromonas species. A Polymerase Chain reaction (PCR) based genetic characterization determined the presence of six...

  6. Checking of individuality by DNA profiling.

    PubMed

    Brdicka, R; Nürnberg, P

    1993-08-25

    A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.

  7. Process for crosslinking and extending conjugated diene-containing polymers

    NASA Technical Reports Server (NTRS)

    Bell, Vernon L. (Inventor); Havens, Stephen J. (Inventor)

    1977-01-01

    A process using a Diels-Alder reaction which increases the molecular weight and/or crosslinks polymers by reacting the polymers with bisunsaturated dienophiles is developed. The polymer comprises at least 75% by weight based on the reaction product, has a molecular weight of at least 5000 and a plurality of conjugated 1,3-diene systems incorporated into the molecular structure. A dienophile reaction with the conjugated 1,3-diene of the polymer is at least 1% by weight based on the reaction product. Examples of the polymer include polyesters, polyamides, polyethers, polysulfones and copolymers. The bisunsaturated dienophiles may include bis-maleimides, bis maleic and bis tumaric esters and amides. This method for expanding the molecular weight chains of the polymers, preferable thermoplastics, is advantageous for processing or fabricating thermoplastics. A low molecular weight thermoplastic is converted to a high molecular weight plastic having improved strength and toughness for use in the completed end use article.

  8. Experimental Study of Serpentinization Reactions

    NASA Technical Reports Server (NTRS)

    Cohen, B. A.; Brearley, A. J.; Ganguly, J.; Liermann, H.-P.; Keil, K.

    2004-01-01

    Current carbonaceous chondrite parent-body thermal models [1-3] produce scenarios that are inconsistent with constraints on aqueous alteration conditions based on meteorite mineralogical evidence, such as phase stability relationships within the meteorite matrix minerals [4] and isotope equilibration arguments [5, 6]. This discrepancy arises principally because of the thermal runaway effect produced by silicate hydration reactions (here loosely called serpentinization, as the principal products are serpentine minerals), which are so exothermic as to produce more than enough heat to melt more ice and provide a self-sustaining chain reaction. One possible way to dissipate the heat of reaction is to use a very small parent body [e.g., 2] or possibly a rubble pile model. Another possibility is to release this heat more slowly, which depends on the alteration reaction path and kinetics.

  9. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  10. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  11. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  12. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  13. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  14. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  15. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  16. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  17. Thermodynamics of enzyme-catalyzed esterifications: II. Levulinic acid esterification with short-chain alcohols.

    PubMed

    Altuntepe, Emrah; Emel'yanenko, Vladimir N; Forster-Rotgers, Maximilian; Sadowski, Gabriele; Verevkin, Sergey P; Held, Christoph

    2017-10-01

    Levulinic acid was esterified with methanol, ethanol, and 1-butanol with the final goal to predict the maximum yield of these equilibrium-limited reactions as function of medium composition. In a first step, standard reaction data (standard Gibbs energy of reaction Δ R g 0 ) were determined from experimental formation properties. Unexpectedly, these Δ R g 0 values strongly deviated from data obtained with classical group contribution methods that are typically used if experimental standard data is not available. In a second step, reaction equilibrium concentrations obtained from esterification catalyzed by Novozym 435 at 323.15 K were measured, and the corresponding activity coefficients of the reacting agents were predicted with perturbed-chain statistical associating fluid theory (PC-SAFT). The so-obtained thermodynamic activities were used to determine Δ R g 0 at 323.15 K. These results could be used to cross-validate Δ R g 0 from experimental formation data. In a third step, reaction-equilibrium experiments showed that equilibrium position of the reactions under consideration depends strongly on the concentration of water and on the ratio of levulinic acid: alcohol in the initial reaction mixtures. The maximum yield of the esters was calculated using Δ R g 0 data from this work and activity coefficients of the reacting agents predicted with PC-SAFT for varying feed composition of the reaction mixtures. The use of the new Δ R g 0 data combined with PC-SAFT allowed good agreement to the measured yields, while predictions based on Δ R g 0 values obtained with group contribution methods showed high deviations to experimental yields.

  18. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

    PubMed Central

    Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

    2017-01-01

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

  19. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  20. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  1. Predicting gaseous reaction rates of short chain chlorinated paraffins with ·OH: overcoming the difficulty in experimental determination.

    PubMed

    Li, Chao; Xie, Hong-Bin; Chen, Jingwen; Yang, Xianhai; Zhang, Yifei; Qiao, Xianliang

    2014-12-02

    Short chain chlorinated paraffins (SCCPs) are under evaluation for inclusion in the Stockholm Convention on persistent organic pollutants. However, information on their reaction rate constants with gaseous ·OH (kOH) is unavailable, limiting the evaluation of their persistence in the atmosphere. Experimental determination of kOH is confined by the unavailability of authentic chemical standards for some SCCP congeners. In this study, we evaluated and selected density functional theory (DFT) methods to predict kOH of SCCPs, by comparing the experimental kOH values of six polychlorinated alkanes (PCAs) with those calculated by the different theoretical methods. We found that the M06-2X/6-311+G(3df,2pd)//B3LYP/6-311 +G(d,p) method is time-effective and can be used to predict kOH of PCAs. Moreover, based on the calculated kOH of nine SCCPs and available experimental kOH values of 22 PCAs with low carbon chain, a quantitative structure-activity relationship (QSAR) model was developed. The molecular structural characteristics determining the ·OH reaction rate were discussed. logkOH was found to negatively correlate with the percentage of chlorine substitutions (Cl%). The DFT calculation method and the QSAR model are important alternatives to the conventional experimental determination of kOH for SCCPs, and are prospective in predicting their persistence in the atmosphere.

  2. A TaqMan-based real-time PCR assay for porcine parvovirus 4 detection and quantification in reproductive tissues of sows

    USDA-ARS?s Scientific Manuscript database

    Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...

  3. Analysis of genetic diversity of certain species of Piper using RAPD-based molecular markers.

    PubMed

    Chowdhury, Utpal; Tanti, Bhaben; Rethy, Parakkal; Gajurel, Padma Raj

    2014-09-01

    The utility of RAPD markers in assessing genetic diversity and phenetic relationships of six different species of Piper from Northeast India was investigated. Polymerase chain reaction (PCR) with four arbitrary 10-mer oligonucleotide primers applied to the six species produced a total of 195 marker bands, of which, 159 were polymorphic. On average, six RAPD fragments were amplified per reaction. In the UPGMA phenetic dendrogram based on Jaccard's coefficient, the different accessions of Piper showed a high level of genetic variation. This study may be useful in identifying diverse genetic stocks of Piper, which may then be conserved on a priority basis.

  4. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  5. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  6. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  7. Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

    PubMed

    Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

    2007-06-01

    Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

  8. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  9. Ionizable side chains at catalytic active sites of enzymes.

    PubMed

    Jimenez-Morales, David; Liang, Jie; Eisenberg, Bob

    2012-05-01

    Catalytic active sites of enzymes of known structure can be well defined by a modern program of computational geometry. The CASTp program was used to define and measure the volume of the catalytic active sites of 573 enzymes in the Catalytic Site Atlas database. The active sites are identified as catalytic because the amino acids they contain are known to participate in the chemical reaction catalyzed by the enzyme. Acid and base side chains are reliable markers of catalytic active sites. The catalytic active sites have 4 acid and 5 base side chains, in an average volume of 1,072 Å(3). The number density of acid side chains is 8.3 M (in chemical units); the number density of basic side chains is 10.6 M. The catalytic active site of these enzymes is an unusual electrostatic and steric environment in which side chains and reactants are crowded together in a mixture more like an ionic liquid than an ideal infinitely dilute solution. The electrostatics and crowding of reactants and side chains seems likely to be important for catalytic function. In three types of analogous ion channels, simulation of crowded charges accounts for the main properties of selectivity measured in a wide range of solutions and concentrations. It seems wise to use mathematics designed to study interacting complex fluids when making models of the catalytic active sites of enzymes.

  10. Ionizable Side Chains at Catalytic Active Sites of Enzymes

    PubMed Central

    Jimenez-Morales, David; Liang, Jie

    2012-01-01

    Catalytic active sites of enzymes of known structure can be well defined by a modern program of computational geometry. The CASTp program was used to define and measure the volume of the catalytic active sites of 573 enzymes in the Catalytic Site Atlas database. The active sites are identified as catalytic because the amino acids they contain are known to participate in the chemical reaction catalyzed by the enzyme. Acid and base side chains are reliable markers of catalytic active sites. The catalytic active sites have 4 acid and 5 base side chains, in an average volume of 1072 Å3. The number density of acid side chains is 8.3 M (in chemical units); the number density of basic side chains is 10.6 M. The catalytic active site of these enzymes is an unusual electrostatic and steric environment in which side chains and reactants are crowded together in a mixture more like an ionic liquid than an ideal infinitely dilute solution. The electrostatics and crowding of reactants and side chains seems likely to be important for catalytic function. In three types of analogous ion channels, simulation of crowded charges accounts for the main properties of selectivity measured in a wide range of solutions and concentrations. It seems wise to use mathematics designed to study interacting complex fluids when making models of the catalytic active sites of enzymes. PMID:22484856

  11. DL-ADR: a novel deep learning model for classifying genomic variants into adverse drug reactions.

    PubMed

    Liang, Zhaohui; Huang, Jimmy Xiangji; Zeng, Xing; Zhang, Gang

    2016-08-10

    Genomic variations are associated with the metabolism and the occurrence of adverse reactions of many therapeutic agents. The polymorphisms on over 2000 locations of cytochrome P450 enzymes (CYP) due to many factors such as ethnicity, mutations, and inheritance attribute to the diversity of response and side effects of various drugs. The associations of the single nucleotide polymorphisms (SNPs), the internal pharmacokinetic patterns and the vulnerability of specific adverse reactions become one of the research interests of pharmacogenomics. The conventional genomewide association studies (GWAS) mainly focuses on the relation of single or multiple SNPs to a specific risk factors which are a one-to-many relation. However, there are no robust methods to establish a many-to-many network which can combine the direct and indirect associations between multiple SNPs and a serial of events (e.g. adverse reactions, metabolic patterns, prognostic factors etc.). In this paper, we present a novel deep learning model based on generative stochastic networks and hidden Markov chain to classify the observed samples with SNPs on five loci of two genes (CYP2D6 and CYP1A2) respectively to the vulnerable population of 14 types of adverse reactions. A supervised deep learning model is proposed in this study. The revised generative stochastic networks (GSN) model with transited by the hidden Markov chain is used. The data of the training set are collected from clinical observation. The training set is composed of 83 observations of blood samples with the genotypes respectively on CYP2D6*2, *10, *14 and CYP1A2*1C, *1 F. The samples are genotyped by the polymerase chain reaction (PCR) method. A hidden Markov chain is used as the transition operator to simulate the probabilistic distribution. The model can perform learning at lower cost compared to the conventional maximal likelihood method because the transition distribution is conditional on the previous state of the hidden Markov chain. A least square loss (LASSO) algorithm and a k-Nearest Neighbors (kNN) algorithm are used as the baselines for comparison and to evaluate the performance of our proposed deep learning model. There are 53 adverse reactions reported during the observation. They are assigned to 14 categories. In the comparison of classification accuracy, the deep learning model shows superiority over the LASSO and kNN model with a rate over 80 %. In the comparison of reliability, the deep learning model shows the best stability among the three models. Machine learning provides a new method to explore the complex associations among genomic variations and multiple events in pharmacogenomics studies. The new deep learning algorithm is capable of classifying various SNPs to the corresponding adverse reactions. We expect that as more genomic variations are added as features and more observations are made, the deep learning model can improve its performance and can act as a black-box but reliable verifier for other GWAS studies.

  12. Hyperbranched Hybridization Chain Reaction for Triggered Signal Amplification and Concatenated Logic Circuits.

    PubMed

    Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying; Wang, Zonghua

    2015-07-06

    A hyper-branched hybridization chain reaction (HB-HCR) is presented herein, which consists of only six species that can metastably coexist until the introduction of an initiator DNA to trigger a cascade of hybridization events, leading to the self-sustained assembly of hyper-branched and nicked double-stranded DNA structures. The system can readily achieve ultrasensitive detection of target DNA. Moreover, the HB-HCR principle is successfully applied to construct three-input concatenated logic circuits with excellent specificity and extended to design a security-mimicking keypad lock system. Significantly, the HB-HCR-based keypad lock can alarm immediately if the "password" is incorrect. Overall, the proposed HB-HCR with high amplification efficiency is simple, homogeneous, fast, robust, and low-cost, and holds great promise in the development of biosensing, in the programmable assembly of DNA architectures, and in molecular logic operations. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  14. Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

    PubMed

    Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

    2015-08-01

    Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

    PubMed

    Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

    2007-01-01

    Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

  16. Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

    PubMed

    Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

    2005-01-01

    A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

  17. Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

    PubMed

    Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

    2017-02-23

    Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

  18. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

    PubMed

    James, Ameh; Macdonald, Joanne

    2015-01-01

    Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

  19. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  20. Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

    PubMed

    Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

    2017-02-01

    Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

  1. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  2. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  3. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  4. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  5. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  7. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    PubMed

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  8. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    PubMed Central

    Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

  9. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    PubMed Central

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

  10. Quantitative analysis of pork and chicken products by droplet digital PCR.

    PubMed

    Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

    2014-01-01

    In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

  11. Enzyme- and label-free electrochemical aptasensor for kanamycin detection based on double stir bar-assisted toehold-mediated strand displacement reaction for dual-signal amplification.

    PubMed

    Hong, Feng; Chen, Xixue; Cao, Yuting; Dong, Youren; Wu, Dazhen; Hu, Futao; Gan, Ning

    2018-07-30

    It is critically important to detect antibiotic residues for monitoring food safety. In this study, an enzyme- and label-free electrochemical aptasensor for antibiotics, with kanamycin (Kana) as a typical analyte, was developed based on a double stir bar-assisted toehold-mediated strand displacement reaction (dSB-TMSDR) for dual-signal amplification. First, we modified two gold electrodes (E-1 and E-2) with different DNA probes (S1/S2 hybrid probe in E-1 and DNA fuel strand S3 in E-2). In the presence of Kana, an S1/S2 probe can be disassembled from E-1 to form an S2/Kana complex in supernatant. The S2/Kana could react with S3 on E-2 to form S2/S3 hybrid and release Kana through TMSDR. After then, the target recycling was triggered. Subsequently, the formed S2/S3 hybrid can also trigger a hybridization chain reaction (HCR). Consequently, the dual-signal amplification strategy was established, which resulted in many long dsDNA chains on E-2. The chains can associate with methylene blue (MB) as redox probes to produce a current response for the quantification of Kana. The assay exhibited high sensitivity and specificity with a detection limit at 16 fM Kana due to the dual-signal amplification. The double stir bars system can both increase phase separation and prevent leakage of DNA fuel to reduce background interference. Moreover, it allows flexible sequence design of the TMSDR probes. The assay was successfully employed to detect Kana residues in food and showed potential application value in food safety detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

    PubMed

    Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

    2014-02-01

    Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

  13. Synthesis of structured lipids by lipase-catalyzed interesterification of triacetin with camellia oil methyl esters and preliminary evaluation of their plasma lipid-lowering effect in mice.

    PubMed

    Cao, Yu; Qi, Suijian; Zhang, Yang; Wang, Xiaoning; Yang, Bo; Wang, Yonghua

    2013-03-25

    Structured lipids (SLCTs triacylglycerols with short- and long-chain acyl residues) were synthesized by interesterification of triacetin and fatty acid methyl esters (FAMEs) from camellia oil, followed by molecular distillation for purification. Different commercial immobilized lipases (Lipozyme RM IM and Novozyme 435), the substrate molar ratios of FAMEs to triacetin, the reaction temperatures and the lipase amounts were studied for their efficiency in producing SLCTs. Results showed that Novozyme 435 was more suitable for this reaction system. Moreover, the optimal reaction conditions for the highest conversion of FAMEs and the highest LLS-TAGs (triacylglycerols with one short- and two long-chain acyl residues) yields were achieved at a molar ratio of FAMEs to triacetin of 3:1, 50 °C of reaction temperature and a lipase amount of 4% (w/v). Scale-up was conducted based on the optimized reaction conditions. Results showed that after 24 h of reaction , the conversion rate of FAMEs was 82.4% and the rate of disubstituted triacetin was 52.4 mol%. The final product yield rate was 94.6%. The effects of the synthesized SLCTs on the plasma lipid level of fasting mice were also studied. The SLCTs could effectively lessen the total triacylglycerol levels in plasma compared to the triacylglycerol group in fasting NIH mice. It suggested that this type of structured lipid might be beneficial for human health, especially for the prevention of obesity.

  14. Selective Transformation of β-Lactam Antibiotics by Peroxymonosulfate: Reaction Kinetics and Nonradical Mechanism.

    PubMed

    Chen, Jiabin; Fang, Cong; Xia, Wenjun; Huang, Tianyin; Huang, Ching-Hua

    2018-02-06

    While the β-lactam antibiotics are known to be susceptible to oxidative degradation by sulfate radical (SO 4 •- ), here we report that peroxymonosulfate (PMS) exhibits specific high reactivity toward β-lactam antibiotics without SO 4 •- generation for the first time. Apparent second-order reaction constants (k 2,app ) were determined for the reaction of PMS with three penicillins, five cephalosporins, two carbapenems, and several structurally related chemicals. The pH-dependency of k 2,app could be well modeled based on species-specific reactions. On the basis of reaction kinetics, stoichiometry, and structure-activity assessment, the thioether sulfur, on the six- or five-membered rings (penicillins and cephalosporins) and the side chain (carbapenems), was the main reaction site for PMS oxidation. Cephalosporins were more reactive toward PMS than penicillins and carbapenems, and the presence of a phenylglycine side chain significantly enhanced cephalosporins' reactivity toward PMS. Product analysis indicated oxidation of β-lactam antibiotics to two stereoisomeric sulfoxides. A radical scavenging study and electron paramagnetic resonance (EPR) technique confirmed lack of involvement of radical species (e.g., SO 4 •- ). Thus, the PMS-induced oxidation of β-lactam antibiotics was proposed to proceed through a nonradical mechanism involving direct two-electron transfer along with the heterolytic cleavage of the PMS peroxide bond. The new findings of this study are important for elimination of β-lactam antibiotic contamination, because PMS exhibits specific high reactivity and suffers less interference from the water matrix than the radical process.

  15. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

    USGS Publications Warehouse

    Chase, D.M.; Pascho, R.J.

    1998-01-01

    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

  16. [Study on the calcium-based sorbent for removal fluorine during coal combustion].

    PubMed

    Li, Shu-ling; Qi, Qing-jie; Liu, Jian-zhong; Cao, Xin-yu; Zhou, Jun-hu; Cen, Ke-fa

    2004-03-01

    In the paper, the reaction of CaO-HF and fluorine removal mechanics at high temperature by blending calcium-based sorbents with coal during coal combustion were discussed, and test results about fluorine retention during coal combustion in fluidized bed and chain-grate furnace were reported. The results identified that lime and calcium-based sorbets developed can restratin the emission of fluorine during coal combustion. The efficiency of fluorine removal can reach 66.7%-70.0% at Ca/F 60-70 by blending lime with coal in fluidized bed combustion, and the efficiency of fluorine removal are between 57.32% and 75.19% by blending calcium-based sorbets with coal in chain-grate furnace combustion. Blending CaO or lime with coal during coal combustion can remove SO2 and HF simultaneously.

  17. 9 CFR 147.52 - Approved tests.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... for use. The cooperating laboratories must perform the assay exactly as stated in the supplied instructions. Each laboratory must test a panel of at least 25 known positive clinical samples supplied by the...) H7L4S3. (3) DuPont Qualicon BAX Polymerase Chain Reaction (PCR)-based assay for Salmonella, DuPont...

  18. 9 CFR 147.52 - Approved tests.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... for use. The cooperating laboratories must perform the assay exactly as stated in the supplied instructions. Each laboratory must test a panel of at least 25 known positive clinical samples supplied by the...) H7L4S3. (3) DuPont Qualicon BAX Polymerase Chain Reaction (PCR)-based assay for Salmonella, DuPont...

  19. Application of multiplex PCR, pulsed-field gel electrophoresis (PFGE), and BOX-PCR for molecular analysis of enterococci

    USDA-ARS?s Scientific Manuscript database

    The objective of the study was to use band-based molecular methods including BOX-PCR (Polymerase Chain Reaction) and Pulsed-Field Gel Electrophoresis (PFGE) to determine if genetically related enterococci were found among different stores, food types, or years. Enterococci were also characterized f...

  20. Development of a duplex ddPCR assay for detection of “Candidatus Liberibacter asiaticus”

    USDA-ARS?s Scientific Manuscript database

    Huanglongbing (HLB) (aka citrus greening) is a devastating citrus disease associated with “Candidatus Liberibacter asiaticus” (CLas). Currently, diagnosis of CLas in regulatory samples is based on a real-time quantitative polymerase chain reaction (qPCR) assay using 16S rRNA gene specific primers/pr...

  1. USE OF MOLECULAR PROBES TO ASSESS GEOGRAPHIC DISTRIBUTION OF PFIESTERIA SPECIES. (R827084)

    EPA Science Inventory

    We have developed multiple polymerase chain reaction (PCR)-based methods for the
    detection of Pfiesteria sp. in cultures and environmental samples. More than 2,100 water and
    sediment samples from estuarine sites of the U.S. Atlantic and gulf coasts were assayed for the
    p...

  2. Mapping a Mutation in "Caenorhabditis elegans" Using a Polymerase Chain Reaction-Based Approach

    ERIC Educational Resources Information Center

    Myers, Edith M.

    2014-01-01

    Many single nucleotide polymorphisms (SNPs) have been identified within the "Caenorhabditis elegans" genome. SNPs present in the genomes of two isogenic "C. elegans" strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which…

  3. Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

    EPA Science Inventory

    Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...

  4. West Nile Virus Encephalitis in a Barbary Macaque (Macaca sylvanus)

    PubMed Central

    Barker, Ian K.; Crawshaw, Graham J.; Bertelsen, Mads F.; Drebot, Michael A.; Andonova, Maya

    2004-01-01

    An aged Barbary ape (Macaca sylvanus) at the Toronto Zoo became infected with naturally acquired West Nile virus (WNV) encephalitis that caused neurologic signs, which, associated with other medical problems, led to euthanasia. The diagnosis was based on immunohistochemical assay of brain lesions, reverse transcriptase–polymerase chain reaction, and virus isolation. PMID:15200866

  5. Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

    EPA Science Inventory

    Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

  6. Microfluidic Gel Electrophoresis in the Undergraduate Laboratory Applied to Food Analysis

    ERIC Educational Resources Information Center

    Chao, Tzu-Chiao; Bhattacharya, Sanchari; Ros, Alexandra

    2012-01-01

    A microfluidics-based laboratory experiment for the analysis of DNA fragments in an analytical undergraduate course is presented. The experiment is set within the context of food species identification via amplified DNA fragments. The students are provided with berry samples from which they extract DNA and perform polymerase chain reaction (PCR)…

  7. DNA-Based Analyses of Molds in Singapore Public Buildings Results in a Proposed Singapore Environmental Relative Moldiness Index

    EPA Science Inventory

    Dust samples (n=75) were collected from shopping malls, hotels and libraries in Singapore and then analyzed using Mold Specific Quantitative Polymerase Chain Reaction(MSQPCR) for the 36 molds that make up the Environmental Relative Moldiness Index (ERMI). Most of these molds (23/...

  8. Distribution and survival of Pseudomonas sp. on Italian ryegrass and Curly dock in Georgia

    USDA-ARS?s Scientific Manuscript database

    Yellow bud, caused by Pseudomonas sp. is an emerging bacterial disease of onion. Polymerase chain reaction (PCR) assay based on the coronafacate ligase (cfl) and HrpZ genes were used to detect initial suspected bacteria on weeds. Growth on an agar medium, ability to cause a hypersensitive response i...

  9. [Enzymatic conversion of tetradecanol in heterogenous phase by yeast-alcohol dehydrogenase].

    PubMed

    Rothe, U; Schöpp, W; Aurich, H

    1976-01-01

    Alcohol dehydrogenase from yeast converts long-chain primary alcohols not only in the dissolved state, but also at the surface of undissolved particles. Tetradecanol beads with a defined surface can be produced and employed as model substrate. The reaction rate was determined by the proton release accomplished in the reaction. The initial reaction rate depends on the enzyme concentration. The relation is nonlinear (vi = k-[e]0,4); the numerical value of the exponent (n = 0.4) argues in favour of a reaction occurring at the interface. The Lineweaver-Burk plots become linear if the substrate concentrations are based on the molar surface concentrations of the particles. The pH optimum for the reaction at the surface is displaced by 0.25 pH units towards the alkaline region (compared with ethanol as substrate). The activation energy of the reaction with tetradecanol beads as substrate is 30% lower than that for the ethanol oxydation.

  10. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  11. Polymerase chain reaction in the detection of tumor cells: new approaches in diagnosis and follow-up of patients with thyroid cancer.

    PubMed

    Bojunga, Jörg; Kusterer, Klaus; Schumm-Draeger, Petra-Maria; Usadel, Klaus-Henning

    2002-12-01

    Thyroid cancers are the most common endocrine malignancies and are being diagnosed with increasing frequency. In addition to other measures, diagnosis is based on fine-needle aspiration cytology examination. Recently, new assays using reverse transcription-polymerase chain reaction (PCR) are being tested to improve sensitivity and specificity of primary diagnosis and detection of recurrent thyroid cancer. In the preoperative diagnosis of thyroid cancer, several tissue- and/or tumor-specific mRNA have been described and in several cases, a higher sensitivity and specificity could be achieved using molecular techniques compared to conventional methods. In the postoperative follow-up of patients with thyroid cancer, conflicting data have been published and the use of PCR techniques revealed several problems of the molecular approach, which are based on some technical as well as biologic limitations. Despite these problems, which are discussed in detail in this review, molecular techniques may nevertheless improve the sensitivity and accuracy of fine-needle aspiration of thyroid nodules, fine-needle aspiration of metastases, and detection of recurrent disease in peripheral blood samples.

  12. Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease.

    PubMed

    Olsvik, B; Olsen, I; Tenover, F C

    1995-04-01

    The polymerase chain reaction was used to examine 114 tetracycline-resistant anaerobic and facultative anaerobic bacterial isolates from patients with periodontal disease for the tet(M) and tet(O) genes. A 740-base-pair fragment of the tet(M) gene was amplified from 84 of 114 isolates, and a 519-base-pair fragment of the tet(O) gene was amplified from 13 streptococcal isolates. Six of 7 tetracycline-resistant isolates of Veillonella spp. and tetracycline-resistant isolates of Eubacterium spp. (n = 3), Eubacterium saburreum (n = 1), Streptococcus intermedius (n = 5) and Gemella morbillorum (n = 2) all harbored the tet(M) gene. The tet(M) and tet(O) negative as well as selected positive isolates were tested for the tet(K) and tet(L) genes using DNA probes. All isolates of Staphylococcus spp. (n = 11) hybridized with the tet(K) probe. None of the isolates tested hybridized with the probe for tet(L). This is the first report of the tet(M) gene in the facultative bacterium G. morbillorum and in E. saburreum.

  13. Quantitative competitive (QC) PCR for quantification of porcine DNA.

    PubMed

    Wolf, C; Lüthy, J

    2001-02-01

    Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

  14. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    PubMed

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Multistimuli Response Micro- and Nanolayers of a Coordination Polymer Based on Cu2 I2 Chains Linked by 2-Aminopyrazine.

    PubMed

    Conesa-Egea, J; Gallardo-Martínez, J; Delgado, S; Martínez, J I; Gonzalez-Platas, J; Fernández-Moreira, V; Rodríguez-Mendoza, U R; Ocón, P; Zamora, F; Amo-Ochoa, P

    2017-09-01

    A nonporous laminar coordination polymer of formula [Cu 2 I 2 (2-aminopyrazine)] n is prepared by direct reaction between CuI and 2-aminopyrazine, two industrially available building blocks. The fine tuning of the reaction conditions allows obtaining [Cu 2 I 2 (2-aminopyrazine)] n in micrometric and nanometric sizes with same structure and composition. Interestingly, both materials show similar reversible thermo- and pressure-luminescent response as well as reversible electrical response to volatile organic solvents such as acetic acid. X-ray diffraction studies under different conditions, temperatures and pressures, in combination with theoretical calculations allow rationalizing the physical properties of this compound and its changes under physical stimuli. Thus, the emission dramatically increases when lowering the temperature, while an enhancement of the pressure produces a decrease in the emission intensity. These observations emerge as a direct consequence of the high structural flexibility of the Cu 2 I 2 chains which undergo a contraction in CuCu distances as far as temperature decreases or pressure increases. However, the strong structural changes observed under high pressure lead to an unexpected effect that produces a less effective CuCu orbital overlapping that justifies the decrease in the intensity emission. This work shows the high potential of materials based on Cu 2 I 2 chains for new applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Crystal Structure of Haloalkane Dehalogenase LinB from Sphingomonas paucimobilis UT26 at 0.95 Å Resolution: Dynamics of Catalytic Residues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oakley, Aaron J.; Klvana, Martin; Otyepka, Michal

    We present the structure of LinB, a 33-kDa haloalkane dehalogenase from Sphingomonas paucimobilis UT26, at 0.95 {angstrom} resolution. The data have allowed us to directly observe the anisotropic motions of the catalytic residues. In particular, the side-chain of the catalytic nucleophile, Asp108, displays a high degree of disorder. It has been modeled in two conformations, one similar to that observed previously (conformation A) and one strained (conformation B) that approached the catalytic base (His272). The strain in conformation B was mainly in the C{sub {alpha}}-C{sub {beta}}-C{sub {gamma}} angle (126{sup o}) that deviated by 13.4{sup o} from the 'ideal' bond anglemore » of 112.6{sup o}. On the basis of these observations, we propose a role for the charge state of the catalytic histidine in determining the geometry of the catalytic residues. We hypothesized that double-protonation of the catalytic base (His272) reduces the distance between the side-chain of this residue and that of the Asp108. The results of molecular dynamics simulations were consistent with the structural data showing that protonation of the His272 side-chain nitrogen atoms does indeed reduce the distance between the side-chains of the residues in question, although the simulations failed to demonstrate the same degree of strain in the Asp108 C{sub {alpha}}-C{sub {beta}}-C{sub {gamma}} angle. Instead, the changes in the molecular dynamics structures were distributed over several bond and dihedral angles. Quantum mechanics calculations on LinB with 1-chloro-2,2-dimethylpropane as a substrate were performed to determine which active site conformations and protonation states were most likely to result in catalysis. It was shown that His272 singly protonated at N{sub {delta}1} and Asp108 in conformation A gave the most exothermic reaction ({Delta}H = -22 kcal/mol). With His272 doubly protonated at N{sub {delta}1} and N{sub {epsilon}2}, the reactions were only slightly exothermic or were endothermic. In all calculations starting with Asp108 in conformation B, the Asp108 C{sub {alpha}}-C{sub {beta}}-C{sub {gamma}} angle changed during the reaction and the Asp108 moved to conformation A. The results presented here indicate that the positions of the catalytic residues and charge state of the catalytic base are important for determining reaction energetics in LinB.« less

  17. Reaction of 3-Amino-1,2,4-Triazole with Diethyl Phosphite and Triethyl Orthoformate: Acid-Base Properties and Antiosteoporotic Activities of the Products.

    PubMed

    Miszczyk, Patrycja; Wieczorek, Dorota; Gałęzowska, Joanna; Dziuk, Błażej; Wietrzyk, Joanna; Chmielewska, Ewa

    2017-02-08

    The reaction of diethyl phosphite with triethyl orthoformate and a primary amine followed by hydrolysis is presented, and the reaction was suitable for the preparation of (aminomethylene)bisphosphonates. 3-Amino-1,2,4-triazole was chosen as an interesting substrate for this reaction because it possesses multiple groups that can serve as the amino component in the reaction-namely, the side-chain and triazole amines. This substrate readily forms 1,2,4-triazolyl-3-yl-aminomethylenebisphosphonic acid (compound 1 ) as a major product, along with N -ethylated bisphosphonates as side products. The in vitro antiproliferative effects of the synthesized aminomethylenebisphosphonic acids against J774E macrophages were determined. These compounds exhibit similar activity to zoledronic acid and higher activity than incadronic acid.

  18. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  19. Microfluidics-Based PCR for Fusion Transcript Detection.

    PubMed

    Chen, Hui

    2016-01-01

    The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

  20. Biochemistry of Ammonia Monoxygenase from Nitrosomonas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alan Hooper

    2009-07-15

    Major results. 1. CytochromecM552, a protein in the electron transfer chain to ammonia monooxygenase. Purification, modeling of protein structure based on primary structure, characterization of 4 hemes by magnetic spectroscopy, potentiometry, ligand binding and turnover. Kim, H. J., ,Zatsman, et al. 2008). 2. Characterization of proteins which thought to be involved in the AMO reaction or to protect AMO from toxic nitrogenous intermediates such as NO. Nitrosocyanin is a protein present only in bacteria which catalyze the ammonia monoxygenase reaction (1). Cytochrome c P460 beta and cytochrome c’ beta.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lebrilla, C.B.; Schulze, C.; Schwarz, H.

    The gas-phase reaction of bare Fe/sup +/ atoms with linear alkyl nitriles generates end-on complexes which, depending on geometrical constraints, specifically interact with remote C-H bonds. Based on chain length effect studies and the investigation of labeled precursors, a mechanism is suggested which accounts for the chemospecificity observed for the loss of H/sub 2/ and C/sub 2/H/sub 4/ from RCN/Fe/sup +/ complexes. This mechanism does not follow the analogous reaction of Fe/sup +/ with alkenes and alkynes but involves an initial C-H insertion of the remote CH bonds followed by a C-C insertion.

  2. Diagnostic devices for isothermal nucleic acid amplification.

    PubMed

    Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

    2012-01-01

    Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.

  3. Diagnostic Devices for Isothermal Nucleic Acid Amplification

    PubMed Central

    Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

    2012-01-01

    Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development. PMID:22969402

  4. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  5. Impacts of Sampling and Handling Procedures on DNA- and RNA-based Microbial Characterization and Quantification of Groundwater and Saturated Soil

    DTIC Science & Technology

    2012-07-01

    use of molecular biological techniques (MBTs) has allowed microbial ecologists and environmental engineers to determine microbial community...metabolic genes). The most common approaches used in bioremediation research are those based on the polymerase chain reaction (PCR) amplification of... bioremediation . Because of its sensitivity compared to direct hybridization/probing, PCR is increasingly used to analyze groundwater samples and soil samples

  6. A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

    PubMed Central

    2017-01-01

    We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

  7. Development of a dry-reagent mix-based polymerase chain reaction as a novel tool for the identification of Acinetobacter species and its comparison with conventional polymerase chain reaction

    PubMed Central

    Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama

    2018-01-01

    BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209

  8. Review: Authentication and traceability of foods from animal origin by polymerase chain reaction-based capillary electrophoresis.

    PubMed

    Rodríguez-Ramírez, Roberto; González-Córdova, Aarón F; Vallejo-Cordoba, Belinda

    2011-01-31

    This work presents an overview of the applicability of PCR-based capillary electrophoresis (CE) in food authentication and traceability of foods from animal origin. Analytical approaches for authenticating and tracing meat and meat products and fish and seafood products are discussed. Particular emphasis will be given to the usefulness of genotyping in food tracing by using CE-based genetic analyzers. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Polymerase chain reaction-based detection of Pneumocystis jirovecii in bronchoalveolar lavage fluid for the diagnosis of pneumocystis pneumonia.

    PubMed

    Oren, Ilana; Hardak, Emilia; Finkelstein, Renato; Yigla, Mordechai; Sprecher, Hannah

    2011-09-01

    The diagnosis of pneumocystis pneumonia (PCP) in non-human immunodeficiency virus (HIV)-infected immunocompromised patients is notoriously difficult. The recent advent of polymerase chain reaction (PCR)-based detection systems, based on the identification of single fungal genes, has markedly improved diagnostic accuracy in this ominous disease. In an attempt to further improve diagnostic yield, the authors used a PCR-based detection system for Pneumocystis jirovecii, based on targeting 3 distinct genes. During the 4-year period (January 2005 to January 2009), all consecutive immunocompromised patients suspected of having PCP in the differential diagnosis underwent bronchoscopy with bronchoalveolar lavage sampling for the evaluation of the etiology of pulmonary infiltrates. Bronchoalveolar fluid was tested for the presence of a wide variety of possible etiological microorganisms. In a cohort of 214 immunocompromised patients (of which 198 were non-HIV immunocompromised patients) who underwent bronchoscopy with bronchoalveolar lavage for evaluation of pulmonary infiltrates, PCR correctly diagnosed PCP in 75% (42/56) compared with 14% (8/56) diagnosed by traditional stains, and increased diagnostic yield 5.4-fold. Given the absence of a sensitive gold standard, this study demonstrates the usefulness of a multigene PCR-based detection of Pneumocystis jirovecii DNA for supporting the clinical diagnosis of PCP, with high sensitivity and negative predictive value rates compared with direct stains, especially in non-HIV immunocompromised patients.

  10. Chemical Modification of Polysaccharides

    PubMed Central

    Cumpstey, Ian

    2013-01-01

    This review covers methods for modifying the structures of polysaccharides. The introduction of hydrophobic, acidic, basic, or other functionality into polysaccharide structures can alter the properties of materials based on these substances. The development of chemical methods to achieve this aim is an ongoing area of research that is expected to become more important as the emphasis on using renewable starting materials and sustainable processes increases in the future. The methods covered in this review include ester and ether formation using saccharide oxygen nucleophiles, including enzymatic reactions and aspects of regioselectivity; the introduction of heteroatomic nucleophiles into polysaccharide chains; the oxidation of polysaccharides, including oxidative glycol cleavage, chemical oxidation of primary alcohols to carboxylic acids, and enzymatic oxidation of primary alcohols to aldehydes; reactions of uronic-acid-based polysaccharides; nucleophilic reactions of the amines of chitosan; and the formation of unsaturated polysaccharide derivatives. PMID:24151557

  11. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  12. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  13. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  14. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  15. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  16. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  17. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  18. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  19. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  20. Knockout of the regulatory site of 3-ketoacyl-ACP synthase III enhances short- and medium-chain acyl-ACP synthesis.

    PubMed

    Abbadi, A; Brummel, M; Spener, F

    2000-10-01

    3-ketoacyl-acyl carrier protein synthase (KAS) III catalyses the first condensing step of the fatty acid synthase (FAS) type II reaction in plants and bacteria, using acetyl CoA and malonyl-acyl carrier protein (ACP) as substrates. Enzymatic characterization of recombinant KAS III from Cuphea wrightii embryo shows that this enzyme is strongly inhibited by medium-chain acyl-ACP end products of the FAS reaction, i.e. inhibition by lauroyl-ACP was uncompetitive towards acetyl CoA and non-competitive with regard to malonyl-ACP. This indicated a distinct attachment site for regulatory acyl-ACPs. Based on alignment of primary structures of various KAS IIIs and 3-ketoacyl CoA synthases, we suspected the motif G290NTSAAS296 to be responsible for binding of regulatory acyl-ACPs. Deletion of the tetrapeptide G290NTS293 led to a change of secondary structure and complete loss of KAS III condensing activity. Exchange of asparagine291 to aspartate, alanine294 to serine and alanine295 to proline, however, produced mutant enzymes with slightly reduced condensing activity, yet with insensitivity towards acyl-ACPs. To assess the potential of unregulated KAS III as tool in oil production, we designed in vitro experiments employing FAS preparations from medium-chain fatty acid-producing Cuphea lanceolata seeds and long-chain fatty acid-producing rape seeds, each supplemented with a fivefold excess of the N291D KAS III mutant. High amounts of short-chain acyl-ACPs in the case of C. lanceolata, and of medium-chain acyl-ACPs in the case of rape seed preparations, were obtained. This approach targets regulation and offers new possibilities to derive transgenic or non-transgenic plants for production of seed oils with new qualities.

  1. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  2. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  3. Accuracy of Reaction Cross Section for Exotic Nuclei in Glauber Model Based on MCMC Diagnostics

    NASA Astrophysics Data System (ADS)

    Rueter, Keiti; Novikov, Ivan

    2017-01-01

    Parameters of a nuclear density distribution for an exotic nuclei with halo or skin structures can be determined from the experimentally measured reaction cross-section. In the presented work, to extract parameters such as nuclear size information for a halo and core, we compare experimental data on reaction cross-sections with values obtained using expressions of the Glauber Model. These calculations are performed using a Markov Chain Monte Carlo algorithm. We discuss the accuracy of the Monte Carlo approach and its dependence on k*, the power law turnover point in the discreet power spectrum of the random number sequence and on the lag-1 autocorrelation time of the random number sequence.

  4. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Electron Transfer Dissociation: Effects of Cation Charge State on Product Partitioning in Ion/Ion Electron Transfer to Multiply Protonated Polypeptides

    PubMed Central

    Liu, Jian; McLuckey, Scott A.

    2012-01-01

    The effect of cation charge state on product partitioning in the gas-phase ion/ion electron transfer reactions of multiply protonated tryptic peptides, model peptides, and relatively large peptides with singly charged radical anions has been examined. In particular, partitioning into various competing channels, such as proton transfer (PT) versus electron transfer (ET), electron transfer with subsequent dissociation (ETD) versus electron transfer with no dissociation (ET,noD), and fragmentation of backbone bonds versus fragmentation of side chains, was measured quantitatively as a function of peptide charge state to allow insights to be drawn about the fundamental aspects of ion/ion reactions that lead to ETD. The ET channel increases relative to the PT channel, ETD increases relative to ET,noD, and fragmentation at backbone bonds increases relative to side-chain cleavages as cation charge state increases. The increase in ET versus PT with charge state is consistent with a Landau-Zener based curve-crossing model. An optimum charge state for ET is predicted by the model for the ground state-to-ground state reaction. However, when the population of excited product ion states is considered, it is possible that a decrease in ET efficiency as charge state increases will not be observed due to the possibility of the population of excited electronic states of the products. Several factors can contribute to the increase in ETD versus ET,noD and backbone cleavage versus side-chain losses. These factors include an increase in reaction exothermicity and charge state dependent differences in precursor and product ion structures, stabilities, and sites of protonation. PMID:23264749

  6. A parallel algorithm for step- and chain-growth polymerization in molecular dynamics.

    PubMed

    de Buyl, Pierre; Nies, Erik

    2015-04-07

    Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

  7. A parallel algorithm for step- and chain-growth polymerization in molecular dynamics

    NASA Astrophysics Data System (ADS)

    de Buyl, Pierre; Nies, Erik

    2015-04-01

    Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

  8. A real-time polymerase chain reaction-based protocol for low/medium-throughput Y-chromosome microdeletions analysis.

    PubMed

    Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe

    2012-12-01

    We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.

  9. Development of a reverse transcription quantitative polymerase chain reaction-based assay for broad coverage detection of African and Asian Zika virus lineages.

    PubMed

    Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai

    2017-06-01

    The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.

  10. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    PubMed

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  11. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  12. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  13. Premature parturition, edema, and ascites in an alpaca infected with Anaplasma phagocytophilum

    PubMed Central

    Tinkler, Stacy H.; Firshman, Anna M.; Sharkey, Leslie C.

    2012-01-01

    An 8-year-old alpaca was presented for fever, anorexia, edema, ascites, and premature parturition. She was determined to have Anaplasma phagocytophilum infection based on positive blood polymerase chain reaction (PCR) and positive acute and convalescent serum titers. Antibiotics and supportive therapies were administered and the alpaca made a complete recovery. PMID:23633715

  14. Real-time PCR assays for detection and quactification of Edwardsiella tarda, Edwardsiella piscicida, Edwardsiella piscicida-like sp. in catfish tissues and pond water

    USDA-ARS?s Scientific Manuscript database

    Researchers have proposed the adoption of 3 distinct genetic taxa among bacteria previously classified as Edwardsiella tarda; namely E. tarda, E. piscicida, and a taxon presently termed E. piscicida–like. Individual real-time polymerase chain reaction (qPCR) assays were developed, based on published...

  15. Triggered and catalyzed self-assembly of hyperbranched DNA structures for logic operations and homogeneous CRET biosensing of microRNA.

    PubMed

    Bi, Sai; Yue, Shuzhen; Wu, Qiang; Ye, Jiayan

    2016-04-07

    Toehold-mediated strand displacement-based nanocircuits are developed by integrating catalytic hairpin assembly (CHA) with hybridization chain reaction (HCR), which achieves self-assembly of hyperbranched DNA structures and is readily utilized as an enzyme-free amplifier for homogeneous CRET detection of microRNA with high sensitivity and selectivity.

  16. Aspergillus DNA contamination in blood collection tubes.

    PubMed

    Harrison, Elizabeth; Stalhberger, Thomas; Whelan, Ruth; Sugrue, Michele; Wingard, John R; Alexander, Barbara D; Follett, Sarah A; Bowyer, Paul; Denning, David W

    2010-08-01

    Fungal polymerase chain reaction (PCR)-based diagnostic methods are at risk for contamination. Sample collection containers were investigated for fungal DNA contamination using real-time PCR assays. Up to 18% of blood collection tubes were contaminated with fungal DNA, probably Aspergillus fumigatus. Lower proportions of contamination in other vessels were observed. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

    Treesearch

    Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

    2018-01-01

    Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

  18. Influences of sample interference and interference controls on quantification of enterococci fecal indicator bacteria in surface water samples by the qPCR method

    EPA Science Inventory

    A quantitative polymerase chain reaction (qPCR) method for the detection of entercocci fecal indicator bacteria has been shown to be generally applicable for the analysis of temperate fresh (Great Lakes) and marine coastal waters and for providing risk-based determinations of wat...

  19. COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

    EPA Science Inventory

    Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

  20. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    ERIC Educational Resources Information Center

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  1. Replicon typing of plasmids encoding resistance to newer beta-lactams.

    PubMed

    Carattoli, Alessandra; Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M; Rossolini, Gian Maria

    2006-07-01

    Polymerase chain reaction-based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems.

  2. Low Frequencies of Interference to EPA Quantitative Polymerase Chain Reaction (qPCR) Methods for Microbial Water Quality Monitoring in U.S. Rivers and Streams and Coastal Waters

    EPA Science Inventory

    In collaboration with U.S States and Tribes, the United States Environmental Protection Agency (EPA) conducts periodic and rotating, statistically based surveys of U.S. rivers and streams (National Rivers and Streams Assessment, NRSA), estuarine and Great Lakes nearshore coastal ...

  3. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    USDA-ARS?s Scientific Manuscript database

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  4. An Inexpensive Gel Electrophoresis-Based Polymerase Chain Reaction Method for Quantifying mRNA Levels

    ERIC Educational Resources Information Center

    Bradford, William D.; Cahoon, Laty; Freel, Sara R.; Hoopes, Laura L. Mays; Eckdahl, Todd T.

    2005-01-01

    In order to engage their students in a core methodology of the new genomics era, an everincreasing number of faculty at primarily undergraduate institutions are gaining access to microarray technology. Their students are conducting successful microarray experiments designed to address a variety of interesting questions. A next step in these…

  5. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  6. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  7. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  8. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  9. Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

    PubMed

    Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

    2013-10-17

    Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

  10. Hybrid RTM process: Monitoring and processing of composites based on reactive thermoplastic systems

    NASA Astrophysics Data System (ADS)

    Dkier, Mohamed; Lamnawar, Khalid; Maazouz, Abderrahim

    2017-10-01

    In this work, hybrid process coupling "Reactive Extrusion" and "Resin Transfer Molding" machine (T-ERTM) equipped with an instrumented mold was designed and developed. Polyamides model matrix according to two kinds of polymerizations were studied as well anionic and chain extension reactions. For the former, different ratios of catalyst and activator were investigated. For the latter, various formulations of prepolymer with chain extender (CA) were studied at different stoichiometry ratios and temperatures. Since that both reaction kinetics are very fast to be monitored at short times by usual technics, the chemo-rheological evolutions were firstly studied ex-situ by coupling rheology with FTIR and dielectric spectroscopy (DRS). Secondly, the T-ERTM process with an "instrumented mold" was developed with specific dielectric sensors in order to in-situ track viscosity and reaction evolution. The in-situ results corroborate the ex-situ ones aforementioned. Overall, a processing window was obtained for each reactive system to ensure a good preform impregnation for the manufacturing of complex and continuous glass fiber-reinforced parts. Herein, the Time-Temperature-Transformation-equivalent diagrams were established to obtain Thermoplastic composites with tailored mechanical and physical properties.

  11. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  12. A Bullet-Block Experiment that Explains the Chain Fountain

    NASA Astrophysics Data System (ADS)

    Pantaleone, J.; Smith, R.

    2018-05-01

    It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

  13. New synthesis of maleic anhydride modified polyolefins and their applications

    NASA Astrophysics Data System (ADS)

    Lu, Bing

    Maleic anhydride (MA) modified polyolefins are the most useful commercial functional polyolefins. The current technology of producing MA modified polyolefins, mainly free radical modification, usually results in low MA graft contents, extensive side reactions, and poor control of graft structures. In this thesis, we show a new synthetic route for preparing MA modified polyolefins with excellent control of polymer structures and MA concentrations. The synthesis is based on the "reactive" polyolefin copolymers, i.e. polyolefins containing p-methylstyrene or alkylborane groups. The p-methylstyrene copolymers lead to selectively grafting reactions on the p-methyl groups, greatly reducing the side reactions on the polyolefin backbone. The MA graft content was proportional to the concentration of p-methylstyrene. In the borane approach, under controlled selective oxidation, the alkylborane containing PP polymers formed the "stable" polymeric radical in situ which initiated the graft-from reaction. By varying the monomer concentrations of MA and styrene, reaction time and temperature, a broad range of MA modified PP polymers were prepared from a single MA terminated or grafted PP to a very long SMA segment blocked or grafted PP, and there is no detectable side reaction on the PP backbone. MA modified polyolefins were investigated in the applications of glass fiber reinforced PP, elastomer toughened Nylon, and polyolefin/Nylon blends. The MA modified polyolefin compatibilizers showed the significant improved mechanical properties and morphology of the blends. The effectiveness of compatibilization depends on the MA concentration, molecular weight of the polyolefin segments, the structure of the compatibilizers, and the composition of the blend. By amidation or imidation reaction of MA modified PP with amine terminated PP, long chain branched PP polymers were also prepared. The results of IR, GPC, intrinsic viscosity and DSC studies clearly indicate the formation of long chain branched PP.

  14. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    PubMed

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  15. ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

    PubMed Central

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

  16. Biodegradable polyester-based eco-composites containing hemp fibers modified with macrocyclic oligomers

    NASA Astrophysics Data System (ADS)

    Conzatti, Lucia; Utzeri, Roberto; Hodge, Philip; Stagnaro, Paola

    2016-05-01

    An original compatibilizing pathway for hemp fibers/poly(1,4-butylene adipate-co-terephtalate) (PBAT) eco-composites was explored exploiting the capability of macrocyclic oligomers (MCOs), obtained by cyclodepolymerization (CDP) of PBAT at high dilution, of being re-converted into linear chains by entropically-driven ring-opening polymerization (ED-ROP) that occurs simply heating the MCOS in the bulk. CDP reaction of PBAT was carried out varying solvent, catalyst and reaction time. Selected MCOs were used to adjust the conditions of the ED-ROP reaction. The best experimental conditions were then adopted to modify hemp fibers. Eco-composites based on PBAT and hemp fibers as obtained or modified with PBAT macrocyclics or oligomers were prepared by different process strategies. The best fiber-PBAT compatibility was observed when the fibers were modified with PBAT oligomers before incorporation in the polyester matrix.

  17. Tuning of chain chirality by interchain stacking forces and the structure-property relationship in coordination systems constructed by meridional FeIII cyanide and MnIII Schiff bases.

    PubMed

    Sohn, Ah Ram; Lim, Kwang Soo; Kang, Dong Won; Song, Jeong Hwa; Koh, Eui Kwan; Moon, Dohyun; Hong, Chang Seop

    2016-12-06

    We synthesized six Fe(iii)-Mn(iii) bimetallic compounds by self-assembling the newly developed mer-Fe cyanide PPh 4 [Fe(Clqpa)(CN) 3 ]·H 2 O (1) and PPh 4 [Fe(Brqpa)(CN) 3 ]·H 2 O (2) with Mn Schiff base Mn(5-Xsalen) + cations. These compounds include [Fe(Xqpa)(CN) 3 ][Mn(5-Ysalen)]·pMeOH·qH 2 O [qpaH 2 = N-(quinolin-8-yl)picolinamide; salen = N,N'-ethylenebis(salicylideneiminato) dianion; X = Cl, Y = H (3); X = Cl, Y = Br (4); X = Br, Y = H (5); X = Br, Y = F (6); X = Br, Y = Cl (7); X = Br, Y = Br (8)]. When precursor 1 was used, compounds 3 and 4 were isolated to give a dinuclear entity and a linear chain structure, respectively. The reaction of precursor 2 with the Schiff bases afforded four linear Fe(iii)-Mn(iii) chain complexes. Chain chirality with P- and M-helicity emerges in 4, 7, and 8, while 5 exhibits chain helicity opposite to the previous chain complexes and 6 presents no chain helicity. Such a structural feature is heavily dependent on the interchain π-π contacts and the Fe precursor bridging unit. Chiral induction from a local ethylenediamine link of Y-salen is propagated over the chain via noncovalent π-π interactions. All the bimetallic compounds show antiferromagnetic interactions transmitted by the cyanide linkage. A field-induced metamagnetic transition is involved in 4, 7, and 8, while a field-induced two-step transition is evident in 6. From a magnetostructural viewpoint, the coupling constant is primarily governed by the Mn-N ax -C ax angle (ax = axial) in the bimetallic chain complexes composed of mer-Fe(iii) tricyanides, although the torsion angle plays a role.

  18. Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

    NASA Astrophysics Data System (ADS)

    Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

    Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

  19. Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

    PubMed

    Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

    2014-02-07

    An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

  20. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  1. Pooled nucleic acid testing to identify antiretroviral treatment failure during HIV infection.

    PubMed

    May, Susanne; Gamst, Anthony; Haubrich, Richard; Benson, Constance; Smith, Davey M

    2010-02-01

    Pooling strategies have been used to reduce the costs of polymerase chain reaction-based screening for acute HIV infection in populations in which the prevalence of acute infection is low (less than 1%). Only limited research has been done for conditions in which the prevalence of screening positivity is higher (greater than 1%). We present data on a variety of pooling strategies that incorporate the use of polymerase chain reaction-based quantitative measures to monitor for virologic failure among HIV-infected patients receiving antiretroviral therapy. For a prevalence of virologic failure between 1% and 25%, we demonstrate relative efficiency and accuracy of various strategies. These results could be used to choose the best strategy based on the requirements of individual laboratory and clinical settings such as required turnaround time of results and availability of resources. Virologic monitoring during antiretroviral therapy is not currently being performed in many resource-constrained settings largely because of costs. The presented pooling strategies may be used to significantly reduce the cost compared with individual testing, make such monitoring feasible, and limit the development and transmission of HIV drug resistance in resource-constrained settings. They may also be used to design efficient pooling strategies for other settings with quantitative screening measures.

  2. Randomized controlled clinical trial evaluating multiplex polymerase chain reaction for pathogen identification and therapy adaptation in critical care patients with pulmonary or abdominal sepsis.

    PubMed

    Tafelski, Sascha; Nachtigall, Irit; Adam, Thomas; Bereswill, Stefan; Faust, Jana; Tamarkin, Andrey; Trefzer, Tanja; Deja, Maria; Idelevich, Evgeny A; Wernecke, Klaus-Dieter; Becker, Karsten; Spies, Claudia

    2015-06-01

    To determine whether a multiplex polymerase chain reaction (PCR)-based test could reduce the time required for initial pathogen identification in patients in an intensive care unit (ICU) setting. This double-blind, parallel-group randomized controlled trial** enrolled adults with suspected pulmonary or abdominal sepsis caused by an unknown pathogen. Both the intervention and control groups underwent the standard blood culture (BC) testing, but additional pathogen identification, based on the results of a LightCycler® SeptiFast PCR test, were provided in the intervention group. The study enrolled 37 patients in the control group and 41 in the intervention group. Baseline clinical and demographic characteristics were similar in both groups. The PCR-based test identified a pathogen in 10 out of 41 (24.4%) patients in the intervention group, with a mean duration from sampling to providing the information to the ICU of 15.9 h. In the control group, BC results were available after a significantly longer period (38.1 h). The LightCycler® SeptiFast PCR test demonstrated a significant reduction in the time required for initial pathogen identification, compared with standard BC. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  3. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    PubMed

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  5. Novel route of synthesis for cellulose fiber-based hybrid polyurethane

    NASA Astrophysics Data System (ADS)

    Ikhwan, F. H.; Ilmiati, S.; Kurnia Adi, H.; Arumsari, R.; Chalid, M.

    2017-07-01

    Polyurethanes, obtained by the reaction of a diisocyanate compound with bifunctional or multifunctional reagent such as diols or polyols, have been studied intensively and well developed. The wide range modifier such as chemical structures and molecular weight to build polyurethanes led to designs of materials that may easily meet the functional product demand and to the extraordinary spreading of these materials in market. Properties of the obtained polymer are related to the chemical structure of polyurethane backbone. A number polyurethanes prepared from biomass-based monomers have been reported. Cellulose fiber, as a biomass material is containing abundant hydroxyl, promising material as chain extender for building hybrid polyurethanes. In previous researches, cellulose fiber was used as filler in synthesis of polyurethane composites. This paper reported a novel route of hybrid polyurethane synthesis, which a cellulose fiber was used as chain extender. The experiment performed by reacting 4,4’-Methylenebis (cyclohexyl isocyanate) (HMDI) and polyethylene glycol with variation of molecular weight to obtained pre-polyurethane, continued by adding micro fiber cellulose (MFC) with variation of type and composition in the mixture. The experiment was evaluated by NMR, FTIR, SEM and STA measurement. NMR and FTIR confirmed the reaction of the hybrid polyurethane. STA showed hybrid polyurethane has good thermal stability. SEM showed good distribution and dispersion of sorghum-based MFC.

  6. Patchy micelles based on coassembly of block copolymer chains and block copolymer brushes on silica particles.

    PubMed

    Zhu, Shuzhe; Li, Zhan-Wei; Zhao, Hanying

    2015-04-14

    Patchy particles are a type of colloidal particles with one or more well-defined patches on the surfaces. The patchy particles with multiple compositions and functionalities have found wide applications from the fundamental studies to practical uses. In this research patchy micelles with thiol groups in the patches were prepared based on coassembly of free block copolymer chains and block copolymer brushes on silica particles. Thiol-terminated and cyanoisopropyl-capped polystyrene-block-poly(N-isopropylacrylamide) block copolymers (PS-b-PNIPAM-SH and PS-b-PNIPAM-CIP) were synthesized by reversible addition-fragmentation chain transfer polymerization and chemical modifications. Pyridyl disulfide-functionalized silica particles (SiO2-SS-Py) were prepared by four-step surface chemical reactions. PS-b-PNIPAM brushes on silica particles were prepared by thiol-disulfide exchange reaction between PS-b-PNIPAM-SH and SiO2-SS-Py. Surface micelles on silica particles were prepared by coassembly of PS-b-PNIPAM-CIP and block copolymer brushes. Upon cleavage of the surface micelles from silica particles, patchy micelles with thiol groups in the patches were obtained. Dynamic light scattering, transmission electron microscopy, and zeta-potential measurements demonstrate the preparation of patchy micelles. Gold nanoparticles can be anchored onto the patchy micelles through S-Au bonds, and asymmetric hybrid structures are formed. The thiol groups can be oxidized to disulfides, which results in directional assembly of the patchy micelles. The self-assembly behavior of the patchy micelles was studied experimentally and by computer simulation.

  7. Efficiency of photochemical stages of photosynthesis in purple bacteria (a critical survey).

    PubMed

    Borisov, A Yu

    2014-03-01

    Based on currently available data, the energy transfer efficiency in the successive photophysical and photochemical stages has been analyzed for purple bacteria. This analysis covers the stages starting from migration of the light-induced electronic excitations from the bulk antenna pigments to the reaction centers up to irreversible stage of the electron transport along the transmembrane chain of cofactors-carriers. Some natural factors are revealed that significantly increase the rates of efficient processes in these stages. The influence on their efficiency by the "bottleneck" in the energy migration chain is established. The overall quantum yield of photosynthesis in these stages is determined.

  8. FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

    PubMed Central

    Ekstedt, Richard D.; Stollerman, Gene H.

    1960-01-01

    Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

  9. Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

    PubMed

    Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

    2014-05-28

    3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

  10. Aromatic ring generation as a dust precursor in acetylene discharges

    NASA Astrophysics Data System (ADS)

    De Bleecker, Kathleen; Bogaerts, Annemie; Goedheer, Wim

    2006-04-01

    Production of aromatic hydrocarbon compounds as an intermediate step for particle formation in low-pressure acetylene discharges is investigated via a kinetic approach. The detailed chemical reaction mechanism contains 140 reactions among 55 species. The cyclic hydrocarbon chemistry is mainly based on studies of polycyclic aromatic hydrocarbon formation in cosmic environments. The model explicitly includes organic chain, cyclic molecules, radicals, and ions up to a size of 12 carbon atoms. The calculated density profiles show that the aromatic formation yields are quite significant, suggesting that aromatic compounds play a role in the underlying mechanisms of particle formation in hydrocarbon plasmas.

  11. Intact carbohydrate structures as part of the melanoidin skeleton.

    PubMed

    Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

    2002-03-27

    Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

  12. Optimal Conditions for the Asymmetric Polymerase Chain Reaction for Detecting Food Pathogenic Bacteria Using a Personal SPR Sensor.

    PubMed

    Nagai, Haruka; Tomioka, Kanji; Okumura, Shiro

    2018-06-26

    We have been developing quick and simple system for detecting food-poisoning bacteria using a combination of an asymmetric PCR and a portable surface plasmon resonance (SPR) sensor. The system would be suitable for point-of-care detection of food-poisoning bacteria in the field of food industry. In this study, we established a novel method for quantifying the amplified forward (F) and reverse (R) chains of Staphylococcus aureus separately by high-performance liquid chromatography (HPLC). The concentration of single-stranded DNA amplicon excessively amplified, which is crucial for the system, could be calculated as the difference between those of the F- and R-chains. For the R-chain, a correction based on the F-chain concentration in the sample was used to obtain a more accurate value, because the determination of the R-chain concentration was affected by that of the coexisting F-chain. The concentration values were also determined by fluorescence imaging for electrophoresis gels of amplicons with FITC- or Cy5-conjugated primers, and they were in good agreement with the values by the HPLC. The measured concentration of the single-strand F-chain correlated well with the value of the SPR response against the probe that was a complementary sequence of the F-chain, immobilized on the sensor chip of the SPR sensor.

  13. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    PubMed

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Multiplex Detection of Aspergillus Species.

    PubMed

    Martínez-Culebras, Pedro; Selma, María Victoria; Aznar, Rosa

    2017-01-01

    Multiplex real-time polymerase chain reaction (PCR) provides a fast and accurate DNA-based tool for the simultaneous amplification of more than one target sequence in a single reaction. Here a duplex real-time PCR assay is described for the simultaneous detection of Aspergillus carbonarius and members of the Aspergillus niger aggregate, which are the main responsible species for ochratoxin A (OTA) contamination in grapes. This single tube reaction targets the beta-ketosynthase and the acyl transferase domains of the polyketide synthase of A. carbonarius and the A. niger aggregate, respectively.Besides, a rapid and efficient fungi DNA extraction procedure is described suitable to be applied in wine grapes. It includes a pulsifier equipment to remove conidia from grapes which prevents releasing of PCR inhibitors.

  15. Chemical construction and structural permutation of neurotoxic natural product, antillatoxin: importance of the three-dimensional structure of the bulky side chain

    PubMed Central

    INOUE, Masayuki

    2014-01-01

    Antillatoxin 1 is a unique natural product that displays potent neurotoxic and neuritogenic activities through activation of voltage-gated sodium channels. The peptidic macrocycle of 1 was attached to a side chain with an exceptionally high degree of methylation. In this review, we discuss the total synthesis and biological evaluation of 1 and its analogues. First we describe an efficient synthetic route to 1. This strategy enabled the unified preparation of nine side chain analogues. Structure-activity relationship studies of these analogues revealed that subtle side chain modification leads to dramatic changes in activity, and detailed structural analyses indicated the importance of the overall size and three dimensional shape of the side chain. Based on these data, we designed and synthesized a photoresponsive analogue, proving that the activity of 1 was modulated via a photochemical reaction. The knowledge accumulated through these studies will be useful for the rational design of new tailor-made molecules to control the function and behavior of ion channels. PMID:24522155

  16. Cysteine Racemization on IgG Heavy and Light Chains

    PubMed Central

    Zhang, Qingchun; Flynn, Gregory C.

    2013-01-01

    Under basic pH conditions, the heavy chain 220-light chain 214 (H220-L214) disulfide bond, found in the flexible hinge region of an IgG1, can convert to a thioether. Similar conditions also result in racemization of the H220 cysteine. Here, we report that racemization occurs on both H220 and L214 on an IgG1 with a λ light chain (IgG1λ) but almost entirely on H220 of an IgGl with a κ light chain (IgG1κ) under similar conditions. Likewise, racemization was detected at significant levels on H220 and L214 on endogenous human IgG1λ but only at the H220 position on IgG1κ. Low but measurable levels of d-cysteines were found on IgG2 cysteines in the hinge region, both with monoclonal antibodies incubated under basic pH conditions and on antibodies isolated from human serum. A simplified reaction mechanism involving reversible β-elimination on the cysteine is presented that accounts for both base-catalyzed racemization and thioether formation at the hinge disulfide. PMID:24142697

  17. Enhanced detection of intracellular organism of swine proliferative enteritis, ileal symbiont intracellularis, in feces by polymerase chain reaction.

    PubMed Central

    Jones, G F; Ward, G E; Murtaugh, M P; Lin, G; Gebhart, C J

    1993-01-01

    A sensitive assay based on amplification of a 319-bp DNA fragment of the intracellular bacterium of swine proliferative enteritis was developed for the detection of the organism in the feces of swine. A vernacular name, ileal symbiont intracellularis (IS-intracellularis), has recently been published for the intracellular bacterium, which was formerly known as a Campylobacter-like organism (C.J. Gebhart, S.M. Barnes, S. McOrist, G.F. Lin, and G.H.K. Larson, Int. J. Syst. Bacteriol. 43:533-538, 1993). As few as 10(1) IS-intracellularis organisms purified from intestinal mucosa, or 10(3) IS-intracellularis per g of feces, were detected. No amplification product was produced from a polymerase chain reaction performed on DNA extracted from the feces of healthy pigs. A 319-bp DNA fragment specific for IS-intracellularis was produced on amplification of DNA from the feces of pigs with experimental and naturally occurring proliferative enteritis. Images PMID:8253956

  18. Genetic diversity of Chlamydia among captive birds from central Argentina.

    PubMed

    Frutos, María C; Monetti, Marina S; Vaulet, Lucia Gallo; Cadario, María E; Fermepin, Marcelo Rodríguez; Ré, Viviana E; Cuffini, Cecilia G

    2015-01-01

    To study the occurrence of Chlamydia spp. and their genetic diversity, we analysed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp. were not detected in wild birds; however, four species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes n = 2; Piciformes n = 2; Anseriformes n = 1; Galliformes n = 1; Strigiformes n = 1). Two pathogens (C. pneumoniae and C. pecorum) were identified simultaneously in samples obtained from captive birds. Based on nucleotide-sequence variations of the ompA gene, three C. psittaci-positive samples detected were grouped into a cluster with the genotype WC derived from mammalian hosts. A single positive sample was phylogenetically related to a new strain of C. gallinacea. This report contributes to our increasing understanding of the abundance of Chlamydia in the animal kingdom.

  19. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    PubMed

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  20. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

    PubMed

    Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

    2007-07-01

    In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

  2. A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

    PubMed

    Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

    2017-01-01

    To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

  3. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

    PubMed Central

    Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

    2009-01-01

    Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

  4. Detection of the reemerging agent Burkholderia mallei in a recent outbreak of glanders in the United Arab Emirates by a newly developed fliP-based polymerase chain reaction assay.

    PubMed

    Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich

    2006-04-01

    A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.

  5. Detection of Dichelobacter nodosus in wild ungulates (Capra ibex ibex and Ovis aries musimon) and domestic sheep suffering from foot rot using a two-step polymerase chain reaction.

    PubMed

    Belloy, Luc; Giacometti, Marco; Boujon, Patrick; Waldvogel, Andreas

    2007-01-01

    Severe keratinous hoof afflictions have been recorded in ibex (Capra ibex ibex) since 1995 and more recently in mouflon (Ovis aries musimon) in Switzerland. Based on clinical observations and comparison with diseases known to affect domestic ungulates, it was hypothesized these wild ungulates were affected by foot rot associated with infection with Dichelobacter nodosus. Dichelobacter nodosus has been shown to be the essential pathogen for initiation and establishment of foot rot, a highly contagious foot disease of sheep and goats. Because these bacteria could not be cultivated from affected ibex, we developed a nested polymerase chain reaction that allowed detection of D. nodosus without culture. Using this assay, we were able to diagnose D. nodosus infections of ibex, mouflon, and domestic sheep in natural outbreaks. From these results we conclude that D. nodosus plays an etiological role in foot rot not only in domestic but also in wild Caprinae.

  6. Formation and characterization of a multicomponent equilibrium system derived from cis- and trans-1-aminomethylcyclohexane-1,2-diol.

    PubMed

    Hetényi, Anasztázia; Szakonyi, Zsolt; Klika, Karel D; Pihlaja, Kalevi; Fülöp, Ferenc

    2003-03-21

    Both cis and trans isomers of amino diols 3-6 were prepared stereoselectively. In the reactions between 3-6 and phenyl isothiocyanate, the ring closure proceeded regioselectively and resulted only in spiro derivatives of 2-phenyliminooxazolidines 9, 10, 13, and 14. The reaction of cis- (or trans-)1-aminomethylcyclohexane-1,2-diol 4 (or 6) with 1 equiv of an aromatic aldehyde 15a-g in EtOH at room temperature resulted in a complex, multicomponent equilibrium mixture of 16a-g and 18a-g (or 17a-g and 19a-g), in each case consisting of a five-component, ring-chain tautomeric system 16A-E (or 17A-E), involving the Schiff base, two epimeric spirooxazolidines, two epimeric condensed 1,3-oxazines, and some of the four tricyclic compounds 18A-D (or 19A-D). The five-component, ring-chain equilibria were found to be adequately described by the Hammett-Brown linear free energy equation.

  7. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    PubMed

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  8. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

    PubMed

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

  9. Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers

    PubMed Central

    Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric

    2012-01-01

    Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402

  10. Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.

    PubMed

    Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi

    2018-04-17

    We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.

  11. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

    PubMed

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

    1999-07-01

    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  12. Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

    PubMed

    Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

    2018-01-18

    Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  13. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  14. Quasifree (p, 2p) Reactions on Oxygen Isotopes: Observation of Isospin Independence of the Reduced Single-Particle Strength.

    PubMed

    Atar, L; Paschalis, S; Barbieri, C; Bertulani, C A; Díaz Fernández, P; Holl, M; Najafi, M A; Panin, V; Alvarez-Pol, H; Aumann, T; Avdeichikov, V; Beceiro-Novo, S; Bemmerer, D; Benlliure, J; Boillos, J M; Boretzky, K; Borge, M J G; Caamaño, M; Caesar, C; Casarejos, E; Catford, W; Cederkall, J; Chartier, M; Chulkov, L; Cortina-Gil, D; Cravo, E; Crespo, R; Dillmann, I; Elekes, Z; Enders, J; Ershova, O; Estrade, A; Farinon, F; Fraile, L M; Freer, M; Galaviz Redondo, D; Geissel, H; Gernhäuser, R; Golubev, P; Göbel, K; Hagdahl, J; Heftrich, T; Heil, M; Heine, M; Heinz, A; Henriques, A; Hufnagel, A; Ignatov, A; Johansson, H T; Jonson, B; Kahlbow, J; Kalantar-Nayestanaki, N; Kanungo, R; Kelic-Heil, A; Knyazev, A; Kröll, T; Kurz, N; Labiche, M; Langer, C; Le Bleis, T; Lemmon, R; Lindberg, S; Machado, J; Marganiec-Gałązka, J; Movsesyan, A; Nacher, E; Nikolskii, E Y; Nilsson, T; Nociforo, C; Perea, A; Petri, M; Pietri, S; Plag, R; Reifarth, R; Ribeiro, G; Rigollet, C; Rossi, D M; Röder, M; Savran, D; Scheit, H; Simon, H; Sorlin, O; Syndikus, I; Taylor, J T; Tengblad, O; Thies, R; Togano, Y; Vandebrouck, M; Velho, P; Volkov, V; Wagner, A; Wamers, F; Weick, H; Wheldon, C; Wilson, G L; Winfield, J S; Woods, P; Yakorev, D; Zhukov, M; Zilges, A; Zuber, K

    2018-02-02

    Quasifree one-proton knockout reactions have been employed in inverse kinematics for a systematic study of the structure of stable and exotic oxygen isotopes at the R^{3}B/LAND setup with incident beam energies in the range of 300-450  MeV/u. The oxygen isotopic chain offers a large variation of separation energies that allows for a quantitative understanding of single-particle strength with changing isospin asymmetry. Quasifree knockout reactions provide a complementary approach to intermediate-energy one-nucleon removal reactions. Inclusive cross sections for quasifree knockout reactions of the type ^{A}O(p,2p)^{A-1}N have been determined and compared to calculations based on the eikonal reaction theory. The reduction factors for the single-particle strength with respect to the independent-particle model were obtained and compared to state-of-the-art ab initio predictions. The results do not show any significant dependence on proton-neutron asymmetry.

  15. Feasibility Study and System Architecture of Radioisotope Thermoelectric Generation Power Systems for USMC Forward Operating Bases

    DTIC Science & Technology

    2013-06-01

    isotopes decay primarily through alpha particle emission, a small critical mass will cause sustained nuclear chain reaction, emitting gamma neutron...viii 1. Strontium-90 (Example) ....................................................................33 a. Pure Radioisotope Mass to Produce 300W...Power .................33 b. Compound Mass to Produce 300W Power .............................33 c. Estimated cost to Produce 300W power at BOL

  16. DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

    PubMed Central

    Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

    1997-01-01

    To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

  17. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

  18. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  19. Immunological diagnosis as an adjunctive tool for an early diagnosis of tuberculous meningitis of an immune competent child in a low tuberculosis endemic country: a case report.

    PubMed

    Vita, Serena; Ajassa, Camilla; Caraffa, Emanuela; Lichtner, Miriam; Mascia, Claudia; Mengoni, Fabio; Paglia, Maria Grazia; Mancarella, Cristina; Colistra, Davide; Di Biasi, Claudio; Ciardi, Rosa Maria; Mastroianni, Claudio Maria; Vullo, Vincenzo

    2017-03-13

    Pediatric tuberculous meningitis is a highly morbid, often fatal disease. Its prompt diagnosis and treatment saves lives, in fact delays in the initiation of therapy have been associated with high mortality rates. This is a case of an Italian child who was diagnosed with tuberculous meningitis after a history of a month of headache, fatigue and weight loss. Cerebrospinal fluid analysis revealed a lymphocytic pleocytosis with predominance and decreased glucose concentration. Microscopy and conventional diagnostic tests to identify Mycobacterium tuberculosis were negative, while a non classical method based on intracellular cytokine flow cytometry response of CD4 cells in cerebral spinal fluid helped us to address the diagnosis, that was subsequently confirmed by a nested polymerase chain reaction amplifying a 123 base pair fragment of the M. tuberculosis DNA. We diagnosed tuberculous meningitis at an early stage through an innovative immunological approach, supported by a nested polymerase chain reaction for detection of M. tuberculosis DNA. An early diagnosis is required in order to promptly initiate a therapy and to increase the patient's survival.

  20. A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

    PubMed Central

    Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

    2018-01-01

    We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

  1. Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

    PubMed

    Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

    2012-04-01

    Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

  2. Galactomannan, β-D-Glucan, and Polymerase Chain Reaction-Based Assays for the Diagnosis of Invasive Fungal Disease in Pediatric Cancer and Hematopoietic Stem Cell Transplantation: A Systematic Review and Meta-Analysis.

    PubMed

    Lehrnbecher, Thomas; Robinson, Paula D; Fisher, Brian T; Castagnola, Elio; Groll, Andreas H; Steinbach, William J; Zaoutis, Theoklis E; Negeri, Zelalem F; Beyene, Joseph; Phillips, Bob; Sung, Lillian

    2016-11-15

    We systematically reviewed and analyzed the available data for galactomannan (GM), β-D-glucan (BG), and polymerase chain reaction (PCR)-based assays to detect invasive fungal disease (IFD) in patients with pediatric cancer or undergoing hematopoietic stem cell transplantation when used as screening tools during immunosuppression or as diagnostic tests in patients presenting with symptoms such as fever during neutropenia (FN). Of 1532 studies screened, 25 studies reported on GM (n = 19), BG (n = 3), and PCR (n = 11). All fungal biomarkers demonstrated highly variable sensitivity, specificity, and positive predictive values, and these were generally poor in both clinical settings. GM negative predictive values were high, ranging from 85% to 100% for screening and 70% to 100% in the diagnostic setting, but failure to identify non-Aspergillus molds limits its usefulness. Future work could focus on the usefulness of combinations of fungal biomarkers in pediatric cancer and HSCT. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  3. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    PubMed

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-06-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  4. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  5. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOEpatents

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  6. Correlation between MGMT promoter methylation and response to temozolomide-based therapy in neuroendocrine neoplasms: an observational retrospective multicenter study.

    PubMed

    Campana, Davide; Walter, Thomas; Pusceddu, Sara; Gelsomino, Fabio; Graillot, Emmanuelle; Prinzi, Natalie; Spallanzani, Andrea; Fiorentino, Michelangelo; Barritault, Marc; Dall'Olio, Filippo; Brighi, Nicole; Biasco, Guido

    2018-06-01

    Temozolomide (TEM) based therapy has been reported being effective in the treatment of metastatic neuroendocrine neoplasms (NEN), with response rates ranging from 30 to 70%. Among patients affected by advanced glioblastoma or melanoma and treated with TEM, loss of tumoral O6-methylguanine DNA methyltransferase (MGMT) is correlated with improved survival. In NEN patients, the role of MGMT deficiency in predicting clinical outcomes of TEM treatment is still under debate. In this study we evaluated 95 patients with advanced NENs undergoing treatment with TEM-based therapy. MGMT promoter methylation status was evaluated with two techniques: methylation specific-polymerase chain reaction or pyrosequencing. Treatment with TEM-based therapy was associated with an overall response rate of 27.4% according to RECIST criteria (51.8% of patients with and 17.7% without MGMT promoter methylation). Response to therapy, progression free survival and overall survival was correlated to MGMT status at univariate and multivariate analysis. Methylation of MGMT promoter could be a strong predictive factor of objective response and an important prognostic factor of a longer PFS and OS. According to our results, MGMT methylation status, evaluated with methylation specific-polymerase chain reaction or pyrosequencing, should have an important role in patients with metastatic NENs, in order to guide therapeutic options. These results need further confirmation with prospective studies.

  7. A polymerase chain reaction strategy for the diagnosis of camelpox.

    PubMed

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  8. Accuracy of polimerase chain reaction for the diagnosis of pleural tuberculosis.

    PubMed

    Trajman, Anete; da Silva Santos Kleiz de Oliveira, Elen Fabricia; Bastos, Mayara Lisboa; Belo Neto, Epaminondas; Silva, Edgar Manoel; da Silva Lourenço, Maria Cristina; Kritski, Afrânio; Oliveira, Martha Maria

    2014-06-01

    Polymerase chain reaction (PCR)-based techniques to detect Mycobacterium tuberculosis DNA in respiratory specimens have been increasingly used to diagnose pulmonary tuberculosis. Their use in non-respiratory specimens to diagnose extrapulmonary tuberculosis is, however, controversial. In this study, we estimated the accuracy of three in-country commercialized PCR-based diagnostic techniques in pleural fluid samples for the diagnosis of pleural tuberculosis. Patients underwent thoracenthesis for diagnosis purposes; pleural fluid aliquots were frozen and subsequently submitted to two real time PCR tests (COBAS(®)TAQMAN(®)MTB and Xpert(®)MTB/Rif) and one conventional PCR test (Detect-TB(®)). Two different reference standards were considered: probable tuberculosis (based on clinical grounds) and confirmed tuberculosis (bacteriologically or histologically). Ninety-three patients were included, of whom 65 with pleural tuberculosis, 35 of them confirmed. Sensitivities were 29% for COBAS(®)TAQMAN(®)MTB, 3% for Xpert(®)MTB/Rif and 3% for Detect-TB(®); specificities were 86%, 100% and 97% respectively, considering confirmed tuberculosis. Considering all cases, sensitivities were 16%, 3% and 2%, and specificities, 86%, 100%, and 97%. Compared to the 95% sensitivity of adenosine deaminase, the most sensitive test for pleural tuberculosis, the sensitivities of the three PCR-based tests were very low. We conclude that at present, there is no major place for such tests in routine clinical use. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Self-generated covalent cross-links in the cell-surface adhesins of Gram-positive bacteria.

    PubMed

    Baker, Edward N; Squire, Christopher J; Young, Paul G

    2015-10-01

    The ability of bacteria to adhere to other cells or to surfaces depends on long, thin adhesive structures that are anchored to their cell walls. These structures include extended protein oligomers known as pili and single, multi-domain polypeptides, mostly based on multiple tandem Ig-like domains. Recent structural studies have revealed the widespread presence of covalent cross-links, not previously seen within proteins, which stabilize these domains. The cross-links discovered so far are either isopeptide bonds that link lysine side chains to the side chains of asparagine or aspartic acid residues or ester bonds between threonine and glutamine side chains. These bonds appear to be formed by spontaneous intramolecular reactions as the proteins fold and are strategically placed so as to impart considerable mechanical strength. © 2015 Authors; published by Portland Press Limited.

  10. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    NASA Technical Reports Server (NTRS)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  11. Chemical control of the viscoelastic properties of vinylogous urethane vitrimers

    PubMed Central

    Denissen, Wim; Droesbeke, Martijn; Nicolaÿ, Renaud; Leibler, Ludwik; Winne, Johan M.; Du Prez, Filip E.

    2017-01-01

    Vinylogous urethane based vitrimers are polymer networks that have the intrinsic property to undergo network rearrangements, stress relaxation and viscoelastic flow, mediated by rapid addition/elimination reactions of free chain end amines. Here we show that the covalent exchange kinetics significantly can be influenced by combination with various simple additives. As anticipated, the exchange reactions on network level can be further accelerated using either Brønsted or Lewis acid additives. Remarkably, however, a strong inhibitory effect is observed when a base is added to the polymer matrix. These effects have been mechanistically rationalized, guided by low-molecular weight kinetic model experiments. Thus, vitrimer elastomer materials can be rationally designed to display a wide range of viscoelastic properties. PMID:28317893

  12. [Effect of calcium cations on acid-base properties and free radical oxidation of dopamine and pyrocatechol].

    PubMed

    Lebedev, A V; Ivanova, M V; Timoshin, A A; Ruuge, E K

    2008-01-01

    Ca2+-induced increase in the rate of pyrocatechol and dopamine oxidation by dioxygen and Ca2+-dependent acid-base properties of the catechols were studied by potentiometric titration, UV/Vis-spectrophotometry, EPR-spectroscopy, and by measurement of oxygen consumption. The effect of Ca2+ on the chain reactions of oxidation can be explained by additional deprotonation (decrease in pKai) of the catechols that accelerates one electron transport to dioxygen and formation of calcium semiquinonate, undergoing further oxidation. The described Ca2+-dependent redox-conversion of ortho-phenols proposes that an additional function of calcium in the cell can be its involvement in free radical oxidoreductive reactions at pH > pKai.

  13. Electronic shift register memory based on molecular electron-transfer reactions

    NASA Technical Reports Server (NTRS)

    Hopfield, J. J.; Onuchic, Jose Nelson; Beratan, David N.

    1989-01-01

    The design of a shift register memory at the molecular level is described in detail. The memory elements are based on a chain of electron-transfer molecules incorporated on a very large scale integrated (VLSI) substrate, and the information is shifted by photoinduced electron-transfer reactions. The design requirements for such a system are discussed, and several realistic strategies for synthesizing these systems are presented. The immediate advantage of such a hybrid molecular/VLSI device would arise from the possible information storage density. The prospect of considerable savings of energy per bit processed also exists. This molecular shift register memory element design solves the conceptual problems associated with integrating molecular size components with larger (micron) size features on a chip.

  14. Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

    PubMed

    Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

    2008-04-01

    Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

  15. Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

    PubMed

    Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2017-05-02

    Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  18. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  19. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  20. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  1. Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

    PubMed Central

    Brownholland, David P.

    2017-01-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

  2. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  3. Supramolecular recognition control of polyethylene glycol modified N-doped graphene quantum dots: tunable selectivity for alkali and alkaline-earth metal ions.

    PubMed

    Yang, Siwei; Sun, Jing; Zhu, Chong; He, Peng; Peng, Zheng; Ding, Guqiao

    2016-02-07

    The graphene quantum dot based fluorescent probe community needs unambiguous evidence about the control on the ion selectivity. In this paper, polyethylene glycol modified N-doped graphene quantum dots (PN-GQDs) were synthesized by alkylation reaction between graphene quantum dots and organic halides. We demonstrate the tunable selectivity and sensitivity by controlling the supramolecular recognition through the length and the end group size of the polyether chain on PN-GQDs. The relationship formulae between the selectivity/detection limit and polyether chains are experimentally deduced. The polyether chain length determines the interaction between the PN-GQDs and ions with different ratios of charge to radius, which in turn leads to a good selectivity control. Meanwhile the detection limit shows an exponential growth with the size of end groups of the polyether chain. The PN-GQDs can be used as ultrasensitive and selective fluorescent probes for Li(+), Na(+), K(+), Mg(2+), Ca(2+) and Sr(2+), respectively.

  4. Biofiltration of gasoline and diesel aliphatic hydrocarbons.

    PubMed

    Halecky, Martin; Rousova, Jana; Paca, Jan; Kozliak, Evguenii; Seames, Wayne; Jones, Kim

    2015-02-01

    The ability of a biofilm to switch between the mixtures of mostly aromatic and aliphatic hydrocarbons was investigated to assess biofiltration efficiency and potential substrate interactions. A switch from gasoline, which consisted of both aliphatic and aromatic hydrocarbons, to a mixture of volatile diesel n-alkanes resulted in a significant increase in biofiltration efficiency, despite the lack of readily biodegradable aromatic hydrocarbons in the diesel mixture. This improved biofilter performance was shown to be the result of the presence of larger size (C₉-C(12)) linear alkanes in diesel, which turned out to be more degradable than their shorter-chain (C₆-C₈) homologues in gasoline. The evidence obtained from both biofiltration-based and independent microbiological tests indicated that the rate was limited by biochemical reactions, with the inhibition of shorter chain alkane biodegradation by their larger size homologues as corroborated by a significant substrate specialization along the biofilter bed. These observations were explained by the lack of specific enzymes designed for the oxidation of short-chain alkanes as opposed to their longer carbon chain homologues.

  5. METHOD OF OPERATING NUCLEAR REACTORS

    DOEpatents

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  6. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  7. Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

    NASA Astrophysics Data System (ADS)

    Nakazumi, Tomoka; Hara, Yusuke

    2017-09-01

    We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

  8. Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

    PubMed

    Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

    2016-05-01

    A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A One-Step Route to CO2 -Based Block Copolymers by Simultaneous ROCOP of CO2 /Epoxides and RAFT Polymerization of Vinyl Monomers.

    PubMed

    Wang, Yong; Zhao, Yajun; Ye, Yunsheng; Peng, Haiyan; Zhou, Xingping; Xie, Xiaolin; Wang, Xianhong; Wang, Fosong

    2018-03-26

    The one-step synthesis of well-defined CO 2 -based diblock copolymers was achieved by simultaneous ring-opening copolymerization (ROCOP) of CO 2 /epoxides and RAFT polymerization of vinyl monomers using a trithiocarbonate compound bearing a carboxylic group (TTC-COOH) as the bifunctional chain transfer agent (CTA). The double chain-transfer effect allows for independent and precise control over the molecular weight of the two blocks and ensures narrow polydispersities of the resultant block copolymers (1.09-1.14). Notably, an unusual axial group exchange reaction between the aluminum porphyrin catalyst and TTC-COOH impedes the formation of homopolycarbonates. By taking advantage of the RAFT technique, it is able to meet the stringent demand for functionality control to well expand the application scopes of CO 2 -based polycarbonates. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A new and selective cycle for dehydrogenation of linear and cyclic alkanes under mild conditions using a base metal.

    PubMed

    Solowey, Douglas P; Mane, Manoj V; Kurogi, Takashi; Carroll, Patrick J; Manor, Brian C; Baik, Mu-Hyun; Mindiola, Daniel J

    2017-11-01

    Selectively converting linear alkanes to α-olefins under mild conditions is a highly desirable transformation given the abundance of alkanes as well as the use of olefins as building blocks in the chemical community. Until now, this reaction has been primarily the remit of noble-metal catalysts, despite extensive work showing that base-metal alkylidenes can mediate the reaction in a stoichiometric fashion. Here, we show how the presence of a hydrogen acceptor, such as the phosphorus ylide, when combined with the alkylidene complex (PNP)Ti=CH t Bu(CH 3 ) (PNP=N[2-P(CHMe 2 ) 2 -4-methylphenyl] 2 - ), catalyses the dehydrogenation of cycloalkanes to cyclic alkenes, and linear alkanes with chain lengths of C 4 to C 8 to terminal olefins under mild conditions. This Article represents the first example of a homogeneous and selective alkane dehydrogenation reaction using a base-metal titanium catalyst. We also propose a unique mechanism for the transfer dehydrogenation of hydrocarbons to olefins and discuss a complete cycle based on a combined experimental and computational study.

  11. A new and selective cycle for dehydrogenation of linear and cyclic alkanes under mild conditions using a base metal

    NASA Astrophysics Data System (ADS)

    Solowey, Douglas P.; Mane, Manoj V.; Kurogi, Takashi; Carroll, Patrick J.; Manor, Brian C.; Baik, Mu-Hyun; Mindiola, Daniel J.

    2017-11-01

    Selectively converting linear alkanes to α-olefins under mild conditions is a highly desirable transformation given the abundance of alkanes as well as the use of olefins as building blocks in the chemical community. Until now, this reaction has been primarily the remit of noble-metal catalysts, despite extensive work showing that base-metal alkylidenes can mediate the reaction in a stoichiometric fashion. Here, we show how the presence of a hydrogen acceptor, such as the phosphorus ylide, when combined with the alkylidene complex (PNP)Ti=CHtBu(CH3) (PNP=N[2-P(CHMe2)2-4-methylphenyl]2-), catalyses the dehydrogenation of cycloalkanes to cyclic alkenes, and linear alkanes with chain lengths of C4 to C8 to terminal olefins under mild conditions. This Article represents the first example of a homogeneous and selective alkane dehydrogenation reaction using a base-metal titanium catalyst. We also propose a unique mechanism for the transfer dehydrogenation of hydrocarbons to olefins and discuss a complete cycle based on a combined experimental and computational study.

  12. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  13. Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

    PubMed

    Winkelmann, Kurt; Calhoun, Robert L; Mills, German

    2006-12-28

    Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

  14. Tested Demonstrations.

    ERIC Educational Resources Information Center

    Gilbert, George L., Ed.

    1983-01-01

    Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

  15. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  16. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

    PubMed

    van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

    2012-05-01

    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

  17. On the mobility of iron particles embedded in elastomeric silicone matrix

    NASA Astrophysics Data System (ADS)

    Rabindranath, R.; Böse, H.

    2013-02-01

    In this contribution the rheological and magnetorheological properties of different polydimethylsiloxane (PDMS) based magnetorheological elastomers (MRE) are presented and discussed. In order to investigate the mobility of the iron particles with respect to the rheological characteristics, the iron particles were silanized with vinyltrimethoxysilane to enable a reaction between the modified particle and the cross-linking agent of the silicone elastomer. In addition, the vinyl-functionalized particles were further modified by the coupling of the superficial vinyl groups with a long-chain hydride terminated PDMS, which enables a reaction pathway with the vinyl terminated PDMS. On the other hand, the iron particles were treated with surfactants such as fatty acids, calcium and aluminum soaps, respectively, prior to vulcanization in order to increase the mobility of the iron particles in the elastomeric matrix. It was found, that both, the modification with the long-chain hydride terminated PDMS as well as the treatment with surfactants lead to an increase of the storage modulus G', the loss modulus G" and the loss factor tan δ in the magnetic field. It is concluded that both modifications, the coupling with long-chain hydride terminated PDMS as well as the treatment with surfactants, provide a greater mobility of the iron particles and hence a greater friction represented by the increase of the loss factor tan δ. Consequently it is assumed that untreated iron particles are less mobile in the rubber matrix due to covalent bonding with the silicone components, most likely due to the reaction of the hydroxyl groups on the metal surface with the silane groups of the cross-linking agent.

  18. Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

    PubMed

    Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

    The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  19. Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

    PubMed

    Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

    2017-11-01

    In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

  20. Chemiluminescence resonance energy transfer imaging on magnetic particles for single-nucleotide polymorphism detection based on ligation chain reaction.

    PubMed

    Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua

    2015-03-15

    A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR

    PubMed Central

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-01

    AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830

  2. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

    PubMed

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-21

    To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

  3. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  4. Nanosilver-based surface-enhanced Raman spectroscopic determination of DNA methyltransferase activity through real-time hybridization chain reaction.

    PubMed

    Hu, Ping Ping; Liu, Hui; Zhen, Shu Jun; Li, Chun Mei; Huang, Cheng Zhi

    2015-11-15

    In this manuscript, a nanosilver enhanced SERS strategy was successfully constructed for the determination of DNA methyltransferase activity in soulution combined with hybridization chain reaction (HCR). The proposed method was mainly on the basis of excellent separation ability of magnetic microparticles (MMPs), HCR as signal amplification unit and assembled AgNPs as enhancement substrate. In the presence of M. SssI MTase, the duplex sequence (5'-CCGG-3') tethered to MMPs was methylated, which cannot be cleaved by HpaII endonuclease. The resulted DNA skeleton captured on MMPs then triggered the HCR reaction, generated a polymerized and extended symmetrical sequence, in which more biotin terminal was available for the conjugation of AgNPs-SA, leading to significantly amplified SERS response. When it was used to analyze M. SssI activity, a linear equation ∆ISERS=1215.32+446.80 cM.SssI was obtained with the M. SssI activity ranged from 0.1 to 10.0 U with the correlation coefficient (r(2)) of 0.97. The most important advantage of this method is the combination of SERS and HCR in solution for the first time and its good selectivity, which enabled the detection of even one-base mismatched sequence. The new assay method holds great promising application to be a versatile platform for sensitive, high-throughput detection, and the screening of new anticancer drugs on DNA MTase. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  6. Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

    DOE PAGES

    Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

    2015-10-27

    In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

  7. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

    2015-07-15

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

  8. Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

    PubMed

    Brownholland, David P; Covey, Douglas F

    2017-05-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  10. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  11. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  12. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  13. Tandem-ESQ for Accelerator-Based Boron Neutron Capture Therapy (AB-BNCT)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kreiner, A. J.; Escuela de Ciencia y Tecnologia, Universidad de Gral San Martin; CONICET,

    2007-02-12

    A folded tandem, with 1.25 MV terminal voltage, combined with an ElectroStatic Quadrupole (ESQ) chain is being proposed as a machine for Accelerator-Based Boron Neutron Capture Therapy (AB-BNCT). The machine is shown to be capable of accelerating a 30 mA proton beam to 2.5 MeV. These are the specifications needed to produce sufficiently intense and clean epithermal neutron beams, based on the on the 7Li(p,n)7Be reaction, to perform BNCT treatment for deep seated tumors in less than an hour.

  14. Spark Plasma Sintering for Nanostructured Smart Materials

    DTIC Science & Technology

    2009-03-02

    polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

  15. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  16. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    DTIC Science & Technology

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  17. A molecular shift register based on electron transfer

    NASA Technical Reports Server (NTRS)

    Hopfield, J. J.; Onuchic, Josenelson; Beratan, David N.

    1988-01-01

    An electronic shift-register memory at the molecular level is described. The memory elements are based on a chain of electron-transfer molecules and the information is shifted by photoinduced electron-transfer reactions. This device integrates designed electronic molecules onto a very large scale integrated (silicon microelectronic) substrate, providing an example of a 'molecular electronic device' that could actually be made. The design requirements for such a device and possible synthetic strategies are discussed. Devices along these lines should have lower energy usage and enhanced storage density.

  18. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

    USDA-ARS?s Scientific Manuscript database

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

  19. Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

    USDA-ARS?s Scientific Manuscript database

    A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

  20. Nilgai antelope in northern Mexico as a possible carrier for cattle fever ticks and Babesia bovis and Babesia bigemina.

    PubMed

    Cárdenas-Canales, Elsa M; Ortega-Santos, J Alfonso; Campbell, Tyler A; García-Vázquez, Zeferino; Cantú-Covarrubias, Antonio; Figueroa-Millán, Julio V; DeYoung, Randall W; Hewitt, David G; Bryant, Fred C

    2011-07-01

    Of 20 blood samples from nilgais from México, five were polymerase chain reaction-positive for Babesia bigemina and one for Babesia bovis. Positive samples had the expected 170 (B. bigemina) and 291 (B. bovis) base pairs and were identical to Gen-Bank B. bigemina accession S45366 and B. bovis M38218.

  1. Numerical Study of Pressure Influence on Methane-Oxygen Laminar Counterflow Diffusion Flames

    NASA Astrophysics Data System (ADS)

    Iino, Kimio; Akamatsu, Fumiteru; Katsuki, Masashi

    We carried out numerical studies on methane/oxygen diffusion flames of counter-flow configuration to elucidate the influence of pressure on flame structure, heat release rate and reaction mechanisms. The chemistry in gas-phase was based on GRI-Mech 3.0 database. The thickness of diffusion flame became thinner with increasing strain rate a , with its characteristic flame thickness varying inversely with √a, especially its relation became significant with increasing pressure. Flame temperature increased with increasing pressure. Enhanced H2O production reactions, especially chain terminal reactions for H2O production, were found to be important in determining the flame temperature at high pressures. The small reduction in the flame temperature with increasing strain rate at high pressures, compared to the atmospheric pressure, is caused by the capacitor effect of product dissociation. From QRPDs, the third body dependent reactions were enhanced in high pressure conditions, hence C2 pathway was enhanced.

  2. Chemical reactions occurring during direct solar reduction of CO2.

    PubMed

    Lyma, J L; Jensen, R J

    2001-09-28

    At high temperatures carbon dioxide may absorb solar radiation and react to form carbon monoxide and molecular oxygen. The CO, so produced, may be converted by well-established means to a combustible fuel, such as methanol. We intend to make a future demonstration of the solar reduction of CO2 based on these processes. This paper, however, addresses only the problem of preserving, or even enhancing, the initial photolytic CO by quenching the hot gas with colder H2O or CO2. We present model calculations with a reaction mechanism used extensively in other calculations. If a CO2 gas stream is heated and photolyzed by intense solar radiation and then allowed to cool slowly, it will react back to the initial CO2 by a series of elementary chemical reactions. The back reaction to CO2 can be terminated with the rapid addition of CO2, water, or a mixture. Calculations show that a three-fold quench with pure CO2 will stop the reactions and preserve over 90% of the initial photolytic CO. We find that water has one of two effects. It can either increase the CO level, or it can catalyze the recombination of O and CO to CO2. The gas temperature is the determining factor. If the quench gas is not sufficient to keep the temperature below approximately 1100 K, a chain-branching reaction dominates and the reaction to CO2 occurs. If the temperature stays below that level a chain terminating reaction dominates and the CO is increased. The former case occurs below approximately a fourfold quench with a water/CO2 mixture. The later case occurs when the quench is greater than fourfold. We conclude that CO2, H2O, or a mixture may quench the hot gas stream photolyzed by solar radiation and preserve the photolytic CO.

  3. Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

    NASA Astrophysics Data System (ADS)

    Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

    Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

  4. Addressing fluorogenic real-time qPCR inhibition using the novel custom Excel file system 'FocusField2-6GallupqPCRSet-upTool-001' to attain consistently high fidelity qPCR reactions

    PubMed Central

    Ackermann, Mark R.

    2006-01-01

    The purpose of this manuscript is to discuss fluorogenic real-time quantitative polymerase chain reaction (qPCR) inhibition and to introduce/define a novel Microsoft Excel-based file system which provides a way to detect and avoid inhibition, and enables investigators to consistently design dynamically-sound, truly LOG-linear qPCR reactions very quickly. The qPCR problems this invention solves are universal to all qPCR reactions, and it performs all necessary qPCR set-up calculations in about 52 seconds (using a pentium 4 processor) for up to seven qPCR targets and seventy-two samples at a time – calculations that commonly take capable investigators days to finish. We have named this custom Excel-based file system "FocusField2-6GallupqPCRSet-upTool-001" (FF2-6-001 qPCR set-up tool), and are in the process of transforming it into professional qPCR set-up software to be made available in 2007. The current prototype is already fully functional. PMID:17033699

  5. Fast and high-efficiency magnetic surface imprinting based on microwave-accelerated reversible addition fragmentation chain transfer polymerization for the selective extraction of estrogen residues in milk.

    PubMed

    Chen, Fangfang; Wang, Jiayu; Lu, Ruicong; Chen, Huiru; Xie, Xiaoyu

    2018-08-10

    A novel microwave-accelerated reversible addition fragmentation chain transfer (RAFT) polymerization strategy has been introduced to shorten reaction time and improved polymerization efficiency of the conventional molecularly imprinting technology based on RAFT. Magnetic molecular imprinted polymers (MMIPs) were successfully synthesized much more efficiently using 17β-estradiol (E2) as a template for the determination of estrogen residues. The resultant MMIPs had well-defined thin imprinted film, favoring the fast mass transfer. Moreover, the reaction time, which was just 1/24 of the time taken by conventional heating, was significantly decreased, improving the reaction efficiency and reducing the probability of side reactions. Meanwhile, the obtained polymers have good capacity of 6.67 mg g -1 and satisfactory selectivity to template molecule with the imprinting factor of 5.11. As a result, a method combination of the resultant MMIPs as solid phase extraction sorbents and high-performance liquid chromatography was successfully set up to determinate three estrogen residues in milk samples. For E2, estrone, and estriol, the limit of detections were calculated to be 0.03, 0.08, and 0.06 ng mL -1 , respectively, and the limit of quantifications were 0.11, 0.27, and 0.21 ng mL -1 , respectively. At the spiked level of 1, 5, and 10 ng mL -1 , the recoveries of the three estrogens were ranged from 69.1% to 91.9% and the intra-day relative standard deviation (RSD) was less than 5.7%. In addition, the resultant MMIPs exhibited good reproducibility and reusability with the inter-batch RSD of 5.3% and the intra-batch RSD of 6.2%, respectively. Overall, the realization of this strategy facilitates the preparation of MMIPs with good architecture and high reaction efficiencies for the analysis of complicated real samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Methanol Cannon Demonstrations Revisited.

    ERIC Educational Resources Information Center

    Dolson, David A.; And Others

    1995-01-01

    Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

  7. Development of molecularly imprinted polymer-based field effect transistor for sugar chain sensing

    NASA Astrophysics Data System (ADS)

    Nishitani, Shoichi; Kajisa, Taira; Sakata, Toshiya

    2017-04-01

    In this study, we developed a molecularly imprinted polymer-based field-effect transistor (MIP-gate FET) for selectively detecting sugar chains in aqueous media, focusing on 3‧-sialyllactose (3SLac) and 6‧-sialyllactose (6SLac). The FET biosensor enables the detection of small molecules as long as they have intrinsic charges. Additionally, the MIP gels include the template for the target molecule, which is selectively trapped without requiring enzyme-target molecule reaction. The MIP gels were synthesized on the gate surface of the FET device, including phenylboronic acid (PBA), which enables binding to sugar chains. Firstly, the 3SLac-MIP-gate FET quantitatively detected 3SLac at µM levels. This is because the FET device recognized the change in molecular charges on the basis of PBA-3SLac binding in the MIP gel. Moreover, 3SLac was selectively detected using the 3SLac- and 6SLac-MIP-gate FETs to some extent, where the detecting signal from the competent was suppressed by 40% at maximum. Therefore, a platform based on the MIP-coupled FET biosensor is suitable for a selective biosensing system in an enzyme-free manner, which can be applied widely in medical fields. However, we need to further improve the selectivity of MIP-gate FETs to discriminate more clearly between similar structures of sugar chains such as 3SLac and 6SLac.

  8. Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

    NASA Astrophysics Data System (ADS)

    Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

    2017-09-01

    It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

  9. A pure inorganic 1D chain based on {Mo8O28} clusters and Mn(II) ions: [Mn(H2O)2Mo8O28 ] n 6 n -

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaofen; Yan, Yonghong; Wu, Lizhou; Yu, Chengxin; Dong, Xinbo; Hu, Huaiming; Xue, Ganglin

    2016-01-01

    A new pure inorganic polymer, (NH4)6n[Mn(H2O)2Mo8O28)]n(H2O)2n(1), has been synthesized and characterized by elemental analyses, IR spectrum, UV-vis absorption spectra, TG-DSC and electrochemical studies. In 1, [Mo8O28]8- anions act as tetradentate ligands and are alternately linked by Mn(H2O)2 2 + ions into a one-dimensional chain structure. It is interesting that 1 represents the first example of pure inorganic-inorganic hybrid based on octamolybdate and transition metal ions. Moreover, it was indicated that 1 had definite catalytic activities on the probe reaction of benzyl alcohol oxidation to benzaldehyde with H2O2.

  10. Analysis of charge transport in gels containing polyoxometallates using methods of different sensitivity to migration.

    PubMed

    Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R

    2006-08-04

    Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.

  11. The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

    NASA Astrophysics Data System (ADS)

    Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

    1989-06-01

    The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

  12. Low-cost synthesis and physical characterization of thieno[3,4-c]pyrrole-4,6-dione-based polymers.

    PubMed

    Berrouard, Philippe; Dufresne, Stéphane; Pron, Agnieszka; Veilleux, Justine; Leclerc, Mario

    2012-09-21

    The improved synthesis of thieno[3,4-c]pyrrole-4,6-dione (TPD) monomers, including Gewald thiophene ring formation, a Sandmeyer-type reaction, and neat condensation with an amine, is presented. This protocol enables faster, cheaper, and more efficient preparation of TPD units in comparison to traditional methods. Furthermore, a series of TPD homo- and pseudohomopolymers bearing various alkyl chains was synthesized via a direct heteroarylation polymerization (DHAP) procedure. UV-visible absorption and powder X-ray diffraction measurements revealed the relationship between the ratio of branched to linear alkyl chains and the optoelectronic properties of the polymers as well as their packing in the solid state.

  13. NMR-based conformational analysis of perezone and analogues.

    PubMed

    Zepeda, L Gerardo; Burgueño-Tapia, Eleuterio; Pérez-Hernández, Nury; Cuevas, Gabriel; Joseph-Nathan, Pedro

    2013-04-01

    Complete assignment of the (1)H NMR chemical shift and coupling constant values of perezone (1), O-methylperezone (2) and 6-hydroxyperezone (3) was carried out by total-line-shape-fitting calculations using the PERCH iterative spectra analysis software (PERCH Solutions Ltd., Kuopio, Finland). The resulting simulated spectra for the three compounds showed strong similarity to their corresponding experimental spectra. Particularly, all vicinal, allylic and homoallylic coupling constant values for the side chain of the three compounds were very similar, thus revealing that the conformation of these three molecules in solution is indeed almost identical. This fact is in agreement with extended side chain conformations over folded chain conformations because 1, 2 and 3 undergo completely different intramolecular cycloaddition reactions. In addition, results of double pulsed field gradient spin echo NOESY 1D experiments performed on perezone (1) were unable to provide evidence for folded conformers. Copyright © 2013 John Wiley & Sons, Ltd.

  14. AJIPHASE®: A Highly Efficient Synthetic Method for One-Pot Peptide Elongation in the Solution Phase by an Fmoc Strategy.

    PubMed

    Takahashi, Daisuke; Inomata, Tatsuji; Fukui, Tatsuya

    2017-06-26

    We previously reported an efficient peptide synthesis method, AJIPHASE®, that comprises repeated reactions and isolations by precipitation. This method utilizes an anchor molecule with long-chain alkyl groups as a protecting group for the C-terminus. To further improve this method, we developed a one-pot synthesis of a peptide sequence wherein the synthetic intermediates were isolated by solvent extraction instead of precipitation. A branched-chain anchor molecule was used in the new process, significantly enhancing the solubility of long peptides and the operational efficiency compared with the previous method, which employed precipitation for isolation and a straight-chain aliphatic group. Another prerequisite for this solvent-extraction-based strategy was the use of thiomalic acid and DBU for Fmoc deprotection, which facilitates the removal of byproducts, such as the fulvene adduct. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The J beta segment of the T cell receptor contributes to the V beta-specific T cell expansion caused by staphylococcal enterotoxin B and Urtica dioica superantigens.

    PubMed

    Musette, P; Galelli, A; Truffa-Bachi, P; Peumans, W; Kourilsky, P; Gachelin, G

    1996-03-01

    We have used a new polymerase chain reaction-based technique to analyze at the clonal level the CDR3 diversity and the J beta usage associated with the V beta-dependent T cell receptor (TCR) recognition of two superantigens: the staphylococcal enterotoxin B and the Urtica dioica agglutinin. Our results show that subset of J beta elements is preferentially expanded in a given V beta family, independently of the nature of the superantigen. By contrast, the CDR3 loop does not contribute significantly to the T cell expansion induced by the superantigens. We conclude that the J beta segment of the TCR beta chain, but not the CDR3 region, participates in superantigen binding, presumably by influencing the quaternary structure of the TCR beta chain.

  16. A facile method to synthesize boron-doped Ni/Fe alloy nano-chains as electrocatalyst for water oxidation

    NASA Astrophysics Data System (ADS)

    Yang, Yisu; Zhuang, Linzhou; Lin, Rijia; Li, Mengran; Xu, Xiaoyong; Rufford, Thomas E.; Zhu, Zhonghua

    2017-05-01

    We report a novel magnetic field assisted chemical reduction method for the synthesis of boron-doped Ni/Fe nano-chains as promising catalysts for the oxygen evolution reaction (OER). The boron-doped Ni/Fe nano-chains were synthesised in a one step process at room temperature using NaBH4 as a reducing agent. The addition of boron reduced the magnetic moment of the intermediate synthesis products and produced nano-chains with a high specific surface area of 73.4 m2 g-1. The boron-doped Ni/Fe nano-chains exhibited catalytic performance superior to state-of-the-art Ba0.5Sr0.5Co0.8Fe0.2O3-δ perovskite and RuO2 noble metal oxide catalysts. The mass normalized activity of the boron-doped Ni/Fe nano-chains measured at an overpotential of 0.35 V was 64.0 A g-1, with a Tafel slope of only 40 mV dec-1. The excellent performance of the boron-doped Ni/Fe nano-chains can be attributed to the uniform elemental distribution and highly amorphous structure of the B-doped nano-chains. These results provide new insights into the effect of doping transition-metal based OER catalysts with non-metallic elements. The study demonstrates a facile approach to prepare transition metal nano-chains using magnetic field assisted chemical reduction method as cheap and highly active catalysts for electrochemical water oxidation.

  17. No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

    PubMed

    Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

    2012-07-30

    This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

    PubMed

    Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

    2013-05-07

    We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

  19. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

    PubMed

    Kidd, I M; Clark, D A; Emery, V C

    2000-06-01

    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

  20. Gelation-driven selection in dynamic covalent C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 C/CN exchange.

    PubMed

    Liang, Chunshuang; Kulchat, Sirinan; Jiang, Shimei; Lehn, Jean-Marie

    2017-10-01

    Knoevenagel barbiturate derivatives bearing long alkyl chains were proven to form organogels in suitable solvents based on supramolecular interactions. Their reaction with imines allows for component exchange through CC/CN recombination. The effect of various parameters (solvents, chain length, and temperature) on the CC/CN exchange reaction has been studied. Mixing Knoevenagel compound K and imine I-16 in a 1 : 1 ratio generated a constitutional dynamic library containing the four constituents K , I-16 , K'-16 , and I' . The reversible exchange reaction was monitored by 1 H-NMR, showing marked changes in the fractions of the four constituents on sol-gel interconversion as a function of temperature. The library composition changed from statistical distribution of the four constituents in the sol state to selective amplification of the gel forming K'-16 constituent together with that of its agonist I' . The process amounts to self-organization driven component selection in a constitutional dynamic organogel system undergoing gelation. This process displays up-regulation of the gel-forming constituent by component redistribution through reversible covalent connections.

Top