Sample records for chain reaction experiments

  1. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  2. A Bullet-Block Experiment that Explains the Chain Fountain

    NASA Astrophysics Data System (ADS)

    Pantaleone, J.; Smith, R.

    2018-05-01

    It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

  3. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  4. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  5. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  6. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  7. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  8. The Learning Gains and Student Perceptions of a Second Life Virtual Lab

    ERIC Educational Resources Information Center

    Cobb, Stephanie; Heaney, Rose; Corcoran, Olivia; Henderson-Begg, Stephanie

    2009-01-01

    This study examines students' reactions to the virtual biosciences laboratory developed in Second Life[R] (SL) at the University of East London. Final year undergraduates and masters students studying biotechnology took part in a trial of a virtual Polymerase Chain Reaction (PCR) experiment in Second Life and evaluated their experience by…

  9. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  10. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  11. Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

    NASA Astrophysics Data System (ADS)

    Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2016-09-01

    Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

  12. Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

    DOE PAGES

    Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

    2015-10-27

    In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

  13. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  14. Implications of Measurement Assay Type in Design of HIV Experiments.

    PubMed

    Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

    2017-12-01

    Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

  15. Selected spectroscopic results on element 115 decay chains

    DOE PAGES

    Rudolph, D.; Forsberg, U.; Golubev, P.; ...

    2014-08-24

    We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

  16. Nuclear Experiments You Can Do...from Edison.

    ERIC Educational Resources Information Center

    Benrey, Ronald M.

    This booklet discusses some of the basic facts about nuclear energy and provides eight experiments related to these facts. The experiments (which include lists of materials needed and procedures used) involve: (1) an oil-drop model of a splitting atom; (2) a domino model of a chain reaction; (3) observing radioactivity with an electroscope; (4)…

  17. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  18. A new assessment of the alleged link between element 115 and element 117 decay chains

    NASA Astrophysics Data System (ADS)

    Forsberg, U.; Rudolph, D.; Fahlander, C.; Golubev, P.; Sarmiento, L. G.; Åberg, S.; Block, M.; Düllmann, Ch. E.; Heßberger, F. P.; Kratz, J. V.; Yakushev, A.

    2016-09-01

    A novel rigorous statistical treatment is applied to available data (May 9, 2016) from search and spectroscopy experiments on the elements with atomic numbers Z = 115 and Z = 117. The present analysis implies that the hitherto proposed cross-reaction link between α-decay chains associated with the isotopes 293117 and 289115 is highly improbable.

  19. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  20. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  1. The role of acyl carrier protein isoforms from Cuphea lanceolata seeds in the de-novo biosynthesis of medium-chain fatty acids.

    PubMed

    Schütt, B S; Brummel, M; Schuch, R; Spener, F

    1998-06-01

    To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.

  2. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  3. One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

    PubMed

    Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

    2014-02-21

    In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

  4. FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

    PubMed Central

    Ekstedt, Richard D.; Stollerman, Gene H.

    1960-01-01

    Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

  5. Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

    PubMed

    Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

    2006-05-01

    Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

  6. Inquiry-Based Experiments for Large-Scale Introduction to PCR and Restriction Enzyme Digests

    ERIC Educational Resources Information Center

    Johanson, Kelly E.; Watt, Terry J.

    2015-01-01

    Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are…

  7. Microfluidic Gel Electrophoresis in the Undergraduate Laboratory Applied to Food Analysis

    ERIC Educational Resources Information Center

    Chao, Tzu-Chiao; Bhattacharya, Sanchari; Ros, Alexandra

    2012-01-01

    A microfluidics-based laboratory experiment for the analysis of DNA fragments in an analytical undergraduate course is presented. The experiment is set within the context of food species identification via amplified DNA fragments. The students are provided with berry samples from which they extract DNA and perform polymerase chain reaction (PCR)…

  8. Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

    NASA Astrophysics Data System (ADS)

    Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

    2017-09-01

    It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

  9. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  10. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  11. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  12. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  13. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  14. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  15. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  16. High Energy Density Plasmas (HEDP) for studies of basic nuclear science relevant to Stellar and Big Bang Nucleosynthesis

    NASA Astrophysics Data System (ADS)

    Frenje, Johan

    2014-06-01

    Thermonuclear reaction rates and nuclear processes have been explored traditionally by means of conventional accelerator experiments, which are difficult to execute at conditions relevant to stellar nucleosynthesis. Thus, nuclear reactions at stellar energies are often studied through extrapolations from higher-energy data or in low-background underground experiments. Even when measurements are possible using accelerators at relevant energies, thermonuclear reaction rates in stars are inherently different from those in accelerator experiments. The fusing nuclei are surrounded by bound electrons in accelerator experiments, whereas electrons occupy mainly continuum states in a stellar environment. Nuclear astrophysics research will therefore benefit from an enlarged toolkit for studies of nuclear reactions. In this presentation, we report on the first use of High Energy Density Plasmas for studies of nuclear reactions relevant to basic nuclear science, stellar and Big Bang nucleosynthesis. These experiments were carried out at the OMEGA laser facility at University of Rochester and the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory, in which spherical capsules were irradiated with powerful lasers to compress and heat the fuel to high enough temperatures and densities for nuclear reactions to occur. Four experiments will be highlighted in this presentation. In the first experiment, the differential cross section for the elastic neutron-triton (n-T) scattering at 14.1 MeV was measured with significantly higher accuracy than achieved in accelerator experiments. In the second experiment, the T(t,2n)4He reaction, a mirror reaction to the 3He(3He,2p)4He reaction that plays an important role in the proton-proton chain that transforms hydrogen into ordinary 4He in stars like our Sun, was studied at energies in the range 15-40 keV. In the third experiment, the 3He+3He solar fusion reaction was studied directly, and in the fourth experiment, we probed the T+3He reaction, possibly relevant to Big Bang nucleosynthesis.

  17. Introductory Laboratory Exercises in Radiobiology

    ERIC Educational Resources Information Center

    Williams, J. R. Parry; Servant, D. M.

    1970-01-01

    Describes experiments suitable for introducing use of radioisotopes in biology. Includes demonstrations of tracing food chains, uptake of ions by plants, concentration of elements by insects, tracing photosynthetic reactions, activation analysis of copper, and somatic and genetic effects. Uses autoradiographic and counting techniques. (AL)

  18. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  19. Study of the 249-251Cf + 48Ca reactions: recent results and outlook

    NASA Astrophysics Data System (ADS)

    Voinov, A. A.; Oganessian, Yu Ts; Abdullin, F. Sh; Brewer, N. T.; Dmitriev, S. N.; Grzywacz, R. K.; Hamilton, J. H.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Rykaczewski, K. P.; Sabelnikov, A. V.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Stoyer, M. A.; Subbotin, V. G.; Sukhov, A. M.; Tsyganov, Yu S.; Utyonkov, V. K.; Vostokin, G. K.

    2018-02-01

    Experiment aiming at the synthesis of heavy isotopes of Z=118 (Og) using beam of 48Ca and a target of 249-251Cf was undertaken in October 2015 - April 2016 employing the Dubna Gas-Filled Recoil Separator (FLNR JINR). The target of mixed isotopes of 249-251Cf (50.7% of 249Cf, 12.9% of 250Cf, and 36.4% of 251Cf) was irradiated by 48Ca ions at two beam energies of 252 and 258 MeV with the corresponding accumulated beam doses of 1.6×1019 and 1.1×1019. A single event observed at lower beam energy was assigned to the isotope 294Og, the product of the reaction 249Cf(48Ca, 3n); its decay pattern and the observed radioactive properties of the nuclides in the decay chain reproduce in full those observed for 294Og in our earlier experiments of 2002-2005 and 2012. At higher beam energy we observed no decay chains that could be attributed to the isotopes of Og. The possibility of renewal of this experiment in the future is discussed.

  20. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  1. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  2. Detection of Genetically Modified Food: Has Your Food Been Genetically Modified?

    ERIC Educational Resources Information Center

    Brandner, Diana L.

    2002-01-01

    Explains the benefits and risks of genetically-modified foods and describes methods for genetically modifying food. Presents a laboratory experiment using a polymerase chain reaction (PCR) test to detect foreign DNA in genetically-modified food. (Contains 18 references.) (YDS)

  3. Violence and vulnerability of female migrants in drop houses in Arizona: the predictable outcome of a chain reaction of violence.

    PubMed

    Simmons, William Paul; Menjívar, Cecilia; Téllez, Michelle

    2015-05-01

    This qualitative research study examines the experiences of immigrant women crossing the U.S./Mexico border and the proliferation of "drop houses" in Arizona as a new phenomenon, one that is often marked by kidnappings and sexual assault. Little research has been published on the violence women face on their journey, and the drop houses have almost completely escaped scholarly analysis. We argue that the drop houses must be seen as a consequence of a "state of emergency" declared by policy makers that led to changes in U.S. national and local immigration policies that fueled what we call a "chain reaction of violence." © The Author(s) 2015.

  4. Copolymer Synthesis and Characterization by Post-Polymerization Modification

    NASA Astrophysics Data System (ADS)

    Galvin, Casey James

    This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

  5. Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

    PubMed

    Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

    2017-10-01

    Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Reaction pathways of propene pyrolysis.

    PubMed

    Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

    2010-05-01

    The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

  7. Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

    PubMed

    Treff, Nathan R; Scott, Richard T

    2013-03-15

    Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  8. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  9. Experiments with the Dragon Machine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    R.E. Malenfant

    2005-08-12

    The basic characteristics of a self-sustaining chain reaction were demonstrated with the Chicago Pile in 1943, but it was not until early 1945 that sufficient enriched material became available to experimentally verify fast-neutron cross-sections and the kinetic characteristics of a nuclear chain reaction sustained with prompt neutrons alone. However, the demands of wartime and the rapid decline in effort following the cessation of hostilities often resulted in the failure to fully document the experiments or in the loss of documentation as personnel returned to civilian pursuits. When documented, the results were often highly classified. Even when eventually declassified, the datamore » were often not approved for public release until years later.2 Even after declassification and approval for public release, the records are sometimes difficult to find. Through a fortuitous discovery, a set of handwritten notes by ''ORF July 1945'' entitled ''Dragon - Research with a Pulsed Fission Reactor'' was found by William L. Myers in an old storage safe at Pajarito Site of the Los Alamos National Laboratory3. Of course, ORF was identified as Otto R. Frisch. The document was attached to a page in a nondescript spiral bound notebook labeled ''494 Book'' that bore the signatures of Louis Slotin and P. Morrison. The notes also reference an ''Idea LS'' that can only be Louis Slotin. The discovery of the notes led to a search of Laboratory Archives, the negative files of the photo lab, and the Report Library for additional details of the experiments with the Dragon machine that were conducted between January and July 1945. The assembly machine and the experiments were carefully conceived and skillfully executed. The analyses--without the crutch of computers--display real insight into the characteristics of the nuclear chain reaction. The information presented here provides what is believed to be a complete collection of the original documentation of the observations made with the Dragon Machine in early 1945.« less

  10. Multi angle laser light scattering evaluation of field exposed thermoplastic photovoltaic encapsulant materials

    DOE PAGES

    Kempe, Michael D.; Miller, David C.; Wohlgemuth, John H.; ...

    2016-01-08

    As creep of polymeric materials is potentially a safety concern for photovoltaic modules, the potential for module creep has become a significant topic of discussion in the development of IEC 61730 and IEC 61215. To investigate the possibility of creep, modules were constructed, using several thermoplastic encapsulant materials, into thin-film mock modules and deployed in Mesa, Arizona. The materials examined included poly(ethylene)-co-vinyl acetate (EVA, including formulations both cross-linked and with no curing agent), polyethylene/polyoctene copolymer (PO), poly(dimethylsiloxane) (PDMS), polyvinyl butyral (PVB), and thermoplastic polyurethane (TPU). The absence of creep in this experiment is attributable to several factors of which themore » most notable one was the unexpected cross-linking of an EVA formulation without a cross-linking agent. It was also found that some materials experienced both chain scission and cross-linking reactions, sometimes with a significant dependence on location within a module. The TPU and EVA samples were found to degrade with cross-linking reactions dominating over chain scission. In contrast, the PO materials degraded with chain scission dominating over cross-linking reactions. Furthermore, we found no significant indications that viscous creep is likely to occur in fielded modules capable of passing the qualification tests, we note that one should consider how a polymer degrades, chain scission or cross-linking, in assessing the suitability of a thermoplastic polymer in terrestrial photovoltaic applications.« less

  11. 10 CFR 140.3 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... atomic weapon, designed or used to sustain nuclear fission in a self-supporting chain reaction. (g... experiments; or (ii) A liquid fuel loading; or (iii) An experimental facility in the core in excess of 16... in the isotope 235, except laboratory scale facilities designed or used for experimental or...

  12. 10 CFR 140.3 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... in the isotope 235, except laboratory scale facilities designed or used for experimental or... atomic weapon, designed or used to sustain nuclear fission in a self-supporting chain reaction. (g... experiments; or (ii) A liquid fuel loading; or (iii) An experimental facility in the core in excess of 16...

  13. 10 CFR 140.3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... in the isotope 235, except laboratory scale facilities designed or used for experimental or... atomic weapon, designed or used to sustain nuclear fission in a self-supporting chain reaction. (g... experiments; or (ii) A liquid fuel loading; or (iii) An experimental facility in the core in excess of 16...

  14. South East Asia to America: Links in a Chain (Part Two).

    ERIC Educational Resources Information Center

    Rose, Peter I.

    1981-01-01

    Discusses the transfer of Indochinese refugees from Southeast Asia to the United States, their stay in interim refugee camps, the voyage by plane, bureaucratic problems, and their first encounter with American life. Provides an anecdotal account of one family's experiences and reactions. (GC)

  15. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  16. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  17. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  18. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  19. UW Team Reaches Out to Grade- and High-School Students.

    ERIC Educational Resources Information Center

    Hood, Leroy

    1994-01-01

    Describes an outreach program designed to expose high school students to cutting-edge science. High school students are provided with hands-on experience in molecular biology (polymerase chain reaction, restriction mapping, chromatography, gel electrophoresis, human DNA sequencing, etc.) and may have an opportunity to participate in the Human…

  20. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  1. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  2. Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?

    NASA Astrophysics Data System (ADS)

    Behnke, Wolfgang; Zetzsch, Cornelius

    2010-05-01

    We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/kBr[toluene] ~ 100). Formation of aldehydes (R-CHO) interferes with the chain reaction (1) - (3) markedly, since kBr[O3] ≈kBr[R-CHO]. The chain reaction is limited by availability of ozone (degradation of HCs by atomic Cl stops completely with vanishing ozone), of HO2 (HCs are required to form HO2) and of aerosol. The central question is: will sufficient HO2 be formed from degradation of HCs to explain the magnitude of the formed Br2 and BrCl in our experiments? We found that the formation of HO2 should be by a factor of 2-4 larger to explain the formation of Br2 and BrCl. Which other sources for the formation of HOBr besides reaction (2a) are then available? The rate of CH3O2with BrO is 25% of that with HO2 (Enami, S.; Yamanaka, T.; Nakayama, T.; Hashimoto, S.; Kawasaki, M.; Shallcross, D.E.; Nakano, Y.; Ishiwata, T., J. Phys. Chem. A, 11, 3342 - 3348, 2007), suggesting that other RO2 radicals must contribute. In our model calculations we use this rate constant for all RO2 radicals to obtain reasonable agreement between the produced HOBr and the formed BrCl and Br2 necessary for our experimental degradation results. So reaction scheme (1) - (3) should be completed by: BrO + RO2 => HOBr + products (2b) The German Science Foundation (DFG) supported this research in unit 783 (HALOPROC).

  3. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  4. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  5. Prediction of Chain Propagation Rate Constants of Polymerization Reactions in Aqueous NIPAM/BIS and VCL/BIS Systems.

    PubMed

    Kröger, Leif C; Kopp, Wassja A; Leonhard, Kai

    2017-04-06

    Microgels have a wide range of possible applications and are therefore studied with increasing interest. Nonetheless, the microgel synthesis process and some of the resulting properties of the microgels, such as the cross-linker distribution within the microgels, are not yet fully understood. An in-depth understanding of the synthesis process is crucial for designing tailored microgels with desired properties. In this work, rate constants and reaction enthalpies of chain propagation reactions in aqueous N-isopropylacrylamide/N,N'-methylenebisacrylamide and aqueous N-vinylcaprolactam/N,N'-methylenebisacrylamide systems are calculated to identify the possible sources of an inhomogeneous cross-linker distribution in the resulting microgels. Gas-phase reaction rate constants are calculated from B2PLYPD3/aug-cc-pVTZ energies and B3LYPD3/tzvp geometries and frequencies. Then, solvation effects based on COSMO-RS are incorporated into the rate constants to obtain the desired liquid-phase reaction rate constants. The rate constants agree with experiments within a factor of 2-10, and the reaction enthalpies deviate less than 5 kJ/mol. Further, the effect of rate constants on the microgel growth process is analyzed, and it is shown that differences in the magnitude of the reaction rate constants are a source of an inhomogeneous cross-linker distribution within the resulting microgel.

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  7. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  10. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    ERIC Educational Resources Information Center

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  11. Teaching Molecular Biological Techniques in a Research Content

    ERIC Educational Resources Information Center

    Stiller, John W.; Coggins, T. Chad

    2006-01-01

    Molecular biological methods, such as the polymerase chain reaction (PCR) and gel electrophoresis, are now commonly taught to students in introductory biology courses at the college and even high school levels. This often includes hands-on experience with one or more molecular techniques as part of a general biology laboratory. To assure that most…

  12. Aligning Goals, Assessments, and Activities: An Approach to Teaching PCR and Gel Electrophoresis

    ERIC Educational Resources Information Center

    Phillips, Allison R.; Robertson, Amber L.; Batzli, Janet; Harris, Michelle; Miller, Sarah

    2008-01-01

    Polymerase chain reaction (PCR) and gel electrophoresis have become common techniques used in undergraduate molecular and cell biology labs. Although students enjoy learning these techniques, they often cannot fully comprehend and analyze the outcomes of their experiments because of a disconnect between concepts taught in lecture and experiments…

  13. Optimization of lipase-catalyzed synthesis of ginsenoside Rb1 esters using response surface methodology.

    PubMed

    Hu, Jiang-Ning; Lee, Jeung-Hee; Zhu, Xue-Mei; Shin, Jung-Ah; Adhikari, Prakash; Kim, Jae-Kyung; Lee, Ki-Teak

    2008-11-26

    In the lipase (Novozyme 435)-catalyzed synthesis of ginsenoside Rb1 esters, different acyl donors were found to affect not only the degree of conversion but also the regioselectivity. The reaction of acyl donors with short carbon chain was more effective, showing higher conversion than those with long carbon chain. Among the three solvent systems, the reaction in tert-amyl alcohol showed the highest conversion rate, while the reaction in the mixed solvent of t-BuOH and pyridine (1:1) had the lowest conversion rate. To allow the increase of GRb1 lipophilicity, we decided to further study the optimal condition of synthesis of GRb1 with vinyl decanoate with 10 carbon chain fatty acids in tert-amyl alcohol. Response surface methodology (RSM) was employed to optimize the synthesis condition. From the ridge analysis with maximum responses, the maximum GRb1 conversion was predicted to be 61.51% in a combination of factors (40.2 h, 52.95 degrees C, substrate mole ratio 275.57, and enzyme amount 39.81 mg/mL). Further, the adequacy of the predicted model was examined by additional independent experiments at the predicted maximum synthesis conditions. Results showed that the RSM was effective to optimize a combination of factors for lipase-catalyzed synthesis of ginsenoside Rb1 with vinyl decanoate.

  14. Measurement of peroxy radicals in the urban atmosphere by PERCA-LIF technique

    NASA Astrophysics Data System (ADS)

    Sadanaga, Y.; Matsumoto, J.; Sakurai, K.; Kato, S.; Nomaguchi, T.; Bandow, H.; Kajii, Y.

    2002-12-01

    A new instrument has been developed for measuring peroxy radicals (RO2) using the Chemical Amplifier-Laser Induced Fluorescence (PERCA-LIF) technique. RO2 was converted to NO2 via a chain reaction by the addition of NO and CO in a 1/4" Teflon tube. NO2 was detected by LIF using Nd:YAG laser (532 nm, 5W at 10kHz). More selective detection of NO2 is enabled by the LIF than by luminol chemiluminescence because of free from the interference by other oxidants when using luminol. LIF technique can be more sensitive detection of NO2 than the luminol detector. Optimum conditions were investigated by varying reaction time (i.e. the length of reaction tube) and the concentrations of NO and CO. Maximum chain length of approximately 300 was obtained in dry conditions using a H2O/O2 simultaneous photolysis method. Experiments were performed to characterize the dependence of the chain length on humidity for this instrument. In August 2002, RO2 measurements were performed in Osaka using this method. Maximum concentrations of RO2 in the daytime were approximately 100 pptv. Nighttime observations were also conducted and significant concentrations of RO2 were detected just after the sunset. Existence of formation processes in the dark condition was investigated.

  15. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  16. LUNA: Nuclear astrophysics underground

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Best, A.

    Underground nuclear astrophysics with LUNA at the Laboratori Nazionali del Gran Sasso spans a history of 20 years. By using the rock overburden of the Gran Sasso mountain chain as a natural cosmic-ray shield very low signal rates compared to an experiment on the surface can be tolerated. The cross sectons of important astrophysical reactions directly in the stellar energy range have been successfully measured. In this proceeding we give an overview over the key accomplishments of the experiment and an outlook on its future with the expected addition of an additional accelerator to the underground facilities, enabling the coveragemore » of a wider energy range and the measurement of previously inaccessible reactions.« less

  17. Lipozyme RM IM-catalyzed acidolysis of Cinnamomum camphora seed oil with oleic acid to produce human milk fat substitutes enriched in medium-chain fatty acids.

    PubMed

    Zou, Xian-Guo; Hu, Jiang-Ning; Zhao, Man-Li; Zhu, Xue-Mei; Li, Hong-Yan; Liu, Xiao-Ru; Liu, Rong; Deng, Ze-Yuan

    2014-10-29

    In the present study, a human milk fat substitute (HMFS) enriched in medium-chain fatty acids (MCFAs) was synthesized through acidolysis reaction from Cinnamomum camphora seed oil (CCSO) with oleic acid in a solvent-free system. A commercial immobilized lipase, Lipozyme RM IM, from Rhizomucor miehei, was facilitated as a biocatalyst. Effects of different reaction conditions, including substrate molar ratio, enzyme concentration, reaction temperature, and reaction time were investigated using response surface methodology (RSM) to obtain the optimal oleic acid incorporation. After optimization, results showed that the maximal incorporation of oleic acid into HMFS was 59.68%. Compared with CCSO, medium-chain fatty acids at the sn-2 position of HMFS accounted for >70%, whereas oleic acid was occupied predominantly at the sn-1,3 position (78.69%). Meanwhile, triacylglycerol (TAG) components of OCO (23.93%), CCO (14.94%), LaCO (13.58%), OLaO (12.66%), and OOO (11.13%) were determined as the major TAG species in HMFS. The final optimal reaction conditions were carried out as follows: substrate molar ratio (oleic acid/CCSO), 5:1; enzyme concentration, 12.5% (w/w total reactants); reaction temperature, 60 °C; and reaction time, 28 h. The reusability of Lipozyme RM IM in the acidolysis reaction was also evaluated, and it was found that it could be reused up to 9 times without significant loss of activities. Urea inclusion method was used to separate and purify the synthetic product. As the ratio of HMFS/urea increased to 1:2, the acid value lowered to the minimum. In a scale-up experiment, the contents of TAG and total tocopherols in HMFS (modified CCSO) were 77.28% and 12.27 mg/100 g, respectively. All of the physicochemical indices of purified product were within food standards. Therefore, such a MCFA-enriched HMFS produced by using the acidolysis method might have potential application in the infant formula industry.

  18. Caution is required in interpretation of mutations in the voltage sensing domain of voltage gated channels as evidence for gating mechanisms.

    PubMed

    Kariev, Alisher M; Green, Michael E

    2015-01-12

    The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD). The primary supporting evidence came from R → C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS) reagent. The cys side chain is -SH (reactive form -S-); the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain -OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations.

  19. Food Fish Identification from DNA Extraction through Sequence Analysis

    ERIC Educational Resources Information Center

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  20. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  1. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    ERIC Educational Resources Information Center

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  2. An Inexpensive Gel Electrophoresis-Based Polymerase Chain Reaction Method for Quantifying mRNA Levels

    ERIC Educational Resources Information Center

    Bradford, William D.; Cahoon, Laty; Freel, Sara R.; Hoopes, Laura L. Mays; Eckdahl, Todd T.

    2005-01-01

    In order to engage their students in a core methodology of the new genomics era, an everincreasing number of faculty at primarily undergraduate institutions are gaining access to microarray technology. Their students are conducting successful microarray experiments designed to address a variety of interesting questions. A next step in these…

  3. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  4. Sulfur Dioxide Accelerates the Heterogeneous Oxidation Rate of Organic Aerosol by Hydroxyl Radicals

    DOE PAGES

    Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

    2016-03-08

    There remains considerable uncertainty in how anthropogenic gas phase emissions alter the oxidative aging of organic aerosols in the troposphere. Here we observe a 10-20 fold acceleration in the effective heterogeneous OH oxidation rate of organic aerosol in the presence of SO 2. This acceleration originates from the radical chain reactions propagated by alkoxy radicals, which are formed efficiently inside the particle by the reaction of peroxy radicals with SO 2. As the OH approaches atmospheric concentrations, the radical chain length increases, transforming the aerosol at rates predicted to be up to 10 times the OH-aerosol collision frequency. Model predictions,more » constrained by experiments over orders of magnitude changes in [OH] and [SO 2], suggest that in polluted regions the heterogeneous processing of organic aerosols by OH ([SO 2] ≥ 40 ppb) occur on similar time scales as analogous gas-phase oxidation reactions. These results provide evidence for a previously unidentified mechanism by which organic aerosol oxidation is enhanced by anthropogenic gas phase emissions. (Chemical Equation Presented).« less

  5. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  6. Shock tube measurements of growth constants in the branched-chain ethane-carbon monoxide-oxygen system

    NASA Technical Reports Server (NTRS)

    Brokaw, R. S.; Brabbs, T. A.; Snyder, C. A.

    1985-01-01

    Exponential free radical growth constants have been measured for ethane carbon monoxide oxygen mixtures by monitoring the growth of oxygen atom concentration as manifested by CO flame band emission. Data were obtained over the temperature range of 1200 to 1700 K. The data were analyzed using an ethane oxidation mechanism involving seven elementary reaction steps. Calculated growth constants were close to experimental values at lower temperatures, up to about 1400 K, but at higher temperatures computed growth constants were considerably smaller than experiment. In attempts to explain these results additional branching reactions were added to the mechanism. However, these additional reactions did not appreciably change calculated growth constants.

  7. Thermodynamics of enzyme-catalyzed esterifications: II. Levulinic acid esterification with short-chain alcohols.

    PubMed

    Altuntepe, Emrah; Emel'yanenko, Vladimir N; Forster-Rotgers, Maximilian; Sadowski, Gabriele; Verevkin, Sergey P; Held, Christoph

    2017-10-01

    Levulinic acid was esterified with methanol, ethanol, and 1-butanol with the final goal to predict the maximum yield of these equilibrium-limited reactions as function of medium composition. In a first step, standard reaction data (standard Gibbs energy of reaction Δ R g 0 ) were determined from experimental formation properties. Unexpectedly, these Δ R g 0 values strongly deviated from data obtained with classical group contribution methods that are typically used if experimental standard data is not available. In a second step, reaction equilibrium concentrations obtained from esterification catalyzed by Novozym 435 at 323.15 K were measured, and the corresponding activity coefficients of the reacting agents were predicted with perturbed-chain statistical associating fluid theory (PC-SAFT). The so-obtained thermodynamic activities were used to determine Δ R g 0 at 323.15 K. These results could be used to cross-validate Δ R g 0 from experimental formation data. In a third step, reaction-equilibrium experiments showed that equilibrium position of the reactions under consideration depends strongly on the concentration of water and on the ratio of levulinic acid: alcohol in the initial reaction mixtures. The maximum yield of the esters was calculated using Δ R g 0 data from this work and activity coefficients of the reacting agents predicted with PC-SAFT for varying feed composition of the reaction mixtures. The use of the new Δ R g 0 data combined with PC-SAFT allowed good agreement to the measured yields, while predictions based on Δ R g 0 values obtained with group contribution methods showed high deviations to experimental yields.

  8. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  9. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  10. Caution Is Required in Interpretation of Mutations in the Voltage Sensing Domain of Voltage Gated Channels as Evidence for Gating Mechanisms

    PubMed Central

    Kariev, Alisher M.; Green, Michael E.

    2015-01-01

    The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD). The primary supporting evidence came from R→C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS) reagent. The cys side chain is –SH (reactive form –S−); the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain –OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations. PMID:25588216

  11. Numerical verification of three point bending experiment of magnetorheological elastomer (MRE) in magnetic field

    NASA Astrophysics Data System (ADS)

    Miedzinska, Danuta; Boczkowska, Anna; Zubko, Konrad

    2010-07-01

    In the article a method of numerical verification of experimental results for magnetorheological elastomer samples (MRE) is presented. The samples were shaped into cylinders with diameter of 8 mm and height of 20 mm with various carbonyl iron volume shares (1,5%, 11,5% and 33%). The diameter of soft ferromagnetic substance particles ranged from 6 to 9 μm. During the experiment, initially bended samples were exposed to the magnetic field with intensity levels at 0,1T, 0,3T, 0,5T, 0,7 and 1T. The reaction of the sample to the field action was measured as a displacement of a specimen. Numerical calculation was carried out with the MSC Patran/Marc computer code. For the purpose of numerical analysis the orthotropic material model with the material properties of magnetorheological elastomer along the iron chains, and of the pure elastomer along other directions, was applied. The material properties were obtained from the experimental tests. During the numerical analysis, the initial mechanical load resulting from cylinder deflection was set. Then, the equivalent external force, that was set on the basis of analytical calculations of intermolecular reaction within iron chains in the specific magnetic field, was put on the bended sample. Correspondence of such numerical model with results of the experiment was verified. Similar results of the experiments and both theoretical and FEM analysis indicates that macroscopic modeling of magnetorheological elastomer mechanical properties as orthotropic material delivers accurate enough description of the material's behavior.

  12. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  13. Substrate Shuttling Between Active Sites of Uroporphyrinogen Decarboxylase in Not Required to Generate Coproporphyrinogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phillips, J.; Warby, C; Whitby, F

    2009-01-01

    Uroporphyrinogen decarboxylase (URO-D; EC 4.1.1.37), the fifth enzyme of the heme biosynthetic pathway, is required for the production of heme, vitamin B12, siroheme, and chlorophyll precursors. URO-D catalyzes the sequential decarboxylation of four acetate side chains in the pyrrole groups of uroporphyrinogen to produce coproporphyrinogen. URO-D is a stable homodimer, with the active-site clefts of the two subunits adjacent to each other. It has been hypothesized that the two catalytic centers interact functionally, perhaps by shuttling of reaction intermediates between subunits. We tested this hypothesis by construction of a single-chain protein (single-chain URO-D) in which the two subunits were connectedmore » by a flexible linker. The crystal structure of this protein was shown to be superimposable with wild-type activity and to have comparable catalytic activity. Mutations that impaired one or the other of the two active sites of single-chain URO-D resulted in approximately half of wild-type activity. The distributions of reaction intermediates were the same for mutant and wild-type sequences and were unaltered in a competition experiment using I and III isomer substrates. These observations indicate that communication between active sites is not required for enzyme function and suggest that the dimeric structure of URO-D is required to achieve conformational stability and to create a large active-site cleft.« less

  14. Determination of the Rh Factor: A Practical Illustrating the Use of the Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Imperial, Santiago; Boronat, Albert

    2005-01-01

    A practical experiment on the PCR is described that has been used over several years as part of an undergraduate biochemistry and molecular biology course for chemistry students. In the first experimental session, students prepare their own DNA samples from epithelial cells of the mouth and use them as templates in the PCR. In the second session,…

  15. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  16. Anti-knock quality of sugar derived levulinic esters and cyclic ethers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tian, Miao; McCormick, Robert L.; Luecke, Jon

    Here, the objective of this paper is to investigate the anti-knock quality of sugar-derived levulinic esters (methyl levulinate (ML) and ethyl levulinate (EL)) and cyclic ethers (furfuryl ethyl ether (FEE) and ethyl tetrahydrofurfuryl ether (ETE)). To this end, combustion experiments were carried out in both an engine and a constant volume autoignition device. The results from both apparati demonstrate that ML, EL and FEE have superior anti-knock quality than the reference Euro95 gasoline. ETE, conversely, performed markedly worse than the reference fuel on both setups and might therefore be a more appropriate fuel for compression ignition engines. The main reasonmore » of the distinctions in anti-knock quality can be found in the molecular structure of the neat biofuels. ML and EL are levulinic esters, with a ketone (C=O) functionality and an ester (C(=O)-O) group on the carbon chain. They can readily produce stable intermediates during the auto-ignition process, thereby slowing down the overall reaction rate. The unsaturated cyclic ether (FEE) has very strong ring C-H bonds. However, the saturated cyclic ether (ETE) has weak ring C-H bonds, which facilitate more readily ring opening reactions. Long side chains on the cyclic ethers further accelerate the reaction rate. Importantly for future research, our results suggest that IQT and engine experiments are interchangeable setups with respect to qualitative anti-knock quality evaluation of novel compounds.« less

  17. Anti-knock quality of sugar derived levulinic esters and cyclic ethers

    DOE PAGES

    Tian, Miao; McCormick, Robert L.; Luecke, Jon; ...

    2017-04-22

    Here, the objective of this paper is to investigate the anti-knock quality of sugar-derived levulinic esters (methyl levulinate (ML) and ethyl levulinate (EL)) and cyclic ethers (furfuryl ethyl ether (FEE) and ethyl tetrahydrofurfuryl ether (ETE)). To this end, combustion experiments were carried out in both an engine and a constant volume autoignition device. The results from both apparati demonstrate that ML, EL and FEE have superior anti-knock quality than the reference Euro95 gasoline. ETE, conversely, performed markedly worse than the reference fuel on both setups and might therefore be a more appropriate fuel for compression ignition engines. The main reasonmore » of the distinctions in anti-knock quality can be found in the molecular structure of the neat biofuels. ML and EL are levulinic esters, with a ketone (C=O) functionality and an ester (C(=O)-O) group on the carbon chain. They can readily produce stable intermediates during the auto-ignition process, thereby slowing down the overall reaction rate. The unsaturated cyclic ether (FEE) has very strong ring C-H bonds. However, the saturated cyclic ether (ETE) has weak ring C-H bonds, which facilitate more readily ring opening reactions. Long side chains on the cyclic ethers further accelerate the reaction rate. Importantly for future research, our results suggest that IQT and engine experiments are interchangeable setups with respect to qualitative anti-knock quality evaluation of novel compounds.« less

  18. Rubber elasticity for percolation network consisting of Gaussian chains.

    PubMed

    Nishi, Kengo; Noguchi, Hiroshi; Sakai, Takamasa; Shibayama, Mitsuhiro

    2015-11-14

    A theory describing the elastic modulus for percolation networks of Gaussian chains on general lattices such as square and cubic lattices is proposed and its validity is examined with simulation and mechanical experiments on well-defined polymer networks. The theory was developed by generalizing the effective medium approximation (EMA) for Hookian spring network to Gaussian chain networks. From EMA theory, we found that the ratio of the elastic modulus at p, G to that at p = 1, G0, must be equal to G/G0 = (p - 2/f)/(1 - 2/f) if the position of sites can be determined so as to meet the force balance, where p is the degree of cross-linking reaction. However, the EMA prediction cannot be applicable near its percolation threshold because EMA is a mean field theory. Thus, we combine real-space renormalization and EMA and propose a theory called real-space renormalized EMA, i.e., REMA. The elastic modulus predicted by REMA is in excellent agreement with the results of simulations and experiments of near-ideal diamond lattice gels.

  19. Rubber elasticity for percolation network consisting of Gaussian chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishi, Kengo, E-mail: kengo.nishi@phys.uni-goettingen.de, E-mail: sakai@tetrapod.t.u-tokyo.ac.jp, E-mail: sibayama@issp.u-tokyo.ac.jp; Noguchi, Hiroshi; Shibayama, Mitsuhiro, E-mail: kengo.nishi@phys.uni-goettingen.de, E-mail: sakai@tetrapod.t.u-tokyo.ac.jp, E-mail: sibayama@issp.u-tokyo.ac.jp

    2015-11-14

    A theory describing the elastic modulus for percolation networks of Gaussian chains on general lattices such as square and cubic lattices is proposed and its validity is examined with simulation and mechanical experiments on well-defined polymer networks. The theory was developed by generalizing the effective medium approximation (EMA) for Hookian spring network to Gaussian chain networks. From EMA theory, we found that the ratio of the elastic modulus at p, G to that at p = 1, G{sub 0}, must be equal to G/G{sub 0} = (p − 2/f)/(1 − 2/f) if the position of sites can be determined somore » as to meet the force balance, where p is the degree of cross-linking reaction. However, the EMA prediction cannot be applicable near its percolation threshold because EMA is a mean field theory. Thus, we combine real-space renormalization and EMA and propose a theory called real-space renormalized EMA, i.e., REMA. The elastic modulus predicted by REMA is in excellent agreement with the results of simulations and experiments of near-ideal diamond lattice gels.« less

  20. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Knockout of the regulatory site of 3-ketoacyl-ACP synthase III enhances short- and medium-chain acyl-ACP synthesis.

    PubMed

    Abbadi, A; Brummel, M; Spener, F

    2000-10-01

    3-ketoacyl-acyl carrier protein synthase (KAS) III catalyses the first condensing step of the fatty acid synthase (FAS) type II reaction in plants and bacteria, using acetyl CoA and malonyl-acyl carrier protein (ACP) as substrates. Enzymatic characterization of recombinant KAS III from Cuphea wrightii embryo shows that this enzyme is strongly inhibited by medium-chain acyl-ACP end products of the FAS reaction, i.e. inhibition by lauroyl-ACP was uncompetitive towards acetyl CoA and non-competitive with regard to malonyl-ACP. This indicated a distinct attachment site for regulatory acyl-ACPs. Based on alignment of primary structures of various KAS IIIs and 3-ketoacyl CoA synthases, we suspected the motif G290NTSAAS296 to be responsible for binding of regulatory acyl-ACPs. Deletion of the tetrapeptide G290NTS293 led to a change of secondary structure and complete loss of KAS III condensing activity. Exchange of asparagine291 to aspartate, alanine294 to serine and alanine295 to proline, however, produced mutant enzymes with slightly reduced condensing activity, yet with insensitivity towards acyl-ACPs. To assess the potential of unregulated KAS III as tool in oil production, we designed in vitro experiments employing FAS preparations from medium-chain fatty acid-producing Cuphea lanceolata seeds and long-chain fatty acid-producing rape seeds, each supplemented with a fivefold excess of the N291D KAS III mutant. High amounts of short-chain acyl-ACPs in the case of C. lanceolata, and of medium-chain acyl-ACPs in the case of rape seed preparations, were obtained. This approach targets regulation and offers new possibilities to derive transgenic or non-transgenic plants for production of seed oils with new qualities.

  2. First experiment at TASCA towards X-ray fingerprinting of element 115 decay chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Forsberg, U.; Golubev, P.; Sarmiento, L. G.

    2012-01-01

    To identify the atomic number of superheavy nuclei produced in 48Ca-induced fusion-evaporation reactions, an experiment aiming at measuring characteristic X-rays is being prepared at GSI, Darmstadt, Germany. The gas-filled separator TASCA will be employed, sending the residues towards the multi-coincidence detector setup TASISpec. Two ionoptical modes relying on differing magnetic polarities of the quadrupole magnets can be used at TASCA. New simulations and experimental tests of transmission and background suppression for these two focusing modes into TASISpec are presented.

  3. Genes In Space-5

    NASA Image and Video Library

    2018-04-13

    iss055e020319 (April 13, 2018) --- Flight Engineer Ricky Arnold processes of samples inside the Miniature Polymerase Chain Reaction (miniPCR) for the Genes In Space-5 experiment. The research gathered from Genes in Space-5 may be valuable in the development of procedures to maintain astronaut health and prevent an increased risk of cancer on deep space missions. The investigation also provides a deeper understanding of the human immune system, while giving student researchers a direct connection to the space program and offering hands-on educational experiences on Earth and promoting involvement in STEM fields.

  4. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  5. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  6. Irreversible Heavy Chain Transfer to Chondroitin*

    PubMed Central

    Lauer, Mark E.; Hascall, Vincent C.; Green, Dixy E.; DeAngelis, Paul L.; Calabro, Anthony

    2014-01-01

    We have recently demonstrated that the transfer of heavy chains (HCs) from inter-α-inhibitor, via the enzyme TSG-6 (tumor necrosis factor-stimulated gene 6), to hyaluronan (HA) oligosaccharides is an irreversible event in which subsequent swapping of HCs between HA molecules does not occur. We now describe our results of HC transfer experiments to chondroitin sulfate A, chemically desulfated chondroitin, chemoenzymatically synthesized chondroitin, unsulfated heparosan, heparan sulfate, and alginate. Of these potential HC acceptors, only chemically desulfated chondroitin and chemoenzymatically synthesized chondroitin were HC acceptors. The kinetics of HC transfer to chondroitin was similar to HA. At earlier time points, HCs were more widely distributed among the different sizes of chondroitin chains. As time progressed, the HCs migrated to lower molecular weight chains of chondroitin. Our interpretation is that TSG-6 swaps the HCs from the larger, reversible sites on chondroitin chains, which function as HC acceptors, onto smaller chondroitin chains, which function as irreversible HC acceptors. HCs transferred to smaller chondroitin chains were unable to be swapped off the smaller chondroitin chains and transferred to HA. HCs transferred to high molecular weight HA were unable to be swapped onto chondroitin. We also present data that although chondroitin was a HC acceptor, HA was the preferred acceptor when chondroitin and HA were in the same reaction mixture. PMID:25135638

  7. Pooling Cervical Swabs and Testing by Ligase Chain Reaction Are Accurate and Cost-Saving Strategies for Diagnosis of Chlamydia trachomatis

    PubMed Central

    Kapala, J.; Copes, D.; Sproston, A.; Patel, J.; Jang, D.; Petrich, A.; Mahony, J.; Biers, K.; Chernesky, M.

    2000-01-01

    Specimen pooling to achieve efficiency when testing urine specimens for Chlamydia trachomatis nucleic acids has been suggested. We pooled endocervical swabs from 1,288 women and also tested individual swabs by ligase chain reaction (LCR). Out of 53 positive specimens, pools of 4 or 8 specimens missed two positives, providing 96.2% accuracy compared to individual test results. Dilution and positive-control spiking experiments showed that negative specimens with inhibitors of LCR in the pool reduced the signal. Conversely, two extra positives, detected only through pooling, were negative by individual testing but became positive after storage, suggesting that fresh positive specimens with labile inhibitors may be positive in a pool because of dilution of inhibitors. For this population of women with a 4% prevalence of C. trachomatis infection, substantial savings in cost of reagents (55 to 63%) and technologist time (50 to 63%) made pooling strategies a desirable alternative to individual testing. PMID:10878029

  8. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    PubMed

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  9. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  10. Inference of reaction rate parameters based on summary statistics from experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin

    Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

  11. Inference of reaction rate parameters based on summary statistics from experiments

    DOE PAGES

    Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin; ...

    2016-10-15

    Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

  12. RT-qPCR Demonstrates Light-Dependent AtRBCS1A and AtRBCS3B mRNA Expressions in "Arabidopsis thaliana" Leaves

    ERIC Educational Resources Information Center

    Chang, Ming-Mei; Li, Anna; Feissner, Robert; Ahmad, Talal

    2016-01-01

    Reverse transcription quantitative polymerase chain reaction (RT-qPCR) is widely used in diagnosis and research to determine specific mRNA expressions in cells. As RT-qPCR applications increase, it is necessary to provide undergraduates hands-on experience of this modern technique. Here, we report a 3-week laboratory exercise using RT-qPCR to…

  13. Tested Studies for Laboratory Teaching. Proceedings of the Workshop/Conference of the Association for Biology Laboratory Education (ABLE) (15th, Toronto, Ontario, Canada, June 8-12, 1993). Volume 15.

    ERIC Educational Resources Information Center

    Goldman, Corey A., Ed.

    The focus of the Association for Biology Laboratory Education (ABLE) is to improve the undergraduate biology laboratory experience by promoting the development and dissemination of interesting, innovative, and reliable laboratory exercises. This proceedings volume contains 18 papers: "Human DNA Fingerprinting by Polymerase Chain Reaction" (M. V.…

  14. Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.

    PubMed

    Xue, J; Feng, Y

    2018-06-01

    Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.

  15. Novel route of synthesis for cellulose fiber-based hybrid polyurethane

    NASA Astrophysics Data System (ADS)

    Ikhwan, F. H.; Ilmiati, S.; Kurnia Adi, H.; Arumsari, R.; Chalid, M.

    2017-07-01

    Polyurethanes, obtained by the reaction of a diisocyanate compound with bifunctional or multifunctional reagent such as diols or polyols, have been studied intensively and well developed. The wide range modifier such as chemical structures and molecular weight to build polyurethanes led to designs of materials that may easily meet the functional product demand and to the extraordinary spreading of these materials in market. Properties of the obtained polymer are related to the chemical structure of polyurethane backbone. A number polyurethanes prepared from biomass-based monomers have been reported. Cellulose fiber, as a biomass material is containing abundant hydroxyl, promising material as chain extender for building hybrid polyurethanes. In previous researches, cellulose fiber was used as filler in synthesis of polyurethane composites. This paper reported a novel route of hybrid polyurethane synthesis, which a cellulose fiber was used as chain extender. The experiment performed by reacting 4,4’-Methylenebis (cyclohexyl isocyanate) (HMDI) and polyethylene glycol with variation of molecular weight to obtained pre-polyurethane, continued by adding micro fiber cellulose (MFC) with variation of type and composition in the mixture. The experiment was evaluated by NMR, FTIR, SEM and STA measurement. NMR and FTIR confirmed the reaction of the hybrid polyurethane. STA showed hybrid polyurethane has good thermal stability. SEM showed good distribution and dispersion of sorghum-based MFC.

  16. Monte Carlo Simulation of Endlinking Oligomers

    NASA Technical Reports Server (NTRS)

    Hinkley, Jeffrey A.; Young, Jennifer A.

    1998-01-01

    This report describes initial efforts to model the endlinking reaction of phenylethynyl-terminated oligomers. Several different molecular weights were simulated using the Bond Fluctuation Monte Carlo technique on a 20 x 20 x 20 unit lattice with periodic boundary conditions. After a monodisperse "melt" was equilibrated, chain ends were linked whenever they came within the allowed bond distance. Ends remained reactive throughout, so that multiple links were permitted. Even under these very liberal crosslinking assumptions, geometrical factors limited the degree of crosslinking. Average crosslink functionalities were 2.3 to 2.6; surprisingly, they did not depend strongly on the chain length. These results agreed well with the degrees of crosslinking inferred from experiment in a cured phenylethynyl-terminated polyimide oligomer.

  17. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  18. Rheological analysis of irradiated crosslinkable and scissionable polymers used for medical devices under different radiation conditions

    NASA Astrophysics Data System (ADS)

    Satti, A. J.; Ressia, J. A.; Cerrada, M. L.; Andreucetti, N. A.; Vallés, E. M.

    2018-03-01

    The effects on different synthetic polymers of distinct types of radiation, gamma rays and electron beam, under different atmospheres are followed by changes in their viscoelastic behavior. Taking into account the two main radioinduced reactions, crosslinking and scissioning of polymeric chains, liquid polydimethylsiloxane has been used as example of crosslinkable polymer and semi crystalline polypropylene as example of scissionable polymer. Propylene - 1-hexene copolymers have been also evaluated, and the effects of both reactions were clearly noticed. Accordingly, samples of those aforementioned polymers have been irradiated with 60Co gamma irradiation in air and under vacuum, and also with electron beam, at similar doses. Sinusoidal dynamic oscillation experiments showed a significant increase in branching and crosslinking reactions when specimens are irradiated under vacuum, while scissioning reactions were observed for the different polymers when irradiation takes place under air with either gamma irradiation or electron beam.

  19. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  20. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  1. Selection of single chain antibody fragments binding to the extracellular domain of 4-1BB receptor by phage display technology.

    PubMed

    Bagheri, Salman; Yousefi, Mehdi; Safaie Qamsari, Elmira; Riazi-Rad, Farhad; Abolhassani, Mohsen; Younesi, Vahid; Dorostkar, Ruhollah; Movassaghpour, Ali Akbar; Sharifzadeh, Zahra

    2017-03-01

    The 4-1BB is a surface glycoprotein that pertains to the tumor necrosis factor-receptor family. There is compelling evidence suggesting important roles for 4-1BB in the immune response, including cell activation and proliferation and also cytokine induction. Because of encouraging results of different agonistic monoclonal antibodies against 4-1BB in the treatment of cancer, infectious, and autoimmune diseases, 4-1BB has been suggested as an attractive target for immunotherapy. In this study, single chain variable fragment phage display libraries, Tomlinson I+J, were screened against specific synthetic oligopeptides (peptides I and II) designed from 4-1BB extracellular domain. Five rounds of panning led to selection of four 4-1BB specific single chain variable fragments (PI.12, PI.42, PII.16, and PII.29) which showed specific reaction to relevant peptides in phage enzyme-linked immunosorbent assay. The selected clones were successfully expressed in Escherichia coli Rosetta-gami 2, and their expression was confirmed by western blot analysis. Enzyme-linked immunosorbent assay experiments indicated that these antibodies were able to specifically recognize 4-1BB without any cross-reactivity with other antigens. Flow cytometry analysis demonstrated an acceptable specific binding of the single chain variable fragments to 4-1BB expressed on CCRF-CEM cells, while no binding was observed with an irrelevant antibody. Anti-4-1BB single chain variable fragments enhanced surface CD69 expression and interleukin-2 production in stimulated CCRF-CEM cells which confirmed the agonistic effect of the selected single chain variable fragments. The data from this study have provided a rationale for further experiments involving the biological functions of anti-4-1BB single chain variable fragments in future studies.

  2. Palladium-Catalyzed Oxidative Couplings and Applications to the Synthesis of Macrocycles and Strained Cyclic Dienes

    NASA Astrophysics Data System (ADS)

    Boon, Byron Adrian

    The palladium(II)-catalyzed oxidative macrocyclization of bis(vinylboronate esters) is demonstrated as an efficient method for the synthesis of macrocyclic dienes. The macrocyclization reactions feature mild conditions due to a palladium(II) catalytic cycle which obviates the need for a high energy oxidative addition step of standard palladium(0) catalytic cycles. Instead, this oxidative coupling is promoted by chloroacetone as a terminal re-oxidant in the catalytic cycle. An extension of the oxidative coupling/macrocyclization strategy is highlighted where molecular oxygen may be used in place of chloroacetone as the terminal re-oxidant. Homocoupling reactions of vinylboronate esters served as a template to screen reaction conditions for this method. From these experiments, multiple reaction conditions gave the oxidative homocoupling product in high yield. These reaction conditions were successfully applied to the oxidative macrocyclization of a bis(vinylboronate ester) using molecular oxygen as a re-oxidant. Syntheses of strained cyclic dienes were accomplished via the palladium(II)-catalyzed oxidative cyclizations of terminal bis(vinylboronate esters). The reactions generated strained (E,E)-1,3-dienes that underwent spontaneous 4?-electrocyclizations to form bicyclic cyclobutenes. Formation of the cyclobutenes is driven by strain in the medium-ring (E,E)-1,3-diene intermediates. Thermal ring openings of the cyclobutenes give (Z,Z)-1,3-diene products, again for thermodynamic reasons. These results are in contrast with typical acyclic trans-3,4-dialkyl cyclobutenes, which favor outward torquoselective ring-openings to give (E,E)-1,3-dienes. DFT calculations verified the thermodynamic versus kinetic control of the reactions and kinetic studies are in excellent agreement with the calculated energy changes. Investigations on the transannular Pauson-Khand reaction are also highlighted. The Pauson-Khand reaction is a powerful tool for the synthesis of cyclopentenones through the efficient [2+2+1] cycloaddition of dicobalt alkyne complexes with alkenes. While intermolecular and intramolecular variants are widely known, transannular versions of this reaction are unknown and the basis of this study. Our successful transannular Pauson-Khand reaction required a cyclic enyne incorporating one short three-membered linker chain and a rigid aryl linker in the backbone of the long linker chain. This rigidity of the aryl linker is proposed to facilitate the transannular [2+2+1] cyclization. Computational studies revealed that transannular Pauson-Khand reactions are thermodynamically favored for cyclic enynes featuring a long linker of at least 5 carbons, but with smaller chains the reactions are thermodynamically disfavored. Experimental studies show that long linking chains with more than 5 members are required to prevent to steric interactions between the dicobalt hexacarbonyl moiety and the linking chain to allow the reaction to be kinetically favored. The final part of this work highlights progress towards the total synthesis of (+)-kingianin A. This natural product was isolated as a racemic mixture from the bark of Endiandra kingiana and is an inhibitor of antiapoptotic protein Bcl-Xl, highlighting its potential use in cancer treatments. Its structure is proposed to arise from an intermolecular Diels-Alder dimerization reaction of bicyclo[4.2.0]octadiene fragments derived from an 8pi/6pi-electrocyclization cascade. Although two total syntheses of (+/-)-kingianin A have been reported, an enantioselective synthesis has not been achieved and is the purpose of this study. This synthetic route begins from L-(+)-dimethyl tartrate, a cheap and commercially available starting material, and aims to follow a biomimetic synthetic pathway featuring a substrate controlled diastereoselective palladium(II)-catalyzed oxidative cyclization and 8pi/6pi-electrocyclization cascade. Although the feasibility of this cascade pathway has not yet been realized, key synthetic transformations to install the requisite carbocyclic framework of (+)-kingianin A have been discovered, paving the way for future investigations on the palladium(II)-catalyzed coupling/electrocyclization cascade and completion of the synthesis.

  3. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  4. NMR-based conformational analysis of perezone and analogues.

    PubMed

    Zepeda, L Gerardo; Burgueño-Tapia, Eleuterio; Pérez-Hernández, Nury; Cuevas, Gabriel; Joseph-Nathan, Pedro

    2013-04-01

    Complete assignment of the (1)H NMR chemical shift and coupling constant values of perezone (1), O-methylperezone (2) and 6-hydroxyperezone (3) was carried out by total-line-shape-fitting calculations using the PERCH iterative spectra analysis software (PERCH Solutions Ltd., Kuopio, Finland). The resulting simulated spectra for the three compounds showed strong similarity to their corresponding experimental spectra. Particularly, all vicinal, allylic and homoallylic coupling constant values for the side chain of the three compounds were very similar, thus revealing that the conformation of these three molecules in solution is indeed almost identical. This fact is in agreement with extended side chain conformations over folded chain conformations because 1, 2 and 3 undergo completely different intramolecular cycloaddition reactions. In addition, results of double pulsed field gradient spin echo NOESY 1D experiments performed on perezone (1) were unable to provide evidence for folded conformers. Copyright © 2013 John Wiley & Sons, Ltd.

  5. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  7. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  8. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  9. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  10. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  12. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  13. Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A

    2013-01-01

    Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. Wemore » observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.« less

  14. Comprehensive Nuclear-Test-Ban Treaty: Issues and Arguments

    DTIC Science & Technology

    2008-02-28

    is the point at which this chain reaction occurs; a “ critical mass ” is the amount of fissile material just enough to support criticality . The...amount of material for a critical mass depends on many factors, such as shape, density, impurities that absorb neutrons, and use of material to reflect...the years. Hydronuclear experiments were conducted during the 1958-1961 nuclear test moratorium. They initially used less than a critical mass of

  15. Exclusion of black hole disaster scenarios at the LHC

    NASA Astrophysics Data System (ADS)

    Koch, Benjamin; Bleicher, Marcus; Stöcker, Horst

    2009-02-01

    The upcoming high energy experiments at the LHC are one of the most outstanding efforts for a better understanding of nature. It is associated with great hopes in the physics community. But there is also some fear in the public, that the conjectured production of mini black holes might lead to a dangerous chain reaction. In this Letter we summarize the most straightforward arguments that are necessary to rule out such doomsday scenarios.

  16. Phi-value analysis of apo-azurin folding: comparison between experiment and theory.

    PubMed

    Zong, Chenghang; Wilson, Corey J; Shen, Tongye; Wolynes, Peter G; Wittung-Stafshede, Pernilla

    2006-05-23

    Pseudomonas aeruginosa azurin is a 128-residue beta-sandwich metalloprotein; in vitro kinetic experiments have shown that it folds in a two-state reaction. Here, we used a variational free energy functional to calculate the characteristics of the transition state ensemble (TSE) for folding of the apo-form of P. aeruginosa azurin and investigate how it responds to thermal and mutational changes. The variational method directly yields predicted chevron plots for wild-type and mutant apo-forms of azurin. In parallel, we performed in vitro kinetic-folding experiments on the same set of azurin variants using chemical perturbation. Like the wild-type protein, all apo-variants fold in apparent two-state reactions both in calculations and in stopped-flow mixing experiments. Comparisons of phi (phi) values determined from the experimental and theoretical chevron parameters reveal an excellent agreement for most positions, indicating a polarized, highly structured TSE for folding of P. aeruginosa apo-azurin. We also demonstrate that careful analysis of side-chain interactions is necessary for appropriate theoretical description of core mutants.

  17. Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

    PubMed

    Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

    2010-09-01

    This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  18. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  19. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  20. Case-Study Investigation of Equine Maternity via PCR-RFLP: A Biochemistry Laboratory Experiment

    PubMed Central

    Millard, Julie T.; Chuang, Edward; Lucas, James S.; Nagy, Erzsebet E.; Davis, Griffin T.

    2013-01-01

    A simple and robust biochemistry laboratory experiment is described that uses restriction fragment length polymorphism (RFLP) of polymerase chain reaction (PCR) products to verify the identity of a potentially valuable horse. During the first laboratory period, students purify DNA from equine samples and amplify two loci of mitochondrial DNA. During the second laboratory period, students digest PCR products with restriction enzymes and analyze the fragment sizes through agarose gel electrophoresis. An optional step of validating DNA extracts through realtime PCR can expand the experiment to three weeks. This experiment, which has an engaging and versatile scenario, provides students with exposure to key principles and techniques of molecular biology, bioinformatics, and evolution in a forensic context. PMID:24363455

  1. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  2. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  3. Mechanical properties experimental investigation of HTPB propellant after thermal accelerated aging

    NASA Astrophysics Data System (ADS)

    Yang, Xiaohong; Sun, Chaoxiang; Zhang, Junfa; Xu, Jinsheng; Tan, Bingdong

    2017-04-01

    To get accurate aging mechanical properties of aged HTPB propellant, the thermal accelerated aging experiment method is utilized and the uniaxial tensile experiments were conducted to obtain the mechanical data of aged HTPB propellants, and the maximum tensile strength, σm, maximum tensile strain, ɛm, and the fracture tensile strain, ɛb, of HTPB propellant with different aging time and various aging temperatures,were obtained, using universal material testing machine. The experimental results show that the σm of HTPB propellant initially increases, subsequently decreases and finally increases with aging time. The ɛm and ɛb generally decrease with increasing aging time, what's more, the decrease rate of both ɛm and ɛb reduce with the aging time. What's more, the postcure effect and oxidation reaction occurred inside HTPB matrix, including the chain degradation reaction and oxidation-induced crosslinking, were discussed to explain the mechanical aging rule of HTPB propellant.

  4. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  5. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  6. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  7. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  8. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

    PubMed

    Kidd, I M; Clark, D A; Emery, V C

    2000-06-01

    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

  9. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  10. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  11. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  12. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  13. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  14. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  15. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  16. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  17. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  18. Rhodium(I)-Catalyzed Ring-Closing Reaction of Allene-Alkene-Alkynes: One-Step Construction of Tricyclo[6.4.0.02,6 ] and Bicyclo[6.3.0] Skeletons from Linear Carbon Chains.

    PubMed

    Kawaguchi, Yasuaki; Nagata, Asami; Kurokawa, Kei; Yokosawa, Haruna; Mukai, Chisato

    2018-05-02

    Treatment of dodecatrienyne derivatives with [RhCl(CO) 2 ] 2 in refluxing toluene effected the cycloisomerization to produce tricyclo[6.4.0.0 2,6 ]dodecadienes. The one-carbon shortened undecatrienyne derivatives, however, afforded bicyclo[6.3.0]undecatriene derivatives instead of tricyclic compounds, the latter of which are well known as a basic skeleton of naturally occurring octanoids. On the basis of two experiments with deuterated substrates, a plausible reaction mechanism for the construction of these products was proposed. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Various nanoparticle morphologies and surface properties of waterborne polyurethane controlled by water

    PubMed Central

    Zhou, Xing; Fang, Changqing; Lei, Wanqing; Du, Jie; Huang, Tingyi; Li, Yan; Cheng, Youliang

    2016-01-01

    Water plays important roles in organic reactions such as polyurethane synthesis, and the aqueous solution environment affects polymer morphology and other properties. This paper focuses on the morphology and surface properties of waterborne polyurethane resulting from the organic reaction in water involving different forms (solid and liquid), temperatures and aqueous solutions. We provide evidence from TEM observations that the appearance of polyurethane nanoparticles in aqueous solutions presents diverse forms, including imperfect spheres, perfect spheres, perfect and homogenous spheres and tubes. Based on the results on FTIR, GPC, AFM and XRD experiments, we suggest that the shape of the nanoparticles may be decided by the crimp degree (i.e., the degree of polyurethane chains intertangling in the water environment) and order degree, which are determined by the molecular weight (Mn) and hydrogen bonds. Meanwhile, solid water and high-temperature water can both reduce hard segments that gather on the polyurethane film surface to reduce hydrophilic groups and produce a soft surface. Our findings show that water may play key roles in aqueous polymer formation and bring order to molecular chains. PMID:27687001

  20. Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

    PubMed

    Po, F; Le Dimna, M; Le Potier, M F

    2011-12-01

    Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

  1. Long-range electron tunneling.

    PubMed

    Winkler, Jay R; Gray, Harry B

    2014-02-26

    Electrons have so little mass that in less than a second they can tunnel through potential energy barriers that are several electron-volts high and several nanometers wide. Electron tunneling is a critical functional element in a broad spectrum of applications, ranging from semiconductor diodes to the photosynthetic and respiratory charge transport chains. Prior to the 1970s, chemists generally believed that reactants had to collide in order to effect a transformation. Experimental demonstrations that electrons can transfer between reactants separated by several nanometers led to a revision of the chemical reaction paradigm. Experimental investigations of electron exchange between redox partners separated by molecular bridges have elucidated many fundamental properties of these reactions, particularly the variation of rate constants with distance. Theoretical work has provided critical insights into the superexchange mechanism of electronic coupling between distant redox centers. Kinetics measurements have shown that electrons can tunnel about 2.5 nm through proteins on biologically relevant time scales. Longer-distance biological charge flow requires multiple electron tunneling steps through chains of redox cofactors. The range of phenomena that depends on long-range electron tunneling continues to expand, providing new challenges for both theory and experiment.

  2. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  3. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  4. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  5. Comprehensive Nuclear-Test-Ban Treaty: Issues and Arguments

    DTIC Science & Technology

    2008-03-12

    further fissions. “ Criticality ” is the point at which this chain reaction occurs; a “ critical mass ” is the amount of fissile material just enough to...support criticality . The amount of material for a critical mass depends on many factors, such as shape, density, impurities that absorb neutrons, and use...less than a critical mass of fissile material; as the amount of this material was stepped up toward criticality from one experiment to the next, some of

  6. Identification of a whitefly species by genomic and behavioral studies

    USGS Publications Warehouse

    Perring, T.M.; Cooper, A.D.; Rodriguez, R.J.; Farrar, C.A.; Bellows, T.S.

    1993-01-01

    An introduced whitefly species, responsible for over a half billion dollars in damage to U.S. agricultural production in 1991, is morphologically indistinguishable from Bemisia tabaci (Gennadius). However, with the use of polymerase chain reaction-based DNA differentiation tests, allozymic frequency analyses, crossing experiments, and mating behavior studies, the introduced whitefly is found to be a distinct species. Recognition of this new species, the silverleaf whitefly, is critical in the search for management options.

  7. PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

    PubMed

    Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

    2014-03-01

    To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

  8. Measurements of cross sections and decay properties of the isotopes of elements 112, 114, and 116 produced in the fusion reactions 233,238 U , 242Pu , and 248Cm + 48Ca

    NASA Astrophysics Data System (ADS)

    Oganessian, Yu. Ts.; Utyonkov, V. K.; Lobanov, Yu. V.; Abdullin, F. Sh.; Polyakov, A. N.; Shirokovsky, I. V.; Tsyganov, Yu. S.; Gulbekian, G. G.; Bogomolov, S. L.; Gikal, B. N.; Mezentsev, A. N.; Iliev, S.; Subbotin, V. G.; Sukhov, A. M.; Voinov, A. A.; Buklanov, G. V.; Subotic, K.; Zagrebaev, V. I.; Itkis, M. G.; Patin, J. B.; Moody, K. J.; Wild, J. F.; Stoyer, M. A.; Stoyer, N. J.; Shaughnessy, D. A.; Kenneally, J. M.; Wilk, P. A.; Lougheed, R. W.; Il'Kaev, R. I.; Vesnovskii, S. P.

    2004-12-01

    We have studied the dependence of the production cross sections of the isotopes 282,283 112 and 286,287 114 on the excitation energy of the compound nuclei 286112 and 290114 . The maximum cross section values of the xn -evaporation channels for the reaction 238U ( 48Ca ,xn) 286-x 112 were measured to be σ3n = 2.5 +1.8 -1.1 pb and σ4n = 0.6 +1.6 -0.5 pb ; for the reaction 242Pu ( 48Ca ,xn) 290-x 114 : σ2n ˜0.5 pb , σ3n = 3.6 +3.4 -1.7 pb , and σ4n = 4.5 +3.6 -1.9 pb . In the reaction 233U ( 48Ca ,2 4n) 277 279 112 at E*=34.9±2.2 MeV we measured an upper cross section limit of σxn ⩽0.6 pb . The observed shift of the excitation energy associated with the maximum sum evaporation residue cross section σER (E*) to values significantly higher than that associated with the calculated Coulomb barrier can be caused by the orientation of the deformed target nucleus in the entrance channel of the reaction. An increase of σER in the reactions of actinide targets with 48Ca is consistent with the expected increase of the survivability of the excited compound nucleus upon closer approach to the closed neutron shell N=184 . In the present work we detected 33 decay chains arising in the decay of the known nuclei 282112 , 283112 , 286114 , 287114 , and 288114 . In the decay of 287114 (α) → 283112 (α) → 279110 (SF) , in two cases out of 22, we observed decay chains of four and five sequential α transitions that end in spontaneous fission of 271Sg ( Tα/SF = 2.4 +4.3 -1.0 min) and 267Rf ( TSF ˜2.3 h) , longer decay chains than reported previously. We observed the new nuclide 292116 ( Tα = 18 +16 -6 ms, Eα =10.66±0.07 MeV) in the irradiation of the 248Cm target at a higher energy than in previous experiments. The observed nuclear decay properties of the nuclides with Z=104 118 are compared with theoretical nuclear mass calculations and the systematic trends of spontaneous fission properties. As a whole, they give a consistent pattern of decay of the 18 even- Z neutron-rich nuclides with Z=104 118 and N=163 177 . The experiments were performed with the heavy-ion beam delivered by the U400 cyclotron of the FLNR (JINR, Dubna) employing the Dubna gas-filled recoil separator.

  9. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  10. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  11. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  12. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  13. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  14. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  15. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  16. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  17. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  18. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  19. Mechanism and regulation of mycobactin fatty acyl-AMP ligase FadD33.

    PubMed

    Vergnolle, Olivia; Xu, Hua; Blanchard, John S

    2013-09-27

    Mycobacterial siderophores are critical components for bacterial virulence in the host. Pathogenic mycobacteria synthesize iron chelating siderophores named mycobactin and carboxymycobactin to extract intracellular macrophage iron. The two siderophores differ in structure only by a lipophilic aliphatic chain attached on the ε-amino group of the lysine mycobactin core, which is transferred by MbtK. Prior to acyl chain transfer, the lipophilic chain requires activation by a specific fatty acyl-AMP ligase FadD33 (also known as MbtM) and is then loaded onto phosphopantetheinylated acyl carrier protein (holo-MbtL) to form covalently acylated MbtL. We demonstrate that FadD33 prefers long chain saturated lipids and initial velocity studies showed that FadD33 proceeds via a Bi Uni Uni Bi ping-pong mechanism. Inhibition experiments suggest that, during the first half-reaction (adenylation), fatty acid binds first to the free enzyme, followed by ATP and the release of pyrophosphate to form the adenylate intermediate. During the second half-reaction (ligation), holo-MbtL binds to the enzyme followed by the release of products AMP and acylated MbtL. In addition, we characterized a post-translational regulation mechanism of FadD33 by the mycobacterial protein lysine acetyltransferase in a cAMP-dependent manner. FadD33 acetylation leads to enzyme inhibition, which can be reversed by the NAD(+)-dependent deacetylase, MSMEG_5175 (DAc1). To the best of our knowledge, this is the first time that bacterial siderophore synthesis has been shown to be regulated via post-translational protein acetylation.

  20. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  1. The measured and calculated affinity of methyl and methoxy substituted benzoquinones for the QA site of bacterial reaction centers

    PubMed Central

    Zheng, Zhong; Dutton, P. Leslie; Gunner, M. R.

    2010-01-01

    Quinones play important roles in mitochondrial and photosynthetic energy conversion acting as intramembrane, mobile electron and proton carriers between catalytic sites in various electron transfer proteins. They display different affinity, selectivity, functionality and exchange dynamics in different binding sites. The computational analysis of quinone binding sheds light on the requirements for quinone affinity and specificity. The affinities of ten oxidized, neutral benzoquinones (BQs) were measured for the high affinity QA site in the detergent solubilized Rhodobacter sphaeroides bacterial photosynthetic reaction center. Multi-Conformation Continuum Electrostatics (MCCE) was then used to calculate their relative binding free energies by Grand Canonical Monte Carlo sampling with a rigid protein backbone, flexible ligand and side chain positions and protonation states. Van der Waals and torsion energies, Poisson-Boltzmann continuum electrostatics and accessible surface area dependent ligand-solvent interactions are considered. An initial, single cycle of GROMACS backbone optimization improves the match with experiment as do coupled ligand and side chain motions. The calculations match experiment with an RMSD of 2.29 and a slope of 1.28. The affinities are dominated by favorable protein-ligand van der Waals rather than electrostatic interactions. Each quinone appears in a closely clustered set of positions. Methyl and methoxy groups move into the same positions as found for the native quinone. Difficulties putting methyls into methoxy sites are observed. Calculations using an SAS dependent implicit van der Waals interaction smoothed out small clashes, providing a better match to experiment with a RMSD of 0.77 and a slope of 0.97. PMID:20607696

  2. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  3. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  5. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  6. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  7. Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

    PubMed

    Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

    2017-01-01

    Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

  8. [Treatment of cetyltrimethyl ammonium bromide wastewater by potassium ferrate].

    PubMed

    Yang, Wei-hua; Wang, Hong-hui; Zeng, Xiao-xu; Huang, Ting-ting

    2009-08-15

    A novel oxidant potassium ferrate (K2FeO4) was used to remove cetyltrimethyl ammonium bromide (CTAB) at room temperature. The effects of various conditions on the removal ratio, such as reaction time, dosing quantity of K2FeO4 and initial pH, were investigated. The experiments results show that the removal ratio reaches 79.4% when the reaction time is 30 min, the dosing quantity of K2FeO4 to CTAB is 1:1, the initial pH of the solution is 7. In the reaction progress, the oxidation of K2FeO4 and the flocculation of the reduction product have synergistic effect on the removal of CTAB. In addition, infrared spectra of CTAB before and after being treated with K2FeO4 were further studied. The results indicate that the degradation process involves the interruption of chain and the subsequent mineralization to inorganic molecules. Furthermore, the reaction of K2FeO4 and CTAB follows second order kinetics law.

  9. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  10. Confirmation of the Decay of 283112 and First Indication for Hg-like Behavior of Element 112

    NASA Astrophysics Data System (ADS)

    Eichler, R.; Aksenov, N. V.; Belozerov, A. V.; Bozhikov, G. A.; Chepigin, V. I.; Dressler, R.; Dmitriev, S. N.; Gäggeler, H. W.; Gorshkov, V. A.; Haenssler, F.; Itkis, M. G.; Lebedev, V. Ya.; Laube, A.; Malyshev, O. N.; Oganessian, Yu. Ts.; Petruschkin, O. V.; Piguet, D.; Rasmussen, P.; Shishkin, S. V.; Shutov, A. V.; Svirikhin, A. I.; Tereshatov, E. E.; Vostokin, G. K.; Wegrzecki, M.; Yeremin, A. V.

    2007-05-01

    Two gas phase adsorption chemistry experiments aimed at the chemical characterization of element 112 using its isotope 283112 have been performed at the Flerov Laboratory for Nuclear Reactions (FLNR) Dubna, Russia. The applied Insitu-Volatilization and On-line Detection (IVO) technique is a thermochromatographic system combining the determination of the deposition temperature of volatile elements on a surface along a temperature gradient with an efficient detection of the deposited species by event-by-event alpha and SF-fragment spectroscopy. Two possibilities to produce the isotope 283112 were used: 1.) the direct production reaction 238U( 48Ca,3n) 283112; 2.) the reaction 242Pu( 48Ca,3n), where the primary product 287114, decays via alpha emission to 283112 with a half-life of 0.5 s. The chemistry experiments were aimed at a chemical identification of 283112 and an independent confirmation of its decay properties. In the direct reaction no decays related to 283112 were observed. However, two decay chains unambiguously attributed to the decay of 283112 were observed using the second production path. Previously reported observation of 283112 and 279Ds and their decay properties were confirmed. From its thermochromatorgaphic deposition first thermochemical data were deduced for element 112, unveiling it as a typical group 12 element.

  11. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  12. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  13. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  14. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  15. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  17. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  18. Charge-tagged ligands: useful tools for immobilising complexes and detecting reaction species during catalysis

    PubMed Central

    Limberger, Jones; Leal, Bárbara C.; Monteiro, Adriano L.

    2015-01-01

    In recent years, charge-tagged ligands (CTLs) have become valuable tools in organometallic catalysis. Insertion of an ionic side chain into the molecular skeleton of a known ligand has become a useful protocol for anchoring ligands, and consequently catalysts, in polar and ionic liquid phases. In addition, the insertion of a cationic moiety into a ligand is a powerful tool that can be used to detect reaction intermediates in organometallic catalysis through electrospray ionisation mass spectrometry (ESI-MS) experiments. The insertion of an ionic tag ensures the charge in the intermediates independently of the ESI-MS. For this reason, these ligands have been used as ionic probes in mechanistic studies for several catalytic reactions. Here, we summarise selected examples on the use of CTLs as immobilising agents in organometallic catalysis and as probes for studying mechanisms through ESI-MS. PMID:28553458

  19. Elucidation of the Key Role of [Ru(bpy)3 ](2+) in Photocatalyzed RAFT Polymerization.

    PubMed

    Christmann, Julien; Ibrahim, Ahmad; Charlot, Vincent; Croutxé-Barghorn, Céline; Ley, Christian; Allonas, Xavier

    2016-08-04

    Photocatalysis reactions using [Ru(II) (bpy)3 ](2+) were studied on the example of visible-light-sensitized reversible addition-fragmentation chain transfer (RAFT) polymerization. Although both photoinduced electron- and energy-transfer mechanisms are able to describe this interaction, no definitive experimental proof has been presented so far. This paper investigates the actual mechanism governing this reaction. A set of RAFT agents was selected, their redox potentials measured by cyclic voltammetry, and relaxed triplet energies calculated by quantum mechanics. Gibbs free-energy values were calculated for both electron- and energy-transfer mechanisms. Quenching rate constants were determined by laser flash photolysis. The results undoubtedly evidence the involvement of a photoinduced energy-transfer reaction. Controlled photopolymerization experiments are discussed in the light of the primary photochemical process and photodissociation ability of RAFT agent triplet states. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Detection of transient radical cations in electron transfer-initiated Diels-Alder reactions by electrospray ionization mass spectrometry.

    PubMed

    Fürmeier, Sven; Metzger, Jürgen O

    2004-11-10

    The coupling of a simple microreactor to an atmospheric pressure ion source, such as electrospray ionization (ESI) or atmospheric pressure chemical ionization (APCI), allows the investigation of reactions in solution by mass spectrometry. The tris(p-bromophenyl)aminium hexachloroantimonate (1(*)(+)SbCl(6)(-))-initiated reactions of phenylvinylsulfide (2) and cyclopentadiene (3) and of trans-anethole (5) and isoprene (6) and the dimerization of 1,3-cyclohexadiene (8) to give the respective Diels-Alder products were studied. These preparatively interesting reactions proceed as radical cation chain reactions via the transient radical cations of the respective dienophiles and of the respective Diels-Alder addition products. These radical cations could be detected directly and characterized unambiguously in the reacting solution by ESI-MS-MS. The identity was confirmed by comparison with MS-MS spectra of the authentic radical cations obtained by APCI-MS and by CID experiments of the corresponding molecular ions generated by EI-MS. In addition, substrates and products could be monitored easily in the reacting solution by APCI-MS.

  1. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  2. Chemical control of the viscoelastic properties of vinylogous urethane vitrimers

    PubMed Central

    Denissen, Wim; Droesbeke, Martijn; Nicolaÿ, Renaud; Leibler, Ludwik; Winne, Johan M.; Du Prez, Filip E.

    2017-01-01

    Vinylogous urethane based vitrimers are polymer networks that have the intrinsic property to undergo network rearrangements, stress relaxation and viscoelastic flow, mediated by rapid addition/elimination reactions of free chain end amines. Here we show that the covalent exchange kinetics significantly can be influenced by combination with various simple additives. As anticipated, the exchange reactions on network level can be further accelerated using either Brønsted or Lewis acid additives. Remarkably, however, a strong inhibitory effect is observed when a base is added to the polymer matrix. These effects have been mechanistically rationalized, guided by low-molecular weight kinetic model experiments. Thus, vitrimer elastomer materials can be rationally designed to display a wide range of viscoelastic properties. PMID:28317893

  3. Radiation induced decomposition of chlorinated phenols in water

    NASA Astrophysics Data System (ADS)

    Getoff, N.; Solar, S.

    Experiments with 4-Cl-phenol as a model compound for pesticides were performed under steady-state conditions using deoxygenated solutions as well as such saturated with air, oxygen or oxygen mixed with ozone. The yield of Cl -ions serviced as an indicator for the degradation process. As main products of the first step of decomposition were identified: polyhydroxybenzenes, aldehydes and acids. The yield of aldehydes was studied as a function of the absorbed dose and substrate concentration. In the presence of ozone a chain-reaction of the oxidative pollutant degradation takes place. Transient absorption spectra and kinetics obtained by preliminary pulse radiolysis studies of 4-Cl-phenol in the presence of oxygen as well as probable reaction mechanisms are also presented.

  4. Linear free energy relationships between aqueous phase hydroxyl radical reaction rate constants and free energy of activation.

    PubMed

    Minakata, Daisuke; Crittenden, John

    2011-04-15

    The hydroxyl radical (HO(•)) is a strong oxidant that reacts with electron-rich sites on organic compounds and initiates complex radical chain reactions in aqueous phase advanced oxidation processes (AOPs). Computer based kinetic modeling requires a reaction pathway generator and predictions of associated reaction rate constants. Previously, we reported a reaction pathway generator that can enumerate the most important elementary reactions for aliphatic compounds. For the reaction rate constant predictor, we develop linear free energy relationships (LFERs) between aqueous phase literature-reported HO(•) reaction rate constants and theoretically calculated free energies of activation for H-atom abstraction from a C-H bond and HO(•) addition to alkenes. The theoretical method uses ab initio quantum mechanical calculations, Gaussian 1-3, for gas phase reactions and a solvation method, COSMO-RS theory, to estimate the impact of water. Theoretically calculated free energies of activation are found to be within approximately ±3 kcal/mol of experimental values. Considering errors that arise from quantum mechanical calculations and experiments, this should be within the acceptable errors. The established LFERs are used to predict the HO(•) reaction rate constants within a factor of 5 from the experimental values. This approach may be applied to other reaction mechanisms to establish a library of rate constant predictions for kinetic modeling of AOPs.

  5. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  6. Role of Reversible Histidine Coordination in Hydroxylamine Reduction by Plant Hemoglobins (Phytoglobins).

    PubMed

    Athwal, Navjot Singh; Alagurajan, Jagannathan; Andreotti, Amy H; Hargrove, Mark S

    2016-10-18

    Reduction of hydroxylamine to ammonium by phytoglobin, a plant hexacoordinate hemoglobin, is much faster than that of other hexacoordinate hemoglobins or pentacoordinate hemoglobins such as myoglobin, leghemoglobin, and red blood cell hemoglobin. The reason for differences in reactivity is not known but could be intermolecular electron transfer between protein molecules in support of the required two-electron reduction, hydroxylamine binding, or active site architecture favoring the reaction. Experiments were conducted with phytoglobins from rice, tomato, and soybean along with human neuroglobin and soybean leghemoglobin that reveal hydroxylamine binding as the rate-limiting step. For hexacoordinate hemoglobins, binding is limited by the dissociation rate constant for the distal histidine, while leghemoglobin is limited by an intrinsically low affinity for hydroxylamine. When the distal histidine is removed from rice phytoglobin, a hydroxylamine-bound intermediate is formed and the reaction rate is diminished, indicating that the distal histidine imidazole side chain is critical for the reaction, albeit not for electron transfer but rather for direct interaction with the substrate. Together, these results demonstrate that phytoglobins are superior at hydroxylamine reduction because they have distal histidine coordination affinity constants near 1, and facile rate constants for binding and dissociation of the histidine side chain. Hexacoordinate hemoglobins such as neuroglobin are limited by tighter histidine coordination that blocks hydroxylamine binding, and pentacoordinate hemoglobins have intrinsically lower hydroxylamine affinities.

  7. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  8. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  9. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  10. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  11. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  12. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  13. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  14. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  15. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  16. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  17. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  18. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  19. Contribution to an effective design method for stationary reaction-diffusion patterns.

    PubMed

    Szalai, István; Horváth, Judit; De Kepper, Patrick

    2015-06-01

    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

  20. Arginine Coordination in Enzymatic Phosphoryl Transfer: Evaluation of the Effect of Arg166 Mutations in Escherichia Coli Alkaline Phosphatase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O'Brien, P.J.; Lassila, J.K.; Fenn, T.D.

    2009-05-22

    Arginine residues are commonly found in the active sites of enzymes catalyzing phosphoryl transfer reactions. Numerous site-directed mutagenesis experiments establish the importance of these residues for efficient catalysis, but their role in catalysis is not clear. To examine the role of arginine residues in the phosphoryl transfer reaction, we have measured the consequences of mutations to arginine 166 in Escherichia coli alkaline phosphatase on hydrolysis of ethyl phosphate, on individual reaction steps in the hydrolysis of the covalent enzyme-phosphoryl intermediate, and on thio substitution effects. The results show that the role of the arginine side chain extends beyond its positivemore » charge, as the Arg166Lys mutant is as compromised in activity as Arg166Ser. Through measurement of individual reaction steps, we construct a free energy profile for the hydrolysis of the enzyme-phosphate intermediate. This analysis indicates that the arginine side chain strengthens binding by {approx}3 kcal/mol and provides an additional 1-2 kcal/mol stabilization of the chemical transition state. A 2.1 {angstrom} X-ray diffraction structure of Arg166Ser AP is presented, which shows little difference in enzyme structure compared to the wild-type enzyme but shows a significant reorientation of the bound phosphate. Altogether, these results support a model in which the arginine contributes to catalysis through binding interactions and through additional transition state stabilization that may arise from complementarity of the guanidinum group to the geometry of the trigonal bipyramidal transition state.« less

  1. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

    PubMed Central

    2005-01-01

    Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

  3. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  4. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  5. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  6. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  7. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  8. Detection of Mycoplasma hyopneumoniae by polymerase chain reaction in swine presenting respiratory problems

    PubMed Central

    Yamaguti, M.; Muller, E.E.; Piffer, A.I.; Kich, J.D.; Klein, C.S.; Kuchiishi, S.S.

    2008-01-01

    Since Mycoplasma hyopneumoniae isolation in appropriate media is a difficult task and impractical for daily routine diagnostics, Nested-PCR (N-PCR) techniques are currently used to improve the direct diagnostic sensitivity of Swine Enzootic Pneumonia. In a first experiment, this paper describes a N-PCR technique optimization based on three variables: different sampling sites, sample transport media, and DNA extraction methods, using eight pigs. Based on the optimization results, a second experiment was conducted for testing validity using 40 animals. In conclusion, the obtained results of the N-PCR optimization and validation allow us to recommend this test as a routine monitoring diagnostic method for Mycoplasma hyopneumoniae infection in swine herds. PMID:24031248

  9. The influence of photocatalytic interior paints on indoor air quality

    NASA Astrophysics Data System (ADS)

    Auvinen, Joonas; Wirtanen, Leif

    2008-06-01

    A clean indoor air is important for the well-being and health of people. Lately, new photocatalytic paints have been launched on the market, which are claimed to have air-purifying effects. Photocatalysis initiates radical reactions. Radicals are formed when a photocatalyst (e.g. TiO2) is subjected to radiation. Typical radicals are the hydroxyl radical (radOH) and the superoxide radical (radO2-). Radicals cause chain reactions, which degrade and decompose organic compounds. The end products of these chain reactions are water and carbon dioxide, if the reactions are fully completed (mineralization). If mineralization does not take place, then a great number of side products can be formed, whose properties are not well understood. The side products of photocatalytic reactions can be permanent and stabile. The decomposition of indoor air impurities on the surface of photocatalytic paints is not obvious. The ability of photocatalytic indoor paints to reduce chemical indoor air impurities is the key issue of this study. Six different paints with different binder systems, such as lime, polyorganic siloxane, silica sol-gel and organic binders, were examined. The experiments were divided into three topics: degradation of an organic binder, photocatalytic decomposition of formaldehyde, and a volatile organic compound (VOC) mixture consisting of five different indoor air VOCs. All tests were carried out in an environmental test chamber under dynamic conditions. The test results indicate that many indoor pollutants are generated under normal- and UVA-light. Typical compounds formed include formaldehyde, acetone, acetaldehyde, etc. A clear decrease of formaldehyde or the VOC mixture concentration was not observed. All possibly generated compounds could not be collected or analyzed in this research project, but the measurements show that photocatalytic reactions do not generate only carbon dioxide and water. Photocatalytic decomposition of indoor air impurities can, however, produce many side products, which may be stabile and harmful.

  10. Real-time PCR probe optimization using design of experiments approach.

    PubMed

    Wadle, S; Lehnert, M; Rubenwolf, S; Zengerle, R; von Stetten, F

    2016-03-01

    Primer and probe sequence designs are among the most critical input factors in real-time polymerase chain reaction (PCR) assay optimization. In this study, we present the use of statistical design of experiments (DOE) approach as a general guideline for probe optimization and more specifically focus on design optimization of label-free hydrolysis probes that are designated as mediator probes (MPs), which are used in reverse transcription MP PCR (RT-MP PCR). The effect of three input factors on assay performance was investigated: distance between primer and mediator probe cleavage site; dimer stability of MP and target sequence (influenza B virus); and dimer stability of the mediator and universal reporter (UR). The results indicated that the latter dimer stability had the greatest influence on assay performance, with RT-MP PCR efficiency increased by up to 10% with changes to this input factor. With an optimal design configuration, a detection limit of 3-14 target copies/10 μl reaction could be achieved. This improved detection limit was confirmed for another UR design and for a second target sequence, human metapneumovirus, with 7-11 copies/10 μl reaction detected in an optimum case. The DOE approach for improving oligonucleotide designs for real-time PCR not only produces excellent results but may also reduce the number of experiments that need to be performed, thus reducing costs and experimental times.

  11. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  12. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE PAGES

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  13. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  14. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  15. Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

    PubMed

    Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

    2013-10-17

    Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

  16. Experimental interstellar organic chemistry: Preliminary findings

    NASA Technical Reports Server (NTRS)

    Khare, B. N.; Sagan, C.

    1971-01-01

    In a simulation of interstellar organic chemistry in dense interstellar clouds or on grain surfaces, formaldehyde, water vapor, ammonia and ethane are deposited on a quartz cold finger and ultraviolet-irradiated in high vacuum at 77K. The HCHO photolytic pathway which produces an aldehyde radical and a superthermal hydrogen atom initiates solid phase chain reactions leading to a range of new compounds, including methanol, ethanol, acetaldehyde, acetonitrile, acetone, methyl formate, and possibly formic acid. Higher nitriles are anticipated. Genetic relations among these interstellar organic molecules (e.g., the Cannizzaro and Tischenko reactions) must exist. Some of them, rather than being synthesized from smaller molecules, may be degradation products of larger organic molecules, such as hexamethylene tetramine, which are candidate consitituents of the interstellar grains. The experiments reported here may also be relevant to cometary chemistry.

  17. Low-energy (anti)neutrino physics with Borexino: Neutrinos from the primary proton-proton fusion process in the Sun

    NASA Astrophysics Data System (ADS)

    Mosteiro, P.; Bellini, G.; Benziger, J.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Cadonati, L.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chavarría, Á.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Empl, A.; Etenko, A.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Gazzana, S.; Ghiano, C.; Giammarchi, M.; Göger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Hungerford, E.; Ianni, Al.; Ianni, An.; Kobychev, V.; Korablëv, D.; Korga, G.; Kryn, D.; Laubenstein, M.; Lehnert, B.; Lewke, T.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Meindl, Q.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Rossi, N.; Saldanha, R.; Salvo, C.; Schönert, S.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Vignaud, D.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Winter, J.; Wojcik, M.; Wright, A.; Wurm, M.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

    2015-08-01

    The Sun is fueled by a series of nuclear reactions that produce the energy that makes it shine. The primary reaction is the fusion of two protons into a deuteron, a positron and a neutrino. These neutrinos constitute the vast majority of neutrinos reaching Earth, providing us with key information about what goes on at the core of our star. Several experiments have now confirmed the observation of neutrino oscillations by detecting neutrinos from secondary nuclear processes in the Sun; this is the first direct spectral measurement of the neutrinos from the keystone proton-proton fusion. This observation is a crucial step towards the completion of the spectroscopy of pp-chain neutrinos, as well as further validation of the LMA-MSW model of neutrino oscillations.

  18. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  19. What limits the yield of levoglucosan during fast pyrolysis of cellulose?

    NASA Astrophysics Data System (ADS)

    Proano-Aviles, Juan

    The pyrolysis of cellulose to form levoglucosan is investigated in this study. Although the stoichiometric yield of levoglucosan from the pyrolysis of cellulose is expected to be 100%, only about 60 wt.% yields are reported in the literature. Several possible reasons for this limitation are investigated through experiments in micropyrolyzers and computational studies on the depolymerization of cellulose. Heat and mass transfer limitations in an experimental apparatus is one possible limitation on the yield of levoglucosan. Repolymerization of condensed phase reaction intermediates could prevent the formation and release of volatile levoglucosan. Thermohydrolysis of pyrolyzing cellulose to form non-volatile and thermally unstable glucose has also been proposed as a mechanism that reduces levoglucosan yields. Secondary reactions in the gas phase were also investigated to explain limitations on levoglucosan yields. Population balance models were developed to test ideas on how cellulose depolymerized to form levoglucosan at less than stoichiometric yields. These models were supported with chemical kinetic data obtained from transient pyrolysis experiments. Under carefully controlled experimental conditions, no evidence was found for heat and mass transfer effects limiting levoglucosan yields to 60 wt.% nor do secondary reactions in the condensed- or gas-phases appear to offer a satisfactory explanation. Based on modeling results, it appears levoglucosan-forming reaction rates that decrease as oligosaccharide chain length decreases is the most plausible explanation for limitations on levoglucosan yield from cellulose.

  20. Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

    NASA Astrophysics Data System (ADS)

    Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

    Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

  1. The Synthesis of Cellulose Graft Copolymers Using Cu(0)-Mediated Polymerization

    NASA Astrophysics Data System (ADS)

    Donaldson, Jason L.

    Cellulose is the most abundant renewable polymer on the planet and there is great interest in expanding its use beyond its traditional applications. However, its hydrophilicity and insolubility in most common solvent systems are obstacles to its widespread use in advanced materials. One way to counteract this is to attach hydrophobic polymer chains to cellulose: this allows the properties of the copolymer to be tailored by the molecular weight, density, and physical properties of the grafts. Two methods were used here to synthesize the graft copolymers: a 'grafting-from' approach, where synthetic chains were grown outward from bromoester moieties on cellulose (Cell-BiB) via Cu(0)-mediated polymerization; and a 'grafting-to' approach, where fully formed synthetic chains with terminal sulfide functionality were added to cellulose acetate with methacrylate functionality (CA-MAA) via thiol-ene Michael addition. The Cell-BiB was synthesized in the ionic liquid 1-butyl-3-methylimidazolium chloride and had a degree of substitution of 1.13. Polymerization from Cell-BiB proceeded at similar but slightly slower rate than an analogous non-polymeric initiator (EBiB). The average graft density of poly(methyl acrylate) chains was 0.71 chains/ring, with a maximum of 1.0 obtained. The graft density when grafting poly(methyl methacrylate) was only 0.15, and this appeared to be due to the slow initiation of BiB groups. Using EBiB to model the reaction and improve the design should allow this to be overcome. Chain extension experiments demonstrated the living behaviour of the polymer. The CA-MAA was synthesized by esterification with methacrylic acid. Reactions of CA-MAA with thiophenol and dodecanethiol resulted in quantitative addition of the thiol to the alkene. The grafts were synthesized by Cu(0)-mediated polymerization from a bifunctional initiator containing a disulfide bond, followed by reduction to sulfides. The synthetic polymers were successfully grafted to CA-MAA but the grafting yield was limited by the low sulfide functionality. Better retention of sulfide functionality is necessary for more efficient grafting.

  2. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  3. Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

    PubMed

    Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

    2014-02-07

    An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

  4. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  5. Measurement of Solar pp-neutrino flux with Borexino: results and implications

    NASA Astrophysics Data System (ADS)

    Smirnov, O. Yu; Agostini, M.; Appel, S.; Bellini, G.; Benziger, J.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Di Noto, L.; Drachnev, I.; Etenko, A.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kryn, D.; Laubenstein, M.; Lehnert, B.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, O.; Manecki, S.; Maneschg, W.; Marcocci, S.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Mosteiro, P.; Muratova, V.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, N.; Schönert, S.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Unzhakov, E.; Vishneva, A.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

    2016-02-01

    Measurement of the Solar pp-neutrino flux completed the measurement of Solar neutrino fluxes from the pp-chain of reactions in Borexino experiment. The result is in agreement with the prediction of the Standard Solar Model and the MSW/LMA oscillation scenario. A comparison of the total neutrino flux from the Sun with Solar luminosity in photons provides a test of the stability of the Sun on the 105 years time scale, and sets a strong limit on the power production by the unknown energy sources in the Sun.

  6. U.S. Maritime Strategy In a Post-Cold War World?

    DTIC Science & Technology

    1990-05-16

    worlo in wnIcn zne East-West squarea off across an iron curzain nas oeen- aramatically transformed . A chain reaction of nhslocic events in Eastern Europe...research will n e to exam int- tne -- ri :.me Componen t ot the Un itec St ates Natioanal M ~r z a , egov ,71tni1n the context of the changing geoo~o...experience. 12 :Zi. Historical BacKqrouna By maritime strategy we mean the principies wnicn govern a war in which the sea is a suostantia! factor. Naval

  7. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  8. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  9. Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

    PubMed

    Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

    2013-08-22

    Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

  10. Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

    PubMed

    Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

    2014-05-28

    3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

  11. Intact carbohydrate structures as part of the melanoidin skeleton.

    PubMed

    Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

    2002-03-27

    Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

  12. Modification of aniline containing proteins using an oxidative coupling strategy.

    PubMed

    Hooker, Jacob M; Esser-Kahn, Aaron P; Francis, Matthew B

    2006-12-13

    A new bioconjugation reaction has been developed based on the chemoselective modification of anilines through an oxidative coupling pathway. Aryl amines were installed on the surface of protein substrates through lysine acylation reactions or through the use of native chemical ligation techniques. Upon exposure to NaIO4 in aqueous buffer, the anilines coupled rapidly to the aromatic rings of N,N-dialkyl-N'-acyl-p-phenylenediamines. The identities of the reaction products were confirmed using ESI-MS and through comparison to small molecule analogs. Control experiments indicated that none of the native amino acids participated in the reaction. The resulting bioconjugates were found to be stable toward hydrolysis from pH 4 to pH 11 and in the presence of many commonly used oxidants, reductants, and nucleophiles. A fluorescent phenylenediamine reagent was synthesized for the selective detection of aniline labeled proteins in mixtures, and the reaction was used to append the C-terminus of the green fluorescent protein with a single PEG chain. When combined with techniques for the incorporation of unnatural amino acids into proteins, this bioorthogonal coupling method should prove useful for a number of applications requiring a high degree of labeling specificity.

  13. Initiation reactions in acetylene pyrolysis

    DOE PAGES

    Zador, Judit; Fellows, Madison D.; Miller, James A.

    2017-05-10

    In gas-phase combustion systems the interest in acetylene stems largely from its role in molecular weight growth processes. The consensus is that above 1500 K acetylene pyrolysis starts mainly with the homolytic fission of the C–H bond creating an ethynyl radical and an H atom. However, below ~1500 K this reaction is too slow to initiate the chain reaction. It has been hypothesized that instead of dissociation, self-reaction initiates this process. Nevertheless, rigorous theoretical or direct experimental evidence is lacking, to an extent that even the molecular mechanism is debated in the literature. In this work we use rigorous abmore » initio transition-state theory master equation methods to calculate pressure- and temperature-dependent rate coefficients for the association of two acetylene molecules and related reactions. We establish the role of vinylidene, the high-energy isomer of acetylene in this process, compare our results with available experimental data, and assess the competition between the first-order and second-order initiation steps. As a result, we also show the effect of the rapid isomerization among the participating wells and highlight the need for time-scale analysis when phenomenological rate coefficients are compared to observed time scales in certain experiments.« less

  14. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  15. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOEpatents

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  16. Antioxidant pool in beer and kinetics of EPR spin-trapping.

    PubMed

    Kocherginsky, Nikolai M; Kostetski, Yuri Yu; Smirnov, Alex I

    2005-08-24

    The kinetics of spin-trap adduct formation in beer oxidation exhibits an induction period if the reaction is carried out at elevated temperatures and in the presence of air. This lag period lasts until the endogenous antioxidants are almost completely depleted, and its duration is used as an indicator of the flavor stability and shelf life of beer. This paper demonstrates that the total kinetics of the process can be characterized by three parameters-the lag period, the rate of spin-trap adduct formation, and, finally, the steady-state spin-adduct concentration. A steady-state chain reaction mechanism is described, and quantitative estimates of the main kinetic parameters such as the initiation rate, antioxidant pool, effective content of organic molecules participating in the chain reactions, and the rate constant of the 1-hydroxyethyl radical EtOH(*) spin-adduct disappearance are given. An additional new dimensionless parameter is suggested to characterize the antioxidant pool-the product of the lag time and the rate of spin-trap radical formation immediately after the lag time, normalized by the steady-state concentration of the adducts. The results of spin-tapping EPR experiments are compared with the nitroxide reduction kinetics measured in the same beer samples. It is shown that although the kinetics of nitroxide reduction in beer can be used to evaluate the reducing power of beer, the latter parameter does not correlate with the antioxidant pool. The relationship of free radical processes, antioxidant pool, reducing power, and beer staling is discussed.

  17. Top-Down Charge Transfer Dissociation (CTD) of Gas-Phase Insulin: Evidence of a One-Step, Two-Electron Oxidation Mechanism

    NASA Astrophysics Data System (ADS)

    Li, Pengfei; Kreft, Iris; Jackson, Glen P.

    2018-02-01

    Top-down analyses of protonated insulin cations of charge states of 4+, 5+, or 6+ were performed by exposing the isolated precursor ions to a beam of helium cations with kinetic energy of more than 6 keV, in a technique termed charge transfer dissociation (CTD). The 100 ms charge transfer reaction resulted in approximately 20% conversion efficiency to other intact charge exchange products (CTnoD), and a range of low abundance fragment ions. To increase backbone and sulfide cleavages, and to provide better structural information than straightforward MS2 CTD, the CTnoD oxidized products were isolated and subjected to collisional activation at the MS3 level. The MS3 CTD/CID reaction effectively broke the disulfide linkages, separated the two chains, and yielded more structurally informative fragment ions within the inter-chain cyclic region. CTD also provided doubly oxidized intact product ions at the MS2 level, and resonance ejection of the singly oxidized product ion revealed that the doubly oxidized product originates directly from the isolated precursor ion and not from consecutive CTD reactions of a singly oxidized intermediate. MS4 experiments were employed to help identify potential radical cations and diradical cations, but the results were negative or inconclusive. Nonetheless, the two-electron oxidation process is a demonstration of the very large potential energy (>20 eV) available through CTD, and is a notable capability for a 3D ion trap platform.

  18. Polymerase chain reaction and DNA probe hybridization to assess the efficacy of diminazene treatment in Trypanosoma brucei-infected cattle.

    PubMed

    Clausen, P H; Waiswa, C; Katunguka-Rwakishaya, E; Schares, G; Steuber, S; Mehlitz, D

    1999-03-01

    Four of eight Ankole longhorn cattle experimentally infected with Trypanosoma brucei were treated with 7 mg/kg diminazene aceturate (Berenil, Hoechst AG, Germany) at day 71 postinfection. The trypanocidal activity was monitored using polymerase chain reaction (PCR) and DNA probe hybridization. When extracted parasite DNA (without host DNA) was used, as little as 1 fg per reaction, which is equivalent to about 1-10% of the DNA in a single trypanosome, produced a specific product that was visible as a 177-bp band in an agarose gel. In infected cattle, specific PCR products could be amplified at as early as 1 day postinfection. PCR signals remained positive during infection, except in one sample, although aparasitemic phases occurred. In cases where treatment resulted in a significant clinical improvement, PCR signals disappeared at 3-4 days after the administration of the drug. By contrast, in cattle that showed clinical signs of CNS involvement after treatment, although aparasitemic, and died before the termination of the experiment, specific products could be amplified on several occasions following treatment. The PCR signals generated after treatment could be further enhanced by subsequent slot-blot hybridization with a T. brucei-specific DNA probe. We conclude that PCR coupled with DNA probe hybridization provides a highly sensitive tool for the assessment of therapeutic efficiency and disease progression in trypanosome infections, especially in chronic infections when the level of parasitemia is low or when trypanosomes are sequestered at cryptic sites.

  19. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    NASA Technical Reports Server (NTRS)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gates, J. M.; Gregorich, K. E.; Gothe, O. R.

    In this study, forty-six decay chains, assigned to the decay of 288115, were produced using the 243Am ( 48Ca, 3n) 288115 reaction at the Lawrence Berkeley National Laboratory 88-in. cyclotron. The resulting series of α decays were studied using α-photon and α-x-ray spectroscopies. Multiple α-photon coincidences were observed in the element 115 decay chain members, particularly in the third- and fourth-generation decays (presumed to be 280Rg and 276Mt, respectively). Upon combining these data with those from 22 288115 decay chains observed in a similar experiment, updated level schemes in 276Mt and 272Bh (populated by the α decay of 280Rg andmore » 276Mt, respectively) are proposed. Additionally, photons were observed in the energy range expected for K x rays coincident with the α decay of both 280Rg and 276Mt. However, Compton scattering of higher-energy γ rays and discrete transitions are present in the K x-ray region preventing a definitive Z identification to be made based on observation of characteristic K x-ray energies.« less

  1. Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

    PubMed

    Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

    2008-04-01

    Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

  2. Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

    PubMed

    Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2017-05-02

    Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  5. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  6. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  7. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  8. Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

    PubMed Central

    Brownholland, David P.

    2017-01-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

  9. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  10. METHOD OF OPERATING NUCLEAR REACTORS

    DOEpatents

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  11. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  12. Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

    NASA Astrophysics Data System (ADS)

    Nakazumi, Tomoka; Hara, Yusuke

    2017-09-01

    We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

  13. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  14. Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

    PubMed

    Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

    2016-05-01

    A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Fine and coarse modes of dicarboxylic acids in the Arctic aerosols collected during the Polar Sunrise Experiment 1997

    NASA Astrophysics Data System (ADS)

    Narukawa, M.; Kawamura, K.; Anlauf, K. G.; Barrie, L. A.

    2003-09-01

    Fine (<1 μm) and coarse (>1 μm) aerosol particles were collected at Alert, Canada (82°27'N, 62°30'W), during the Arctic spring as part of the Polar Sunrise Experiment 1997 and were analyzed for low molecular weight dicarboxylic acids (C2-C11) using gas chromatography with flame ionization detector (GC-FID) and GC/mass spectrometry (GC/MS). More than 80% of total diacids were detected in the fine fraction, suggesting the production by gas-to-particle conversion in the Arctic. In both fractions, oxalic acid was the dominant diacid species followed by succinic and malonic acids. Shorter chain diacids (C2-C5) showed the concentration maximum on 5-7 April; however, longer chain diacids (

  16. Versatile Tandem Ring-Opening/Ring-Closing Metathesis Polymerization: Strategies for Successful Polymerization of Challenging Monomers and Their Mechanistic Studies.

    PubMed

    Park, Hyeon; Kang, Eun-Hye; Müller, Laura; Choi, Tae-Lim

    2016-02-24

    Tandem ring-opening/ring-closing metathesis (RO/RCM) results in extremely fast living polymerization; however, according to previous reports, only monomers containing certain combinations of cycloalkenes, terminal alkynes, and nitrogen linkers successfully underwent tandem polymerization. After examining the polymerization pathways, we proposed that the relatively slow intramolecular cyclization might lead to competing side reactions such as intermolecular cross metathesis reactions to form inactive propagating species. Thus, we developed two strategies to enhance tandem polymerization efficiency. First, we modified monomer structures to accelerate tandem RO/RCM cyclization by enhancing the Thorpe-Ingold effect. This strategy increased the polymerization rate and suppressed the chain transfer reaction to achieve controlled polymerization, even for challenging syntheses of dendronized polymers. Alternatively, reducing the reaction concentration facilitated tandem polymerization, suggesting that the slow tandem RO/RCM cyclization step was the main reason for the previous failure. To broaden the monomer scope, we used monomers containing internal alkynes and observed that two different polymer units with different ring sizes were produced as a result of nonselective α-addition and β-addition on the internal alkynes. Thorough experiments with various monomers with internal alkynes suggested that steric and electronic effects of the alkyne substituents influenced alkyne addition selectivity and the polymerization reactivity. Further polymerization kinetics studies revealed that the rate-determining step of monomers containing certain internal alkynes was the six-membered cyclization step via β-addition, whereas that for other monomers was the conventional intermolecular propagation step, as observed in other chain-growth polymerizations. This conclusion agrees well with all those polymerization results and thus validates our strategies.

  17. Electron-transfer dynamics in highly reduced states of simple and superstructured metalloporphyrins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anxolabehere, E.; Lexa, D.; Saveant, J.M.

    1992-02-06

    The standard rate constants of the Fe(I){sup -}/Fe({open_quotes}0{close_quotes}){sup 2-} couple in a series of four simple and basket-handle superstructured porphyrins have been measured by means of fast cyclic voltammetry at mercury and gold ultramicroelectrodes. Analysis of the experimental data by the Marcus-Hush model revealed that the main rate-controlling factor of these very fast electron-transfer reactions is solvent reorganization. The presence of secondary amide groups borne by the basket-handle structure and located in the close vicinity of the metalloporphyrin center largely facilitates the reaction from a thermodynamic viewpoint. This facilitation of the reaction is not counterbalanced by any significant contribution ofmore » the fluctuational reorganization of the NHCO dipoles thanks to their attachment to the basket-handle chains. A few complementary experiments were carried out with zinc and copper porphyrins where the same general trends were observed. 16 refs., 3 figs., 2 tabs.« less

  18. New potentially active pyrazinamide derivatives synthesized under microwave conditions.

    PubMed

    Jandourek, Ondrej; Dolezal, Martin; Kunes, Jiri; Kubicek, Vladimir; Paterova, Pavla; Pesko, Matus; Buchta, Vladimir; Kralova, Katarina; Zitko, Jan

    2014-07-03

    A series of 18 N-alkyl substituted 3-aminopyrazine-2-carboxamides was prepared in this work according to previously experimentally set and proven conditions using microwave assisted synthesis methodology. This approach for the aminodehalogenation reaction was chosen due to higher yields and shorter reaction times compared to organic reactions with conventional heating. Antimycobacterial, antibacterial, antifungal and photosynthetic electron transport (PET) inhibiting in vitro activities of these compounds were investigated. Experiments for the determination of lipophilicity were also performed. Only a small number of substances with alicyclic side chain showed activity against fungi which was the same or higher than standards and the biological efficacy of the compounds increased with rising lipophilicity. Nine pyrazinamide derivatives also inhibited PET in spinach chloroplasts and the IC50 values of these compounds varied in the range from 14.3 to 1590.0 μmol/L. The inhibitory activity was connected not only with the lipophilicity, but also with the presence of secondary amine fragment bounded to the pyrazine ring. Structure-activity relationships are discussed as well.

  19. High-throughput multiplex HLA-typing by ligase detection reaction (LDR) and universal array (UA) approach.

    PubMed

    Consolandi, Clarissa

    2009-01-01

    One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.

  20. Second-order Kinetics of DTPA and Plutonium in Rat Plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Guthrie; Poudel, Deepesh; Klumpp, John Allan

    We report that in 2008, Serandour et al. reported on their in vitro experiment involving rat plasma samples obtained after an intravenous intake of plutonium citrate. Different amounts of DTPA were added to the plasma samples and the percentage of low-molecular-weight plutonium measured. Only when the DTPA dosage was three orders of magnitude greater than the recommended 30 μmol/kg was 100% of the plutonium apparently in the form of chelate. These data were modeled assuming three competing chemical reactions with other molecules that bind with plutonium. Here, time-dependent second-order kinetics of these reactions are calculated, intended eventually to become partmore » of a complete biokinetic model of DTPA action on actinides in laboratory animals or humans. The probability distribution of the ratio of stability constants for the reactants was calculated using Markov Chain Monte Carlo. In conclusion, these calculations substantiate that the inclusion of more reactions is needed in order to be in agreement with known stability constants.« less

  1. Oxidative Degradation of Nadic-End-Capped Polyimides. 2; Evidence for Reactions Occurring at High Temperatures

    NASA Technical Reports Server (NTRS)

    Meador, Mary Ann B.; Johnston, J. Christopher; Cavano, Paul J.; Frimer, Aryeh A.

    1997-01-01

    The oxidative degradation of PMR (for polymerization of monomeric reactants) polyimides at elevated temperatures was followed by cross-polarized magic angle spinning (Cp-MAS) NMR. C-13 labeling of selected sites in the polymers allowed for direct observation of the transformations arising from oxidation processes. As opposed to model compound studies, the reactions were followed directly in the polymer. The labeling experiments confirm the previously reported oxidation of the methylene carbon to ketone in the methylenedianiline portion of the polymer chain. They also show the formation of two other oxidized species, acid and ester, from this same carbon. In addition, the technique provides the first evidence of the kind of degradation reactions that are occurring in the nadic end caps. Several PMR formulations containing moieties determined to be present after oxidation, as suggested by the labeling study, were synthesized. Weight loss, FTIR, and natural abundance NMR of these derivatives were followed during aging. In this way, weight loss could be related to the observed transformations.

  2. Second-order Kinetics of DTPA and Plutonium in Rat Plasma

    DOE PAGES

    Miller, Guthrie; Poudel, Deepesh; Klumpp, John Allan; ...

    2017-11-15

    We report that in 2008, Serandour et al. reported on their in vitro experiment involving rat plasma samples obtained after an intravenous intake of plutonium citrate. Different amounts of DTPA were added to the plasma samples and the percentage of low-molecular-weight plutonium measured. Only when the DTPA dosage was three orders of magnitude greater than the recommended 30 μmol/kg was 100% of the plutonium apparently in the form of chelate. These data were modeled assuming three competing chemical reactions with other molecules that bind with plutonium. Here, time-dependent second-order kinetics of these reactions are calculated, intended eventually to become partmore » of a complete biokinetic model of DTPA action on actinides in laboratory animals or humans. The probability distribution of the ratio of stability constants for the reactants was calculated using Markov Chain Monte Carlo. In conclusion, these calculations substantiate that the inclusion of more reactions is needed in order to be in agreement with known stability constants.« less

  3. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  4. Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

    PubMed

    Winkelmann, Kurt; Calhoun, Robert L; Mills, German

    2006-12-28

    Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

  5. Tested Demonstrations.

    ERIC Educational Resources Information Center

    Gilbert, George L., Ed.

    1983-01-01

    Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

  6. Quantification of diesel exhaust gas phase organics by a thermal desorption proton transfer reaction mass spectrometer

    NASA Astrophysics Data System (ADS)

    Erickson, M. H.; Wallace, H. W.; Jobson, B. T.

    2012-02-01

    A new approach was developed to measure the total abundance of long chain alkanes (C12 and above) in urban air using thermal desorption with a proton transfer reaction mass spectrometer (PTR-MS). These species are emitted in diesel exhaust and may be important precursors to secondary organic aerosol production in urban areas. Long chain alkanes undergo dissociative proton transfer reactions forming a series of fragment ions with formula CnH2n+1. The yield of the fragment ions is a function of drift conditions. At a drift field strength of 80 Townsends, the most abundant ion fragments from C10 to C16 n-alkanes were m/z 57, 71 and 85. The PTR-MS is insensitive to n-alkanes less than C8 but displays an increasing sensitivity for larger alkanes. Higher drift field strengths yield greater normalized sensitivity implying that the proton affinity of the long chain n-alkanes is less than H2O. Analysis of diesel fuel shows the mass spectrum was dominated by alkanes (CnH2n+1), monocyclic aromatics, and an ion group with formula CnH2n-1 (m/z 97, 111, 125, 139). The PTR-MS was deployed in Sacramento, CA during the Carbonaceous Aerosols and Radiative Effects Study field experiment in June 2010. The ratio of the m/z 97 to 85 ion intensities in ambient air matched that found in diesel fuel. Total diesel exhaust alkane concentrations calculated from the measured abundance of m/z 85 ranged from the method detection limit of ~1 μg m-3 to 100 μg m-3 in several air pollution episodes. The total diesel exhaust alkane concentration determined by this method was on average a factor of 10 greater than the sum of alkylbenzenes associated with spark ignition vehicle exhaust.

  7. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  8. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

    2015-07-15

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

  9. Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

    PubMed

    Brownholland, David P; Covey, Douglas F

    2017-05-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  11. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  12. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  13. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  14. Spark Plasma Sintering for Nanostructured Smart Materials

    DTIC Science & Technology

    2009-03-02

    polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

  15. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  16. Structural and kinetic mapping of side-chain exposure onto the protein energy landscape.

    PubMed

    Bernstein, Rachel; Schmidt, Kierstin L; Harbury, Pehr B; Marqusee, Susan

    2011-06-28

    Identification and characterization of structural fluctuations that occur under native conditions is crucial for understanding protein folding and function, but such fluctuations are often rare and transient, making them difficult to study. Native-state hydrogen exchange (NSHX) has been a powerful tool for identifying such rarely populated conformations, but it generally reveals no information about the placement of these species along the folding reaction coordinate or the barriers separating them from the folded state and provides little insight into side-chain packing. To complement such studies, we have performed native-state alkyl-proton exchange, a method analogous to NSHX that monitors cysteine modification rather than backbone amide exchange, to examine the folding landscape of Escherichia coli ribonuclease H, a protein well characterized by hydrogen exchange. We have chosen experimental conditions such that the rate-limiting barrier acts as a kinetic partition: residues that become exposed only upon crossing the unfolding barrier are modified in the EX1 regime (alkylation rates report on the rate of unfolding), while those exposed on the native side of the barrier are modified predominantly in the EX2 regime (alkylation rates report on equilibrium populations). This kinetic partitioning allows for identification and placement of partially unfolded forms along the reaction coordinate. Using this approach we detect previously unidentified, rarely populated conformations residing on the native side of the barrier and identify side chains that are modified only upon crossing the unfolding barrier. Thus, in a single experiment under native conditions, both sides of the rate-limiting barrier are investigated.

  17. Structural and kinetic mapping of side-chain exposure onto the protein energy landscape

    PubMed Central

    Bernstein, Rachel; Schmidt, Kierstin L.; Harbury, Pehr B.; Marqusee, Susan

    2011-01-01

    Identification and characterization of structural fluctuations that occur under native conditions is crucial for understanding protein folding and function, but such fluctuations are often rare and transient, making them difficult to study. Native-state hydrogen exchange (NSHX) has been a powerful tool for identifying such rarely populated conformations, but it generally reveals no information about the placement of these species along the folding reaction coordinate or the barriers separating them from the folded state and provides little insight into side-chain packing. To complement such studies, we have performed native-state alkyl-proton exchange, a method analogous to NSHX that monitors cysteine modification rather than backbone amide exchange, to examine the folding landscape of Escherichia coli ribonuclease H, a protein well characterized by hydrogen exchange. We have chosen experimental conditions such that the rate-limiting barrier acts as a kinetic partition: residues that become exposed only upon crossing the unfolding barrier are modified in the EX1 regime (alkylation rates report on the rate of unfolding), while those exposed on the native side of the barrier are modified predominantly in the EX2 regime (alkylation rates report on equilibrium populations). This kinetic partitioning allows for identification and placement of partially unfolded forms along the reaction coordinate. Using this approach we detect previously unidentified, rarely populated conformations residing on the native side of the barrier and identify side chains that are modified only upon crossing the unfolding barrier. Thus, in a single experiment under native conditions, both sides of the rate-limiting barrier are investigated. PMID:21670244

  18. Proton pumping in the bc1 complex: a new gating mechanism that prevents short circuits.

    PubMed

    Crofts, Antony R; Lhee, Sangmoon; Crofts, Stephanie B; Cheng, Jerry; Rose, Stuart

    2006-08-01

    The Q-cycle mechanism of the bc1 complex explains how the electron transfer from ubihydroquinone (quinol, QH2) to cytochrome (cyt) c (or c2 in bacteria) is coupled to the pumping of protons across the membrane. The efficiency of proton pumping depends on the effectiveness of the bifurcated reaction at the Q(o)-site of the complex. This directs the two electrons from QH2 down two different pathways, one to the high potential chain for delivery to an electron acceptor, and the other across the membrane through a chain containing heme bL and bH to the Qi-site, to provide the vectorial charge transfer contributing to the proton gradient. In this review, we discuss problems associated with the turnover of the bc1 complex that center around rates calculated for the normal forward and reverse reactions, and for bypass (or short-circuit) reactions. Based on rate constants given by distances between redox centers in known structures, these appeared to preclude conventional electron transfer mechanisms involving an intermediate semiquinone (SQ) in the Q(o)-site reaction. However, previous research has strongly suggested that SQ is the reductant for O2 in generation of superoxide at the Q(o)-site, introducing an apparent paradox. A simple gating mechanism, in which an intermediate SQ mobile in the volume of the Q(o)-site is a necessary component, can readily account for the observed data through a coulombic interaction that prevents SQ anion from close approach to heme bL when the latter is reduced. This allows rapid and reversible QH2 oxidation, but prevents rapid bypass reactions. The mechanism is quite natural, and is well supported by experiments in which the role of a key residue, Glu-295, which facilitates proton transfer from the site through a rotational displacement, has been tested by mutation.

  19. Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

    NASA Astrophysics Data System (ADS)

    Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

    Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

  20. Methanol Cannon Demonstrations Revisited.

    ERIC Educational Resources Information Center

    Dolson, David A.; And Others

    1995-01-01

    Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

  1. Comparison of quantitative real-time polymerase chain reaction with NanoString® methodology using adipose and liver tissues from rats fed seaweed.

    PubMed

    Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman

    2016-05-25

    Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

    PubMed Central

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-01-01

    To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

  3. Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

    PubMed

    Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

    2011-04-01

    To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

  4. Determination of rate constants and branching ratios for TCE degradation by zero-valent iron using a chain decay multispecies model.

    PubMed

    Hwang, Hyoun-Tae; Jeen, Sung-Wook; Sudicky, Edward A; Illman, Walter A

    2015-01-01

    The applicability of a newly-developed chain-decay multispecies model (CMM) was validated by obtaining kinetic rate constants and branching ratios along the reaction pathways of trichloroethene (TCE) reduction by zero-valent iron (ZVI) from column experiments. Changes in rate constants and branching ratios for individual reactions for degradation products over time for two columns under different geochemical conditions were examined to provide ranges of those parameters expected over the long-term. As compared to the column receiving deionized water, the column receiving dissolved CaCO3 showed higher mean degradation rates for TCE and all of its degradation products. However, the column experienced faster reactivity loss toward TCE degradation due to precipitation of secondary carbonate minerals, as indicated by a higher value for the ratio of maximum to minimum TCE degradation rate observed over time. From the calculated branching ratios, it was found that TCE and cis-dichloroethene (cis-DCE) were dominantly dechlorinated to chloroacetylene and acetylene, respectively, through reductive elimination for both columns. The CMM model, validated by the column test data in this study, provides a convenient tool to determine simultaneously the critical design parameters for permeable reactive barriers and natural attenuation such as rate constants and branching ratios. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. The Mini Orange Spectrometer (MOS) for Stellar and Big-Bang Nucleosynthesis studies at OMEGA and the National Ignition Facility

    NASA Astrophysics Data System (ADS)

    Sutcliffe, G. D.; Frenje, J. A.; Gatu Johnson, M.; Li, C. K.; Parker, C.; Simpson, R.; Sio, H.; Seguin, F. H.; Petrasso, R. D.; Zylstra, A.

    2017-10-01

    A compact and highly efficient Mini Orange Spectrometer (MOS) is being designed for measurements of energy spectra of protons and alphas in the range of 1-12 MeV in experiments at the OMEGA laser facility and the National Ignition Facility (NIF). The MOS will extend charged-particle spectrometry at these laser facilities to lower energies (<5 MeV) and lower yields (<5×108) than current instrumentation allows. This new spectrometer will enable studies of low-probability stellar nucleosynthesis reactions, including the 3He+3He reaction that is part of the solar proton-proton chain. Its unique capabilities will also be exploited in other basic science experiments, including studies of stopping power in ICF-relevant plasmas, astrophysical shocks and kinetic physics. The MOS design achieves high efficiency by maximizing the solid angle of particle acceptance. The optimization of the MOS design uses simulated magnetic fields and particle tracing. Performance requirements of the MOS system, including desired detection efficiencies and energy resolution, are discussed. This work was supported in part by the U.S. DoE, LLNL, and LLE.

  6. Effects of reaction-kinetic parameters on modeling reaction pathways in GaN MOVPE growth

    NASA Astrophysics Data System (ADS)

    Zhang, Hong; Zuo, Ran; Zhang, Guoyi

    2017-11-01

    In the modeling of the reaction-transport process in GaN MOVPE growth, the selections of kinetic parameters (activation energy Ea and pre-exponential factor A) for gas reactions are quite uncertain, which cause uncertainties in both gas reaction path and growth rate. In this study, numerical modeling of the reaction-transport process for GaN MOVPE growth in a vertical rotating disk reactor is conducted with varying kinetic parameters for main reaction paths. By comparisons of the molar concentrations of major Ga-containing species and the growth rates, the effects of kinetic parameters on gas reaction paths are determined. The results show that, depending on the values of the kinetic parameters, the gas reaction path may be dominated either by adduct/amide formation path, or by TMG pyrolysis path, or by both. Although the reaction path varies with different kinetic parameters, the predicted growth rates change only slightly because the total transport rate of Ga-containing species to the substrate changes slightly with reaction paths. This explains why previous authors using different chemical models predicted growth rates close to the experiment values. By varying the pre-exponential factor for the amide trimerization, it is found that the more trimers are formed, the lower the growth rates are than the experimental value, which indicates that trimers are poor growth precursors, because of thermal diffusion effect caused by high temperature gradient. The effective order for the contribution of major species to growth rate is found as: pyrolysis species > amides > trimers. The study also shows that radical reactions have little effect on gas reaction path because of the generation and depletion of H radicals in the chain reactions when NH2 is considered as the end species.

  7. Unraveling reaction pathways and specifying reaction kinetics for complex systems.

    PubMed

    Vinu, R; Broadbelt, Linda J

    2012-01-01

    Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

  8. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    PubMed

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  9. Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

    PubMed

    Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

    This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  10. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  11. Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

    PubMed

    Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

    2006-10-12

    [reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

  12. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    PubMed

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  13. A computational study of pyrolysis reactions of lignin model compounds

    Treesearch

    Thomas Elder

    2010-01-01

    Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

  14. Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

    NASA Astrophysics Data System (ADS)

    Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

    2005-12-01

    Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

  15. An Experimental and Kinetic Modeling Study of Methyl Decanoate Combustion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarathy, S M; Thomson, M J; Pitz, W J

    2009-12-04

    Biodiesel is a mixture of long chain fatty acid methyl esters derived from fats and oils. This research study presents opposed-flow diffusion flame data for one large fatty acid methyl ester, methyl decanoate, and uses the experiments to validate an improved skeletal mechanism consisting of 648 species and 2998 reactions. The results indicate that methyl decanoate is consumed via abstraction of hydrogen atoms to produce fuel radicals, which lead to the production of alkenes. The ester moiety in methyl decanoate leads to the formation of low molecular weight oxygenated compounds such as carbon monoxide, formaldehyde, and ketene.

  16. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    NASA Astrophysics Data System (ADS)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  17. Perioperative Anaphylaxis Including Kounis Syndrome due to Selective Cefazolin Allergy.

    PubMed

    Mota, Inês; Gaspar, Ângela; Morais-Almeida, Mário

    2018-06-18

    Perioperative use of cefazolin has been associated with severe allergic reactions, and patients are usually labelled as allergic to penicillin afterwards. The aim of our study was to describe a group of patients with immediate reactions to cefazolin, with proven selective hypersensitivity reactions. Systematic review of all patients followed at our drug centre with cefazolin-related reactions, between January 2012 and December 2016. All patients were investigated according to the European Network for Drug Allergy (ENDA) recommendations through skin testing (major and minor penicillin determinants, penicillin, amoxicillin, cefazolin, cefuroxime and ceftriaxone) and oral challenges tests. We included 7 patients (median age 40 years) with perioperative anaphylactic reactions immediately after cefazolin injection, 4 with hypotension and 1 with Kounis syndrome (KS) type I. The presence of a selective IgE-mediated hypersensitivity through positive skin tests to cefazoline has been proven in all patients. Two patients experienced systemic reactions during skin testing. All patients were successfully challenged with amoxicillin, and they tolerated cefuroxime. Cefazolin can be responsible for immediate severe allergic reactions in perioperative setting, including KS. Allergological workup is essential for an accurate diagnosis and to explore cross-reactivity between cefazolin and other beta-lactams. Our experience confirmed that patients with IgE-mediated hypersensitivity reactions to cefazolin can tolerate other beta-lactams. This selective pattern of clinical reactivity may be explained by its particular chemical structure, whose R1 side-chain is different from other beta-lactams. © 2018 S. Karger AG, Basel.

  18. T(T,4He)2n and 3He(3He,4He)2p Reactions and the Energy Dependence of Their Mechanisms

    NASA Astrophysics Data System (ADS)

    Bacher, Andrew; McNabb, Dennis; Brune, Carl; Sayre, Dan; Hale, Gerry; Frenje, Johan; Gatu Johnson, Maria

    2015-10-01

    We have studied the T(T,alpha)2n reaction because it is the charge symmetric analog to the 3He(3He,alpha)2p reaction which completes the most direct mode of the p-p chain in stellar interiors. These reactions lead to three-body final states whose energy spectrum shapes are dominated by the strong nucleon-alpha interaction and the weaker nucleon-nucleon interaction. These experiments were done at OMEGA at the University of Rochester and at the NIF at Lawrence Livermore Lab. We will focus on two features: (1) the excitation energy dependence of the reaction mechanism and (2) the center-of-mass energy dependence of the reaction mechanism. At stellar energies (OMEGA and the NIF) we find that the shape of the neutron spectrum peaks in the middle. The n-alpha 1/2-excited state is about two times stronger than the n-alpha 3/2-ground state. For the 3He+3He reaction (at CalTech), the proton spectrum peaks at the high end. The p-alpha 3/2-state is about two times stronger than the 1/2-state. This difference in the spectrum shape is explained by theoretical models which include the interference between the two identical fermions in the final state. At CalTech we have angular distributions of the 3He+3He reaction from 2 MeV to 18 MeV. We see the p-wave strength increasing.

  19. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  20. Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

    PubMed

    Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

    2018-05-15

    A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

  1. Chemical reactions directed Peptide self-assembly.

    PubMed

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  2. Chemical Reactions Directed Peptide Self-Assembly

    PubMed Central

    Rasale, Dnyaneshwar B.; Das, Apurba K.

    2015-01-01

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

  3. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  4. Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

    PubMed

    He, Peng; He, Lin

    2009-07-13

    We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

  5. Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

    PubMed

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

    2007-04-01

    Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

  6. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  7. Kerosene combustion at pressures up to 40 atm: Experimental study and detailed chemical kinetic modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dagaut, P.; Reuillon, M.; Boettner, J.C.

    1994-12-31

    The oxidation of TR0 kerosene (jet A1 aviation fuel) was studied in a jet-stirred reactor (JSR) at pressures extending from 10 to 40 atm, in the temperature range 750--1,150 K. A large number of reaction intermediates were identified, and their concentrations were followed for reaction yields ranging from low conversion to the formation of the final products. A reference hydrocarbon, n-decane, studied under the same experimental conditions gave very similar experimental concentration profiles for the main oxidation products. Because of the strong analogy between n-decane and kerosene oxidation kinetics, a detailed chemical kinetic reaction mechanisms describing the oxidation of n-decanemore » was built to reproduce the present experimental results. This mechanisms includes 573 elementary reactions, most of them being reversible, among 90 chemical species. A reasonably good prediction of the concentrations of major species was obtained by computation, covering the whole range of temperature, pressures, and equivalence ratios of the experiments. A kinetic analysis performed to identify the dominant reaction steps of the mechanism shows that, under the conditions of the present study (intermediate temperature and high pressure), HO{sub 2} radicals are important chain carriers leading to the formation of the branching agent H{sub 2}O{sub 2}.« less

  8. Ozone reaction with clothing and its initiated VOC emissions in an environmental chamber.

    PubMed

    Rai, A C; Guo, B; Lin, C-H; Zhang, J; Pei, J; Chen, Q

    2014-02-01

    Human health is adversely affected by ozone and the volatile organic compounds (VOCs) produced from its reactions in the indoor environment. Hence, it is important to characterize the ozone-initiated reactive chemistry under indoor conditions and study the influence of different factors on these reactions. This investigation studied the ozone reactions with clothing through a series of experiments conducted in an environmental chamber under various conditions. The study found that the ozone reactions with a soiled (human-worn) T-shirt consumed ozone and generated VOCs. The ozone removal rate and deposition velocity for the T-shirt increased with the increasing soiling level and air change rate, decreased at high ozone concentrations, and were relatively unaffected by the humidity. The deposition velocity for the soiled T-shirt ranged from 0.15 to 0.29 cm/s. The ozone-initiated VOC emissions included C6-C10 straight-chain saturated aldehydes, acetone, and 4-OPA (4-oxopentanal). The VOC emissions were generally higher at higher ozone, humidity, soiling of T-shirt, and air change rate. The total molar yield was approximately 0.5 in most cases, which means that for every two moles of ozone removed by the T-shirt surface, one mole of VOCs was produced. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

    PubMed

    Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

    2011-06-07

    Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

  10. High-throughput microfluidic single-cell digital polymerase chain reaction.

    PubMed

    White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

    2013-08-06

    Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

  11. Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

    NASA Astrophysics Data System (ADS)

    Verma, Anand Mohan; Kishore, Nanda

    2017-02-01

    The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

  12. Molecular beam scattering from C-13 enriched Kapton and correlation with the EOIM-3 carousel experiment

    NASA Technical Reports Server (NTRS)

    Minton, Timothy K.; Moore, Teresa A.

    1995-01-01

    Mass spectra of products emerging from identical samples of a C-13-enriched polyimide polymer (chemically equivalent to Kapton) under atomic oxygen bombardment in space and in the laboratory were collected. Reaction products unambiguously detected in space were CO-13, NO, (12)CO2, and (13)CO2. These reaction products and two others, H2O and CO-12, were detected in the laboratory, along with inelastically scattered atomic and molecular oxygen. Qualitative agreement was seen in the mass spectra taken in space and in the laboratory; the agreement may be improved by reducing the fraction of O2 in the laboratory molecular beam. Both laboratory and space data indicated that CO and CO2 products come preferentially from reaction with the imide component of the polymer chain, raising the possibility that the either component may degrade in part by the 'evaporation' of higher molecular weight fragments. Laboratory time-of-flight distributions showed: (1) incomplete energy accommodation of impinging O and O2 species that do not react with the surface; and (2) both hyperthermal and thermal CO and CO2 products, suggesting two distinct reaction mechanisms with the surface.

  13. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  14. Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

    NASA Technical Reports Server (NTRS)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

    1997-01-01

    Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

  15. ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

    PubMed Central

    Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

    2014-01-01

    ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

  16. Do Nursing Home Chain Size and Proprietary Status Affect Experiences With Care?

    PubMed

    You, Kai; Li, Yue; Intrator, Orna; Stevenson, David; Hirth, Richard; Grabowski, David; Banaszak-Holl, Jane

    2016-03-01

    In 2012, over half of nursing homes were operated by corporate chains. Facilities owned by the largest for-profit chains were reported to have lower quality of care. However, it is unknown how nursing home chain ownerships are related with experiences of care. To study the relationship between nursing home chain characteristics (chain size and profit status) with patients' family member reported ratings on experiences with care. Maryland nursing home care experience reports, the Online Survey, Certification, And Reporting (OSCAR) files, and Area Resource Files are used. Our sample consists of all nongovernmental nursing homes in Maryland from 2007 to 2010. Consumer ratings were reported for: overall care; recommendation of the facility; staff performance; care provided; food and meals; physical environment; and autonomy and personal rights. We identified chain characteristics from OSCAR, and estimated multivariate random effect linear models to test the effects of chain ownership on care experience ratings. Independent nonprofit nursing homes have the highest overall rating score of 8.9, followed by 8.6 for facilities in small nonprofit chains, and 8.5 for independent for-profit facilities. Facilities in small, medium, and large for-profit chains have even lower overall ratings of 8.2, 7.9, and 8.0, respectively. We find similar patterns of differences in terms of recommendation rate, and important areas such as staff communication and quality of care. Evidence suggests that Maryland nursing homes affiliated with large-for-profit and medium-for-profit chains had lower ratings of family reported experience with care.

  17. Sterically controlled mechanochemistry under hydrostatic pressure

    NASA Astrophysics Data System (ADS)

    Yan, Hao; Yang, Fan; Pan, Ding; Lin, Yu; Hohman, J. Nathan; Solis-Ibarra, Diego; Li, Fei Hua; Dahl, Jeremy E. P.; Carlson, Robert M. K.; Tkachenko, Boryslav A.; Fokin, Andrey A.; Schreiner, Peter R.; Galli, Giulia; Mao, Wendy L.; Shen, Zhi-Xun; Melosh, Nicholas A.

    2018-02-01

    Mechanical stimuli can modify the energy landscape of chemical reactions and enable reaction pathways, offering a synthetic strategy that complements conventional chemistry. These mechanochemical mechanisms have been studied extensively in one-dimensional polymers under tensile stress using ring-opening and reorganization, polymer unzipping and disulfide reduction as model reactions. In these systems, the pulling force stretches chemical bonds, initiating the reaction. Additionally, it has been shown that forces orthogonal to the chemical bonds can alter the rate of bond dissociation. However, these bond activation mechanisms have not been possible under isotropic, compressive stress (that is, hydrostatic pressure). Here we show that mechanochemistry through isotropic compression is possible by molecularly engineering structures that can translate macroscopic isotropic stress into molecular-level anisotropic strain. We engineer molecules with mechanically heterogeneous components—a compressible (‘soft’) mechanophore and incompressible (‘hard’) ligands. In these ‘molecular anvils’, isotropic stress leads to relative motions of the rigid ligands, anisotropically deforming the compressible mechanophore and activating bonds. Conversely, rigid ligands in steric contact impede relative motion, blocking reactivity. We combine experiments and computations to demonstrate hydrostatic-pressure-driven redox reactions in metal-organic chalcogenides that incorporate molecular elements that have heterogeneous compressibility, in which bending of bond angles or shearing of adjacent chains activates the metal-chalcogen bonds, leading to the formation of the elemental metal. These results reveal an unexplored reaction mechanism and suggest possible strategies for high-specificity mechanosynthesis.

  18. The AMINO experiment: exposure of amino acids in the EXPOSE-R experiment on the International Space Station and in laboratory

    NASA Astrophysics Data System (ADS)

    Bertrand, Marylène; Chabin, Annie; Colas, Cyril; Cadène, Martine; Chaput, Didier; Brack, Andre; Cottin, Herve

    2015-01-01

    In order to confirm the results of previous experiments concerning the chemical behaviour of organic molecules in the space environment, organic molecules (amino acids and a dipeptide) in pure form and embedded in meteorite powder were exposed in the AMINO experiment in the EXPOSE-R facility onboard the International Space Station. After exposure to space conditions for 24 months (2843 h of irradiation), the samples were returned to the Earth and analysed in the laboratory for reactions caused by solar ultraviolet (UV) and other electromagnetic radiation. Laboratory UV exposure was carried out in parallel in the Cologne DLR Center (Deutsches Zentrum für Luft und Raumfahrt). The molecules were extracted from the sample holder and then (1) derivatized by silylation and analysed by gas chromatography coupled to a mass spectrometer (GC-MS) in order to quantify the rate of degradation of the compounds and (2) analysed by high-resolution mass spectrometry (HRMS) in order to understand the chemical reactions that occurred. The GC-MS results confirm that resistance to irradiation is a function of the chemical nature of the exposed molecules and of the wavelengths of the UV light. They also confirm the protective effect of a coating of meteorite powder. The most altered compounds were the dipeptides and aspartic acid while the most robust were compounds with a hydrocarbon chain. The MS analyses document the products of reactions, such as decarboxylation and decarbonylation of aspartic acid, taking place after UV exposure. Given the universality of chemistry in space, our results have a broader implication for the fate of organic molecules that seeded the planets as soon as they became habitable as well as for the effects of UV radiation on exposed molecules at the surface of Mars, for example.

  19. Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.

    PubMed

    Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F

    1995-12-01

    Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.

  20. Production of RNA by a polymerase protein encapsulated within phospholipid vesicles

    NASA Technical Reports Server (NTRS)

    Chakrabarti, A. C.; Breaker, R. R.; Joyce, G. F.; Deamer, D. W.

    1994-01-01

    Catalyzed polymerization reactions represent a primary anabolic activity of all cells. It can be assumed that early cells carried out such reactions, in which macromolecular catalysts were encapsulated within some type of boundary membrane. In the experiments described here, we show that a template-independent RNA polymerase (polynucleotide phosphorylase) can be encapsulated in dimyristoyl phosphatidylcholine vesicles without substrate. When the substrate adenosine diphosphate (ADP) was provided externally, long-chain RNA polymers were synthesized within the vesicles. Substrate flux was maximized by maintaining the vesicles at the phase transition temperature of the component lipid. A protease was introduced externally as an additional control. Free enzyme was inactivated under identical conditions. RNA products were visualized in situ by ethidium bromide fluorescence. The products were harvested from the liposomes, radiolabeled, and analyzed by polyacrylamide gel electrophoresis. Encapsulated catalysts represent a model for primitive cellular systems in which an RNA polymerase was entrapped within a protected microenvironment.

  1. Decay spectroscopy of element 115 daughters: Rg 280 → Mt 276 and Mt 276 → Bh 272

    DOE PAGES

    Gates, J. M.; Gregorich, K. E.; Gothe, O. R.; ...

    2015-08-03

    In this study, forty-six decay chains, assigned to the decay of 288115, were produced using the 243Am ( 48Ca, 3n) 288115 reaction at the Lawrence Berkeley National Laboratory 88-in. cyclotron. The resulting series of α decays were studied using α-photon and α-x-ray spectroscopies. Multiple α-photon coincidences were observed in the element 115 decay chain members, particularly in the third- and fourth-generation decays (presumed to be 280Rg and 276Mt, respectively). Upon combining these data with those from 22 288115 decay chains observed in a similar experiment, updated level schemes in 276Mt and 272Bh (populated by the α decay of 280Rg andmore » 276Mt, respectively) are proposed. Additionally, photons were observed in the energy range expected for K x rays coincident with the α decay of both 280Rg and 276Mt. However, Compton scattering of higher-energy γ rays and discrete transitions are present in the K x-ray region preventing a definitive Z identification to be made based on observation of characteristic K x-ray energies.« less

  2. IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

    PubMed

    Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

    1999-09-01

    Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

  3. Diazotrophic bacterioplankton in a coral reef lagoon: phylogeny, diel nitrogenase expression and response to phosphate enrichment.

    PubMed

    Hewson, Ian; Moisander, Pia H; Morrison, Amanda E; Zehr, Jonathan P

    2007-05-01

    We investigated diazotrophic bacterioplankton assemblage composition in the Heron Reef lagoon (Great Barrier Reef, Australia) using culture-independent techniques targeting the nifH fragment of the nitrogenase gene. Seawater was collected at 3 h intervals over a period of 72 h (i.e. over diel as well as tidal cycles). An incubation experiment was also conducted to assess the impact of phosphate (PO(4)3*) availability on nifH expression patterns. DNA-based nifH libraries contained primarily sequences that were most similar to nifH from sediment, microbial mat and surface-associated microorganisms, with a few sequences that clustered with typical open ocean phylotypes. In contrast to genomic DNA sequences, libraries prepared from gene transcripts (mRNA amplified by reverse transcription-polymerase chain reaction) were entirely cyanobacterial and contained phylotypes similar to those observed in open ocean plankton. The abundance of Trichodesmium and two uncultured cyanobacterial phylotypes from previous studies (group A and group B) were studied by quantitative-polymerase chain reaction in the lagoon samples. These were detected as transcripts, but were not detected in genomic DNA. The gene transcript abundance of these phylotypes demonstrated variability over several diel cycles. The PO(4)3* enrichment experiment had a clearer pattern of gene expression over diel cycles than the lagoon sampling, however PO(4)3* additions did not result in enhanced transcript abundance relative to control incubations. The results suggest that a number of diazotrophs in bacterioplankton of the reef lagoon may originate from sediment, coral or beachrock surfaces, sloughing into plankton with the flooding tide. The presence of typical open ocean phylotype transcripts in lagoon bacterioplankton may indicate that they are an important component of the N cycle of the coral reef.

  4. Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

    PubMed Central

    Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

    2012-01-01

    Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

  5. The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

    1990-05-01

    There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

  6. From trace evidence to bioinformatics: putting bryophytes into molecular biology education.

    PubMed

    Fuselier, Linda; Bougary, Azhar; Malott, Michelle

    2011-01-01

    Students benefit most from their science education when they participate fully in the process of science in the context of real-world problems. We describe a student-directed open-inquiry lab experience that has no predetermined outcomes and requires students to engage in all components of scientific inquiry from posing a question through evaluating and reporting results. Over 5 weeks, students learn how bryophytes are used in forensics and become proficient in important molecular biology lab skills including DNA isolation, polymerase chain reaction, gel electrophoresis, capillary electrophoresis, and genotyping. For this portion of the experience, there is no specialized equipment necessary outside of gel electrophoresis supplies and a thermocycler. In an optional extension of the experience, students sequence a plastid intron and use introductory bioinformatics skills to identify species related to their forensics case. Students who participated in the lab experience performed well on content-based assessment, and student attitudes toward the experience were positive and indicative of engaged learning. The lab experience is easily modified for higher or lower level courses and can be used in secondary education. Copyright © 2011 Wiley Periodicals, Inc.

  7. Pressure-dependent competition among reaction pathways from first- and second-O 2 additions in the low-temperature oxidation of tetrahydrofuran

    DOE PAGES

    Antonov, Ivan O.; Zador, Judit; Rotavera, Brandon; ...

    2016-07-21

    Here, we report a combined experimental and quantum chemistry study of the initial reactions in low-temperature oxidation of tetrahydrofuran (THF). Using synchrotron-based time-resolved VUV photoionization mass spectrometry, we probe numerous transient intermediates and products at P = 10–2000 Torr and T = 400–700 K. A key reaction sequence, revealed by our experiments, is the conversion of THF-yl peroxy to hydroperoxy-THF-yl radicals (QOOH), followed by a second O 2 addition and subsequent decomposition to dihydrofuranyl hydroperoxide + HO 2 or to γ-butyrolactone hydroperoxide + OH. The competition between these two pathways affects the degree of radical chain-branching and is likely ofmore » central importance in modeling the autoignition of THF. We interpret our data with the aid of quantum chemical calculations of the THF-yl + O 2 and QOOH + O 2 potential energy surfaces. On the basis of our results, we propose a simplified THF oxidation mechanism below 700 K, which involves the competition among unimolecular decomposition and oxidation pathways of QOOH.« less

  8. Travel Behavior Change in Older Travelers: Understanding Critical Reactions to Incidents Encountered in Public Transport.

    PubMed

    Sundling, Catherine

    2015-11-18

    Accessibility of travel may be better understood if psychological factors underlying change in travel behavior are known. This paper examines older (65+) travelers' motives for changing their travel behavior. These changes are grounded in critical incidents earlier encountered in public-transport travel. A scientific framework is developed based on cognitive and behavioral theory. In 29 individual interviews, travelers' critical reactions (i.e., cognitive, emotional, and/or behavioral) to 77 critical incidents were examined. By applying critical incident technique (CIT), five reaction themes were identified that had generated travel-behavior change: firm restrictions, unpredictability, unfair treatment, complicated trips, and earlier adverse experiences. To improve older travelers' access to public transport, key findings were: (a) service must be designed so as to strengthen the feeling of being in control throughout the journey; (b) extended personal service would increase predictability in the travel chain and decrease travel complexity; consequently, (c) when designing new services and making effective accessibility interventions, policy makers should consider and utilize underlying psychological factors that could direct traveler behavior.

  9. Travel Behavior Change in Older Travelers: Understanding Critical Reactions to Incidents Encountered in Public Transport

    PubMed Central

    Sundling, Catherine

    2015-01-01

    Accessibility of travel may be better understood if psychological factors underlying change in travel behavior are known. This paper examines older (65+) travelers’ motives for changing their travel behavior. These changes are grounded in critical incidents earlier encountered in public-transport travel. A scientific framework is developed based on cognitive and behavioral theory. In 29 individual interviews, travelers’ critical reactions (i.e., cognitive, emotional, and/or behavioral) to 77 critical incidents were examined. By applying critical incident technique (CIT), five reaction themes were identified that had generated travel-behavior change: firm restrictions, unpredictability, unfair treatment, complicated trips, and earlier adverse experiences. To improve older travelers’ access to public transport, key findings were: (a) service must be designed so as to strengthen the feeling of being in control throughout the journey; (b) extended personal service would increase predictability in the travel chain and decrease travel complexity; consequently, (c) when designing new services and making effective accessibility interventions, policy makers should consider and utilize underlying psychological factors that could direct traveler behavior. PMID:26593935

  10. Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

    PubMed

    Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

    2016-08-08

    Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

  11. Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

    USDA-ARS?s Scientific Manuscript database

    Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

  12. Do nursing home chain size and proprietary status affect experiences with care?

    PubMed Central

    You, Kai; Li, Yue; Intrator, Orna; Stevenson, David; Hirth, Richard; Grabowski, David; Banaszak-Holl, Jane

    2015-01-01

    Background In 2012, over half of nursing homes were operated by corporate chains. Facilities owned by the largest for-profit chains were reported to have lower quality of care. However, it is unknown how nursing home chain ownerships are related with experiences of care. Objectives To study the relationship between nursing home chain characteristics (chain size and profit status) with patients' family member reported ratings on experiences with care. Data Sources and Study Design Maryland nursing home care experience reports, the Online Survey, Certification, And Reporting (OSCAR) files, and Area Resource Files are used. Our sample consists of all non-governmental nursing homes in Maryland from 2007 to 2010. Consumer ratings were reported for: overall care; recommendation of the facility; staff performance; care provided; food and meals; physical environment; and autonomy and personal rights. We identified chain characteristics from OSCAR, and estimated multivariate random effect linear models to test the effects of chain ownership on care experience ratings. Results Independent nonprofit nursing homes have the highest overall rating score of 8.9, followed by 8.6 for facilities in small nonprofit chains, and 8.5 for independent for-profit facilities. Facilities in small, medium and large for-profit chains have even lower overall ratings of 8.2, 7.9, and 8.0, respectively. We find similar patterns of differences in terms of recommendation rate, and important areas such as staff communication and quality of care. Conclusions Evidence suggests that Maryland nursing homes affiliated with large- and medium- for-profit chains had lower ratings of family reported experience with care. PMID:26765147

  13. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    PubMed

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  15. Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

    NASA Astrophysics Data System (ADS)

    Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

    2017-06-01

    A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

  16. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  17. Hydrolysis of the amorphous cellulose in cotton-based paper.

    PubMed

    Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

    2008-04-01

    Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

  18. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  19. [The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

    PubMed

    D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

    1993-01-01

    The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

  20. Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

    PubMed

    Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

    2002-02-28

    The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

  1. Elucidation of chemical reactions by two-dimensional resonance Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Molesky, Brian Paul

    It has been shown for many systems, including photosynthetic complexes, molecule-semiconductor interfaces, and bulk heterojunctions, that interaction between electronic and nuclear dynamics may heavily influence chemical mechanisms. Four-wave-mixing spectroscopies (i.e. transient absorption, two-dimensional spectroscopy) provide some insight into such non-equilibrium processes but are limited by the single "population time" available in these types of experiments. In this dissertation, two-dimensional resonance Raman spectroscopy (2DRR) is developed to obtain new information regarding chemical reactions that possess time coincident electronic and nuclear evolution. These new insights can only be acquired through higher-order techniques possessing two "population times". Specifically, the coherent reaction mechanism in triiodide photodissociation and structural heterogeneity in myoglobin are investigated. All multidimensional spectroscopies have roots in the off-resonant multidimensional Raman techniques developed from the late 1980's to the early 2000's. Throughout their development these experiments were plagued with technical challenges that eventually halted further use. In this dissertation it is shown through rigorous experimental tests that the technical challenges of the past are obviated for 2DRR, which is done under electronically resonant conditions. The key is that under electronic resonance the harmonic character of vibrational modes contributes to the signal. Under off-resonant conditions signal generation depends on much weaker effects. Upon absorption of light ranging from 250 to 500 nm triiodide photodissociates into diiodide and radical iodine on the same time scale as the period of triiodide's symmetric stretch, impulsively initiating coherence in the stretching coordinate of diiodide. In this dissertation, the sensitivity of 2DRR to coherent reaction mechanisms is shown by directly measuring, for the first time, how the nonequilibrium geometry of triiodide at the moment of photodissociation determines the stretching frequency of diiodide. The functions of heme proteins involve ligand binding and dissociation events, which are facilitated by the fast exchange of energy between the heme and aqueous solvent. It is known that the heme's propionic acid side chains act as an effective "gateway" for this fast energy exchange. In this dissertation it is shown that the propionic chains within myoglobin posses significant structural heterogeneity, suggesting that this may be an important factor in facilitating the functions of heme proteins.

  2. Apparatus and method for polymer synthesis using arrays

    DOEpatents

    Brennan, Thomas M.

    1995-01-01

    A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

  3. Apparatus and method for polymer synthesis using arrays

    DOEpatents

    Brennan, Thomas M.

    1996-01-01

    A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

  4. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1974-01-01

    Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.

  5. Structure-property relationships in a series of diglycerol tetraether model lipids and their lyotropic assemblies: the effect of branching topology and chirality.

    PubMed

    Markowski, Thomas; Drescher, Simon; Meister, Annette; Blume, Alfred; Dobner, Bodo

    2014-06-14

    Three novel diglycerol tetraether lipids with one membrane-spanning chain have been synthesized. These lipids contain only two or four racemic methyl branches at selected positions of the hydrophobic chains in contrast to natural lipids from archaebacterial membranes with an isoprenoid substitution pattern. The insertion of the methyl moieties was realized starting from either (RS)-citronellyl bromide or the inexpensive methyl malonic acid ethyl ester. For chain elongation the Cu-catalysed Grignard coupling reaction was used. The preparation of diglycerol tetraethers was either performed by condensing suitable blocked monoglycerol diethers by Grubbs metathesis or by reaction of the transmembrane C32-chain with blocked glycerols followed by further alkylation steps. Finally, we could show that the resulting lipids can form closed lipid vesicles comparable to the optically pure counterparts. Therefore, these much simpler lipids compared to the natural lipids from archaebacterial membranes are also suitable for preparation of stable tailored liposomes.

  6. RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schramm, V.L.

    1996-05-01

    The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

  7. ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

    PubMed

    Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

    2014-08-01

    ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robinson, N.A.; Wood, H.G.

    1986-05-01

    Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

  9. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    PubMed

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  11. A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

    PubMed

    Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

    2015-01-01

    The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

  12. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  13. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    PubMed

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

  15. Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

    PubMed

    Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

    2015-08-14

    In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

  16. A mathematical model for regulating monomer composition of the microbially synthesized polyhydroxyalkanoate copolymers.

    PubMed

    Xu, Jun; Guo, Baohua; Zhang, Zengmin; Wu, Qiong; Zhou, Quan; Chen, Jinchun; Chen, Guoqiang; Li, Guodong

    2005-06-30

    A mathematical model is proposed for predicting the copolymer composition of the microbially synthesized polyhydroxyalkanoate (PHA) copolymers. Based on the biochemical reactions involved in the precursor formation and polymerization pathways, the model correlates the copolymer composition with the cultivation conditions, the enzyme levels and selectivity, and the metabolic pathways. It suggests the following points: (1) in the case of a sole carbon source, the copolymer composition depends mainly on the topology of the metabolic pathways and the selectivity of both the enzymes involved in the precursor formation and the polymerization route; (2) the copolymer composition can be varied in a wide range via alteration of the flux ratio of different types of monomers channeled from two or more independent and simultaneous pathways; (3) the enzymes which should be over-expressed or inhibited to obtain the desired copolymer composition can be predicted. For example, inhibition of the beta-oxidation pathway will increase the content of the monomer units with longer chain length. To test the model, various experiments were envisaged by varying cultivation time, concentration and chain length of the sole carbon source, and molar ratio of the cosubstrates. The predictions from the model agree well with the experimental results. Therefore, the proposed model will be useful in predicting the PHA copolymer composition under different biochemical reaction conditions. In other words, it can provide a guide for the synthesis of desired PHA copolymers.

  17. [THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

    PubMed

    Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

    2015-11-01

    The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

  18. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  19. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  20. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    PubMed

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

    NASA Astrophysics Data System (ADS)

    Oshanin, G.; Burlatsky, S. F.

    2002-11-01

    We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

  2. Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

    PubMed

    Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

    2018-04-17

    A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

  3. Photo-induced Mass Transport through Polymer Networks

    NASA Astrophysics Data System (ADS)

    Meng, Yuan; Anthamatten, Mitchell

    2014-03-01

    Among adaptable materials, photo-responsive polymers are especially attractive as they allow for spatiotemporal stimuli and response. We have recently developed a macromolecular network capable of photo-induced mass transport of covalently bound species. The system comprises of crosslinked chains that form an elastic network and photosensitive fluorescent arms that become mobile upon irradiation. We form loosely crosslinked polymer networks by Michael-Addition between multifunctional thiols and small molecule containing acrylate end-groups. The arms are connected to the network by allyl sulfide, that undergoes addition-fragmentation chain transfer (AFCT) in the presence of free radicals, releasing diffusible fluorophore. The networks are loaded with photoinitiator to allow for spatial modulation of the AFCT reactions. FRAP experiments within bulk elastomers are conducted to establish correlations between the fluorophore's diffusion coefficient and experimental variables such as network architecture, temperature and UV intensity. Photo-induced mass transport between two contacted films is demonstrated, and release of fluorophore into a solvent is investigated. Spatial and temporal control of mass transport could benefit drug release, printing, and sensing applications.

  4. Stationary microfluidics: molecular diagnostic assays by moving magnetic beads through non-moving liquids

    NASA Astrophysics Data System (ADS)

    Becker, Holger; Carstens, Cornelia; Kuhlmeier, Dirk; Sandetskaya, Natalia; Schröter, Nicole; Zilch, Christian; Gärtner, Claudia

    2013-03-01

    Commonly, microfluidic devices are based on the movement of fluids. For molecular diagnostics assays which often include steps like PCR, this practically always involves a more or less complicated set of external pumps, valves and liquid controls. In the presented paper, we follow a different approach in which the fluid after sample introduction remains stationary and the main bioactive sample molecules are moved through a chain of reaction compartments which contain the different reagents necessary for the assay. The big advantage of this concept is the lack of any external fluid actuation/control. Results on sample carry-over experiments and complete assays will be given.

  5. Recoil- α -fission and recoil- α – α -fission events observed in the reaction 48 Ca + 243 Am

    DOE PAGES

    Forsberg, U.; Rudolph, D.; Andersson, L. -L.; ...

    2016-04-26

    A recent high-resolution α, X-ray, and γ-ray coincidence-spectroscopy experiment at GSI offered the first glimpse of excitation schemes of isotopes along α-decay chains of Z=115. To understand these observations and to make predictions about shell structure of superheavy nuclei below 288115, we employed nuclear DFT. We find that the presence and nature of low-energy E1 transitions in well-deformed nuclei around Z=110, N=168 strongly depends on the strength of the spin-orbit coupling; hence, it provides an excellent constraint on theoretical models of superheavy nuclei.

  6. Thermally multiplexed polymerase chain reaction.

    PubMed

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  7. Molecular diagnostics of periodontitis.

    PubMed

    Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

    2017-01-28

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  8. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  9. Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

    PubMed

    Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

    1993-11-01

    To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

  10. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

  11. Specific Function of the Met-Tyr-Trp Adduct Radical and Residues Arg-418 and Asp-137 in the Atypical Catalase Reaction of Catalase-Peroxidase KatG*

    PubMed Central

    Zhao, Xiangbo; Khajo, Abdelahad; Jarrett, Sanchez; Suarez, Javier; Levitsky, Yan; Burger, Richard M.; Jarzecki, Andrzej A.; Magliozzo, Richard S.

    2012-01-01

    Catalase activity of the dual-function heme enzyme catalase-peroxidase (KatG) depends on several structural elements, including a unique adduct formed from covalently linked side chains of three conserved amino acids (Met-255, Tyr-229, and Trp-107, Mycobacterium tuberculosis KatG numbering) (MYW). Mutagenesis, electron paramagnetic resonance, and optical stopped-flow experiments, along with calculations using density functional theory (DFT) methods revealed the basis of the requirement for a radical on the MYW-adduct, for oxyferrous heme, and for conserved residues Arg-418 and Asp-137 in the rapid catalase reaction. The participation of an oxyferrous heme intermediate (dioxyheme) throughout the pH range of catalase activity is suggested from our finding that carbon monoxide inhibits the activity at both acidic and alkaline pH. In the presence of H2O2, the MYW-adduct radical is formed normally in KatG[D137S] but this mutant is defective in forming dioxyheme and lacks catalase activity. KatG[R418L] is also catalase deficient but exhibits normal formation of the adduct radical and dioxyheme. Both mutants exhibit a coincidence between MYW-adduct radical persistence and H2O2 consumption as a function of time, and enhanced subunit oligomerization during turnover, suggesting that the two mutations disrupting catalase turnover allow increased migration of the MYW-adduct radical to protein surface residues. DFT calculations showed that an interaction between the side chain of residue Arg-418 and Tyr-229 in the MYW-adduct radical favors reaction of the radical with the adjacent dioxyheme intermediate present throughout turnover in WT KatG. Release of molecular oxygen and regeneration of resting enzyme are thereby catalyzed in the last step of a proposed catalase reaction. PMID:22918833

  12. Evolution of material properties during free radical photopolymerization

    NASA Astrophysics Data System (ADS)

    Wu, Jiangtao; Zhao, Zeang; Hamel, Craig M.; Mu, Xiaoming; Kuang, Xiao; Guo, Zaoyang; Qi, H. Jerry

    2018-03-01

    Photopolymerization is a widely used polymerization method in many engineering applications such as coating, dental restoration, and 3D printing. It is a complex chemical and physical process, through which a liquid monomer solution is rapidly converted to a solid polymer. In the most common free-radical photopolymerization process, the photoinitiator in the solution is exposed to light and decomposes into active radicals, which attach to monomers to start the polymerization reaction. The activated monomers then attack Cdbnd C double bonds of unsaturated monomers, which leads to the growth of polymer chains. With increases in the polymer chain length and the average molecular weight, polymer chains start to connect and form a network structure, and the liquid polymer solution becomes a dense solid. During this process, the material properties of the cured polymer change dramatically. In this paper, experiments and theoretical modeling are used to investigate the free-radical photopolymerization reaction kinetics, material property evolution and mechanics during the photopolymerization process. The model employs the first order chemical reaction rate equations to calculate the variation of the species concentrations. The degree of monomer conversion is used as an internal variable that dictates the mechanical properties of the cured polymer at different curing states, including volume shrinkage, glass transition temperature, and nonlinear viscoelastic properties. To capture the nonlinear behavior of the cured polymer under low temperature and finite deformation, a multibranch nonlinear viscoelastic model is developed. A phase evolution model is used to describe the mechanics of the coupling between the crosslink network evolution and mechanical loading during the curing process. The comparison of the model and the experimental results indicates that the model can capture property changes during curing. The model is further applied to investigate the internal stress of a thick sample caused by volume shrinkage during photopolymerization. Changes in the conversion degree gradient and the internal stress during photopolymerization are determined using FEM simulation. The model can be extended to many photocuring processes, such as photopolymerization 3D printing, surface coating and automotive part curing processes.

  13. Standard Free Droplet Digital Polymerase Chain Reaction as a New Tool for the Quality Control of High-Capacity Adenoviral Vectors in Small-Scale Preparations

    PubMed Central

    Boehme, Philip; Stellberger, Thorsten; Solanki, Manish; Zhang, Wenli; Schulz, Eric; Bergmann, Thorsten; Liu, Jing; Doerner, Johannes; Baiker, Armin E.

    2015-01-01

    Abstract High-capacity adenoviral vectors (HCAdVs) are promising tools for gene therapy as well as for genetic engineering. However, one limitation of the HCAdV vector system is the complex, time-consuming, and labor-intensive production process and the following quality control procedure. Since HCAdVs are deleted for all viral coding sequences, a helper virus (HV) is needed in the production process to provide the sequences for all viral proteins in trans. For the purification procedure of HCAdV, cesium chloride density gradient centrifugation is usually performed followed by buffer exchange using dialysis or comparable methods. However, performing these steps is technically difficult, potentially error-prone, and not scalable. Here, we establish a new protocol for small-scale production of HCAdV based on commercially available adenovirus purification systems and a standard method for the quality control of final HCAdV preparations. For titration of final vector preparations, we established a droplet digital polymerase chain reaction (ddPCR) that uses a standard free-end-point PCR in small droplets of defined volume. By using different probes, this method is capable of detecting and quantifying HCAdV and HV in one reaction independent of reference material, rendering this method attractive for accurately comparing viral titers between different laboratories. In summary, we demonstrate that it is possible to produce HCAdV in a small scale of sufficient quality and quantity to perform experiments in cell culture, and we established a reliable protocol for vector titration based on ddPCR. Our method significantly reduces time and required equipment to perform HCAdV production. In the future the ddPCR technology could be advantageous for titration of other viral vectors commonly used in gene therapy. PMID:25640117

  14. A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

    DTIC Science & Technology

    1998-08-01

    polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

  15. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  16. [EXPERIENCE OF STUDY AND POSSIBLE WAYS OF ELIMINATION OF FALSE POSITIVE AND FALSE NEGATIVE RESULTS DURING EXECUTION OF POLYMERASE CHAIN REACTION ON AN EXAMPLE OF JUNIN VIRUS RNA DETECTION].

    PubMed

    Sizikova, T E; Lebedev, V N; Pantyukhov, V B; Borisevich, S V; Merkulov, V A

    2015-01-01

    Experience of study and possible ways of elimination of false positive and false negative results during execution of polymerase chain reaction on an example of Junin virus RNA detection. MATERIALSS AND METHODS: Junin virus--causative agent of Argentine hemorrhagic fever (AHF) strain XJpR37/5787 was obtained from the State collection of pathogenicity group I causative agents of the 48th Central Research Institute. Reagent kit for detection of Junin virus RNA by RT-PCR was developed in the Institute and consists of 4 sets: for isolation of RNA, execution of reverse-transcription reaction, execution of PCR and electrophoretic detection of PCR products. RT-PCR was carried out by a standard technique. Continuous cell cultures of African green monkey Vero B, GMK-AH-1(D) were obtained from the museum of cell culture department of the Centre. An experimental study of the effect of various factors of impact on the sample under investigation ("thawing-freezing", presence of formaldehyde, heparin) on the obtaining of false negative results during Junin virus RNA detection by using RT-PCR was studied. Addition of 0.01% heparin to the samples was shown to completely inhibit PCR. Addition of 0.05% formaldehyde significantly reduces sensitivity of the method. A possibility of reduction of analysis timeframe from 15 to 5 days was shown during detection of the causative agent in samples with low concentration of the latter by growing the samples and subsequent analysis of the material obtained by using RT-PCR. During detection of causative agent by using RT-PCR false negative results could appear in the presence of formaldehyde and heparin in the sample. A possibility of elimination of false negative PCR results due to concentration of the causative agent in the sample under investigation at a level below sensitivity threshold was shown on the example of Junin virus RNA detection by using growing of the pathogen in appropriate accumulation system with subsequent analysis of the material obtained using PCR.

  17. Prize to a Faculty Member for Research in an Undergraduate: Chaotic mixing and front propagation

    NASA Astrophysics Data System (ADS)

    Solomon, Tom

    2014-03-01

    We present results from a series of experiments - all done with undergraduate students - on chaotic fluid mixing and the effects of fluid flows on the behavior of reaction systems. Simple, well-ordered laminar fluid flows can give rise to fluid mixing with complexity far beyond that of the underlying flow, with tracers that separate exponentially in time and invariant manifolds that act as barriers to transport. Recently, we have studied how fluid mixing affects the propagation of reaction fronts in a flow. This is an issue with applications to a wide range of systems including microfluidic chemical reactors, blooms of phytoplankton in the oceans, and the spreading of a disease in a moving population. To analyze and predict the behavior of the fronts, we generalize tools developed to describe passive mixing. In particular, the concept of an invariant manifold is expanded to account for reactive burning. ``Burning invariant manifolds'' (BIMs) are predicted and measured experimentally as structures in the flow that act as one-way barriers that block the motion of reaction fronts. We test these ideas experimentally in three fluid flows: (a) and chain of alternating vortices; (b) an extended, spatially-random pattern of vortices; and (c) a time-independent, three-dimensional, nested vortex flow. The reaction fronts are produced chemically with variations of the well-known Belousov-Zhabotinsky reaction. Supported by Research Corporation and the National Science Foundation.

  18. Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

    USGS Publications Warehouse

    Ostberg, C.O.; Rodriguez, R.J.

    2004-01-01

    Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

  19. Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

    PubMed

    Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

    2015-03-07

    We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

  20. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  1. Molecular implementation of molecular shift register memories

    NASA Technical Reports Server (NTRS)

    Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

    1991-01-01

    An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

  2. Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

    PubMed

    Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

    1998-04-01

    Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

  3. Peroxy radical measurements with NCAR's chemical amplifier

    NASA Technical Reports Server (NTRS)

    Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

    1994-01-01

    The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

  4. Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

    PubMed

    Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

    1995-01-01

    Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

  5. Ab initio study of chain branching reactions involving second generation products in hydrocarbon combustion mechanisms.

    PubMed

    Davis, Alexander C; Francisco, Joseph S

    2012-01-28

    sec-Alkyl radicals are key reactive intermediates in the hydrocarbon combustion and atmospheric decomposition mechanisms that are formed by the abstraction of hydrogen from an alkane, or as a second generation product of n-alkyl H-migrations, C-C bond scissions in branched alkyl radicals, or the bimolecular reaction between olefins and n-alkyl radicals. Since alkanes and branched alkanes, which the sec-alkyl radicals are derived from, make up roughly 40-50% of traditional fuels an understanding of their chemistry is essential to improving combustion systems. The present work investigates all H-migration reactions initiated from an sec-alkyl radical that involve the movement of a secondary hydrogen, for the 2-butyl through 4-octyl radicals, using the CBS-Q, G2, and G4 composite methods. The resulting thermodynamic and kinetic parameters are compared to similar reactions in n-alkyl radicals in order to determine underlying trends. Particular attention is paid to the effect of cis/trans and 1,3-diaxial interactions on activation energies and rate coefficients. When combined with our previous work on n-alkyl radical H-migrations, a complete picture of H-migrations in unbranched alkyl radicals is obtained. This full data set suggests that the directionality of the remaining branched chains has a minimal effect on the rate coefficients for all but the largest viable transition states, which is in stark contrast to the differences predicted by the structurally similar dimethylcycloalkanes. In fact the initial location of the secondary radical site has a greater effect on the rate than does the directionality of the remaining alkyl chains. The activation energies for secondary to secondary reactions are much closer to those of the secondary to primary H-migrations. However, the rate coefficients are found to be closer to the corresponding primary to primary reaction values. A significant ramification of these results is that there will be multiple viable reaction pathways for these reactions instead of only one dominant pathway as previously believed.

  6. Vibrational non-equilibrium in the hydrogen-oxygen reaction. Comparison with experiment

    NASA Astrophysics Data System (ADS)

    Skrebkov, Oleg V.

    2015-03-01

    A theoretical model is proposed for the chemical and vibrational kinetics of hydrogen oxidation based on consistent accounting of the vibrational non-equilibrium of the HO2 radical that forms as a result of the bimolecular recombination H+O2 → HO2. In the proposed model, the chain branching H+O2 = O+OH and inhibiting H+O2+M = HO2+M formal reactions are treated (in the terms of elementary processes) as a single multi-channel process of forming, intramolecular energy redistribution between modes, relaxation, and unimolecular decay of the comparatively long-lived vibrationally excited HO2 radical, which is able to react and exchange energy with the other components of the mixture. The model takes into account the vibrational non-equilibrium of the starting (primary) H2 and O2 molecules, as well as the most important molecular intermediates HO2, OH, O2(1Δ), and the main reaction product H2O. It is shown that the hydrogen-oxygen reaction proceeds in the absence of vibrational equilibrium, and the vibrationally excited HO2(v) radical acts as a key intermediate in a fundamentally important chain branching process and in the generation of electronically excited species O2(1Δ), O(1D), and OH(2Σ+). The calculated results are compared with the shock tube experimental data for strongly diluted H2-O2 mixtures at 1000 < T < 2500 K, 0.5 < p < 4 atm. It is demonstrated that this approach is promising from the standpoint of reconciling the predictions of the theoretical model with experimental data obtained by different authors for various compositions and conditions using different methods. For T < 1500 K, the nature of the hydrogen-oxygen reaction is especially non-equilibrium, and the vibrational non-equilibrium of the HO2 radical is the essence of this process. The quantitative estimation of the vibrational relaxation characteristic time of the HO2 radical in its collisions with H2 molecules has been obtained as a result of the comparison of different experimental data on induction time measurements with the relevant calculations.

  7. Theoretical and computer models of detonation in solid explosives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tarver, C.M.; Urtiew, P.A.

    1997-10-01

    Recent experimental and theoretical advances in understanding energy transfer and chemical kinetics have led to improved models of detonation waves in solid explosives. The Nonequilibrium Zeldovich - von Neumann - Doring (NEZND) model is supported by picosecond laser experiments and molecular dynamics simulations of the multiphonon up-pumping and internal vibrational energy redistribution (IVR) processes by which the unreacted explosive molecules are excited to the transition state(s) preceding reaction behind the leading shock front(s). High temperature, high density transition state theory calculates the induction times measured by laser interferometric techniques. Exothermic chain reactions form product gases in highly excited vibrational states,more » which have been demonstrated to rapidly equilibrate via supercollisions. Embedded gauge and Fabry-Perot techniques measure the rates of reaction product expansion as thermal and chemical equilibrium is approached. Detonation reaction zone lengths in carbon-rich condensed phase explosives depend on the relatively slow formation of solid graphite or diamond. The Ignition and Growth reactive flow model based on pressure dependent reaction rates and Jones-Wilkins-Lee (JWL) equations of state has reproduced this nanosecond time resolved experimental data and thus has yielded accurate average reaction zone descriptions in one-, two- and three- dimensional hydrodynamic code calculations. The next generation reactive flow model requires improved equations of state and temperature dependent chemical kinetics. Such a model is being developed for the ALE3D hydrodynamic code, in which heat transfer and Arrhenius kinetics are intimately linked to the hydrodynamics.« less

  8. Aqueous geochemistry of low molecular weight hydrocarbons at elevated temperatures and pressures: constraints from mineral buffered laboratory experiments

    NASA Astrophysics Data System (ADS)

    Seewald, Jeffrey S.

    2001-05-01

    Organic matter, water, and minerals coexist at elevated temperatures and pressures in sedimentary basins and participate in a wide range of geochemical processes that includes the generation of oil and natural gas. A series of laboratory experiments were conducted at 300 to 350°C and 350 bars to examine chemical interactions involving low molecular weight aqueous hydrocarbons with water and Fe-bearing minerals under hydrothermal conditions. Mineral buffers composed of hematite-magnetite-pyrite, hematite-magnetite, and pyrite-pyrrhotite-magnetite were added to each experiment to fix the redox state of the fluid and the activity of reduced sulfur species. During each experiment the chemical system was externally modified by addition of ethene, ethane, propene, 1-butene, or n-heptane, and variations in the abundance of aqueous organic species were monitored as a function of time and temperature. Results of the experiments indicate that decomposition of aqueous n-alkanes proceeds through a series of oxidation and hydration reactions that sequentially produce alkenes, alcohols, ketones, and organic acids as reaction intermediaries. Organic acids subsequently undergo decarboxylation and/or oxidation reactions to form carbon dioxide and shorter chain saturated hydrocarbons. This alteration assemblage is compositionally distinct from that produced by thermal cracking under anhydrous conditions, indicating that the presence of water and minerals provide alternative reaction pathways for the decomposition of hydrocarbons. The rate of hydrocarbon oxidation decreases substantially under reducing conditions and in the absence of catalytically active aqueous sulfur species. These results represent compelling evidence that the stability of aqueous hydrocarbons at elevated temperatures in natural environments is not a simple function of time and temperature alone. Under the appropriate geochemical conditions, stepwise oxidation represents a mechanism for the decomposition of low molecular weight hydrocarbons and the production of methane-rich ("dry") natural gas. Evaluation of aqueous reaction products generated during the experiments within a thermodynamic framework indicates that alkane-alkene, alkene-ketone, and alkene-alcohol reactions attained metastable thermodynamic equilibrium states. This equilibrium included water and iron-bearing minerals, demonstrating the direct involvement of inorganic species as reactants during organic transformations. The high reactivity of water and iron-bearing minerals suggests that they represent abundant sources of hydrogen and oxygen available for the formation of hydrocarbons and oxygenated alteration products. Thus, variations in elemental kerogen composition may not accurately reflect the timing and extent of hydrocarbon, carbon dioxide, and organic acid generation in sedimentary basins. This study demonstrates that the stabilities of aqueous hydrocarbons are strongly influenced by inorganic sediment composition at elevated temperatures. Incorporation of such interactions into geochemical models will greatly improve prediction of the occurrence of hydrocarbons in natural environments over geologic time.

  9. Novel odd/even effect of alkylene chain length on the photopolymerizability of organogelators.

    PubMed

    Aoki, Ken'ichi; Kudo, Masabumi; Tamaoki, Nobuyuki

    2004-10-28

    [reaction: see text] Starting from diactylene diacarboxylic acids, we have synthesized a series of photopolymerizable organogelators that possess simple amide structures, different alkylene chain lengths, and either optically active or racemic 3,7-dimethyl-1-octylamine units. The alkylene chain length of these compounds exhibits a prominent odd/even effect with respect to the photopolymerization in the gel state and is accompanied by a stereostructural effect on the gelation ability.

  10. Role of choline and glycine betaine in the formation of N,N-dimethylpiperidinium (mepiquat) under Maillard reaction conditions.

    PubMed

    Bessaire, Thomas; Tarres, Adrienne; Stadler, Richard H; Delatour, Thierry

    2014-01-01

    This study is the first to examine the role of choline and glycine betaine, naturally present in some foods, in particular in cereal grains, to generate N,N-dimethylpiperidinium (mepiquat) under Maillard conditions via transmethylation reactions involving the nucleophile piperidine. The formation of mepiquat and its intermediates piperidine - formed by cyclisation of free lysine in the presence of reducing sugars - and N-methylpiperidine were monitored over time (240°C, up to 180 min) using high-resolution mass spectrometry in a model system comprised of a ternary mixture of lysine/fructose/alkylating agent (choline or betaine). The reaction yield was compared with data recently determined for trigonelline, a known methylation agent present naturally in coffee beans. The role of choline and glycine betaine in nucleophilic displacement reactions was further supported by experiments carried out with stable isotope-labelled precursors (¹³C- and deuterium-labelled). The results unequivocally demonstrated that the piperidine ring of mepiquat originates from the carbon chain of lysine, and that either choline or glycine betaine furnishes the N-methyl groups. The kinetics of formation of the corresponding demethylated products of both choline and glycine betaine, N,N-demethyl-2-aminoethanol and N,N-dimethylglycine, respectively, were also determined using high-resolution mass spectrometry.

  11. Coq6 Is Responsible for the C4-deamination Reaction in Coenzyme Q Biosynthesis in Saccharomyces cerevisiae*

    PubMed Central

    Ozeir, Mohammad; Pelosi, Ludovic; Ismail, Alexandre; Mellot-Draznieks, Caroline; Fontecave, Marc; Pierrel, Fabien

    2015-01-01

    The yeast Saccharomyces cerevisiae is able to use para-aminobenzoic acid (pABA) in addition to 4-hydroxybenzoic acid as a precursor of coenzyme Q, a redox lipid essential to the function of the mitochondrial respiratory chain. The biosynthesis of coenzyme Q from pABA requires a deamination reaction at position C4 of the benzene ring to substitute the amino group with an hydroxyl group. We show here that the FAD-dependent monooxygenase Coq6, which is known to hydroxylate position C5, also deaminates position C4 in a reaction implicating molecular oxygen, as demonstrated with labeling experiments. We identify mutations in Coq6 that abrogate the C4-deamination activity, whereas preserving the C5-hydroxylation activity. Several results support that the deletion of Coq9 impacts Coq6, thus explaining the C4-deamination defect observed in Δcoq9 cells. The vast majority of flavin monooxygenases catalyze hydroxylation reactions on a single position of their substrate. Coq6 is thus a rare example of a flavin monooxygenase that is able to act on two different carbon atoms of its C4-aminated substrate, allowing its deamination and ultimately its conversion into coenzyme Q by the other proteins constituting the coenzyme Q biosynthetic pathway. PMID:26260787

  12. Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

    2011-04-01

    Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

  13. Shock tube measurements of specific reaction rates in branched chain CH4-CO-O2 system

    NASA Technical Reports Server (NTRS)

    Brabbs, T. A.; Brokaw, R. S.

    1974-01-01

    Rate constants of two elementary bimolecular reactions involved in the oxidation of methane were determined by monitoring the exponential growth of CO flame band emission behind incident shocks in three suitably chosen gas mixtures.

  14. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

    NASA Astrophysics Data System (ADS)

    Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

    2017-06-01

    The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

  16. Structural modulation of silver complexes and their distinctive catalytic properties.

    PubMed

    Zhao, Yue; Chen, Kai; Fan, Jian; Okamura, Taka-aki; Lu, Yi; Luo, Li; Sun, Wei-Yin

    2014-02-07

    A family of silver(I) complexes, [Ag2(L)2(OOCCF3)2] (1), [Ag(L)0.5(OOCCF3)] (2), [Ag(L)2](OOCCF3)(H2O)2 (3), was obtained by reactions of 4,4'-di(2-oxazolinyl)biphenyl (L) and AgOOCCF3 in different reaction media. Compound 1 has a 1D chain structure with alternative connections between the Ag(I) and L ligand. When the crystal nucleation inductor, pyrazine, was added into the reaction system, complex 2 was isolated with no pyrazine observed in its structure. In 2, the 1D inorganic chains formed by Ag(I) cations and OOCCF3(-) anions were connected by the L ligand to produce a 2D network. When a different inductor, imidazole, was added into the reaction system, 3 with (4,4) topology was synthesized, and again no imidazole was found in 3. When 1-3 were used as catalysts for cycloaddition reactions between imino esters and methyl acrylate, 3 affords the highest yield, in which the particular size of the channels in 3 led to its selective catalytic performance.

  17. Experimental Study of Abiotic Organic Synthesis at High Temperature and Pressure Conditions: Carbon Isotope and Mineral Surface Characterizations

    NASA Astrophysics Data System (ADS)

    Fu, Q.; Socki, R. A.; Niles, P. B.

    2010-12-01

    Abiotic organic synthesis processes have been proposed as potential mechanisms for methane generation in subseafloor hydrothermal systems on Earth, and on other planets. To better understand the detailed reaction pathways and carbon isotope fractionations in this process under a wide range of physical and chemical conditions, hydrothermal experiments at high temperature (750 °C) and pressure (0.55 GPa) were performed using piston cylinder apparatus. Formic acid was used as the source of CO2 and H2, and magnetite was the mineral catalyst. The chemical and carbon isotopic compositions of dissolved organic products were determined by GC-C-MS-IRMS, while organic intermediaries on the mineral catalyst were characterized by Pyrolysis-GC-MS. Among experimental products, dissolved CO2 was the dominant carbon species with a relative abundance of 88 mol%. Dissolved CH4 and C2H6 were also identified with a mole ratio of CH4 over C2H6 of 15:1. No dissolved CO was detected in the experiment, which might be attributable to the loss of H2 through the Au capsule used in the experiments at high temperature and pressure conditions and corresponding conversion of CO to CO2 by the water-gas shift reaction. Carbon isotope results showed that the δ13C values of CH4 and C2H6 were -50.3‰ and -39.3‰ (V-PDB), respectively. CO2 derived from decarboxylation of formic acid had a δ13C value of -19.2‰, which was 3.2‰ heavier than its source, formic acid. The δ13C difference between CO2 and CH4 was 31.1‰, which was higher than the value of 9.4‰ calculated from theoretical isotopic equilibrium predictions at experimental conditions, suggesting the presence of a kinetic isotope effect. This number was also higher than the values (4.6 to 27.1‰) observed in similar experiments previously performed at 400 °C and 50 MPa with longer reaction times. CH4 is 11.0‰ less enriched in 13C than C2H6. Alcohols were observed as carbon compounds on magnetite surfaces by Pyrolysis-GC-MS, which confirms the hypothesis regarding the reaction pathways of hydrothermal abiotic organic synthesis proposed by Fu et al. (2007, 2008). In this proposed pathway, hydroxymethylene (-CHOH) groups serve as organic intermediaries on mineral surfaces while dissolved H2 serves as a chain terminator/breaker to generate short chain hydrocarbons and oxygenated compounds. This pathway is different from the carbide polymerization theory of Fischer-Tropsch-type (FTT) synthesis in a gas phase. The observed increase of δ13C values of C1 and C2 alkanes with carbon number in our hydrothermal experiments can be readily interpreted by hydroxymethylene pathway, and might be used to differentiate between hydroxymethylene and carbide polymerization pathways. Carbon isotope analysis of alcohols on mineral catalyst surfaces is under way to provide further constraints on formation of organic compounds by FTT in hydrothermal systems.

  18. Experimental Study of Abiotic Organic Synthesis at High Temperature and Pressure Conditions: Carbon Isotope and Mineral Surface Characterizations

    NASA Technical Reports Server (NTRS)

    Fu, Qi; Socki, R. A.; Niles, P. B.

    2010-01-01

    Abiotic organic synthesis processes have been proposed as potential mechanisms for methane generation in subseafloor hydrothermal systems on Earth, and on other planets. To better understand the detailed reaction pathways and carbon isotope fractionations in this process under a wide range of physical and chemical conditions, hydrothermal experiments at high temperature (750 C) and pressure (0.55 GPa) were performed using piston cylinder apparatus. Formic acid was used as the source of CO2 and H2, and magnetite was the mineral catalyst. The chemical and carbon isotopic compositions of dissolved organic products were determined by GC-C-MS-IRMS, while organic intermediaries on the mineral catalyst were characterized by Pyrolysis-GC-MS. Among experimental products, dissolved CO2 was the dominant carbon species with a relative abundance of 88 mol%. Dissolved CH4 and C2H6 were also identified with a mole ratio of CH4 over C2H6 of 15:1. No dissolved CO was detected in the experiment, which might be attributable to the loss of H2 through the Au capsule used in the experiments at high temperature and pressure conditions and corresponding conversion of CO to CO2 by the water-gas shift reaction. Carbon isotope results showed that the 13C values of CH4 and C2H6 were -50.3% and -39.3% (V-PDB), respectively. CO2 derived from decarboxylation of formic acid had a (sigma)C-13 value of -19.2%, which was 3.2% heavier than its source, formic acid. The (sigma)C-13 difference between CO2 and CH4 was 31.1%, which was higher than the value of 9.4% calculated from theoretical isotopic equilibrium predictions at experimental conditions, suggesting the presence of a kinetic isotope effect. This number was also higher than the values (4.6 to 27.1%) observed in similar experiments previously performed at 400 C and 50 MPa with longer reaction times. CH4 is 11.0% less enriched in C-13 than C2H6. Alcohols were observed as carbon compounds on magnetite surfaces by Pyrolysis-GC-MS, which confirms the hypothesis regarding the reaction pathways of hydrothermal abiotic organic synthesis proposed by Fu et al. (2007, 2008). In this proposed pathway, hydroxymethylene (-CHOH) groups serve as organic intermediaries on mineral surfaces while dissolved H2 serves as a chain terminator/breaker to generate short chain hydrocarbons and oxygenated compounds. This pathway is different from the carbide polymerization theory of Fischer- Tropsch-type (FTT) synthesis in a gas phase. The observed increase of (sigma)C-13 values of C1 and C2 alkanes with carbon number in our hydrothermal experiments can be readily interpreted by hydroxymethylene pathway, and might be used to differentiate between hydroxymethylene and carbide polymerization pathways. Carbon isotope analysis of alcohols on mineral catalyst surfaces is under way to provide further constraints on formation of organic compounds by FTT in hydrothermal systems.

  19. On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

    PubMed

    Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

    2017-02-01

    A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

  20. Graphite grain-size spectrum and molecules from core-collapse supernovae

    NASA Astrophysics Data System (ADS)

    Clayton, Donald D.; Meyer, Bradley S.

    2018-01-01

    Our goal is to compute the abundances of carbon atomic complexes that emerge from the C + O cores of core-collapse supernovae. We utilize our chemical reaction network in which every atomic step of growth employs a quantum-mechanically guided reaction rate. This tool follows step-by-step the growth of linear carbon chain molecules from C atoms in the oxygen-rich C + O cores. We postulate that once linear chain molecules reach a sufficiently large size, they isomerize to ringed molecules, which serve as seeds for graphite grain growth. We demonstrate our technique for merging the molecular reaction network with a parallel program that can follow 1017 steps of C addition onto the rare seed species. Due to radioactivity within the C + O core, abundant ambient oxygen is unable to convert C to CO, except to a limited degree that actually facilitates carbon molecular ejecta. But oxygen severely minimizes the linear-carbon-chain abundances. Despite the tiny abundances of these linear-carbon-chain molecules, they can give rise to a small abundance of ringed-carbon molecules that serve as the nucleations on which graphite grain growth builds. We expand the C + O-core gas adiabatically from 6000 K for 109 s when reactions have essentially stopped. These adiabatic tracks emulate the actual expansions of the supernova cores. Using a standard model of 1056 atoms of C + O core ejecta having O/C = 3, we calculate standard ejection yields of graphite grains of all sizes produced, of the CO molecular abundance, of the abundances of linear-carbon molecules, and of Buckminsterfullerene. None of these except CO was expected from the C + O cores just a few years past.

  1. Entropy driven chain effects on ligation chemistry† †Electronic supplementary information (ESI) available: Synthetic details, applied MHKS parameters, SEC chromatograms of all samples, (HT) NMR data, experimental debonding values, SANS measurements, computational data (energy contributions and geometries in the form of Gaussian archive entries). See DOI: 10.1039/c4sc02908a Click here for additional data file.

    PubMed Central

    Pahnke, Kai; Brandt, Josef; Gryn'ova, Ganna; Lindner, Peter; Schweins, Ralf; Schmidt, Friedrich Georg

    2015-01-01

    We report the investigation of fundamental entropic chain effects that enable the tuning of modular ligation chemistry – for example dynamic Diels–Alder (DA) reactions in materials applications – not only classically via the chemistry of the applied reaction sites, but also via the physical and steric properties of the molecules that are being joined. Having a substantial impact on the reaction equilibrium of the reversible ligation chemistry, these effects are important when transferring reactions from small molecule studies to larger or other entropically very dissimilar systems. The effects on the DA equilibrium and thus the temperature dependent degree of debonding (%debond) of different cyclopentadienyl (di-)functional poly(meth-)acrylate backbones (poly(methyl methacrylate), poly(iso-butyl methacrylate), poly(tert-butyl methacrylate), poly(iso-butyl acrylate), poly(n-butyl acrylate), poly(tert-butyl acrylate), poly(methyl acrylate) and poly(isobornyl acrylate)), linked via a difunctional cyanodithioester (CDTE) were examined via high temperature (HT) NMR spectroscopy as well as temperature dependent (TD) SEC measurements. A significant impact of not only chain mass and length with a difference in the degree of debonding of up to 30% for different lengths of macromonomers of the same polymer type but – remarkably – as well the chain stiffness with a difference in bonding degrees of nearly 20% for isomeric poly(butyl acrylates) is found. The results were predicted, reproduced and interpreted via quantum chemical calculations, leading to a better understanding of the underlying entropic principles. PMID:29560194

  2. Interactions between Therapeutic Proteins and Acrylic Acid Leachable.

    PubMed

    Liu, Dengfeng; Nashed-Samuel, Yasser; Bondarenko, Pavel V; Brems, David N; Ren, Da

    2012-01-01

    Leachables are chemical compounds that migrate from manufacturing equipment, primary containers and closure systems, and packaging components into biopharmaceutical and pharmaceutical products. Acrylic acid (at concentration around 5 μg/mL) was detected as leachable in syringes from one of the potential vendors (X syringes). In order to evaluate the potential impact of acrylic acid on therapeutic proteins, an IgG 2 molecule was filled into a sterilized X syringe and then incubated at 45 °C for 45 days in a pH 5 acetate buffer. We discovered that acrylic acid can interact with proteins at three different sites: (1) the lysine side chain, (2) the N-terminus, and (3) the histidine side chain, by the Michael reaction. In this report, the direct interactions between acrylic acid leachable and a biopharmaceutical product were demonstrated and the reaction mechanism was proposed. Even thought a small amount (from 0.02% to 0.3%) of protein was found to be modified by acrylic acid, the modified protein can potentially be harmful due to the toxicity of acrylic acid. After being modified by acrylic acid, the properties of the therapeutic protein may change due to charge and hydrophobicity variations. Acrylic acid was detected to migrate from syringes (Vendor X) into a therapeutic protein solution (at a concentration around 5 μg/mL). In this study, we discovered that acrylic acid can modify proteins at three different sites: (1) the lysine side chain, 2) the N-terminus, and 3) the histidine side chain, by the Michael reaction. In this report, the direct interactions between acrylic acid leachable and a biopharmaceutical product were demonstrated and the reaction mechanism was proposed.

  3. Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

    PubMed

    Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

    2017-04-01

    There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

  4. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  5. Chemical stability of insulin. 4. Mechanisms and kinetics of chemical transformations in pharmaceutical formulation.

    PubMed

    Brange, J

    1992-01-01

    Insulin decomposes by a multitude of chemical reactions [1-3]. It deamidates at two different residues by entirely different mechanisms. In acid, deamidation at AsnA21 is intramolecularly catalyzed by the protonated C-terminal, whereas above pH 6 an intermediate imide formation at residue AsnB3 leads to isoAsp and Asp derivatives. The imide formation requires a large rotation around the alpha-carbon/peptide carbonyl carbon bond at B3, corresponding to a 10 A movement of the B-chain N-terminal. The main determinant for the rate of B3 deamidation, as well as for the ratio between the two products formed, is the local conformational structure, which is highly influenced by various excipients and the physical state of the insulin. An amazing thermolysin-like, autoproteolytic cleavage of the A-chain takes place in rhombohedral insulin crystals, mediated by a concerted catalytic action by several, inter-hexameric functional groups and Zn2+. Intermolecular, covalent cross-linking of insulin molecules occurs via several mechanisms. The most prominent type of mechanism is aminolysis by the N-terminals, leading to isopeptide linkages with the A-chain side-chain amides of residues GlnA15, AsnA18 and AsnA21. The same type of reaction also leads to covalent cross-linking of the N-terminal in protamine with insulin. Disulfide exchange reactions, initiated by lysis of the A7-B7 disulfide bridge, lead mainly to formation of covalent oligo- and polymers. Activation energy (Ea) for the neutral deamidation and the aminolysis reactions was found to be 80 and 119 KJ/mol, respectively.

  6. Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

    PubMed Central

    Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

    2014-01-01

    A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

  7. Regeneration of cello-oligomers via selective depolymerization of cellulose fibers derived from printed paper wastes.

    PubMed

    Voon, Lee Ken; Pang, Suh Cem; Chin, Suk Fun

    2016-05-20

    Cellulose extracted from printed paper wastes were selectively depolymerized under controlled conditions into cello-oligomers of controllable chain lengths via dissolution in an ionic liquid, 1-allyl-3-methylimidazolium chloride (AMIMCl), and in the presence of an acid catalyst, Amberlyst 15DRY. The depolymerization process was optimized against reaction temperature, concentration of acid catalyst, and reaction time. Despite rapid initial depolymerization process, the rate of cellulose depolymerization slowed down gradually upon prolonged reaction time, with 75.0 wt% yield of regenerated cello-oligomers (mean Viscosimetric Degree of Polymerization value of 81) obtained after 40 min. The depolymerization of cellulose fibers at 80 °C appeared to proceed via a second-order kinetic reaction with respect to the catalyst concentration of 0.23 mmol H3O(+). As such, the cellulose depolymerization process could afford some degree of control on the degree of polymerization or chain lengths of cello-oligomers formed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Efficient Homodifunctional Bimolecular Ring-Closure Method for Cyclic Polymers by Combining RAFT and Self-Accelerating Click Reaction.

    PubMed

    Qu, Lin; Sun, Peng; Wu, Ying; Zhang, Ke; Liu, Zhengping

    2017-08-01

    An efficient metal-free homodifunctional bimolecular ring-closure method is developed for the formation of cyclic polymers by combining reversible addition-fragmentation chain transfer (RAFT) polymerization and self-accelerating click reaction. In this approach, α,ω-homodifunctional linear polymers with azide terminals are prepared by RAFT polymerization and postmodification of polymer chain end groups. By virtue of sym-dibenzo-1,5-cyclooctadiene-3,7-diyne (DBA) as small linkers, well-defined cyclic polymers are then prepared using the self-accelerating double strain-promoted azide-alkyne click (DSPAAC) reaction to ring-close the azide end-functionalized homodifunctional linear polymer precursors. Due to the self-accelerating property of DSPAAC ring-closing reaction, this novel method eliminates the requirement of equimolar amounts of telechelic polymers and small linkers in traditional bimolecular ring-closure methods. It facilitates this method to efficiently and conveniently produce varied pure cyclic polymers by employing an excess molar amount of DBA small linkers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Toluene nitration in irradiated nitric acid and nitrite solutions

    NASA Astrophysics Data System (ADS)

    Elias, Gracy; Mincher, Bruce J.; Mezyk, Stephen P.; Muller, Jim; Martin, Leigh R.

    2011-04-01

    The kinetics, mechanisms, and stable products produced for the nitration of aryl alkyl mild ortho-para director toluene in irradiated nitric acid and neutral nitrite solutions were investigated using γ and pulse radiolysis. Electron pulse radiolysis was used to determine the bimolecular rate constants for the reaction of toluene with different transient species produced by irradiation. HPLC with UV detection, GC-MS and LC-MS, were used to assess the stable reaction products. Free-radical based nitration reaction products were found in irradiated acidic and neutral media. In 6.0 M HNO3, ring substitution, side chain substitution, and oxidation, produced different nitrated toluene products. For ring substitution, nitrogen oxide radicals were added mainly to cyclohexadienyl radicals, whereas for side chain substitution, these radicals were added to the carbon-centered benzyl radical produced by H-atom abstraction. In neutral nitrite solutions, radiolytically-induced ring nitration products approached a statistically random distribution, suggesting a direct free-radical reaction involving addition of the rad NO2 radical.

  10. Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

    NASA Astrophysics Data System (ADS)

    Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

    2016-03-01

    Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the `reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed `reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams.

  11. Effects of macromolecular crowding on biochemical reaction equilibria: a molecular thermodynamic perspective.

    PubMed

    Hu, Zhongqiao; Jiang, Jianwen; Rajagopalan, Raj

    2007-09-01

    A molecular thermodynamic model is developed to investigate the effects of macromolecular crowding on biochemical reactions. Three types of reactions, representing protein folding/conformational isomerization, coagulation/coalescence, and polymerization/association, are considered. The reactants, products, and crowders are modeled as coarse-grained spherical particles or as polymer chains, interacting through hard-sphere interactions with or without nonbonded square-well interactions, and the effects of crowder size and chain length as well as product size are examined. The results predicted by this model are consistent with experimentally observed crowding effects based on preferential binding or preferential exclusion of the crowders. Although simple hard-core excluded-volume arguments do in general predict the qualitative aspects of the crowding effects, the results show that other intermolecular interactions can substantially alter the extent of enhancement or reduction of the equilibrium and can even change the direction of the shift. An advantage of the approach presented here is that competing reactions can be incorporated within the model.

  12. DNA ELECTROPHORESIS AT SURFACES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in themore » different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.« less

  13. Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

    PubMed

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

    2015-08-25

    Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Oxidative transformation of tunichromes - Model studies with 1,2-dehydro-N-acetyldopamine and N-acetylcysteine.

    PubMed

    Kuang, Qun F; Abebe, Adal; Evans, Jason; Sugumaran, Manickam

    2017-08-01

    Tunichromes are 1,2-dehydrodopa containing bioactive peptidyl derivatives found in blood cells of several tunicates. They have been implicated in metal sequestering, tunic formation, wound healing and defense reaction. Earlier studies conducted on these compounds indicate their extreme liability, high reactivity and easy oxidative polymerization. Their reactions are also complicated by the presence of multiple dehydrodopyl units. Since they have been invoked in crosslinking and covalent binding, to understand the reactivities of these novel compounds, we have taken a simple model compound that possess the tunichrome reactive group viz., 1,2-dehydro-N-acetyldopamine (Dehydro NADA) and examined its reaction with N-acetylcysteine in presence of oxygen under both enzymatic and nonenzymatic conditions. Ultraviolet and visible spectral studies of reaction mixtures containing dehydro NADA and N-acetylcysteine in different molar ratios indicated the production of side chain and ring adducts of N-acetylcysteine to dehydro NADA. Liquid chromatography and mass spectral studies supported this contention and confirmed the production of several different products. Mass spectral analysis of these products show the potentials of dehydro NADA to form side chain adducts that can lead to polymeric products. This is the first report demonstrating the ability of dehydro dopyl units to form adducts and crosslinks with amino acid side chains. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Inquiry-based experiments for large-scale introduction to PCR and restriction enzyme digests.

    PubMed

    Johanson, Kelly E; Watt, Terry J

    2015-01-01

    Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are designed for introductory laboratory courses and combine both techniques. In both approaches, students must determine the identity of an unknown DNA sequence, either a gene sequence or a primer sequence, based on a combination of PCR product size and restriction digest pattern. The experimental design is flexible, and can be adapted based on available instructor preparation time and resources, and both approaches can accommodate large numbers of students. We implemented these experiments in our courses with a combined total of 584 students and have an 85% success rate. Overall, students demonstrated an increase in their understanding of the experimental topics, ability to interpret the resulting data, and proficiency in general laboratory skills. © 2015 The International Union of Biochemistry and Molecular Biology.

  16. Mass Chain Evaluation for A=95

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Basu, S.K.; Sonzogni, A.; Basu, Swapan Kr.

    2011-08-01

    A full evaluation of the mass chain A = 95 has been done in the ENSDF format taking into account all the available data until June 2009. Excited states populated by in-beam nuclear reactions and by radioactive decay have been considered. The 'evp' editor, developed at the NNDC, has been used for the evaluation. This mass chain was last evaluated in 1993. Many new and improved data were reported since then. A total of 13 nuclei have been evaluated.

  17. E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue.

    PubMed

    Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

    Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.

  18. E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue

    PubMed Central

    Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

    2016-01-01

    Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation. PMID:27685940

  19. Improved properties of recycled polypropylene by introducing the long chain branched structure through reactive extrusion.

    PubMed

    Li, Yingchun; Jia, Shuai; Du, Shuanli; Wang, Yafei; Lv, Lida; Zhang, Jianbin

    2018-06-01

    An approach originated from preparing long chain branched polypropylene (PP) was applied to modify the properties of recycled PP that involved reactive extrusion to introduce a branched chain structure onto recycled PP under the assistance of chemical reaction between maleic anhydride (MAH) monomer and glycidyl methacrylate (GMA) grafts. The results from Fourier transformed infrared spectroscopy (FTIR) indicated the reaction took place during melt mixing, and the intensity of ester increased with increasing amount of MAH. Several rheological plots including complex viscosity, storage modulus, loss modulus, loss tangent and Cole-Cole plot were used to investigate the rheological properties of recycled PP and modified PP with MAH, which indicated an additional longer relaxation time that was not shown in recycled PP. The effects of branched structure on melting and crystallization behaviors were also investigated, demonstrating the branched chains acted as nucleating agent. Moreover, the branched structure of modified samples gave rise to enhance mechanical properties, especially, the higher impact strength compared with recycled PP. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. DL-ADR: a novel deep learning model for classifying genomic variants into adverse drug reactions.

    PubMed

    Liang, Zhaohui; Huang, Jimmy Xiangji; Zeng, Xing; Zhang, Gang

    2016-08-10

    Genomic variations are associated with the metabolism and the occurrence of adverse reactions of many therapeutic agents. The polymorphisms on over 2000 locations of cytochrome P450 enzymes (CYP) due to many factors such as ethnicity, mutations, and inheritance attribute to the diversity of response and side effects of various drugs. The associations of the single nucleotide polymorphisms (SNPs), the internal pharmacokinetic patterns and the vulnerability of specific adverse reactions become one of the research interests of pharmacogenomics. The conventional genomewide association studies (GWAS) mainly focuses on the relation of single or multiple SNPs to a specific risk factors which are a one-to-many relation. However, there are no robust methods to establish a many-to-many network which can combine the direct and indirect associations between multiple SNPs and a serial of events (e.g. adverse reactions, metabolic patterns, prognostic factors etc.). In this paper, we present a novel deep learning model based on generative stochastic networks and hidden Markov chain to classify the observed samples with SNPs on five loci of two genes (CYP2D6 and CYP1A2) respectively to the vulnerable population of 14 types of adverse reactions. A supervised deep learning model is proposed in this study. The revised generative stochastic networks (GSN) model with transited by the hidden Markov chain is used. The data of the training set are collected from clinical observation. The training set is composed of 83 observations of blood samples with the genotypes respectively on CYP2D6*2, *10, *14 and CYP1A2*1C, *1 F. The samples are genotyped by the polymerase chain reaction (PCR) method. A hidden Markov chain is used as the transition operator to simulate the probabilistic distribution. The model can perform learning at lower cost compared to the conventional maximal likelihood method because the transition distribution is conditional on the previous state of the hidden Markov chain. A least square loss (LASSO) algorithm and a k-Nearest Neighbors (kNN) algorithm are used as the baselines for comparison and to evaluate the performance of our proposed deep learning model. There are 53 adverse reactions reported during the observation. They are assigned to 14 categories. In the comparison of classification accuracy, the deep learning model shows superiority over the LASSO and kNN model with a rate over 80 %. In the comparison of reliability, the deep learning model shows the best stability among the three models. Machine learning provides a new method to explore the complex associations among genomic variations and multiple events in pharmacogenomics studies. The new deep learning algorithm is capable of classifying various SNPs to the corresponding adverse reactions. We expect that as more genomic variations are added as features and more observations are made, the deep learning model can improve its performance and can act as a black-box but reliable verifier for other GWAS studies.

  1. Water-soluble cavitands promote hydrolyses of long-chain diesters

    PubMed Central

    Shi, Qixun; Mower, Matthew P.; Blackmond, Donna G.; Rebek, Julius

    2016-01-01

    Water-soluble, deep cavitands serve as chaperones of long-chain diesters for their selective hydrolysis in aqueous solution. The cavitands bind the diesters in rapidly exchanging, folded J-shape conformations that bury the hydrocarbon chain and expose each ester group in turn to the aqueous medium. The acid hydrolyses in the presence of the cavitand result in enhanced yields of monoacid monoester products. Product distributions indicate a two- to fourfold relative decrease in the hydrolysis rate constant of the second ester caused by the confined space in the cavitand. The rate constant for the first acid hydrolysis step is enhanced approximately 10-fold in the presence of the cavitand, compared with control reactions of the molecules in bulk solution. Hydrolysis under basic conditions (saponification) with the cavitand gave >90% yields of the corresponding monoesters. Under basic conditions the cavitand complex of the monoanion precipitates from solution and prevents further reaction. PMID:27482089

  2. Phenylpropanoid 2,3-dioxygenase involved in the cleavage of the ferulic acid side chain to form vanillin and glyoxylic acid in Vanilla planifolia.

    PubMed

    Negishi, Osamu; Negishi, Yukiko

    2017-09-01

    Enzyme catalyzing the cleavage of the phenylpropanoid side chain was partially purified by ion exchange and gel filtration column chromatography after (NH 4 ) 2 SO 4 precipitation. Enzyme activities were dependent on the concentration of dithiothreitol (DTT) or glutathione (GSH) and activated by addition of 0.5 mM Fe 2+ . Enzyme activity for ferulic acid was as high as for 4-coumaric acid in the presence of GSH, suggesting that GSH acts as an endogenous reductant in vanillin biosynthesis. Analyses of the enzymatic reaction products with quantitative NMR (qNMR) indicated that an amount of glyoxylic acid (GA) proportional to vanillin was released from ferulic acid by the enzymatic reaction. These results suggest that phenylpropanoid 2,3-dioxygenase is involved in the cleavage of the ferulic acid side chain to form vanillin and GA in Vanilla planifolia.

  3. Preparation of core-shell molecularly imprinted polymer via the combination of reversible addition-fragmentation chain transfer polymerization and click reaction.

    PubMed

    Chang, Limin; Li, Ying; Chu, Jia; Qi, Jingyao; Li, Xin

    2010-11-08

    In this paper, we demonstrated an efficient and robust route to the preparation of well-defined molecularly imprinted polymer based on reversible addition-fragmentation chain transfer (RAFT) polymerization and click chemistry. The alkyne terminated RAFT chain transfer agent was first synthesized, and then click reaction was used to graft RAFT agent onto the surface of silica particles which was modified by azide. Finally, imprinted thin film was prepared in the presence of 2,4-dichlorophenol as the template. The imprinted beads were demonstrated with a homogeneous polymer films (thickness of about 2.27 nm), and exhibited thermal stability under 255°C. The as-synthesized product showed obvious molecular imprinting effects towards the template, fast template rebinding kinetics and an appreciable selectivity over structurally related compounds. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Controlled Ring-Opening Metathesis Polymerization by Molybdenum and Tungsten Alkylidene Complexes

    DTIC Science & Technology

    1988-07-29

    weights and low polydispersities (as low as 1.03) consistent with a living catalyst system employing 50, 100, 200, and 400 eq of monomer. The reactions are...secondary metathesis of polymer chains Bulky alkoxide ligands Wittig-like reaction Ring-opening metathesis polymerization (ROMP) Feast monomer Cyclic...olefins Retro Diels-Alder reaction Norbornene (NBE) Low temperature column chromatography Endo-,endo-5,6-dicarbomethoxynorbornene Discrete, soluble

  5. Cross-reactions of lipopolysaccharides of Pseudomonas aeruginosa in antipneumococcal and other antisera.

    PubMed Central

    Heidelberger, M; Horton, D; Haskell, T H

    1986-01-01

    Lipopolysaccharides of the seven Fisher immunotypes of Pseudomonas aeruginosa gave cross-precipitation in many antipneumococcal sera. The reaction of Pseudomonas type IV in type 25 antipneumococcal serum was immediate and heavy: 93 micrograms of antibody nitrogen per ml. Correlations are described, mainly between the structures of the O-chains of the immunotypes and their specificities as shown by the cross-reactions. PMID:3096896

  6. Accelerating research into bio-based FDCA-polyesters by using small scale parallel film reactors.

    PubMed

    Gruter, Gert-Jan M; Sipos, Laszlo; Adrianus Dam, Matheus

    2012-02-01

    High Throughput experimentation has been well established as a tool in early stage catalyst development and catalyst and process scale-up today. One of the more challenging areas of catalytic research is polymer catalysis. The main difference with most non-polymer catalytic conversions is the fact that the product is not a well defined molecule and the catalytic performance cannot be easily expressed only in terms of catalyst activity and selectivity. In polymerization reactions, polymer chains are formed that can have various lengths (resulting in a molecular weight distribution rather than a defined molecular weight), that can have different compositions (when random or block co-polymers are produced), that can have cross-linking (often significantly affecting physical properties), that can have different endgroups (often affecting subsequent processing steps) and several other variations. In addition, for polyolefins, mass and heat transfer, oxygen and moisture sensitivity, stereoregularity and many other intrinsic features make relevant high throughput screening in this field an incredible challenge. For polycondensation reactions performed in the melt often the viscosity becomes already high at modest molecular weights, which greatly influences mass transfer of the condensation product (often water or methanol). When reactions become mass transfer limited, catalyst performance comparison is often no longer relevant. This however does not mean that relevant experiments for these application areas cannot be performed on small scale. Relevant catalyst screening experiments for polycondensation reactions can be performed in very efficient small scale parallel equipment. Both transesterification and polycondensation as well as post condensation through solid-stating in parallel equipment have been developed. Next to polymer synthesis, polymer characterization also needs to be accelerated without making concessions to quality in order to draw relevant conclusions.

  7. Degradation of cellulose at the wet-dry interface. II. Study of oxidation reactions and effect of antioxidants.

    PubMed

    Jeong, Myung-Joon; Dupont, Anne-Laurence; de la Rie, E René

    2014-01-30

    To better understand the degradation of cellulose upon the formation of a tideline at the wet-dry interface when paper is suspended in water, the production of chemical species involved in oxidation reactions was studied. The quantitation of hydroperoxides and hydroxyl radicals was carried out in reverse phase chromatography using triphenylphosphine and terephthalic acid, respectively, as chemical probes. Both reactive oxygen species were found in the tideline immediately after its formation, in the range of micromoles and nanomoles per gram of paper, respectively. The results indicate that hydroxyl radicals form for the most part in paper before the tideline experiment, whereas hydroperoxides appear to be produced primarily during tideline formation. Iron sulfate impregnation of the paper raised the production of hydroperoxides. After hygrothermal aging in sealed vials the hydroxyl radical content in paper increased significantly. When aged together in the same vial, tideline samples strongly influenced the degradation of samples from other areas of the paper (multi-sample aging). Different types of antioxidants were added to the paper before the tideline experiment to investigate their effect on the oxidation reactions taking place. In samples treated with iron sulfate or artificially aged, the addition of Irgafos 168 (tris(2,4-ditert-butylphenyl) phosphate) and Tinuvin 292 (bis(1,2,2,6,6-pentamethyl-4-piperidyl) sebacate and methyl 1,2,2,6,6-pentamethyl-4-piperidyl sebacate) reduced the concentration of hydroperoxides and hydroxyl radicals, respectively. Tinuvin 292 was also found to considerably lower the rate of cellulose chain scission reactions during hygrothermal aging of the paper. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification

    PubMed Central

    Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.

    2016-01-01

    Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522

  9. Extinction of Chained Instrumental Behaviors: Effects of Procurement Extinction on Consumption Responding

    PubMed Central

    Thrailkill, Eric A.; Bouton, Mark E.

    2015-01-01

    Instrumental behavior often consists of sequences or chains of responses that minimally include procurement behaviors that enable subsequent consumption behaviors. In such chains, behavioral units are linked by access to one another and eventually to a primary reinforcer, such as food or a drug. The present experiments examined the effects of extinguishing procurement responding on consumption responding after training of a discriminated heterogeneous instrumental chain. Rats learned to make a procurement response (e.g., pressing a lever) in the presence of a distinctive discriminative stimulus; making that response led to the presentation of a second discriminative stimulus that set the occasion for a consumption response (e.g., pulling a chain), which then produced a food-pellet reinforcer. Experiment 1 showed that extinction of either the full procurement-consumption chain or procurement alone weakened the consumption response tested in isolation. Experiment 2 replicated the procurement extinction effect and further demonstrated that the opportunity to make the procurement response, as opposed to simple exposure to the procurement stimulus alone, was required. In Experiment 3, rats learned 2 distinct discriminated heterogeneous chains; extinction of 1 procurement response specifically weakened the consumption response that had been associated with it. The results suggest that learning to inhibit the procurement response may produce extinction of consumption responding through mediated extinction. The experiments suggest the importance of an associative analysis of instrumental behavior chains. PMID:25915751

  10. The Synergize effect of Chain extender to Phosporic acid catalyst to the ultimate property of Soy-Polyurethane

    NASA Astrophysics Data System (ADS)

    Elvistia Firdaus, Flora

    2016-04-01

    The polyurethanes (PUs) foam were made from vegetable oil; a soybean based polyol. The foams were categorized into flexible and semi rigid. This research is manufacturally designed polyurethane foams by a process requiring the reaction of mixture of 2, 4- and 2, 6-Toluene di Isocyanate isomers, soy polyol in the presence of other ingredients. The objective of this work was to functionalized soy-polyol using phosporic acid catalyst and chain extender, study their collaborative reaction in producing ultimate property of PU foam. Correlates the foam morphology images in accordance to mechanical properties of foams.

  11. A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

    PubMed

    Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

    2013-05-01

    A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

  12. Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

    PubMed

    Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

    2007-03-01

    A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

  13. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  14. Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

    PubMed

    Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

    2018-04-01

    Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

  15. Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

    PubMed Central

    Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

    2010-01-01

    Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

  16. Illegitimate transcription: transcription of any gene in any cell type.

    PubMed Central

    Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

    1989-01-01

    Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

  17. Transformational leadership: a cascading chain reaction.

    PubMed

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

  18. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    PubMed

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  19. Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

    PubMed

    Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

    2018-06-01

    Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

  20. Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

    PubMed

    Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

    2018-05-25

    The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. [Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

    PubMed

    Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

    2010-06-01

    To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

  2. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  3. Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

    PubMed Central

    Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

    2014-01-01

    Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

  4. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  5. Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

    PubMed

    Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

    2015-02-01

    The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  6. Dynamics Sampling in Transition Pathway Space.

    PubMed

    Zhou, Hongyu; Tao, Peng

    2018-01-09

    The minimum energy pathway contains important information describing the transition between two states on a potential energy surface (PES). Chain-of-states methods were developed to efficiently calculate minimum energy pathways connecting two stable states. In the chain-of-states framework, a series of structures are generated and optimized to represent the minimum energy pathway connecting two states. However, multiple pathways may exist connecting two existing states and should be identified to obtain a full view of the transitions. Therefore, we developed an enhanced sampling method, named as the direct pathway dynamics sampling (DPDS) method, to facilitate exploration of a PES for multiple pathways connecting two stable states as well as addition minima and their associated transition pathways. In the DPDS method, molecular dynamics simulations are carried out on the targeting PES within a chain-of-states framework to directly sample the transition pathway space. The simulations of DPDS could be regulated by two parameters controlling distance among states along the pathway and smoothness of the pathway. One advantage of the chain-of-states framework is that no specific reaction coordinates are necessary to generate the reaction pathway, because such information is implicitly represented by the structures along the pathway. The chain-of-states setup in a DPDS method greatly enhances the sufficient sampling in high-energy space between two end states, such as transition states. By removing the constraint on the end states of the pathway, DPDS will also sample pathways connecting minima on a PES in addition to the end points of the starting pathway. This feature makes DPDS an ideal method to directly explore transition pathway space. Three examples demonstrate the efficiency of DPDS methods in sampling the high-energy area important for reactions on the PES.

  7. Histochemical Demonstration of Protein-Bound Alpha-Acylamido Carboxyl Groups

    PubMed Central

    Barrnett, Russell J.; Seligman, Arnold M.

    1958-01-01

    A method has been developed to demonstrate the alpha-acylamido carboxyl groups of protein, taking advantage of the fact that acylamido carboxyl groups are converted to ketonic carbonyls by the action of acetic anhydride and absolute pyridine. The method utilizes deparaffinized sections of tissues fixed in a variety of fixatives. Following the conversion of carboxyls to the methyl ketones, the latter are stained with 2-hydroxy-3-naphthoic acid hydrazide. Control experiments have indicated that methylation of carboxyls prevented staining, as did carbonyl reagents after the carboxyls were transformed to methyl ketones. Leucofuchsin did not stain the ketonic carbonyls, and only elastic tissue stained with 2-hydroxy-3-naphthoic acid hydrazide without the previous use of the catalyzed reaction with anhydride. A brief survey of the reaction on various tissues of the albino rat was made, and the effects of various fixatives were assayed. Of particular interest were certain sites, such as acidophiles of the anterior pituitary gland, where an intense reaction occurred. The possibility exists that certain specific proteins rich in terminal acylamido carboxyl groups, by virtue of their protein side chains or low molecular weight, may be demonstrated by this method. PMID:13525430

  8. Photothermal monitoring of interaction of carcinoma cells with cytostatic drugs in vitro

    NASA Astrophysics Data System (ADS)

    Lapotko, Dmitri; Hanna, Ehab; Cannon, Martin

    2003-06-01

    Background/problem. Monitoring of tumor response to cancer chemotherapy and dose optimization for specific patients are the key factors for successful application of anti-tumor drugs. Using patient's tumor cells for preliminary in vitro drug screening may allow optimal selection of drug type and dose. Method. Single cell state was studied with photothermal microscope. Carcinoma cells were irradiated at 427 nm with 8 ns laser pulse with energy 30 - 40 μJ. Cell photothermal (PT) response amplitude and shape from each cell were analyzed and amount of cells that produced specific PT response was used as PT parameter. Parallel experiment included cell viability control. Results were obtained for two cytotoxic chemotherapy agents -- Platinol-aq and Adrucil. Incubation of cell suspensions for 90 min at 20 and 37°C caused changes in cell PT parameters. Reaction of carcinoma cells to the drug was very similar to reaction of hepatocytes to respiratory chain inhibition and reaction of RBC to osmotic pressure decrease. PT effect was found to be dose-dependent. PT method allows detecting drug-induced changes before cell death or morphological changes and therefore can be fast and sensitive modality for control of chemotherapy.

  9. Probing the reactivity of nucleophile residues in human 2,3-diphosphoglycerate/deoxy-hemoglobin complex by aspecific chemical modifications.

    PubMed

    Scaloni, A; Ferranti, P; De Simone, G; Mamone, G; Sannolo, N; Malorni, A

    1999-06-11

    The use of aspecific methylation reaction in combination with MS procedures has been employed for the characterization of the nucleophilic residues present on the molecular surface of the human 2,3-diphosphoglycerate/deoxy-hemoglobin complex. In particular, direct molecular weight determinations by ESMS allowed to control the reaction conditions, limiting the number of methyl groups introduced in the modified globin chains. A combined LCESMS-Edman degradation approach for the analysis of the tryptic peptide mixtures yielded to the exact identification of methylation sites together with the quantitative estimation of their degree of modification. The reactivities observed were directly correlated with the pKa and the relative surface accessibility of the nucleophilic residues, calculated from the X-ray crystallographic structure of the protein. The results here described indicate that this methodology can be efficiently used in aspecific modification experiments directed to the molecular characterization of the surface topology in proteins and protein complexes.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Antonov, Ivan O.; Zador, Judit; Rotavera, Brandon

    Here, we report a combined experimental and quantum chemistry study of the initial reactions in low-temperature oxidation of tetrahydrofuran (THF). Using synchrotron-based time-resolved VUV photoionization mass spectrometry, we probe numerous transient intermediates and products at P = 10–2000 Torr and T = 400–700 K. A key reaction sequence, revealed by our experiments, is the conversion of THF-yl peroxy to hydroperoxy-THF-yl radicals (QOOH), followed by a second O 2 addition and subsequent decomposition to dihydrofuranyl hydroperoxide + HO 2 or to γ-butyrolactone hydroperoxide + OH. The competition between these two pathways affects the degree of radical chain-branching and is likely ofmore » central importance in modeling the autoignition of THF. We interpret our data with the aid of quantum chemical calculations of the THF-yl + O 2 and QOOH + O 2 potential energy surfaces. On the basis of our results, we propose a simplified THF oxidation mechanism below 700 K, which involves the competition among unimolecular decomposition and oxidation pathways of QOOH.« less

  11. Ozone treatment of polysaccharides from Arthrocnemum indicum: Physico-chemical characterization and antiproliferative activity.

    PubMed

    Mzoughi, Zeineb; Chakroun, Ibtissem; Hamida, Sarra Ben; Rihouey, Christophe; Mansour, Hedi Ben; Le Cerf, Didier; Majdoub, Hatem

    2017-12-01

    The isolation, purification and ozone depolymerization of polysaccharides from Arthrocnemum indicum as well as the evaluation of their antiproliferative capacities were investigated. The ozone treatment for various reaction times (0, 15, 30, 45 and 60min) was employed as degradation method in order to attain lower molecular weight product with stronger antiproliferative property. According to FTIR, 1 H NMR and UV-vis analysis, the main chain of ozonolytic degraded polysaccharides could be preserved. The monosaccharide composition, which was determined via GC/MS analysis, showed that extracted polysaccharides were of type of arabinan-rich pectic polysaccharides. Macromolecular characteristics as well as intrinsic viscosity of the degraded polysaccharides were performed by size exclusion chromatography before and after ozone treatment. These experiments showed that intrinsic viscosity and molecular weight (Mn and Mw) of degraded samples decreased with increase in reaction time. Furthermore, preliminary antiproliferative tests indicated that degraded polysaccharide for 1h showed even better antiproliferative capacity. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Oxidative decomposition of aromatic hydrocarbons by electron beam irradiation

    NASA Astrophysics Data System (ADS)

    Han, Do-Hung; Stuchinskaya, Tatiana; Won, Yang-Soo; Park, Wan-Sik; Lim, Jae-Kyong

    2003-05-01

    Decomposition of aromatic volatile organic compounds (VOCs) under electron beam irradiation was studied in order to examine the kinetics of the process, to characterize the reaction product distribution and to develop a process of waste gas control technology. Toluene, ethylbenzene, o-, m-, p-xylenes and chlorobenzene were used as target materials. The experiments were carried out at doses ranging from 0.5 to 10 kGy, using a flow reactor utilized under electron beam irradiation. Maximum degrees of decomposition carried out at 10 kGy in air environment were 55-65% for “non-chlorinated” aromatic VOC and 85% for chlorobenzene. It was found that a combination of aromatic pollutants with chlorobenzene would considerably increase the degradation value up to nearly 50% compared to the same compounds in the absence of chlorine groups. Based on our experimental observation, the degradation mechanism of the aromatic compounds combined with chloro-compound suggests that a chlorine radical, formed from EB irradiation, induces a chain reaction, resulting in an accelerating oxidative destruction of aromatic VOCs.

  13. Rapeseed Oil as Renewable Resource for Polyol Synthesis

    NASA Astrophysics Data System (ADS)

    Stirna, Uldis; Fridrihsone, Anda; Misane, Marija; Vilsone, Dzintra

    2011-01-01

    Vegetable oils are one of the most important platform chemicals due to their accessibility, specific structure of oils and low price. Rapeseed oil (RO) polyols were prepared by amidization of RO with diethanolamine (DEA). To determine the kinetics of amidization reaction, experiments were carried out. Fourier transform infrared spectroscopy (FTIR), differential scanning calorimetry (DSC), amine (NH) value was determined. Group contribution method by Fedor‵s was used to calculate solubility parameters, van der Waals volume was calculated by Askadskii. Obtained polyol‵s OH and NH value are from 304 up to 415 mg KOH/g. RO polyols synthesis meets the criteria of "green chemistry". In the present study, reaction of RO amidization with DEA was investigated, as well as optimum conditions for polyol synthesis was established to obtain polyols for polyurethane production. Calculations of solubility parameter and cohesion energy density were calculated, as RO polyols will be used as side chains in polymers, and solubility parameter will be used to explain properties of polymers.

  14. Kinetics and mechanism of electron transfer reaction of single and double chain surfactant cobalt(III) complex by Fe2+ ions in liposome (dipalmitoylphosphotidylcholine) vesicles: effects of phase transition

    NASA Astrophysics Data System (ADS)

    Nagaraj, Karuppiah; Senthil Murugan, Krishnan; Thangamuniyandi, Pilavadi

    2015-05-01

    In this study, we report the kinetics of reduction reactions of single and double chain surfactant cobalt(III) complexes of octahedral geometry, cis-[Co(en)2(4AMP)(DA)](ClO4)3 and cis-[Co(dmp)2(C12H25NH2)2](ClO4)3 (en = ethylenediamine, dmp = 1,3-diaminopropane, 4AMP = 4-aminopropane, C12H25NH2 = dodecylamine) by Fe2+ ion in dipalmitoylphosphotidylcholine (DPPC) vesicles at different temperatures under pseudo first-order conditions. The kinetics of these reactions is followed by spectrophotometry method. The reactions are found to be second order and the electron transfer is postulated as outer sphere. The remarkable findings in the present investigation are that, below the phase transition temperature of DPPC, the rate decreases with an increase in the concentration of DPPC, while above the phase transition temperature the rate increases with an increase in the concentration of DPPC. The main driving force for this phenomenon is considered to be the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes. Besides, comparing the values of rate constants of these outer-sphere electron transfer reactions in the absence and in the presence of DPPC, the rate constant values in the presence of DPPC are always found to be greater than in the absence of DPPC. This is ascribed to the double hydrophobic fatty acid chain in the DPPC that gives the molecule an overall tubular shape due to the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes more suitable for vesicle aggregation which facilitates lower activation energy, and consequently higher rate is observed in the presence of DPPC. The activation parameters (ΔS# and ΔH#) of the reactions at different temperatures have been calculated which corroborate the kinetics of the reaction.

  15. Service workers' chain reactions to daily customer mistreatment: Behavioral linkages, mechanisms, and boundary conditions.

    PubMed

    Chi, Nai-Wen; Yang, Jixia; Lin, Chia-Ying

    2018-01-01

    Drawing on the stressor-emotion model, we examine how customer mistreatment can evoke service workers' passive forms of deviant behaviors (i.e., work withdrawal behavior [WWB]) and negative impacts on their home life (i.e., work-family conflict [WFC]), and whether individuals' core self-evaluations and customer service training can buffer the negative effects of customer mistreatment. Using the experience sampling method, we collect daily data from 77 customer service employees for 10 consecutive working days, yielding 546 valid daily responses. The results show that daily customer mistreatment increases service workers' daily WWB and WFC through negative emotions. Furthermore, employees with high core self-evaluations and employees who received customer service training are less likely to experience negative emotions when faced with customer mistreatment, and thus are less likely to engage in WWB or provoke WFC. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  16. Biocompatibility of PCL/PLGA-BCP porous scaffold for bone tissue engineering applications.

    PubMed

    Thi Hiep, Nguyen; Chan Khon, Huynh; Dai Hai, Nguyen; Byong-Taek, Lee; Van Toi, Vo; Thanh Hung, Le

    2017-06-01

    In this study, biomimic porous polycaprolactone/poly (lactide-co-glycolide) loading biphasic tricalcium phosphate (PCL/PLGA-BCP) scaffolds were fabricated successfully by solvent evaporation method. The distribution of biphasic tricalcium phosphate (BCP) in polycaprolactone/poly (lactide-co-glycolide) (PCL/PLGA) scaffold was confirmed by micro-computed tomography (micro-CT) scanning, scanning electron microscope (SEM) observation and Energy-dispersive X-ray Spectroscopy (EDS) analysis. The hydrophilicity of the scaffolds was confirmed by contact angle measurement. In in vitro experiments, proliferation of human bone marrow mesenchymal stem cell (hBMSCs) and its osteoblastic differentiation on scaffold were assessed for 1, 2 and 3 weeks using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, fluorescence observation, hematoxylin & eosin (H&E) staining and real-time polymerase chain reaction (RT-PCR). In in vivo experiments, ossification was observed using micro-CT analysis and histological staining.

  17. Logistics and quality control for DNA sampling in large multicenter studies.

    PubMed

    Nederhand, R J; Droog, S; Kluft, C; Simoons, M L; de Maat, M P M

    2003-05-01

    To study associations between genetic variation and disease, large bio-banks need to be created in multicenter studies. Therefore, we studied the effects of storage time and temperature on DNA quality and quantity in a simulation experiment with storage up to 28 days frozen, at 4 degrees C and at room temperature. In the simulation experiment, the conditions did not influence the amount or quality of DNA to an unsatisfactory level. However, the amount of extracted DNA was decreased in frozen samples and in samples that were stored for > 7 days at room temperature. In a sample of patients from 24 countries of the EUROPA trial obtained by mail with transport times up to 1 month DNA yield and quality were adequate. From these results we conclude that transport of non-frozen blood by ordinary mail is usable and practical for DNA isolation for polymerase chain reaction in clinical and epidemiological studies.

  18. Heavy ion induced mutations in mammalian cells: Cross sections and molecular analysis

    NASA Technical Reports Server (NTRS)

    Stoll, U.; Schmidt, P.; Schneider, E.; Kiefer, J.

    1994-01-01

    Our investigations of heavy ion-induced mutations in mammalian cells, which had been begun a few years ago, were systematically continued. For the first time, it was possible to cover a large LET range with a few kinds of ions. To do this, both UNILAC and SIS were used to yield comparable data for a large energy range. This is a necessary condition for a comprehensive description of the influence of such ion parameters as energy and LET. In these experiments, the induced resistance against the poison 6-thioguanin (6-TG), which is linked to the HPRT locus on the genome, is being used as mutation system. In addition to the mutation-induction cross-section measurements, the molecular changes of the DNA are being investigated by means of Multiplex PCR ('Polymerase Chain Reaction') gene amplification. From these experiments we expect further elucidation of the mutation-inducing mechanisms composing the biological action of heavy-ion radiation.

  19. Enrico Fermi - And the Revolutions of Modern Physics

    NASA Astrophysics Data System (ADS)

    Cooper, Dan

    1999-02-01

    In 1938, at the age of 37, Enrico Fermi was awarded the Nobel Prize in Physics. That same year he emigrated from Italy to the United States and, in the course of his experiments, discovered nuclear fission--a process which forms the basis of nuclear power and atomic bombs. Soon the brilliant physicist was involved in the top secret race to produce the deadliest weapon on Earth. He created the first self-sustaining chain reaction, devised new methods for purifying plutonium, and eventually participated in the first atomic test. This compelling biography traces Fermis education in Italy, his meteoric career in the scientific world, his escape from fascism to America, and the ingenious experiments he devised and conducted at the University of Rome, Columbia University, and the Los Alamos laboratory. The book also presents a mini-course in quantum and nuclear physics in an accessible, fast-paced narrative that invokes all the dizzying passion of Fermis brilliant discoveries.

  20. Fold or hold: experimental evolution in vitro

    PubMed Central

    Collins, S; Rambaut, A; Bridgett, S J

    2013-01-01

    We introduce a system for experimental evolution consisting of populations of short oligonucleotides (Oli populations) evolving in a modified quantitative polymerase chain reaction (qPCR). It is tractable at the genetic, genomic, phenotypic and fitness levels. The Oli system uses DNA hairpins designed to form structures that self-prime under defined conditions. Selection acts on the phenotype of self-priming, after which differences in fitness are amplified and quantified using qPCR. We outline the methodological and bioinformatics tools for the Oli system here and demonstrate that it can be used as a conventional experimental evolution model system by test-driving it in an experiment investigating adaptive evolution under different rates of environmental change. PMID:24003997

  1. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection.

    PubMed

    Velders, Aldrik H; Schoen, Cor; Saggiomo, Vittorio

    2018-02-01

    Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap and easy, one-button device that can perform LAMP experiments. Here we show how to build and program an Arduino shield for a LAMP and detection of DNA. The here described Arduino Shield is cheap, easy to assemble, to program and use, it is battery operated and the detection of DNA is done by naked-eye so that it can be used in field.

  2. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  3. Desulfurization characteristics of rapidly hydrated sorbents with various adhesive carrier particles for a semidry CFB-FGD system.

    PubMed

    You, Changfu; Li, Yuan

    2013-03-19

    Semidry flue gas desulfurization (FGD) experiments were conducted using rapidly hydrated sorbents with four different adhesive carrier particles: circulation ash from a circulating fluidized bed boiler (CFBB circulation ash), fly ash from the first electrical field of the electrostatic precipitator of a circulating fluidized bed boiler (CFBB ESP ash), fly ash from a chain boiler (chain boiler ash), and river sand smaller than 1 mm. The influences of various adhesive carrier particles and operating conditions on the desulfurization characteristics of the sorbents were investigated, including sprayed water, reaction temperature, and the ratio of calcium to sulfur (Ca/S). The experimental results indicated that the rapidly hydrated sorbents had better desulfurization characteristics by using adhesive carrier particles which possessed better pore, adhesion, and fluidization characteristics. The desulfurization efficiency of the system increased as the reaction temperature decreased, it improved from 35% to 90% as the mass flow rate of the sprayed water increased from 0 to 10 kg/h, and it increased from 65.6% to 82.7% as Ca/S increased from 1.0 to 2.0. Based on these findings, a new semidry circulating fluidized bed (CFB)-FGD system using rapidly hydrated sorbent was developed. Using the rapidly hydrated sorbent, this system uses a cyclone separator instead of an ESP or a bag filter to recycle the sorbent particles, thereby decreasing the system flow resistance, saving investment and operating costs of the solids collection equipment.

  4. Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

    PubMed

    Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

    1994-12-01

    Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

  5. A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

    PubMed

    Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

    2018-01-01

    One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

  6. Legionella sainthelensi: a new species of Legionella isolated from water near Mt. St. Helens.

    PubMed Central

    Campbell, J; Bibb, W F; Lambert, M A; Eng, S; Steigerwalt, A G; Allard, J; Moss, C W; Brenner, D J

    1984-01-01

    Six strains of a new species, Legionella sainthelensi, were isolated from freshwater in areas affected by the volcanic eruptions of Mt. St. Helens in the state of Washington. Strains of L. sainthelensi are culturally and biochemically similar to other legionellae. They grow on buffered charcoal yeast agar but not on media that lack cysteine. They are gram-negative, nonsporeforming, motile rods that are positive in reactions for catalase, oxidase, gelatin liquefaction, and beta-lactamase. They are negative in reactions for urease, hydrolysis of hippurate, reduction of nitrates, fermentation of glucose, and blue-white autofluorescence. Their cell wall fatty acid composition is qualitatively similar to those of other legionellae, with 50 to 62% branched-chain fatty acids. They contain the isobranched-chain 14- and 16-carbon acids and anteisobranched-chain 15- and 17-carbon acids and relatively large amounts of straight-chain 16-carbon acid. All strains of L. sainthelensi contain approximately equal amounts of ubiquinones Q9, Q10, Q11, and Q12, a pattern similar to those of Legionella bozemanii, Legionella dumoffi, and Legionella longbeachae. Serological cross-reactions were observed between L. sainthelensi, both serogroups of L. longbeachae, and Legionella oakridgensis. Three strains of L. sainthelensi were greater than 90% related by DNA hybridization. The type strain of L. sainthelensi, Mt. St. Helens 4, was 36% related to the type strain of L. longbeachae and 3 to 14% related to the other nine described Legionella species. PMID:6712210

  7. Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

    PubMed

    Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

    1996-03-01

    Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

  8. Polymerization Simulator for Introductory Polymer and Material Science Courses

    ERIC Educational Resources Information Center

    Chirdon, William M.

    2010-01-01

    This work describes how molecular simulation of polymerization reactions can be used to enrich introductory polymer or material science courses to give students a deeper understanding of free-radical chain and stepwise growth polymerization reactions. These simulations have proven to be effective media for instruction that do not require material…

  9. Growth and Characterization of Epitaxial Piezoelectric and Semiconductor Films.

    DTIC Science & Technology

    1980-07-01

    quality epitaxial films at low growth rates. This process is limited to films up to a few microns thickness. The aluminum chloride/ ammonia CVD process has... scrubber through a rotary Vacuum pump maintaining Reactions.-DEZ is an electron deficient compound a pressure of about 400 Torr inside the reaction chain

  10. Utilization of oxygen difluoride for syntheses of fluoropolymers

    NASA Technical Reports Server (NTRS)

    Toy, M. S. (Inventor)

    1976-01-01

    The reaction oxygen difluoride, OF2, with ethylenically unsaturated fluorocarbon compounds is examined. Depending upon the fluorocarbon material and reaction conditions, OF2 can chain extend fluoropolyenes, convert functional perfluorovinyl groups to acyl fluoride and/or epoxide groups, and act as a monomer for an addition type copolymerization with diolefins.

  11. Selective binding of carotenoids with a shorter conjugated chain to the LH2 antenna complex and those with a longer conjugated chain to the reaction center from Rubrivivax gelatinosus.

    PubMed

    Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo

    2007-06-19

    Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.

  12. An intact eight-membered water chain in drosophilid alcohol dehydrogenases is essential for optimal enzyme activity.

    PubMed

    Wuxiuer, Yimingjiang; Morgunova, Ekaterina; Cols, Neus; Popov, Alexander; Karshikoff, Andrey; Sylte, Ingebrigt; Gonzàlez-Duarte, Roser; Ladenstein, Rudolf; Winberg, Jan-Olof

    2012-08-01

    All drosophilid alcohol dehydrogenases contain an eight-member water chain connecting the active site with the solvent at the dimer interface. A similar water chain has also been shown to exist in other short-chain dehydrogenase/reductase (SDR) enzymes, including therapeutically important SDRs. The role of this water chain in the enzymatic reaction is unknown, but it has been proposed to be involved in a proton relay system. In the present study, a connecting link in the water chain was removed by mutating Thr114 to Val114 in Scaptodrosophila lebanonensis alcohol dehydrogenase (SlADH). This threonine is conserved in all drosophilid alcohol dehydrogenases but not in other SDRs. X-ray crystallography of the SlADH(T114V) mutant revealed a broken water chain, the overall 3D structure of the binary enzyme-NAD(+) complex was almost identical to the wild-type enzyme (SlADH(wt) ). As for the SlADH(wt) , steady-state kinetic studies revealed that catalysis by the SlADH(T114V) mutant was consistent with a compulsory ordered reaction mechanism where the co-enzyme binds to the free enzyme. The mutation caused a reduction of the k(on) velocity for NAD(+) and its binding strength to the enzyme, as well as the rate of hydride transfer (k) in the ternary enzyme-NAD(+) -alcohol complex. Furthermore, it increased the pK(a) value of the group in the binary enzyme-NAD(+) complex that regulates the k(on) velocity of alcohol and alcohol-competitive inhibitors. Overall, the results indicate that an intact water chain is essential for optimal enzyme activity and participates in a proton relay system during catalysis. © 2012 The Authors Journal compilation © 2012 FEBS.

  13. Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

    2005-01-01

    To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

  14. Self-assembly and alignment of semiconductor nanoparticles on cellulose nanocrystals

    Treesearch

    Sonal Padalkar; Jeff R. Capadona; Stuart J. Rowan; Christoph Weder; Robert J. Moon; Lia A. Stanciu

    2011-01-01

    The synthesis of cadmium sulfide (CdS), zinc sulfide (ZnS), and lead sulfide (PbS) nanoparticle chains on cellulose nanocrystal (CNC) templates can be accomplished by the reaction of the precursor salts. The use of a cationic surfactant, cetyltrimethylammonium bromide (CTAB), was critical for the synthesis of well-defined semiconductor nanoparticle chains on the...

  15. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    USDA-ARS?s Scientific Manuscript database

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  16. 21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...

  17. 21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...

  18. 21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...

  19. 21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... § 177.1980 of this chapter that contact food of Types I, II, IV-B, VI-B, VII-B, and VIII identified in... produced by the reaction of either ethylene glycol or glycerol with long chain monobasic acids containing... carboxylic acids in the formation of the glycerol esters being neutralized with calcium hydroxide to produce...

  20. 21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...

Top