ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

PubMed

Winkelmann, Kurt; Calhoun, Robert L; Mills, German

2006-12-28

Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

PubMed Central

Ekstedt, Richard D.; Stollerman, Gene H.

1960-01-01

Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

The role of acyl carrier protein isoforms from Cuphea lanceolata seeds in the de-novo biosynthesis of medium-chain fatty acids.

PubMed

Schütt, B S; Brummel, M; Schuch, R; Spener, F

1998-06-01

To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

NASA Astrophysics Data System (ADS)

Verma, Anand Mohan; Kishore, Nanda

2017-02-01

The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

PubMed

Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E

2017-09-15

Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

PubMed Central

Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

2011-01-01

The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

PubMed

Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

2017-01-01

To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

A parallel algorithm for step- and chain-growth polymerization in molecular dynamics.

PubMed

de Buyl, Pierre; Nies, Erik

2015-04-07

Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

A parallel algorithm for step- and chain-growth polymerization in molecular dynamics

NASA Astrophysics Data System (ADS)

de Buyl, Pierre; Nies, Erik

2015-04-01

Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Water-soluble cavitands promote hydrolyses of long-chain diesters

PubMed Central

Shi, Qixun; Mower, Matthew P.; Blackmond, Donna G.; Rebek, Julius

2016-01-01

Water-soluble, deep cavitands serve as chaperones of long-chain diesters for their selective hydrolysis in aqueous solution. The cavitands bind the diesters in rapidly exchanging, folded J-shape conformations that bury the hydrocarbon chain and expose each ester group in turn to the aqueous medium. The acid hydrolyses in the presence of the cavitand result in enhanced yields of monoacid monoester products. Product distributions indicate a two- to fourfold relative decrease in the hydrolysis rate constant of the second ester caused by the confined space in the cavitand. The rate constant for the first acid hydrolysis step is enhanced approximately 10-fold in the presence of the cavitand, compared with control reactions of the molecules in bulk solution. Hydrolysis under basic conditions (saponification) with the cavitand gave >90% yields of the corresponding monoesters. Under basic conditions the cavitand complex of the monoanion precipitates from solution and prevents further reaction. PMID:27482089

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Reaction pathways of propene pyrolysis.

PubMed

Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

2010-05-01

The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

PubMed

Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

2013-12-01

A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

USGS Publications Warehouse

Chase, D.M.; Pascho, R.J.

1998-01-01

Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria.

PubMed

Paris, Daniel H; Imwong, Mallika; Faiz, Abul M; Hasan, Mahtabuddin; Yunus, Emran Bin; Silamut, Kamolrat; Lee, Sue J; Day, Nicholas P J; Dondorp, Arjen M

2007-11-01

A recently described loop-mediated isothermal polymerase chain reaction (LAMP) for molecular detection of Plasmodium falciparum was compared with microscopy, PfHRP2-based rapid diagnostic test (RDT), and nested polymerase chain reaction (PCR) as the "gold standard" in 115 Bangladeshi in-patients with fever. DNA extraction for LAMP was conducted by conventional methods or simple heating of the sample; test results were either assessed visually or by gel electrophoresis. Conventional DNA extraction followed by gel electrophoresis had the highest agreement with the reference method (81.7%, kappa = 0.64), with a sensitivity (95% CI) of 76.1% (68.3-83.9%), comparable to RDT and microscopy, but a specificity of 89.6% (84.0-95.2%) compared with 100% for RDT and microscopy. DNA extraction by heat treatment deteriorated specificity to unacceptable levels. LAMP enables molecular diagnosis of falciparum malaria in settings with limited technical resources but will need further optimization. The results are in contrast with a higher accuracy reported in an earlier study comparing LAMP with a non-validated PCR method.

Improved properties of recycled polypropylene by introducing the long chain branched structure through reactive extrusion.

PubMed

Li, Yingchun; Jia, Shuai; Du, Shuanli; Wang, Yafei; Lv, Lida; Zhang, Jianbin

2018-06-01

An approach originated from preparing long chain branched polypropylene (PP) was applied to modify the properties of recycled PP that involved reactive extrusion to introduce a branched chain structure onto recycled PP under the assistance of chemical reaction between maleic anhydride (MAH) monomer and glycidyl methacrylate (GMA) grafts. The results from Fourier transformed infrared spectroscopy (FTIR) indicated the reaction took place during melt mixing, and the intensity of ester increased with increasing amount of MAH. Several rheological plots including complex viscosity, storage modulus, loss modulus, loss tangent and Cole-Cole plot were used to investigate the rheological properties of recycled PP and modified PP with MAH, which indicated an additional longer relaxation time that was not shown in recycled PP. The effects of branched structure on melting and crystallization behaviors were also investigated, demonstrating the branched chains acted as nucleating agent. Moreover, the branched structure of modified samples gave rise to enhance mechanical properties, especially, the higher impact strength compared with recycled PP. Copyright © 2018 Elsevier Ltd. All rights reserved.

Estimates of production and structure of nuclei with Z = 119

NASA Astrophysics Data System (ADS)

Adamian, G. G.; Antonenko, N. V.; Lenske, H.

2018-02-01

The comparative analysis of the hot fusion reactions 50Ti +247-249Bk and 51V +246-248Cm for synthesis of element 119 is made with the dinuclear system model and the prediction of nuclear properties of the microscopic-macroscopic approach, where the closed proton shell at Z ≥ 120 is expected. The quasiparticle structures of nuclei in the α-decay chain of 295119 and a possible spread of alpha energies are studied. The calculated values of Qα are compared with available experimental data. The termination of the α-decay chain of 295119 is revealed.

Equilibrium Polymerization of Butyl Methacrylate in Bulk and in Nanopore Confinement

NASA Astrophysics Data System (ADS)

Tian, Qian; Simon, Sindee

The equilibrium between monomer and polymer in free radical polymerization can be shifted towards monomer under nanoconfinement. This decrease in ceiling temperature is due to a decrease in the entropy associated with the constrained polymer chains, resulting in a larger negative change in entropy of reaction. Here, we investigate the equilibrium polymerization of butyl methacrylate (BMA) in bulk and in nanopore confinement with differential scanning calorimetry (DSC) using di-tert-butyl peroxide (DTBP) as initiator. This system has several advantages compare to the previously studied system of methyl methacrylate (MMA) initiated with 2,2'-azo-bis-isobutyronitrile (AIBN), namely, a reduced rate of reaction, higher boiling point of monomer, and higher initiator utilization temperature range, all of which facilitate the study of the reaction at high temperatures near the ceiling temperature. Interestingly, for BMA, there is no change in limiting conversion between material reacted in bulk and that in controlled pore glass having pore diameters of 7.5 and 50 nm. This unexpected result may be due to the greater flexibility of the PBMA chains compared to PMMA, suggesting that in the BMA/PBMA system, the degree of confinement is relatively low. Future studies will continue to investigate how the entropy change on reaction is affected by confinement.

Chain reaction: an exploratory study of nursing home bankruptcy in California.

PubMed

Kitchener, Martin; O'neill, Ciaran; Harrington, Charlene

2005-01-01

This paper reports on an exploratory study of nursing home bankruptcy. From state and industry data regarding nearly 1,000 California facilities, it was possible to identify 155 homes in five chains (multi-facility organizations) that were operating in bankruptcy in 2000. When compared with facilities in non-bankrupt chains, while the bankrupt chain facilities had significantly worse financial liquidity, higher administrative costs, and higher payables to related parties, they also had more Medicare residents, fewer Medicaid residents, better solvency, and were located in less competitive county markets and in areas with higher Medicaid reimbursement rates. These findings indicate that, rather than facility characteristics and local market factors, strategic decisions taken at the corporate (chain) level are the major determinants of nursing facility bankruptcy status.

A case of Pitt-Hopkins syndrome with absence of hyperventilation.

PubMed

Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

2013-12-01

Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

The role of living/controlled radical polymerization in the formation of improved imprinted polymers.

PubMed

Salian, Vishal D; Vaughan, Asa D; Byrne, Mark E

2012-06-01

In this work, living/controlled radical polymerization (LRP) is compared with conventional free radical polymerization in the creation of highly and weakly cross-linked imprinted poly(methacrylic acid-co-ethylene glycol dimethacrylate) networks. It elucidates, for the first time, the effect of LRP on the chain level and begins to explain why the efficiency of the imprinting process is improved using LRP. Imprinted polymers produced via LRP exhibited significantly higher template affinity and capacity compared with polymers prepared using conventional methods. The use of LRP in the creation of highly cross-linked imprinted polymers resulted in a fourfold increase in binding capacity without a decrease in affinity; whereas weakly cross-linked gels demonstrated a nearly threefold increase in binding capacity at equivalent affinity when LRP was used. In addition, by adjusting the double bond conversion, we can choose to increase either the capacity or the affinity in highly cross-linked imprinted polymers, thus allowing the creation of imprinted polymers with tailorable binding parameters. Using free radical polymerization in the creation of polymer chains, as the template-monomer ratio increased, the average molecular weight of the polymer chains decreased despite a slight increase in the double bond conversion. Thus, the polymer chains formed were shorter but greater in number. Using LRP neutralized the effect of the template. The addition of chain transfer agent resulted in slow, uniform, simultaneous chain growth, resulting in the formation of longer more monodisperse chains. Reaction analysis revealed that propagation time was extended threefold in the formation of highly cross-linked polymers when LRP techniques were used. This delayed the transition to the diffusion-controlled stage of the reaction, which in turn led to the observed enhanced binding properties, decreased polydispersity in the chains, and a more homogeneous macromolecular architecture. Copyright © 2012 John Wiley & Sons, Ltd.

[Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

PubMed

Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

2010-06-01

To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

PubMed

Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

2015-08-25

Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

EPA Science Inventory

EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

Synthesis, Characterization and Application of Thermoresponsive Polyhydroxyalkanoate-graft-Poly(N-isopropylacrylamide).

PubMed

Ma, Yi-Ming; Wei, Dai-Xu; Yao, Hui; Wu, Lin-Ping; Chen, Guo-Qiang

2016-08-08

A thermoresponsive graft copolymer polyhydroxyalkanoate-g-poly(N-isopropylacrylamide) or short as PHA-g-PNIPAm, was successfully synthesized via a three-step reaction. First, PNIPAm oligomer with a trithiocarbonate-based chain transfer agent (CTA), short as PNIPAm-CTA, with designed polymerization degree was synthesized via reversible addition-fragmentation chain transfer (RAFT) polymerization. Subsequently, the PNIPAm-CTA was treated with n-butylamine for aminolysis in order to obtain a pendant thiol group at the end of the chain (PNIPAm-SH). Finally, the PNIPAm-SH was grafted onto unsaturated P(3HDD-co-3H10U), a random copolymer of 3-hydroxydodecanoate (3HDD) and 3-hydroxy-10-undecylenate (3H10U), via a thiol-ene click reaction. Enhanced hydrophilicity and thermoresponsive property of the resulted PHA-g-PNIPAm were confirmed by water contact angle studies. The biocompatibility of PHA-g-PNIPAm was comparable to poly-3-hydroxybutyrate (PHB). The graft copolymer PHA-g-PNIPAm based on biopolyester PHA could be a promising material for biomedical applications.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Identification of Helicobacter and Wolinella spp. in Oral Cavity of Toy Breed Dogs With Periodontal Disease.

PubMed

Nowroozilarki, Negar; Jamshidi, Shahram; Zahraei Salehi, Taghi; Kolahian, Saeed

2017-09-01

Periodontal diseases are the most common oral cavity infectious diseases in adult dogs. We aimed in this study to identify Helicobacter and Wolinella spp. in saliva and dental plaque of dogs with periodontitis. Sixty-two small-breed pet dogs, aged more than 6 years from both sexes, were categorized into healthy and periodontitis groups. Samples from saliva and dental plaques were collected, and Helicobacter and Wolinella were identified on genus and species levels using polymerase chain reaction. Our results showed significant increase in infection rate of Wolinella spp. in periodontitis compared with healthy dogs (P = .002). Furthermore, infection rate of Helicobacter genus was significantly higher in periodontitis compared with healthy dogs (P = .007). Infection with Wolinella spp. showed higher rate than Helicobacter spp. in dogs with periodontitis. According to species-specific polymerase chain reaction results, Helicobacter felis (9.76%) was the main Helicobacter spp. in dogs with periodontitis compared with healthy dogs (P < .001). Oral cavity of pet dogs with periodontitis could be considered as an important source of Wolinella and Helicobacter spp. infections. Copyright © 2017 Elsevier Inc. All rights reserved.

Heterocyclic alpha-alkylidene cyclopentenones obtained via a Pauson-Khand reaction of amino acid derived allenynes. A scope and limitation study directed toward the preparation of a tricyclic pyrrole library.

PubMed

Brummond, Kay M; Curran, Dennis P; Mitasev, Branko; Fischer, Stefan

2005-03-04

The synthesis of a novel class of tricyclic pyrroles has been accomplished by using a Pauson-Khand/Stetter/Paal-Knorr reaction sequence. Full details of the Pauson-Khand reaction of amino acid tethered allenynes 4a-e and 9a-d are disclosed. The study of this reaction led to the discovery of an unprecedented substituent effect on the diastereoselectivity of the Mo(CO)6 mediated allenic Pauson-Khand reaction. It was found that amino acid tethered allenynes with aromatic side chains afford alpha-alkylidene cyclopentenones with the opposite diastereoselectivity compared to those with aliphatic side chains. This effect has been attributed to complexation of the metal mediator to the aromatic ring in the substrate. Furthermore, an isomerization of one of the diastereomers of the alpha-alkylidene cyclopentenones was encountered, leading to eventual decomposition. The stable diastereomers were found to react well in the Stetter reaction leading to 1,4-diketones that were converted to pyrroles. The observation that the first generation of 2-alkyl-substituted pyrroles was unstable led to a second generation of 2-carboxamide pyrroles with sufficient stability for biological tests which are in progress.

The biomechanical and perceptual influence of chain resistance on the performance of the olympic clean.

PubMed

Berning, Joseph M; Coker, Cheryl A; Briggs, Doug

2008-03-01

Proponents of chain training suggest that using chains hung from the ends of barbells rather than using conventional barbells alone enhances strength, power, and neuromuscular adaptations. The purpose of this study was to determine whether a conventional barbell with chains compared to a conventional barbell without chains would affect the performance of an Olympic Clean. The subjects were also asked regarding their perception of how chains affected their lifting. Four male and 3 female competitive weightlifters who used chains as part of their training participated in the study. The testing protocol compared the subjects' lifting 80% and 85% of their 1 repetition maximum (1RM) using conventional barbells and their lifting 80% and 85% of their 1RM using chains (75% conventional barbells + 5% chains and 80% conventional barbells + 5% chains, respectively). Video analysis evaluated the bar's vertical displacement and velocity and the rate of force production. Vertical ground reaction forces for the first-pull, unweighting, and second-pull phases of the lift were evaluated by using a force plate. After testing, the subjects completed a 2-item questionnaire asking individual perception of the effects of the chains. The results showed no significant difference for condition for any of the variables examined. In contrast, all subjects perceived that the chains required a greater effort. In conclusion, the results indicated that the addition of chains provided no greater value over lifting conventional barbells alone in the performance of the Olympic Clean, although the subjects perceived the chains to have a positive effect.

Gene Polymorphism Studies in a Teaching Laboratory

ERIC Educational Resources Information Center

Shultz, Jeffry

2009-01-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this…

[Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

PubMed

Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

2016-02-01

Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

Quasifree (p, 2p) Reactions on Oxygen Isotopes: Observation of Isospin Independence of the Reduced Single-Particle Strength.

PubMed

Atar, L; Paschalis, S; Barbieri, C; Bertulani, C A; Díaz Fernández, P; Holl, M; Najafi, M A; Panin, V; Alvarez-Pol, H; Aumann, T; Avdeichikov, V; Beceiro-Novo, S; Bemmerer, D; Benlliure, J; Boillos, J M; Boretzky, K; Borge, M J G; Caamaño, M; Caesar, C; Casarejos, E; Catford, W; Cederkall, J; Chartier, M; Chulkov, L; Cortina-Gil, D; Cravo, E; Crespo, R; Dillmann, I; Elekes, Z; Enders, J; Ershova, O; Estrade, A; Farinon, F; Fraile, L M; Freer, M; Galaviz Redondo, D; Geissel, H; Gernhäuser, R; Golubev, P; Göbel, K; Hagdahl, J; Heftrich, T; Heil, M; Heine, M; Heinz, A; Henriques, A; Hufnagel, A; Ignatov, A; Johansson, H T; Jonson, B; Kahlbow, J; Kalantar-Nayestanaki, N; Kanungo, R; Kelic-Heil, A; Knyazev, A; Kröll, T; Kurz, N; Labiche, M; Langer, C; Le Bleis, T; Lemmon, R; Lindberg, S; Machado, J; Marganiec-Gałązka, J; Movsesyan, A; Nacher, E; Nikolskii, E Y; Nilsson, T; Nociforo, C; Perea, A; Petri, M; Pietri, S; Plag, R; Reifarth, R; Ribeiro, G; Rigollet, C; Rossi, D M; Röder, M; Savran, D; Scheit, H; Simon, H; Sorlin, O; Syndikus, I; Taylor, J T; Tengblad, O; Thies, R; Togano, Y; Vandebrouck, M; Velho, P; Volkov, V; Wagner, A; Wamers, F; Weick, H; Wheldon, C; Wilson, G L; Winfield, J S; Woods, P; Yakorev, D; Zhukov, M; Zilges, A; Zuber, K

2018-02-02

Quasifree one-proton knockout reactions have been employed in inverse kinematics for a systematic study of the structure of stable and exotic oxygen isotopes at the R^{3}B/LAND setup with incident beam energies in the range of 300-450  MeV/u. The oxygen isotopic chain offers a large variation of separation energies that allows for a quantitative understanding of single-particle strength with changing isospin asymmetry. Quasifree knockout reactions provide a complementary approach to intermediate-energy one-nucleon removal reactions. Inclusive cross sections for quasifree knockout reactions of the type ^{A}O(p,2p)^{A-1}N have been determined and compared to calculations based on the eikonal reaction theory. The reduction factors for the single-particle strength with respect to the independent-particle model were obtained and compared to state-of-the-art ab initio predictions. The results do not show any significant dependence on proton-neutron asymmetry.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

Sustainable Engineering and Improved Recycling of PET for High-Value Applications: Transforming Linear PET to Lightly Branched PET with a Novel, Scalable Process

NASA Astrophysics Data System (ADS)

Pierre, Cynthia; Torkelson, John

2009-03-01

A major challenge for the most effective recycling of poly(ethylene terephthalate) concerns the fact that initial melt processing of PET into a product leads to substantial degradation of molecular weight. Thus, recycled PET has insufficient melt viscosity for reuse in high-value applications such as melt-blowing of PET bottles. Academic and industrial research has tried to remedy this situation by synthesis and use of ``chain extenders'' that can lead to branched PET (with higher melt viscosity than the linear recycled PET) via condensation reactions with functional groups on the PET. Here we show that simple processing of PET via solid-state shear pulverization (SSSP) leads to enhanced PET melt viscosity without need for chemical additives. We hypothesize that this branching results from low levels of chain scission accompanying SSSP, leading to formation of polymeric radicals that participate in chain transfer and combination reactions with other PET chains and thereby to in situ branch formation. The pulverized PET exhibits vastly enhanced crystallization kinetics, eliminating the need to employ cold crystallization to achieve maximum PET crystallinity. Results of SSSP processing of PET will be compared to results obtained with poly(butylene terephthalate).

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

Ab initio study of chain branching reactions involving second generation products in hydrocarbon combustion mechanisms.

PubMed

Davis, Alexander C; Francisco, Joseph S

2012-01-28

sec-Alkyl radicals are key reactive intermediates in the hydrocarbon combustion and atmospheric decomposition mechanisms that are formed by the abstraction of hydrogen from an alkane, or as a second generation product of n-alkyl H-migrations, C-C bond scissions in branched alkyl radicals, or the bimolecular reaction between olefins and n-alkyl radicals. Since alkanes and branched alkanes, which the sec-alkyl radicals are derived from, make up roughly 40-50% of traditional fuels an understanding of their chemistry is essential to improving combustion systems. The present work investigates all H-migration reactions initiated from an sec-alkyl radical that involve the movement of a secondary hydrogen, for the 2-butyl through 4-octyl radicals, using the CBS-Q, G2, and G4 composite methods. The resulting thermodynamic and kinetic parameters are compared to similar reactions in n-alkyl radicals in order to determine underlying trends. Particular attention is paid to the effect of cis/trans and 1,3-diaxial interactions on activation energies and rate coefficients. When combined with our previous work on n-alkyl radical H-migrations, a complete picture of H-migrations in unbranched alkyl radicals is obtained. This full data set suggests that the directionality of the remaining branched chains has a minimal effect on the rate coefficients for all but the largest viable transition states, which is in stark contrast to the differences predicted by the structurally similar dimethylcycloalkanes. In fact the initial location of the secondary radical site has a greater effect on the rate than does the directionality of the remaining alkyl chains. The activation energies for secondary to secondary reactions are much closer to those of the secondary to primary H-migrations. However, the rate coefficients are found to be closer to the corresponding primary to primary reaction values. A significant ramification of these results is that there will be multiple viable reaction pathways for these reactions instead of only one dominant pathway as previously believed.

Lipozyme RM IM-catalyzed acidolysis of Cinnamomum camphora seed oil with oleic acid to produce human milk fat substitutes enriched in medium-chain fatty acids.

PubMed

Zou, Xian-Guo; Hu, Jiang-Ning; Zhao, Man-Li; Zhu, Xue-Mei; Li, Hong-Yan; Liu, Xiao-Ru; Liu, Rong; Deng, Ze-Yuan

2014-10-29

In the present study, a human milk fat substitute (HMFS) enriched in medium-chain fatty acids (MCFAs) was synthesized through acidolysis reaction from Cinnamomum camphora seed oil (CCSO) with oleic acid in a solvent-free system. A commercial immobilized lipase, Lipozyme RM IM, from Rhizomucor miehei, was facilitated as a biocatalyst. Effects of different reaction conditions, including substrate molar ratio, enzyme concentration, reaction temperature, and reaction time were investigated using response surface methodology (RSM) to obtain the optimal oleic acid incorporation. After optimization, results showed that the maximal incorporation of oleic acid into HMFS was 59.68%. Compared with CCSO, medium-chain fatty acids at the sn-2 position of HMFS accounted for >70%, whereas oleic acid was occupied predominantly at the sn-1,3 position (78.69%). Meanwhile, triacylglycerol (TAG) components of OCO (23.93%), CCO (14.94%), LaCO (13.58%), OLaO (12.66%), and OOO (11.13%) were determined as the major TAG species in HMFS. The final optimal reaction conditions were carried out as follows: substrate molar ratio (oleic acid/CCSO), 5:1; enzyme concentration, 12.5% (w/w total reactants); reaction temperature, 60 °C; and reaction time, 28 h. The reusability of Lipozyme RM IM in the acidolysis reaction was also evaluated, and it was found that it could be reused up to 9 times without significant loss of activities. Urea inclusion method was used to separate and purify the synthetic product. As the ratio of HMFS/urea increased to 1:2, the acid value lowered to the minimum. In a scale-up experiment, the contents of TAG and total tocopherols in HMFS (modified CCSO) were 77.28% and 12.27 mg/100 g, respectively. All of the physicochemical indices of purified product were within food standards. Therefore, such a MCFA-enriched HMFS produced by using the acidolysis method might have potential application in the infant formula industry.

Characterization of milled solid residue from cypress liquefaction in sub- and super ethanol.

PubMed

Liu, Hua-Min; Liu, Yu-Lan

2014-01-01

Cypress liquefaction in sub- and super ethanol was carried out in an autoclave at various temperatures. Milled solid residue (MSR) was isolated from solid residue remaining from the liquefaction process, and its chemical characteristics was comparatively investigated with milled wood lignin (MWL) of cypress by sugar analysis, elemental analysis, FT-IR analysis, gel permeation chromatography, and NMR analysis. Results showed that there were two reactions (de-polymerization and re-polymerization) during the cypress liquefaction in sub- and super ethanol and the re-polymerization reactions were the main reaction at 220-260°C. Considering the stability of side-chain, the stability of lignin side-chain in cypress during liquefaction process in ethanol could be sequenced as follows: β-5>β-β'>β-O-4'. The MSR were mainly from the decomposition and re-polymerization of lignin. This study suggests that characterization of MSR provides a promising method to investigate the mechanisms of cypress liquefaction in ethanol. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Experimental studies of one-way reaction front barriers in three-dimensional vortex flows

NASA Astrophysics Data System (ADS)

Gannon, Joanie; Doan, Minh; Simons, Jj; Mitchell, Kevin; Solomon, Tom

2017-11-01

We present results of experimental studies of the evolution of the excitable, Ruthenium (Ru)-catalyzed, Belousov-Zhabotinsky (BZ) reaction in a three-dimensional (3D) flow composed of the superposition of horizontal and vertical vortex chains. The reaction fronts are imaged in 3D with a scanning, laser-induced fluorescence technique that takes advantage of the differential fluoresence of the Ruthenium indicated at the front. When the horizontal and vertical vortex chains are lined up, a dominant scroll structure is observed that acts as a one-way barrier blocking fronts propagating across vortex boundaries and into vortex centers. A second, quarter-tube barrier is observed along the edges of the unit cell. When the vortices are shifted relative to each other, tube-like barriers are observed in the interior. All of these barriers are compared with burning invariant manifolds predicted from a 6D set of differential equations describing the evolution of front elements in the flow. Supported by NSF Grants DMR-1361881 and DUE-1317446.

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

A Physics Finale.

ERIC Educational Resources Information Center

Haynes, Gail E.

1991-01-01

A third-semester physics course that covers the topics of atomic physics, the theory of relativity, and nuclear energy is described. Activities that include the phenomenon of radioactivity, field trips to a nuclear power plant, a simulation of a chain reaction, and comparing the size of atomic particles are presented. (KR)

New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

EPA Science Inventory

Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?

PubMed

Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D

2016-07-14

The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Endogenous ethanol affects biopolyester molecular weight in recombinant Escherichia coli.

PubMed

Hiroe, Ayaka; Hyakutake, Manami; Thomson, Nicholas M; Sivaniah, Easan; Tsuge, Takeharu

2013-11-15

In biopolyester synthesis, polyhydroxyalkanoate (PHA) synthase (PhaC) catalyzes the polymerization of PHA in bacterial cells, followed by a chain transfer (CT) reaction in which the PHA polymer chain is transferred from PhaC to a CT agent. Accordingly, the frequency of CT reaction determines PHA molecular weight. Previous studies have shown that exogenous alcohols are effective CT agents. This study aimed to clarify the effect of endogenous ethanol as a CT agent for poly[(R)-3-hydroxybutyrate] [P(3HB)] synthesis in recombinant Escherichia coli, by comparing with that of exogenous ethanol. Ethanol supplementation to the culture medium reduced P(3HB) molecular weights by up to 56% due to ethanol-induced CT reaction. NMR analysis of P(3HB) polymers purified from the culture supplemented with (13)C-labeled ethanol showed the formation of a covalent bond between ethanol and P(3HB) chain at the carboxyl end. Cultivation without ethanol supplementation resulted in the reduction of P(3HB) molecular weight with increasing host-produced ethanol depending on culture aeration. On the other hand, production in recombinant BW25113(ΔadhE), an alcohol dehydrogenase deletion strain, resulted in a 77% increase in molecular weight. Analysis of five E. coli strains revealed that the estimated number of CT reactions was correlated with ethanol production. These results demonstrate that host-produced ethanol acts as an equally effective CT agent as exogenous ethanol, and the control of ethanol production is important to regulate the PHA molecular weight.

Non-equilibrium kinetics of plasma-assisted combustion: the role of electronically excited atoms and molecules

NASA Astrophysics Data System (ADS)

Popov, Nikolay

2016-09-01

A review of experimental and theoretical investigations of the effect of electronically excited atoms and molecules on the induction delay time and on the shift of the ignition temperature threshold of combustible mixtures is presented. At relatively low initial gas temperature, the effect of excited O(1D) atoms on the oxidation and reforming of combustible mixtures is quite significant due to the high rates of reactions of O(1D) atoms with hydrogen and hydrocarbon molecules. The singlet oxygen molecules, O2(a1Δg) , participate both in chain initiation and chain branching reactions, but the effect of O2(a1Δg) in the ignition processes is generally less important compared to the oxygen atoms. To reduce the ignition delay time and decrease the temperature threshold of fuel-air mixtures, the use of gas discharges with relatively high E/N values is recommended. In this case the reactions of electronically excited N2(A3Σu+ , B3πg , C3πu , a'1Σu-) molecules, and atomic particles in ground and electronically excited states are extremely important. The energy stored in electronic excitation of atoms and molecules is spent on the additional dissociation of oxygen and fuel molecules, on the fast gas heating, and finally to the triggering of chain branching reactions. This work was partially supported by AOARD AFOSR, FA2386-13-1-4064 grant and Linked International Laboratory LIA KaPPA (France-Russia).

Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

PubMed Central

Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

1997-01-01

We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Kinetics and mechanism of electron transfer reaction of single and double chain surfactant cobalt(III) complex by Fe2+ ions in liposome (dipalmitoylphosphotidylcholine) vesicles: effects of phase transition

NASA Astrophysics Data System (ADS)

Nagaraj, Karuppiah; Senthil Murugan, Krishnan; Thangamuniyandi, Pilavadi

2015-05-01

In this study, we report the kinetics of reduction reactions of single and double chain surfactant cobalt(III) complexes of octahedral geometry, cis-[Co(en)2(4AMP)(DA)](ClO4)3 and cis-[Co(dmp)2(C12H25NH2)2](ClO4)3 (en = ethylenediamine, dmp = 1,3-diaminopropane, 4AMP = 4-aminopropane, C12H25NH2 = dodecylamine) by Fe2+ ion in dipalmitoylphosphotidylcholine (DPPC) vesicles at different temperatures under pseudo first-order conditions. The kinetics of these reactions is followed by spectrophotometry method. The reactions are found to be second order and the electron transfer is postulated as outer sphere. The remarkable findings in the present investigation are that, below the phase transition temperature of DPPC, the rate decreases with an increase in the concentration of DPPC, while above the phase transition temperature the rate increases with an increase in the concentration of DPPC. The main driving force for this phenomenon is considered to be the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes. Besides, comparing the values of rate constants of these outer-sphere electron transfer reactions in the absence and in the presence of DPPC, the rate constant values in the presence of DPPC are always found to be greater than in the absence of DPPC. This is ascribed to the double hydrophobic fatty acid chain in the DPPC that gives the molecule an overall tubular shape due to the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes more suitable for vesicle aggregation which facilitates lower activation energy, and consequently higher rate is observed in the presence of DPPC. The activation parameters (ΔS# and ΔH#) of the reactions at different temperatures have been calculated which corroborate the kinetics of the reaction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samsel, R.W.; Perelson, A.S.

Red blood cells aggregate face-to-face to form long, cylindrical, straight chains and sometimes branched structures called rouleaux. Here the authors extend a kinetic model developed by R.W. Samsel and A.S. Perelson to include both the formation and dissociation of rouleaux. Thermodynamic constraints on the rate constants of the model imposed by the principle of detailed balance were examined. Incorporation of reverse reactions allows computation of mean sizes of rouleaux and straight chain segments within rouleaux, as functions of time and at equilibrium. Using the Flory-Stockmayer method from polymer chemistry, a closed-form solution was obtained for the size distribution of straightmore » chain segments within rouleaux at any point in the evolution of the reaction. The predictions of the theory compare favorably with data collected by D. Kernick, A.W.L. Jay, S. Rowlands, and L. Skibo on the kinetics of rouleaux formation. When rouleaux grow large, they may contain rings or loops and take on the appearance of a network. The importance of including the kinetics of ring closure in the development of realistic models of rouleaux formation was demonstrated.« less

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

Multiplex Polymerase Chain Reaction for Identification of Shigellae and Four Shigella Species Using Novel Genetic Markers Screened by Comparative Genomics.

PubMed

Kim, Hyun-Joong; Ryu, Ji-Oh; Song, Ji-Yeon; Kim, Hae-Yeong

2017-07-01

In the detection of Shigella species using molecular biological methods, previously known genetic markers for Shigella species were not sufficient to discriminate between Shigella species and diarrheagenic Escherichia coli. The purposes of this study were to screen for genetic markers of the Shigella genus and four Shigella species through comparative genomics and develop a multiplex polymerase chain reaction (PCR) for the detection of shigellae and Shigella species. A total of seven genomic DNA sequences from Shigella species were subjected to comparative genomics for the screening of genetic markers of shigellae and each Shigella species. The primer sets were designed from the screened genetic markers and evaluated using PCR with genomic DNAs from Shigella and other bacterial strains in Enterobacteriaceae. A novel Shigella quintuplex PCR, designed for the detection of Shigella genus, S. dysenteriae, S. boydii, S. flexneri, and S. sonnei, was developed from the evaluated primer sets, and its performance was demonstrated with specifically amplified results from each Shigella species. This Shigella multiplex PCR is the first to be reported with novel genetic markers developed through comparative genomics and may be a useful tool for the accurate detection of the Shigella genus and species from closely related bacteria in clinical microbiology and food safety.

Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

EPA Science Inventory

Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

PubMed

Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

2007-01-01

We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

Verification of clinical samples, positive in AMPLICOR Neisseria gonorrhoeae polymerase chain reaction, by 16S rRNA and gyrA compared with culture.

PubMed

Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt

2005-06-01

We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.

Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

2009-08-01

A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

PubMed

Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

2018-02-01

Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Predicting gaseous reaction rates of short chain chlorinated paraffins with ·OH: overcoming the difficulty in experimental determination.

PubMed

Li, Chao; Xie, Hong-Bin; Chen, Jingwen; Yang, Xianhai; Zhang, Yifei; Qiao, Xianliang

2014-12-02

Short chain chlorinated paraffins (SCCPs) are under evaluation for inclusion in the Stockholm Convention on persistent organic pollutants. However, information on their reaction rate constants with gaseous ·OH (kOH) is unavailable, limiting the evaluation of their persistence in the atmosphere. Experimental determination of kOH is confined by the unavailability of authentic chemical standards for some SCCP congeners. In this study, we evaluated and selected density functional theory (DFT) methods to predict kOH of SCCPs, by comparing the experimental kOH values of six polychlorinated alkanes (PCAs) with those calculated by the different theoretical methods. We found that the M06-2X/6-311+G(3df,2pd)//B3LYP/6-311 +G(d,p) method is time-effective and can be used to predict kOH of PCAs. Moreover, based on the calculated kOH of nine SCCPs and available experimental kOH values of 22 PCAs with low carbon chain, a quantitative structure-activity relationship (QSAR) model was developed. The molecular structural characteristics determining the ·OH reaction rate were discussed. logkOH was found to negatively correlate with the percentage of chlorine substitutions (Cl%). The DFT calculation method and the QSAR model are important alternatives to the conventional experimental determination of kOH for SCCPs, and are prospective in predicting their persistence in the atmosphere.

Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

PubMed

Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

2015-03-01

Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes. © 2015 The Author(s).

Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

PubMed

Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

2011-01-03

In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

PubMed

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

PubMed

Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

2014-02-01

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR

PubMed Central

Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

2012-01-01

AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830

Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

PubMed

Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

2012-01-21

To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

PubMed

Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

Detection of human papillomaviruses type 16, 18 and 33 in bronchial aspirates of lung carcinoma patients by polymerase chain reaction: a study of 84 cases in Croatia.

PubMed

Branica, Bozica Vrabec; Smojver-Jezek, Silvana; Juros, Zrinka; Grgić, Sandra; Srpak, Nives; Mitrecić, Dinko; Gajović, Srećko

2010-03-01

Besides its well-known role in cervical carcinoma, HPV is also suggested to be involved in lung cancer development. A number of authors have been investigating the presence of HPV in histological materials. We used routine bronchial aspirates from 84 patients with lung carcinoma for DNA extraction and then performed polymerase chain reaction for high-risk HPV types 16, 18 and 33. The results were compared to those obtained from buccal and eyelid mucosa. Only three patients were positive for HPV in bronchial aspirates: one for HPV 16 type, one for HPV 18 type, and one for HPV 33. Our data indicated the low prevalence of HPV in patients with lung carcinomas in Croatia, therefore it seems unlikely that HPV contributes to the development of lung carcinomas in this region.

Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

PubMed

Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

2017-02-23

Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

PubMed

Bullard, K M; Hietpas, P B; Ewing, A G

1998-01-01

Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

Kinematic Analysis of Four Plyometric Push-Up Variations

PubMed Central

MOORE, LAURA H.; TANKOVICH, MICHAEL J.; RIEMANN, BRYAN L.; DAVIES, GEORGE J.

2012-01-01

Plyometric research in the upper extremity is limited, with the effects of open-chain plyometric exercises being studied most. Kinematic and ground reaction force data concerning closed-chain upper extremity plyometrics has yet to be examined. Twenty-one recreationally active male subjects performed four variations of plyometric push-ups in a counterbalanced order. These included box drop push-ups from 3.8 cm, 7.6 cm, 11.4 cm heights, and clap push-ups. Kinematics of the trunk, dominant extremity and both hands were collected to examine peak flight, elbow flexion at ground contact, elbow displacement, and hand separation. Additionally peak vertical ground reaction force was measured under the dominant extremity. The 11.4 cm and clap push-ups had significantly higher peak flight than the other variations (P<.001). At ground contact, the elbow was in significantly greater flexion for the 3.8 cm and clap push-up compared to the other variations (P<.001). The clap push-up had significantly more elbow displacement than the other variations (P<.001) while hand separation was not significantly different between variations (P=.129). Peak vertical ground reaction force was significantly greater for the clap push-ups than for all other variations (P< .001). Despite similar flight heights between the 11.4 cm and clap push-ups, the greater peak vertical ground reaction force and elbow displacement of the clap push-ups indicates the clap push-up is the most intense of the variations examined. Understanding the kinematic variables involved will aid in the creation of a closed chain upper-extremity plyometric progression. PMID:27182390

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

PubMed

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-03-05

The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

[Enzymatic conversion of tetradecanol in heterogenous phase by yeast-alcohol dehydrogenase].

PubMed

Rothe, U; Schöpp, W; Aurich, H

1976-01-01

Alcohol dehydrogenase from yeast converts long-chain primary alcohols not only in the dissolved state, but also at the surface of undissolved particles. Tetradecanol beads with a defined surface can be produced and employed as model substrate. The reaction rate was determined by the proton release accomplished in the reaction. The initial reaction rate depends on the enzyme concentration. The relation is nonlinear (vi = k-[e]0,4); the numerical value of the exponent (n = 0.4) argues in favour of a reaction occurring at the interface. The Lineweaver-Burk plots become linear if the substrate concentrations are based on the molar surface concentrations of the particles. The pH optimum for the reaction at the surface is displaced by 0.25 pH units towards the alkaline region (compared with ethanol as substrate). The activation energy of the reaction with tetradecanol beads as substrate is 30% lower than that for the ethanol oxydation.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.

PubMed

Toyosaki, Toshiyuki

2018-06-01

To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Comparison between Hydrogen and Methane Fuels in a 3-D Scramjet at Mach 8

DTIC Science & Technology

2016-06-24

performance of small chained hydrocarbons ( ethylene and methane) was compared with hydrogen to establish the importance of its lower specific energy...Report Comparison between hydrogen, methane and ethylene fuels in a 3-D Scramjet at Mach 8 Professor Michael K. Smart Chair of Hypersonic Propulsion...hydrocarbons ( ethylene and methane) was compared with hydrogen to establish the importance of its lower specific energy content and slower reaction

Synthesis of structured lipids by lipase-catalyzed interesterification of triacetin with camellia oil methyl esters and preliminary evaluation of their plasma lipid-lowering effect in mice.

PubMed

Cao, Yu; Qi, Suijian; Zhang, Yang; Wang, Xiaoning; Yang, Bo; Wang, Yonghua

2013-03-25

Structured lipids (SLCTs triacylglycerols with short- and long-chain acyl residues) were synthesized by interesterification of triacetin and fatty acid methyl esters (FAMEs) from camellia oil, followed by molecular distillation for purification. Different commercial immobilized lipases (Lipozyme RM IM and Novozyme 435), the substrate molar ratios of FAMEs to triacetin, the reaction temperatures and the lipase amounts were studied for their efficiency in producing SLCTs. Results showed that Novozyme 435 was more suitable for this reaction system. Moreover, the optimal reaction conditions for the highest conversion of FAMEs and the highest LLS-TAGs (triacylglycerols with one short- and two long-chain acyl residues) yields were achieved at a molar ratio of FAMEs to triacetin of 3:1, 50 °C of reaction temperature and a lipase amount of 4% (w/v). Scale-up was conducted based on the optimized reaction conditions. Results showed that after 24 h of reaction , the conversion rate of FAMEs was 82.4% and the rate of disubstituted triacetin was 52.4 mol%. The final product yield rate was 94.6%. The effects of the synthesized SLCTs on the plasma lipid level of fasting mice were also studied. The SLCTs could effectively lessen the total triacylglycerol levels in plasma compared to the triacylglycerol group in fasting NIH mice. It suggested that this type of structured lipid might be beneficial for human health, especially for the prevention of obesity.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

DL-ADR: a novel deep learning model for classifying genomic variants into adverse drug reactions.

PubMed

Liang, Zhaohui; Huang, Jimmy Xiangji; Zeng, Xing; Zhang, Gang

2016-08-10

Genomic variations are associated with the metabolism and the occurrence of adverse reactions of many therapeutic agents. The polymorphisms on over 2000 locations of cytochrome P450 enzymes (CYP) due to many factors such as ethnicity, mutations, and inheritance attribute to the diversity of response and side effects of various drugs. The associations of the single nucleotide polymorphisms (SNPs), the internal pharmacokinetic patterns and the vulnerability of specific adverse reactions become one of the research interests of pharmacogenomics. The conventional genomewide association studies (GWAS) mainly focuses on the relation of single or multiple SNPs to a specific risk factors which are a one-to-many relation. However, there are no robust methods to establish a many-to-many network which can combine the direct and indirect associations between multiple SNPs and a serial of events (e.g. adverse reactions, metabolic patterns, prognostic factors etc.). In this paper, we present a novel deep learning model based on generative stochastic networks and hidden Markov chain to classify the observed samples with SNPs on five loci of two genes (CYP2D6 and CYP1A2) respectively to the vulnerable population of 14 types of adverse reactions. A supervised deep learning model is proposed in this study. The revised generative stochastic networks (GSN) model with transited by the hidden Markov chain is used. The data of the training set are collected from clinical observation. The training set is composed of 83 observations of blood samples with the genotypes respectively on CYP2D6*2, *10, *14 and CYP1A2*1C, *1 F. The samples are genotyped by the polymerase chain reaction (PCR) method. A hidden Markov chain is used as the transition operator to simulate the probabilistic distribution. The model can perform learning at lower cost compared to the conventional maximal likelihood method because the transition distribution is conditional on the previous state of the hidden Markov chain. A least square loss (LASSO) algorithm and a k-Nearest Neighbors (kNN) algorithm are used as the baselines for comparison and to evaluate the performance of our proposed deep learning model. There are 53 adverse reactions reported during the observation. They are assigned to 14 categories. In the comparison of classification accuracy, the deep learning model shows superiority over the LASSO and kNN model with a rate over 80 %. In the comparison of reliability, the deep learning model shows the best stability among the three models. Machine learning provides a new method to explore the complex associations among genomic variations and multiple events in pharmacogenomics studies. The new deep learning algorithm is capable of classifying various SNPs to the corresponding adverse reactions. We expect that as more genomic variations are added as features and more observations are made, the deep learning model can improve its performance and can act as a black-box but reliable verifier for other GWAS studies.

Accuracy of Reaction Cross Section for Exotic Nuclei in Glauber Model Based on MCMC Diagnostics

NASA Astrophysics Data System (ADS)

Rueter, Keiti; Novikov, Ivan

2017-01-01

Parameters of a nuclear density distribution for an exotic nuclei with halo or skin structures can be determined from the experimentally measured reaction cross-section. In the presented work, to extract parameters such as nuclear size information for a halo and core, we compare experimental data on reaction cross-sections with values obtained using expressions of the Glauber Model. These calculations are performed using a Markov Chain Monte Carlo algorithm. We discuss the accuracy of the Monte Carlo approach and its dependence on k*, the power law turnover point in the discreet power spectrum of the random number sequence and on the lag-1 autocorrelation time of the random number sequence.

COMPARISON OF POPULATIONS OF MOULD SPECIES IN HOMES IN THE UK AND US USING MOLD-SPECIFIC QUANTITATIVE PCR (MSQPCR)

EPA Science Inventory

The goal of this research was to compare the populations of 81 mold species in homes in USA and UK using mould specific quantitative polymerase chain reaction (MSQPCR) technology. Dust samples were obtained from randomly selected homes in Great Britain (n=11). The mould populat...

Radiation/Catalytic Augmented Combustion.

DTIC Science & Technology

1984-05-01

interest to compare the experimental results for the solid bluff body with a thuoretical result. Using simple argtinieiiLs from fluid mechanics " one...responsibility through completion. Dr. A. E. Cerkanowlcz assisted in writing this final report. Experimental studies on catalytic augmented combustion...as well as with other combustion species, lead to ignition and sustained combustion via chain reactions. Simple combustion enhancement without

Enhanced analysis of real-time PCR data by using a variable efficiency model: FPK-PCR

PubMed Central

Lievens, Antoon; Van Aelst, S.; Van den Bulcke, M.; Goetghebeur, E.

2012-01-01

Current methodology in real-time Polymerase chain reaction (PCR) analysis performs well provided PCR efficiency remains constant over reactions. Yet, small changes in efficiency can lead to large quantification errors. Particularly in biological samples, the possible presence of inhibitors forms a challenge. We present a new approach to single reaction efficiency calculation, called Full Process Kinetics-PCR (FPK-PCR). It combines a kinetically more realistic model with flexible adaptation to the full range of data. By reconstructing the entire chain of cycle efficiencies, rather than restricting the focus on a ‘window of application’, one extracts additional information and loses a level of arbitrariness. The maximal efficiency estimates returned by the model are comparable in accuracy and precision to both the golden standard of serial dilution and other single reaction efficiency methods. The cycle-to-cycle changes in efficiency, as described by the FPK-PCR procedure, stay considerably closer to the data than those from other S-shaped models. The assessment of individual cycle efficiencies returns more information than other single efficiency methods. It allows in-depth interpretation of real-time PCR data and reconstruction of the fluorescence data, providing quality control. Finally, by implementing a global efficiency model, reproducibility is improved as the selection of a window of application is avoided. PMID:22102586

Mechanism of Air Oxidation of the Fragrance Terpene Geraniol.

PubMed

Bäcktorp, Carina; Hagvall, Lina; Börje, Anna; Karlberg, Ann-Therese; Norrby, Per-Ola; Nyman, Gunnar

2008-01-01

The fragrance terpene geraniol autoxidizes upon air exposure and forms a mixture of oxidation products, some of which are skin sensitizers. Reactions of geraniol with O2 have been studied with DFT (B3LYP) and the computational results compared to experimentally observed product ratios. The oxidation is initiated by hydrogen abstraction, forming an allylic radical which combines with an O2 molecule to yield an intermediate peroxyl radical. In the subsequent step, geraniol differs from previously studied cases, in which the radical chain reaction is propagated through intermolecular hydrogen abstraction. The hydroxy-substituted allylic peroxyl radical prefers an intramolecular rearrangement, producing observable aldehydes and the hydroperoxyl radical, which in turn can propagate the radical reaction. Secondary oxidation products like epoxides and formates were also considered, and plausible reaction pathways for formation are proposed.

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

Proteomic identification of potential biomarkers for cervical squamous cell carcinoma and human papillomavirus infection.

PubMed

Qing, Song; Tulake, Wuniqiemu; Ru, Mingfang; Li, Xiaohong; Yuemaier, Reziwanguli; Lidifu, Dilare; Rouzibilali, Aierken; Hasimu, Axiangu; Yang, Yun; Rouziahong, Reziya; Upur, Halmurat; Abudula, Abulizi

2017-04-01

It is known that high-risk human papillomavirus infection is the main etiological factor in cervical carcinogenesis. However, human papillomavirus screening is not sufficient for early diagnosis. In this study, we aimed to identify potential biomarkers common to cervical carcinoma and human papillomavirus infection by proteomics for human papillomavirus-based early diagnosis and prognosis. To this end, we collected 76 cases of fresh cervical tissues and 116 cases of paraffin-embedded tissue slices, diagnosed as cervical squamous cell carcinoma, cervical intraepithelial neoplasia II-III, or normal cervix from ethnic Uighur and Han women. Human papillomavirus infection by eight oncogenic human papillomavirus types was detected in tissue DNA samples using a quantitative polymerase chain reaction. The protein profile of cervical specimens from human papillomavirus 16-positive squamous cell carcinoma and human papillomavirus-negative normal controls was analyzed by proteomics and bioinformatics. The expression of candidate proteins was further determined by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. We identified 67 proteins that were differentially expressed in human papillomavirus 16-positive squamous cell carcinoma compared to normal cervix. The quantitative reverse transcriptase-polymerase chain reaction analysis verified the upregulation of ASAH1, PCBP2, DDX5, MCM5, TAGLN2, hnRNPA1, ENO1, TYPH, CYC, and MCM4 in squamous cell carcinoma compared to normal cervix ( p < 0.05). In addition, the transcription of PCBP2, MCM5, hnRNPA1, TYPH, and CYC was also significantly increased in cervical intraepithelial neoplasia II-III compared to normal cervix. Immunohistochemistry staining further confirmed the overexpression of PCBP2, hnRNPA1, ASAH1, and DDX5 in squamous cell carcinoma and cervical intraepithelial neoplasia II-III compared to normal controls ( p < 0.05). Our data suggest that the expression of ASAH1, PCBP2, DDX5, and hnRNPA1, and possibly MCM4, MCM5, CYC, ENO1, and TYPH, is upregulated during cervical carcinogenesis and potentially associated with human papillomavirus infection. Further validation studies of the profile will contribute to establishing auxiliary diagnostic markers for human papillomavirus-based cancer prognosis.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Oxidative versus Non-oxidative Decarboxylation of Amino Acids: Conditions for the Preferential Formation of Either Strecker Aldehydes or Amines in Amino Acid/Lipid-Derived Reactive Carbonyl Model Systems.

PubMed

Zamora, Rosario; León, M Mercedes; Hidalgo, Francisco J

2015-09-16

Comparative formation of both 2-phenylethylamine and phenylacetaldehyde as a consequence of phenylalanine degradation by carbonyl compounds was studied in an attempt to understand if the amine/aldehyde ratio can be changed as a function of reaction conditions. The assayed carbonyl compounds were selected because of the presence in the chain of both electron-donating and electron-withdrawing groups and included alkenals, alkadienals, epoxyalkenals, oxoalkenals, and hydroxyalkenals as well as lipid hydroperoxides. The obtained results showed that the 2-phenylethylamine/phenylacetaldehyde ratio depended upon both the carbonyls and the reaction conditions. Thus, it can be increased using electron-donating groups in the chain of the carbonyl compound, small amounts of carbonyl compound, low oxygen content, increasing the pH, or increasing the temperature at pH 6. Opposed conditions (use of electron-withdrawing groups in the chain of the carbonyl compound, large amounts of carbonyl compound, high oxygen contents, low pH values, and increasing temperatures at low pH values) would decrease the 2-phenylethylamine/phenylacetaldehyde ratio, and the formation of aldehydes over amines in amino acid degradations would be favored.

Improved Livingness and Control over Branching in RAFT Polymerization of Acrylates: Could Microflow Synthesis Make the Difference?

PubMed

Derboven, Pieter; Van Steenberge, Paul H M; Vandenbergh, Joke; Reyniers, Marie-Francoise; Junkers, Thomas; D'hooge, Dagmar R; Marin, Guy B

2015-12-01

The superior capabilities of structured microreactors over batch reactors are demonstrated for reversible addition-fragmentation chain transfer (RAFT) solution polymerization of n-butyl acrylate with the aid of simulations, explicitly accounting for the chain length distribution of all macrospecies types. Since perfect isothermicity can be established in a microreactor, less side products due to backbiting and β-scission are formed compared to the batch operation in which ineffective heat removal leads to an undesirable temperature spike. For a given RAFT chain transfer agent (CTA), additional microstructural control results under microflow conditions by optimizing the reaction temperature, lowering the dilution degree, or decreasing the initial molar ratio of monomer to RAFT CTA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Substrate Shuttling Between Active Sites of Uroporphyrinogen Decarboxylase in Not Required to Generate Coproporphyrinogen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Phillips, J.; Warby, C; Whitby, F

2009-01-01

Uroporphyrinogen decarboxylase (URO-D; EC 4.1.1.37), the fifth enzyme of the heme biosynthetic pathway, is required for the production of heme, vitamin B12, siroheme, and chlorophyll precursors. URO-D catalyzes the sequential decarboxylation of four acetate side chains in the pyrrole groups of uroporphyrinogen to produce coproporphyrinogen. URO-D is a stable homodimer, with the active-site clefts of the two subunits adjacent to each other. It has been hypothesized that the two catalytic centers interact functionally, perhaps by shuttling of reaction intermediates between subunits. We tested this hypothesis by construction of a single-chain protein (single-chain URO-D) in which the two subunits were connectedmore » by a flexible linker. The crystal structure of this protein was shown to be superimposable with wild-type activity and to have comparable catalytic activity. Mutations that impaired one or the other of the two active sites of single-chain URO-D resulted in approximately half of wild-type activity. The distributions of reaction intermediates were the same for mutant and wild-type sequences and were unaltered in a competition experiment using I and III isomer substrates. These observations indicate that communication between active sites is not required for enzyme function and suggest that the dimeric structure of URO-D is required to achieve conformational stability and to create a large active-site cleft.« less

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

PubMed

Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

2017-08-07

A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

PubMed

Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

2016-04-01

An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

NASA Astrophysics Data System (ADS)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

Development of an optimized protocol for the detection of classical swine fever virus in formalin-fixed, paraffin-embedded tissues by seminested reverse transcription-polymerase chain reaction and comparison with in situ hybridization.

PubMed

Ha, S-K; Choi, C; Chae, C

2004-10-01

An optimized protocol was developed for the detection of classical swine fever virus (CSFV) in formalin-fixed, paraffin-embedded tissues obtained from experimentally and naturally infected pigs by seminested reverse transcription-polymerase chain reaction (RT-PCR). The results for seminested RT-PCR were compared with those determined by in situ hybridization. The results obtained show that the use of deparaffinization with xylene, digestion with proteinase K, extraction with Trizol LS, followed by seminested RT-PCR is a reliable detection method. An increase in sensitivity was observed as amplicon size decreased. The highest sensitivity for RT-PCR on formalin-fixed, paraffin-embedded tissues RNA was obtained with amplicon sizes less than approximately 200 base pairs. An hybridization signal for CSFV was detected in lymph nodes from 12 experimentally and 12 naturally infected pigs. The sensitivity of seminested RT-PCR compared with in situ hybridization was 100% for CSFV. When only formalin-fixed tissues are available, seminested RT-PCR and in situ hybridization would be useful diagnostic methods for the detection of CSFV nucleic acid.

Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

PubMed

Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

2002-10-15

Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

The cervical mucus plug inhibits, but does not block, the passage of ascending bacteria from the vagina during pregnancy.

PubMed

Hansen, Lea K; Becher, Naja; Bastholm, Sara; Glavind, Julie; Ramsing, Mette; Kim, Chong J; Romero, Roberto; Jensen, Jørgen S; Uldbjerg, Niels

2014-01-01

To evaluate the microbial load and the inflammatory response in the distal and proximal parts of the cervical mucus plug. Experimental research. Twenty women with a normal, singleton pregnancy. Vaginal swabs and specimens from the distal and proximal parts of the cervical mucus plug. Immunohistochemistry, enzyme-linked immunosorbent assay, quantitative polymerase chain reaction and histology. The total bacterial load (16S rDNA) was significantly lower in the cervical mucus plug compared with the vagina (p = 0.001). Among women harboring Ureaplasma parvum, the median genome equivalents/g were 1574 (interquartile range 2526) in the proximal part, 657 (interquartile range 1620) in the distal part and 60,240 (interquartile range 96,386) in the vagina. Histological examinations and quantitative polymerase chain reaction revealed considerable amounts of lactobacilli and inflammatory cells in both parts of the cervical mucus plug. The matrix metalloproteinase-8 concentration was decreased in the proximal part of the plug compared with the distal part (p = 0.08). The cervical mucus plug inhibits, but does not block, the passage of Ureaplasma parvum during its ascending route from the vagina through the cervical canal. © 2013 Nordic Federation of Societies of Obstetrics and Gynecology.

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

PubMed

Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

2018-02-28

Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye, Piaoran; Cao, Peng -Fei; Su, Zhe

Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR),more » and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L –1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.« less

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

PubMed

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

PubMed Central

Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

2018-01-01

Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Reaction Paths and Chemical Activation Reactions of 2-Methyl-5-Furanyl Radical with 3O2.

PubMed

Hudzik, Jason M; Bozzelli, Joseph W

2017-10-05

Interest in high-energy substituted furans has been increasing due to their occurrence in biofuel production and their versatility in conversion to other useful products. Methylfurans are the simplest substituted furans and understanding their reaction pathways, thermochemical properties, including intermediate species stability, and chemical kinetics would aid in the study of larger furans. Furan ring C-H bonds have been shown to be extremely strong, approximately 120 kcal mol -1 , due in part to the placement of the oxygen atom and aromatic-like resonance, both within the ring. The thermochemistry and kinetics of the oxidation of 2-methyfuran radical at position 5 of the furan ring, 2-methyl-5-furanyl radical (2MF5j), is analyzed. The resulting chemically activated species, 2MF5OOj radical, has a well depth of 51 kcal mol -1 below the 2MF5j + O 2 reactants; this is 4-5 kcal mol -1 deeper than that of phenyl and vinyl radical plus O 2 , with both of these reactions known to undergo chain branching. Important, low-energy reaction pathways include chain branching dissociations, intramolecular abstractions, group transfers, and radical oxygen additions. Enthalpies of formation, entropies, and heat capacities for the stable molecules, radicals, and transition-state species are analyzed using computational methods. Calculated ΔH ° f 298 values were determined using an isodesmic work reaction from the CBS-QB3 composite method. Elementary rate parameters are from saddle point transition-state structures and compared to variational transition-state analysis for the barrierless reactions. Temperature- and pressure-dependent rate constants which are calculated using QRRK and master equation analysis is used for falloff and stabilization.

Hybrid quantum chemical studies for the methanol formation reaction assisted by the proton transfer mechanism in supercritical water: CH3Cl+nH2O-->CH3OH+HCl+(n-1)H2O

NASA Astrophysics Data System (ADS)

Hori, T.; Takahashi, H.; Nitta, T.

2003-10-01

The proton transfer along the chain of hydrogen bonds is involved in many chemical reactions in aqueous solution and known to play a decisive role. We have performed the hybrid quantum chemical simulations for the methanol formation reaction catalyzed by the proton transfer mechanism [CH3Cl+nH2O→CH3OH+HCl+(n-1)H2O, n=3] in supercritical water (SCW) to investigate the role of water solvent on the reaction. In the simulation, the electronic state of the chemically active solutes (CH3Cl+3H2O) has been determined quantum mechanically, while the static water solvent has been represented by a classical model. The activation free energy for the water-catalytic reaction in SCW has been found to be 9.6 kcal/mol, which is much lower than that in the gas phase (29.2 kcal/mol). The fractional charge analysis has revealed that the notable charge separation in the solute complex takes place at the transition state (TS) and the resulting huge dipole gives rise to the considerable stabilization of the TS as compared to the reactant. It has been shown that the reaction assisted by the proton transfer mechanism is energetically much favored than the ionic SN2 reaction (CH3Cl+OH-→CH3OH+Cl-, 18.8 kcal/mol). The present calculations suggest that the proton migrations through the chain of hydrogen bonds can be regarded as a probable candidate responsible for the anomalous reactivities observed in SCW.

Bio-barcode gel assay for microRNA

NASA Astrophysics Data System (ADS)

Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min

2014-02-01

MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.

Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

PubMed

McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

2018-01-01

One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

PubMed

Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

2006-02-01

The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

Pooling Cervical Swabs and Testing by Ligase Chain Reaction Are Accurate and Cost-Saving Strategies for Diagnosis of Chlamydia trachomatis

PubMed Central

Kapala, J.; Copes, D.; Sproston, A.; Patel, J.; Jang, D.; Petrich, A.; Mahony, J.; Biers, K.; Chernesky, M.

2000-01-01

Specimen pooling to achieve efficiency when testing urine specimens for Chlamydia trachomatis nucleic acids has been suggested. We pooled endocervical swabs from 1,288 women and also tested individual swabs by ligase chain reaction (LCR). Out of 53 positive specimens, pools of 4 or 8 specimens missed two positives, providing 96.2% accuracy compared to individual test results. Dilution and positive-control spiking experiments showed that negative specimens with inhibitors of LCR in the pool reduced the signal. Conversely, two extra positives, detected only through pooling, were negative by individual testing but became positive after storage, suggesting that fresh positive specimens with labile inhibitors may be positive in a pool because of dilution of inhibitors. For this population of women with a 4% prevalence of C. trachomatis infection, substantial savings in cost of reagents (55 to 63%) and technologist time (50 to 63%) made pooling strategies a desirable alternative to individual testing. PMID:10878029

Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

PubMed

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

2016-06-01

Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

PubMed

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

PubMed

Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

2006-05-01

Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

Novel cytochrome P450 genes, CYP6EB1 and CYP6EC1, are over-expressed in acrinathrin-resistant Frankliniella occidentalis (Thysanoptera: Thripidae).

PubMed

Cifuentes, D; Chynoweth, R; Guillén, J; De la Rúa, P; Bielza, P

2012-06-01

Control of Frankliniella occidentalis (Pergande) is a serious problem for agriculture all over the world because of the limited range of insecticides that are available. Insecticide resistance in F. occidentalis has been reported for all major insecticide groups. Our previous studies showed that cytochrome P450-mediated detoxification is a major mechanism responsible for insecticide resistance in this pest. Degenerate polymerase chain reaction was used to identify P450 genes that might be involved in acrinathrin resistance, in a laboratory population of F. occidentalis. Associated sequences were classified as belonging to the CYP4 and CYP6 families. Real-time quantitative polymerase chain reaction analyses revealed that two genes, CYP6EB1 and CYP6EC1, were over-expressed in adults and L2 larvae of the resistant population, when compared with the susceptible population, suggesting their possible involvement in resistance to acrinathrin.

Polymerase Chain Reaction Pool Screening Used To Compare Prevalence of Infective Black Flies in Two Onchocerciasis Foci in Northern Sudan

PubMed Central

Higazi, Tarig B.; Zarroug, Isam M. A.; Mohamed, Hanan A.; Mohamed, Wigdan A.; Deran, Tong Chor M.; Aziz, Nabil; Katabarwa, Moses; Hassan, Hassan K.; Unnasch, Thomas R.; Mackenzie, Charles D.; Richards, Frank

2011-01-01

Onchocerciasis remains an important debilitating disease in many areas of Africa, including Sudan. The status of infection transmission in 2007 was assessed in the vectors of two disease foci in Sudan: Abu Hamed in northern Sudan, which has received at least 10 years of annual treatment and Galabat focus in eastern Sudan, where only minor, largely undocumented treatment activity has occurred. Assessment of more than 30,000 black flies for Onchocerca volvulus infectious stage L3 larvae by using an O-150 polymerase chain reaction protocol showed that black fly infectivity rates were 0.84 (95% confidence interval = 0.0497–1.88) per 10,000 flies for Abu Hamed and 6.9 (95% confidence interval = 1.1–16.4) infective flies per 10,000 for Galabat. These results provide entomologic evidence for suppressed Onchocerca volvulus transmission in the Abu Hamed focus and a moderate transmission rate of the parasite in the Galabat focus. PMID:21540385

Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

Transcriptional Changes That Characterize the Immune Reactions of Leprosy

PubMed Central

Dupnik, Kathryn M.; Bair, Thomas B.; Maia, Andressa O.; Amorim, Francianne M.; Costa, Marcos R.; Keesen, Tatjana S. L.; Valverde, Joanna G.; Queiroz, Maria do Carmo A. P.; Medeiros, Lúcio L.; de Lucena, Nelly L.; Wilson, Mary E.; Nobre, Mauricio L.; Johnson, Warren D.; Jeronimo, Selma M. B.

2015-01-01

Background. Leprosy morbidity is increased by 2 pathologic immune reactions, reversal reaction (RR) and erythema nodosum leprosum (ENL). Methods. To discover host factors related to immune reactions, global transcriptional profiles of peripheral blood mononuclear cells were compared between 11 RR, 11 ENL, and 19 matched control patients, with confirmation by quantitative polymerase chain reaction. Encoded proteins were investigated in skin biopsy specimens by means of immunohistochemistry. Results. There were 275 genes differentially expressed in RR and 517 differentially expressed in ENL on the microarray. Pathway analysis showed immunity-related pathways represented in RR and ENL transcriptional profiles, with the “complement and coagulation” pathway common to both. Interferon γ was identified as a significant upstream regulator of the expression changes for RR and ENL. Immunohistochemical staining of skin lesions showed increased C1q in both RR and ENL. Conclusions. These data suggest a previously underrecognized role for complement in the pathogenesis of both RR and ENL, and we propose new hypotheses for reaction pathogenesis. PMID:25398459

[First attempts of detecting fetal cells in the maternal circulation].

PubMed

Nagy, Gyula Richárd; Bán, Zoltán; Sipos, Ferenc; Fent, János; Oroszné Nagy, Judit; Beke, Artúr; Furész, József; Papp, Zoltán

2004-10-31

In prenatal diagnosis there is great interest for noninvasive diagnostic methods. Authors report their first results in detecting fetal cells in the maternal circulation during pregnancy. The aim of the study was to detect fetal gender from maternal peripheral blood samples during pregnancy. Authors have analysed fetal nucleated red blood cells. In 12 cases after a double density Percoll gradient separation they labelled the surface antigens of the cells with anti-glycophorin-A and anti-CD45 fluorescent antibodies, did an intracellular staining of the epsilon haemoglobin chain, and analysed the cells with flow cytometry. The CD45 negative/glycophorin-A positive/epsilon-haemoglobin chain positive cells were considered as fetal cells. Having the results, in another 13 cases magnetic activated cell sorting with CD71 antibody were used as an enrichment step. Authors made an intracellular staining of the epsilon haemoglobin chain, the positive cells were isolated by micromanipulation, and analysed by single cell fluorescent polymerase chain reaction. Primers for the amelogenin gene were used to detect fetal gender. Only the Percoll enrichment step itself is not enough for using the samples for diagnostic molecular-biologic examinations, a following enrichment step is needed. For this the authors used magnetic activated cell sorting with CD71 antibody. With the help of this enrichment step, after the intracellular staining of the epsilon haemoglobin chain the direct micromanipulator isolation of the epsilon haemoglobin chain positive cells could be done. After analysing single cells by fluorescent polymerase chain reaction, in 8 out of the 11 comparable cases the results were similar to those, what was found during the genetic amniocentesis. In 2 cases from this 8, genetic amniocentesis proved Klinefelter syndrome, which they could also confirm with the examination of fetal cells in the maternal circulation. The results of the study suggest that the method described above can be useful in prenatal genetic diagnosis, and improving it could be useful to detect other genetic abnormalities (chromosomal abnormalities, single gene disorders) as well.

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

PubMed

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Short-Chain PEG Mixed-Monolayer Protected Gold Clusters Increase Clearance and Red Blood Cell Counts

PubMed Central

Simpson, Carrie A.; Agrawal, Amanda C.; Balinski, Andrzej; Harkness, Kellen M.; Cliffel, David E.

2011-01-01

Monolayer-protected gold nanoparticles have great potential as novel building blocks for the design of new drugs and therapeutics based on the easy ability to multifunctionalize them for biological targeting and drug activity. In order to create nanoparticles that are biocompatible in vivo, poly-ethylene glycol functional groups have been added to many previous multifunctionalized particles to eliminate non-specific binding. Recently, monolayer-protected gold nanoparticles with mercaptoglycine functionalities were shown to elicit deleterious effects on the kidney in vivo that were eliminated by incorporating a long-chain, mercapto-undecyl-tetraethylene glycol, at very high loadings into a mixed monolayer. These long-chain PEGs induced an immune response to the particle presumably generating an anti-PEG antibody as seen in other long-chain PEG-ylated nanoparticles in vivo. In the present work, we explore the in vivo effects of high and low percent ratios of a shorter chain, mercapto-tetraethylene glycol, within the monolayer using simple place-exchange reactions. The shorter chain PEG MPCs were expected to have better water solubility due to elimination of the alkyl chain, no toxicity, and long-term circulation in vivo. Shorter chain lengths at lower concentrations should not trigger the immune system into creating an anti-PEG antibody. We found that a 10% molar exchange of this short chain PEG within the monolayer met three of the desired goals: high water solubility, no toxicity, and no immune response as measured by white blood cell counts, but none of the short chain PEG mixed monolayer compositions enabled the nanoparticles to have a long circulation time within the blood as compared to mercapto-undecyl-ethylene glycol, which had a residence time of 4 weeks. We also compared the effects of a hydroxyl versus a carboxylic acid terminal functional group on the end of the PEG thiol on both clearance and immune response. The results indicate that short-chain length PEGs, regardless of termini, increase clearance rates compared to the previous long-chain PEG studies while carboxylated-termini increase red blood cell counts at high loadings. Given these findings, short-chain, alcohol-terminated PEG, exchanged at 10% was identified as a potential nanoparticle for further in vivo applications requiring short circulation lifetimes with desired features of no toxicity, no immune response, and high water solubility. PMID:21473648

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Monochrome Multiplexing in Polymerase Chain Reaction by Photobleaching of Fluorogenic Hydrolysis Probes.

PubMed

Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix

2016-03-01

Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays.

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

Initiation reactions in acetylene pyrolysis

DOE PAGES

Zador, Judit; Fellows, Madison D.; Miller, James A.

2017-05-10

In gas-phase combustion systems the interest in acetylene stems largely from its role in molecular weight growth processes. The consensus is that above 1500 K acetylene pyrolysis starts mainly with the homolytic fission of the C–H bond creating an ethynyl radical and an H atom. However, below ~1500 K this reaction is too slow to initiate the chain reaction. It has been hypothesized that instead of dissociation, self-reaction initiates this process. Nevertheless, rigorous theoretical or direct experimental evidence is lacking, to an extent that even the molecular mechanism is debated in the literature. In this work we use rigorous abmore » initio transition-state theory master equation methods to calculate pressure- and temperature-dependent rate coefficients for the association of two acetylene molecules and related reactions. We establish the role of vinylidene, the high-energy isomer of acetylene in this process, compare our results with available experimental data, and assess the competition between the first-order and second-order initiation steps. As a result, we also show the effect of the rapid isomerization among the participating wells and highlight the need for time-scale analysis when phenomenological rate coefficients are compared to observed time scales in certain experiments.« less

Modification of quinone electrochemistry by the proteins in the biological electron transfer chains: examples from photosynthetic reaction centers

PubMed Central

Gunner, M. R.; Madeo, Jennifer; Zhu, Zhenyu

2009-01-01

Quinones such as ubiquinone are the lipid soluble electron and proton carriers in the membranes of mitochondria, chloroplasts and oxygenic bacteria. Quinones undergo controlled redox reactions bound to specific sites in integral membrane proteins such as the cytochrome bc1 oxidoreductase. The quinone reactions in bacterial photosynthesis are amongst the best characterized, presenting a model to understand how proteins modulate cofactor chemistry. The free energy of ubiquinone redox reactions in aqueous solution and in the QA and QB sites of the bacterial photosynthetic reaction centers (RCs) are compared. In the primary QA site ubiquinone is reduced only to the anionic semiquinone (Q•−) while in the secondary QB site the product is the doubly reduced, doubly protonated quinol (QH2). The ways in which the protein modifies the relative energy of each reduced and protonated intermediate are described. For example, the protein stabilizes Q•− while destabilizing Q= relative to aqueous solution through electrostatic interactions. In addition, kinetic and thermodynamic mechanisms for stabilizing the intermediate semiquinones are compared. Evidence for the protein sequestering anionic compounds by slowing both on and off rates as well as by binding the anion more tightly is reviewed. PMID:18979192

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Targeting Conserved Genes in Penicillium Species.

PubMed

Peterson, Stephen W

2017-01-01

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Chemoselective O-acylation of hydroxyamino acids and amino alcohols under acidic reaction conditions: History, scope and applications

PubMed Central

2015-01-01

Summary Amino acids, whether natural, semisynthetic or synthetic, are among the most important and useful chiral building blocks available for organic chemical synthesis. In principle, they can function as inexpensive, chiral and densely functionalized starting materials. On the other hand, the use of amino acid starting materials routinely necessitates protective group chemistry, and in reality, large-scale preparations of even the simplest side-chain derivatives of many amino acids often become annoyingly strenuous due to the necessity of employing protecting groups, on one or more of the amino acid functionalities, during the synthetic sequence. However, in the case of hydroxyamino acids such as hydroxyproline, serine, threonine, tyrosine and 3,4-dihydroxyphenylalanine (DOPA), many O-acyl side-chain derivatives are directly accessible via a particularly expedient and scalable method not commonly applied until recently. Direct acylation of unprotected hydroxyamino acids with acyl halides or carboxylic anhydrides under appropriately acidic reaction conditions renders possible chemoselective O-acylation, furnishing the corresponding side-chain esters directly, on multigram-scale, in a single step, and without chromatographic purification. Assuming a certain degree of stability under acidic reaction conditions, the method is also applicable for a number of related compounds, such as various amino alcohols and the thiol-functional amino acid cysteine. While the basic methodology underlying this approach has been known for decades, it has evolved through recent developments connected to amino acid-derived chiral organocatalysts to become a more widely recognized procedure for large-scale preparation of many useful side-chain derivatives of hydroxyamino acids and related compounds. Such derivatives are useful in peptide chemistry and drug development, as amino acid amphiphiles for asymmetric catalysis, and as amino acid acrylic precursors for preparation of catalytically active macromolecular networks in the form of soluble polymers, crosslinked polymer beads or nanoparticulate systems. The objective of the present review is to increase awareness of the existence and convenience of this methodology, assess its competitiveness compared to newer and more elaborate procedures for chemoselective O-acylation reactions, spur its further development, and finally to chronicle the informative, but poorly documented history of its development. PMID:25977719

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Automated Extraction of Formalin-Fixed, Paraffin-Embedded Tissue for High-Risk Human Papillomavirus Testing of Head and Neck Squamous Cell Carcinomas Using the Roche Cobas 4800 System.

PubMed

Kerr, Darcy A; Sweeney, Brenda; Arpin, Ronald N; Ring, Melissa; Pitman, Martha B; Wilbur, David C; Faquin, William C

2016-08-01

-Testing for high-risk human papillomavirus (HR-HPV) in head and neck squamous cell carcinomas (HNSCCs) is important for both prognostication and clinical management. Several testing platforms are available for HR-HPV; however, effective alternative automated approaches are needed. -To assess the performance of the automated Roche cobas 4800 HPV real-time polymerase chain reaction-based system on formalin-fixed, paraffin-embedded HNSCC specimens and compare results with standard methods of in situ hybridization (ISH) and p16 immunohistochemistry. -Formalin-fixed, paraffin-embedded samples of HNSCC were collected from archival specimens in the Department of Pathology, Massachusetts General Hospital (Boston), and prepared using the automated system by deparaffinization and dehydration followed by tissue lysis. Samples were integrated into routine cervical cytology testing runs by cobas. Corresponding formalin-fixed, paraffin-embedded samples were evaluated for HR-HPV by ISH and p16 by immunohistochemistry. Discrepant cases were adjudicated by polymerase chain reaction. -Sixty-two HNSCC samples were analyzed using the automated cobas system, ISH, and immunohistochemistry. Fifty-two percent (n = 32 of 62) of formalin-fixed, paraffin-embedded tumors were positive for HR-HPV by cobas. Eighty-eight percent (n = 28 of 32) of cases were the HPV 16 subtype and 12% (n = 4 of 32) were other HR-HPV subtypes. Corresponding testing with ISH was concordant in 92% (n = 57 of 62) of cases. Compared with the adjudication polymerase chain reaction standard, there were 3 false-positive cases by cobas. -Concordance in HNSCC HR-HPV status between cobas and ISH was more than 90%. The cobas demonstrated a sensitivity of 100% and a specificity of 91% for detection of HR-HPV. Advantages favoring cobas include its automation, cost efficiency, objective results, and ease of performance.

Use of polymerase chain reaction for the detection of Chlamydia trachomatis in ocular and nasopharyngeal specimens from infants with conjunctivitis.

PubMed

Hammerschlag, M R; Roblin, P M; Gelling, M; Tsumura, N; Jule, J E; Kutlin, A

1997-03-01

Chlamydia trachomatis is the most common identifiable infectious cause of neonatal conjunctivitis. Nonculture tests including enzyme immunoassays and direct fluorescent antibody tests have been shown to perform well for the diagnosis of chlamydial conjunctivitis with sensitivities and specificities > or = 90%. However, the performance with respiratory specimens has been less than satisfactory. We compared a new, commercially available polymerase chain reaction (PCR) assay, Roche AMPLICOR (Roche Diagnostic Systems, Branchburg, NJ) with culture for the detection of C. trachomatis in conjunctival and nasopharyngeal specimens from infants with conjunctivitis. We also evaluated AMPLICOR for the detection of C. trachomatis in the urine of mothers of positive infants. Ocular and nasopharyngeal specimens from 75 infants with conjunctivitis were obtained for culture and PCR. AMPLICOR was equivalent to culture for eye specimens and more sensitive than culture for nasopharyngeal specimens. The sensitivity, specificity and positive and negative predictive values of PCR compared with culture for conjunctival specimens were 92.3, 100, 100 and 98.4%, respectively. The sensitivity, specificity and positive and negative predictive values for nasopharyngeal specimens were 100, 97.2, 60 and 100%, respectively. We also detected C. trachomatis by PCR in the urine of 12 mothers of culture positive infants. PCR performed comparably to culture for detection of C. trachomatis in conjunctival and nasopharyngeal specimens from infants with conjunctivitis.

Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

PubMed Central

Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

2013-01-01

OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

NASA Astrophysics Data System (ADS)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

PubMed Central

Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

2016-01-01

Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

Numerical Study of Pressure Influence on Methane-Oxygen Laminar Counterflow Diffusion Flames

NASA Astrophysics Data System (ADS)

Iino, Kimio; Akamatsu, Fumiteru; Katsuki, Masashi

We carried out numerical studies on methane/oxygen diffusion flames of counter-flow configuration to elucidate the influence of pressure on flame structure, heat release rate and reaction mechanisms. The chemistry in gas-phase was based on GRI-Mech 3.0 database. The thickness of diffusion flame became thinner with increasing strain rate a , with its characteristic flame thickness varying inversely with √a, especially its relation became significant with increasing pressure. Flame temperature increased with increasing pressure. Enhanced H2O production reactions, especially chain terminal reactions for H2O production, were found to be important in determining the flame temperature at high pressures. The small reduction in the flame temperature with increasing strain rate at high pressures, compared to the atmospheric pressure, is caused by the capacitor effect of product dissociation. From QRPDs, the third body dependent reactions were enhanced in high pressure conditions, hence C2 pathway was enhanced.

[Use of nested PCR in detection of the plague pathogen].

PubMed

Glukhov, A I; Gordeev, S A; Al'tshuler, M L; Zykova, I E; Severin, S E

2003-07-01

Causative agents of plague, i.e. bacterium Yersina pestis (in the subcutaneous tissues of rodents) and their cutaneous parasites need to be isolated to enable plague prevention. A comparatively new method of polymerase chain reaction (PCR) opens up new possibilities of determining Y. pestis just within several hours and without any cultivation. The article contains a description of the PCR-method, which makes it possible to distinguish the culture of Y. pestis from cultures of other microorganism, including speci of Yersina. The method is of the cluster-type, i.e. it is made up of subsequent PC reactions with the substrate for the second reaction being the product of the first one. The cluster nature of the method preconditions a higher sensitivity and specificity versus the ordinary PCR.

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Catalytic effects of histidine enantiomers and glycine on the formation of dileucine and dimethionine in the salt-induced peptide formation reaction.

PubMed

Li, Feng; Fitz, Daniel; Fraser, Donald G; Rode, Bernd M

2010-01-01

The salt-induced peptide formation (SIPF) reaction takes place readily under mild reaction conditions and proceeds via a copper complex. Its ease of reaction and the universality for prebiotic scenarios add weights to the arguments in favour of the importance of peptide and proteins in the tug of war with the RNA world hypothesis. In addition, the SIPF reaction has a preference for L-form amino acids in dipeptide formation, casting light on the puzzle of biohomochirality, especially for the amino acids with aliphatic side chains. A detailed investigation on the behaviour of aliphatic leucine in the SIPF reaction is presented in this paper, including the catalytic effects of glycine, L- and D-histidine as well as the stereoselectivity under all the reaction conditions above. The results show a relatively low reactivity and stereoselectivity of leucine in the SIPF reaction, while both glycine and histidine enantiomers remarkably increase the yields of dileucine by factors up to 40. Moreover, a comparative study of the effectiveness of L- and D-histidine in catalysing the formation of dimethionine was also carried out and extends the scope of mutual catalysis by amino acid enantiomers in the SIPF reaction.

AJIPHASE®: A Highly Efficient Synthetic Method for One-Pot Peptide Elongation in the Solution Phase by an Fmoc Strategy.

PubMed

Takahashi, Daisuke; Inomata, Tatsuji; Fukui, Tatsuya

2017-06-26

We previously reported an efficient peptide synthesis method, AJIPHASE®, that comprises repeated reactions and isolations by precipitation. This method utilizes an anchor molecule with long-chain alkyl groups as a protecting group for the C-terminus. To further improve this method, we developed a one-pot synthesis of a peptide sequence wherein the synthetic intermediates were isolated by solvent extraction instead of precipitation. A branched-chain anchor molecule was used in the new process, significantly enhancing the solubility of long peptides and the operational efficiency compared with the previous method, which employed precipitation for isolation and a straight-chain aliphatic group. Another prerequisite for this solvent-extraction-based strategy was the use of thiomalic acid and DBU for Fmoc deprotection, which facilitates the removal of byproducts, such as the fulvene adduct. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

NASA Astrophysics Data System (ADS)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Low-Temperature Reactivity of C2n+1N(-) Anions with Polar Molecules.

PubMed

Joalland, Baptiste; Jamal-Eddine, Nour; Kłos, Jacek; Lique, François; Trolez, Yann; Guillemin, Jean-Claude; Carles, Sophie; Biennier, Ludovic

2016-08-04

Following the recent discovery of molecular anions in the interstellar medium, we report on the kinetics of proton transfer reactions between cyanopolyynide anions C2n+1N(-) (n = 0, 1, 2) and formic acid HCOOH. The results, obtained from room temperature down to 36 K by means of uniform supersonic flows, show a surprisingly weak temperature dependence of the CN(-) reaction rate, in contrast with longer chain anions. The CN(-) + HCOOH reaction is further studied theoretically via a reduced dimensional quantum model that highlights a tendency of the reaction probability to decrease with temperature, in agreement with experimental data but at the opposite of conventional long-range capture theories. In return, comparing HCOOH to HC3N as target molecules suggests that dipole-dipole interactions must play an active role in overcoming this limiting effect at low temperatures. This work provides new fundamental insights on prototypical reactions between polar anions and polar molecules along with critical data for astrochemical modeling.

Vulcanization characteristics and dynamic mechanical behavior of natural rubber reinforced with silane modified silica.

PubMed

Chonkaew, Wunpen; Minghvanish, Withawat; Kungliean, Ulchulee; Rochanawipart, Nutthaya; Brostow, Witold

2011-03-01

Two silane coupling agents were used for hydrolysis-condensation reaction modification of nanosilica surfaces. The surface characteristics were analyzed using Fourier transform infrared spectroscopy (FTIR). The vulcanization kinetics of natural rubber (NR) + silica composites was studied and compared to behavior of the neat NR using differential scanning calorimetry (DSC) in the dynamic scan mode. Dynamic mechanical analysis (DMA) was performed to evaluate the effects of the surface modification. Activation energy E(a) values for the reaction are obtained. The presence of silica, modified or otherwise, inhibits the vulcanization reaction of NR. The neat silica containing system has the lowest cure rate index and the highest activation energy for the vulcanization reaction. The coupling agent with longer chains causes more swelling and moves the glass transition temperature T(g) downwards. Below the glass transition region, silica causes a lowering of the dynamic storage modulus G', a result of hindering the cure reaction. Above the glass transition, silica-again modified or otherwise-provides the expected reinforcement effect.

Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

PubMed

Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

2015-01-01

Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

PubMed

Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

2002-12-01

The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

PubMed

Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

2014-02-07

An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

Performance of the Directigen EZ Flu A+B rapid influenza diagnostic test to detect pandemic influenza A/H1N1 2009.

PubMed

Boyanton, Bobby L; Almradi, Amro; Mehta, Tejal; Robinson-Dunn, Barbara

2014-04-01

The Directigen EZ Flu A+B rapid influenza diagnostic test, as compared to real-time reverse transcriptase polymerase chain reaction, demonstrated suboptimal performance to detect pandemic influenza A/H1N1 2009. Age- and viral load-stratified test sensitivity ranged from 33.3 to 84.6% and 0 to 100%, respectively. © 2013.

Point-of-care testing system enabling 30 min detection of influenza genes.

PubMed

Abe, Tomoteru; Segawa, Yuji; Watanabe, Hidetoshi; Yotoriyama, Tasuku; Kai, Shinichi; Yasuda, Akio; Shimizu, Norio; Tojo, Naoko

2011-03-21

We developed a portable and easy-to-use nucleic acid amplification test (NAT) system for use in point-of-care testing (POCT). The system shows sensitivity that is sufficiently higher than that of the currently available rapid diagnostic kit and is comparable to that of real-time reverse transcription polymerase chain reaction (RT-PCR) for influenza testing. This journal is © The Royal Society of Chemistry 2011

A practical molecular identification of nonfermenting Gram-negative bacteria from cystic fibrosis.

PubMed

Capizzani, Carolina Paulino da Costa; Caçador, Natália Candido; Marques, Elizabeth Andrade; Levy, Carlos Emílio; Tonani, Ludmilla; Torres, Lidia Alice Gomes Monteiro Marin; Darini, Ana Lúcia da Costa

Identification of nonfermenting Gram-negative bacteria (NFGNB) of cystic fibrosis patients is hard and misidentification could affect clinical outcome. This study aimed to propose a scheme using polymerase chain reaction to identify NFGNB. This scheme leads to reliable identification within 3 days in an economically viable manner when compared to other methods. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Impacts of Sampling and Handling Procedures on DNA- and RNA-based Microbial Characterization and Quantification of Groundwater and Saturated Soil

DTIC Science & Technology

2012-07-01

use of molecular biological techniques (MBTs) has allowed microbial ecologists and environmental engineers to determine microbial community...metabolic genes). The most common approaches used in bioremediation research are those based on the polymerase chain reaction (PCR) amplification of... bioremediation . Because of its sensitivity compared to direct hybridization/probing, PCR is increasingly used to analyze groundwater samples and soil samples

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

PubMed Central

White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

2015-01-01

Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing.

PubMed

White, P Lewis; Wingard, John R; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F; Slavin, Monica A; Barnes, Rosemary A; Pappas, Peter G; Donnelly, J Peter

2015-10-15

Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%-88.0% and 75.0%-94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor), and ocelots (Leopardus pardalis)

USGS Publications Warehouse

Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Kays, R.W.; Riley, S.P.D.; Boyce, W.M.; Crooks, K.R.; VandeWoude, S.

2007-01-01

Although lentiviruses similar to feline immunodeficiency virus (FIV) are known to infect numerous felid species, the relative utility of assays used for detecting lentiviral infection has not been compared for many of these hosts. We tested bobcats (Lynx rufus), pumas (Felis concolor), and ocelots (Leopardus pardalis) for exposure to lentivirus using five different assays: puma lentivirus (PLV), African lion lentivirus (LLV), and domestic cat FIV-based immunoblots, a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and nested polymerase chain reaction (PCR). Puma lentivirus immunoblots identified more seropositive individuals than the other antibody-detection assays. The commercial ELISA provided a fair ability to recognize seropositive samples when compared with PLV immunoblot for screening bobcats and ocelots, but not pumas. Polymerase chain reaction identified fewer positive samples than PLV immunoblot for all three species. Immunoblot results were equivalent whether the sample tested was serum, plasma, or whole blood. The results from this study and previous investigations suggest that the PLV immunoblot has the greatest ability to detect reactive samples when screening wild felids of North America and is unlikely to produce false positive results. However, the commercial ELISA kit may provide ap adequate alternative for screening of some species and is more easily adapted to field conditions. ?? Wildlife Disease Association 2007.

Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

PubMed

Xia, Minghui; Qi, Qingguo

2013-01-01

We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

PubMed

Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

2013-05-07

We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.

PubMed

Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S

1996-01-01

The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.

A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

PubMed

Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

2016-06-23

Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

PubMed Central

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

PubMed

Adamski, Mateusz G; Gumann, Patryk; Baird, Alison E

2014-01-01

Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR) have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR) and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells) and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA)) permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1) the achievement of absolute quantification and (2) a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

PubMed

Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

2014-05-28

3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

Chip PCR. I. Surface passivation of microfabricated silicon-glass chips for PCR.

PubMed Central

Shoffner, M A; Cheng, J; Hvichia, G E; Kricka, L J; Wilding, P

1996-01-01

The microreaction volumes of PCR chips (a microfabricated silicon chip bonded to a piece of flat glass to form a PCR reaction chamber) create a relatively high surface to volume ratio that increases the significance of the surface chemistry in the polymerase chain reaction (PCR). We investigated several surface passivations in an attempt to identify 'PCR friendly' surfaces and used those surfaces to obtain amplifications comparable with those obtained in conventional PCR amplification systems using polyethylene tubes. Surface passivations by a silanization procedure followed by a coating of a selected protein or polynucleotide and the deposition of a nitride or oxide layer onto the silicon surface were investigated. Native silicon was found to be an inhibitor of PCR and amplification in an untreated PCR chip (i.e. native slicon) had a high failure rate. A silicon nitride (Si(3)N(4) reaction surface also resulted in consistent inhibition of PCR. Passivating the PCR chip using a silanizing agent followed by a polymer treatment resulted in good amplification. However, amplification yields were inconsistent and were not always comparable with PCR in a conventional tube. An oxidized silicon (SiO(2) surface gave consistent amplifications comparable with reactions performed in a conventional PCR tube. PMID:8628665

Intact carbohydrate structures as part of the melanoidin skeleton.

PubMed

Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

2002-03-27

Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

Biodiesel production from triolein and short chain alcohols through biocatalysis.

PubMed

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

DOEpatents

Fermi, E.; Leverett, M.C.

1957-11-12

This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

NASA Technical Reports Server (NTRS)

Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

1998-01-01

Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

PubMed

Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

2015-11-01

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

PubMed

Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

2008-04-01

Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

PubMed

Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

2017-05-02

Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

PubMed Central

Brownholland, David P.

2017-01-01

A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

METHOD OF OPERATING NUCLEAR REACTORS

DOEpatents

Untermyer, S.

1958-10-14

A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

NASA Astrophysics Data System (ADS)

Nakazumi, Tomoka; Hara, Yusuke

2017-09-01

We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Influence of side chain conformation and configuration on glycosyl donor reactivity and selectivity as illustrated by sialic acid donors epimeric at the 7-position.

PubMed

Kancharla, Pavan K; Crich, David

2013-12-18

Two N-acetyl 4O,5N-oxazolidinone-protected sialyl thioglycosides epimeric at the 7-position have been synthesized and their reactivity and stereoselectivity in glycosylation reactions have been compared. It is demonstrated that the natural 7S-donor is both more reactive and more α-selective than the unnatural 7R-isomer. The difference in reactivity is attributed to the side chain conformation and specifically to the proximity of O7 to the anomeric center. In the natural 7S-isomer, O7 is closer to the anomeric center than in its unnatural 7R-epimer and, therefore, better able to support incipient positive charge at the locus of reaction. The difference in selectivity is also attributed to the side conformation, which in the unnatural 7R-series is placed perpendicularly above the α-face of the donor and so shields it to a greater extent than in the 7S-series. These observations are consistent with earlier conclusions on the influence of the side chain conformation on reactivity and selectivity derived from conformationally locked models in the glucose and galactose series and corroborate the suggestion that those effects are predominantly stereoelectronic rather than torsional. The possible relevance of side chain conformation as a factor in the influence of glycosylation stereoselectivity by remote protecting groups and as a control element in enzymic processes for glycosidic bond formation and hydrolysis are discussed. Methods for assignment of the anomeric configuration in the sialic acid glycosides are critically surveyed.

The effect of Pd ensemble structure on the O2 dissociation and CO oxidation mechanisms on Au—Pd(100) surface alloys

NASA Astrophysics Data System (ADS)

Oǧuz, Ismail-Can; Mineva, Tzonka; Guesmi, Hazar

2018-01-01

The reactivity of various Pd ensembles on the Au—Pd(100) alloy catalyst toward CO oxidation was investigated by using density functional theory (DFT). This study was prompted by the search for efficient catalysts operating at low temperature for the CO oxidation reaction that is of primary environmental importance. To this aim, we considered Pd modified Au(100) surfaces including Pd monomers, Pd dimers, second neighboring Pd atoms, and Pd chains in a comparative study of the minimum energy reaction pathways. The effect of dispersion interactions was included in the calculations of the O2 dissociation reaction pathway by using the DFT-D3 scheme. The addition of the dispersion interaction strongly improves the adsorption ability of O2 on the Au—Pd surface but does not affect the activation energy barriers of the Transitions States (TSs). As for O2 to dissociate, it is imperative that the TS has lower activation energy than the O2 desorption energy. DFT-D3 is found to favor, in some cases, O2 dissociation on configurations being identified from uncorrected DFT calculations as inactive. This is the case of the second neighboring Pd configuration for which uncorrected DFT predicts positive Gibbs free energy (ΔG) of the O2 adsorption, therefore an endergonic reaction. With the addition of D3 correction, ΔG becomes negative that reveals a spontaneous O2 adsorption. Among the investigated Au—Pd (100) ensembles, the Pd chain dissociates most easily O2 and highly stabilizes the dissociated O atoms; however, it has an inferior reactivity toward CO oxidation and CO2 formation. Indeed, CO strongly adsorbs on the palladium bridge sites and therefore poisoning the surface Pd chain. By contrast, the second neighboring Pd configuration that shows somewhat lower ability to dissociate O2 turns out to be more reactive in the CO2 formation step. These results evidence the complex effect of Pd ensembles on the CO oxidation reaction. Associative CO oxidation proceeds with high energy barriers on all the considered Pd ensembles and should be excluded, in agreement with experimental observations.

Polymerase chain reaction for screening clinical isolates of corynebacteria for the production of diphtheria toxin.

PubMed

Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A

1994-04-01

To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease.

Polymerase chain reaction for screening clinical isolates of corynebacteria for the production of diphtheria toxin.

PubMed Central

Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A

1994-01-01

AIMS--To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. METHODS--Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. RESULTS--There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. CONCLUSIONS--These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease. Images PMID:8027375

Pilot study of the utility and acceptability of tampon sampling for the diagnosis of Neisseria gonorrhoeae and Chlamydia trachomatis infections by duplex realtime polymerase chain reaction in United Kingdom sex workers.

PubMed

Kimmitt, P T; Tabrizi, S N; Crosatti, M; Garland, S M; Schober, P C; Rajakumar, K; Chapman, C A

2010-04-01

We aimed to evaluate the acceptability of self-collected tampon samples for the screening of female sex workers for sexually transmitted infections. We recruited 65 sex workers, and 63 agreed to provide tampon samples. The tampon samples were processed by realtime polymerase chain reaction (PCR) targeting Neisseria gonorrhoeae and Chlamydia trachomatis. Urethral and endocervical swabs were also obtained from 61 of 63 participants and tested using culture (N. gonorrhoeae) and the BD ProbeTec strand displacement amplification (SDA) (C. trachomatis) assay. Tampon sampling was preferred by 95% of the women and all favoured being tested away from genitourinary medicine clinics; the most common reasons cited were avoidance of embarrassment (40%) and convenience (30%). Besides near-universal acceptability of tampon sampling, the tampon sampling-PCR approach described in this study appeared to have enhanced sensitivity compared with conventional testing, suggesting the possibility of a residual hidden burden of N. gonorrhoeae and/or C. trachomatis genital infections in UK female sex workers.

Human metapneumovirus-associated hospital admissions over five consecutive epidemic seasons: evidence for alternating circulation of different genotypes.

PubMed

Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona

2012-03-01

Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

PubMed Central

Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

2013-01-01

The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

PubMed

Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

2014-01-01

Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

Evaluation of repetitive element polymerase chain reaction for surveillance of methicillin-resistant Staphylococcus aureus at a large academic medical center and community hospitals.

PubMed

Wang, Shu-Hua; Stevenson, Kurt B; Hines, Lisa; Mediavilla, José R; Khan, Yosef; Soni, Ruchi; Dutch, Wendy; Brandt, Eric; Bannerman, Tammy; Kreiswirth, Barry N; Pancholi, Preeti

2015-01-01

Repetitive element polymerase chain reaction (rep-PCR) typing has been used for methicillin-resistant Staphylococcus aureus (MRSA) strain characterization. The goal of this study was to determine if a rapid commercial rep-PCR system, DiversiLab™ (DL; bioMérieux, Durham, NC, USA), could be used for MRSA surveillance at a large medical center and community hospitals. A total of 1286 MRSA isolates genotyped by the DL system were distributed into 84 distinct rep-PCR patterns: 737/1286 (57%) were clustered into 6 major rep-PCR patterns. A subset of 220 isolates was further typed by pulsed-field gel electrophoresis (PFGE), spa typing, and SCCmec typing. The 220 isolates were distributed into 80 rep-PCR patterns, 94 PFGE pulsotypes, 27 spa, and 3 SCCmec types. The DL rep-PCR system is sufficient for surveillance, but the DL system alone cannot be used to compare data to other institutions until a standardized nomenclature is established and the DL MRSA reference library is expanded. Copyright © 2015 Elsevier Inc. All rights reserved.

Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

PubMed

Lo, Yat-Tung; Shaw, Pang-Chui

2017-10-25

Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Polymerase chain reaction in the detection of tumor cells: new approaches in diagnosis and follow-up of patients with thyroid cancer.

PubMed

Bojunga, Jörg; Kusterer, Klaus; Schumm-Draeger, Petra-Maria; Usadel, Klaus-Henning

2002-12-01

Thyroid cancers are the most common endocrine malignancies and are being diagnosed with increasing frequency. In addition to other measures, diagnosis is based on fine-needle aspiration cytology examination. Recently, new assays using reverse transcription-polymerase chain reaction (PCR) are being tested to improve sensitivity and specificity of primary diagnosis and detection of recurrent thyroid cancer. In the preoperative diagnosis of thyroid cancer, several tissue- and/or tumor-specific mRNA have been described and in several cases, a higher sensitivity and specificity could be achieved using molecular techniques compared to conventional methods. In the postoperative follow-up of patients with thyroid cancer, conflicting data have been published and the use of PCR techniques revealed several problems of the molecular approach, which are based on some technical as well as biologic limitations. Despite these problems, which are discussed in detail in this review, molecular techniques may nevertheless improve the sensitivity and accuracy of fine-needle aspiration of thyroid nodules, fine-needle aspiration of metastases, and detection of recurrent disease in peripheral blood samples.

Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

PubMed

Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

1998-10-01

In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P < .001). HIV-1 DNA was detected by PCR in ulcers of 6 (50%) of 12 HIV-positive patients. Multivariate analysis indicated that men with chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

Methylation pattern of IFNG in periapical granulomas and radicular cysts.

PubMed

Campos, Kelma; Gomes, Carolina Cavaliéri; de Fátima Correia-Silva, Jeane; Farias, Lucyana Conceição; Fonseca-Silva, Thiago; Bernardes, Vanessa Fátima; Pereira, Cláudia Maria; Gomez, Ricardo Santiago

2013-04-01

Interferon-γ plays an important role in the pathogenesis of periapical lesions, and the methylation of IFNG has been associated with transcriptional inactivation. The purpose of the present study was to investigate IFNG promoter methylation in association with gene transcription and protein levels in periapical granulomas and radicular cysts. Methylation-specific polymerase chain reaction was used to assess the DNA methylation pattern of the IFNG gene in 16 periapical granulomas and 13 radicular cyst samples. The transcription levels of IFNG mRNA were verified by quantitative real-time polymerase chain reaction, and protein expression was evaluated by immunohistochemistry. All the periapical lesion samples exhibited partial or total methylation of the IFNG gene. In addition, an increased methylation profile was found in radicular cysts compared with periapical granulomas. Increased IFNG mRNA expression was observed in the partially methylated periapical lesion samples relative to the samples that were completely methylated. The present study provides the first evidence of the possible impact of IFNG methylation on IFNG transcription in periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Simplified transient isotachophoresis/capillary gel electrophoresis method for highly sensitive analysis of polymerase chain reaction samples on a microchip with laser-induced fluorescence detection.

PubMed

Liu, Dayu; Ou, Ziyou; Xu, Mingfei; Wang, Lihui

2008-12-19

We present a sensitive, simple and robust on-chip transient isotachophoresis/capillary gel electrophoresis (tITP/CGE) method for the analysis of polymerase chain reaction (PCR) samples. Using chloride ions in the PCR buffer and N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) in the background electrolyte, respectively, as the leading and terminating electrolytes, the tITP preconcentration was coupled with CGE separation with double-T shaped channel network. The tITP/CGE separation was carried out with a single running buffer. The separation process involved only two steps that were performed continuously with the sequential switching of four voltage outputs. The tITP/CGE method showed an analysis time and a separation efficiency comparable to those of standard CGE, while the signal intensity was enhanced by factors of over 20. The limit of detection of the chip-based tITP/CGE method was estimated to be 1.1 ng/mL of DNA in 1x PCR buffer using confocal fluorescence detection following 473 nm laser excitation.

Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

PubMed

Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

2014-09-19

Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

Using Reference Quantitative Polymerase Chain Reaction to Assess the Clinical Performance of the Paracheck-Pf® Rapid Diagnostic Test in a Field Setting in Uganda.

PubMed

Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K

2018-06-04

Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.

Production of medium chain fatty acid rich mustard oil using packed bed bioreactor.

PubMed

Sengupta, Avery; Roy, Susmita; Mukherjee, Sohini; Ghosh, Mahua

2015-01-01

A comparative study was done on the production of different medium chain fatty acid (MCFA) rich mustard oil using a stirred tank batchreactor (STBR) and packed bed bio reactor (PBBR) using three commercially available immobilised lipases viz. Thermomyces lanuginosus, Candida antarctica and Rhizomucor meihe. Three different MCFAs capric, caprylic and lauric acids were incorporated in the mustard oil. Reaction parameters, such as substrate molar ratio, reaction temperature and enzyme concentration were standardized in the STBR and maintained in the PBBR. To provide equal time of residence between the substrate and enzyme in both the reactors for the same amount of substrates, the substrate flow rate in the PBBR was maintainedat 0.27 ml/min. Gas liquid chromatography was used to monitor the incorporation of MCFA in mustard oil. The study showed that the PBBR was more efficient than the STBR in the synthesis of structured lipids with less migration of acyl groups. The physico-chemical parameters of the product along with fatty acid composition in all positions and sn-2 positions were also determined.

Expected distributions of root-mean-square positional deviations in proteins.

PubMed

Pitera, Jed W

2014-06-19

The atom positional root-mean-square deviation (RMSD) is a standard tool for comparing the similarity of two molecular structures. It is used to characterize the quality of biomolecular simulations, to cluster conformations, and as a reaction coordinate for conformational changes. This work presents an approximate analytic form for the expected distribution of RMSD values for a protein or polymer fluctuating about a stable native structure. The mean and maximum of the expected distribution are independent of chain length for long chains and linearly proportional to the average atom positional root-mean-square fluctuations (RMSF). To approximate the RMSD distribution for random-coil or unfolded ensembles, numerical distributions of RMSD were generated for ensembles of self-avoiding and non-self-avoiding random walks. In both cases, for all reference structures tested for chains more than three monomers long, the distributions have a maximum distant from the origin with a power-law dependence on chain length. The purely entropic nature of this result implies that care must be taken when interpreting stable high-RMSD regions of the free-energy landscape as "intermediates" or well-defined stable states.

Numerical simulation of transport and sequential biodegradation of chlorinated aliphatic hydrocarbons using CHAIN_2D

NASA Astrophysics Data System (ADS)

Schaerlaekens, J.; Mallants, D.; Imûnek, J.; van Genuchten, M. Th.; Feyen, J.

1999-12-01

Microbiological degradation of perchloroethylene (PCE) under anaerobic conditions follows a series of chain reactions, in which, sequentially, trichloroethylene (TCE), cis-dichloroethylene (c-DCE), vinylchloride (VC) and ethene are generated. First-order degradation rate constants, partitioning coefficients and mass exchange rates for PCE, TCE, c-DCE and VC were compiled from the literature. The parameters were used in a case study of pump-and-treat remediation of a PCE-contaminated site near Tilburg, The Netherlands. Transport, non-equilibrium sorption and biodegradation chain processes at the site were simulated using the CHAIN_2D code without further calibration. The modelled PCE compared reasonably well with observed PCE concentrations in the pumped water. We also performed a scenario analysis by applying several increased reductive dechlorination rates, reflecting different degradation conditions (e.g. addition of yeast extract and citrate). The scenario analysis predicted considerably higher concentrations of the degradation products as a result of enhanced reductive dechlorination of PCE. The predicted levels of the very toxic compound VC were now an order of magnitude above the maximum permissible concentration levels.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Tested Demonstrations.

ERIC Educational Resources Information Center

Gilbert, George L., Ed.

1983-01-01

Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

Implications of Measurement Assay Type in Design of HIV Experiments.

PubMed

Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

2017-12-01

Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

Surface modification and antimicrobial properties of cellulose nanocrystals

NASA Astrophysics Data System (ADS)

Bespalova, Yulia A.

Surface modification of cellulose nanocrystals (CNC) was performed by acetylation and subsequent reaction with various tertiary amines with different lengths of alkyl groups. Chloroacetic anhydride (95%) was used for acetylation. The acetylation of CNC was confirmed using IR spectroscopy. The bands associated with C=0 stretching (1740 cm-1) and C-Cl stretching (793 cm -1) was present in the acetylated CNC but they were absent in the neat CNC. It has been suggested that the primary hydroxyl groups of CNC are substituted by chloro acetyl groups during acetylation reaction. Subsequent reaction of chloro acetylated CNC with N, N - Dimethyl ethylamine, N, N - Dimethyl hexylamine, N, N - Dimethyl dodecylamine, N, N - Dimethyl hexadecylamine and N, N - Dimethyl decylamine formed quaternary ammonium salts. These quaternary ammonium salts were characterized by FTIR and solid state13C NMR spectroscopy. FTIR spectra of five types of quaternary ammonium salts of CNC are similar and they showed infrared bands at 2905 -1 and 2850 cm-1, attributed to symmetrical and unsymmetrical C-H stretching vibration. The absence of C-Cl band at 793 cm-1 proves that quaternary salt formation was successful. The 13C NMR spectrum of quaternary ammonium modified CNC with N, N - Dimethyl dodecylamine shows several additional resonances ranging from 14.5 ppm to 58.0 ppm when compared to 13C NMR spectrum of pure CNC. This evidence proves that long alkyl chains have been added to the pure CNC. The disc diffusion method confirmed that quaternary ammonium modified CNCs with a chain longer than ten carbons are effective antimicrobial agents against Staphylococcus aureus and E. coli bacteria. Pure CNC and quaternary ammonium modified CNCs with an alkyl chain length of ten or less were not able to inhibit bacteria growth.

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

Structures and Mechanism of the Monoamine Oxidase Family

PubMed Central

Gaweska, Helena; Fitzpatrick, Paul F.

2011-01-01

Members of the monoamine oxidase family of flavoproteins catalyze the oxidation of primary and secondary amines, polyamines, amino acids, and methylated lysine side chains in proteins. The enzymes have similar overall structures, with conserved FAD-binding domains and varied substrate-binding sites. Multiple mechanisms have been proposed for the catalytic reactions of these enzymes. The present review compares the structures of different members of the family and the various mechanistic proposals. PMID:22022344

Nonproductive events in ring-closing metathesis using ruthenium catalysts.

PubMed

Stewart, Ian C; Keitz, Benjamin K; Kuhn, Kevin M; Thomas, Renee M; Grubbs, Robert H

2010-06-30

The relative TONs of productive and nonproductive metathesis reactions of diethyl diallylmalonate are compared for eight different ruthenium-based catalysts. Nonproductive cross metathesis is proposed to involve a chain-carrying ruthenium methylidene. A second more-challenging substrate (dimethyl allylmethylallylmalonate) that forms a trisubstituted olefin product is used to further delineate the effect of catalyst structure on the relative efficiencies of these processes. A steric model is proposed to explain the observed trends.

LUNA: Nuclear astrophysics underground

DOE Office of Scientific and Technical Information (OSTI.GOV)

Best, A.

Underground nuclear astrophysics with LUNA at the Laboratori Nazionali del Gran Sasso spans a history of 20 years. By using the rock overburden of the Gran Sasso mountain chain as a natural cosmic-ray shield very low signal rates compared to an experiment on the surface can be tolerated. The cross sectons of important astrophysical reactions directly in the stellar energy range have been successfully measured. In this proceeding we give an overview over the key accomplishments of the experiment and an outlook on its future with the expected addition of an additional accelerator to the underground facilities, enabling the coveragemore » of a wider energy range and the measurement of previously inaccessible reactions.« less

An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

PubMed

Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

2013-01-01

Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

PubMed

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Gaseous nitrogen and bacterial responses to raw and digested dairy manure applications in incubated soil.

PubMed

Saunders, Olivia E; Fortuna, Ann-Marie; Harrison, Joe H; Cogger, Craig G; Whitefield, Elizabeth; Green, Tonia

2012-11-06

A study was conducted under laboratory conditions to compare rates of nitrous oxide (N(2)O) and ammonia (NH(3)) emissions when soil was amended with anaerobically digested dairy manure slurry containing <30% food byproducts, raw dairy manure slurry, or urea. Slurries were applied via surface and subsurface methods. A second objective was to correlate genes regulating nitrification and denitrification with rates of N(2)O production, slurry treatment, and application method. Ammonia volatilization from incubated soil ranged from 140 g kg(-1) of total N applied in digested slurry to 230 g kg(-1) in urea. Subsurface application of raw dairy manure slurry decreased ammonia volatilization compared with surface application. Anaerobic digestion increased N(2)O production. Cumulative N(2)O loss averaged 27 g kg(-1) of total N applied for digested slurry, compared with 5 g kg(-1) for raw dairy slurry. Genes of interest included a 16S rRNA gene selective for β-subgroup proteobacterial ammonia-oxidizers, amoA, narG, and nosZ quantified with quantitative polymerase chain reaction (qPCR) and real-time polymerase chain reaction (RT-PCR). Application of anaerobically digested slurry increased nitrifier and denitrifier gene copies that correlated with N(2)O production. Expression of all genes measured via mRNA levels was affected by N applications to soil. This study provides new information linking genetic markers in denitrifier and nitrifier populations to N(2)O production.

Microarray expression profiling in adhesion and normal peritoneal tissues.

PubMed

Ambler, Dana R; Golden, Alicia M; Gell, Jennifer S; Saed, Ghassan M; Carey, David J; Diamond, Michael P

2012-05-01

To identify molecular markers associated with adhesion and normal peritoneal tissue using microarray expression profiling. Comparative study. University hospital. Five premenopausal women. Adhesion and normal peritoneal tissue samples were obtained from premenopausal women. Ribonucleic acid was extracted using standard protocols and processed for hybridization to Affymetrix Whole Transcript Human Gene Expression Chips. Microarray data were obtained from five different patients, each with adhesion tissue and normal peritoneal samples. Real-time polymerase chain reaction was performed for confirmation using standard protocols. Gene expression in postoperative adhesion and normal peritoneal tissues. A total of 1,263 genes were differentially expressed between adhesion and normal tissues. One hundred seventy-three genes were found to be up-regulated and 56 genes were down-regulated in the adhesion tissues compared with normal peritoneal tissues. The genes were sorted into functional categories according to Gene Ontology annotations. Twenty-six up-regulated genes and 11 down-regulated genes were identified with functions potentially relevant to the pathophysiology of postoperative adhesions. We evaluated and confirmed expression of 12 of these specific genes via polymerase chain reaction. The pathogenesis, natural history, and optimal treatment of postoperative adhesive disease remains unanswered. Microarray analysis of adhesions identified specific genes with increased and decreased expression when compared with normal peritoneum. Knowledge of these genes and ontologic pathways with altered expression provide targets for new therapies to treat patients who have or are at risk for postoperative adhesions. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

NanoString nCounter® Approach in Breast Cancer: A Comparative Analysis with Quantitative Real-Time Polymerase Chain Reaction, In Situ Hybridization, and Immunohistochemistry.

PubMed

Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon

2017-09-01

Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2015-10-27

In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

2015-07-15

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

PubMed

Brownholland, David P; Covey, Douglas F

2017-05-01

A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Spark Plasma Sintering for Nanostructured Smart Materials

DTIC Science & Technology

2009-03-02

polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

Asymptotic study of pulsating evolution of overdriven and CJ detonation with a chain-branching kinetics model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Short, Mark; Chliquete, Carlos

2011-01-20

The pulsating dynamics of gaseous detonations with a model two-step chain-branching kinetic mechanism are studied both numerically and asymptotically. The model studied here was also used in [4], [3] and [2] and mimics the attributes of some chain-branching reaction mechanisms. Specifically, the model comprises a chain-initiationlbranching zone with an Arrhenius temperature-sensitive rate behind the detonation shock where fuel is converted into chain-radical with no heat release. This is followed by a chain-termination zone having a temperature insensitive rate where the exothermic heat of reaction is released. The lengths of these two zones depend on the relative rates of each stage.more » It was determined in [4] and [3] via asymptotic and numerical analysis that the ratio of the length of the chain-branching zone to that of the chain-initation zone relative to the size of the von Neumann state scaled activation energy in the chain initiation/branching zone has a primary influence of the stability of one-dimensional pulsating instability behavior for this model. In [2], the notion of a specific stability parameter related to this ratio was proposed that determines the boundary between stable and unstable waves. In [4], a slow-time varying asymptotic study was conducted of pulsating instability of Chapman-Jouguet (CJ) detonations with the above two-step rate model, assuming a large activation energy for the chain-initiation zone and a chain-termination zone longer than the chain-initiation zone. Deviations D{sub n}{sup (1)} ({tau}) of the detonation velocity from Chapman-Jouguet were of the order of the non-dimensional activation energy. Solutions were sought for a pulsation timescale of the order of the non-dimensional activation energy times the particle transit time through the induction zone. On this time-scale, the evolution of the chain-initation zone is quasi-steady. In [4], a time-dependent non-linear evolution equation for D{sub n}{sup (1)} ({tau}) was then constructed via a perturbation procedure for cases where the ratio of the length of the chain-termination zone to chain-initiation zone was less than the non-dimensional activation energy. To leading order, the steady CJ detonation was found to be unstable; higher-order corrections lead to the construction of a stability limit between stable and unsteady pulsating solutions. One conclusion from this study is that for a stability limit to occur at leading order, the period of pulsation of the detonation must occur on the time scale of particle passage through the longer chain-termination zone, while the length of the chain-termination zone must be of order of the non-dimensional activation energy longer than the chain-initiation zone. The relevance of these suggested scalings was verified via numerical solutions of the full Euler system in [3], and formed the basis of the stability parameter criteria suggested in [2]. In the following, we formulate an asymptotic study based on these new suggested scales, studying the implications for describing pulsating behavior in gaseous chain-branching detonations. Specifically, we find that the chain-induction zone structure is the same as that studied in [4]. However, the study of unsteady evolution in the chain-termination region is now governed by a set of asymptotically derived nonlinear POEs. Equations for the linear stablity behavior of this set of POE's is obtained, while the nonlinear POEs are solved numerically using a shock-attached, shock-fitting method developed by Henrick et aJ. [1]. The results thus far show that the stability threshold calculated using the new ratio of the chain-termination zone length to that of the chain-initiation zone yields a marked improvement over [2]. Additionally, solutions will be compared with predictions obtained from the solution of the full Euler system. Finally, the evolution equation previously derived in [4] has been generalized to consider both arbitrary reaction orders and any degree of overdrive.« less

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Quantification of the Influence of Extracellular Laccase and Intracellular Reactions on the Isomer-Specific Biotransformation of the Xenoestrogen Technical Nonylphenol by the Aquatic Hyphomycete Clavariopsis aquatica▿

PubMed Central

Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar

2009-01-01

The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

Methanol Cannon Demonstrations Revisited.

ERIC Educational Resources Information Center

Dolson, David A.; And Others

1995-01-01

Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

NASA Astrophysics Data System (ADS)

Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

2017-09-01

It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

On-Surface Pseudo-High-Dilution Synthesis of Macrocycles: Principle and Mechanism.

PubMed

Fan, Qitang; Wang, Tao; Dai, Jingya; Kuttner, Julian; Hilt, Gerhard; Gottfried, J Michael; Zhu, Junfa

2017-05-23

Macrocycles have attracted much attention due to their specific "endless" topology, which results in extraordinary properties compared to related linear (open-chain) molecules. However, challenges still remain in their controlled synthesis with well-defined constitution and geometry. Here, we report the successful application of the (pseudo-)high-dilution method to the conditions of on-surface synthesis in ultrahigh vacuum. This approach leads to high yields (up to 84%) of cyclic hyperbenzene ([18]-honeycombene) via an Ullmann-type reaction from 4,4″-dibromo-meta-terphenyl (DMTP) as precursor on a Ag(111) surface. The mechanism of macrocycle formation was explored in detail using scanning tunneling microscopy and X-ray photoemission spectroscopy. We propose that the dominant pathway for hyperbenzene (MTP) 6 formation is the stepwise desilverization of an organometallic (MTP-Ag) 6 macrocycle, which forms via cyclization of (MTP-Ag) 6 chains under pseudo-high-dilution conditions. The high probability of cyclization on the stage of the organometallic phase results from the reversibility of the C-Ag bond. The case is different from that in solution, in which cyclization typically occurs on the stage of a covalently bonded open-chain precursor. This difference in the cyclization mechanism on a surface compared to that in solution stems mainly from the 2D confinement exerted by the surface template, which hinders the flipping of chain segments necessary for cyclization.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

Unraveling reaction pathways and specifying reaction kinetics for complex systems.

PubMed

Vinu, R; Broadbelt, Linda J

2012-01-01

Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

Sensing Size through Clustering in Non-Equilibrium Membranes and the Control of Membrane-Bound Enzymatic Reactions

PubMed Central

Vagne, Quentin; Turner, Matthew S.; Sens, Pierre

2015-01-01

The formation of dynamical clusters of proteins is ubiquitous in cellular membranes and is in part regulated by the recycling of membrane components. We show, using stochastic simulations and analytic modeling, that the out-of-equilibrium cluster size distribution of membrane components undergoing continuous recycling is strongly influenced by lateral confinement. This result has significant implications for the clustering of plasma membrane proteins whose mobility is hindered by cytoskeletal “corrals” and for protein clustering in cellular organelles of limited size that generically support material fluxes. We show how the confinement size can be sensed through its effect on the size distribution of clusters of membrane heterogeneities and propose that this could be regulated to control the efficiency of membrane-bound reactions. To illustrate this, we study a chain of enzymatic reactions sensitive to membrane protein clustering. The reaction efficiency is found to be a non-monotonic function of the system size, and can be optimal for sizes comparable to those of cellular organelles. PMID:26656912

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

PubMed

Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

2006-10-12

[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

A computational study of pyrolysis reactions of lignin model compounds

Treesearch

Thomas Elder

2010-01-01

Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

PubMed

Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

2016-11-01

Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560-568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. © 2016 Peeters et al.

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis

PubMed Central

Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh

2016-01-01

Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560–568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. PMID:27881439

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

PubMed

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species. Nevertheless, to accurately differentiate among the taxonomically related species, PCR-RFLP should be implemented.

Genomic characterization of Indian isolates of egg drop syndrome 1976 virus.

PubMed

Raj, G D; Sivakumar, S; Sudharsan, S; Mohan, A C; Nachimuthu, K

2001-02-01

Five Indian isolates of egg drop syndrome (EDS) 1976 virus and the reference strain 127 were compared by restriction enzyme analysis of viral DNA, and the hexon gene amplified by polymerase chain reaction. Using these techniques, no differences were seen among these viruses. However, partial sequencing of the hexon gene revealed major differences (4.6%) in one of the isolates sequenced, EDS Kerala. Phylogenetic analysis also placed this isolate in a different lineage compared with the other isolates. The need for constant monitoring of the genetic nature of the field isolates of EDS viruses is emphasized.

A fluorometric determination of urinary 17-hydroxycorticosteroids using benzamidine.

PubMed

Yamaguchi, Y; Seki, T

1984-10-01

A fluorometric determination of urinary 17-hydroxycorticosteroids using a reaction of benzamidine with compounds carrying the dihydroxyacetone side chain is described. The fluorescent compounds have excitation and emission maxima at 370 and 480 nm, respectively. The method includes enzymatic hydrolysis with beta-glucuronidase (EC 3.2.1.31, from Escherichia coli) and extraction with methylene chloride and generation of fluorescence in alkaline solution (pH 13.4). The specificity of the reaction was examined and the results were compared with those of an accepted method based on the Porter-Silber reaction (C. C. Porter and R. H. Silber, 1950, J. Biol. Chem. 185, 201-207). The coefficient of correlation was 0.945 with regression line of y = 0.91x + 0.7 mg/day (y, present method; x, Porter-Silber reaction method). Sensitivity of the reaction was 0.5 microgram/ml of standard or sample, mean recovery of cortisol added to five urine samples (5-micrograms addition) was 95%, and the coefficient of variation of the method (five repeated assays of sample with a value of 5.2 mg/liter) was 6.2%.

Structures of the N47A and E109Q mutant proteins of pyruvoyl-dependent arginine decarboxylase from Methanococcus jannaschii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soriano, Erika V.; McCloskey, Diane E.; Kinsland, Cynthia

2008-04-01

The crystal structures of two arginine decarboxylase mutant proteins provide insights into the mechanisms of pyruvoyl-group formation and the decarboxylation reaction. Pyruvoyl-dependent arginine decarboxylase (PvlArgDC) catalyzes the first step of the polyamine-biosynthetic pathway in plants and some archaebacteria. The pyruvoyl group of PvlArgDC is generated by an internal autoserinolysis reaction at an absolutely conserved serine residue in the proenzyme, resulting in two polypeptide chains. Based on the native structure of PvlArgDC from Methanococcus jannaschii, the conserved residues Asn47 and Glu109 were proposed to be involved in the decarboxylation and autoprocessing reactions. N47A and E109Q mutant proteins were prepared and themore » three-dimensional structure of each protein was determined at 2.0 Å resolution. The N47A and E109Q mutant proteins showed reduced decarboxylation activity compared with the wild-type PvlArgDC. These residues may also be important for the autoprocessing reaction, which utilizes a mechanism similar to that of the decarboxylation reaction.« less

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

Conservation of the sequence of the Alzheimer's disease amyloid peptide in dog, polar bear and five other mammals by cross-species polymerase chain reaction analysis.

PubMed

Johnstone, E M; Chaney, M O; Norris, F H; Pascual, R; Little, S P

1991-07-01

Neuritic plaque and cerebrovascular amyloid deposits have been detected in the aged monkey, dog, and polar bear and have rarely been found in aged rodents (Biochem. Biophy. Res. Commun., 12 (1984) 885-890; Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 4245-4249). To determine if the primary structure of the 42-43 residue amyloid peptide is conserved in species that accumulate plaques, the region of the amyloid precursor protein (APP) cDNA that encodes the peptide region was amplified by the polymerase chain reaction and sequenced. The deduced amino acid sequence was compared to those species where amyloid accumulation has not been detected. The DNA sequences of dog, polar bear, rabbit, cow, sheep, pig and guinea pig were compared and a phylogenetic tree was generated. We conclude that the amino acid sequence of dog and polar bear and other mammals which may form amyloid plaques is conserved and the species where amyloid has not been detected (mouse, rat) may be evolutionarily a distinct group. In addition, the predicted secondary structure of mouse and rat amyloid that differs from that of amyloid bearing species is its lack of propensity to form a beta sheeted structure. Thus, a cross-species examination of the amyloid peptide may suggest what is essential for amyloid deposition.

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.

PubMed

Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K

2017-07-01

This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.

Frequencies of polymorphisms of the Rh, Kell, Kidd, Duffy and Diego systems of Santa Catarina, Southern Brazil.

PubMed

Costa, Daiane Cobianchi; Schinaider, Alessandra Arruda; Santos, Thais Mattos; Schörner, Everaldo José; Simon, Daniel; Maluf, Sharbel Weidner; de Moraes, Ana Carolina Rabello; Silva, Maria Claudia Silva

2016-01-01

Red blood cell genes are highly polymorphic with the distribution of alleles varying between different populations and ethnic groups. The objective of this study was to investigate gene polymorphisms of blood groups in the state of Santa Catarina, Southern Brazil. Three hundred and seventy-three unrelated blood donors and 31 transfusion-dependent patients were evaluated to investigate polymorphisms of the Rh, Kell, Duffy, Kidd, and Diego blood group systems in a population from the state of Santa Catarina. The subjects, from seven regions that comprise the blood-banking network of the state, were assessed between August 2011 and March 2014. The genotypes of the Rh, Kell, Duffy, Kidd, and Diego systems were determined using the restriction fragment length polymorphism-polymerase chain reaction and allele-specific polymerase chain reaction techniques. The genotype frequencies in this study were significantly different when populations from different regions of Santa Catarina were compared. Furthermore, there were also significant differences in the genetic frequencies compared to other Brazilian states. The genotype frequencies of the Kell and Kidd blood groups are similar to European populations from Naples, Italy and Zurich, Switzerland. This article reports for the first time the frequency of polymorphisms of blood group systems in blood donors from Santa Catarina, Southern Brazil. Copyright © 2016 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

Evaluation of p16 hypermethylation in oral submucous fibrosis: A quantitative and comparative analysis in buccal cells and saliva using real-time methylation-specific polymerase chain reaction.

PubMed

Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian

2016-01-01

The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.

The 2.1Å Crystal Structure of an Acyl-CoA Synthetase from Methanosarcina acetivorans reveals an alternate acyl binding pocket for small branched acyl substrates†,‡

PubMed Central

Shah, Manish B.; Ingram-Smith, Cheryl; Cooper, Leroy L.; Qu, Jun; Meng, Yu; Smith, Kerry S.; Gulick, Andrew M.

2009-01-01

The acyl-AMP forming family of adenylating enzymes catalyze two-step reactions to activate a carboxylate with the chemical energy derived from ATP hydrolysis. X-ray crystal structures have been determined for multiple members of this family and, together with biochemical studies, provide insights into the active site and catalytic mechanisms used by these enzymes. These studies have shown that the enzymes use a domain rotation of 140° to reconfigure a single active site to catalyze the two partial reactions. We present here the crystal structure of a new medium chain acyl-CoA synthetase from Methanosarcina acetivorans. The binding pocket for the three substrates is analyzed, with many conserved residues present in the AMP binding pocket. The CoA binding pocket is compared to the pockets of both acetyl-CoA synthetase and 4-chlorobenzoate:CoA ligase. Most interestingly, the acyl binding pocket of the new structure is compared with other acyl- and aryl-CoA synthetases. A comparison of the acyl-binding pocket of the acyl-CoA synthetase from M. acetivorans with other structures identifies a shallow pocket that is used to bind the medium chain carboxylates. These insights emphasize the high sequence and structural diversity among this family in the area of the acyl binding pocket. PMID:19544569

Polymerase chain reaction-based detection of Pneumocystis jirovecii in bronchoalveolar lavage fluid for the diagnosis of pneumocystis pneumonia.

PubMed

Oren, Ilana; Hardak, Emilia; Finkelstein, Renato; Yigla, Mordechai; Sprecher, Hannah

2011-09-01

The diagnosis of pneumocystis pneumonia (PCP) in non-human immunodeficiency virus (HIV)-infected immunocompromised patients is notoriously difficult. The recent advent of polymerase chain reaction (PCR)-based detection systems, based on the identification of single fungal genes, has markedly improved diagnostic accuracy in this ominous disease. In an attempt to further improve diagnostic yield, the authors used a PCR-based detection system for Pneumocystis jirovecii, based on targeting 3 distinct genes. During the 4-year period (January 2005 to January 2009), all consecutive immunocompromised patients suspected of having PCP in the differential diagnosis underwent bronchoscopy with bronchoalveolar lavage sampling for the evaluation of the etiology of pulmonary infiltrates. Bronchoalveolar fluid was tested for the presence of a wide variety of possible etiological microorganisms. In a cohort of 214 immunocompromised patients (of which 198 were non-HIV immunocompromised patients) who underwent bronchoscopy with bronchoalveolar lavage for evaluation of pulmonary infiltrates, PCR correctly diagnosed PCP in 75% (42/56) compared with 14% (8/56) diagnosed by traditional stains, and increased diagnostic yield 5.4-fold. Given the absence of a sensitive gold standard, this study demonstrates the usefulness of a multigene PCR-based detection of Pneumocystis jirovecii DNA for supporting the clinical diagnosis of PCP, with high sensitivity and negative predictive value rates compared with direct stains, especially in non-HIV immunocompromised patients.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

NASA Astrophysics Data System (ADS)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

USGS Publications Warehouse

Rocke, T.E.; Smith, S.R.; Miyamoto, A.; Shadduck, D.J.

2002-01-01

A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

Standard Free Droplet Digital Polymerase Chain Reaction as a New Tool for the Quality Control of High-Capacity Adenoviral Vectors in Small-Scale Preparations

PubMed Central

Boehme, Philip; Stellberger, Thorsten; Solanki, Manish; Zhang, Wenli; Schulz, Eric; Bergmann, Thorsten; Liu, Jing; Doerner, Johannes; Baiker, Armin E.

2015-01-01

Abstract High-capacity adenoviral vectors (HCAdVs) are promising tools for gene therapy as well as for genetic engineering. However, one limitation of the HCAdV vector system is the complex, time-consuming, and labor-intensive production process and the following quality control procedure. Since HCAdVs are deleted for all viral coding sequences, a helper virus (HV) is needed in the production process to provide the sequences for all viral proteins in trans. For the purification procedure of HCAdV, cesium chloride density gradient centrifugation is usually performed followed by buffer exchange using dialysis or comparable methods. However, performing these steps is technically difficult, potentially error-prone, and not scalable. Here, we establish a new protocol for small-scale production of HCAdV based on commercially available adenovirus purification systems and a standard method for the quality control of final HCAdV preparations. For titration of final vector preparations, we established a droplet digital polymerase chain reaction (ddPCR) that uses a standard free-end-point PCR in small droplets of defined volume. By using different probes, this method is capable of detecting and quantifying HCAdV and HV in one reaction independent of reference material, rendering this method attractive for accurately comparing viral titers between different laboratories. In summary, we demonstrate that it is possible to produce HCAdV in a small scale of sufficient quality and quantity to perform experiments in cell culture, and we established a reliable protocol for vector titration based on ddPCR. Our method significantly reduces time and required equipment to perform HCAdV production. In the future the ddPCR technology could be advantageous for titration of other viral vectors commonly used in gene therapy. PMID:25640117

Autoignition of hydrogen in shear flows

NASA Astrophysics Data System (ADS)

Kalbhor, Abhijit; Chaudhuri, Swetaprovo; Chitilappilly, Lazar

2018-05-01

In this paper, we compare the autoignition characteristics of laminar, nitrogen-diluted hydrogen jets in two different oxidizer flow configurations: (a) co-flowing heated air and (b) wake of heated air, using two-dimensional numerical simulations coupled with detailed chemical kinetics. In both cases, autoignition is observed to initiate at locations with low scalar dissipation rates and high HO2 depletion rates. It is found that the induction stage prior to autoignition is primarily dominated by chemical kinetics and diffusion while the improved scalar mixing imparted by the large-scale flow structures controls the ignition progress in later stages. We further investigate the ignition transience and its connection with mixing by varying the initial wake conditions and fuel jet to oxidizer velocity ratios. These studies reveal that the autoignition delay times are independent of initial wake flow conditions. However, with increased jet velocity ratios, the later stages of ignition are accelerated, mainly due to enhanced mixing facilitated by the higher scalar dissipation rates. Furthermore, the sensitivity studies for the jet in wake configuration show a significant reduction in ignition delay even for about 0.14% (by volume) hydrogen dilution in the oxidizer. In addition, the detailed autoignition chemistry and the relative roles of certain radical species in the initiation of the autoignition process in these non-premixed jets are investigated by tracking the evolution of important chain reactions using a Lagrangian particle tracking approach. The reaction H2 + O2 ↔ HO2 + H is recognized to be the dominant chain initiation reaction that provides H radicals essential for the progress of subsequent elementary reactions during the pre-ignition stage.

Arginine Coordination in Enzymatic Phosphoryl Transfer: Evaluation of the Effect of Arg166 Mutations in Escherichia Coli Alkaline Phosphatase

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, P.J.; Lassila, J.K.; Fenn, T.D.

2009-05-22

Arginine residues are commonly found in the active sites of enzymes catalyzing phosphoryl transfer reactions. Numerous site-directed mutagenesis experiments establish the importance of these residues for efficient catalysis, but their role in catalysis is not clear. To examine the role of arginine residues in the phosphoryl transfer reaction, we have measured the consequences of mutations to arginine 166 in Escherichia coli alkaline phosphatase on hydrolysis of ethyl phosphate, on individual reaction steps in the hydrolysis of the covalent enzyme-phosphoryl intermediate, and on thio substitution effects. The results show that the role of the arginine side chain extends beyond its positivemore » charge, as the Arg166Lys mutant is as compromised in activity as Arg166Ser. Through measurement of individual reaction steps, we construct a free energy profile for the hydrolysis of the enzyme-phosphate intermediate. This analysis indicates that the arginine side chain strengthens binding by {approx}3 kcal/mol and provides an additional 1-2 kcal/mol stabilization of the chemical transition state. A 2.1 {angstrom} X-ray diffraction structure of Arg166Ser AP is presented, which shows little difference in enzyme structure compared to the wild-type enzyme but shows a significant reorientation of the bound phosphate. Altogether, these results support a model in which the arginine contributes to catalysis through binding interactions and through additional transition state stabilization that may arise from complementarity of the guanidinum group to the geometry of the trigonal bipyramidal transition state.« less

Vibrational non-equilibrium in the hydrogen-oxygen reaction. Comparison with experiment

NASA Astrophysics Data System (ADS)

Skrebkov, Oleg V.

2015-03-01

A theoretical model is proposed for the chemical and vibrational kinetics of hydrogen oxidation based on consistent accounting of the vibrational non-equilibrium of the HO2 radical that forms as a result of the bimolecular recombination H+O2 → HO2. In the proposed model, the chain branching H+O2 = O+OH and inhibiting H+O2+M = HO2+M formal reactions are treated (in the terms of elementary processes) as a single multi-channel process of forming, intramolecular energy redistribution between modes, relaxation, and unimolecular decay of the comparatively long-lived vibrationally excited HO2 radical, which is able to react and exchange energy with the other components of the mixture. The model takes into account the vibrational non-equilibrium of the starting (primary) H2 and O2 molecules, as well as the most important molecular intermediates HO2, OH, O2(1Δ), and the main reaction product H2O. It is shown that the hydrogen-oxygen reaction proceeds in the absence of vibrational equilibrium, and the vibrationally excited HO2(v) radical acts as a key intermediate in a fundamentally important chain branching process and in the generation of electronically excited species O2(1Δ), O(1D), and OH(2Σ+). The calculated results are compared with the shock tube experimental data for strongly diluted H2-O2 mixtures at 1000 < T < 2500 K, 0.5 < p < 4 atm. It is demonstrated that this approach is promising from the standpoint of reconciling the predictions of the theoretical model with experimental data obtained by different authors for various compositions and conditions using different methods. For T < 1500 K, the nature of the hydrogen-oxygen reaction is especially non-equilibrium, and the vibrational non-equilibrium of the HO2 radical is the essence of this process. The quantitative estimation of the vibrational relaxation characteristic time of the HO2 radical in its collisions with H2 molecules has been obtained as a result of the comparison of different experimental data on induction time measurements with the relevant calculations.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Self-assembly and photoluminescence evolution of hydrophilic and hydrophobic quantum dots in sol–gel processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Ping, E-mail: mse_yangp@ujn.edu.cn; Matras-Postolek, Katarzyna; Song, Xueling

2015-10-15

Graphical abstract: Highly luminescent quantum dots (QDs) with tunable photoluminescence (PL) wavelength were assembled into various morphologies including chain, hollow spheres, fibers, and ring structures through sol–gel processes. The PL properties during assembly as investigated. - Highlights: • Highly luminescent quantum dots (QDs) were synthesized from several ligands. • The evolution of PL in self-assembly via sol–gel processes was investigated. • CdTe QDs were assembled into a chain by controlling hydrolysis and condensation reactions. • Hollow spheres, fibers, and ring structures were created via CdSe/ZnS QDs in sol–gel processes. - Abstract: Highly luminescent quantum dots (QDs) with tunable photoluminescence (PL)more » wavelength were synthesized from several ligands to investigate the PL evolution in QD self-assembly via sol–gel processes. After ligand exchange, CdTe QDs were assembled into a chain by controlling the hydrolysis and condensation reaction of 3-mercaptopropyl-trimethoxysilane. The chain was then coated with a SiO{sub 2} shell from tetraethyl orthosilicate (TEOS). Hollow spheres, fibers, and ring structures were created from CdSe/ZnS QDs via various sol–gel processes. CdTe QDs revealed red-shifted and narrowed PL spectrum after assembly compared with their initial one. In contrast, the red-shift of PL spectra of CdSe/ZnS QDs is small. By optimizing experimental conditions, SiO{sub 2} spheres with multiple CdSe/ZnS QDs were fabricated using TEOS and MPS. The QDs in these SiO{sub 2} spheres retained their initial PL properties. This result is useful for application because of their high stability and high PL efficiency of 33%.« less

One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

PubMed

Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

2014-02-21

In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Vascular endothelial growth factor and nitric oxide synthase expression in human tooth germ development.

PubMed

Mastrangelo, F; Sberna, M T; Tettamanti, L; Cantatore, G; Tagliabue, A; Gherlone, E

2016-01-01

Vascular Endothelia Growth Factor (VEGF) and Nitric Oxide Synthase (NOS) expression, were evaluated in human tooth germs at two different stages of embryogenesis, to clarify the role of angiogenesis during tooth tissue differentiation and growth. Seventy-two third molar germ specimens were selected during oral surgery. Thirty-six were in the early stage and 36 in the later stage of tooth development. The samples were evaluated with Semi-quantitative Reverse Transcription-Polymerase chain Reaction analyses (RT-PcR), Western blot analysis (WB) and immunohistochemical analysis. Western blot and immunohistochemical analysis showed a VEGF and NOS 1-2-3 positive reaction in all samples analysed. VEGF high positive decrease reaction was observed in stellate reticulum cells, ameloblast and odontoblast clusters in early stage compared to later stage of tooth germ development. Comparable VEGF expression was observed in endothelial cells of early and advanced stage growth. NOS1 and NOS3 expressions showed a high increased value in stellate reticulum cells, and ameloblast and odontoblast clusters in advanced stage compared to early stage of development. The absence or only moderate positive reaction of NOS2 was detected in all the different tissues. Positive NOS2 expression showed in advanced stage of tissue development compared to early stage. The action of VEGF and NOS molecules are important mediators of angiogenesis during dental tissue development. VEGF high positive expression in stellate reticulum cells in the early stage of tooth development compared to the later stage and the other cell types, suggests a critical role of the stellate reticulum during dental embryo-morphogenesis.

Finite Element Studies of Solitary Waves in Granular Chains

NASA Astrophysics Data System (ADS)

Musson, Ryan W.

Solitary wave propagation in a monodisperse metallic granular chain was simulated using the finite element method. The model was built to address a discrepancy between numerical and experimental results from Lazaridi and Nesterenko (J. Appl. Mech. Tech. Phys., 26 [3] 405-408 1985). In their work, solitary waves were generated in a chain of particles through impact of a piston, and results were quantified by comparing the chains' reactions to a rigid wall. Their numerical calculations resulted in a solitary wave with a force amplitude of 83 N, while it was measured experimentally to be 71 N. In the present work, the configuration of the granular chain and piston was duplicated from Lazaridi and Nesterenko (J. Appl. Mech. Tech. Phys., 26 [3] 405-408 1985). Qualitatively similar solitary waves were produced, and von Mises stress values indicated that localized plastic deformation is possible, even at low piston impact velocities. These results show that localized plastic deformation was a likely source of dissipation in experiments performed by Lazaridi and Nesterenko. Solitary wave response was investigated in the same metallic granular chain-piston system using LS-DYNA. A power-law hardening material model was used to show that localized plastic deformation is present in the metallic granular chain, even for an impact velocity of 0.5 m/s. This loss due to plastic deformation was quantified via impulse, and it was shown that the loss scales nearly linearly with impact velocity. Therefore, metallic grains may not be suitable for devices that require high amplitude solitary waves. There would be too much energy lost to plastic deformation. The response of an aluminum oxide granular chain was subsequently compared to that of a steel chain because ceramics are inherently elastic. It was shown that solitary waves travel faster and the initial peak is slightly lower when compared to a steel chain. The response of granular chains to impulse loading was investigated as a function of material properties. COMSOL Multiphysics was used to study the effect of density and elastic modulus on a granular chain with fixed Poisson's ratio. Solitary wave velocity and amplitude increased with elastic modulus. Increasing density caused a decrease in wave velocity and an increase in amplitude. In addition, higher density granular chains exhibited a decrease in the number of solitary waves in their respective solitary wave trains. LS-DYNA was then used to explore the response of a variety of ceramic and metallic granular chains. Density, elastic modulus, and Poisson's ratio were all set to representative values for the respective material. It was shown that solitary wave development and decay occur at different rates for different materials. In addition, the kinetic energy decay of the impactor was slower for glass compared with tungsten. Finally, it was shown that a single solitary wave with no train could be produced by impacting a high density, high modulus chain such as tungsten with a glass piston, which has relatively low density and elastic modulus. Increasing impact velocity for this case resulted in a single high-amplitude solitary wave with no train.

Contribution to an effective design method for stationary reaction-diffusion patterns.

PubMed

Szalai, István; Horváth, Judit; De Kepper, Patrick

2015-06-01

The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

Free radical reaction characteristics of coal low-temperature oxidation and its inhibition method.

PubMed

Li, Zenghua; Kong, Biao; Wei, Aizhu; Yang, Yongliang; Zhou, Yinbo; Zhang, Lanzhun

2016-12-01

Study on the mechanism of coal spontaneous combustion is significant for controlling fire disasters due to coal spontaneous combustion. The free radical reactions can explain the chemical process of coal at low-temperature oxidation. Electron spin resonance (ESR) spectroscopy was used to measure the change rules of the different sorts and different granularity of coal directly; ESR spectroscopy chart of free radicals following the changes of temperatures was compared by the coal samples applying air and blowing nitrogen, original coal samples, dry coal samples, and demineralized coal samples. The fragmentation process was the key factor of producing and initiating free radical reactions. Oxygen, moisture, and mineral accelerated the free radical reactions. Combination of the free radical reaction mechanism, the mechanical fragmentation leaded to the elevated CO concentration, fracturing of coal pillar was more prone to spontaneous combustion, and spontaneous combustion in goaf accounted for a large proportion of the fire in the mine were explained. The method of added diphenylamine can inhibit the self-oxidation of coal effectively, the action mechanism of diphenylamine was analyzed by free radical chain reaction, and this research can offer new method for the development of new flame retardant.

ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

PubMed Central

Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-01-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

Electrically detected displacement assay (EDDA): a practical approach to nucleic acid testing in clinical or medical diagnosis.

PubMed

Liepold, P; Kratzmüller, T; Persike, N; Bandilla, M; Hinz, M; Wieder, H; Hillebrandt, H; Ferrer, E; Hartwich, G

2008-07-01

This paper introduces the electrically detected displacement assay (EDDA), a electrical biosensor detection principle for applications in medical and clinical diagnosis, and compares the method to currently available microarray technologies in this field. The sensor can be integrated into automated systems of routine diagnosis, but may also be used as a sensor that is directly applied to the polymerase chain reaction (PCR) reaction vessel to detect unlabeled target amplicons within a few minutes. Major aspects of sensor assembly like immobilization procedure, accessibility of the capture probes, and prevention from nonspecific target adsorption, that are a prerequisite for a robust and reliable performance of the sensor, are demonstrated. Additionally, exemplary results from a human papillomavirus assay are presented.

Comprehensive analysis of immune, extracellular matrices and pathogens profile in lung granulomatosis of unexplained etiology.

PubMed

da Costa Souza, Paola; Dondo, Patrícia Suemi; Souza, Gabriela; Lopes, Deborah; Moscardi, Marcel; de Miranda Martinho, Vinicius; de Mattos Lourenço, Rodolfo Daniel; Prieto, Tabatha; Balancin, Marcelo Luiz; Assato, Aline Kawassaki; Teodoro, Walcy Rosolia; Rodrigues, Silvia; Lima, Mariana; Castellano, Maria Vera; Coletta, Ester; Parra, Edwin Roger; Capelozzi, Vera Luiza

2018-05-01

This study analyzed the type 1 and type 2T helper (Th1/Th2) cytokines (including interleukins), immune cellular, matrix profile, and pathogens in granulomas with unexplained etiology compared to those with infectious and noninfectious etiology. Surgical lung biopsies from 108 patients were retrospectively reviewed. Histochemistry, immunohistochemistry, immunofluorescence, morphometry and polymerase chain reaction were used, respectively, to evaluate total collagen and elastin fibers, collagen I and III, immune cells, cytokines, matrix metalloproteinase-9, myofibroblasts, and multiple usual and unusual pathogens. No relevant polymerase chain reaction expression was found in unexplained granulomas. A significant difference was found between the absolute number of eosinophils, macrophages, and lymphocytes within granulomas compared to uninvolved lung tissue. Granulomas with unexplained etiology (UEG) presented increased number of eosinophils and high expression of interleukins (ILs) IL-4/IL-5 and transforming growth factor-β. In sarcoidosis, CD4/CD8 cell number was significantly higher within and outside granulomas, respectively; the opposite was detected in hypersensitivity pneumonitis. Again, a significant difference was found between the high number of myofibroblasts and matrix metalloproteinase-9 in UEG, hypersensitivity pneumonitis, and sarcoidosis compared to granulomas of tuberculosis. Granulomas of paracoccidioisis exhibited increased type I collagen and elastic fibers. Th1 immune cellular profile was similar among granulomas with unexplained, infectious, and noninfectious etiology. In contrast, modulation of Th2 and matrix remodeling was associated with more fibroelastogenesis and scarring of lung tissue in UEG compared to infectious and noninfectious. We concluded that IL-4/IL-5 and transforming growth factor-β might be used as surrogate markers of early fibrosis, reducing the need for genotyping, and promise therapeutic target in unexplained granulomas. Copyright © 2018 Elsevier Inc. All rights reserved.

Cytogenic and molecular analyses of 46,XX male syndrome with clinical comparison to other groups with testicular azoospermia of genetic origin.

PubMed

Chiang, Han-Sun; Wu, Yi-No; Wu, Chien-Chih; Hwang, Jiann-Loung

2013-02-01

XX male is a rare sex chromosomal disorder in infertile men. The purpose of this study was to distinguish the clinical and genetic features of the 46,XX male syndrome from other more frequent, testicular-origin azoospermic causes of male infertility. To study 46,XX male syndrome, we compared clinical and endocrinological parameters to other groups with testicular-origin azoospermia, and to an age-matched group of healthy males and females as normal control. Fluorescent in situ hybridization for detection and localization of the sex-determining region of the Y gene (SRY), array-based comparative genomic hybridization screening, and real-time qualitative polymerase chain reaction of FGF9, WT1, NR5A1, and SPRY2 genes were performed in this genetic investigation. Our three patients with 46,XX male syndrome had a much higher follicular-stimulating hormone level, lower body height, lower testosterone level, and ambiguous external genitalia. One of the three patients with 46,XX male syndrome was SRY-negative. A further genetic study, including a comparative genomic hybridization array and real-time polymerase chain reaction, showed a gain of FGF9 copy numbers only in the SRY-negative 46,XX male. The genetic copy number of the FGF9 gene was duplicated in that case compared to the normal female control and was significantly lower than that of the normal male control. No such genomic gain was observed in the case of the two SRY-positive 46,XX males. Similar to clinical manifestations of 46,XX male syndrome, genetic evidence in this study suggests that FGF9 may contribute to sex reversal, but additional confirmation with more cases is still needed. Copyright © 2012. Published by Elsevier B.V.

Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

NASA Astrophysics Data System (ADS)

Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

2016-09-01

Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

Evaluation of coal-related model compounds using a tandem mass spectrometry.

PubMed

Li, Guo-Sheng; Dong, Xueming; Fan, Xing; You, Chun-Yan; Wu, Ge; Zhao, Yun-Peng; Lu, Yao; Wei, Xian-Yong; Ma, Feng-Yun

2018-05-08

Gas chromotography/mass spectrometry (GC/MS) is a routine and basic instrumental method for the analysis of complex coal conversion products in chemical industry. To further enhance practical potentials of GC/MS in chemical industry, a tandem MS method for the selection of ion pair applied in monitoring coal conversions was established by using GC/quadrupole time-of-flight MS (GC/Q-TOF MS). The corresponding fragmentation pathways were explored and suitable ion pairs were screened. Fourteen coal-related model compounds (CRMCs) were analyzed using a GC/Q-TOF MS with different collision induced dissociation (CID) energies (5-20 eV). The fragmentation pathways can offer a better understanding of chemical bond breaking, hydrogen transfer, rearrangement reactions and elimination of neutral fragments for CRMCs during the CID process. The precursor ions of aromatic hydrocarbons without alkyl chain were hard to fragment with a CID energy of 20 eV. But aromatic hydrocarbons with branched chains were prone to fragment via the loss of alkyl chains and further fragmented through ring-open reactions. Compared to C alk -C ar bond, C ar -C ar bond was hard to fragment duo to its high bond dissociation energy. The existence of heteroatoms facilitated fragmentation that was conducive to screening ion pair. The CID technique of GC/Q-TOF MS will contribute to the studies on the organic composition of coals and building monitoring methods for coal conversions via fragmentation and ion pair selection. This article is protected by copyright. All rights reserved.

Sieving polymer synthesis by reversible addition fragmentation chain transfer polymerization.

PubMed

Nai, Yi Heng; Jones, Roderick C; Breadmore, Michael C

2013-12-01

Replaceable sieving polymers are the fundamental component for high resolution nucleic acids separation in CE. The choice of polymer and its physical properties play significant roles in influencing separation performance. Recently, reversible addition fragmentation chain transfer (RAFT) polymerization has been shown to be a versatile polymerization technique capable of yielding well defined polymers previously unattainable by conventional free radical polymerization. In this study, a high molecular weight PDMA at 765 000 gmol-1 with a PDI of 1.55 was successfully synthesized with the use of chain transfer agent - 2-propionic acidyl butyl trithiocarbonate (PABTC) in a multi-step sequential RAFT polymerization approach. This study represents the first demonstration of RAFT polymerization for synthesizing polymers with the molecular weight range suitable for high resolution DNA separation in sieving electrophoresis. Adjustment of pH in the reaction was found to be crucial for the successful RAFT polymerization of high molecular weight polymer as the buffered condition minimizes the effect of hydrolysis and aminolysis commonly associated with trithiocarbonate chain transfer agents. The separation efficiency of PABTC-PDMA was found to have marginally superior separation performance compared to a commercial PDMA formulation, POP™-CAP, of similar molecular weight range.

Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

PubMed

Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

2008-01-01

In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera. © 2007 Blackwell Publishing Ltd No claim to original US government works.

IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

PubMed

Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

1999-09-01

Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

Expression of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) in bladder transitional cell carcinoma.

PubMed

Ham, Won Sik; Lee, Joo Hyoung; Yu, Ho Song; Choi, Young Deuk

2008-10-01

An analysis of differentially expressed genes (DEGs) between bladder transitional cell carcinoma (TCC) and the surrounding urothelium to help identify what lies behind the mechanism of multifocal tumor development has not yet been performed. We sought to find a new DEG related to the development of bladder TCC. Thirty-nine bladder TCC tissues paired with normal-appearing urothelium tissues obtained from the same patient were used as subjects. Initially, we compared the messenger RNA (mRNA) profiles between normal-appearing urothelium and TCC tissue of 1 patient by using annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) and selective amplification of family members (SAFM) PCR to identify potential DEGs. To validate the results of the ACP data, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on those of all 39 patients. Among the several DEGs discovered in the ACP data, 1 DEG was chosen as the candidate for the RT-PCR, that is present or markedly upregulated in normal-appearing urothelial tissue compared with TCC tissue. Gene sequence searching revealed that this DEG is chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI). Downregulation of COUP-TFI mRNA expression in TCC tissue compared to normal-appearing urothelium tissue of the same patient, irrespective of tumor stage and grade, was confirmed by RT-PCR in 39 patients. Our results suggest that the loss of COUP-TFI may play a role in the transition from normal epithelium to TCC. Further characterization of the COUP-TFI gene is expected to give us informations about bladder TCC tumorigenesis.

Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

PubMed Central

Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

2012-01-01

Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

PubMed

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Using urinary leucocyte esterase tests as an indicator of infection with gonorrhoea or chlamydia in asymptomatic males in a primary health care setting.

PubMed

Rahman, Md Saifur; Beever, Warwick; Skov, Steven; Boffa, John

2014-02-01

To evaluate a leucocyte esterase test as a predictor of gonorrhoea or chlamydia in asymptomatic Aboriginal males at the Central Australian Aboriginal Congress Male Clinic (Ingkintja), first-void urine samples and clinical information were collected from consecutive asymptomatic males presenting to the Ingkintja in Alice Springs between March 2008 and December 2009. Urine was tested immediately with a leucocyte esterase test dipstick and then by polymerase chain reaction for gonorrhoea and chlamydia. Among the 292 specimens from asymptomatic males, 15.4% were positive for gonorrhoea or chlamydia. In this group, compared with polymerase chain reaction result for gonorrhoea or chlamydia, leucocyte esterase test alone and in combination with age ≤35 years showed sensitivities of 66.7% and 60%, specificities of 90.7% and 94.7%, positive predictive values of 56.6% and 67.5%, negative predictive values of 93.7% and 92.8% and the area under receiver operating characteristics curve values of 0.79 and 0.85, respectively. Leucocyte esterase tests can reasonably be used as a basis for immediate empirical treatment for gonorrhoea or chlamydia in asymptomatic central Australian Aboriginal men under 35 years of age.

Quantitative polymerase chain reaction for transforming growth factor-β applied to a field study of fish health in Chesapeake Bay tributaries

USGS Publications Warehouse

Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.

2000-01-01

Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.

[Comparative cost analysis of molecular biology methods in the diagnosis of sarcomas].

PubMed

Baffert, Sandrine; Italiano, Antoine; Pierron, Gaëlle; Traoré, Marie-Angèle; Rapp, Jocelyn; Escande, Fabienne; Ghnassia, Jean-Pierre; Terrier, Philippe; Voegeli, Anne-Claire; Ranchere-Vince, Dominique; Coindre, Jean-Michel; Pedeutour, Florence

2013-10-01

Sarcomas represent a complex and heterogeneous group of rare malignant tumors and their correct diagnosis is often difficult. Recent molecular biological techniques have been of great diagnostic use and there is a need to assess the cost of these procedures in routine clinical practice. Using prospective and observational data from eight molecular biology laboratories in France, we used "microcosting" method to assess the cost of molecular biological techniques in the diagnosis of five types of sarcoma. The mean cost of fluorescence in situ hybridization (FISH) was 318 € (273-393) per sample; mean reverse transcription polymerase chain reaction (RT-PCR) cost ranged from 300 € (229-481) per formalin-fixed, paraffin-embedded specimen to 258 € (213-339) per frozen specimen; mean quantitative polymerase chain reaction (Q-PCR) cost was 184 € (112-229) and mean CGH-array cost was 332 € (329-335). The cost of these recently implemented techniques varied according to the type of sarcoma; the method of tissue collection and local organizational factors including the level of local expertise and investment. The cost of molecular diagnostic techniques needs to be balanced against their respective performance.

Effect of thermal modification on rheological properties of polyethylene blends

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siriprumpoonthum, Monchai; Nobukawa, Shogo; Yamaguchi, Masayuki, E-mail: m-yama@jaist.ac.jp

2014-03-15

We examined the effects of thermal modification under flow field on the rheological properties of linear low-density polyethylene (LLDPE) with high molecular weight, low-density polyethylene (LDPE), and their blends, without thermal stabilizer. Although structural changes during processing are not detected by size extrusion chromatography or nuclear magnetic resonance spectroscopy, linear viscoelastic properties changed greatly, especially for the LLDPE. A cross-linking reaction took place, leading to, presumably, star-shaped long-chain branches. Consequently, the modified LLDPE, having high zero-shear viscosity, became a thermorheologically complex melt. Moreover, it should be noted that the drawdown force, defined as the uniaxial elongational force at a constantmore » draw ratio, was significantly enhanced for the blends. Enhancement of elongational viscosity was also detected. The drawdown force and elongational viscosity are marked for the thermally modified blend as compared with those for the blend of thermally modified pure components. Intermolecular cross-linking reactions between LDPE and LLDPE, yielding polymers with more than two branch points per chain, result in marked strain-hardening in the elongational viscosity behavior even at small strain. The recovery curve of the oscillatory modulus after the shear modification is further evidence of a branched structure.« less

Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

PubMed Central

2005-01-01

Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

PubMed Central

Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

2015-01-01

The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

Astrophysical S-factor of the 32He(α,γ) 733 7Be reaction in the Big-Bang nucleosynthesis

NASA Astrophysics Data System (ADS)

Ghamary, Motahareh; Sadeghi, Hossein; Mohammadi, Saeed

2018-05-01

In the present work, we have studied the properties of the 23He(α , γ) 47Be reaction. The direct radiative capture nuclear reactions in the Big-Bang nucleosynthesis mainly, are done in the external areas of inter-nuclear interaction range and play an essential role in nuclear astrophysics. Among of these reactions, the 23He(α , γ) 47Be reaction with Q = 1.586 MeV is the main part of the Big-Bang nucleosynthesis chain reactions. This reaction can be used to understand the physical and chemical properties of the sun as well as can be justified the lake of the observed solar neutrino in the detector of the Earth. Since product neutrino fluxes are predicated in the center of the sun by the decay of 7Be and 8B, and almost are proportional to the astrophysical S-factor for the 23He(α , γ) 47Be reaction, S34. The 23He(α , γ) 47Be reaction is considered the key to solve the solar neutrino puzzle. Finally, we have astrophysical S-factor obtained for the ground S1,3/2-, first excited S1,1/2-and total S34 states by modern nucleon-nucleon two-body local potential models. We have also compared the obtained S-factor with experimental data and other theoretical works.

Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

PubMed

Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

2006-05-01

Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

NASA Astrophysics Data System (ADS)

Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

1990-05-01

There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

The reaction of C5N- with acetylene as a possible intermediate step to produce large anions in Titan's ionosphere.

PubMed

Lindén, Carl Fredrik; Žabka, Ján; Polášek, Miroslav; Zymak, Illia; Geppert, Wolf D

2018-02-21

A theoretical and experimental investigation of the reaction C 5 N - + C 2 H 2 has been carried out. This reaction is of astrophysical interest since the growth mechanism of large anions that have been detected in Titan's upper atmosphere by the Cassini plasma spectrometer are still largely unknown. The experimental studies have been performed using a tandem quadrupole mass spectrometer which allows identification of the different reaction channels and assessment of their reaction thresholds. Results of these investigations were compared with the predictions of ab initio calculations, which identified possible pathways leading to the observed products and their thermodynamical properties. These computations yielded that the majority of these products are only accessible via energy barriers situated more than 1 eV above the reactant energies. In many cases, the thresholds predicted by the ab initio calculations are in good agreement with the experimentally observed ones. For example, the chain elongation reaction leading to C 7 N - , although being slightly exoergic, possesses an energy barrier of 1.91 eV. Therefore, the title reaction can be regarded to be somewhat unlikely to be responsible for the formation of large anions in cold environments such as interstellar medium or planetary ionospheres.

Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

PubMed

Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

2016-08-08

Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

USDA-ARS?s Scientific Manuscript database

Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

NASA Astrophysics Data System (ADS)

Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

2017-06-01

A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

Hydrolysis of the amorphous cellulose in cotton-based paper.

PubMed

Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

2008-04-01

Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

PubMed

Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

2002-02-28

The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

Copolymer Synthesis and Characterization by Post-Polymerization Modification

NASA Astrophysics Data System (ADS)

Galvin, Casey James

This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1995-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1996-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1974-01-01

Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.

RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schramm, V.L.

1996-05-01

The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

PubMed

Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-08-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

NASA Astrophysics Data System (ADS)

Oshanin, G.; Burlatsky, S. F.

2002-11-01

We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

PubMed

Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

2018-04-17

A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

Antioxidant pool in beer and kinetics of EPR spin-trapping.

PubMed

Kocherginsky, Nikolai M; Kostetski, Yuri Yu; Smirnov, Alex I

2005-08-24

The kinetics of spin-trap adduct formation in beer oxidation exhibits an induction period if the reaction is carried out at elevated temperatures and in the presence of air. This lag period lasts until the endogenous antioxidants are almost completely depleted, and its duration is used as an indicator of the flavor stability and shelf life of beer. This paper demonstrates that the total kinetics of the process can be characterized by three parameters-the lag period, the rate of spin-trap adduct formation, and, finally, the steady-state spin-adduct concentration. A steady-state chain reaction mechanism is described, and quantitative estimates of the main kinetic parameters such as the initiation rate, antioxidant pool, effective content of organic molecules participating in the chain reactions, and the rate constant of the 1-hydroxyethyl radical EtOH(*) spin-adduct disappearance are given. An additional new dimensionless parameter is suggested to characterize the antioxidant pool-the product of the lag time and the rate of spin-trap radical formation immediately after the lag time, normalized by the steady-state concentration of the adducts. The results of spin-tapping EPR experiments are compared with the nitroxide reduction kinetics measured in the same beer samples. It is shown that although the kinetics of nitroxide reduction in beer can be used to evaluate the reducing power of beer, the latter parameter does not correlate with the antioxidant pool. The relationship of free radical processes, antioxidant pool, reducing power, and beer staling is discussed.

Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

PubMed Central

Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

2016-01-01

Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586

Development and validation of a multiplex quantitative polymerase chain reaction assay for the detection of Mollicutes impurities in human cells, cultured under good manufacturing practice conditions, and following European Pharmacopoeia requirements and the International Conference on Harmonization guidelines.

PubMed

Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto

2012-07-01

The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.

Towards Sustainable H2 Production: Rational Design of Hydrophobic Triphenylamine-based Dyes for Sensitized Ethanol Photoreforming.

PubMed

Dessì, Alessio; Monai, Matteo; Bessi, Matteo; Montini, Tiziano; Calamante, Massimo; Mordini, Alessandro; Reginato, Gianna; Trono, Cosimo; Fornasiero, Paolo; Zani, Lorenzo

2018-02-22

Donor-acceptor dyes are a well-established class of photosensitizers, used to enhance visible-light harvesting in solar cells and in direct photocatalytic reactions, such as H 2 production by photoreforming of sacrificial electron donors (SEDs). Amines-typically triethanolamine (TEOA)-are commonly employed as SEDs in such reactions. Dye-sensitized photoreforming of more sustainable, biomass-derived alcohols, on the other hand, was only recently reported by using methanol as the electron donor. In this work, several rationally designed donor-acceptor dyes were used as sensitizers in H 2 photocatalytic production, comparing the efficiency of TEOA and EtOH as SEDs. In particular, the effect of hydrophobic chains in the spacer and/or the donor unit of the dyes was systematically studied. The H 2 production rates were higher when TEOA was used as SED, whereas the activity trends depended on the SED used. The best performance was obtained with TEOA by using a sensitizer with just one bulky hydrophobic moiety, propylenedioxythiophene, placed on the spacer unit. In the case of EtOH, the best-performing sensitizers were the ones featuring a thiazolo[5,4-d]thiazole internal unit, needed for enhancing light harvesting, and carrying alkyl chains on both the donor part and the spacer unit. The results are discussed in terms of reaction mechanism, interaction with the SED, and structural/electrochemical properties of the sensitizers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Circulating polymerase chain reaction chips utilizing multiple-membrane activation

NASA Astrophysics Data System (ADS)

Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

2007-02-01

This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

Quantum Mechanics and Molecular Mechanics Study of the Catalytic Mechanism of Human AMSH-LP Domain Deubiquitinating Enzymes.

PubMed

Zhu, Wenyou; Liu, Yongjun; Ling, Baoping

2015-08-25

Deubiquitinating enzymes (DUBs) catalyze the cleavage of the isopeptide bond in polyubiquitin chains to control and regulate the deubiquitination process in all known eukaryotic cells. The human AMSH-LP DUB domain specifically cleaves the isopeptide bonds in the Lys63-linked polyubiquitin chains. In this article, the catalytic mechanism of AMSH-LP has been studied using a combined quantum mechanics and molecular mechanics method. Two possible hydrolysis processes (Path 1 and Path 2) have been considered. Our calculation results reveal that the activation of Zn(2+)-coordinated water molecule is the essential step for the hydrolysis of isopeptide bond. In Path 1, the generated hydroxyl first attacks the carbonyl group of Gly76, and then the amino group of Lys63 is protonated, which is calculated to be the rate limiting step with an energy barrier of 13.1 kcal/mol. The energy barrier of the rate limiting step and the structures of intermediate and product are in agreement with the experimental results. In Path 2, the protonation of amino group of Lys63 is prior to the nucleophilic attack of activated hydroxyl. The two proton transfer processes in Path 2 correspond to comparable overall barriers (33.4 and 36.1 kcal/mol), which are very high for an enzymatic reaction. Thus, Path 2 can be ruled out. During the reaction, Glu292 acts as a proton transfer mediator, and Ser357 mainly plays a role in stabilizing the negative charge of Gly76. Besides acting as a Lewis acid, Zn(2+) also influences the reaction by coordinating to the reaction substrates (W1 and Gly76).

Oligomerization of uridine phosphorimidazolides on montmorillonite: a model for the prebiotic synthesis of RNA on minerals

NASA Technical Reports Server (NTRS)

Ding, P. Z.; Kawamura, K.; Ferris, J. P.

1996-01-01

The 5'-phosphorimidazolide of uridine reacts on Na(+)-montmorillonite 22A in aqueous solution to give oligomers as long as 7 mers. The maximum chain length increases to 9 mers and the overall oligomer yield increases when 9:1 ImpU, A5' ppA mixtures react under the same conditions. The oligomer yield and maximum chain length decreases with the structure of the added pyrophosphate in the order A5' ppA > A5' ppU > U5' ppU. Structure analysis of individual oligomer fractions was performed by selective enzymatic hydrolyses followed by HPLC analysis of the products. The regioselectivity for 3',5'-bond formation is 80-90% in the 9:1 ImpU, A5' ppA reaction, a percentage comparable to that observed in the 9:1 ImpA, A5' ppA reaction. Oligomerization of ImpU is inhibited by addition of dA5' ppdA, and MeppA. No oligomers containing A5' ppU were products of the 9:1 ImpU,A5' ppA reaction, a finding consistent with the simple addition of the ImpU to the A5' ppA and not the rearrangement of an ImpU-A5' ppA adduct. Concentrations of lysine or arginine which were close to that of the ImpU did not inhibit oligomer formation. Treatment of Na(+)-montmorillonite with 1 M arginine yielded arginine-montmorillonite, an amino acid-mineral adduct which did not catalyze ImpU oligomerization. Neither the 4-9 mers formed in the 9:1 ImpU, A5' ppA reaction nor the 4-9 mers formed by the base hydrolysis of poly(U) served as templates for the formation of oligo(A)s.

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

PubMed

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Thermally multiplexed polymerase chain reaction.

PubMed

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Persistence, population dynamics and competitiveness for nodulation of marker gene-tagged Rhizobium galegae strains in field lysimeters in the boreal climatic zone.

PubMed

Pitkäjärvi, Jyrki; Räsänen, Leena A; Langenskiöld, Jenny; Wallenius, Kaisa; Niemi, Maarit; Lindström, Kristina

2003-10-01

Abstract A non-indigenous wild-type strain Rhizobium galegae HAMBI 540, which specifically nodulates perennial goat's rue (Galega orientalis), and its marker gene-tagged derivatives R. galegae HAMBI 2363(luc), R. galegae HAMBI 2368(gusA21) and R. galegae HAMBI 2364(gusA30) were used to evaluate the persistence, population dynamics and competitiveness for nodulation of rhizobia under field conditions in Finland. The lysimeters were filled with clean or diesel oil-polluted (3000 mug g(-1)) agricultural soil. During the first 2 years of the field release luc- and gusA21-tagged strains could be effectively detected by cultivation, reinforced with colony polymerase chain reaction. The population densities remained relatively stable from 10(4) to 10(5) cfu g(-1) dry soil from spring until late autumn. Replicate limiting dilution polymerase chain reaction analysis gave comparable results with cultivation with strain HAMBI 2363 until 49 weeks after inoculation. GUS activity of strain HAMBI 2368 could be stably detected in nodules and soil. On the other hand, luc activity weakened clearly in cold conditions along with decreased metabolic activity of rhizobia. The competitive ability for nodulation of the gusA30-tagged strain decreased slowly with time compared to the wild-type strain. Moderate soil pollution did not have significant effects on target bacteria or plant growth. Limited vertical movement of target bacteria outside the rhizosphere was detected from percolated water.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Recommendations for Methicillin-Resistant Staphylococcus aureus Prevention in Adult ICUs: A Cost-Effectiveness Analysis.

PubMed

Whittington, Melanie D; Atherly, Adam J; Curtis, Donna J; Lindrooth, Richard C; Bradley, Cathy J; Campbell, Jonathan D

2017-08-01

Patients in the ICU are at the greatest risk of contracting healthcare-associated infections like methicillin-resistant Staphylococcus aureus. This study calculates the cost-effectiveness of methicillin-resistant S aureus prevention strategies and recommends specific strategies based on screening test implementation. A cost-effectiveness analysis using a Markov model from the hospital perspective was conducted to determine if the implementation costs of methicillin-resistant S aureus prevention strategies are justified by associated reductions in methicillin-resistant S aureus infections and improvements in quality-adjusted life years. Univariate and probabilistic sensitivity analyses determined the influence of input variation on the cost-effectiveness. ICU. Hypothetical cohort of adults admitted to the ICU. Three prevention strategies were evaluated, including universal decolonization, targeted decolonization, and screening and isolation. Because prevention strategies have a screening component, the screening test in the model was varied to reflect commonly used screening test categories, including conventional culture, chromogenic agar, and polymerase chain reaction. Universal and targeted decolonization are less costly and more effective than screening and isolation. This is consistent for all screening tests. When compared with targeted decolonization, universal decolonization is cost-saving to cost-effective, with maximum cost savings occurring when a hospital uses more expensive screening tests like polymerase chain reaction. Results were robust to sensitivity analyses. As compared with screening and isolation, the current standard practice in ICUs, targeted decolonization, and universal decolonization are less costly and more effective. This supports updating the standard practice to a decolonization approach.

Detection of nucleophosmin 1 mutations by quantitative real-time polymerase chain reaction versus capillary electrophoresis: a comparative study.

PubMed

Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang

2011-08-01

Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.

Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

PubMed

Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

2009-12-01

The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

Activation of RAS family genes in urothelial carcinoma.

PubMed

Boulalas, I; Zaravinos, A; Karyotis, I; Delakas, D; Spandidos, D A

2009-05-01

Bladder cancer is the fifth most common malignancy in men in Western society. We determined RAS codon 12 and 13 point mutations and evaluated mRNA expression levels in transitional cell carcinoma cases. Samples from 30 human bladder cancers and 30 normal tissues were analyzed by polymerase chain reaction/restriction fragment length polymorphism and direct sequencing to determine the occurrence of mutations in codons 12 and 13 of RAS family genes. Moreover, we used real-time reverse transcriptase-polymerase chain reaction to evaluate the expression profile of RAS genes in bladder cancer specimens compared to that in adjacent normal tissues. Overall H-RAS mutations in codon 12 were observed in 9 tumor samples (30%). Two of the 9 patients (22%) had invasive bladder cancer and 7 (77%) had noninvasive bladder cancer. One H-RAS mutation (11%) was homozygous and the remaining 89% were heterozygous. All samples were WT for K and N-RAS oncogenes. Moreover, 23 of 30 samples (77%) showed over expression in at least 1 RAS family gene compared to adjacent normal tissue. K and N-RAS had the highest levels of over expression in bladder cancer specimens (50%), whereas 27% of transitional cell carcinomas demonstrated H-RAS over expression relative to paired normal tissues. Our results underline the importance of H-RAS activation in human bladder cancer by codon 12 mutations. Moreover, they provide evidence that increased expression of all 3 RAS genes is a common event in bladder cancer that is associated with disease development.

Comparative investigation of two methods for Acetylcholinesterase enzyme immobilization on modified porous silicon

NASA Astrophysics Data System (ADS)

Khaldi, Khadidja; Sam, Sabrina; Lounas, Amel; Yaddaden, Chafiaa; Gabouze, Noure-Eddine

2017-11-01

In this work, Acetylcholinesterase enzyme (AChE) was immobilized on porous silicon (PSi) surface using two strategies. In the first method, acid chains were covalently grafted on the hydrogenated PSi by hydrosilylation reaction. The obtained acid-terminated surface was activated by a reaction with N-hydroxysuccinimide (NHS) in the presence of a peptide-coupling agent N-ethyl-N‧-(3-dimethylaminopropyl)-carbodiimide (EDC), and then reacted with the amino linker of the lysine residues AChE to anchor the enzyme by a covalent amide bond. In the second procedure, the PSi surface was first hydroxylated in piranha solution, followed by a silanization reaction with 3-aminopropyltriethoxysilane (APTES) to form amine-terminated surface. Finally, AChE was attached to the terminal amine groups by an aminolysis reaction with carboxylic acid groups of AChE in the presence of NHS/EDC mixture. Fourier transform infrared spectroscopy (FTIR) confirmed the efficiency of the surface modifications. The enzymatic activity of immobilized AChE was determined by means of a colorimetric test and was discussed according to the enzyme orientation on the surface which was revealed by contact angle measurements.

64Cu-DOTATATE PET/MRI for Detection of Activated Macrophages in Carotid Atherosclerotic Plaques: Studies in Patients Undergoing Endarterectomy.

PubMed

Pedersen, Sune Folke; Sandholt, Benjamin Vikjær; Keller, Sune Høgild; Hansen, Adam Espe; Clemmensen, Andreas Ettrup; Sillesen, Henrik; Højgaard, Liselotte; Ripa, Rasmus Sejersten; Kjær, Andreas

2015-07-01

A feature of vulnerable atherosclerotic plaques of the carotid artery is high activity and abundance of lesion macrophages. There is consensus that this is of importance for plaque vulnerability, which may lead to clinical events, such as stroke and transient ischemic attack. We used positron emission tomography (PET) and the novel PET ligand [(64)Cu] [1,4,7,10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid]-d-Phe1,Tyr3-octreotate ((64)Cu-DOTATATE) to specifically target macrophages via the somatostatin receptor subtype-2 in vivo. Ten patients underwent simultaneous PET/MRI to measure (64)Cu-DOTATATE uptake in carotid artery plaques before carotid endarterectomy. (64)Cu-DOTATATE uptake was significantly higher in symptomatic plaque versus the contralateral carotid artery (P<0.001). Subsequently, a total of 62 plaque segments were assessed for gene expression of selected markers of plaque vulnerability using real-time quantitative polymerase chain reaction. These results were compared with in vivo (64)Cu-DOTATATE uptake calculated as the mean standardized uptake value. Univariate analysis of real-time quantitative polymerase chain reaction and PET showed that cluster of differentiation 163 (CD163) and CD68 gene expression correlated significantly but weakly with mean standardized uptake value in scans performed 85 minutes post injection (P<0.001 and P=0.015, respectively). Subsequent multivariate analysis showed that CD163 correlated independently with (64)Cu-DOTATATE uptake (P=0.031) whereas CD68 did not contribute significantly to the final model. The novel PET tracer (64)Cu-DOTATATE accumulates in atherosclerotic plaques of the carotid artery. CD163 gene expression correlated independently with (64)Cu-DOTATATE uptake measured by real-time quantitative polymerase chain reaction in the final multivariate model, indicating that (64)Cu-DOTATATE PET is detecting alternatively activated macrophages. This association could potentially improve noninvasive identification and characterization of vulnerable plaques. © 2015 The Authors.

Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

PubMed

Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

2012-11-01

A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

Development of a dry-reagent mix-based polymerase chain reaction as a novel tool for the identification of Acinetobacter species and its comparison with conventional polymerase chain reaction

PubMed Central

Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama

2018-01-01

BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209

Surface-enhanced localized surface plasmon resonance biosensing of avian influenza DNA hybridization using subwavelength metallic nanoarrays

NASA Astrophysics Data System (ADS)

Kim, Shin Ae; Byun, Kyung Min; Kim, Kyujung; Jang, Sung Min; Ma, Kyungjae; Oh, Youngjin; Kim, Donghyun; Kim, Sung Guk; Shuler, Michael L.; Kim, Sung June

2010-09-01

We demonstrated enhanced localized surface plasmon resonance (SPR) biosensing based on subwavelength gold nanoarrays built on a thin gold film. Arrays of nanogratings (1D) and nanoholes (2D) with a period of 200 nm were fabricated by electron-beam lithography and used for the detection of avian influenza DNA hybridization. Experimental results showed that both nanoarrays provided significant sensitivity improvement and, especially, 1D nanogratings exhibited higher SPR signal amplification compared with 2D nanohole arrays. The sensitivity enhancement is associated with changes in surface-limited reaction area and strong interactions between bound molecules and localized plasmon fields. Our approach is expected to improve both the sensitivity and sensing resolution and can be applicable to label-free detection of DNA without amplification by polymerase chain reaction.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Selected spectroscopic results on element 115 decay chains

DOE PAGES

Rudolph, D.; Forsberg, U.; Golubev, P.; ...

2014-08-24

We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Peroxy radical measurements with NCAR's chemical amplifier

NASA Technical Reports Server (NTRS)

Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

1994-01-01

The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

PubMed

Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

1995-01-01

Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

The effect of artichoke (Cynara scolymus L.) extract on respiratory chain system activity in rat liver mitochondria.

PubMed

Juzyszyn, Z; Czerny, B; Myśliwiec, Z; Pawlik, A; Droździk, M

2010-06-01

The effect of artichoke extract on mitochondrial respiratory chain (MRC) activity in isolated rat liver mitochondria (including reaction kinetics) was studied. The effect of the extract on the activity of isolated cytochrome oxidase was also studied. Extract in the range of 0.68-2.72 microg/ml demonstrated potent and concentration-dependent inhibitory activity. Concentrations > or =5.4 microg/ml entirely inhibited MRC activity. The succinate oxidase system (MRC complexes II-IV) was the most potently inhibited, its activity at an extract concentration of 1.36 microg/ml being reduced by 63.3% compared with the control (p < 0.05). The results suggest a complex inhibitory mechanism of the extract. Inhibition of the succinate oxidase system was competitive (K(i) = 0.23 microg/ml), whereas isolated cytochrome oxidase was inhibited noncompetitively (K(i) = 126 microg/ml). The results of this study suggest that the salubrious effects of artichoke extracts may rely in part on the effects of their active compounds on the activity of the mitochondrial respiratory chain system.

Study on the pyrolysis of cellulose for bio-oil with mesoporous molecular sieve catalysts.

PubMed

Yu, Feng-wen; Ji, Deng-xiang; Nie, Yong; Luo, Yao; Huang, Cheng-jie; Ji, Jian-bing

2012-09-01

Mesoporous materials possess a hexagonal array of uniform mesopores, high surface areas, and moderate acidity. They are one of the important catalysts in the field of catalytic pyrolysis. In this paper, mesoporous materials of Al-MCM-41, La-Al-MCM-41, and Ce-Al-MCM-41 were synthesized, characterized, and tested as catalysts in the cellulose catalytic pyrolysis process using a fixed bed pyrolysis reactor. The results showed that mesoporous materials exhibited a strong influence on the pyrolytic behavior of cellulose. The presence of these mesoporous molecular sieve catalysts could vary the yield of products, which was that they could decrease the yield of liquid and char and increase the yield of gas product, and could promote high-carbon chain compounds to break into low-carbon chain compounds. Mesoporous molecular sieve catalysts were benefit to the reaction of dehydrogenation and deoxidation and the breakdown of carbon chain. Further, La-Al-MCM-41 and Ce-Al-MCM-41 catalysts can produce more toluene and 2-methoxy-phenol, as compared to the non-catalytic runs.

Novel odd/even effect of alkylene chain length on the photopolymerizability of organogelators.

PubMed

Aoki, Ken'ichi; Kudo, Masabumi; Tamaoki, Nobuyuki

2004-10-28

[reaction: see text] Starting from diactylene diacarboxylic acids, we have synthesized a series of photopolymerizable organogelators that possess simple amide structures, different alkylene chain lengths, and either optically active or racemic 3,7-dimethyl-1-octylamine units. The alkylene chain length of these compounds exhibits a prominent odd/even effect with respect to the photopolymerization in the gel state and is accompanied by a stereostructural effect on the gelation ability.

Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

2011-04-01

Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

Multi angle laser light scattering evaluation of field exposed thermoplastic photovoltaic encapsulant materials

DOE PAGES

Kempe, Michael D.; Miller, David C.; Wohlgemuth, John H.; ...

2016-01-08

As creep of polymeric materials is potentially a safety concern for photovoltaic modules, the potential for module creep has become a significant topic of discussion in the development of IEC 61730 and IEC 61215. To investigate the possibility of creep, modules were constructed, using several thermoplastic encapsulant materials, into thin-film mock modules and deployed in Mesa, Arizona. The materials examined included poly(ethylene)-co-vinyl acetate (EVA, including formulations both cross-linked and with no curing agent), polyethylene/polyoctene copolymer (PO), poly(dimethylsiloxane) (PDMS), polyvinyl butyral (PVB), and thermoplastic polyurethane (TPU). The absence of creep in this experiment is attributable to several factors of which themore » most notable one was the unexpected cross-linking of an EVA formulation without a cross-linking agent. It was also found that some materials experienced both chain scission and cross-linking reactions, sometimes with a significant dependence on location within a module. The TPU and EVA samples were found to degrade with cross-linking reactions dominating over chain scission. In contrast, the PO materials degraded with chain scission dominating over cross-linking reactions. Furthermore, we found no significant indications that viscous creep is likely to occur in fielded modules capable of passing the qualification tests, we note that one should consider how a polymer degrades, chain scission or cross-linking, in assessing the suitability of a thermoplastic polymer in terrestrial photovoltaic applications.« less

Shock tube measurements of specific reaction rates in branched chain CH4-CO-O2 system

NASA Technical Reports Server (NTRS)

Brabbs, T. A.; Brokaw, R. S.

1974-01-01

Rate constants of two elementary bimolecular reactions involved in the oxidation of methane were determined by monitoring the exponential growth of CO flame band emission behind incident shocks in three suitably chosen gas mixtures.

DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

NASA Astrophysics Data System (ADS)

Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

2017-06-01

The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

Structural modulation of silver complexes and their distinctive catalytic properties.

PubMed

Zhao, Yue; Chen, Kai; Fan, Jian; Okamura, Taka-aki; Lu, Yi; Luo, Li; Sun, Wei-Yin

2014-02-07

A family of silver(I) complexes, [Ag2(L)2(OOCCF3)2] (1), [Ag(L)0.5(OOCCF3)] (2), [Ag(L)2](OOCCF3)(H2O)2 (3), was obtained by reactions of 4,4'-di(2-oxazolinyl)biphenyl (L) and AgOOCCF3 in different reaction media. Compound 1 has a 1D chain structure with alternative connections between the Ag(I) and L ligand. When the crystal nucleation inductor, pyrazine, was added into the reaction system, complex 2 was isolated with no pyrazine observed in its structure. In 2, the 1D inorganic chains formed by Ag(I) cations and OOCCF3(-) anions were connected by the L ligand to produce a 2D network. When a different inductor, imidazole, was added into the reaction system, 3 with (4,4) topology was synthesized, and again no imidazole was found in 3. When 1-3 were used as catalysts for cycloaddition reactions between imino esters and methyl acrylate, 3 affords the highest yield, in which the particular size of the channels in 3 led to its selective catalytic performance.

New potentially active pyrazinamide derivatives synthesized under microwave conditions.

PubMed

Jandourek, Ondrej; Dolezal, Martin; Kunes, Jiri; Kubicek, Vladimir; Paterova, Pavla; Pesko, Matus; Buchta, Vladimir; Kralova, Katarina; Zitko, Jan

2014-07-03

A series of 18 N-alkyl substituted 3-aminopyrazine-2-carboxamides was prepared in this work according to previously experimentally set and proven conditions using microwave assisted synthesis methodology. This approach for the aminodehalogenation reaction was chosen due to higher yields and shorter reaction times compared to organic reactions with conventional heating. Antimycobacterial, antibacterial, antifungal and photosynthetic electron transport (PET) inhibiting in vitro activities of these compounds were investigated. Experiments for the determination of lipophilicity were also performed. Only a small number of substances with alicyclic side chain showed activity against fungi which was the same or higher than standards and the biological efficacy of the compounds increased with rising lipophilicity. Nine pyrazinamide derivatives also inhibited PET in spinach chloroplasts and the IC50 values of these compounds varied in the range from 14.3 to 1590.0 μmol/L. The inhibitory activity was connected not only with the lipophilicity, but also with the presence of secondary amine fragment bounded to the pyrazine ring. Structure-activity relationships are discussed as well.

Exponential isothermal amplification of nucleic acids and amplified assays for proteins, cells, and enzyme activities.

PubMed

Reid, Michael S; Le, X Chris; Zhang, Hongquan

2018-04-27

Isothermal exponential amplification techniques, such as strand-displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), helicase-dependent amplification (HDA), and recombinase polymerase amplification (RPA), have great potential for on-site, point-of-care, and in-situ assay applications. These amplification techniques eliminate the need for temperature cycling required for polymerase chain reaction (PCR) while achieving comparable amplification yield. We highlight here recent advances in exponential amplification reaction (EXPAR) for the detection of nucleic acids, proteins, enzyme activities, cells, and metal ions. We discuss design strategies, enzyme reactions, detection techniques, and key features. Incorporation of fluorescence, colorimetric, chemiluminescence, Raman, and electrochemical approaches enables highly sensitive detection of a variety of targets. Remaining issues, such as undesirable background amplification resulting from non-specific template interactions, must be addressed to further improve isothermal and exponential amplification techniques. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Norovirus and Rotavirus Disease Severity in Children: Systematic Review and Meta-analysis.

PubMed

Riera-Montes, Margarita; O'Ryan, Miguel; Verstraeten, Thomas

2018-06-01

Rotaviruses (RVs) and noroviruses (NoVs) are the most common causes of severe acute gastroenteritis in children. It is generally accepted that RVs cause severe acute gastroenteritis in a higher proportion of cases compared with NoVs. To our knowledge, there are no systematic reviews and meta-analyses comparing the severity of NoV and RV disease. We searched MEDLINE for studies reporting data for NoV and RV medically attended disease severity in children. We included studies where all children had been tested for both NoV (reverse transcription polymerase chain reaction) and RV (enzyme-linked immunosorbent assay or reverse transcription polymerase chain reaction) and that reported disease severity using the Vesikari or modified Vesikari score, or provided clinical information on severity. We generated pooled estimates of the mean with 95% confidence intervals using random effects meta-analysis. We identified 266 publications, of which 31 were retained for qualitative analysis and 26 for quantitative analysis. Fourteen studies provided data on severity score for the meta-analysis. The pooled mean severity scores (95% confidence interval) among outpatients were 10 (8-12) and 11 (8-14) for NoV and RV, respectively. Among inpatients, they were 11 (9-13) for NoV and 12 (10-14) for RV. The difference was statistically significant among inpatients, but relatively small (1 point in a 20-point scale). About 20% more children with RV required rehydration when compared with children with NoV. NoV causes moderate to severe disease similar to RV in young children. This information should be useful for future evaluations of an eventual introduction of NoV vaccines in national immunization programs.

Variable Methylation Potential in Preterm Placenta: Implication for Epigenetic Programming of the Offspring.

PubMed

Khot, Vinita V; Chavan-Gautam, Preeti; Mehendale, Savita; Joshi, Sadhana R

2017-06-01

Children born preterm are reported to be at increased risk of developing noncommunicable diseases in later life. Altered placental DNA methylation patterns are implicated in fetal programming of adult diseases. Our earlier animal studies focus on micronutrients (folic acid, vitamin B 12 ) and long-chain polyunsaturated fatty acids (LCPUFAs) that interact in the 1 carbon cycle, thereby influencing methylation reactions. Our previous studies in women delivering preterm show altered plasma levels of micronutrients and lower plasma LCPUFA levels. We postulate that alterations in the micronutrient metabolism may affect the regulation of enzymes, methionine adenosyltransferase ( MAT2A), and SAH-hydrolase ( AHCY), involved in the production of methyl donor S-adenosylmethionine (SAM), thereby influencing the methylation potential (MP) in the placenta of women delivering preterm. The present study, therefore, examines the mRNA, protein levels of enzymes ( MAT2A and AHCY), SAM, S-adenosylhomocysteine (SAH) levels, and global DNA methylation levels from preterm (n = 73) and term (n = 73) placentae. The enzyme messenger RNA (mRNA) levels were analyzed by real-time quantitative polymerase chain reaction, protein levels by enzyme-linked immunosorbent assay, and SAM-SAH levels by high-performance liquid chromatography. The mRNA levels for MAT2A and AHCY are higher ( P < .05 for both) in the preterm group as compared to the term group. S-Adenosylmethionine and SAH levels were similar in both groups, although SAM:SAH ratio was lower ( P < .05) in the preterm group as compared to the term group. The global DNA methylation levels were higher ( P < .05) in women delivering small for gestation age infants as compared to women delivering appropriate for gestation age infants at term. Our data showing lower MP in the preterm placenta may have implications for the epigenetic programming of the developing fetus.

Study of the bacterial diversity of foods: PCR-DGGE versus LH-PCR.

PubMed

Garofalo, Cristiana; Bancalari, Elena; Milanović, Vesna; Cardinali, Federica; Osimani, Andrea; Sardaro, Maria Luisa Savo; Bottari, Benedetta; Bernini, Valentina; Aquilanti, Lucia; Clementi, Francesca; Neviani, Erasmo; Gatti, Monica

2017-02-02

The present study compared two culture-independent methods, polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) and length-heterogeneity polymerase chain reaction (LH-PCR), for their ability to reveal food bacterial microbiota. Total microbial DNA and RNA were extracted directly from fourteen fermented and unfermented foods, and domain A of the variable regions V1 and V2 of the 16S rRNA gene was analyzed through LH-PCR and PCR-DGGE. Finally, the outline of these analyses was compared with bacterial viable counts obtained after bacterial growth on suitable selective media. For the majority of the samples, RNA-based PCR-DGGE revealed species that the DNA-based PCR-DGGE was not able to highlight. When analyzing either DNA or RNA, LH-PCR identified several lactic acid bacteria (LAB) and coagulase negative cocci (CCN) species that were not identified by PCR-DGGE. This phenomenon was particularly evident in food samples with viable loads<5.0 Logcfug -1 . Furthermore, LH-PCR was able to detect a higher number of peaks in the analyzed food matrices relative to species identified by PCR-DGGE. In light of these findings, it may be suggested that LH-PCR shows greater sensitivity than PCR-DGGE. However, PCR-DGGE detected some other species (LAB included) that were not detected by LH-PCR. Therefore, certain LH-PCR peaks not attributed to known species within the LH-PCR database could be solved by comparing them with species identified by PCR-DGGE. Overall, this study also showed that LH-PCR is a promising method for use in the food microbiology field, indicating the necessity to expand the LH-PCR database, which is based, up to now, mainly on LAB isolates from dairy products. Copyright © 2016 Elsevier B.V. All rights reserved.

Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia

PubMed Central

Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R; Champagne, Sylvie; Gregson, Daniel G

2015-01-01

BACKGROUND: Pneumocystis jirovecii (PJ), a pathogenic fungus, causes severe interstitial Pneumocystis pneumonia (PCP) among immunocompromised patients. A laboratory-developed real-time polyermase chain reaction (PCR) assay was validated for PJ detection to improve diagnosis of PCP. METHODS: Forty stored bronchoalveolar lavage (BAL) samples (20 known PJ positive [PJ+] and 20 known PJ negative [PJ−]) were initially tested using the molecular assay. Ninety-two sequentially collected BAL samples were then analyzed using an immunofluorescence assay (IFA) and secondarily tested using the PJ real-time PCR assay. Discrepant results were resolved by retesting BAL samples using another real-time PCR assay with a different target. PJ real-time PCR assay performance was compared with the existing gold standard (ie, IFA) and a modified gold standard, in which a true positive was defined as a sample that tested positive in two of three methods in a patient suspected to have PCP. RESULTS: Ninety of 132 (68%) BAL fluid samples were collected from immunocompromised patients. Thirteen of 92 (14%) BALs collected were PJ+ when tested using IFA. A total of 40 BAL samples were PJ+ in the present study including: all IFA positive samples (n=13); all referred PJ+ BAL samples (n=20); and seven additional BAL samples that were IFA negative, but positive using the modified gold standard. Compared with IFA, the PJ real-time PCR had sensitivity, specificity, and positive and negative predictive values of 100%, 91%, 65% and 100%, respectively. Compared with the modified gold standard, PJ real-time PCR had a sensitivity, specificity, and positive and negative predictive values of 100%. CONCLUSION: PJ real-time PCR improved detection of PJ in immunocompromised patients. PMID:26600815

Impact of Enteroviral Polymerase Chain Reaction Testing on Length of Stay for Infants 60 Days Old or Younger.

PubMed

Aronson, Paul L; Lyons, Todd W; Cruz, Andrea T; Freedman, Stephen B; Okada, Pamela J; Fleming, Alesia H; Arms, Joseph L; Thompson, Amy D; Schmidt, Suzanne M; Louie, Jeffrey; Alfonzo, Michael J; Monuteaux, Michael C; Nigrovic, Lise E

2017-10-01

To determine the impact of a cerebrospinal fluid enterovirus polymerase chain reaction (PCR) test performance on hospital length of stay (LOS) in a large multicenter cohort of infants undergoing evaluation for central nervous system infection. We performed a planned secondary analysis of a retrospective cohort of hospitalized infants ≤60 days of age who had a cerebrospinal fluid culture obtained at 1 of 18 participating centers (2005-2013). After adjustment for patient age and study year as well as clustering by hospital center, we compared LOS for infants who had an enterovirus PCR test performed vs not performed and among those tested, for infants with a positive vs negative test result. Of 19 953 hospitalized infants, 4444 (22.3%) had an enterovirus PCR test performed and 945 (21.3% of tested infants) had positive test results. Hospital LOS was similar for infants who had an enterovirus PCR test performed compared with infants who did not (incident rate ratio 0.98 hours; 95% CI 0.89-1.06). However, infants PCR positive for enterovirus had a 38% shorter LOS than infants PCR negative for enterovirus (incident rate ratio 0.62 hours; 95% CI 0.57-0.68). No infant with a positive enterovirus PCR test had bacterial meningitis (0%; 95% CI 0-0.4). Although enterovirus PCR testing was not associated with a reduction in LOS, infants with a positive enterovirus PCR test had a one-third shorter LOS compared with infants with a negative enterovirus PCR test. Focused enterovirus PCR test use could increase the impact on LOS for infants undergoing cerebrospinal fluid evaluation. Copyright © 2017 Elsevier Inc. All rights reserved.

Ethnic differences in the frequency of subtypes of childhood acute lymphoblastic leukemia: results of the Malaysia-Singapore Leukemia Study Group.

PubMed

Ariffin, Hany; Chen, Siew-Peng; Kwok, Cecilia S; Quah, Thuan-Chong; Lin, Hai-Peng; Yeoh, Allen E J

2007-01-01

Childhood acute lymphoblastic leukemia (ALL) is clinically heterogeneous with prognostically and biologically distinct subtypes. Although racial differences in frequency of different types of childhood ALL have been reported, many are confounded by selected or limited population samples. The Malaysia-Singapore (MA-SPORE) Leukemia Study Group provided a unique platform for the study of the frequency of major subgroups of childhood ALL in a large cohort of unselected multiethnic Asian children. Screening for the prognostically important chromosome abnormalities (TEL-AML1, BCR-ABL, E2A-PBX1, and MLL) using multiplex reverse-transcription polymerase chain reaction was performed on 299 consecutive patients with ALL at 3 study centers (236 de novo, 63 at relapse), with the ethnic composition predominantly Chinese (51.8%) and Malay (34.8%). Reverse-transcription polymerase chain reaction was successful in 278 (93%) of cases screened. The commonest fusion transcript was TEL-AML1 (19.1%) followed by BCR-ABL (7.8%), MLL rearrangements (4.2%), and E2A-PBX1 (3.1%). Chinese have a significantly lower frequency of TEL-AML1 (13.3% in de novo patients) compared with Malays (22.2%) and Indians (21.7%) (P=0.04). Malays have a lower frequency of T-ALL (6.2%) compared with the Chinese and Indians (9.8%). Both Malays (7.4%) and Chinese (5.0%) have significantly higher frequency of BCR-ABL compared with the Indian population (P<0.05) despite a similar median age at presentation. Our study suggests that there are indeed significant and important racial differences in the frequency of subtypes of childhood ALL. Comprehensive subgrouping of childhood ALL may reveal interesting population frequency differences of the various subtypes, their risk factors and hopefully, its etiology.

Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?

NASA Astrophysics Data System (ADS)

Behnke, Wolfgang; Zetzsch, Cornelius

2010-05-01

We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/kBr[toluene] ~ 100). Formation of aldehydes (R-CHO) interferes with the chain reaction (1) - (3) markedly, since kBr[O3] ≈kBr[R-CHO]. The chain reaction is limited by availability of ozone (degradation of HCs by atomic Cl stops completely with vanishing ozone), of HO2 (HCs are required to form HO2) and of aerosol. The central question is: will sufficient HO2 be formed from degradation of HCs to explain the magnitude of the formed Br2 and BrCl in our experiments? We found that the formation of HO2 should be by a factor of 2-4 larger to explain the formation of Br2 and BrCl. Which other sources for the formation of HOBr besides reaction (2a) are then available? The rate of CH3O2with BrO is 25% of that with HO2 (Enami, S.; Yamanaka, T.; Nakayama, T.; Hashimoto, S.; Kawasaki, M.; Shallcross, D.E.; Nakano, Y.; Ishiwata, T., J. Phys. Chem. A, 11, 3342 - 3348, 2007), suggesting that other RO2 radicals must contribute. In our model calculations we use this rate constant for all RO2 radicals to obtain reasonable agreement between the produced HOBr and the formed BrCl and Br2 necessary for our experimental degradation results. So reaction scheme (1) - (3) should be completed by: BrO + RO2 => HOBr + products (2b) The German Science Foundation (DFG) supported this research in unit 783 (HALOPROC).

Palladium-Catalyzed Oxidative Couplings and Applications to the Synthesis of Macrocycles and Strained Cyclic Dienes

NASA Astrophysics Data System (ADS)

Boon, Byron Adrian

The palladium(II)-catalyzed oxidative macrocyclization of bis(vinylboronate esters) is demonstrated as an efficient method for the synthesis of macrocyclic dienes. The macrocyclization reactions feature mild conditions due to a palladium(II) catalytic cycle which obviates the need for a high energy oxidative addition step of standard palladium(0) catalytic cycles. Instead, this oxidative coupling is promoted by chloroacetone as a terminal re-oxidant in the catalytic cycle. An extension of the oxidative coupling/macrocyclization strategy is highlighted where molecular oxygen may be used in place of chloroacetone as the terminal re-oxidant. Homocoupling reactions of vinylboronate esters served as a template to screen reaction conditions for this method. From these experiments, multiple reaction conditions gave the oxidative homocoupling product in high yield. These reaction conditions were successfully applied to the oxidative macrocyclization of a bis(vinylboronate ester) using molecular oxygen as a re-oxidant. Syntheses of strained cyclic dienes were accomplished via the palladium(II)-catalyzed oxidative cyclizations of terminal bis(vinylboronate esters). The reactions generated strained (E,E)-1,3-dienes that underwent spontaneous 4?-electrocyclizations to form bicyclic cyclobutenes. Formation of the cyclobutenes is driven by strain in the medium-ring (E,E)-1,3-diene intermediates. Thermal ring openings of the cyclobutenes give (Z,Z)-1,3-diene products, again for thermodynamic reasons. These results are in contrast with typical acyclic trans-3,4-dialkyl cyclobutenes, which favor outward torquoselective ring-openings to give (E,E)-1,3-dienes. DFT calculations verified the thermodynamic versus kinetic control of the reactions and kinetic studies are in excellent agreement with the calculated energy changes. Investigations on the transannular Pauson-Khand reaction are also highlighted. The Pauson-Khand reaction is a powerful tool for the synthesis of cyclopentenones through the efficient [2+2+1] cycloaddition of dicobalt alkyne complexes with alkenes. While intermolecular and intramolecular variants are widely known, transannular versions of this reaction are unknown and the basis of this study. Our successful transannular Pauson-Khand reaction required a cyclic enyne incorporating one short three-membered linker chain and a rigid aryl linker in the backbone of the long linker chain. This rigidity of the aryl linker is proposed to facilitate the transannular [2+2+1] cyclization. Computational studies revealed that transannular Pauson-Khand reactions are thermodynamically favored for cyclic enynes featuring a long linker of at least 5 carbons, but with smaller chains the reactions are thermodynamically disfavored. Experimental studies show that long linking chains with more than 5 members are required to prevent to steric interactions between the dicobalt hexacarbonyl moiety and the linking chain to allow the reaction to be kinetically favored. The final part of this work highlights progress towards the total synthesis of (+)-kingianin A. This natural product was isolated as a racemic mixture from the bark of Endiandra kingiana and is an inhibitor of antiapoptotic protein Bcl-Xl, highlighting its potential use in cancer treatments. Its structure is proposed to arise from an intermolecular Diels-Alder dimerization reaction of bicyclo[4.2.0]octadiene fragments derived from an 8pi/6pi-electrocyclization cascade. Although two total syntheses of (+/-)-kingianin A have been reported, an enantioselective synthesis has not been achieved and is the purpose of this study. This synthetic route begins from L-(+)-dimethyl tartrate, a cheap and commercially available starting material, and aims to follow a biomimetic synthetic pathway featuring a substrate controlled diastereoselective palladium(II)-catalyzed oxidative cyclization and 8pi/6pi-electrocyclization cascade. Although the feasibility of this cascade pathway has not yet been realized, key synthetic transformations to install the requisite carbocyclic framework of (+)-kingianin A have been discovered, paving the way for future investigations on the palladium(II)-catalyzed coupling/electrocyclization cascade and completion of the synthesis.

On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

PubMed

Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

2017-02-01

A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.