A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula)

USDA-ARS?s Scientific Manuscript database

Quantitative real-time polymerase chain reaction (qRT-PCR) is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference gene...

Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

USDA-ARS?s Scientific Manuscript database

Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Transcriptional Changes That Characterize the Immune Reactions of Leprosy

PubMed Central

Dupnik, Kathryn M.; Bair, Thomas B.; Maia, Andressa O.; Amorim, Francianne M.; Costa, Marcos R.; Keesen, Tatjana S. L.; Valverde, Joanna G.; Queiroz, Maria do Carmo A. P.; Medeiros, Lúcio L.; de Lucena, Nelly L.; Wilson, Mary E.; Nobre, Mauricio L.; Johnson, Warren D.; Jeronimo, Selma M. B.

2015-01-01

Background. Leprosy morbidity is increased by 2 pathologic immune reactions, reversal reaction (RR) and erythema nodosum leprosum (ENL). Methods. To discover host factors related to immune reactions, global transcriptional profiles of peripheral blood mononuclear cells were compared between 11 RR, 11 ENL, and 19 matched control patients, with confirmation by quantitative polymerase chain reaction. Encoded proteins were investigated in skin biopsy specimens by means of immunohistochemistry. Results. There were 275 genes differentially expressed in RR and 517 differentially expressed in ENL on the microarray. Pathway analysis showed immunity-related pathways represented in RR and ENL transcriptional profiles, with the “complement and coagulation” pathway common to both. Interferon γ was identified as a significant upstream regulator of the expression changes for RR and ENL. Immunohistochemical staining of skin lesions showed increased C1q in both RR and ENL. Conclusions. These data suggest a previously underrecognized role for complement in the pathogenesis of both RR and ENL, and we propose new hypotheses for reaction pathogenesis. PMID:25398459

HOX Genes in Human Lung

PubMed Central

Golpon, Heiko A.; Geraci, Mark W.; Moore, Mark D.; Miller, Heidi L.; Miller, Gary J.; Tuder, Rubin M.; Voelkel, Norbert F.

2001-01-01

HOX genes belong to the large family of homeodomain genes that function as transcription factors. Animal studies indicate that they play an essential role in lung development. We investigated the expression pattern of HOX genes in human lung tissue by using microarray and degenerate reverse transcriptase-polymerase chain reaction survey techniques. HOX genes predominantly from the 3′ end of clusters A and B were expressed in normal human adult lung and among them HOXA5 was the most abundant, followed by HOXB2 and HOXB6. In fetal (12 weeks old) and diseased lung specimens (emphysema, primary pulmonary hypertension) additional HOX genes from clusters C and D were expressed. Using in situ hybridization, transcripts for HOXA5 were predominantly found in alveolar septal and epithelial cells, both in normal and diseased lungs. A 2.5-fold increase in HOXA5 mRNA expression was demonstrated by quantitative reverse transcriptase-polymerase chain reaction in primary pulmonary hypertension lung specimens when compared to normal lung tissue. In conclusion, we demonstrate that HOX genes are selectively expressed in the human lung. Differences in the pattern of HOX gene expression exist among fetal, adult, and diseased lung specimens. The altered pattern of HOX gene expression may contribute to the development of pulmonary diseases. PMID:11238043

Expression of Leptin and Visfatin in Gingival Tissues of Chronic Periodontitis With and Without Type 2 Diabetes Mellitus: A Study Using Enzyme-Linked Immunosorbent Assay and Real-Time Polymerase Chain Reaction.

PubMed

Ghallab, Noha A; Amr, Eman M; Shaker, Olfat G

2015-07-01

The aim of this study is to investigate the protein and gene expression of leptin and visfatin in gingival tissue from patients with chronic periodontitis (CP), patients with CP and type 2 diabetes mellitus (T2DM), and healthy individuals. The study includes 50 individuals: 10 healthy individuals, 20 patients with CP, and 20 patients with CP and T2DM. Plaque index, gingival index, probing depth, and clinical attachment loss were measured, and gingival biopsies were obtained. Leptin and visfatin protein expression in gingival tissues was determined using enzyme-linked immunosorbent assay, and messenger RNA (mRNA) expression was measured via real-time polymerase chain reaction. The highest leptin mRNA and protein expression was observed in the control group and was significantly (P ≤0.05) different from the CP and CP+T2DM groups. Gingival tissues from patients with CP and T2DM had a significant increase in visfatin and a decrease in leptin gene and protein expression (P <0.05) compared with both controls and patients with CP. Expression of leptin and visfatin in the gingival tissues suggests a possible role for these adipokines in the pathogenesis of CP and T2DM.

Spatiotemporal expression of caveolin-1 and EMMPRIN during mouse tooth development.

PubMed

Shi, Lu; Li, Lingyun; Wang, Ding; Li, Shu; Chen, Zhi; An, Zhengwen

2016-06-01

Caveolin-1 is a scaffolding protein involved in the formation of cholesterol-rich caveolae lipid rafts within the plasma membrane and is capable of collecting signaling molecules into the caveolae and regulating their activity, including extracellular matrix metalloproteinase inducer (EMMPRIN). However, detailed expression patterns of caveolin-1 and EMMPRIN in the developing dental germ are largely unknown. The present study investigated the expression patterns of caveolin-1 and EMMPRIN in the developing mouse tooth germ by immunohistochemistry and real-time polymerase chain reaction. At the bud stage, caveolin-1 expression was initiated in the epithelium bud and mesenchymal cells, while EMMPRIN was weakly expressed at this stage. At the cap stage, caveolin-1 protein was located in the lingual part of the tooth germ; however, EMMPRIN protein was located in the labial part. From the bell stage to 2 days postnatal, caveolin-1 expression was detected in the ameloblasts and cervical loop area; with EMMPRIN expression in the ameloblasts and odontoblasts. Real-time polymerase chain reaction results showed that both caveolin-1 and EMMPRIN mRNA levels increased gradually with progression of developmental stages, and peaked at day two postnatal. The current finding suggests that both caveolin-1 and EMMPRIN take part in mouse tooth development, especially in the differentiation and organization of odontogenic tissues.

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

Treesearch

Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

2018-01-01

Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

PubMed

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

Differential expression of steroidogenic factors 1 and 2, cytochrome p450scc, and steroidogenic acute regulatory protein in human pancreas.

PubMed

Morales, Angélica; Vilchis, Felipe; Chávez, Bertha; Morimoto, Sumiko; Chan, Carlos; Robles-Díaz, Guillermo; Díaz-Sánchez, Vicente

2008-08-01

The aim of this study was to investigate the expression of the 4 gene transcripts, steroidogenic factors 1 (SF-1) and 2 (SF-2), steroidogenic acute regulatory (StAR), and cytochrome P450 11A1, involved in the synthesis of steroid hormones in normal human pancreas. Total RNA was extracted from normal male (n = 5) and female (n = 5) samples, obtained from the organ donor program. The expression levels of SF-1, SF-2, StAR protein, and P450scc were assessed by reverse transcription-polymerase chain reaction and complemented with immunohistochemistry analysis. Polymerase chain reaction products amplification for all genes was present in both male and female samples, although differential expression was observed. The signals detected were much more evident in male than in female messenger RNA isolates for SF-1, SF-2, and StAR protein. The expression for P450scc was more intense in female samples. A similar pattern was observed in the immunohistochemical studies. Normal human pancreas expresses 4 gene transcripts involved in steroid synthesis similarly to steroidogenic organs. A distinctive characteristic is the sexually dimorphic expression of these factors. These data provide further evidence to support that the pancreas is a truly steroidogenic tissue, highlighting the presence of sex- and location-related differences in the expression of steroidogenic factors.

Matrix metalloprotease-3 expression in the medial plica and pannus-like tissue in knees from patients with medial compartment osteoarthritis.

PubMed

Wang, Hwai-Shi; Kuo, Pei-Yin; Yang, Chih-Chang; Lyu, Shaw-Ruey

2011-03-01

The severity of cartilage degeneration is positively correlated with the severity of the pathologic change of medial plica. However, knowledge of the pathogenic mechanisms and the impact of plica on cartilage destruction is limited. The aim of the present study was therefore to investigate matrix metalloprotease-3 (MMP-3) expression in the plica isolated from patients with medial compartment osteoarthritis of the knee. Immunohistochemistry showed that MMP-3 was highly expressed in pannus-like tissue and the plica. Western blotting of culture supernatants showed that interleukin-1β (IL-1β) treatment induced MMP-3 release by cells isolated from pannus tissue or the plica. Furthermore, reverse transcriptase polymerase chain reaction and real-time polymerase chain reaction analysis showed that MMP-3 mRNA levels were increased after IL-1β treatment of the cultured cells. MMP-3 and IL-1β mRNAs were expressed in the plica and pannus-like tissue, with MMP-3 mRNA being expressed at significantly higher levels in the plica than in normal synovial membrane and highly expressed in the plica at different stages in osteoarthritis (OA) patients. Pannus-like tissue and the plica express IL-1β and MMP-3. Moreover, MMP-3 mRNA and protein expression in the plica may contribute to the pathogenesis of OA. © 2011 Blackwell Publishing Limited.

Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

PubMed

Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

2017-06-01

Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

Expression of Fra-1 in human hepatocellular carcinoma and its prognostic significance.

PubMed

Gao, Xiao-Qiang; Ge, Yong-Sheng; Shu, Qing-Hua; Ma, Hua-Xing

2017-06-01

This study aimed to explore the clinical significance and prognostic value of Fra-1 in hepatocellular carcinoma patients after curative resection. Fra-1 expression was investigated using a combination of techniques: immunohistochemistry for 66 samples of hepatocellular carcinoma and quantitative real-time polymerase chain reaction and western blotting assays for 19 matched hepatocellular carcinoma specimens. Fra-1 was present in 38 of 66 (57.6%) tumor tissues, with intense staining in the nuclei. There was also positive staining in 14 of 66 (21.2%) adjacent peritumoral tissues, with weak staining in the cytoplasm. Quantitative real-time polymerase chain reaction and western blotting assays confirmed higher expression of Fra-1 messenger RNA and Fra-1 protein in tumor tissues than adjacent non-tumor tissues for 19 hepatocellular carcinoma samples (p < 0.001). Positive expression of Fra-1 was significantly related to vascular invasion and serum alpha-fetoprotein. Kaplan-Meier survival analysis found that overexpressed Fra-1 was correlated with poor overall survival and disease-free survival. Multivariate analysis identified Fra-1 as an independent prognostic factor. Fra-1 may be involved in the progress of hepatocellular carcinoma and could be a promising molecular candidate in the diagnosis and treatment of hepatocellular carcinoma.

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Validation of Reference Genes in mRNA Expression Analysis Applied to the Study of Asthma.

PubMed

Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S

2016-01-01

The quantitative Polymerase Chain Reaction is the most used technique for the study of gene expression. To correct putative experimental errors of this technique is necessary normalizing the expression results of the gene of interest with the obtained for reference genes. Here, we describe an example of the process to select reference genes. In this particular case, we select reference genes for expression studies in the peripheral blood mononuclear cells of asthmatic patients.

Expression and function of CD8 alpha/beta chains on rat and human mast cells.

PubMed

Kim, Mi-Sun; Kim, Sung-Hoon; Lee, Hye-Jung; Kim, Hyung-Min

2004-03-01

The expression and functional role of CD8 glycoprotein, a marker of cytotoxic/suppressor T lymphocytes and NK cells, were not studied on freshly isolated connective tissue type rat peritoneal mast cells, a rat mucosal type mast cell line (RBL 2H3), or human mast cell line (HMC-1). We used the reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis, immunohistochemistry and enzyme-linked immunosorbent assay. RT-PCR and Western blot analysis identified the presence of CD8 alpha/beta chains on the mast cells, and immunohistochemistry confirmed CD8alpha expression on rat or human mast cells. Functional studies demonstrated that stimulation of CD8 alpha/beta chains on rat mast cells induced the secretion of tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6), which are regarded as important mediators during infection. However, co-stimulation with stem cell factor had no effect on CD8-induced mediator secretion. Our findings demonstrate novel biological roles of CD8 molecules in mast cells.

The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

PubMed

Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

2015-03-01

This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

Microarray Analysis of Differential Gene Expression Profile Between Human Fetal and Adult Heart.

PubMed

Geng, Zhimin; Wang, Jue; Pan, Lulu; Li, Ming; Zhang, Jitai; Cai, Xueli; Chu, Maoping

2017-04-01

Although many changes have been discovered during heart maturation, the genetic mechanisms involved in the changes between immature and mature myocardium have only been partially elucidated. Here, gene expression profile changed between the human fetal and adult heart was characterized. A human microarray was applied to define the gene expression signatures of the fetal (13-17 weeks of gestation, n = 4) and adult hearts (30-40 years old, n = 4). Gene ontology analyses, pathway analyses, gene set enrichment analyses, and signal transduction network were performed to predict the function of the differentially expressed genes. Ten mRNAs were confirmed by quantificational real-time polymerase chain reaction. 5547 mRNAs were found to be significantly differentially expressed. "Cell cycle" was the most enriched pathway in the down-regulated genes. EFGR, IGF1R, and ITGB1 play a central role in the regulation of heart development. EGFR, IGF1R, and FGFR2 were the core genes regulating cardiac cell proliferation. The quantificational real-time polymerase chain reaction results were concordant with the microarray data. Our data identified the transcriptional regulation of heart development in the second trimester and the potential regulators that play a prominent role in the regulation of heart development and cardiac cells proliferation.

Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

PubMed

Nishiura, T; Abe, K

1999-01-01

The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

EPA Science Inventory

Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

Microarray expression profiling in adhesion and normal peritoneal tissues.

PubMed

Ambler, Dana R; Golden, Alicia M; Gell, Jennifer S; Saed, Ghassan M; Carey, David J; Diamond, Michael P

2012-05-01

To identify molecular markers associated with adhesion and normal peritoneal tissue using microarray expression profiling. Comparative study. University hospital. Five premenopausal women. Adhesion and normal peritoneal tissue samples were obtained from premenopausal women. Ribonucleic acid was extracted using standard protocols and processed for hybridization to Affymetrix Whole Transcript Human Gene Expression Chips. Microarray data were obtained from five different patients, each with adhesion tissue and normal peritoneal samples. Real-time polymerase chain reaction was performed for confirmation using standard protocols. Gene expression in postoperative adhesion and normal peritoneal tissues. A total of 1,263 genes were differentially expressed between adhesion and normal tissues. One hundred seventy-three genes were found to be up-regulated and 56 genes were down-regulated in the adhesion tissues compared with normal peritoneal tissues. The genes were sorted into functional categories according to Gene Ontology annotations. Twenty-six up-regulated genes and 11 down-regulated genes were identified with functions potentially relevant to the pathophysiology of postoperative adhesions. We evaluated and confirmed expression of 12 of these specific genes via polymerase chain reaction. The pathogenesis, natural history, and optimal treatment of postoperative adhesive disease remains unanswered. Microarray analysis of adhesions identified specific genes with increased and decreased expression when compared with normal peritoneum. Knowledge of these genes and ontologic pathways with altered expression provide targets for new therapies to treat patients who have or are at risk for postoperative adhesions. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Bio-barcode gel assay for microRNA

NASA Astrophysics Data System (ADS)

Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min

2014-02-01

MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.

Use of Hybridization Chain Reaction-Fluorescent In Situ Hybridization To Track Gene Expression by Both Partners during Initiation of Symbiosis.

PubMed

Nikolakakis, K; Lehnert, E; McFall-Ngai, M J; Ruby, E G

2015-07-01

The establishment of a productive symbiosis between Euprymna scolopes, the Hawaiian bobtail squid, and its luminous bacterial symbiont, Vibrio fischeri, is mediated by transcriptional changes in both partners. A key challenge to unraveling the steps required to successfully initiate this and many other symbiotic associations is characterization of the timing and location of these changes. We report on the adaptation of hybridization chain reaction-fluorescent in situ hybridization (HCR-FISH) to simultaneously probe the spatiotemporal regulation of targeted genes in both E. scolopes and V. fischeri. This method revealed localized, transcriptionally coregulated epithelial cells within the light organ that responded directly to the presence of bacterial cells while, at the same time, provided a sensitive means to directly show regulated gene expression within the symbiont population. Thus, HCR-FISH provides a new approach for characterizing habitat transition in bacteria and for discovering host tissue responses to colonization. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Novel cytochrome P450 genes, CYP6EB1 and CYP6EC1, are over-expressed in acrinathrin-resistant Frankliniella occidentalis (Thysanoptera: Thripidae).

PubMed

Cifuentes, D; Chynoweth, R; Guillén, J; De la Rúa, P; Bielza, P

2012-06-01

Control of Frankliniella occidentalis (Pergande) is a serious problem for agriculture all over the world because of the limited range of insecticides that are available. Insecticide resistance in F. occidentalis has been reported for all major insecticide groups. Our previous studies showed that cytochrome P450-mediated detoxification is a major mechanism responsible for insecticide resistance in this pest. Degenerate polymerase chain reaction was used to identify P450 genes that might be involved in acrinathrin resistance, in a laboratory population of F. occidentalis. Associated sequences were classified as belonging to the CYP4 and CYP6 families. Real-time quantitative polymerase chain reaction analyses revealed that two genes, CYP6EB1 and CYP6EC1, were over-expressed in adults and L2 larvae of the resistant population, when compared with the susceptible population, suggesting their possible involvement in resistance to acrinathrin.

Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

PubMed

Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

2014-01-01

Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P < .0001, 11.36 ± 6.0 vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

Characterization of vitellogenin gene expression in round goby (Neogobius melanostomus) using a quantitative polymerase chain reaction assay.

PubMed

Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y

2010-12-01

A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.

Analysis of immunoglobulin heavy and light chain variable genes in post-transplant lymphoproliferative disorders.

PubMed

Capello, Daniela; Cerri, Michaela; Muti, Giuliana; Lucioni, Marco; Oreste, Pierluigi; Gloghini, Annunziata; Berra, Eva; Deambrogi, Clara; Franceschetti, Silvia; Rossi, Davide; Alabiso, Oscar; Morra, Enrica; Rambaldi, Alessandro; Carbone, Antonino; Paulli, Marco; Gaidano, Gianluca

2006-12-01

Post-transplant lymphoproliferative disorders (PTLD) derive from antigen-experienced B-cells and represent a major complication of solid organ transplantation. We characterized usage, mutation frequency and mutation pattern of immunoglobulin variable (IGV) gene rearrangements in 50 PTLD (polymorphic PTLD, n=10; diffuse large B-cell lymphoma, n=35; and Burkitt/Burkitt-like lymphoma, n=5). Among PTLD yielding clonal IGV amplimers, a functional IGV heavy chain (IGHV) rearrangement was found in 40/50 (80.0%) cases, whereas a potentially functional IGV light chain rearrangement was identified in 36/46 (78.3%) PTLD. By combining IGHV and IGV light chain rearrangements, 10/50 (20.0%) PTLD carried crippling mutations, precluding expression of a functional B-cell receptor (BCR). Immunohistochemistry showed detectable expression of IG light chains in only 18/43 (41.9%) PTLD. Failure to detect a functional IGV rearrangement associated with lack of IGV expression. Our data suggest that a large fraction of PTLD arise from germinal centre (GC)-experienced B-cells that display impaired BCR. Since a functional BCR is required for normal B-cell survival during GC transit, PTLD development may implicate rescue from apoptosis and expansion of B-cells that have failed the GC reaction. The high frequency of IGV loci inactivation appears to be a peculiar feature of PTLD among immunodeficiency-associated lymphoproliferations.

RT-qPCR Demonstrates Light-Dependent AtRBCS1A and AtRBCS3B mRNA Expressions in "Arabidopsis thaliana" Leaves

ERIC Educational Resources Information Center

Chang, Ming-Mei; Li, Anna; Feissner, Robert; Ahmad, Talal

2016-01-01

Reverse transcription quantitative polymerase chain reaction (RT-qPCR) is widely used in diagnosis and research to determine specific mRNA expressions in cells. As RT-qPCR applications increase, it is necessary to provide undergraduates hands-on experience of this modern technique. Here, we report a 3-week laboratory exercise using RT-qPCR to…

Head and Neck Squamous Cell Carcinomas Do Not Express EGFRvIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melchers, Lieuwe J., E-mail: l.j.melchers@umcg.nl; Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen; Clausen, Martijn J.A.M.

2014-10-01

Purpose: To assess the prevalence of EGFRvIII, a specific variant of EGFR (epidermal growth factor receptor), in 3 well-defined cohorts of head and neck squamous cell carcinoma (HNSCC). Methods and Materials: Immunohistochemistry for the specific detection of EGFRvIII using the L8A4 antibody was optimized on formalin-fixed, paraffin-embedded tissue using glioblastoma tissue. It was compared with EGFR and EGFRvIII RNA expression using a specific reverse transcription–polymerase chain reaction also optimized for formalin-fixed, paraffin-embedded tissue. Tissue microarrays including 531 HNSCCs of various stages with complete clinicopathologic and follow-up data were tested for the presence of EGFRvIII. Results: None of the 531 casesmore » showed EGFRvIII protein expression. Using an immunohistochemistry protocol reported by others revealed cytoplasmic staining in 8% of cases. Reverse transcription–polymerase chain reaction for the EGFRvIII transcript of the 28 highest cytoplasmic staining cases, as well as 69 negative cases, did not show expression in any of the tested cases, suggesting aspecific staining by a nonoptimal protocol. Conclusions: The EGFRvIII mutation is not present in HNSCC. Therefore, EGFRvIII does not influence treatment response in HNSCC and is not a usable clinical prognostic marker.« less

Inducible expression of A Disintegrin and Metalloproteinase 8 in chronic periodontitis and gingival epithelial cells.

PubMed

Aung, W P P; Chotjumlong, P; Pata, S; Montreekachon, P; Supanchart, C; Khongkhunthian, S; Sastraruji, T; Krisanaprakornkit, S

2017-06-01

The expression of A Disintegrin and Metalloproteinase 8 (ADAM8) is associated with several inflammatory diseases. Elevated ADAM8 levels have been shown in gingival crevicular fluid of patients with chronic periodontitis. The objective of this study was to investigate ADAM8 expression in chronic periodontitis tissues compared with that in normal tissues. ADAM8 expression and its inductive mechanism were examined in human gingival epithelial cells (HGECs) and human gingival fibroblasts. Total RNA and protein were extracted from gingival biopsies of 33 patients with chronic periodontitis and those of 23 healthy volunteers. ADAM8 mRNA and protein expression was analyzed by real-time polymerase chain reaction, immunoblotting and immunohistochemistry. ADAM8 expression in control and stimulated cells in the presence or absence of specific inhibitors for mitogen-activated protein kinase pathways was assayed by real-time polymerase chain reaction, immunoblotting, flow cytometry and immunofluorescence. ADAM8 mRNA and protein expression in chronic periodontitis tissues was significantly greater than that in normal tissues (p < 0.01). Significantly increased ADAM8 expression was detected in the gingival epithelium of chronic periodontitis tissues (p < 0.001). ADAM8 mRNA expression in HGECs, but not in human gingival fibroblasts, was significantly induced by stimulation with Fusobacterium nucleatum (p < 0.05), partially via the p44/42 mitogen-activated protein kinase pathway. ADAM8 expression in the cell lysates and on the surface of HGECs was induced by stimulation with F. nucleatum. ADAM8 expression is increased in inflamed chronic periodontitis tissues and localized within gingival epithelium, consistent with an upregulation of ADAM8 expression in F. nucleatum-stimulated HGECs, suggesting a possible role of ADAM8 in innate immunity of periodontal tissue. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Electroconvulsive stimulation (ECS) increases the expression of neuropeptide Y (NPY) in rat brains in a model of neuropathic pain: a quantitative real-time polymerase chain reaction (RT-PCR) study.

PubMed

Okabe, Tadashi; Sato, Chiyo; Matsumoto, Keisuke; Ozawa, Hitoshi; Sakamoto, Atsuhiro

2009-11-01

Electroconvulsive shock therapy (ECT) has been widely used as an effective and established treatment for refractory depression and schizophrenia. Some reports have shown that ECT is also effective for treating refractory neuropathic pain. In a rat model of neuropathic pain produced by chronic constrictive injury (CCI) of the sciatic nerve, thermal hyperalgesia, and mechanical allodynia were observed from day 2 after surgery. An electroconvulsive shock (ECS) was administered to rodents once daily for 6 days on days 7-12 after CCI operation using a pulse generator. Thermal and mechanical stimulation tests were performed to assess pain thresholds. Real-time polymerase chain reaction was used to measure the gene expression levels for 5HT(1A)R, 5HT(2A)R, neuropeptide Y (NPY), and GABAA(alpha1)R in the brain. After ECS, the latency to withdrawal from thermal stimulation was significantly increased; however, pain withdrawal thresholds in response to mechanical stimulation were not significantly changed. Expression ratios of NPY were significantly greater after ECS. Symptoms of neuropathic pain improved and expression of NPY in the brain was increased in CCI model rats after ECS, suggesting that changes in the expression of NPY in the brain may be related to the mechanism of action of ECT in treating neuropathic pain.

Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

PubMed Central

Liu, Rui; Liang, Xiao; Xiang, Dandan; Guo, Yirong; Liu, Yihua; Zhu, Guonian

2016-01-01

Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv) antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb) against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL) to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples. PMID:27338340

Expression of mitochondrial branched-chain aminotransferase and α-keto-acid dehydrogenase in rat brain: implications for neurotransmitter metabolism

PubMed Central

Cole, Jeffrey T.; Sweatt, Andrew J.; Hutson, Susan M.

2012-01-01

In the brain, metabolism of the essential branched chain amino acids (BCAAs) leucine, isoleucine, and valine, is regulated in part by protein synthesis requirements. Excess BCAAs are catabolized or excreted. The first step in BCAA catabolism is catalyzed by the branched chain aminotransferase (BCAT) isozymes, mitochondrial BCATm and cytosolic BCATc. A product of this reaction, glutamate, is the major excitatory neurotransmitter and precursor of the major inhibitory neurotransmitter γ-aminobutyric acid (GABA). The BCATs are thought to participate in a α-keto-acid nitrogen shuttle that provides nitrogen for synthesis of glutamate from α-ketoglutarate. The branched-chain α-keto acid dehydrogenase enzyme complex (BCKDC) catalyzes the second, irreversible step in BCAA metabolism, which is oxidative decarboxylation of the branched-chain α-keto acid (BCKA) products of the BCAT reaction. Maple Syrup Urine Disease (MSUD) results from genetic defects in BCKDC, which leads to accumulation of toxic levels of BCAAs and BCKAs that result in brain swelling. Immunolocalization of BCATm and BCKDC in rats revealed that BCATm is present in astrocytes in white matter and in neuropil, while BCKDC is expressed only in neurons. BCATm appears uniformly distributed in astrocyte cell bodies throughout the brain. The segregation of BCATm to astrocytes and BCKDC to neurons provides further support for the existence of a BCAA-dependent glial-neuronal nitrogen shuttle since the data show that BCKAs produced by glial BCATm must be exported to neurons. Additionally, the neuronal localization of BCKDC suggests that MSUD is a neuronal defect involving insufficient oxidation of BCKAs, with secondary effects extending beyond the neuron. PMID:22654736

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nasarabadi, Shanavaz

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

PubMed

Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

2015-12-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

Selection of single chain antibody fragments binding to the extracellular domain of 4-1BB receptor by phage display technology.

PubMed

Bagheri, Salman; Yousefi, Mehdi; Safaie Qamsari, Elmira; Riazi-Rad, Farhad; Abolhassani, Mohsen; Younesi, Vahid; Dorostkar, Ruhollah; Movassaghpour, Ali Akbar; Sharifzadeh, Zahra

2017-03-01

The 4-1BB is a surface glycoprotein that pertains to the tumor necrosis factor-receptor family. There is compelling evidence suggesting important roles for 4-1BB in the immune response, including cell activation and proliferation and also cytokine induction. Because of encouraging results of different agonistic monoclonal antibodies against 4-1BB in the treatment of cancer, infectious, and autoimmune diseases, 4-1BB has been suggested as an attractive target for immunotherapy. In this study, single chain variable fragment phage display libraries, Tomlinson I+J, were screened against specific synthetic oligopeptides (peptides I and II) designed from 4-1BB extracellular domain. Five rounds of panning led to selection of four 4-1BB specific single chain variable fragments (PI.12, PI.42, PII.16, and PII.29) which showed specific reaction to relevant peptides in phage enzyme-linked immunosorbent assay. The selected clones were successfully expressed in Escherichia coli Rosetta-gami 2, and their expression was confirmed by western blot analysis. Enzyme-linked immunosorbent assay experiments indicated that these antibodies were able to specifically recognize 4-1BB without any cross-reactivity with other antigens. Flow cytometry analysis demonstrated an acceptable specific binding of the single chain variable fragments to 4-1BB expressed on CCRF-CEM cells, while no binding was observed with an irrelevant antibody. Anti-4-1BB single chain variable fragments enhanced surface CD69 expression and interleukin-2 production in stimulated CCRF-CEM cells which confirmed the agonistic effect of the selected single chain variable fragments. The data from this study have provided a rationale for further experiments involving the biological functions of anti-4-1BB single chain variable fragments in future studies.

Immunohistochemical Study of Laminin-332 γ2 Chain and MMP-9 in High Risk of Malignant Transformation Oral Lesions and OSCC.

PubMed

Silva, Eline Manhães Reid; Freitas, Vanessa Morais; Bautz, Willian Grassi; de Barros, Liliana Aparecida Pimenta; da Gama de Souza, Letícia Nogueira

2018-01-01

Oral squamous cell carcinoma is associated with alterations in basement membrane. Laminin-332 is present in basal lamina and performs multiple biologic effects by γ2 chain. Matrix metalloproteinase acts disrupting extracellular components and was related to poor prognosis in cancer. Here, molecular profile of laminin-332 γ2 chain and matrix metalloproteinase-9 was assessed in oral lesions. The expression of laminin-332 γ2 chain and matrix metalloproteinase-9 (MMP-9) was examined by immunohistochemistry in 10 patients with high risk of malignant transformation oral lesions and 26 cases of oral squamous cell carcinoma (OSCC). Associations between microscopic and clinicopathologic features were established. Immunostaining of laminin-332 γ2 chain in high risk oral lesions was most detected in basement membrane which is continuous, while the majority of OSCC cases showed a discontinuous membrane (P = 0.001). It was observed a positive reaction for γ2 chain in invasive fronts and a higher expression in epithelial compartment of smoking patients with OSCC (P < 0.0001). In epithelium, MMP-9 expression was presented in all layers with no difference between lesions. However, an elevated immunostaining in stromal cells was associated with male patients (P = 0.0054), older than 60 years (P = 0.0101) and with OSCC. Present study results support the hypothesis of changes in molecules expression in high risk oral lesions and oral squamous cell carcinoma. A relation between clinical and molecule profile was observed. Those molecules may represent a useful tool to predict oral cancer behaviour.

LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

NASA Astrophysics Data System (ADS)

Oshanin, G.; Burlatsky, S. F.

2002-11-01

We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].

PubMed

Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e

2010-06-01

To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.

Comparisons of serum miRNA expression profiles in patients with diabetic retinopathy and type 2 diabetes mellitus.

PubMed

Ma, Jianping; Wang, Jufang; Liu, Yanfen; Wang, Changyi; Duan, Donghui; Lu, Nanjia; Wang, Kaiyue; Zhang, Lu; Gu, Kaibo; Chen, Sihan; Zhang, Tao; You, Dingyun; Han, Liyuan

2017-02-01

The aim of this study was to compare the expression levels of serum miRNAs in diabetic retinopathy and type 2 diabetes mellitus. Serum miRNA expression profiles from diabetic retinopathy cases (type 2 diabetes mellitus patients with diabetic retinopathy) and type 2 diabetes mellitus controls (type 2 diabetes mellitus patients without diabetic retinopathy) were examined by miRNA-specific microarray analysis. Quantitative real-time polymerase chain reaction was used to validate the significantly differentially expressed serum miRNAs from the microarray analysis of 45 diabetic retinopathy cases and 45 age-, sex-, body mass index- and duration-of-diabetes-matched type 2 diabetes mellitus controls. The relative changes in serum miRNA expression levels were analyzed using the 2-ΔΔCt method. A total of 5 diabetic retinopathy cases and 5 type 2 diabetes mellitus controls were included in the miRNA-specific microarray analysis. The serum levels of miR-3939 and miR-1910-3p differed significantly between the two groups in the screening stage; however, quantitative real-time polymerase chain reaction did not reveal significant differences in miRNA expression for 45 diabetic retinopathy cases and their matched type 2 diabetes mellitus controls. Our findings indicate that miR-3939 and miR-1910-3p may not play important roles in the development of diabetic retinopathy; however, studies with a larger sample size are needed to confirm our findings.

Activation of RAS family genes in urothelial carcinoma.

PubMed

Boulalas, I; Zaravinos, A; Karyotis, I; Delakas, D; Spandidos, D A

2009-05-01

Bladder cancer is the fifth most common malignancy in men in Western society. We determined RAS codon 12 and 13 point mutations and evaluated mRNA expression levels in transitional cell carcinoma cases. Samples from 30 human bladder cancers and 30 normal tissues were analyzed by polymerase chain reaction/restriction fragment length polymorphism and direct sequencing to determine the occurrence of mutations in codons 12 and 13 of RAS family genes. Moreover, we used real-time reverse transcriptase-polymerase chain reaction to evaluate the expression profile of RAS genes in bladder cancer specimens compared to that in adjacent normal tissues. Overall H-RAS mutations in codon 12 were observed in 9 tumor samples (30%). Two of the 9 patients (22%) had invasive bladder cancer and 7 (77%) had noninvasive bladder cancer. One H-RAS mutation (11%) was homozygous and the remaining 89% were heterozygous. All samples were WT for K and N-RAS oncogenes. Moreover, 23 of 30 samples (77%) showed over expression in at least 1 RAS family gene compared to adjacent normal tissue. K and N-RAS had the highest levels of over expression in bladder cancer specimens (50%), whereas 27% of transitional cell carcinomas demonstrated H-RAS over expression relative to paired normal tissues. Our results underline the importance of H-RAS activation in human bladder cancer by codon 12 mutations. Moreover, they provide evidence that increased expression of all 3 RAS genes is a common event in bladder cancer that is associated with disease development.

Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Spatiotemporal expression of chondroitin sulfate sulfotransferases in the postnatal developing mouse cerebellum.

PubMed

Ishii, Maki; Maeda, Nobuaki

2008-08-01

Chondroitin sulfate (CS) proteoglycans are major components of the cell surface and the extracellular matrix in the developing brain and bind to various proteins via CS chains in a CS structure-dependent manner. This study demonstrated the expression pattern of three CS sulfotransferase genes, dermatan 4-O-sulfotransferase (D4ST), uronyl 2-O-sulfotransferase (UST), and N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (GalNAc4S-6ST), in the mouse postnatal cerebellum. These sulfotransferases are responsible for the biosynthesis of oversulfated structures in CS chains such as B, D, and E units, which constitute the binding sites for various heparin-binding proteins. Real-time reverse transcription-polymerase chain reaction analysis indicated that the expression of UST increased remarkably during cerebellar development. The amounts of B and D units, which are generated by UST activity, in the cerebellar CS chains also increased during development. In contrast, the expression of GalNAc4S-6ST and its biosynthetic product, E unit, decreased during postnatal development. In situ hybridization experiments revealed the levels of UST and GalNAc4S-6ST mRNAs to correlate inversely in many cells including Purkinje cells, granule cells in the external granular layer, and inhibitory interneurons. In these neurons, the expression of UST increased and that of GalNAc4S-6ST decreased during development and/or maturation. D4ST was also expressed by many neurons, but its expression was not simply correlated with development, which might contribute to the diversification of CS structures expressed by distinct neurons. These results suggest that the CS structures of various cerebellar neurons change during development and such changes of CS are involved in the regulation of various signaling pathways.

Analytical expressions for the closure probability of a stiff wormlike chain for finite capture radius.

PubMed

Guérin, T

2017-08-01

Estimating the probability that two monomers of the same polymer chain are close together is a key ingredient to characterize intramolecular reactions and polymer looping. In the case of stiff wormlike polymers (rigid fluctuating elastic rods), for which end-to-end encounters are rare events, we derive an explicit analytical formula for the probability η(r_{c}) that the distance between the chain extremities is smaller than some capture radius r_{c}. The formula is asymptotically exact in the limit of stiff chains, and it leads to the identification of two distinct scaling regimes for the closure factor, originating from a strong variation of the fluctuations of the chain orientation at closure. Our theory is compatible with existing analytical results from the literature that cover the cases of a vanishing capture radius and of nearly fully extended chains.

The prognostic role of E2A-PBX1 expression detected by real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) in B cell acute lymphoblastic leukemia after allogeneic hematopoietic stem cell transplantation.

PubMed

Hong, Yan; Zhao, Xiaosu; Qin, Yazhen; Zhou, Songhai; Chang, Yingjun; Wang, Yu; Zhang, Xiaohui; Xu, Lanping; Huang, Xiaojun

2018-04-28

The E2A-PBX1 rearrangement is common in B cell acute lymphoblastic leukemia (B-ALL). However, whether this fusion gene can be used as a reliable marker for minimal residual disease (MRD) following allogeneic hematopoietic stem cell transplantation (allo-HSCT) remains unknown. In this study, clinical data were collected from 28 consecutive B-ALL patients who received allo-HSCT. Their MRD was evaluated by E2A-PBX1 and leukemia-associated immunophenotype (LAIP). The median follow-up was 374 days (55-2342 days). Of the enrolled patients, seven (25%) patients died of leukemia relapse. A total of nine (32.1%) patients experienced relapse at a median of 164 days (75-559 days) after transplantation. The median expression level in the first positive sample was 0.14% (0.0071-902.4%). The duration from E2A-PBX1-positive results to hematological relapse was 74 days (30-469 days). E2A-PBX1 expression generally became positive prior to flow cytometry. Patients with positive E2A-PBX1 gene expression pre-transplantation were more likely to have positive E2A-PBX1 expression after transplantation. Taken all together, E2A-PBX1 expression determined by real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) could be used to evaluate MRD status after allo-HSCT. Patients with positive E2A-PBX1 expression after transplant will have a poor prognosis.

Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

PubMed

Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

2017-01-01

In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

ZEB1 is Estrogen Responsive In Vitro in Human Foreskin Cells and is Over Expressed in Penile Skin in Patients With Severe Hypospadias

PubMed Central

Qiao, Liang; Tasian, Gregory E.; Zhang, Haiyang; Cunha, Gerald R.; Baskin, Laurence

2012-01-01

Purpose We determined the effect of estrogen on ZEB1 in vitro and tested the hypothesis that ZEB1 is over expressed in the penile skin of subjects with hypospadias. Materials and Methods Hs68 cells, a fibroblast cell line derived from human foreskin, were exposed to 0, 1, 10 and 100 nM estrogen, and the expression level of ZEB1 was assessed using reverse transcription real-time polymerase chain reaction, Western blot and immunocytochemical analysis. Next, preputial skin was prospectively collected from case and control subjects at hypospadias repair (37 cases) and circumcision (11). Hypospadias was classified as severe (13 cases) or mild (24) based on the position of the urethral meatus. ZEB1 expression was quantified using reverse transcription real-time polymerase chain reaction, Western blot and immunohistochemical analysis. Results Estrogen increased ZEB1 expression at the mRNA and protein levels in Hs68 cells in a concentration dependent fashion (p <0.01). Subjects with severe hypospadias had significantly higher ZEB1 mRNA levels and protein expression compared to controls or subjects with mild hypospadias (both p <0.01). Subjects with severe hypospadias had increased expression of ZEB1 in the basal layers of the preputial epidermis. Conclusions Estrogen increases ZEB1 expression in a human foreskin fibroblast cell line in vitro. Furthermore, ZEB1 is significantly over expressed in the penile skin of subjects with severe hypospadias. We propose that ZEB1 overexpression may contribute to development of hypospadias and may mediate the effect of estrogen on developing external male genitalia. PMID:21421232

Inactivation of parkin by promoter methylation correlated with lymph node metastasis and genomic instability in nasopharyngeal carcinoma.

PubMed

Ni, Haifeng; Zhou, Zhen; Jiang, Bo; Yuan, Xiaoyang; Cao, Xiaolin; Huang, Guangwu; Li, Yong

2017-03-01

This study aimed to investigate the inactivation of the parkin gene by promoter methylation and its relationship with genome instability in nasopharyngeal carcinoma. Parkin was considered as a tumor suppressor gene in various types of cancers. However, its role in nasopharyngeal carcinoma is unexplored. Genomic instabilities were detected in nasopharyngeal carcinoma tissues by the random amplified polymorphic DNA. The methylation-specific polymerase chain reaction, semi-quantitative reverse transcription polymerase chain reaction, and immunohistochemical analysis were used to detect methylation and mRNA and protein expression of parkin in 54 cases of nasopharyngeal carcinoma tissues and 16 cases of normal nasopharyngeal epithelia tissues, and in 5 nasopharyngeal carcinoma cell lines (CNE1, CNE2, TWO3, C666, and HONE1) and 1 normal nasopharyngeal epithelia cell line (NP69). mRNA expression of parkin in CNE1 and CNE2 was analyzed before and after methyltransferase inhibitor 5-aza-2-deoxycytidine treatment. The relationship between promoter methylation and mRNA expression, demethylation and mRNA expression, and mRNA and protein expression of the gene and clinical factors and genomic instabilities were analyzed. The mRNA and protein expression levels were significantly reduced in 54 cases of human nasopharyngeal carcinoma compared with 16 cases of normal nasopharyngeal epithelia. Parkin-methylated cases showed significantly lower mRNA and protein expression levels compared with unmethylated cases. After 5-aza-2-deoxycytidine treatment, parkin mRNA expression was restored in CNE1 and CNE2; 92.59% (50/54) of nasopharyngeal carcinoma demonstrated genomic instability. Parkin is frequently inactivated by promoter methylation, and its mRNA and protein expression correlate with lymph node metastasis and genomic instability. Parkin deficiency probably promotes tumorigenesis in nasopharyngeal carcinoma.

Low-intensity pulsed ultrasound produced an increase of osteogenic genes expression during the process of bone healing in rats.

PubMed

Fávaro-Pípi, Elaine; Bossini, Paulo; de Oliveira, Poliani; Ribeiro, Juliana Uema; Tim, Carla; Parizotto, Nivaldo A; Alves, Jose Marcos; Ribeiro, Daniel Araki; Selistre de Araújo, Heloísa Sobreiro; Renno, Ana Claudia Muniz

2010-12-01

The aim of this study was to measure the temporal expression of osteogenic genes during the process of bone healing in low-intensity pulsed ultrasound (LIPUS) treated bone defects by means of histopathologic and real-time polymerase chain reaction (PCR) analysis. Animals were randomly distributed into two groups (n = 30): control group (bone defect without treatment) and LIPUS treated (bone defect treated with LIPUS). On days 7, 13 and 25 postinjury, 10 rats per group were sacrificed. Rats were treated with a 30 mW/cm(2) LIPUS. The results pointed out intense new bone formation surrounded by highly vascularized connective tissue presenting a slight osteogenic activity, with primary bone deposition was observed in the group exposed to LIPUS in the intermediary (13 days) and late stages of repair (25 days) in the treated animals. In addition, quantitative real-time polymerase chain reaction (RT-qPCR) showed an upregulation of bone morphogenetic protein 4 (BMP4), osteocalcin and Runx2 genes 7 days after the surgery. In the intermediary period, there was no increase in the expression. The expression of alkaline phosphatase, BMP4 and Runx2 was significantly increased at the last period. Our results indicate that LIPUS therapy improves bone repair in rats and upregulated osteogenic genes, mainly at the late stages of recovery. Copyright © 2010. Published by Elsevier Inc.

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

PubMed

Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

2018-04-01

Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

b-FGF induces corneal blood and lymphatic vessel growth in a spatially distinct pattern.

PubMed

Hajrasouliha, Amir R; Sadrai, Zahra; Chauhan, Sunil K; Dana, Reza

2012-07-01

To study the spatial variances in ligand expression and angiogenic effect in response to the inflammatory response induced by basic fibroblast growth factor (b-FGF). b-FGF micropellets (80 ng) were implanted in the temporal side of the cornea of Balb/c mice. On days 1, 3, and 7, blood (heme-) and lymphangiogenesis were observed by immunofluorescence staining of corneal flat mounts with LYVE-1 and CD31 to identify lymphatic and blood vessels, respectively. A second group of corneas were harvested for quantitative real-time polymerase chain reaction. Each cornea was divided into 2 different areas: (1) pre-pellet area and (2) opposite-pellet area. Expression of vascular endothelial growth factor (VEGF) ligands was evaluated using real-time polymerase chain reaction in each respective zone. Blood vessels grew into the cornea from the pre-pellet area, whereas corneal lymphatic vessels grew from the opposite-pellet area toward the center of the cornea. VEGF-A was upregulated in the pre-pellet, whereas VEGF-D expression was mostly observed in the opposite-pellet area. VEGF-C level increased simultaneously in both areas. A single inducing factor, that is, b-FGF, may simultaneously provoke hemangiogenesis and lymphangiogenesis in different locations of the cornea through differential expression of VEGF ligands. This distinctive spatial pattern should be considered while evaluating the corneal predilection for inflammation beyond that which is directly visible by slit lamp examination.

PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

ERIC Educational Resources Information Center

Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

2009-01-01

Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

Real-Time PCR (qPCR) Primer Design Using Free Online Software

ERIC Educational Resources Information Center

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

Evaluation of reference genes for expression studies in ash (Fraxinus spp.)

Treesearch

Loren Rivera-Vega; Praveen Mamidala; Jennifer L. Koch; Mary E. Mason; Omprakash Mittapalli

2012-01-01

Ash (Fraxinus spp.) is a dominant tree species in North America, in both managed and natural landscapes. However, due to the rapid invasion by the emerald ash borer (Agrilus planipennis), an exotic invasive insect pest, millions of North American ash trees have been killed. Real-time quantitative polymerase chain reaction (RTq-PCR...

Methylation pattern of IFNG in periapical granulomas and radicular cysts.

PubMed

Campos, Kelma; Gomes, Carolina Cavaliéri; de Fátima Correia-Silva, Jeane; Farias, Lucyana Conceição; Fonseca-Silva, Thiago; Bernardes, Vanessa Fátima; Pereira, Cláudia Maria; Gomez, Ricardo Santiago

2013-04-01

Interferon-γ plays an important role in the pathogenesis of periapical lesions, and the methylation of IFNG has been associated with transcriptional inactivation. The purpose of the present study was to investigate IFNG promoter methylation in association with gene transcription and protein levels in periapical granulomas and radicular cysts. Methylation-specific polymerase chain reaction was used to assess the DNA methylation pattern of the IFNG gene in 16 periapical granulomas and 13 radicular cyst samples. The transcription levels of IFNG mRNA were verified by quantitative real-time polymerase chain reaction, and protein expression was evaluated by immunohistochemistry. All the periapical lesion samples exhibited partial or total methylation of the IFNG gene. In addition, an increased methylation profile was found in radicular cysts compared with periapical granulomas. Increased IFNG mRNA expression was observed in the partially methylated periapical lesion samples relative to the samples that were completely methylated. The present study provides the first evidence of the possible impact of IFNG methylation on IFNG transcription in periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Water avoidance stress induces frequency through cyclooxygenase-2 expression: a bladder rat model.

PubMed

Yamamoto, Keisuke; Takao, Tetsuya; Nakayama, Jiro; Kiuchi, Hiroshi; Okuda, Hidenobu; Fukuhara, Shinichiro; Yoshioka, Iwao; Matsuoka, Yasuhiro; Miyagawa, Yasushi; Tsujimura, Akira; Nonomura, Norio

2012-02-01

Water avoidance stress is a potent psychological stressor and it is associated with visceral hyperalgesia, which shows degeneration of the urothelial layer mimicking interstitial cystitis. Cyclooxygenase-2 inhibitors have been recognized to ameliorate frequency both in clinical and experimental settings. We investigated the voiding pattern and cyclooxygenase-2 expression in a rat bladder model of water avoidance stress. After being subjected to water avoidance stress or a sham procedure, rats underwent metabolic cage analysis and cystometrography. Real time reverse transcription polymerase chain reaction was carried out to examine cyclooxygenase-2 messenger ribonucleic acid in bladders of rats. Protein expression of cyclooxygenase-2 was analyzed with immunohistochemistry and western blotting. Furthermore, the effects of the cyclooxygenase-2 inhibitor, etodolac, were investigated by carrying out cystometrography, immunohistochemistry and western blotting. Metabolic cage analysis and cystometrography showed significantly shorter intervals and less volume of voiding in water avoidance stress rats. Significantly higher expression of cyclooxygenase-2 messenger ribonucleic acid was verified by reverse transcription polymerase chain reaction. Immunohistochemistry and western blotting showed significantly higher cyclooxygenase-2 protein levels in water avoidance stress bladders. Furthermore, immunohistochemistry showed high cyclooxygenase-2 expression exclusively in smooth muscle cells. All water avoidance stress-induced changes were reduced by cyclooxygenase-2 inhibitor pretreatment. Chronic stress might cause frequency through cyclooxygenase-2 gene upregulation in bladder smooth muscle cells. Further study of cyclooxygenase-2 in the water avoidance stress bladder might provide novel therapeutic modalities for interstitial cystitis. © 2011 The Japanese Urological Association.

Ginsenoside Rg3 up-regulates the expression of vascular endothelial growth factor in human dermal papilla cells and mouse hair follicles.

PubMed

Shin, Dae Hyun; Cha, Youn Jeong; Yang, Kyeong Eun; Jang, Ik-Soon; Son, Chang-Gue; Kim, Bo Hyeon; Kim, Jung Min

2014-07-01

Crude Panax ginseng has been documented to possess hair growth activity and is widely used to treat alopecia, but the effects of ginsenoside Rg3 on hair growth have not to our knowledge been determined. The aim of the current study was to identify the molecules through which Rg3 stimulates hair growth. The thymidine incorporation for measuring cell proliferation was determined. We used DNA microarray analysis to measure gene expression levels in dermal papilla (DP) cells upon treatment with Rg3. The mRNA and protein expression levels of vascular endothelial growth factor (VEGF) in human DP cells were measured by real-time polymerase chain reaction and immunohistochemistry, respectively. We also used immunohistochemistry assays to detect in vivo changes in VEGF and 3-stemness marker expressions in mouse hair follicles. Reverse transcription polymerase chain reaction showed dose-dependent increases in VEGF mRNA levels on treatment with Rg3. Immunohistochemical analysis showed that expression of VEGF was significantly up-regulated by Rg3 in a dose-dependent manner in human DP cells and in mouse hair follicles. In addition, the CD8 and CD34 were also up-regulated by Rg3 in the mouse hair follicles. It may be concluded that Rg3 might increase hair growth through stimulation of hair follicle stem cells and it has the potential to be used in hair growth products. Copyright © 2013 John Wiley & Sons, Ltd.

Alcoholytic Cleavage of Polyhydroxyalkanoate Chains by Class IV Synthases Induced by Endogenous and Exogenous Ethanol

PubMed Central

Hyakutake, Manami; Tomizawa, Satoshi; Mizuno, Kouhei; Abe, Hideki

2014-01-01

Polyhydroxyalkanoate (PHA)-producing Bacillus strains express class IV PHA synthase, which is composed of the subunits PhaR and PhaC. Recombinant Escherichia coli expressing PHA synthase from Bacillus cereus strain YB-4 (PhaRCYB-4) showed an unusual reduction of the molecular weight of PHA produced during the stationary phase of growth. Nuclear magnetic resonance analysis of the low-molecular-weight PHA revealed that its carboxy end structure was capped by ethanol, suggesting that the molecular weight reduction was the result of alcoholytic cleavage of PHA chains by PhaRCYB-4 induced by endogenous ethanol. This scission reaction was also induced by exogenous ethanol in both in vivo and in vitro assays. In addition, PhaRCYB-4 was observed to have alcoholysis activity for PHA chains synthesized by other synthases. The PHA synthase from Bacillus megaterium (PhaRCBm) from another subgroup of class IV synthases was also assayed and was shown to have weak alcoholysis activity for PHA chains. These results suggest that class IV synthases may commonly share alcoholysis activity as an inherent feature. PMID:24334666

Elevated AQP1 Expression Is Associated With Unfavorable Oncologic Outcome in Patients With Hilar Cholangiocarcinoma.

PubMed

Li, Chunxiang; Li, Xiaofu; Wu, Linfeng; Jiang, Zheng

2017-08-01

Hilar cholangiocarcinomas are malignant tumors with a poor prognosis. An early prediction of prognosis for patients may help us determine treatment strategies. Aquaporin 1 is a cell membrane channel involved in water transport, cell motility, and proliferation. Increasing evidences showed that aquaporin 1 played a role in tumor prognosis and diagnosis. The purpose of this study is to evaluate the role of aquaporin 1 in hilar cholangiocarcinoma. Here, we analyzed messenger RNA expression data of genes function as bile secretion in a data set of 169 samples using the R2 bioinformatic platform ( http://r2.amc.nl ). Quantitative polymerase chain reaction was performed to verify the gene expression in 17 hilar cholangiocarcinoma samples. Immunohistochemistry was also performed in a series of specimens from 62 hilar cholangiocarcinoma tissues, and its clinical significance was assessed by clinical correlation and Kaplan-Meier analyses. All data were analyzed using the R2 web application, aquaporin 1 was selected for further analysis. The significant expression variation of aquaporin 1 among 17 cases with cholangiocarcinoma was also found using quantitative polymerase chain reaction. The expression level of aquaporin 1 protein significantly correlated with tumor-node-metastasis stage ( P = .002) and overall survival time ( P = .010). Higher aquaporin 1 expression indicated poor prognostic outcomes ( P <.05, log-rank test). Multivariate analysis also showed strong aquaporin 1 protein expression was an independent adverse prognosticator in hilar cholangiocarcinoma ( P = .002). This study highlighted the prognostic value of aquaporin 1 in hilar cholangiocarcinoma. Strong aquaporin 1 expression predicts poor survival, regardless of pathological features. Immunohistochemical detection of aquaporin 1, as a prognostic marker, may contribute to predicting clinical outcome for patients with hilar cholangiocarcinoma.

Transcription of G-protein coupled receptors in corporeal smooth muscle is regulated by the endogenous neutral endopeptidase inhibitor sialorphin.

PubMed

Tong, Yuehong; Tiplitsky, Scott I; Tar, Moses; Melman, Arnold; Davies, Kelvin P

2008-08-01

Several reports suggest that the rat Vcsa1 gene is down-regulated in models of erectile dysfunction. The Vcsa protein product sialorphin is an endogenous neutral endopeptidase inhibitor and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated whether Vcsa1 down-regulation could result in an adaptive change in GPCR (G-protein coupled receptor) expression. Gene expression in cultured rat corporeal smooth muscle cells following treatment with siRNA directed against Vcsa1 or the neutral endopeptidase gene was analyzed using microarray and quantitative reverse transcriptase-polymerase chain reaction. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernous nerves. In that animal model we also investigated whether Vcsa1 down-regulation was accompanied by similar changes in gene expression in corporeal smooth muscle cells in which Vcsa1 was knocked down in vitro. Microarray analysis and quantitative reverse transcriptase-polymerase chain reaction demonstrated that corporeal smooth muscle cells treated in vitro with siRNA against Vcsa1 resulted in GPCR up-regulation as a functional group. In contrast, treatment of corporeal smooth muscle cells that lowered neutral endopeptidase activity resulted in decreased GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on neutral endopeptidase. In animals with bilaterally transected cavernous nerves the decreased Vcsa1 expression is accompanied by increased GPCR expression in cavernous tissue. These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression.

Expression characteristics of long noncoding RNA uc.322 and its effects on pancreatic islet function.

PubMed

Zhao, Xiaoqin; Rong, Can; Pan, Fenghui; Xiang, Lizhi; Wang, Xinlei; Hu, Yun

2018-06-28

Increasing evidence indicates that long noncoding RNAs (lncRNAs) perform special biological functions by regulating gene expression through multiple pathways and molecular mechanisms. The aim of this study was to explore the expression characteristics of lncRNA uc.322 in pancreatic islet cells and its effects on the secretion function of islet cells. Bioinformatics analysis was used to detect the lncRNA uc.322 sequence, location, and structural features. Expression of lncRNA uc.322 in different tissues was detected by quantitative polymerase chain reaction analyses. Quantitative polymerase chain reaction, Western blot analysis, adenosine triphosphate determination, glucose-stimulated insulin secretion, and enzyme-linked immunosorbent assay were used to evaluate the effects of lncRNA uc.322 on insulin secretion. The results showed that the full-length of lncRNA uc.322 is 224 bp and that it is highly conserved in various species. Bioinformatics analysis revealed that lncRNA uc.322 is located on chr7:122893196-122893419 (GRCH37/hg19) within the SRY-related HMG-box 6 gene exon region. Compared with other tissues, lncRNA uc.322 is highly expressed in pancreatic tissue. Upregulation of lncRNA uc.322 expression increases the insulin transcription factors pancreatic and duodenal homeobox 1 and Forkhead box O1 expression, promotes insulin secretion in the extracellular fluid of Min6 cells, and increases the adenosine triphosphate concentration. On the other hand, knockdown of lncRNA uc.322 has opposite effects on Min6 cells. Overall, this study showed that upregulation of lncRNA uc.322 in islet β-cells can increase the expression of insulin transcription factors and promote insulin secretion, and it may be a new therapeutic target for diabetes. © 2018 Wiley Periodicals, Inc.

Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

PubMed Central

Duan, L; Pomerantz, R J

1994-01-01

The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

64Cu-DOTATATE PET/MRI for Detection of Activated Macrophages in Carotid Atherosclerotic Plaques: Studies in Patients Undergoing Endarterectomy.

PubMed

Pedersen, Sune Folke; Sandholt, Benjamin Vikjær; Keller, Sune Høgild; Hansen, Adam Espe; Clemmensen, Andreas Ettrup; Sillesen, Henrik; Højgaard, Liselotte; Ripa, Rasmus Sejersten; Kjær, Andreas

2015-07-01

A feature of vulnerable atherosclerotic plaques of the carotid artery is high activity and abundance of lesion macrophages. There is consensus that this is of importance for plaque vulnerability, which may lead to clinical events, such as stroke and transient ischemic attack. We used positron emission tomography (PET) and the novel PET ligand [(64)Cu] [1,4,7,10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid]-d-Phe1,Tyr3-octreotate ((64)Cu-DOTATATE) to specifically target macrophages via the somatostatin receptor subtype-2 in vivo. Ten patients underwent simultaneous PET/MRI to measure (64)Cu-DOTATATE uptake in carotid artery plaques before carotid endarterectomy. (64)Cu-DOTATATE uptake was significantly higher in symptomatic plaque versus the contralateral carotid artery (P<0.001). Subsequently, a total of 62 plaque segments were assessed for gene expression of selected markers of plaque vulnerability using real-time quantitative polymerase chain reaction. These results were compared with in vivo (64)Cu-DOTATATE uptake calculated as the mean standardized uptake value. Univariate analysis of real-time quantitative polymerase chain reaction and PET showed that cluster of differentiation 163 (CD163) and CD68 gene expression correlated significantly but weakly with mean standardized uptake value in scans performed 85 minutes post injection (P<0.001 and P=0.015, respectively). Subsequent multivariate analysis showed that CD163 correlated independently with (64)Cu-DOTATATE uptake (P=0.031) whereas CD68 did not contribute significantly to the final model. The novel PET tracer (64)Cu-DOTATATE accumulates in atherosclerotic plaques of the carotid artery. CD163 gene expression correlated independently with (64)Cu-DOTATATE uptake measured by real-time quantitative polymerase chain reaction in the final multivariate model, indicating that (64)Cu-DOTATATE PET is detecting alternatively activated macrophages. This association could potentially improve noninvasive identification and characterization of vulnerable plaques. © 2015 The Authors.

Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

PubMed Central

Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

2014-01-01

Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

Comparison of quantitative real-time polymerase chain reaction with NanoString® methodology using adipose and liver tissues from rats fed seaweed.

PubMed

Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman

2016-05-25

Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

PubMed

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

A common active site of polyhydroxyalkanoate synthase from Bacillus cereus YB-4 is involved in polymerization and alcoholysis reactions.

PubMed

Hyakutake, Manami; Tomizawa, Satoshi; Mizuno, Kouhei; Hisano, Tamao; Abe, Hideki; Tsuge, Takeharu

2015-06-01

Polyhydroxyalkanoate (PHA) synthase from Bacillus cereus YB-4 (PhaRCYB4) catalyzes not only PHA polymerization but also alcoholytic cleavage of PHA chains. The alcoholysis activity of PhaRCYB4 is expressed when a hydroxyacyl-CoA monomer is absent but an alcohol compound is present. In this study, we performed alanine mutagenesis of the putative catalytic triad (Cys(151), Asp(306), and His(335)) in the PhaCYB4 subunit to identify the active site residues for polymerization and alcoholysis activities. Individual substitution of each triad residue with alanine resulted in loss of both polymerization and alcoholysis activities, suggesting that these residues are commonly shared between polymerization and alcoholysis reactions. The loss of activity was also observed following mutagenesis of the triad to other amino acids, except for one PhaRCYB4 mutant with a C151S substitution, which lost polymerization activity but still possessed cleavage activity towards PHA chains. The low-molecular-weight PHA isolated from the PhaRCYB4(C151S)-expressing strain showed a lower ratio of alcohol capping at the P(3HB) carboxy terminus than did that from the wild-type-expressing strain. This observation implies that hydrolysis activity of PhaRCYB4 might be elicited by the C151S mutation.

Simple model of inhibition of chain-branching combustion processes

NASA Astrophysics Data System (ADS)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

DTIC Science & Technology

1992-10-01

indicated a high degree of SSC buffer (1x SSC is 0.15 M NaC! plus 0.015 M sodium conservation at the amino terminus of the protein (20). We citrate...Guerry, P., S. M. Logan, S. A. Thornton, and T. J. Trust. 1990. American Society for Microbiology, Washington, D.C. Genomic organization and expression of...Probes 4:261-271. 1981. Construction and expression of recombinant plasmids 36. Taylor, D. N. 1991. Campylobacter infections in developing encoding type 1

Mitochondrial Gene Cytochrome b Developmental and Environmental Expression in Aedes aegypti (Diptera: Culicidae)

DTIC Science & Technology

2009-11-01

Culicidae), a primary vector of dengue and yellow fever viruses, has not been explored. By using real- time quantitative polymerase chain reaction (qPCR...pesticide) on AeaCytB gene expression. Taken together, these results suggest thatAeaCytB gene plays an important role in the development of Ae. aegypti...2and 9 d old) were exposed to three temperatures (24, 37, and 40C) and 56 1.5% RH in an environmental chamber (L-C incubator, Lab-Line Instruments

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Oxytetracycline induces DNA damage and epigenetic changes: a possible risk for human and animal health?

PubMed

Gallo, Adriana; Landi, Rosaria; Rubino, Valentina; Di Cerbo, Alessandro; Giovazzino, Angela; Palatucci, Anna Teresa; Centenaro, Sara; Guidetti, Gianandrea; Canello, Sergio; Cortese, Laura; Ruggiero, Giuseppina; Alessandrini, Andrea; Terrazzano, Giuseppe

2017-01-01

Oxytetracycline (OTC), which is largely employed in zootechnical and veterinary practices to ensure wellness of farmed animals, is partially absorbed within the gastrointestinal tract depositing in several tissues. Therefore, the potential OTC toxicity is relevant when considering the putative risk derived by the entry and accumulation of such drug in human and pet food chain supply. Despite scientific literature highlights several OTC-dependent toxic effects on human and animal health, the molecular mechanisms of such toxicity are still poorly understood. Here, we evaluated DNA damages and epigenetic alterations by quantitative reverse transcription polymerase chain reaction, quantitative polymerase chain reaction, chromatin immuno-precipitation and Western blot analysis. We observed that human peripheral blood mononuclear cells (PBMCs) expressed DNA damage features (activation of ATM and p53, phosphorylation of H2AX and modifications of histone H3 methylation of lysine K4 in the chromatin) after the in vitro exposure to OTC. These changes are linked to a robust inflammatory response indicated by an increased expression of Interferon (IFN)- γ and type 1 superoxide dismutase (SOD1). Our data reveal an unexpected biological in vitro activity of OTC able to modify DNA and chromatin in cultured human PBMC. In this regard, OTC presence in foods of animal origin could represent a potential risk for both the human and animal health.

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

High-throughput assay for long chain fatty acyl-CoA elongase using homogeneous scintillation proximity format.

PubMed

Shimamura, Ken; Miyamoto, Yasuhisa; Kitazawa, Hidefumi; Kobayashi, Tsutomu; Kotani, Hidehito; Tokita, Shigeru

2009-04-01

Elongase of very-long-chain fatty acid (Elovl) 6 is a rate-limiting enzyme that is responsible for the elongation of long-chain fatty acids such as palmitoic acid (C16). Elovl6 is abundantly expressed in liver and adipose tissue, and the expression levels in these tissues are up-regulated in obese animals. Furthermore, Elovl6-deficient mice display improved glucose homeostasis and insulin sensitivity, suggesting that Elovl6 might be a potential therapeutic target for metabolic disorders. From the drug discovery point of view, it is critical to establish a high-throughput screening (HTS) assay for the identification of therapeutic agents. Conventional assay methods for fatty acid elongases include an extraction step for respective radioactive products from the reaction mixtures, which is labor-intensive and not feasible for HTS. In this study, we utilized the acyl-coenzyme A (CoA) binding protein (ACBP) as a molecular probe to detect radioactive long-chain acyl-CoA, a direct product of Elovl6. Recombinant ACBP binds stearoyl-CoA but not malonyl-CoA, enabling specific detection of the radioactive product in the homogenous reaction mixture without the liquid extraction step. Finally, combination of ACBP and scintillation proximity assay beads led to specific detection of Elovl6 activity with appropriate window and reproducibility amenable to HTS (signal-to-background noise ratio of approximately 13.0-fold, Z' = 0.85). The assay system described here has the potential to enable identification of small compounds that modify fatty acid elongase activity and assessment of the therapeutic potential of acyl-CoA elongases.

Development of recombinant canine adenovirus type-2 expressing the Gn glycoprotein of Seoul virus.

PubMed

Yuan, Ziguo; Zhang, Xiuxiang; Zhang, Shoufeng; Liu, Ye; Gao, Shengyan; Zhang, Fei; Xu, Huijuan; Wang, Xiaohu; Hu, Rongliang

2008-05-01

Seoul virus glycoprotein Gn is a major structural protein and candidate antigen of hantavirus that induces a highly immunogenic response for hantavirus vaccine. In this study, a replication-competent recombinant canine adenovirus type-2 expressing Gn was constructed by the in vitro ligation method. The Gn expression cassette, including the human cytomegalovirus (hCMV) promoter/enhancer and the SV40 early mRNA polyadenylation signal, was cloned into the SspI site of the E3 region which is not essential for proliferation of CAV-2. Expression of Gn was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting.

A novel monoclonal antibody, C41, reveals IL-13Ralpha1 expression by murine germinal center B cells and follicular dendritic cells.

PubMed

Poudrier, J; Graber, P; Herren, S; Berney, C; Gretener, D; Kosco-Vilbois, M H; Gauchat, J F

2000-11-01

Responsiveness to IL-13 involves at least two chains, IL-4Ralpha and IL-13Ralpha1. Although mouse B cells express IL-4Ralpha, little is known about their expression of IL-13Ralpha chains. To investigate this topic further, we have generated a monoclonal antibody (C41) specific for murine IL-13Ralpha1. Using C41, IL-13Ralpha1 expression was detected on germinal center (GC) B cells by flow cytometry and immunohistochemistry. In addition, IL-13Ralpha1 was observed on follicular dendritic cells, but not interdigitating dendritic cells in the T cell areas. Furthermore, resting B cells also expressed IL-13Ralpha1, and in the presence of IL-13 produced increased amounts of IgM in response to in vitro CD40 stimulation. However, C41 was unable to neutralize this bioactivity. The distribution of IL-13Ralpha1 on murine B cells and during GC reactions suggests a role for IL-13 during B cell differentiation.

Tools to minimize interlaboratory variability in vitellogenin gene expression monitoring programs

USGS Publications Warehouse

Jastrow, Aaron; Gordon, Denise A.; Auger, Kasie M.; Punska, Elizabeth C.; Arcaro, Kathleen F.; Keteles, Kristen; Winkelman, Dana L.; Lattier, David; Biales, Adam; Lazorchak, James M.

2017-01-01

The egg yolk precursor protein vitellogenin is widely used as a biomarker of estrogen exposure in male fish. However, standardized methodology is lacking and little is known regarding the reproducibility of results among laboratories using different equipment, reagents, protocols, and data analysis programs. To address this data gap we tested the reproducibility across laboratories to evaluate vitellogenin gene (vtg) expression and assessed the value of using a freely available software data analysis program. Samples collected from studies of male fathead minnows (Pimephales promelas) exposed to 17α-ethinylestradiol (EE2) and minnows exposed to processed wastewater effluent were evaluated for vtg expression in 4 laboratories. Our results indicate reasonable consistency among laboratories if the free software for expression analysis LinRegPCR is used, with 3 of 4 laboratories detecting vtg in fish exposed to 5 ng/L EE2 (n = 5). All 4 laboratories detected significantly increased vtg levels in 15 male fish exposed to wastewater effluent compared with 15 male fish held in a control stream. Finally, we were able to determine that the source of high interlaboratory variability from complementary deoxyribonucleic acid (cDNA) to quantitative polymerase chain reaction (qPCR) analyses was the expression analysis software unique to each real-time qPCR machine. We successfully eliminated the interlaboratory variability by reanalyzing raw fluorescence data with independent freeware, which yielded cycle thresholds and polymerase chain reaction (PCR) efficiencies that calculated results independently of proprietary software. Our results suggest that laboratories engaged in monitoring programs should validate their PCR protocols and analyze their gene expression data following the guidelines established in the present study for all gene expression biomarkers. 

Study on relationship between expression level and molecular conformations of gene drugs targeting to hepatoma cells in vitro

PubMed Central

Yang, Dong-Ye; Lu, Fang-Gen; Tang, Xi-Xiang; Zhao, Shui-Ping; Ouyang, Chun-Hui; Wu, Xiao-Ping; Liu, Xiao-Wei; Wu, Xiao-Ying

2003-01-01

AIM: To increase exogenous gene expression level by modulating molecular conformations of targeting gene drugs. METHODS: The full length cDNAs of both P40 and P35 subunits of human interleukin 12 were amplified through polymerase chain reaction (PCR) and cloned into eukaryotic expressing vectors pcDNA3.1 (±) to construct plasmids of P (+)/IL-12, P (+)/P40 and P (-)/P35. These plasmids were combined with ASOR-PLL to form two targeting gene drugs [ASOR-PLL-P (+)/IL-12 and ASOR-PLL-P (+)/P40 + ASOR-PLL-P (-)/P35] in optimal ratios. The conformations of these two drugs at various concentrations adjuvant were examined under electron microscope (EM) and the drugs were transfected into HepG2 (ASGr+) cells. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed with total RNA extracted from the transfected cells to determine the hIL12 mRNA transcript level. The hIL12 protein in the cultured supernatant was measured with enzyme-linked immunosorbent assay (ELISA) 48 hours after transfection. RESULTS: Targeting gene drugs, whose structures were granular and circle-like and diameters ranged from 25 nm to 150 nm, had the highest hIL-12 expression level. The hIL-12 expression level in the group co-transfected with ASOR-PLL-P (+)/P40 and ASOR-PLL-P (-)/P35 was higher than that of ASOR-PLL-P (+)/IL-12 transfected group. CONCLUSION: The molecular conformations of targeting gene drugs play an important role in exogenous gene expression level, the best structures are granular and circle-like and their diameters range from 25 nm to 150 nm. The sizes and linking styles of exogenous genes also have some effects on their expression level. PMID:12970883

High expression of long noncoding RNA NORAD indicates a poor prognosis and promotes clinical progression and metastasis in bladder cancer.

PubMed

Li, Qiaqia; Li, Chao; Chen, Jinbo; Liu, Peihua; Cui, Yu; Zhou, Xinyi; Li, Huihuang; Zu, Xiongbing

2018-06-01

To explore the function of NORAD in bladder cancer (BC), and to verify whether NORAD could be used as a biomarker to determine preoperative presence of progression and lymph node metastasis. To our knowledge, it is the first study investigating NORAD and its implications in BC. BC specimens of 90 patients underwent bladder cystectomy or transurethral resection between January 2012 to December 2016 were tested by fluorescence in situ hybridization. The association between NORAD expression and clinicopathological features and prognosis of the patients was analyzed using Kaplan-Meier survival analysis and Cox regression analysis. Quantitative real-time polymerase chain reaction was performed in 4 BC cell lines and 10 fresh tumor sample together with adjacent tissues. MTT, colony formation assay, and Annexin-V apoptosis detection were performed after knockdown of NORAD using shRNA in TSSCUP cells. Western blot was performed to related proteins extracted from these cells. Fluorescence in situ hybridization indicated that high NORAD expression was associated with more advanced histological grade and clinical stage for patients with BC. Higher NORAD expression resulted in lower overall survival, and was an independent prognostic indicator. Real-time polymerase chain reaction showed that the expression of NORAD in BC tissues was higher than those measured in adjacent normal tissues. MTT and colony formation assay demonstrated that knockdown of NORAD results in lower proliferation in TSSCUP cells, whereas PUM2 expression was upregulated and E2F3 downregulated. High NORAD expression could serve as an independent prognostic factor for overall survival of patients with transitional BC. NORAD could be considered as a promising candidate for novel biomarker and therapeutic target for human BC. Copyright © 2018 Elsevier Inc. All rights reserved.

Microfluidics-Based PCR for Fusion Transcript Detection.

PubMed

Chen, Hui

2016-01-01

The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

[Effect of Leonurus Heterophyllus Sweet on tissue factor transcription and expression in human umbilical vein endothelial cells in vitro].

PubMed

Zheng, Lian; Fang, Chi-hua

2007-06-01

To investigate the effect of Leonurus Heterophyllus Sweet, (LHS) on tissue factor (TF) transcription and expression induced by thrombin in human umbilical vein endothelial cells (HUVECs). HUVECs were incubated with different concentrations of LHS and the TF mRNA expression was detected by reverse transcript-polymerase chain reaction (RT-PCR). LHS treatment of HUVECs at different concentrations and for different times resulted in significant differences in TF expression (Plt;0.01). The transcription of TF in LHS-treated cells was significantly different from that of the blank control group (Plt;0.01). LHS can decrease the expression of TF and intervene with TF transcription in HUVECs in vitro.

The fate of Helicobacter pylori phagocytized by Acanthamoeba polyphaga demonstrated by fluorescent in situ hybridization and quantitative polymerization chain reaction tests

EPA Science Inventory

Helicobacter pylori able to express green fluorescent protein, as well as an ATCC strain, and a clinical isolate of this pathogen were evaluated for their ability to survive predation by Acanthamoeba polyphaga. Ingestion was evaluated by microscopic observation of the GFP-H. pyl...

ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

PubMed

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

Branched chain amino acid suppressed insulin-initiated proliferation of human cancer cells through induction of autophagy.

PubMed

Wubetu, Gizachew Yismaw; Utsunomiya, Tohru; Ishikawa, Daichi; Ikemoto, Tetsuya; Yamada, Shinichiro; Morine, Yuji; Iwahashi, Shuichi; Saito, Yu; Arakawa, Yusuke; Imura, Satoru; Arimochi, Hideki; Shimada, Mitsuo

2014-09-01

Branched chain amino acid (BCAA) dietary supplementation inhibits activation of the insulin-like growth factor (IGF)/IGF-I receptor (IGF-IR) axis in diabetic animal models. However, the in vitro effect of BCAA on human cancer cell lines under hyper-insulinemic conditions remains unclear. Colon (HCT-116) and hepatic (HepG2) tumor cells were treated with varying concentrations of BCAA with or without fluorouracil (5-FU). The effect of BCAA on insulin-initiated proliferation was determined. Gene and protein expression was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting, respectively. BCAA supplementation had no significant effect on cell proliferation and did not show significant synergistic or antagonistic effects with 5-FU. However, BCAA significantly decreased insulin-initiated proliferation of human colon and hepatic cancer cell lines in vitro. BCAA supplementation caused a marked decrease in activated IGF-IR expression and significantly enhanced both mRNA and protein expression of LC3-II and BECN1 (BECLIN-1). BCAA could be a useful chemopreventive modality for cancer in hyperinsulinemic conditions. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Expression of myosin heavy chain isoforms mRNA transcripts in the temporalis muscle of common chimpanzees (Pan troglodytes).

PubMed

Ciurana, Neus; Artells, Rosa; Muñoz, Carmen; Arias-Martorell, Júlia; Bello-Hellegouarch, Gaëlle; Casado, Aroa; Cuesta, Elisabeth; Pérez-Pérez, Alejandro; Pastor, Juan Francisco; Potau, Josep Maria

2017-11-01

The common chimpanzee (Pan troglodytes) is the primate that is phylogenetically most closely related to humans (Homo sapiens). In order to shed light on the anatomy and function of the temporalis muscle in the chimpanzee, we have analyzed the expression patterns of the mRNA transcripts of the myosin heavy chain (MyHC) isoforms in different parts of the muscle. We dissected the superficial, deep and sphenomandibularis portions of the temporalis muscle in five adult P. troglodytes and quantified the expression of the mRNA transcripts of the MyHC isoforms in each portion using real-time quantitative polymerase chain reaction. We observed significant differences in the patterns of expression of the mRNA transcripts of the MyHC-IIM isoform between the sphenomandibularis portion and the anterior superficial temporalis (33.6% vs 47.0%; P=0.032) and between the sphenomandibularis portion and the anterior deep temporalis (33.6% vs 43.0; P=0.016). We also observed non-significant differences between the patterns of expression in the anterior and posterior superficial temporalis. The differential expression patterns of the mRNA transcripts of the MyHC isoforms in the temporalis muscle in P. troglodytes may be related to the functional differences that have been observed in electromyographic studies in other species of primates. Our findings can be applicable to the fields of comparative anatomy, evolutionary anatomy, and anthropology. Copyright © 2017 Elsevier GmbH. All rights reserved.

Modifying a standard method allows simultaneous extraction of RNA and protein, enabling detection of enzymes in the rat retina with low expressions and protein levels.

PubMed

Agardh, Elisabet; Gustavsson, Carin; Hagert, Per; Nilsson, Marie; Agardh, Carl-David

2006-02-01

The aim of the study was to evaluate messenger RNA and protein expression in limited amounts of tissue with low protein content. The Chomczynski method was used for simultaneous extraction of RNA, and protein was modified in the protein isolation step. Template mass and cycling time for the complementary DNA synthesis step of real-time reverse transcription-polymerase chain reaction (RT-PCR) for analysis of catalase, copper/zinc superoxide dismutase, manganese superoxide dismutase, the catalytic subunit of glutamylcysteine ligase, glutathione peroxidase 1, and the endogenous control cyclophilin B (CypB) were optimized before PCR. Polymerase chain reaction accuracy and efficacy were demonstrated by calculating the regression (R2) values of the separate amplification curves. Appropriate antibodies, blocking buffers, and running conditions were established for Western blot, and protein detection and multiplex assays with CypB were performed for each target. During the extraction procedure, the protein phase was dissolved in a modified washing buffer containing 0.1% sodium dodecyl sulfate, followed by ultrafiltration. Enzyme expression on real-time RT-PCR was accomplished with high reliability and reproducibility (R2, 0.990-0.999), and all enzymes except for glutathione peroxidase 1 were detectable in individual retinas on Western blot. Western blot multiplexing with CypB was possible for all targets. In conclusion, connecting gene expression directly to protein levels in the individual rat retina was possible by simultaneous extraction of RNA and protein. Real-time RT-PCR and Western blot allowed accurate detection of retinal protein expressions and levels.

Cloning and Expression Analysis of a PISTILLATA Homologous Gene from Pineapple (Ananas comosus L. Merr)

PubMed Central

Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

2012-01-01

PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. PMID:22312303

Cloning and expression analysis of a PISTILLATA homologous gene from pineapple (Ananas comosus L. Merr).

PubMed

Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

2012-01-01

PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants.

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

PubMed

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Quercetin improves postpartum hypogalactia in milk-deficient mice via stimulating prolactin production in pituitary gland.

PubMed

Lin, Man; Wang, Na; Yao, Bei; Zhong, Yao; Lin, Yan; You, Tianhui

2018-04-19

Postpartum dysgalactia is a common clinical problem for lactating women. Seeking out the safe and efficient phytoestrogens will be a promising strategy for postpartum dysgalactia therapy. In this study, the postpartum mice within four groups, including control group, the model group, and the treatment groups intragastrically administrated with normal saline, bromocriptine, bromocriptine plus 17α-ethinyl estradiol, and bromocriptine plus quercetin, respectively, were used. The results showed that quercetin, a kind of natural phytoestrogen, could efficiently promote lactation yield and mammary gland development in the agalactosis mice produced by bromocriptine administration. Mechanically, quercetin, such as 17α-ethinyl estradiol, significantly stimulated prolactin (PRL) production and deposition in the mammary gland in the agalactosis mice determined by western blotting, quantitative polymerase chain reaction, and enzyme-linked immunosorbent assay, respectively. Furthermore, quercetin could increase the expression of β-casein, stearoyl-CoA desaturase, fatty acid synthase, and α-lactalbumin in the breast tissues that are responsible for the production of fatty acid, lactose, and galactose in the milk at the transcriptional level determined by quantitative polymerase chain reaction. Specifically, quercetin promoted primary mammary epithelial cell proliferation and stimulated prolactin receptor (PRLR) expression probably via AKT activation in vitro. In conclusion, this study indicates that estrogen-like quercetin promotes mammary gland development and lactation yield in milk-deficient mice, probably via stimulating PRL expression and release from the pituitary gland, as well as induces PRLR expression in primary mammary epithelial cells. Copyright © 2018 John Wiley & Sons, Ltd.

Glycosyltransferases as marker genes for the quantitative polymerase chain reaction-based detection of circulating tumour cells from blood samples of patients with breast cancer undergoing adjuvant therapy.

PubMed

Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich

2015-08-01

Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.

The Glyoxylate Cycle in an Arbuscular Mycorrhizal Fungus. Carbon Flux and Gene Expression

PubMed Central

Lammers, Peter J.; Jun, Jeongwon; Abubaker, Jehad; Arreola, Raul; Gopalan, Anjali; Bago, Berta; Hernandez-Sebastia, Cinta; Allen, James W.; Douds, David D.; Pfeffer, Philip E.; Shachar-Hill, Yair

2001-01-01

The arbuscular mycorrhizal (AM) symbiosis is responsible for huge fluxes of photosynthetically fixed carbon from plants to the soil. Lipid, which is the dominant form of stored carbon in the fungal partner and which fuels spore germination, is made by the fungus within the root and is exported to the extraradical mycelium. We tested the hypothesis that the glyoxylate cycle is central to the flow of carbon in the AM symbiosis. The results of 13C labeling of germinating spores and extraradical mycelium with 13C2-acetate and 13C2-glycerol and analysis by nuclear magnetic resonance spectroscopy indicate that there are very substantial fluxes through the glyoxylate cycle in the fungal partner. Full-length sequences obtained by polymerase chain reaction from a cDNA library from germinating spores of the AM fungus Glomus intraradices showed strong homology to gene sequences for isocitrate lyase and malate synthase from plants and other fungal species. Quantitative real-time polymerase chain reaction measurements show that these genes are expressed at significant levels during the symbiosis. Glyoxysome-like bodies were observed by electron microscopy in fungal structures where the glyoxylate cycle is expected to be active, which is consistent with the presence in both enzyme sequences of motifs associated with glyoxysomal targeting. We also identified among several hundred expressed sequence tags several enzymes of primary metabolism whose expression during spore germination is consistent with previous labeling studies and with fluxes into and out of the glyoxylate cycle. PMID:11706207

NanoString nCounter® Approach in Breast Cancer: A Comparative Analysis with Quantitative Real-Time Polymerase Chain Reaction, In Situ Hybridization, and Immunohistochemistry.

PubMed

Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon

2017-09-01

Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.

Expression of Biglycan in First Trimester Chorionic Villous Sampling Placental Samples and Altered Function in Telomerase-Immortalized Microvascular Endothelial Cells.

PubMed

Chui, Amy; Gunatillake, Tilini; Brennecke, Shaun P; Ignjatovic, Vera; Monagle, Paul T; Whitelock, John M; van Zanten, Dagmar E; Eijsink, Jasper; Wang, Yao; Deane, James; Borg, Anthony J; Stevenson, Janet; Erwich, Jan Jaap; Said, Joanne M; Murthi, Padma

2017-06-01

Biglycan (BGN) has reduced expression in placentae from pregnancies complicated by fetal growth restriction (FGR). We used first trimester placental samples from pregnancies with later small for gestational age (SGA) infants as a surrogate for FGR. The functional consequences of reduced BGN and the downstream targets of BGN were determined. Furthermore, the expression of targets was validated in primary placental endothelial cells isolated from FGR or control pregnancies. APPROACH AND RESULTS: BGN expression was determined using real-time polymerase chain reaction in placental tissues collected during chorionic villous sampling performed at 10 to 12 weeks' gestation from pregnancies that had known clinical outcomes, including SGA. Short-interference RNA reduced BGN expression in telomerase-immortalized microvascular endothelial cells, and the effect on proliferation, angiogenesis, and thrombin generation was determined. An angiogenesis array identified downstream targets of BGN, and their expression in control and FGR primary placental endothelial cells was validated using real-time polymerase chain reaction. Reduced BGN expression was observed in SGA placental tissues. BGN reduction decreased network formation of telomerase-immortalized microvascular endothelial cells but did not affect thrombin generation or cellular proliferation. The array identified target genes, which were further validated: angiopoetin 4 ( ANGPT4 ), platelet-derived growth factor receptor α ( PDGFRA ), tumor necrosis factor superfamily member 15 ( TNFSF15 ), angiogenin ( ANG ), serpin family C member 1 ( SERPIN1 ), angiopoietin 2 ( ANGPT2 ), and CXC motif chemokine 12 ( CXCL12 ) in telomerase-immortalized microvascular endothelial cells and primary placental endothelial cells obtained from control and FGR pregnancies. This study reports a temporal relationship between altered placental BGN expression and subsequent development of SGA. Reduction of BGN in vascular endothelial cells leads to disrupted network formation and alterations in the expression of genes involved in angiogenesis. Therefore, differential expression of these may contribute to aberrant angiogenesis in SGA pregnancies. © 2017 American Heart Association, Inc.

Increased Expression of Interleukin-18 mRNA is Associated with Carotid Artery Stenosis

PubMed

Arapi, Berk; Bayoğlu, Burcu; Cengiz, Müjgan; Dirican, Ahmet; Deser, Serkan Burç; Junusbekov, Yerik; Arslan, Caner

2018-05-29

Carotid artery stenosis is the atherosclerotic narrowing of the proximal internal carotid artery and one of the primary causes of stroke. Elevated expression of the pleiotropic proinflammatory cytokine interleukin-18 has been demonstrated in human atherosclerotic plaques. To investigate whether the mRNA expression levels of interleukin-18 and interleukin-18-binding protein and interleukin-18 −137 G/C (rs187238) variants are associated with carotid artery stenosis development. Case-control study. The mRNA expression levels of interleukin-18 and interleukin-18-binding protein and interleukin-18 rs187238 variants were evaluated by quantitative real-time polymerase chain reaction and real-time polymerase chain reaction, respectively, in the peripheral blood mononuclear cells of 70 patients with carotid artery stenosis (36 symptomatic, 34 asymptomatic) and 75 healthy controls. Interleukin-18 mRNA expression was significantly increased in carotid artery stenosis patients compared to that in healthy controls (p=0.01). However, no significant difference was observed between interleukin-18-binding protein mRNA expression levels in patients with carotid artery stenosis and those in controls (p=0.101). Internal carotid artery stenosis severity was significantly higher in symptomatic patients than that in asymptomatic patients (p<0.001). A significant relationship was identified between interleukin-18 expression and internal carotid artery stenosis severity in patients with carotid artery stenosis (p=0.051). Interleukin-18 rs187238 polymorphism genotype frequencies did not significantly differ between patients with carotid artery stenosis and controls (p=0.246). A significant difference was identified between interleukin-18-binding protein gene expression and symptomatic and asymptomatic patients (p=0.026), but there was no difference in interleukin-18 expression between the symptomatic and asymptomatic subgroups (p=0.397). Interleukin-18 mRNA expression may affect carotid artery stenosis etiopathogenesis and internal carotid artery stenosis severity and also may play a mechanistic role in the pathogenesis of carotid artery stenosis, influencing the appearance of symptoms.

The role of acyl carrier protein isoforms from Cuphea lanceolata seeds in the de-novo biosynthesis of medium-chain fatty acids.

PubMed

Schütt, B S; Brummel, M; Schuch, R; Spener, F

1998-06-01

To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

Markov chain aggregation and its applications to combinatorial reaction networks.

PubMed

Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

2014-09-01

We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

PubMed

Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

2018-06-01

The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p < 0.008) in expression levels between paired pancreatic juice and tissue samples in pancreas cancer. In intraductal papillary mucinous neoplasms (IPMN), Matrix Metalloproteinase 7 (MMP7), showed significant correlation (p < 0.01) in the expression levels between paired pancreatic juice and tissue samples. This study confirms that RNA analysis of paired pancreatic juice and tissue samples and establishment of cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

Immunological characteristics of outer membrane protein omp31 of goat Brucella and its monoclonal antibody.

PubMed

Zheng, W Y; Wang, Y; Zhang, Z C; Yan, F

2015-10-05

We examined the immunological characteristics of outer membrane protein omp31 of goat Brucella and its monoclonal antibody. Genomic DNA from the M5 strain of goat Brucella was amplified by polymerase chain reaction and cloned into the prokaryotic expression vector pGEX-4T-1. The expression and immunological characteristics of the fusion protein GST-omp31 were subjected to preliminary western blot detection with goat Brucella rabbit immune serum. The Brucella immunized BALB/c mouse serum was detected using purified protein. The high-potency mouse splenocytes and myeloma Sp2/0 cells were fused. Positive clones were screened by enzyme-linked immunosorbent assay to establish a hybridoma cell line. Mice were inoculated intraperitoneally with hybridoma cells to prepare ascites. The mAb was purified using the n-caprylic acid-ammonium sulfate method. The characteristics of mAb were examined using western blotting and enzyme-linked immunosorbent assay. A 680-base pair band was observed after polymerase chain reaction. Enzyme digestion identification and sequencing showed that the pGEX-4T-1-omp31 prokaryotic expression vector was successfully established; a target band of approximately 57 kDa with an apparent molecular weight consistent with the size of the target fusion protein. At 25°C, the expression of soluble expression increased significantly; the fusion protein GST-omp31 was detected by western blotting. Anti-omp31 protein mAb was obtained from 2 strains of Brucella. The antibody showed strong specificity and sensitivity and did not cross-react with Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Mycobacterium tuberculosis, or Bacillus pyocyaneus. The pGEX-4T-1-omp31 prokaryotic expression vector was successfully established and showed good immunogenicity. The antibody also showed strong specificity and good sensitivity.

Activation‐Induced Killer Cell Immunoglobulin‐like Receptor 3DL2 Binding to HLA–B27 Licenses Pathogenic T Cell Differentiation in Spondyloarthritis

PubMed Central

Ridley, Anna; Hatano, Hiroko; Wong‐Baeza, Isabel; Shaw, Jacqueline; Matthews, Katherine K.; Al‐Mossawi, Hussein; Ladell, Kristin; Price, David A.; Bowness, Paul

2016-01-01

Objective In the spondyloarthritides (SpA), increased numbers of CD4+ T cells express killer cell immunoglobulin‐like receptor 3DL2 (KIR‐3DL2). The aim of this study was to determine the factors that induce KIR‐3DL2 expression, and to characterize the relationship between HLA–B27 and the phenotype and function of KIR‐3DL2–expressing CD4+ T cells in SpA. Methods In total, 34 B27+ patients with SpA, 28 age‐ and sex‐matched healthy controls (20 B27− and 8 B27+), and 9 patients with rheumatoid arthritis were studied. KIR-3DL2 expression and other phenotypic characteristics of peripheral blood and synovial fluid CD4+ T cells were studied by flow cytometry, quantitative polymerase chain reaction, and Western blotting. T cell receptor clonality was determined by template‐switch anchored reverse transcription–polymerase chain reaction and sequencing analysis. Cytokines were measured by enzyme‐linked immunosorbent assay. Results Cellular activation induced KIR‐3DL2 expression on both naive and effector CD4+ T cells. KIR‐3DL2 binding to B27+ cells promoted expression of KIR‐3DL2, the Th17‐specific transcription factor retinoic acid receptor–related orphan nuclear receptor γt, and the antiapoptotic factor B cell lymphoma 2. KIR‐3DL2+CD4+ T cells in patients with ankylosing spondylitis were oligoclonal and enriched for markers of T cell activation and for the gut homing receptor CCR9. In the presence of B27+ antigen‐presenting cells, KIR‐3DL2+CD4+ T cells produced less interleukin‐2 (IL‐2) but more IL‐17. This effect was blocked by HC10, an antibody that inhibits the binding of KIR‐3DL2 to B27 heavy chains. Conclusion KIR‐3DL2 binding to HLA–B27 licenses Th17 cell differentiation in SpA. These findings raise the therapeutic potential of targeting HLA–B27–KIR‐3DL2 interactions for the treatment of B27+ patients with SpA. PMID:26841353

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

Comprehensive Nuclear-Test-Ban Treaty: Background and Current Developments

DTIC Science & Technology

2013-06-10

subcritical; that is, no critical mass is formed and no self-sustaining nuclear chain reaction can occur; thus, there is no nuclear explosion.”211 SCEs...45 The National Academy of Sciences Study and Its Critics ...the future, but there are no plans to do so.”8 Critics expressed concern about the implications of these policies for testing and new weapons

VLSI Microsystem for Rapid Bioinformatic Pattern Recognition

NASA Technical Reports Server (NTRS)

Fang, Wai-Chi; Lue, Jaw-Chyng

2009-01-01

A system comprising very-large-scale integrated (VLSI) circuits is being developed as a means of bioinformatics-oriented analysis and recognition of patterns of fluorescence generated in a microarray in an advanced, highly miniaturized, portable genetic-expression-assay instrument. Such an instrument implements an on-chip combination of polymerase chain reactions and electrochemical transduction for amplification and detection of deoxyribonucleic acid (DNA).

Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction.

PubMed

Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C

2000-09-01

The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.

Susceptibility of human liver cells to porcine endogenous retrovirus.

PubMed

Lin, Xinzi; Qi, Lin; Li, Zhiguo; Chi, Hao; Lin, Wanjun; Wang, Yan; Jiang, Zesheng; Pan, Mingxin; Gao, Yi

2013-12-01

The risk of porcine endogenous retrovirus infection is a major barrier for pig-to-human xenotransplant. Porcine endogenous retrovirus, present in porcine cells, can infect many human and nonhuman primate cells in vitro, but there is no evidence available about in vitro infection of human liver cells. We investigated the susceptibility of different human liver cells to porcine endogenous retrovirus. The supernatant from a porcine kidney cell line was added to human liver cells, including a normal hepatocyte cell line (HL-7702 cells), primary hepatocytes (Phh cells), and a liver stellate cell line (Lx-2 cells), and to human embryonic kidney cells as a reference control. Expression of the porcine endogenous retrovirus antigen p15E in the human cells was evaluated with polymerase chain reaction, reverse transcription-polymerase chain reaction, and Western blot. The porcine endogenous retrovirus antigen p15E was not expressed in any human liver cells (HL-7702, Phh, or Lx-2 cells) that had been exposed to supernatants from porcine kidney cell lines. Porcine endogenous retrovirus-specific fragments were amplified in human kidney cells. Human liver cells tested were not susceptible to infection by porcine endogenous retrovirus. Therefore, not all human cells are susceptible to porcine endogenous retrovirus.

Stabilization of bacterially expressed erythropoietin by single site-specific introduction of short branched PEG chains at naturally occurring glycosylation sites.

PubMed

Hoffmann, E; Streichert, K; Nischan, N; Seitz, C; Brunner, T; Schwagerus, S; Hackenberger, C P R; Rubini, M

2016-05-24

The covalent attachment of polyethylene glycol (PEG) to therapeutic proteins can improve their physicochemical properties. In this work we utilized the non-natural amino acid p-azidophenylalanine (pAzF) in combination with the chemoselective Staudinger-phosphite reaction to install branched PEG chains to recombinant unglycosylated erythropoietin (EPO) at each single naturally occurring glycosylation site. PEGylation with two short 750 or 2000 Da PEG units at positions 24, 38, or 83 significantly decreased unspecific aggregation and proteolytic degradation while biological activity in vitro was preserved or even increased in comparison to full-glycosylated EPO. This site-specific bioconjugation approach permits to analyse the impact of PEGylation at single positions. These results represent an important step towards the engineering of site-specifically modified EPO variants from bacterial expression with increased therapeutic efficacy.

Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

PubMed

Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

The increased mucosal mRNA expressions of complement C3 and interleukin-17 in inflammatory bowel disease

PubMed Central

Sugihara, T; Kobori, A; Imaeda, H; Tsujikawa, T; Amagase, K; Takeuchi, K; Fujiyama, Y; Andoh, A

2010-01-01

Recent studies have demonstrated that the complement system participates in the regulation of T cell functions. To address the local biosynthesis of complement components in inflammatory bowel disease (IBD) mucosa, we investigated C3 and interleukin (IL)-17 mRNA expression in mucosal samples obtained from patients with IBD. The molecular mechanisms underlying C3 induction were investigated in human colonic subepithelial myofibroblasts (SEMFs). IL-17 and C3 mRNA expressions in the IBD mucosa were evaluated by real-time polymerase chain reaction. The C3 levels in the supernatant were determined by enzyme-linked immunosorbent assay. IL-17 and C3 mRNA expressions were elevated significantly in the active lesions from ulcerative colitis (UC) and Crohn's disease (CD) patients. There was a significant positive correlation between IL-17 and C3 mRNA expression in the IBD mucosa. IL-17 stimulated a dose- and time-dependent increase in C3 mRNA expression and C3 secretion in colonic SEMFs. The C3 molecules secreted by colonic SEMFs were a 115-kDa α-chain linked to a 70-kDa β-chain by disulphide bonds, which was identical to serum C3. The IL-17-induced C3 mRNA expression was blocked by p42/44 mitogen-activated protein kinase (MAPK) inhibitors (PD98059 and U0216) and a p38 MAPK inhibitor (SB203580). Furthermore, IL-17-induced C3 mRNA expression was inhibited by an adenovirus containing a stable mutant form of IκBα. C3 and IL-17 mRNA expressions are enhanced, with a strong correlation, in the inflamed mucosa of IBD patients. Part of these clinical findings was considered to be mediated by the colonic SEMF response to IL-17. PMID:20089077

PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

PubMed

Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

2014-03-01

To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

Selection of internal reference genes for normalization of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in the canine brain and other organs.

PubMed

Park, Sang-Je; Huh, Jae-Won; Kim, Young-Hyun; Lee, Sang-Rae; Kim, Sang-Hyun; Kim, Sun-Uk; Kim, Heui-Soo; Kim, Min Kyu; Chang, Kyu-Tae

2013-05-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a specific and sensitive technique for quantifying gene expression. To analyze qRT-PCR data accurately, suitable reference genes that show consistent expression patterns across different tissues and experimental conditions should be selected. The objective of this study was to obtain the most stable reference genes in dogs, using samples from 13 different brain tissues and 10 other organs. 16 well-known candidate reference genes were analyzed by the geNorm, NormFinder, and BestKeeper programs. Brain tissues were derived from several different anatomical regions, including the forebrain, cerebrum, diencephalon, hindbrain, and metencephalon, and grouped accordingly. Combination of the three different analyses clearly indicated that the ideal reference genes are ribosomal protien S5 (RPS5) in whole brain, RPL8 and RPS5 in whole body tissues, RPS5 and RPS19 in the forebrain and cerebrum, RPL32 and RPS19 in the diencephalon, GAPDH and RPS19 in the hindbrain, and MRPS7 and RPL13A in the metencephalon. These genes were identified as ideal for the normalization of qRT-PCR results in the respective tissues. These findings indicate more suitable and stable reference genes for future studies of canine gene expression.

Calcium: A novel and efficient inducer of differentiation of adipose-derived stem cells into neuron-like cells.

PubMed

Goudarzi, Farjam; Tayebinia, Heidar; Karimi, Jamshid; Habibitabar, Elahe; Khodadadi, Iraj

2018-06-05

This study comparatively investigated the effectiveness of calcium and other well-known inducers such as isobutylmethylxanthine (IBMX) and insulin in differentiating human adipose-derived stem cells (ADSCs) into neuronal-like cells. ADSCs were immunophenotyped and differentiated into neuron-like cells with different combinations of calcium, IBMX, and insulin. Calcium mobilization across the membrane was determined. Differentiated cells were characterized by cell cycle profiling, staining of Nissl bodies, detecting the gene expression level of markers such as neuronal nuclear antigen (NeuN), microtubule associated protein 2 (MAP2), neuron-specific enolase (NSE), doublecortin, synapsin I, glial fibrillary acidic protein (GFAP), and myelin basic protein (MBP) by quantitative real-time polymerase chain reaction (quantitative real-time polymerase chain reaction (qRT-PCR) and protein level by the immunofluorescence technique. Treatment with Ca + IBMX + Ins induced neuronal appearance and projection of neurite-like processes in the cells, accompanied with inhibition of proliferation and halt in the cell cycle. A significantly higher expression of MBP, GFAP, NeuN, NSE, synapsin 1, doublecortin, and MAP2 was detected in differentiated cells, confirming the advantages of Ca + IBMX + Ins to the other combinations of inducers. Here, we showed an efficient protocol for neuronal differentiation of ADSCs, and calcium fostered differentiation by augmenting the number of neuron-like cells and instantaneous increase in the expression of neuronal markers. © 2018 Wiley Periodicals, Inc.

Cardiomyogenic Differentiation in Cardiac Myxoma Expressing Lineage-Specific Transcription Factors

PubMed Central

Kodama, Hiroaki; Hirotani, Takashi; Suzuki, Yusuke; Ogawa, Satoshi; Yamazaki, Kazuto

2002-01-01

We investigated five cases of cardiac myxoma and one case of cardiac undifferentiated sarcoma by light and electron microscopy, in situ hybridization, immunohistochemical staining, and reverse transcriptase-polymerase chain reaction for cardiomyocyte-specific transcription factors, Nkx2.5/Csx, GATA-4, MEF2, and eHAND. Conventional light microscopy revealed that cardiac myxoma and sarcoma cells presented variable cellular arrangements and different histological characteristics. Ultrastructurally, some of the myxoma cells exhibited endothelium-like or immature mesenchymal cell differentiation. Immunohistochemistry for Nkx2.5/Csx, GATA-4, and eHAND was slightly to intensely positive in all myxoma cases. MEF2 immunoreactivity was observed in all cases including the case of sarcoma, thus suggesting myogenic differentiation of myxoma or sarcoma cells. In situ hybridization for Nkx2.5/Csx also revealed that all myxoma cells, but not sarcoma cells, expressed mRNA of the cardiac homeobox gene, Nkx2.5/Csx. Furthermore, nested reverse transcriptase-polymerase chain reaction from formalin-fixed, paraffin-embedded tissue was performed and demonstrated that the Nkx2.5/Csx and eHAND gene product to be detected in all cases, and in three of six cases, respectively. In conclusion, cardiac myxoma cells were found to express various amounts of cardiomyocyte-specific transcription factor gene products at the mRNA and protein levels, thus suggesting cardiomyogenic differentiation. These results support the concept that cardiac myxoma might arise from mesenchymal cardiomyocyte progenitor cells. PMID:12163362

Accuracy of Reaction Cross Section for Exotic Nuclei in Glauber Model Based on MCMC Diagnostics

NASA Astrophysics Data System (ADS)

Rueter, Keiti; Novikov, Ivan

2017-01-01

Parameters of a nuclear density distribution for an exotic nuclei with halo or skin structures can be determined from the experimentally measured reaction cross-section. In the presented work, to extract parameters such as nuclear size information for a halo and core, we compare experimental data on reaction cross-sections with values obtained using expressions of the Glauber Model. These calculations are performed using a Markov Chain Monte Carlo algorithm. We discuss the accuracy of the Monte Carlo approach and its dependence on k*, the power law turnover point in the discreet power spectrum of the random number sequence and on the lag-1 autocorrelation time of the random number sequence.

Automation of fluorescent differential display with digital readout.

PubMed

Meade, Jonathan D; Cho, Yong-Jig; Fisher, Jeffrey S; Walden, Jamie C; Guo, Zhen; Liang, Peng

2006-01-01

Since its invention in 1992, differential display (DD) has become the most commonly used technique for identifying differentially expressed genes because of its many advantages over competing technologies such as DNA microarray, serial analysis of gene expression (SAGE), and subtractive hybridization. Despite the great impact of the method on biomedical research, there has been a lack of automation of DD technology to increase its throughput and accuracy for systematic gene expression analysis. Most of previous DD work has taken a "shot-gun" approach of identifying one gene at a time, with a limited number of polymerase chain reaction (PCR) reactions set up manually, giving DD a low-tech and low-throughput image. We have optimized the DD process with a new platform that incorporates fluorescent digital readout, automated liquid handling, and large-format gels capable of running entire 96-well plates. The resulting streamlined fluorescent DD (FDD) technology offers an unprecedented accuracy, sensitivity, and throughput in comprehensive and quantitative analysis of gene expression. These major improvements will allow researchers to find differentially expressed genes of interest, both known and novel, quickly and easily.

FcepsilonRI-alpha siRNA inhibits the antigen-induced activation of mast cells.

PubMed

Safaralizadeh, Reza; Soheili, Zahra-Soheila; Deezagi, Abdolkhaleg; Pourpak, Zahra; Samiei, Shahram; Moin, Mostafa

2009-12-01

FcepsilonRI, The high affinity receptor for IgE plays a critical role in triggering the allergic reactions. It is responsible for inducing mast cell degranulation and deliberation of allergy mediators when it is aggregated by allergen and IgE complexes. FcepsilonRI on the mast cells consists of three subunits; alpha chain directly binds IgE, beta chain and dimmer of gamma chains together mediate intracellular signaling. Cross-linking of IgE-bound FcepsilonRI on the surface of mast cells and basophils by the multivalent antigen induces release of chemical mediators. The present in vitro study was designed to investigate the effect of synthetic FcepsilonRI-alpha siRNA on the antigen-induced activation of MC/9 cells. MC/9 cells which are murine mast cells were transfected by FcepsilonRI-alpha siRNA and negative control siRNA. After 6 h, anti-DNP (Dinitrophenyl) IgE was used for the cells sensitization. Then the cells were challenged with Dinitrophenyl-Human Serum Albumin (DNP-HSA) for mast cell degranulation induction before collection of supernatants. The amount of mRNA and protein expression was measured by Real Time PCR and western blot analysis, respectively. Determination of the expression rate of FcepsilonRI-alpha on cell surface was achieved by flow cytometry. ELISA and spectrophotometry methods were used subsequently for measuring the effects of FcepsilonRI-alpha siRNA on antigen-induced histamine and beta-hexosaminidase release. FcepsilonRI-alpha siRNA treated cells showed significant decrease in FcepsilonRI-alpha mRNA and protein expression in comparison to control cells. FcepsilonRI-mediated mast cell release of beta-hexosaminidase and histamine were also inhibited. In this study it was shown that FcepsilonRI-alpha siRNA could suppress FcepsilonRI-alpha expression and inhibited degranulation and histamine release in antigen-stimulated MC/9 cells. In conclusion, knock-down of FcepsilonRI-alpha by siRNA could be a promising method for inhibition of the mast cell-mediated allergic reactions.

Vascular endothelial growth factor and nitric oxide synthase expression in human tooth germ development.

PubMed

Mastrangelo, F; Sberna, M T; Tettamanti, L; Cantatore, G; Tagliabue, A; Gherlone, E

2016-01-01

Vascular Endothelia Growth Factor (VEGF) and Nitric Oxide Synthase (NOS) expression, were evaluated in human tooth germs at two different stages of embryogenesis, to clarify the role of angiogenesis during tooth tissue differentiation and growth. Seventy-two third molar germ specimens were selected during oral surgery. Thirty-six were in the early stage and 36 in the later stage of tooth development. The samples were evaluated with Semi-quantitative Reverse Transcription-Polymerase chain Reaction analyses (RT-PcR), Western blot analysis (WB) and immunohistochemical analysis. Western blot and immunohistochemical analysis showed a VEGF and NOS 1-2-3 positive reaction in all samples analysed. VEGF high positive decrease reaction was observed in stellate reticulum cells, ameloblast and odontoblast clusters in early stage compared to later stage of tooth germ development. Comparable VEGF expression was observed in endothelial cells of early and advanced stage growth. NOS1 and NOS3 expressions showed a high increased value in stellate reticulum cells, and ameloblast and odontoblast clusters in advanced stage compared to early stage of development. The absence or only moderate positive reaction of NOS2 was detected in all the different tissues. Positive NOS2 expression showed in advanced stage of tissue development compared to early stage. The action of VEGF and NOS molecules are important mediators of angiogenesis during dental tissue development. VEGF high positive expression in stellate reticulum cells in the early stage of tooth development compared to the later stage and the other cell types, suggests a critical role of the stellate reticulum during dental embryo-morphogenesis.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

PubMed

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Bond Graph Modeling of Chemiosmotic Biomolecular Energy Transduction.

PubMed

Gawthrop, Peter J

2017-04-01

Engineering systems modeling and analysis based on the bond graph approach has been applied to biomolecular systems. In this context, the notion of a Faraday-equivalent chemical potential is introduced which allows chemical potential to be expressed in an analogous manner to electrical volts thus allowing engineering intuition to be applied to biomolecular systems. Redox reactions, and their representation by half-reactions, are key components of biological systems which involve both electrical and chemical domains. A bond graph interpretation of redox reactions is given which combines bond graphs with the Faraday-equivalent chemical potential. This approach is particularly relevant when the biomolecular system implements chemoelectrical transduction - for example chemiosmosis within the key metabolic pathway of mitochondria: oxidative phosphorylation. An alternative way of implementing computational modularity using bond graphs is introduced and used to give a physically based model of the mitochondrial electron transport chain To illustrate the overall approach, this model is analyzed using the Faraday-equivalent chemical potential approach and engineering intuition is used to guide affinity equalisation: a energy based analysis of the mitochondrial electron transport chain.

Shikonin, an ingredient of Lithospermum erythrorhizon, down-regulates the expression of steroid sulfatase genes in breast cancer cells.

PubMed

Zhang, Yi; Qian, Rui-Qin; Li, Ping-Ping

2009-10-18

Steroid sulfatase (STS) has an important role in regulating the biosynthesis of estrogen within breast tumors. We aimed to investigate whether shikonin, an ingredient of Lithospermum erythrorhizon, could modulate STS expression in breast cancer cells. By MTT assay, shikonin inhibited the cell proliferation of breast cancer cells MCF-7 and SK-BR-3. Moreover, by semi-quantitative/quantitative reverse transcription polymerase chain reaction and dual-luciferase reporter based bioluminescent measurements, the mRNA and enzymatic activity levels of STS were decreased after shikonin treatment. Concluding, shikonin could act as a selective estrogen enzyme modulator by down-regulating the STS expression.

Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

PubMed

Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

2015-01-01

Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

An easy and efficient strategy for KEL genotyping in a multiethnic population.

PubMed

Arnoni, Carine Prisco; Muniz, Janaína Guinhem; de Paula, Tatiane Aparecida; Person, Rosangela Duarte de Medeiros; Gazito, Diana; Baleotti, Wilson; Barreto, José Augusto; Castilho, Lilian; Latini, Flavia Roche Moreira

2013-01-01

The Kell blood group system expresses high and low frequency antigens with the most important in relation to transfusion including the antithetic KEL1 and KEL2; KEL3 and KEL4; KEL6 and KEL7 antigens. Kell is a clinically relevant system, as it is highly immunogenic and anti-KEL antibodies are associated with hemolytic transfusion reactions and hemolytic disease of the fetus and newborn. Although required in some situations, Kell antigen phenotyping is restricted due to technical limitations. In these cases, molecular approaches maybe a solution. This study proposes three polymerase chain reaction genotyping protocols to analyze the single nucleotide polymorphisms responsible for six Kell antithetic antigens expressed in a Brazilian population. DNA was extracted from 800 blood donor samples and three polymerase chain reaction-restriction fragment length polymorphism protocols were used to genotype the KEL*1/KEL*2, KEL*3/KEL*4 and KEL*6/KEL*7 alleles. KEL*3/KEL*4 and KEL*6/KEL*7 genotyping was standardized using the NlaIII and MnlI restriction enzymes and validated using sequencing. KEL*1/KEL*2 genotyping was performed using a previously reported assay. KEL genotyping was successfully implemented in the service; the following distribution of KEL alleles was obtained for a population from southeastern Brazil: KEL*1 (2.2%), KEL*2 (97.8%), KEL*3 (0.69%), KEL*4 (99.31%), KEL*6 (2.69%) and KEL*7 (97.31%). Additionally, two individuals with rare genotypes, KEL*1/KEL*1 and KEL*3/KEL*3, were identified. KEL allele genotyping using these methods proved to be reliable and applicable to predict Kell antigen expressions in a Brazilian cohort. This easy and efficient strategy can be employed to provide safer transfusions and to help in rare donor screening.

Proteomic identification of potential biomarkers for cervical squamous cell carcinoma and human papillomavirus infection.

PubMed

Qing, Song; Tulake, Wuniqiemu; Ru, Mingfang; Li, Xiaohong; Yuemaier, Reziwanguli; Lidifu, Dilare; Rouzibilali, Aierken; Hasimu, Axiangu; Yang, Yun; Rouziahong, Reziya; Upur, Halmurat; Abudula, Abulizi

2017-04-01

It is known that high-risk human papillomavirus infection is the main etiological factor in cervical carcinogenesis. However, human papillomavirus screening is not sufficient for early diagnosis. In this study, we aimed to identify potential biomarkers common to cervical carcinoma and human papillomavirus infection by proteomics for human papillomavirus-based early diagnosis and prognosis. To this end, we collected 76 cases of fresh cervical tissues and 116 cases of paraffin-embedded tissue slices, diagnosed as cervical squamous cell carcinoma, cervical intraepithelial neoplasia II-III, or normal cervix from ethnic Uighur and Han women. Human papillomavirus infection by eight oncogenic human papillomavirus types was detected in tissue DNA samples using a quantitative polymerase chain reaction. The protein profile of cervical specimens from human papillomavirus 16-positive squamous cell carcinoma and human papillomavirus-negative normal controls was analyzed by proteomics and bioinformatics. The expression of candidate proteins was further determined by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. We identified 67 proteins that were differentially expressed in human papillomavirus 16-positive squamous cell carcinoma compared to normal cervix. The quantitative reverse transcriptase-polymerase chain reaction analysis verified the upregulation of ASAH1, PCBP2, DDX5, MCM5, TAGLN2, hnRNPA1, ENO1, TYPH, CYC, and MCM4 in squamous cell carcinoma compared to normal cervix ( p < 0.05). In addition, the transcription of PCBP2, MCM5, hnRNPA1, TYPH, and CYC was also significantly increased in cervical intraepithelial neoplasia II-III compared to normal cervix. Immunohistochemistry staining further confirmed the overexpression of PCBP2, hnRNPA1, ASAH1, and DDX5 in squamous cell carcinoma and cervical intraepithelial neoplasia II-III compared to normal controls ( p < 0.05). Our data suggest that the expression of ASAH1, PCBP2, DDX5, and hnRNPA1, and possibly MCM4, MCM5, CYC, ENO1, and TYPH, is upregulated during cervical carcinogenesis and potentially associated with human papillomavirus infection. Further validation studies of the profile will contribute to establishing auxiliary diagnostic markers for human papillomavirus-based cancer prognosis.

Astrocyte- and endothelial-targeted CCL2 conditional knockout mice: critical tools for studying the pathogenesis of neuroinflammation.

PubMed

Ge, Shujun; Murugesan, Nivetha; Pachter, Joel S

2009-09-01

While the expression of the C-C chemokine ligand 2 (CCL2) in the central nervous system (CNS) is associated with numerous neuroinflammatory conditions, the critical cellular sources of this chemokine, which is responsible for disease processes-as well as associated pathogenic mechanisms, remain unresolved. As the potential for anti-CCL2 therapeutics in treating neuroinflammatory disease is likely to be contingent upon effective drug delivery to the source(s) and/or target(s) of CCL2 action in the CNS, tools to highlight the course of CCL2 action during neuroinflammation are imperative. In response to this need, we used the Cre/loxP and FLP-FRT recombination system to develop the first two, cell-conditional CCL2 knockout mice-separately targeting CCL2 gene elimination to astrocytes and endothelial cells, both of which have been considered to play crucial though undefined roles in neuroinflammatory disease. Specifically, mice containing a floxed CCL2 allele were intercrossed with GFAP-Cre or Tie2-Cre transgenic mice to generate mice with CCL2-deficient astrocytes (astrocyte KO) or endothelial cells (endothelial KO), respectively. Polymerase chain reaction, reverse transcription polymerase chain reaction/quantitative reverse transcriptase polymerase chain reaction, and enzyme-linked immunosorbent assay of CCL2 gene, RNA, and protein, respectively, from cultured astrocytes and brain microvascular endothelial cells (BMEC) established the efficiency and specificity of the CCL2 gene deletions and a CCL2 null phenotype in these CNS cells. Effective cell-conditional knockout of CCL2 was also confirmed in an in vivo setting, wherein astrocytes and BMEC were retrieved by immune-guided laser capture microdissection from their in situ positions in the brains of mice experiencing acute, lipopolysaccharide-mediated endotoxemia to induce CCL2 gene expression. In vivo analysis further revealed apparent cross-talk between BMEC and astrocytes regarding the regulation of astrocyte CCL2 expression. Use of astrocyte KO and endothelial KO mice should prove critical in elaborating the pathogenic mechanisms of and optimizing the treatments for neuroinflammatory disease.

Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

PubMed

Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

2000-04-01

Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

Molecular cloning, characterization and expression profiles of thioredoxin 1 and thioredoxin 2 genes in Mytilus galloprovincialis

NASA Astrophysics Data System (ADS)

Wang, Qing; Ning, Xuanxuan; Pei, Dong; Zhao, Jianmin; You, Liping; Wang, Chunyan; Wu, Huifeng

2013-05-01

Thioredoxin (Trx) proteins are involved in many biological processes especially the regulation of cellular redox homeostasis. In this study, two Trx cDNAs were cloned from the mussel Mytilus galloprovincialis using rapid amplifi cation of cDNA ends-polymerase chain reaction (RACE-PCR). The two cDNAs were named MgTrx1 and MgTrx2, respectively. The open reading frames of MgTrx1 and MgTrx2 were 318 and 507 base pairs (bp) and they encoded proteins of 105 and 168 amino acids with estimated molecular masses of 11.45 and 18.93 kDa, respectively. Sequence analysis revealed that both proteins possessed the conserved active site dithiol motif Cys-Gly-Pro-Cys. In addition, MgTrx2 also possessed a putative mitochondrial targeting signal suggesting that it is located in the mitochondria. Quantitative real-time polymerase chain reaction (qPCR) revealed that both MgTrx1 and MgTrx2 were constitutively expressed in all tissues examined. The MgTrx1 transcript was most abundant in hemocytes and gills, whereas the MgTrx2 transcript was most abundant in gonad, hepatopancreas, gill and hemocytes. Following Vibrio anguillarum challenge, the expression of MgTrx1 was up-regulated and reached its peak, at a value 10-fold the initial value, at 24 h. Subsequently, expression returned back to the original level. In contrast, the expression level of MgTrx2 was down-regulated following bacterial stimulation, with one fi fth of the control level evident at 12 h post challenge. These results suggest that MgTrx1 and MgTrx2 may play important roles in the response of M. galloprovincialis to bacterial challenge.

Growth and differentiation of human lens epithelial cells in vitro on matrix

NASA Technical Reports Server (NTRS)

Blakely, E. A.; Bjornstad, K. A.; Chang, P. Y.; McNamara, M. P.; Chang, E.; Aragon, G.; Lin, S. P.; Lui, G.; Polansky, J. R.

2000-01-01

PURPOSE: To characterize the growth and maturation of nonimmortalized human lens epithelial (HLE) cells grown in vitro. METHODS: HLE cells, established from 18-week prenatal lenses, were maintained on bovine corneal endothelial (BCE) extracellular matrix (ECM) in medium supplemented with basic fibroblast growth factor (FGF-2). The identity, growth, and differentiation of the cultures were characterized by karyotyping, cell morphology, and growth kinetics studies, reverse transcription-polymerase chain reaction (RT-PCR), immunofluorescence, and Western blot analysis. RESULTS: HLE cells had a male, human diploid (2N = 46) karyotype. The population-doubling time of exponentially growing cells was 24 hours. After 15 days in culture, cell morphology changed, and lentoid formation was evident. Reverse transcription-polymerase chain reaction (RT-PCR) indicated expression of alphaA- and betaB2-crystallin, fibroblast growth factor receptor 1 (FGFR1), and major intrinsic protein (MIP26) in exponential growth. Western analyses of protein extracts show positive expression of three immunologically distinct classes of crystallin proteins (alphaA-, alphaB-, and betaB2-crystallin) with time in culture. By Western blot analysis, expression of p57(KIP2), a known marker of terminally differentiated fiber cells, was detectable in exponential cultures, and levels increased after confluence. MIP26 and gamma-crystallin protein expression was detected in confluent cultures, by using immunofluorescence, but not in exponentially growing cells. CONCLUSIONS: HLE cells can be maintained for up to 4 months on ECM derived from BCE cells in medium containing FGF-2. With time in culture, the cells demonstrate morphologic characteristics of, and express protein markers for, lens fiber cell differentiation. This in vitro model will be useful for investigations of radiation-induced cataractogenesis and other studies of lens toxicity.

Standardized Scalp Massage Results in Increased Hair Thickness by Inducing Stretching Forces to Dermal Papilla Cells in the Subcutaneous Tissue

PubMed Central

Kobayashi, Kazuhiro; Hama, Takanori; Murakami, Kasumi; Ogawa, Rei

2016-01-01

Objective: In this study, we evaluated the effect of scalp massage on hair in Japanese males and the effect of stretching forces on human dermal papilla cells in vitro. Methods: Nine healthy men received 4 minutes of standardized scalp massage per day for 24 weeks using a scalp massage device. Total hair number, hair thickness, and hair growth rate were evaluated. The mechanical effect of scalp massage on subcutaneous tissue was analyzed using a finite element method. To evaluate the effect of mechanical forces, human dermal papilla cells were cultured using a 72-hour stretching cycle. Gene expression change was analyzed using DNA microarray analyses. In addition, expression of hair cycle-related genes including IL6, NOGGIN, BMP4, and SMAD4 were evaluated using real-time reverse transcription-polymerase chain reaction. Results: Standardized scalp massage resulted in increased hair thickness 24 weeks after initiation of massage (0.085 ± 0.003 mm vs 0.092 ± 0.001 mm). Finite element method showed that scalp massage caused z-direction displacement and von Mises stress on subcutaneous tissue. In vitro, DNA microarray showed gene expression change significantly compared with nonstretching human dermal papilla cells. A total of 2655 genes were upregulated and 2823 genes were downregulated. Real-time reverse transcription-polymerase chain reaction demonstrated increased expression of hair cycle–related genes such as NOGGIN, BMP4, SMAD4, and IL6ST and decrease in hair loss–related genes such as IL6. Conclusions: Stretching forces result in changes in gene expression in human dermal papilla cells. Standardized scalp massage is a way to transmit mechanical stress to human dermal papilla cells in subcutaneous tissue. Hair thickness was shown to increase with standardized scalp massage. PMID:26904154

Human adipose-derived mesenchymal stromal cell pigment epithelium-derived factor cytotherapy modifies genetic and epigenetic profiles of prostate cancer cells.

PubMed

Zolochevska, Olga; Shearer, Joseph; Ellis, Jayne; Fokina, Valentina; Shah, Forum; Gimble, Jeffrey M; Figueiredo, Marxa L

2014-03-01

Adipose-derived mesenchymal stromal cells (ASCs) are promising tools for delivery of cytotherapy against cancer. However, ASCs can exert profound effects on biological behavior of tumor cells. Our study aimed to examine the influence of ASCs on gene expression and epigenetic methylation profiles of prostate cancer cells as well as the impact of expressing a therapeutic gene on modifying the interaction between ASCs and prostate cancer cells. ASCs were modified by lentiviral transduction to express either green fluorescent protein as a control or pigment epithelium-derived factor (PEDF) as a therapeutic molecule. PC3 prostate cancer cells were cultured in the presence of ASC culture-conditioned media (CCM), and effects on PC3 or DU145. Ras cells were examined by means of real-time quantitative polymerase chain reaction, EpiTect methyl prostate cancer-focused real-time quantitative polymerase chain reaction arrays, and luciferase reporter assays. ASCs transduced with lentiviral vectors were able to mediate expression of several tumor-inhibitory genes, some of which correlated with epigenetic methylation changes on cocultured PC3 prostate cancer cells. When PC3 cells were cultured with ASC-PEDF CCM, we observed a shift in the balance of gene expression toward tumor inhibition, which suggests that PEDF reduces the potential tumor-promoting activity of unmodified ASCs. These results suggest that ASC-PEDF CCM can promote reprogramming of tumor cells in a paracrine manner. An improved understanding of genetic and epigenetic events in prostate cancer growth in response to PEDF paracrine therapy would enable a more effective use of ASC-PEDF, with the goal of achieving safer yet more potent anti-tumor effects. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction.

PubMed

Brell, Marta; Ibáñez, Javier; Tortosa, Avelina

2011-01-26

The DNA repair protein O6-Methylguanine-DNA methyltransferase (MGMT) confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP) the most commonly used for promoter methylation study, while immunohistochemistry (IHC) has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. A computer-aided search of MEDLINE (1950-October 2009), EBSCO (1966-October 2009) and EMBASE (1974-October 2009) was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Of 254 studies identified as eligible for full-text review, 52 (20.5%) met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others) was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

Phosphorylation of Mitochondrial Polyubiquitin by PINK1 Promotes Parkin Mitochondrial Tethering

PubMed Central

Shiba-Fukushima, Kahori; Arano, Taku; Matsumoto, Gen; Inoshita, Tsuyoshi; Yoshida, Shigeharu; Ishihama, Yasushi; Ryu, Kwon-Yul; Nukina, Nobuyuki; Hattori, Nobutaka; Imai, Yuzuru

2014-01-01

The kinase PINK1 and the E3 ubiquitin (Ub) ligase Parkin participate in mitochondrial quality control. The phosphorylation of Ser65 in Parkin's ubiquitin-like (UBl) domain by PINK1 stimulates Parkin activation and translocation to damaged mitochondria, which induces mitophagy generating polyUb chain. However, Parkin Ser65 phosphorylation is insufficient for Parkin mitochondrial translocation. Here we report that Ser65 in polyUb chain is also phosphorylated by PINK1, and that phosphorylated polyUb chain on mitochondria tethers Parkin at mitochondria. The expression of Tom70MTS-4xUb SE, which mimics phospho-Ser65 polyUb chains on the mitochondria, activated Parkin E3 activity and its mitochondrial translocation. An E3-dead form of Parkin translocated to mitochondria with reduced membrane potential in the presence of Tom70MTS-4xUb SE, whereas non-phospho-polyUb mutant Tom70MTS-4xUb SA abrogated Parkin translocation. Parkin binds to the phospho-polyUb chain through its RING1-In-Between-RING (IBR) domains, but its RING0-linker is also required for mitochondrial translocation. Moreover, the expression of Tom70MTS-4xUb SE improved mitochondrial degeneration in PINK1-deficient, but not Parkin-deficient, Drosophila. Our study suggests that the phosphorylation of mitochondrial polyUb by PINK1 is implicated in both Parkin activation and mitochondrial translocation, predicting a chain reaction mechanism of mitochondrial phospho-polyUb production by which rapid translocation of Parkin is achieved. PMID:25474007

Regulation of acetylcholine receptor alpha subunit variants in human myasthenia gravis. Quantification of steady-state levels of messenger RNA in muscle biopsy using the polymerase chain reaction.

PubMed Central

Guyon, T; Levasseur, P; Truffault, F; Cottin, C; Gaud, C; Berrih-Aknin, S

1994-01-01

Myasthenia gravis (MG) is an autoimmune disease mediated by auto-antibodies that attack the nicotinic acetylcholine receptor (AChR). To elucidate the molecular mechanisms underlying the decrease in AChR levels at the neuromuscular junction, we investigated the regulation of AChR expression by analyzing mRNA of the two AChR alpha subunit isoforms (P3A+ and P3A-) in muscle samples from myasthenic patients relative to controls. We applied a quantitative method based on reverse transcription of total RNA followed by polymerase chain reaction (PCR), using an internal standard we constructed by site-directed mutagenesis. An increased expression of mRNA coding for the alpha subunit of the AChR isoforms was observed in severely affected patients (P < 0.003 versus controls) but not in moderately affected patients, independently of the anti-AChR antibody titer. Study of mRNA precursor levels indicates a higher expression in severely affected patients compared to controls, suggesting an enhanced rate of transcription of the message coding for the alpha subunit isoforms in these patients. We have also reported that mRNA encoding both isoforms are expressed at an approximate 1:1 ratio in controls and in patients. We have thus identified a new biological parameter correlated with disease severity, and provide evidence of a compensatory mechanism to balance the loss of AChR in human myasthenia gravis, which is probably triggered only above a certain degree of AChR loss. Images PMID:8040257

Gene expression analysis in hypoplastic lungs in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Burgos, Carmen Mesas; Uggla, Andreas Ringman; Fagerström-Billai, Fredrik; Eklöf, Ann-Christine; Frenckner, Björn; Nord, Magnus

2010-07-01

Pulmonary hypoplasia and persistent pulmonary hypertension are the main causes of mortality and morbidity in newborns with congenital diaphragmatic hernia (CDH). Nitrofen is well known to induce CDH and lung hypoplasia in a rat model, but the mechanism remains unknown. To increase the understanding of the underlying pathogenesis of CDH, we performed a global gene expression analysis using microarray technology. Pregnant rats were given 100 mg nitrofen on gestational day 9.5 to create CDH. On day 21, fetuses after nitrofen administration and control fetuses were removed; and lungs were harvested. Global gene expression analysis was performed using Affymetrix Platform and the RAE 230 set arrays. For validation of microarray data, we performed real-time polymerase chain reaction and Western blot analysis. Significantly decreased genes after nitrofen administration included several growth factors and growth factors receptors involved in lung development, transcription factors, water and ion channels, and genes involved in angiogenesis and extracellular matrix. These results could be confirmed with real-time polymerase chain reaction and protein expression studies. The pathogenesis of lung hypoplasia and CDH in the nitrofen model includes alteration at a molecular level of several pathways involved in lung development. The complexity of the nitrofen mechanism of action reminds of human CDH; and the picture is consistent with lung hypoplasia and vascular disease, both important contributors to the high mortality and morbidity in CDH. Increased understanding of the molecular mechanisms that control lung growth may be the key to develop novel therapeutic techniques to stimulate pre- and postnatal lung growth. Copyright 2010 Elsevier Inc. All rights reserved.

Cytotoxic and Apoptogenic Effects of Cyanidin-3-Glucoside on the Glioblastoma Cell Line.

PubMed

Hosseini, Masoumeh Mansoubi; Karimi, Aliasghar; Behroozaghdam, Mitra; Javidi, Mohammad Amin; Ghiasvand, Saeedeh; Bereimipour, Ahmad; Aryan, Hoda; Nassiri, Farbod; Jangholi, Ehsan

2017-12-01

Glioblastoma multiforme (GBM) is the most prevalent and aggressive primary cerebral tumor. The median survival time is 15 months despite maximum treatment because the tumor is resistant to most therapeutic modalities. Several studies have indicated chemopreventive and chemotherapeutic activity of cyanidin-3-glucoside (C3G) as an anthocyanin component. We aimed to illustrate the cytotoxic and apoptogenic effects of C3G in the U87 cell line (human GBM cell line). Cytotoxic activity was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide tetrazolium assay after treatment with C3G at different concentrations in the U87 cell line. Cisplatin was used as a positive control for 24 and 48 hours. The percentage of apoptotic cells was determined using an Annexin V/propidium iodide assay, and the expression of bax, bcl2, and p53 genes was assessed using real-time polymerase chain reaction. Treatment of U87 cells with 40 μg/mL of C3G resulted in 32% apoptotic cells after 24 hours. To further confirm that C3G treatment induced apoptosis in U87 cells, RNA expression of bax, bcl2, and p53 genes was investigated after treatment. Real-time polymerase chain reaction indicated that the expression of bax and p53 increased, whereas the expression of bcl2 decreased. C3G had an apoptogenic effect in the GBM cell line. New information regarding the therapeutic effects of C3G in GBM could ultimately lead to the production of new drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

Platelet activation by Histophilus somni and its lipooligosaccharide induces endothelial cell proinflammatory responses and platelet internalization.

PubMed

Kuckleburg, Christopher J; McClenahan, Dave J; Czuprynski, Charles J

2008-02-01

Histophilus somni is a gram-negative coccobacillus that causes respiratory and reproductive disease in cattle. The hallmark of systemic H. somni infection is diffuse vascular inflammation that can lead to an acute central nervous system disease known as thrombotic meningoencephalitis. Previously, we demonstrated that H. somni and its lipooligosaccharide (LOS) activate bovine platelets, leading to expression of P selectin, CD40L, and FasL. Because activated platelets have been reported to induce endothelial cell cytokine production and adhesion molecule expression, we sought to determine if bovine platelets induce proinflammatory and procoagulative changes in bovine pulmonary artery endothelial cells. Endothelial cells were incubated with platelets activated with adenosine diphosphate, H. somni, or H. somni LOS. Incubation with activated bovine platelets significantly increased expression of in adhesion molecules (intercellular adhesion molecule 1, E selectin) and tissue factor, as measured by flow cytometry, real-time polymerase chain reaction, and Western blot analysis. Activated platelets also up-regulated expression of endothelial cell IL-1beta, monocyte chemoattractant protein 1, and macrophage inflammatory protein 1alpha as determined by real-time polymerase chain reaction and an IL-1beta enzyme-linked immunosorbent assay. An interesting and surprising finding was that bovine platelets activated by H. somni or its LOS were internalized by bovine endothelial cells as visualized by transmission electron microscopy. This internalization seemed to correlate with endothelial cell activation and morphological changes indicative of cell stress. These findings suggest that activated platelets might play a role in promoting vascular inflammation during H. somni infection.

DNA Methylation of MMP9 Is Associated with High Levels of MMP-9 Messenger RNA in Periapical Inflammatory Lesions.

PubMed

Campos, Kelma; Gomes, Carolina Cavalieri; Farias, Lucyana Conceição; Silva, Renato Menezes; Letra, Ariadne; Gomez, Ricardo Santiago

2016-01-01

Matrix metalloproteinases (MMPs) are the major class of enzymes responsible for degradation of extracellular matrix components and participate in the pathogenesis of periapical inflammatory lesions. MMP expression may be regulated by DNA methylation. The purpose of the present investigation was to analyze the expression of MMP2 and MMP9 in periapical granulomas and radicular cysts and to test the hypothesis that, in these lesions, their transcription may be modulated by DNA methylation. Methylation-specific polymerase chain reaction was used to evaluate the DNA methylation pattern of the MMP2 gene in 13 fresh periapical granuloma samples and 10 fresh radicular cyst samples. Restriction enzyme digestion was used to assess methylation of the MMP9 gene in 12 fresh periapical granuloma samples and 10 fresh radicular cyst samples. MMP2 and MMP9 messenger RNA transcript levels were measured by quantitative real-time polymerase chain reaction. All periapical lesions and healthy mucosa samples showed partial methylation of the MMP2 gene; however, periapical granulomas showed higher MMP2 mRNA expression levels than healthy mucosa (P = .014). A higher unmethylated profile of the MMP9 gene was found in periapical granulomas and radicular cysts compared with healthy mucosa. In addition, higher MMP9 mRNA expression was observed in the periapical lesions compared with healthy tissues. The present study suggests that the unmethylated status of the MMP9 gene in periapical lesions may explain the observed up-regulation of messenger RNA transcription in these lesions. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Effects of ß-TCP scaffolds on neurogenic and osteogenic differentiation of human embryonic stem cells.

PubMed

Arpornmaeklong, Premjit; Pressler, Michael J

2018-01-01

Extracellular matrix (ECM) and adhesion molecules play crucial roles in regulating growth and differentiation of stem cells. The current study aimed to investigate the effects of beta-tricalcium phosphate (ß-TCP) scaffolds on differentiation and expression of ECM and adhesion molecules of human embryonic stem cells (hESCs). Undifferentiated hESCs were seeded on ß-TCP scaffolds and cell culture plates and cultured in growth and osteogenic medium for 21 days. Scanning electron microscopy (SEM) displayed adhesion and growth of hESCs on the porous ß-TCP scaffolds. Histological analysis, immunohistochemical staining and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) demonstrated that the scaffolds supported growth and differentiation of hESCs. Expression levels of neural crest related genes (AP2a, FoxD3, HNK1, P75, Sox1, Sox10) and osteoblast-related genes (Runx2, SPP1 and BGLA) on the scaffolds in osteogenic medium were significantly higher than on the scaffolds in growth and cell culture plates in osteogenic medium, respectively (p<0.05). Polymerase chain reaction array experiments demonstrated increased expression of ECM and adhesion molecule-related genes on the scaffolds. In conclusion, osteoconductive scaffolds such as ß-TCP scaffolds promoted differentiation of hESCs, particularly expression of genes related to neural crest stem cell and osteoblastic differentiations. Beta-TCP scaffolds could be an alternative cell culture substrate for neural crest and osteogenic differentiation of hESCs. Optimization of culture medium may be necessary to enhance lineage restriction of hESCs on the ß-TCP scaffolds. Copyright © 2017 Elsevier GmbH. All rights reserved.

Evaluation of reference gene suitability for quantitative expression analysis by quantitative polymerase chain reaction in the mandibular condyle of sheep.

PubMed

Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin

2015-10-01

Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.

[Neurological adaptations to hypoxia in Tibetan antelope (Pantholops hodgsonii) with a view of molecular biology of respiratory globin-neuroglobin].

PubMed

Bai, Zhen-Zhong; Yang, Ying-Zhong; Jin, Guo-En; Ma, Lan; Ge, Ri-Li

2012-11-01

Neuroglobin (Ngb) is a respiratory protein that is preferentially expressed in brain of mouse and man. In this article, Tibetan antelope, living at altitude of 3 000-5 000 m for millions of years, was selected as the model of hypoxia-tolerant adaptation species. Using reverse transcription polymerase chain reaction (RT-PCR) and Western blot techniques, expression of Ngb gene was amplified and analyzed in antelope brain tissue. Our results showed that Ngb homology protein in Tibetan antelope was identified with more sequence similarity with cattle (96%), sheep (95%), and human (95%). We detected that there were some mutations occurred in the Open Reading Frame of Ngb in Tibetan antelope compared with sheep. Phylogenetic analysis of Ngb chain showed that it was closer to cattle than the others. This study suggests possible roles of central nervous system enriched Ngb in adaptation of Tibetan antelope to extremely high altitude.

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

TS mRNA levels can predict pemetrexed and raltitrexed sensitivity in colorectal cancer.

PubMed

Zhang, Qun; Shen, Jie; Wang, Hao; Hu, Jing; Yu, Lixia; Xie, Li; Wei, Jia; Liu, Baorui; Guan, Wenxian; Qian, Xiaoping

2014-02-01

The purpose of the study is to analyze the relationship between tumor thymidylate synthase (TS) mRNA expression levels and raltitrexed/pemetrexed/5-FU sensitivity. We collected freshly removed colorectal tumor specimens from 50 patients. Chemosensitivities to anticancer drugs were evaluated by histoculture drug response assay. We adopted quantitative reverse transcription polymerase chain reaction for TS mRNA detection and immunohistochemical staining for assessing TS expression in tumor tissues. There is a significant relationship between TS mRNA expression levels and in vitro chemosensitivity of freshly removed colorectal tumor specimens to pemetrexed (P < 0.001)/raltitrexed (P = 0.004)/5-FU (P = 0.007). TS mRNA expression levels can predict pemetrexed and raltitrexed sensitivity in colorectal cancer.

Induction of vascular endothelial growth factor expression in human pulp fibroblasts stimulated with black-pigmented Bacteroides.

PubMed

Yang, L-C; Tsai, C-H; Huang, F-M; Su, Y-F; Lai, C-C; Liu, C-M; Chang, Y-C

2004-09-01

To investigate the effect of black-pigmented Bacteroides on the expression of vascular endothelial growth factor (VEGF) gene in human pulp fibroblasts. The supernatants of Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia were used to evaluate VEGF gene expression in human pulp fibroblasts. The levels of mRNAs were measured by the quantitative reverse-transcriptase polymerase chain reaction analysis. Black-pigmented Bacteroides induced significantly high levels of VEGF mRNA gene expression in human pulp fibroblasts (P < 0.05). In addition, the expression of VEGF depended on the bacteria tested. Black-pigmented Bacteroides may be involved in developing pulpal disease through the stimulation of VEGF production that would lead to the expansion of the vascular network coincident to progression of the inflammation.

Quantitation of cytokine mRNA expression as an endpoint for prediction and diagnosis of xenobiotic-induced hypersensitivity reactions.

PubMed

Gaspard, I; Kerdine, S; Pallardy, M; Lebrec, H

1999-09-01

Xenobiotic-induced hypersensitivity reactions are immune-mediated effects that involve specific antibodies and/or effector and regulatory T lymphocytes. Cytokines are key mediators of such responses and must be considered as possible endpoints for predicting sensitizing potency of drugs and chemicals, as well as for helping diagnosis of allergy. Detecting cytokine production at the protein level has been shown to not be always sensitive enough. This paper describes three examples of the utilization of semiquantitative or competitive reverse transcription polymerase chain reaction analysis of interleukin-4, interferon gamma, and interleukin-1beta mRNAs as endpoints for assessing T-cell or dendritic cell responses to sensitizing drugs (beta-lactam antibiotics) or chemicals (dinitrochlorobenzene). Copyright 1999 Academic Press.

Clinical value of miR-452-5p expression in lung adenocarcinoma: A retrospective quantitative real-time polymerase chain reaction study and verification based on The Cancer Genome Atlas and Gene Expression Omnibus databases.

PubMed

Gan, Xiao-Ning; Luo, Jie; Tang, Rui-Xue; Wang, Han-Lin; Zhou, Hong; Qin, Hui; Gan, Ting-Qing; Chen, Gang

2017-05-01

The role and mechanism of miR-452-5p in lung adenocarcinoma remain unclear. In this study, we performed a systematic study to investigate the clinical value of miR-452-5p expression in lung adenocarcinoma. The expression of miR-452-5p in 101 lung adenocarcinoma patients was detected by quantitative real-time polymerase chain reaction. The Cancer Genome Atlas and Gene Expression Omnibus databases were joined to verify the expression level of miR-452-5p in lung adenocarcinoma. Via several online prediction databases and bioinformatics software, pathway and network analyses of miR-452-5p target genes were performed to explore its prospective molecular mechanism. The expression of miR-452-5p in lung adenocarcinoma in house was significantly lower than that in adjacent tissues (p < 0.001). Additionally, the expression level of miR-452-5p was negatively correlated with several clinicopathological parameters including the tumor size (p = 0.014), lymph node metastasis (p = 0.032), and tumor-node-metastasis stage (p = 0.036). Data from The Cancer Genome Atlas also confirmed the low expression of miR-452 in lung adenocarcinoma (p < 0.001). Furthermore, reduced expression of miR-452-5p in lung adenocarcinoma (standard mean deviations = -0.393, 95% confidence interval: -0.774 to -0.011, p = 0.044) was validated by a meta-analysis. Five hub genes targeted by miR-452-5p, including SMAD family member 4, SMAD family member 2, cyclin-dependent kinase inhibitor 1B, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon, and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta, were significantly enriched in the cell-cycle pathway. In conclusion, low expression of miR-452-5p tends to play an essential role in lung adenocarcinoma. Bioinformatics analysis might be beneficial to reveal the potential mechanism of miR-452-5p in lung adenocarcinoma.

Molecular cloning, characterization, and expression analysis of an ecdysone receptor homolog in Teleogryllus emma (Orthoptera: Gryllidae).

PubMed

He, Hui; Xi, Gengsi; Lu, Xiao

2015-01-01

Ecdysteroids are steroid hormones that play important roles in the regulation of Arthropoda animal growth development, larvae ecdysis, and reproduction. The effect of ecdysteroids is mediated by ecdysteroid receptor (EcR). The ecdysone receptor (EcR) belongs to the superfamily of nuclear receptors (NRs) that are ligand-dependent transcription factors. Ecdysone receptor is present only in invertebrates and plays a critical role in regulating the expression of a series of genes during development and reproduction. Here, we isolated and characterized cDNA of the cricket Teleopgryllus emma (Ohmachi & Matsuura) (Orthoptera: Gryllidae) and studied mRNA expression pattern using real time-polymerase chain reaction. The full-length cDNA of T. emma EcR, termed TeEcR, is 2,558 bp and contains a 5'-untranslated region of 555 bp and a 3'-untranslated region of 407 bp. The open reading frame of TeEcR encodes deduced 531-amino acid peptides with a predicted molecular mass of 60.7 kDa. The amino acid sequence of T. emma EcR was similar to that of known EcR especially in the ligand-binding domain of insect EcR. Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare TeEcR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeEcR mRNA is differentially expressed during T. emma development, with the highest expression level in late-instar larvae of the body and lowest in third instar. The levels of TeEcR transcripts also vary among gonads development, and levels in ovaries were higher than in testes at every developmental stage. These results suggest that TeEcR may have potential significance to regulate the morphological structure and gonad development of T. emma, due to its expression in different developmental periods. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Molecular Cloning, Characterization, and Expression Analysis of an Ecdysone Receptor Homolog in Teleogryllus emma (Orthoptera: Gryllidae)

PubMed Central

He, Hui; Xi, Gengsi; Lu, Xiao

2015-01-01

Ecdysteroids are steroid hormones that play important roles in the regulation of Arthropoda animal growth development, larvae ecdysis, and reproduction. The effect of ecdysteroids is mediated by ecdysteroid receptor (EcR). The ecdysone receptor (EcR) belongs to the superfamily of nuclear receptors (NRs) that are ligand-dependent transcription factors. Ecdysone receptor is present only in invertebrates and plays a critical role in regulating the expression of a series of genes during development and reproduction. Here, we isolated and characterized cDNA of the cricket Teleopgryllus emma (Ohmachi & Matsuura) (Orthoptera: Gryllidae) and studied mRNA expression pattern using real time-polymerase chain reaction. The full-length cDNA of T. emma EcR, termed TeEcR, is 2,558 bp and contains a 5′-untranslated region of 555 bp and a 3′-untranslated region of 407 bp. The open reading frame of TeEcR encodes deduced 531-amino acid peptides with a predicted molecular mass of 60.7 kDa. The amino acid sequence of T. emma EcR was similar to that of known EcR especially in the ligand-binding domain of insect EcR. Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare TeEcR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeEcR mRNA is differentially expressed during T. emma development, with the highest expression level in late-instar larvae of the body and lowest in third instar. The levels of TeEcR transcripts also vary among gonads development, and levels in ovaries were higher than in testes at every developmental stage. These results suggest that TeEcR may have potential significance to regulate the morphological structure and gonad development of T. emma, due to its expression in different developmental periods. PMID:25797799

mRNA expression OF IFN-λs in the gingival tissue of chronic and aggressive periodontitis patients: A polymerase chain reaction study.

PubMed

Bilichodmath, Shivaprasad; Nair, Sruthi K; Bilichodmath, Rekha; Mangalekar, Sachin B

2018-05-01

Several studies have proven the existence of herpesviruses in periodontal pockets of chronic and aggressive periodontitis patients. Recently discovered interferon lambda (IFN-λ) has antiviral properties and is induced by herpesviruses. The present study was aimed at quantitative analysis of mRNA expression of IFN-λs (IFN-λ1, IFN-λ2, IFN-λ3) in the gingival tissues of chronic and aggressive periodontitis patients. A total of 90 participants (50 males and 40 females; age ranging from 19 to 50 years, mean age 31.50±7.8) were categorized into three groups as healthy participants, chronic periodontitis patients and aggressive periodontitis patients. mRNA expression of IFN-λs in gingival tissues was estimated using reverse transcriptase polymerase chain reaction and was correlated with clinical parameters such as gingival index (GI), probing pocket depth (PPD), and clinical attachment level (CAL). mRNA of IFN-λ1, IFN-λ2 and IFN-λ3 was expressed in gingival tissues of healthy participants, chronic and aggressive periodontitis patients. Highest level of IFN-λ1 was observed in aggressive periodontitis patients (3.049±9.793), whereas IFN-λ2 (4.322±11.310) and IFN-λ3 (11.932±27.479) were maximum in chronic periodontitis patients. The difference in the mRNA expression of IFN-λ1 (p = 0.008) and IFN-λ3 (p = 0.043) among three groups was statistically significant CONCLUSION: Increased quantity of IFN-λs in chronic and aggressive periodontitis patients suggests a role in periodontitis. Variation in the expression of IFN-λ1 and IFN-λ3 in periodontitis patients needs to be further evaluated. The mRNA expression of antiviral IFN-λs in gingival tissues might enhance our understanding related to viral pathogenesis of periodontal diseases. This article is protected by copyright. All rights reserved. © 2018 American Academy of Periodontology.

The melanocortin receptor agonist NDP-MSH impairs the allostimulatory function of dendritic cells.

PubMed

Rennalls, La'Verne P; Seidl, Thomas; Larkin, James M G; Wellbrock, Claudia; Gore, Martin E; Eisen, Tim; Bruno, Ludovica

2010-04-01

As alpha-melanocyte-stimulating hormone (alpha-MSH) is released by immunocompetent cells and has potent immunosuppressive properties, it was determined whether human dendritic cells (DCs) express the receptor for this hormone. Reverse transcription-polymerase chain reaction detected messenger RNA specific for all of the known melanocortin receptors in DCs. Mixed lymphocyte reactions also revealed that treatment with [Nle(4), DPhe(7)]-alpha-MSH (NDP-MSH), a potent alpha-MSH analogue, significantly reduced the ability of DCs to stimulate allogeneic T cells. The expression of various cell surface adhesion, maturation and costimulatory molecules on DCs was also investigated. Although treatment with NDP-MSH did not alter the expression of CD83 and major histocompatibility complex class I and II, the surface expression of CD86 (B7.2), intercellular adhesion molecule (ICAM-1/CD54) and CD1a was reduced. In summary, our data indicate that NDP-MSH inhibits the functional activity of DCs, possibly by down-regulating antigen-presenting and adhesion molecules and that these events may be mediated via the extracellular signal-regulated kinase 1 and 2 pathway.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

Selection and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Studies in Mossy Maze Polypore, Cerrena unicolor (Higher Basidiomycetes).

PubMed

Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun

2016-01-01

With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.

Genome shuffling of Saccharomyces cerevisiae for enhanced glutathione yield and relative gene expression analysis using fluorescent quantitation reverse transcription polymerase chain reaction.

PubMed

Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming

2016-08-01

Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

PubMed

Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

2012-02-01

Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

Superoxide overproduction and kidney fibrosis: a new animal model

PubMed Central

Guimarães-Souza, Nadia Karina; Yamaleyeva, Liliya Marsovna; Lu, Baisong; Ramos, Ana Claudia Mallet de Souza; Bishop, Colin Edward; Andersson, Karl Erik

2015-01-01

Objective To establish whether the mutation in the Immp2L gene induces renal fibrosis and whether aging exacerbates renal morphology in mice. Methods Female mutant mice with mutation in the inner mitochondrial membrane peptidase 2-like protein at 3 and 18 months of age were used. Renal fibrosis was analyzed using classic fibrosis score, Masson’s trichrome staining, and analysis of profibrotic markers using real time polymerase chain reaction (superoxide dismutase 1, metalloproteinase-9, erythropoietin, transforming growth factor beta), and immunostaining (fibroblasts and Type IV collagen). Oxidative stress markers were determined by immunohistochemistry. The number of renal apoptotic cells was determined. Renal function was estimated by serum creatinine. Results Young mutant mice had significantly more glomerulosclerosis than age-matched mice (p=0.034). Mutant mice had more tubular casts (p=0.025), collagen deposition (p=0.019), and collagen type IV expression (p<0.001). Superoxide dismutase 1 expression was significantly higher in young mutants (p=0.038). Old mutants exhibited significantly higher expression of the fibroblast marker and macrophage marker (p=0.007 and p=0.012, respectively). The real time polymerase chain reaction of metalloproteinase-9 and erythropoietin were enhanced 2.5- and 6-fold, respectively, in old mutants. Serum creatinine was significantly higher in old mutants (p<0.001). Conclusion This mutation altered renal architecture by increasing the deposition of extracellular matrix, oxidative stress, and inflammation, suggesting a protective role of Immp2L against renal fibrosis. PMID:25993073

Antitumor and antiangiogenic activities of anti-vascular endothelial growth factor hairpin ribozyme in human hepatocellular carcinoma cell cultures and xenografts.

PubMed

Li, Li-Hua; Guo, Zi-Jian; Yan, Ling-Ling; Yang, Ji-Cheng; Xie, Yu-Feng; Sheng, Wei-Hua; Huang, Zhao-Hui; Wang, Xue-Hao

2007-12-21

To study the effectiveness and mechanisms of anti- human vascular endothelial growth factor (hVEGF) hairpin ribozyme on angiogenesis, oncogenicity and tumor growth in a hepatocarcinoma cell line and a xenografted model. The artificial anti-hVEGF hairpin ribozyme was transfected into hepatocarcinoma cell line SMMC-7,721 and, subsequently, polymerase chain reaction (PCR) and reverse transcription polymerase chain reaction (RT-PCR) were performed to confirm the ribozyme gene integration and transcription. To determine the effects of ribozyme ,VEGF expression was detected by semiquantitative RT-PCR and enzyme liked immunosorbent assay (ELISA). MTT assay was carried out to measure the cell proliferation. Furthermore,the transfected and control cells were inoculated into nude mice respectively, the growth of cells in nude mice and angiogenesis were observed. VEGF expression was down-regulated sharply by ribozyme in transfected SMMC-7,721 cells and xenografted tumor. Compared to the control group, the transfected cells grew slower in cell cultures and xenografts, and the xenograft formation was delayed as well. In addition, the microvessel density of the xenografted tumor was obviously declined in the transfected group. As demonstrated by microscopy,reduction of VEGF production induced by ribozyme resulted in a significantly higher cell differentiation and less proliferation vigor in xenografted tumor. Anti-hVEGF hairpin ribozyme can effectively inhibit VEGF expression and growth of hepatocarcinoma in vitro and in vivo. VEGF is functionally related to cell proliferation, differentiation and tumori-genesis in hepatocarcinoma.

Primary porcine Kupffer cell phagocytosis of human platelets involves the CD18 receptor.

PubMed

Chihara, Ray K; Paris, Leela L; Reyes, Luz M; Sidner, Richard A; Estrada, Jose L; Downey, Susan M; Wang, Zheng-Yu; Tector, A Joseph; Burlak, Christopher

2011-10-15

Hepatic failure has been treated successfully with clinical extracorporeal perfusions of porcine livers. However, dog-to-pig and pig-to-baboon liver xenotransplant models have resulted in severe bleeding secondary to liver xenograft-induced thrombocytopenia. Kupffer cells (KC) are abundant phagocytic cells in the liver. KC express the CD11b/CD18 receptor, which has been implicated in chilled platelet binding and phagocytosis through interaction with platelet surface proteins and carbohydrates. We sought to identify the role of KC CD18 in liver xenograft-induced thrombocytopenia. Primary pig KC were characterized by flow cytometry, immunoblots, and quantitative polymerase chain reaction. Pig KC were used in inhibition assays with fluorescently labeled human platelets. The CD18 receptor was targeted for siRNA knockdown. Domestic and α1,3-galactosyltransferase double knockout porcine KC cultures were approximately 92% positive for CD18 as detected by quantitative polymerase chain reaction and flow cytometry. Use of CD18 blocking antibodies resulted in reduction of human platelet binding and phagocytosis. Additionally, asialofetuin, not fetuin, inhibited platelet phagocytosis suggesting the involvement of an oligosaccharide-binding site. Furthermore, reduced CD18 expression by siRNA resulted in decreased human platelet binding. Our data suggest that primary pig KC bind and phagocytose human platelets with involvement of CD18. Further understanding and modification of CD18 expression in pigs may result in a liver xenograft with reduced thrombocytopenic effects, which could be used as a bridge to allogeneic liver transplantation.

Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

PubMed

Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

2017-05-01

Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

HLA-B73: An atypical HLA-B molecule carrying a Bw6-epitope motif variant and a B pocket identical to HLA-B27

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilches, C.; Pablo, R. de; Herrero, M.J.

1994-12-31

HLA-B73, first described by Mayr and Kirnbauer (1981), is a poorly characterized allospecificity, serologically related to the B7-CREG. We polymerase chain reaction-amplified, cloned and sequenced the HLA-B alleles of the B-LCL LE023, established from a Spanish Caucasoid individual expressing HLA-B73. 5 refs., 2 figs.

Transcription Analysis of the Beta-Glucosidase Precursor in Wild-Type and l-4i Mutant Bombyx mori (Lepidoptera: Bombycidae).

PubMed

Kang, Lequn; Huang, Fei; Wu, Fan; Zhao, Qiaoling

2015-01-01

Lethal fourth-instar larvae (l-4i) mutant of Bombyx mori, a recently discovered novel mutant, die from energy depletion due to genetic mutation. Beta-glucosidase is a common digestive enzyme that hydrolyzes cellulose in the diet to provide energy. In this study, the mRNA expression profiles of B. mori beta-glucosidase precursor (BmpreBG) were characterized by reverse transcription polymerase chain reaction and quantitative real-time polymerase chain reaction. The transcription level of BmpreBG varied in different tissues and developmental stages, except in the pupa and moth, which are the no-diet period. Remarkably, the mRNA expression level of BmpreBG was sharply reduced in l-4i but not in the wild type, which suggested that the digestive function of the mutant was severely damaged. This was consistent with the l-4i phenotypic traits of not eating mulberries, lack of energy, and ultimate death. 5'-rapid amplification of cDNA ends showed, for the first time, that BmpreBG has a 160-bp 5'-untranslated region. These findings suggested that B. mori β-glucosidase precursor was involved in the death process of l-4i mutant larvae. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction.

PubMed

Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun

2012-10-01

Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

Expression of immunoglobulin G in human podocytes, and its role in cell viability and adhesion.

PubMed

Jing, Ziyang; Deng, Hui; Ma, Junfan; Guo, Yanhong; Liang, Yaoxian; Wu, Rui; A, Lata; Geng, Zihan; Qiu, Xiaoyan; Wang, Yue

2018-06-01

Podocyte injury occurs during the initiation and development of numerous forms of glomerular disease, and antibodies targeting podocytes have become a biomarker for diagnosis and monitoring treatment response. Accumulating evidence has suggested that immunoglobulin (Ig) is expressed in non‑B lineage cells, including epithelial cancer cells, myeloid cells and several types of normal cells. The main aim of the present study was to ascertain the expression of IgG in human podocytes and to determine its potential role in cellular bioactivity. The present study detected positive staining for IgG heavy chain (Igγ) and its subtype γ4, and the light chains κ and λ in the cytoplasm or on the membrane by immunofluorescence. In addition, positive bands were detected for Igγ, γ1, γ3, γ4, κ and λ in the lysates of a podocyte cell line by western blotting. Mass spectrometry confirmed IgG1 as an intact tetramer in the culture supernatant. Constant region transcripts of Igγ, γ1, γ3, γ4, κ and λ were identified by reverse transcription‑polymerase chain reaction, and DNA sequencing of these transcripts revealed 96‑99% similarity with Ig mRNAs in the National Center for Biotechnology Information database. Compared with the diverse gene rearrangements from B cell-derived Ig, podocyte‑derived Ig exhibited conservative V(D)J patterns in the variable regions of Igγ and κ chains. Furthermore, the present study investigated the mechanism underlying IgG production in these cells by examining the expression of recombination activating gene (RAG)1, RAG2 and activation‑induced cytidine deaminase. The expression levels of these proteins suggested that podocyte‑derived Ig and traditional Ig may be generated in a similar manner. Furthermore, small interfering RNA‑mediated downregulation of IgG expression reduced podocyte viability and adhesive capabilities. These findings suggested that IgG is expressed in podocytes and that this expression may be associated with podocyte function. Due to its potential biological and clinical significance, this phenomenon warrants further investigation.

Higher risk of cytomegalovirus reactivation in human immunodeficiency virus-1-infected patients homozygous for MICA5.1.

PubMed

Moenkemeyer, Maren; Heiken, Hans; Schmidt, Reinhold E; Witte, Torsten

2009-03-01

Infection with cytomegalovirus (CMV) induces surface expression of major histocompatibility complex (MHC)-class-I-chain-related A (MICA), a ligand for NKG2D. This leads to improved recognition and elimination of infected cells by natural killer (NK) as well as CD8+ T cells. The MICA5.1 allele codes for a truncated protein. This study was performed to test whether impaired expression of a functional MICA protein would influence the susceptibility to severe CMV reactivation in immunocompromised individuals. In this study, the frequency of MICA5.1 was assessed by polymerase chain reaction in 230 Caucasian human immunodeficiency virus (HIV)-1-infected patients and in 219 healthy controls. Patients co-infected with hepatitis C virus (HCV) and GB virus-C served as controls. MICA5.1 allele was analyzed by polymerase chain reaction. Association of MICA5.1 homozygosity and risk of CMV reactivation was calculated by Pearson chi2 test. Comparison of patients with and without a history of CMV disease manifestation revealed that homozygous MICA5.1 genotype was present in a significantly higher frequency in patients with CMV reactivation (33%) than in those without (16%; p 0.032; odds ratio 0.330). The percentage was similar in HIV-1-infected patients and healthy controls. Furthermore, there was no difference in the frequency of MICA5.1 with respect to infection with HCV and GB virus-C. Our study provides the first in vivo demonstration of an association between homozygous MICA5.1 genotype and susceptibility to CMV reactivation in immunocompromised individuals.

Involvement of Resveratrol and ω-3 Polyunsaturated Fatty Acids on Sirtuin 1 Gene Expression in THP1 Cells.

PubMed

Tsuchiya, Takafumi; Endo, Ayano; Tsujikado, Kyoko; Inukai, Toshihiko

2017-10-01

Resveratrol, a kind of polyphenol, has the potential to activate the longevity gene in several cells, in the same manner as calorie restriction. We investigated the effect of resveratrol and ω-3-line polyunsaturated fatty acid on surtuin 1 (SIRT1) gene expression in human monocytes (THP1) cells. We examined the gene expression of THP1 cells using real-time polymerase chain reaction and Western blotting analysis. Resveratol, eicosapentaenoic acid (EPA) and docosahexaeanoic acid (DHA) as n-3 polyunsaturated fatty acid were added on THP1 cells. We observed the changes in the SIRT1 gene expression in those cells, under various doses of agents and in time courses. Then, we examined the interaction of glucose and mannitol on those agents׳ effect of the gene expression. The concentration range of glucose and mannitol was from 5-20mM, respectively. The SIRT1 gene expression could be defined in 24 and 48 hours both in real-time polymerase chain reaction analysis and in Western blotting. Resveratrol showed SIRT1 gene expression in a dose-dependent manner in the range of 0-20μM in both analyses. Although EPA at 10μM showed marked increase in SIRT1 gene expression compared to control condition in Western blotting, this phenomenon was not in dose-dependent manner. DHA did not exhibit any augmentation of SIRT1 gene expression in a dose-dependent manner in the range of 0-20μM in both analyses. We refined the dose-dependent inhibition of the SIRT1 gene expression within 20mM glucose medium. Although 20mM did not exhibit any inhibition, 10μM resveratrol induced the gene expression compared to control medium. Both 5 and 15mM mannitol medium did not significantly alter basic gene expression and 10μM resveratrol-induced gene expression. The present results suggest that resveratrol and EPA, but not DHA, markedly activated the SIRT1 gene expression in THP1 cells, and that high glucose medium could inhibit the basic gene expression, but not powerful resveratrol-induced gene expression, in those cells. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

Chaperone-Assisted Soluble Expression of a Humanized Anti-EGFR ScFv Antibody in E. Coli

PubMed Central

Veisi, Kamal; Farajnia, Safar; Zarghami, Nosratollah; Khoram Khorshid, Hamid Reza; Samadi, Nasser; Ahdi Khosroshahi, Shiva; Zarei Jaliani, Hossein

2015-01-01

Purpose: Formation of inclusion bodies is a considerable obstacle threatening the advantages of E. coli expression system to serve as the most common and easiest system in recombinant protein production. To solve this problem, several strategies have been proposed among which application of molecular chaperones is of remarkable consideration. The aim of this study was to evaluate the effects of molecular chaperones on soluble expression of aggregation-prone humanized single chain antibody. Methods: To increase the solubility of a humanized single chain antibody (hscFv), different chaperone plasmids including PG-tf2 (GroES- GroEL- tig), ptf16 (tig) and pGro7 (GroES- GroEL) were co-expressed in BL21 cells containing pET-22b- hscFv construct. The solubility of recombinant hscFv was analyzed by SDS-PAGE. After purification of soluble hscFv by Ni-NTA column, the biological activity and cytotoxicity of the recombinant protein were tested by ELISA and MTT assay, respectively. Results: SDS-PAGE analysis of the hscFv revealed that chaperone utility remarkably increased (up to 50%) the solubility of the protein. ELISA test and MTT assay analyses also confirmed the biological activity of the gained hscFv in reaction with A431 cells (OD value: 2.6) and inhibition of their proliferation, respectively. Conclusion: The results of this study revealed that co-expression of chaperones with hscFv leads to remarkable increase in the solubility of the recombinant hscFv, which could be of great consideration for large scale production of recombinant single chain antibodies. PMID:26793607

Tissue Phthalate Levels Correlate With Changes in Immune Gene Expression in a Population of Juvenile Wild Salmon.

PubMed

Martins, Kelly; Hagedorn, Birgit; Ali, Shareen; Kennish, John; Applegate, Ben; Leu, Matthias; Epp, Lidia; Pallister, Chris; Zwollo, Patty

2016-07-01

Phthalates have detrimental effects on health and have been shown to dysregulate the immune system of mammals, birds, and fish. We recently reported that di(2-ethylhexyl) phthalate exposure reduces the abundance and inhibits the proliferation of rainbow trout (Oncorhynchus mykiss) IgM(+) B lymphocytes and expression of secreted immunoglobulin heavy-chain mu transcripts in an in vitro culture system. We proposed that phthalates act as immunomodulators by modifying the normal B cell-activation pathways by accelerating B cell differentiation while suppressing plasmablast expansion, thus resulting in fewer IgM-secreting plasma cells. This hypothesis was tested here in an in vivo field study of juvenile Dolly Varden (Salvelinus malma) from a plastic-polluted lake in the Gulf of Alaska. Fish tissues were analyzed for both phthalate levels using liquid chromatography-coupled tandem mass spectrometry and for changes in immune gene expression using reverse transcriptase-real time polymerase chain reaction. Results showed that fish with higher tissue levels of di(2-ethylhexyl) phthalate, di(n-butyl) phthalate, and/or dimethyl phthalate expressed significantly fewer secreted and membrane-bound immunoglobulin heavy-chain mu and Blimp1 transcripts in their hematopoietic tissue. This suggests that in vivo uptake of phthalates in fish changes the expression of B cell-specific genes. Chronic exposure to phthalates likely dysregulates normal B-lymphoid development and antibody responses in salmonids and may increase susceptibility to infection. Given the conserved nature of B-lineage cells in vertebrate animals, other marine species may be similarly affected by chronic phthalate exposure.

Analysis of myosin heavy chain mRNA expression by RT-PCR

NASA Technical Reports Server (NTRS)

Wright, C.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

1997-01-01

An assay was developed for rapid and sensitive analysis of myosin heavy chain (MHC) mRNA expression in rodent skeletal muscle. Only 2 microg of total RNA were necessary for the simultaneous analysis of relative mRNA expression of six different MHC genes. We designed synthetic DNA fragments as internal standards, which contained the relevant primer sequences for the adult MHC mRNAs type I, IIa, IIx, IIb as well as the embryonic and neonatal MHC mRNAs. A known amount of the synthetic fragment was added to each polymerase chain reaction (PCR) and yielded a product of different size than the amplified MHC mRNA fragment. The ratio of amplified MHC fragment to synthetic fragment allowed us to calculate percentages of the gene expression of the different MHC genes in a given muscle sample. Comparison with the traditional Northern blot analysis demonstrated that our reverse transcriptase-PCR-based assay was reliable, fast, and quantitative over a wide range of relative MHC mRNA expression in a spectrum of adult and neonatal rat skeletal muscles. Furthermore, the high sensitivity of the assay made it very useful when only small quantities of tissue were available. Statistical analysis of the signals for each MHC isoform across the analyzed samples showed a highly significant correlation between the PCR and the Northern signals as Pearson correlation coefficients ranged between 0.77 and 0.96 (P < 0.005). This assay has potential use in analyzing small muscle samples such as biopsies and samples from pre- and/or neonatal stages of development.

Activation-Induced Killer Cell Immunoglobulin-like Receptor 3DL2 Binding to HLA-B27 Licenses Pathogenic T Cell Differentiation in Spondyloarthritis.

PubMed

Ridley, Anna; Hatano, Hiroko; Wong-Baeza, Isabel; Shaw, Jacqueline; Matthews, Katherine K; Al-Mossawi, Hussein; Ladell, Kristin; Price, David A; Bowness, Paul; Kollnberger, Simon

2016-04-01

In the spondyloarthritides (SpA), increased numbers of CD4+ T cells express killer cell immunoglobulin-like receptor 3DL2 (KIR-3DL2). The aim of this study was to determine the factors that induce KIR-3DL2 expression, and to characterize the relationship between HLA-B27 and the phenotype and function of KIR-3DL2-expressing CD4+ T cells in SpA. In total, 34 B27+ patients with SpA, 28 age- and sex-matched healthy controls (20 B27- and 8 B27+), and 9 patients with rheumatoid arthritis were studied. KIR-3DL2 expression and other phenotypic characteristics of peripheral blood and synovial fluid CD4+ T cells were studied by flow cytometry, quantitative polymerase chain reaction, and Western blotting. T cell receptor clonality was determined by template-switch anchored reverse transcription-polymerase chain reaction and sequencing analysis. Cytokines were measured by enzyme-linked immunosorbent assay. Cellular activation induced KIR-3DL2 expression on both naive and effector CD4+ T cells. KIR-3DL2 binding to B27+ cells promoted expression of KIR-3DL2, the Th17-specific transcription factor retinoic acid receptor-related orphan nuclear receptor γt, and the antiapoptotic factor B cell lymphoma 2. KIR-3DL2+CD4+ T cells in patients with ankylosing spondylitis were oligoclonal and enriched for markers of T cell activation and for the gut homing receptor CCR9. In the presence of B27+ antigen-presenting cells, KIR-3DL2+CD4+ T cells produced less interleukin-2 (IL-2) but more IL-17. This effect was blocked by HC10, an antibody that inhibits the binding of KIR-3DL2 to B27 heavy chains. KIR-3DL2 binding to HLA-B27 licenses Th17 cell differentiation in SpA. These findings raise the therapeutic potential of targeting HLA-B27-KIR-3DL2 interactions for the treatment of B27+ patients with SpA. © 2016 The Authors. Arthritis & Rheumatology published by Wiley Periodicals, Inc. on behalf of the American College of Rheumatology.

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

Expression of a chemokine by ciliary body epithelium in horses with naturally occurring recurrent uveitis and in cultured ciliary body epithelial cells.

PubMed

Gilger, Brian C; Yang, Ping; Salmon, Jacklyn H; Jaffe, Glenn J; Allen, Janice B

2002-07-01

To determine whether a chemokine (RANTES)-like protein expressed by ciliary epithelium plays a role in uveitis. 3 clinically normal horses intradermal, 5 eyes from 5 horses with recurrent uveitis, and 10 normal eyes from 5 age- and sex-matched horses. Cross-reactivity and sensitivity of recombinant human (rh)-regulated upon activation, normal T-cell expressed and secreted (RANTES) protein were evaluated in horses by use of intradermal hypersensitivity reactions and a chemotaxis assay. Aqueous humor and ciliary body of eyes from clinically normal horses and horses with uveitis were examined for RANTES expression by use of an ELISA and reverse transcription-polymerase chain reaction (RT-PCR). Expression of RANTES mRNA and protein content of primary cultures of equine ciliary pigmented epithelial cells (RT-PCR) and culture supernatant (ELISA) were measured 6 or 24 hours, respectively, after cultures were stimulated with interleukin-1beta and tumor necrosis factor-alpha. Strong reactions to intradermal hypersensitivity testing and significant chemotaxis of equine leukocytes to rh-RANTES wereas observed. Aqueous humor of eyes from horses with uveitis contained increased concentrations of rh-RANTES-like protein (mean +/- SD, 45.9+/-31.7 pg/ml), compared with aqueous humor from clinically normal horses (0 pg/ml). Ciliary body from horses with uveitis expressed RANTES mRNA, whereas ciliary body from clinically normal horses had low mRNA expression. Stimulated ciliary pigmented epithelial cells expressed increased amounts of rh-RANTES-like protein (506.1+/-298.3 pg/ml) and mRNA, compared with unstimulated samples. Ciliary epithelium may play a role in recruitment and activation of leukocytes through expression of RANTES.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Induction of Syndecan-4 by Organic-Inorganic Hybrid Molecules with a 1,10-Phenanthroline Structure in Cultured Vascular Endothelial Cells.

PubMed

Hara, Takato; Kojima, Takayuki; Matsuzaki, Hiroka; Nakamura, Takehiro; Yoshida, Eiko; Fujiwara, Yasuyuki; Yamamoto, Chika; Saito, Shinichi; Kaji, Toshiyuki

2017-02-08

Organic-inorganic hybrid molecules constitute analytical tools used in biological systems. Vascular endothelial cells synthesize and secrete proteoglycans, which are macromolecules consisting of a core protein and glycosaminoglycan side chains. Although the expression of endothelial proteoglycans is regulated by several cytokines/growth factors, there may be alternative pathways for proteoglycan synthesis aside from downstream pathways activated by these cytokines/growth factors. Here, we investigated organic-inorganic hybrid molecules to determine a variant capable of analyzing the expression of syndecan-4, a transmembrane heparan-sulfate proteoglycan, and identified 1,10-phenanthroline ( o -Phen) with or without zinc (Zn-Phen) or rhodium (Rh-Phen). Bovine aortic endothelial cells in culture were treated with these compounds, and the expression of syndecan-4 mRNA and core proteins was determined by real-time reverse transcription polymerase chain reaction and Western blot analysis, respectively. Our findings indicated that o -Phen and Zn-Phen specifically and strongly induced syndecan-4 expression in cultured vascular endothelial cells through activation of the hypoxia-inducible factor-1α/β pathway via inhibition of prolyl hydroxylase-domain-containing protein 2. These results demonstrated an alternative pathway involved in mediating induction of endothelial syndecan-4 expression and revealed organic-inorganic hybrid molecules as effective tools for analyzing biological systems.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

Up-regulation of IL-23 expression in human dental pulp fibroblasts by IL-17 via activation of the NF-κB and MAPK pathways.

PubMed

Wei, L; Liu, M; Xiong, H; Peng, B

2017-11-06

To investigate the effects of the pro-inflammatory and Th17-polarizing mediator IL-17 on HDPFs-mediated IL-23 production and the molecular mechanism involved. Interleukin (IL)-17R expression was determined by semi-quantitative reverse transcriptase-polymerase chain reaction and Western blot in cultured human dental pulp fibroblasts (HDPFs). Quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay were used to determine IL-23 mRNA and protein levels in IL-17-stimulated HDPFs, respectively. The nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinases (MAPKs) signalling pathways that mediate the IL-17-stimulated production of IL-23 was investigated using Western blot and specific signalling inhibitor analyses. Statistical analyses were performed using Kruskal-Wallis tests followed by the Mann-Whitney U-test. Statistical significance was considered when the P value < 0.05. Primary HDPFs steadily expressed IL-17R mRNA and surface-bound protein. IL-17 stimulated the expression of IL-23 mRNA and protein in cultured human dental pulp fibroblasts, which was attenuated by IL-17 or IL-17R neutralizing antibodies. In accordance with the enhanced expression of IL-23, IL-17 stimulation resulted in rapid activation of p38 MAPK, extracellular signal-regulated kinase (ERK) 1/2, c-Jun-N-terminal kinase (JNK) and NF-κB in HDPFs. Inhibitors of p38 MAPK, ERK 1/2 or NF-κB significantly suppressed, whereas blocking JNK substantially augmented IL-23 production from IL-17-stimulated HDPFs. HDPFs expressed IL-17R and responded to IL-17 to produce IL-23 via the activation of the NF-κB and MAPK signalling pathways. The findings provide insights into the cellular mechanisms of the participation of IL-17 in the activation of HDPFs in inflamed pulp tissue. © 2017 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Detection of rearrangements and transcriptional up-regulation of ALK in FFPE lung cancer specimens using a novel, sensitive, quantitative reverse transcription polymerase chain reaction assay.

PubMed

Gruber, Kim; Horn, Heike; Kalla, Jörg; Fritz, Peter; Rosenwald, Andreas; Kohlhäufl, Martin; Friedel, Godehard; Schwab, Matthias; Ott, German; Kalla, Claudia

2014-03-01

The approved dual-color fluorescence in situ hybridization (FISH) test for the detection of anaplastic lymphoma receptor tyrosine kinase (ALK) gene rearrangements in non-small-cell lung cancer (NSCLC) is complex and represents a low-throughput assay difficult to use in daily diagnostic practice. We devised a sensitive and robust routine diagnostic test for the detection of rearrangements and transcriptional up-regulation of ALK. We developed a quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay adapted to RNA isolated from routine formalin-fixed, paraffin-embedded material and applied it to 652 NSCLC specimens. The reliability of this technique to detect ALK dysregulation was shown by comparison with FISH and immunohistochemistry. qRT-PCR analysis detected unbalanced ALK expression indicative of a gene rearrangement in 24 (4.6%) and full-length ALK transcript expression in six (1.1%) of 523 interpretable tumors. Among 182 tumors simultaneously analyzed by FISH and qRT-PCR, the latter accurately typed 97% of 19 rearranged and 158 nonrearranged tumors and identified ALK deregulation in two cases with insufficient FISH. Six tumors expressing full-length ALK transcripts did not show rearrangements of the gene. Immunohistochemistry detected ALK protein overexpression in tumors with gene fusions and transcriptional up-regulation, but did not distinguish between the two. One case with full-length ALK expression carried a heterozygous point mutation (S1220Y) within the kinase domain potentially interfering with kinase activity and/or inhibitor binding. Our qRT-PCR assay reliably identifies and distinguishes ALK rearrangements and full-length transcript expression in formalin-fixed, paraffin-embedded material. It is an easy-to-perform, cost-effective, and high-throughput tool for the diagnosis of ALK activation. The expression of full-length ALK transcripts may be relevant for ALK inhibitor therapy in NSCLC.

miRNA-26b Overexpression in Ulcerative Colitis-associated Carcinogenesis.

PubMed

Benderska, Natalya; Dittrich, Anna-Lena; Knaup, Sabine; Rau, Tilman T; Neufert, Clemens; Wach, Sven; Fahlbusch, Fabian B; Rauh, Manfred; Wirtz, Ralph M; Agaimy, Abbas; Srinivasan, Swetha; Mahadevan, Vijayalakshmi; Rümmele, Petra; Rapti, Emmanouela; Gazouli, Maria; Hartmann, Arndt; Schneider-Stock, Regine

2015-09-01

Longstanding ulcerative colitis (UC) bears a high risk for development of UC-associated colorectal carcinoma (UCC). The inflammatory microenvironment influences microRNA expression, which in turn deregulates target gene expression. microRNA-26b (miR-26b) was shown to be instrumental in normal tissue growth and differentiation. Thus, we aimed to investigate the impact of miR-26b in inflammation-associated colorectal carcinogenesis. Two different cohorts of patients were investigated. In the retrospective group, a tissue microarray with 38 samples from 17 UC/UCC patients was used for miR-26b in situ hybridization and quantitative reverse transcription polymerase chain reaction analyses. In the prospective group, we investigated miR-26b expression in 25 fresh-frozen colon biopsies and corresponding serum samples of 6 UC and 15 non-UC patients, respectively. In silico analysis, Ago2-RNA immunoprecipitation, luciferase reporter assay, quantitative reverse transcription polymerase chain reaction examination, and miR-26b mimic overexpression were employed for target validation. miR-26b expression was shown to be upregulated with disease progression in tissues and serum of UC and UCC patients. Using miR-26b and Ki-67 expression levels, an UCC was predicted with high accuracy. We identified 4 novel miR-26b targets (DIP1, MDM2, CREBBP, BRCA1). Among them, the downregulation of the E3 ubiquitin ligase DIP1 was closely related to death-associated protein kinase stabilization along the normal mucosa-UC-UCC sequence. In silico functional pathway analysis revealed that the common cellular pathways affected by miR-26b are highly related to cancerogenesis and the development of gastrointestinal diseases. We suggest that miR-26b could serve as a biomarker for inflammation-associated processes in the gastrointestinal system. Because miR-26b expression is downregulated in sporadic colon cancer, it could discriminate between UCC and the sporadic cancer type.

Correlation between messenger RNA expression and protein expression of immune checkpoint-associated molecules in bladder urothelial carcinoma: A retrospective study.

PubMed

Le Goux, Constance; Damotte, Diane; Vacher, Sophie; Sibony, Mathilde; Delongchamps, Nicolas Barry; Schnitzler, Anne; Terris, Benoit; Zerbib, Marc; Bieche, Ivan; Pignot, Géraldine

2017-05-01

Immunotherapy for bladder cancer seems to have promising results. Here, we evaluated the association between messenger RNA (mRNA) and protein levels and possible prognostic value of the programmed cell death 1/programmed cell death ligand 1 (PD-1/PD-L1) and cytotoxic T-lymphocyte-associated protein 4 (CTLA4) immune checkpoint pathways during bladder carcinogenesis. Tumor samples were obtained from 155 patients (84 with muscle-invasive bladder cancer [MIBC], and 71 non-muscle-invasive bladder cancer [NMIBC]) and normal bladder tissue from 15 patients. We evaluated the mRNA expression of 3 genes in the PD-1 pathway (PD-1, PD-L1, and PD-L2) and 4 in the CTLA4 pathway (CTLA4, CD28, CD80, and CD86) in normal and tumoral human bladder samples by quantitative real-time reverse transcription polymerase chain reaction, with immunohistochemistry used to evaluate the protein expression of PD-1 and PD-L1 in tumor and immune cells. Results of molecular analyses were compared with survival analyses. As compared with normal bladder tissue, MIBC tissue showed PD-1, PD-L1, CTLA4, and CD80 overexpression (59.5%, 60.7%, 84.5%, and 92.9%, respectively), whereas overexpression was lower in NMIBC tissue (22.5%, 4.2%, 35.2%, and 46.5%, respectively). The results of reverse transcription polymerase chain reaction analysis were confirmed by immunohistochemistry, with a high correlation between mRNA and protein expression. On multivariate analyses, overexpression of the studied genes was not associated with prognosis in relapse or progression of NMIBC or in recurrence-free and overall survival of MIBC. The CTLA4 pathway appears to be deregulated along with the PD-1/PD-L1 pathway in bladder carcinogenesis, with good correlation between mRNA and protein expression endorsing the useful role of immune checkpoints, especially for a large subgroup of MIBC. Copyright © 2017 Elsevier Inc. All rights reserved.

Expression of the Long Intergenic Non-Protein Coding RNA 665 (LINC00665) Gene and the Cell Cycle in Hepatocellular Carcinoma Using The Cancer Genome Atlas, the Gene Expression Omnibus, and Quantitative Real-Time Polymerase Chain Reaction.

PubMed

Wen, Dong-Yue; Lin, Peng; Pang, Yu-Yan; Chen, Gang; He, Yun; Dang, Yi-Wu; Yang, Hong

2018-05-05

BACKGROUND Long non-coding RNAs (lncRNAs) have a role in physiological and pathological processes, including cancer. The aim of this study was to investigate the expression of the long intergenic non-protein coding RNA 665 (LINC00665) gene and the cell cycle in hepatocellular carcinoma (HCC) using database analysis including The Cancer Genome Atlas (TCGA), the Gene Expression Omnibus (GEO), and quantitative real-time polymerase chain reaction (qPCR). MATERIAL AND METHODS Expression levels of LINC00665 were compared between human tissue samples of HCC and adjacent normal liver, clinicopathological correlations were made using TCGA and the GEO, and qPCR was performed to validate the findings. Other public databases were searched for other genes associated with LINC00665 expression, including The Atlas of Noncoding RNAs in Cancer (TANRIC), the Multi Experiment Matrix (MEM), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and protein-protein interaction (PPI) networks. RESULTS Overexpression of LINC00665 in patients with HCC was significantly associated with gender, tumor grade, stage, and tumor cell type. Overexpression of LINC00665 in patients with HCC was significantly associated with overall survival (OS) (HR=1.47795%; CI: 1.046-2.086). Bioinformatics analysis identified 469 related genes and further analysis supported a hypothesis that LINC00665 regulates pathways in the cell cycle to facilitate the development and progression of HCC through ten identified core genes: CDK1, BUB1B, BUB1, PLK1, CCNB2, CCNB1, CDC20, ESPL1, MAD2L1, and CCNA2. CONCLUSIONS Overexpression of the lncRNA, LINC00665 may be involved in the regulation of cell cycle pathways in HCC through ten identified hub genes.

In vitro Fab display: a cell-free system for IgG discovery

PubMed Central

Stafford, Ryan L.; Matsumoto, Marissa L.; Yin, Gang; Cai, Qi; Fung, Juan Jose; Stephenson, Heather; Gill, Avinash; You, Monica; Lin, Shwu-Hwa; Wang, Willie D.; Masikat, Mary Rose; Li, Xiaofan; Penta, Kalyani; Steiner, Alex R.; Baliga, Ramesh; Murray, Christopher J.; Thanos, Christopher D.; Hallam, Trevor J.; Sato, Aaron K.

2014-01-01

Selection technologies such as ribosome display enable the rapid discovery of novel antibody fragments entirely in vitro. It has been assumed that the open nature of the cell-free reactions used in these technologies limits selections to single-chain protein fragments. We present a simple approach for the selection of multi-chain proteins, such as antibody Fab fragments, using ribosome display. Specifically, we show that a two-chain trastuzumab (Herceptin) Fab domain can be displayed in a format which tethers either the heavy or light chain to the ribosome while retaining functional antigen binding. Then, we constructed synthetic Fab HC and LC libraries and performed test selections against carcinoembryonic antigen (CEA) and vascular endothelial growth factor (VEGF). The Fab selection output was reformatted into full-length immunoglobulin Gs (IgGs) and directly expressed at high levels in an optimized cell-free system for immediate screening, purification and characterization. Several novel IgGs were identified using this cell-free platform that bind to purified CEA, CEA positive cells and VEGF. PMID:24586053

P120-Catenin Protects Endplate Chondrocytes From Intermittent Cyclic Mechanical Tension Induced Degeneration by Inhibiting the Expression of RhoA/ROCK-1 Signaling Pathway.

PubMed

Xu, Hong-Guang; Ma, Ming-Ming; Zheng, Quan; Shen, Xiang; Wang, Hong; Zhang, Shu-Feng; Xu, Jia-Jia; Wang, Chuan-Dong; Zhang, Xiao-Ling

2016-08-15

The changes of endplate chondrocytes induced by intermittent cyclic mechanical tension (ICMT) were observed by realtime reverse transcription-polymerase chain reaction, immunofluorescence, and Western blot analysis. To investigate the role of RhoA/ROCK-1 signaling pathway and E-cadherin/P120-catenin complex in endplate chondrocytes degeneration induced by ICMT. ICMT can induce the endplate chondrocyte degeneration. However, the relationship between P120-catenin or RhoA/ROCK-1 signaling pathway and endplate chondrocytes degeneration induced by ICMT is not clear. ICMT (strain at 0.5 Hz sinusoidal curve at 8% elongation) was applied to rat endplate chondrocytes for 6 days, 16 hours a day. The cell viability and apoptosis were examined by the LIVE/DEAD assay and flow cytometry. Histological staining was used to examine the lumbar disc tissue morphology and extracellular matrix. To regulate RhoA/ROCK-1 signaling pathway and the expression of E-cadherin and P120-catenin, RhoA/ROCK-1 pathway-specific inhibitors, E-cadherin, and p120-catenin plasmid were applied. Coimmunoprecipitation was employed to examine the interaction between E-cadherin and P120-catenin, P120-catenin, and RhoA. The related gene expression and protein location was examined by realtime reverse transcription-polymerase chain reaction, Western blot, and immunofluorescence. There was no change of viability verified by LIVE/DEAD assay and flow cytometry after ICMT loading. ICMT loading led to RhoA/ROCK-1 signaling activation and the loss of the chondrogenic phenotype of endplate chondrocytes. Inhibition of RhoA/ROCK-1 signaling pathway significantly ameliorated the degeneration induced by ICMT. The expression of P120-catenin and E-cadherin were inhibited by ICMT. ICMT reduced the interaction between P120-catenin and E-cadherin. Furthermore, over-expression of P120-catenin and E-cadherin can suppress the expression of chondrogenic gene, over-expression of P120-catenin can suppress the RhoA/ROCK-1 signaling pathway, but over-expression of E-cadherin cannot do it. P120-catenin protects endplate chondrocytes from ICMT Induced degeneration by inhibiting the expression of RhoA/ROCK-1 signaling pathway. N/A.

Decreased expression of cell adhesion genes in cancer stem-like cells isolated from primary oral squamous cell carcinomas.

PubMed

Mishra, Amrendra; Sriram, Harshini; Chandarana, Pinal; Tanavde, Vivek; Kumar, Rekha V; Gopinath, Ashok; Govindarajan, Raman; Ramaswamy, S; Sadasivam, Subhashini

2018-05-01

The goal of this study was to isolate cancer stem-like cells marked by high expression of CD44, a putative cancer stem cell marker, from primary oral squamous cell carcinomas and identify distinctive gene expression patterns in these cells. From 1 October 2013 to 4 September 2015, 76 stage III-IV primary oral squamous cell carcinoma of the gingivobuccal sulcus were resected. In all, 13 tumours were analysed by immunohistochemistry to visualise CD44-expressing cells. Expression of CD44 within The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma RNA-sequencing data was also assessed. Seventy resected tumours were dissociated into single cells and stained with antibodies to CD44 as well as CD45 and CD31 (together referred as Lineage/Lin). From 45 of these, CD44 + Lin - and CD44 - Lin - subpopulations were successfully isolated using fluorescence-activated cell sorting, and good-quality RNA was obtained from 14 such sorted pairs. Libraries from five pairs were sequenced and the results analysed using bioinformatics tools. Reverse transcription quantitative polymerase chain reaction was performed to experimentally validate the differential expression of selected candidate genes identified from the transcriptome sequencing in the same 5 and an additional 9 tumours. CD44 was expressed on the surface of poorly differentiated tumour cells, and within the The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma samples, its messenger RNA levels were higher in tumours compared to normal. Transcriptomics revealed that 102 genes were upregulated and 85 genes were downregulated in CD44 + Lin - compared to CD44 - Lin - cells in at least 3 of the 5 tumours sequenced. The upregulated genes included those involved in immune regulation, while the downregulated genes were enriched for genes involved in cell adhesion. Decreased expression of PCDH18, MGP, SPARCL1 and KRTDAP was confirmed by reverse transcription quantitative polymerase chain reaction. Lower expression of the cell-cell adhesion molecule PCDH18 correlated with poorer overall survival in the The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma data highlighting it as a potential negative prognostic factor in this cancer.

[Research of Human-mouse Chimeric Antibodies Against Ebola Virus Nucleoprotein].

PubMed

Zhou, Rongping; Sun, Lina; Liu, Yang; Wu, Wei; Li, Chuan; Liang, Mifang; Qiu, Peihong

2016-01-01

The Ebola virus is highly infectious and can result in death in ≤ 90% of infected subjects. Detection of the Ebola virus and diagnosis of infection are extremely important for epidemic control. Presently, Chinese laboratories detect the nucleic acids of the Ebola virus by real-time reverse transcription-polymerase chain reaction (RT-PCR). However, such detection takes a relatively long time and necessitates skilled personnel and expensive equipment. Enzyme-linked immunosorbent assay (ELISA) of serum is simple, easy to operate, and can be used to ascertain if a patient is infected with the Ebola virus as well as the degree of infection. Hence, ELISA can be used in epidemiological investigations and is a strong complement to detection of nucleic acids. Cases of Ebola hemorrhagic fever have not been documented in China, so quality-control material for positive serology is needed. Construction and expression of human-mouse chimeric antibodies against the nucleoprotein of the Ebola virus was carried out. Genes encoding variable heavy (VH) and variable light (VL) chains were extracted and amplified from murine hybridoma cells. Genes encoding the VH and VL chains of monoclonal antibodies were amplified by RT-PCR. According to sequence analyses, a primer was designed to amplify functional sequences relative to VH and VL chain. The eukaryotic expression vector HL51-14 carrying some human antibody heavy chain- and light chain-constant regions was used. IgG antibodies were obtained by transient transfection of 293T cells. Subsequently, immunological detection and immunological identification were identified by ELISA, immunofluorescence assay, and western blotting. These results showed that we constructed and purified two human- mouse chimeric antibodies.

The majority of atypical cpb2 genes in Clostridium perfringens isolates of different domestic animal origin are expressed.

PubMed

Kircanski, Jasmina; Parreira, Valeria R; Whiteside, Samantha; Pei, Yanlong; Prescott, John F

2012-10-12

This study examined the prevalence and expression of the "consensus" and the "atypical"cpb2 genes in Clostridium perfringens isolates from cattle, chickens, dogs, goats, horses, pigs and sheep using polymerase chain reaction (PCR), sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by Western blotting. Almost all porcine isolates (12/14) carried and expressed the consensus form of cpb2 but, when present in 108 non-porcine isolates, the gene was usually the atypical form (40 atypical versus 9 consensus). Western blotting showed expression in 30 of 40 (75%) atypical cpb2-positive isolates, considerably more frequently than reported previously. CPB2 was expressed by almost all (20/21) the consensus cpb2-positive isolates, regardless of source. Copyright © 2012 Elsevier B.V. All rights reserved.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

A Pilot Study of Circulating MicroRNA-125b as a Diagnostic and Prognostic Biomarker for Epithelial Ovarian Cancer.

PubMed

Zhu, Tao; Gao, Wen; Chen, Xi; Zhang, Ying; Wu, Meijuan; Zhang, Ping; Wang, Shihua

2017-01-01

Early diagnosis of epithelial ovarian cancer is critical for patient survival. The objective of this pilot study is to identify a circulating micro (mi)RNA as a potential biomarker for epithelial ovarian cancer. A total of 135 epithelial ovarian cancer patients and 54 benign ovarian tumor patients were recruited for this study. Using customized TaqMan low density miRNA arrays, we first screened expression levels of 48 miRNAs in sera from 18 epithelial ovarian cancer patients and 16 benign ovarian tumor patients. The most significantly and differentially expressed miRNA was then further examined in all serum samples using real-time polymerase chain reaction. Its expression was further analyzed in relationship with clinicopathological factors and patient survival. Array screening data showed that expression levels of serum miRNA-20a, miRNA-125b, miRNA-126, miRNA-355, and let-7c were significantly different between malignant and benign ovarian tumor patients. Subsequent real-time polymerase chain reaction results showed that serum miRNA-125b levels were significantly higher in epithelial ovarian cancer patients compared to benign controls. Moreover, serum miRNA-125b levels were significantly higher in ovarian cancer patients in early stages I and II, and in patients having no residual tumor following surgery, but were not associated with differentiation and histological types of ovarian cancer. Notably, the higher level of miR-125b was significantly positively correlated with progression-free survival (P = 0.035) and marginally, with overall survival (P = 0.069). miRNA-125b plays an important role in the pathogenesis and progression of epithelial ovarian cancer. Circulating miRNA-125b has the potential to become a novel biomarker for early diagnosis and prognosis prediction of epithelial ovarian cancer.

Molecular cloning and photoperiod-regulated expression of gibberellin 20-oxidase from the long-day plant spinach.

PubMed

Wu, K; Li, L; Gage, D A; Zeevaart, J A

1996-02-01

Spinach (Spinacia oleracea L.) is a long-day (LD) rosette plant in which stem growth under LD conditions is mediated by gibberellins (GAs). Major control points in spinach are the later steps of sequential oxidation and elimination of C-20 of C20-GAs. Degenerate oligonucleotide primers were used to obtain a polymerase chain reaction product from spinach genomic DNA that has a high homology with GA 20-oxidase cDNAs from Cucurbita maxima L. and Arabidopsis thaliana Heynh. This polymerase chain reaction product was used as a probe to isolate a full-length cDNA clone with an open reading frame encoding a putative 43-kD protein of 374 amino acid residues. When this cDNA clone was expressed in Escherichia coli, the fusion protein catalyzed the biosynthetic sequence GA53-->GA44-->GA19-->GA20 and GA19-->GA17. This establishes that in spinach a single protein catalyzes the oxidation and elimination of C-20. Transfer of spinach plants from short day (SD) to LD conditions caused an increase in the level of all GAs of the early-13-hydroxylation pathway, except GA53, with GA20, GA1, and GA8 showing the largest increases. Northern blot analysis indicated that the level of GA 20-oxidase mRNA was higher in plants in LD than in SD conditions, with highest level of expression in the shoot tips and elongating stems. This expression pattern of GA 20-oxidase is consistent with the different levels of GA20, GA1, and GA8 found in spinach plants grown in SD and LD conditions.

Effect of curcumin on human colon cancer multidrug resistance in vitro and in vivo.

PubMed

Lu, Wei-Dong; Qin, Yong; Yang, Chuang; Li, Lei; Fu, Zhong-Xue

2013-05-01

To determine whether curcumin reverses the multidrug resistance of human colon cancer cells in vitro and in vivo. In a vincristine-resistant cell line of human colon cancer, the cell viability of curcumin-treated cells was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Rhodamine123 efflux was evaluated to detect P-glycoprotein transporter activity, and expression of the multidrug resistance protein 1 and survivin genes was analyzed by reverse transcription polymerase chain reaction and western blotting. In addition, xenograft mouse tumors were grown and treated with curcumin. The morphology of the xenografts was investigated by hematoxylin-eosin staining. The in vivo expression of the multidrug resistance gene and P-glycoprotein and survivin genes and proteins was observed using reverse transcription-polymerase chain reaction and western blotting, respectively. Curcumin was not obviously toxic to the vincristine-resistant human colon cancer cells at concentrations less than 25 μM, but the growth of cells was significantly inhibited. At concentrations greater than 25 μM, curcumin was toxic in a concentration-dependent manner. The sensitivity of cells to vincristine, cisplatin, fluorouracil, and hydroxycamptothecin was enhanced, intracellular Rhodamine123 accumulation was increased (p<0.05), and the expression of the multidrug resistance gene and P-glycoprotein were significantly suppressed (p<0.05). The combination of curcumin and vincristine significantly inhibited xenograft growth. The expression of the multidrug resistance protein 1 and survivin genes was significantly reduced in xenografts of curcumin-treated mice and mice treated with both curcumin and vincristine relative to control mice. Curcumin has strong reversal effects on the multidrug resistance of human colon carcinoma in vitro and in vivo.

Effect of curcumin on human colon cancer multidrug resistance in vitro and in vivo

PubMed Central

Lu, Wei-Dong; Qin, Yong; Yang, Chuang; Li, Lei

2013-01-01

OBJECTIVE: To determine whether curcumin reverses the multidrug resistance of human colon cancer cells in vitro and in vivo. METHODS: In a vincristine-resistant cell line of human colon cancer, the cell viability of curcumin-treated cells was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Rhodamine123 efflux was evaluated to detect P-glycoprotein transporter activity, and expression of the multidrug resistance protein 1 and survivin genes was analyzed by reverse transcription polymerase chain reaction and western blotting. In addition, xenograft mouse tumors were grown and treated with curcumin. The morphology of the xenografts was investigated by hematoxylin-eosin staining. The in vivo expression of the multidrug resistance gene and P-glycoprotein and survivin genes and proteins was observed using reverse transcription-polymerase chain reaction and western blotting, respectively. RESULTS: Curcumin was not obviously toxic to the vincristine-resistant human colon cancer cells at concentrations less than 25 μM, but the growth of cells was significantly inhibited. At concentrations greater than 25 μM, curcumin was toxic in a concentration-dependent manner. The sensitivity of cells to vincristine, cisplatin, fluorouracil, and hydroxycamptothecin was enhanced, intracellular Rhodamine123 accumulation was increased (p<0.05), and the expression of the multidrug resistance gene and P-glycoprotein were significantly suppressed (p<0.05). The combination of curcumin and vincristine significantly inhibited xenograft growth. The expression of the multidrug resistance protein 1 and survivin genes was significantly reduced in xenografts of curcumin-treated mice and mice treated with both curcumin and vincristine relative to control mice. CONCLUSION: Curcumin has strong reversal effects on the multidrug resistance of human colon carcinoma in vitro and in vivo. PMID:23778405

Effect of orthodontic force on the expression of PI3K, Akt, and P70S6 K in the human periodontal ligament during orthodontic loading.

PubMed

Xu, Yunhe; Shen, Jiayuan; Muhammed, Fenik Kaml; Zheng, Bowen; Zhang, Yuejiao; Liu, Yi

2017-10-01

The mammalian target of rapamycin (mTOR) is an atypical serine/threonine protein kinases involved in the regulation of cell growth, proliferation, and differentiation through the PI3K/Akt/mTOR/P70S6 K signalling pathway. P70S6 K as a downstream molecule of mTOR is activated by phosphorylation and subsequently promotes the synthesis of ribosomal and translational proteins. In this study, we investigated the role of PI3K, Akt, and P70S6 K in human periodontal tissue remodelling during orthodontic loading. The prepared tissue specimens taken from 4 extracted premolars were processed for immunolabelling. The changes in the expression of PI3K, Akt, and P70S6 K in the periodontal tissues were detected by real-time quantitative-polymerase chain reaction and Western blot analysis. The results from real-time quantitative-polymerase chain reaction and Western blot both showed that the expression of PI3K, Akt, and P70S6 K in the experimental group began to increase at 3 days and increased significantly at 10 days, then decreased approaching the control group level at 28 days. Our findings showed that the expression of PI3K, Akt, and P70S6 K in human periodontal ligament demonstrated a variability during the orthodontic loading, which suggested that the PI3K/Akt/mTOR/P70S6 K signal pathway was involved in orthodontic tooth movement and played a role in the process of periodontium remodelling. Copyright © 2017 John Wiley & Sons, Ltd.

Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

PubMed

Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

1998-08-28

The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

Beta-lactamic resistance profiles in Porphyromonas, Prevotella, and Parvimonas species isolated from acute endodontic infections.

PubMed

Montagner, Francisco; Jacinto, Rogério Castilho; Correa Signoretti, Fernanda Graziela; Scheffer de Mattos, Vanessa; Grecca, Fabiana Soares; Gomes, Brenda Paula Figueiredo de Almeida

2014-03-01

Susceptibility to beta-lactamic agents has changed among anaerobic isolates from acute endodontic infections. The aim of the present study was to determine the prevalence of the cfxA/cfxA2 gene in Prevotella spp., Porphyromonas spp., and Parviomonas micra strains and show its phenotypic expression. Root canal samples from teeth with acute endodontic infections were collected and Porphyromonas, Prevotella, and Parvimonas micra strains were isolated and microbiologically identified with conventional culture techniques. The susceptibility of the isolates was determined by the minimum inhibitory concentration of benzylpenicillin, amoxicillin, and amoxicillin + clavulanate using the E-test method (AB BIODISK, Solna, Sweden). The presence of the cfxA/cfxA2 gene was determined through primer-specific polymerase chain reaction. The nitrocefin test was used to determine the expression of the lactamase enzyme. Prevotella disiens, Prevotella oralis, Porphyromonas gingivalis, and P. micra strains were susceptible to benzylpenicillin, amoxicillin, and amoxicillin + clavulanate. The cfxA/cfxA2 gene was detected in 2 of 29 isolates (6.9%). Simultaneous detection of the cfxA/cfxA2 gene and lactamase production was observed for 1 Prevotella buccalis strain. The gene was in 1 P. micra strain but was not expressed. Three strains were positive for lactamase production, but the cfxA/cfxA2 gene was not detected through polymerase chain reaction. There is a low prevalence of the cfxA/cfxA2 gene and its expression in Porphyromonas spp., Prevotella spp., and P. micra strains isolated from acute endodontic infections. Genetic and phenotypic screening must be performed simultaneously to best describe additional mechanisms involved in lactamic resistance for strict anaerobes. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Serum from pregnant women with gestational diabetes mellitus increases the expression of FABP4 mRNA in primary subcutaneous human pre-adipocytes

PubMed Central

Li, Lan; Lee, Se Jin; Kook, Song Yi; Ahn, Tae Gyu; Lee, Ji Yeon

2017-01-01

Objective Gestational diabetes mellitus (GDM) is defined as glucose intolerance first detected during pregnancy. It can result in pregnancy complications such as birth injury, stillbirth. Fatty acid-binding protein 4 (FABP4), found in adipose tissue, is associated with insulin resistance, and type 2 diabetes. The aim of this study was to investigate whether FABP4 in the placenta and decidua of pregnant women with GDM is higher than that in normal pregnant women, and whether serum from pregnant women with GDM may cause adipocytes to secrete more FABP4 than does serum from a normal pregnant group. Methods We obtained placentas, deciduas, and serum from 12 pregnant women with GDM and 12 normal pregnant women and performed enzyme-linked immunosorbent assay, real time quantitative-polymerase chain reaction. We cultured human pre-adipocytes for 17 days with GDM and non-GDM serum and performed western blot, real time quantitative-polymerase chain reaction, and oil red O staining. Results Expression of FABP4 in serum, placenta and decidua of pregnant women with GDM was significantly higher than that in normal pregnant women. Serum from pregnant women with GDM increased the expression of FABP4 mRNA and decreased the expression of adiponectin mRNA in human pre-adipocytes significantly. Adipocyte cultured in GDM serum showed significantly greater lipid accumulation than those cultured in normal serum. Conclusion Our results suggest that FABP4 is higher in placenta and decidua from pregnant women with GDM. Increased circulating FABP4 in maternal serum from pregnant women with GDM may originate from adipocytes and the placenta. Circulating FABP4 can induce increased insulin resistance and decreased insulin sensitivity. PMID:28534013

Serum from pregnant women with gestational diabetes mellitus increases the expression of FABP4 mRNA in primary subcutaneous human pre-adipocytes.

PubMed

Li, Lan; Lee, Se Jin; Kook, Song Yi; Ahn, Tae Gyu; Lee, Ji Yeon; Hwang, Jong Yun

2017-05-01

Gestational diabetes mellitus (GDM) is defined as glucose intolerance first detected during pregnancy. It can result in pregnancy complications such as birth injury, stillbirth. Fatty acid-binding protein 4 (FABP4), found in adipose tissue, is associated with insulin resistance, and type 2 diabetes. The aim of this study was to investigate whether FABP4 in the placenta and decidua of pregnant women with GDM is higher than that in normal pregnant women, and whether serum from pregnant women with GDM may cause adipocytes to secrete more FABP4 than does serum from a normal pregnant group. We obtained placentas, deciduas, and serum from 12 pregnant women with GDM and 12 normal pregnant women and performed enzyme-linked immunosorbent assay, real time quantitative-polymerase chain reaction. We cultured human pre-adipocytes for 17 days with GDM and non-GDM serum and performed western blot, real time quantitative-polymerase chain reaction, and oil red O staining. Expression of FABP4 in serum, placenta and decidua of pregnant women with GDM was significantly higher than that in normal pregnant women. Serum from pregnant women with GDM increased the expression of FABP4 mRNA and decreased the expression of adiponectin mRNA in human pre-adipocytes significantly. Adipocyte cultured in GDM serum showed significantly greater lipid accumulation than those cultured in normal serum. Our results suggest that FABP4 is higher in placenta and decidua from pregnant women with GDM. Increased circulating FABP4 in maternal serum from pregnant women with GDM may originate from adipocytes and the placenta. Circulating FABP4 can induce increased insulin resistance and decreased insulin sensitivity.

ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation.

PubMed

Haslam, Tegan M; Haslam, Richard; Thoraval, Didier; Pascal, Stéphanie; Delude, Camille; Domergue, Frédéric; Fernández, Aurora Mañas; Beaudoin, Frédéric; Napier, Johnathan A; Kunst, Ljerka; Joubès, Jérôme

2015-03-01

The extension of very-long-chain fatty acids (VLCFAs) for the synthesis of specialized apoplastic lipids requires unique biochemical machinery. Condensing enzymes catalyze the first reaction in fatty acid elongation and determine the chain length of fatty acids accepted and produced by the fatty acid elongation complex. Although necessary for the elongation of all VLCFAs, known condensing enzymes cannot efficiently synthesize VLCFAs longer than 28 carbons, despite the prevalence of C28 to C34 acyl lipids in cuticular wax and the pollen coat. The eceriferum2 (cer2) mutant of Arabidopsis (Arabidopsis thaliana) was previously shown to have a specific deficiency in cuticular waxes longer than 28 carbons, and heterologous expression of CER2 in yeast (Saccharomyces cerevisiae) demonstrated that it can modify the acyl chain length produced by a condensing enzyme from 28 to 30 carbon atoms. Here, we report the physiological functions and biochemical specificities of the CER2 homologs CER2-LIKE1 and CER2-LIKE2 by mutant analysis and heterologous expression in yeast. We demonstrate that all three CER2-LIKEs function with the same small subset of condensing enzymes, and that they have different effects on the substrate specificity of the same condensing enzyme. Finally, we show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. © 2015 American Society of Plant Biologists. All Rights Reserved.

ECERIFERUM2-LIKE Proteins Have Unique Biochemical and Physiological Functions in Very-Long-Chain Fatty Acid Elongation1[OPEN

PubMed Central

Haslam, Tegan M.; Haslam, Richard; Thoraval, Didier; Pascal, Stéphanie; Delude, Camille; Domergue, Frédéric; Fernández, Aurora Mañas; Beaudoin, Frédéric; Napier, Johnathan A.; Kunst, Ljerka; Joubès, Jérôme

2015-01-01

The extension of very-long-chain fatty acids (VLCFAs) for the synthesis of specialized apoplastic lipids requires unique biochemical machinery. Condensing enzymes catalyze the first reaction in fatty acid elongation and determine the chain length of fatty acids accepted and produced by the fatty acid elongation complex. Although necessary for the elongation of all VLCFAs, known condensing enzymes cannot efficiently synthesize VLCFAs longer than 28 carbons, despite the prevalence of C28 to C34 acyl lipids in cuticular wax and the pollen coat. The eceriferum2 (cer2) mutant of Arabidopsis (Arabidopsis thaliana) was previously shown to have a specific deficiency in cuticular waxes longer than 28 carbons, and heterologous expression of CER2 in yeast (Saccharomyces cerevisiae) demonstrated that it can modify the acyl chain length produced by a condensing enzyme from 28 to 30 carbon atoms. Here, we report the physiological functions and biochemical specificities of the CER2 homologs CER2-LIKE1 and CER2-LIKE2 by mutant analysis and heterologous expression in yeast. We demonstrate that all three CER2-LIKEs function with the same small subset of condensing enzymes, and that they have different effects on the substrate specificity of the same condensing enzyme. Finally, we show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. PMID:25596184

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

MERP1: a mammalian ependymin-related protein gene differentially expressed in hematopoietic cells.

PubMed

Gregorio-King, Claudia C; McLeod, Janet L; Collier, Fiona McL; Collier, Gregory R; Bolton, Karyn A; Van Der Meer, Gavin J; Apostolopoulos, Jim; Kirkland, Mark A

2002-03-20

We have utilized differential display polymerase chain reaction to investigate the gene expression of hematopoietic progenitor cells from adult bone marrow and umbilical cord blood. A differentially expressed gene was identified in CD34+ hematopoietic progenitor cells, with low expression in CD34- cells. We have obtained the full coding sequence of this gene which we designated human mammalian ependymin-related protein 1 (MERP1). Expression of MERP1 was found in a variety of normal human tissues, and is 4- and 10-fold higher in adult bone marrow and umbilical cord blood CD34+ cells, respectively, compared to CD34- cells. Additionally, MERP1 expression in a hematopoietic stem cell enriched population was down-regulated with proliferation and differentiation. Conceptual translation of the MERP1 open reading frame reveals significant homology to two families of glycoprotein calcium-dependant cell adhesion molecules: ependymins and protocadherins.

Chronic smoking and alcoholism change expression of selective genes in the human prefrontal cortex.

PubMed

Flatscher-Bader, Traute; Wilce, Peter A

2006-05-01

Alcoholism is commonly associated with chronic smoking. A number of gene expression profiles of regions within the human mesocorticolimbic system have identified potential alcohol-sensitive genes; however, the influence of smoking on these changes was not taken into account. This study addressed the impact of alcohol and smoking on the expression of 4 genes, previously identified as alcoholism-sensitive, in the human prefrontal cortex (PFC). mRNA expression of apolipoprotein D, tissue inhibitor of the metalloproteinase 3, high-affinity glial glutamate transporter and midkine, was measured in the PFC of alcoholic subjects and controls with and without smoking comorbidity using real-time polymerase chain reaction. The results show that alcohol affects transcription of some of these genes. Additionally, smoking has a marked influence on gene expression. This study emphasizes the need for careful case selection in future gene expression studies to delineate the adaptive molecular process associated with smoking and alcohol.

Overexpression of α3, β3 and γ2 chains of laminin-332 is associated with poor prognosis in pancreatic ductal adenocarcinoma

PubMed Central

Chen, Jun; Zhang, Hao; Luo, Jiansheng; Wu, Xiaokang; Li, Xueming; Zhao, Xinyi; Zhou, Dongkai; Yu, Shian

2018-01-01

Pancreatic ductal adenocarcinoma (PDA) is a worldwide health problem. Early diagnosis and assessment may enhance the quality of life and survival of patients. The present study investigated the potential correlations between the gene and protein expression of laminin-332 (LM-332 or laminin-5) and clinicopathological factors as well as evaluating its influence on the survival of patients with PDA. The expression of LM-332 subunit mRNAs in pancreatic carcinoma specimens from 37 patients was investigated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. Using immunohistochemical methods, the protein expressions of the three chains of LM-322 (LNα3, LNβ3 and LNγ2) were determined in 96 pancreatic carcinoma specimens, for association analysis with clinicopathological characteristics from patient data. The results of the prognosis analysis of three mRNAs expression datasets were validated in The Cancer Genome Atlas datasets. RT-qPCR results indicated that the overall relative values of LNα3 and LNγ2 mRNAs were increased in pancreatic carcinoma compared with the control. In immunostaining analyses LNα3 and LNγ2 expression was observed in all tumor tissues from the 96 patient samples. The expression levels of LNα3, LNβ3 and LNγ2 were associated with each other. LNα3 and LNγ2 positivity was significantly associated with differentiation, depth of invasion and advanced stage (P<0.05). The samples were classified into three groups: Basement membrane (B) type, cytoplasmic (C) type and mixed (M) type, according to their LNγ2 immunohistochemical expression patterns. The B type correlated significantly with differentiation (P=0.010) and the M type was significantly associated with hepatic metastasis (P=0.031). Patients with B-type LNγ2 demonstrated significantly better outcomes than patients with the C or M type (P=0.012 and P=0.003, respectively). Overexpression of the α3, β3 and γ2 chains of LM-332 may serve an important role in the progression and prognosis of PDA. PMID:29928402

Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

PubMed Central

MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

2008-01-01

C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

A toy model for the yield of a tamped fission bomb

NASA Astrophysics Data System (ADS)

Reed, B. Cameron

2018-02-01

A simple expression is developed for estimating the yield of a tamped fission bomb, that is, a basic nuclear weapon comprising a fissile core jacketed by a surrounding neutron-reflecting tamper. This expression is based on modeling the nuclear chain reaction as a geometric progression in combination with a previously published expression for the threshold-criticality condition for such a core. The derivation is especially straightforward, as it requires no knowledge of diffusion theory and should be accessible to students of both physics and policy. The calculation can be set up as a single page spreadsheet. Application to the Little Boy and Fat Man bombs of World War II gives results in reasonable accord with published yield estimates for these weapons.

Platelet-derived growth factor A mRNA in platelets is associated with the degree of hepatic fibrosis in chronic hepatitis C.

PubMed

Tanikawa, Aline Aki; Grotto, Rejane Maria Tommasini; Silva, Giovanni Faria; Ferrasi, Adriana Camargo; Sarnighausen, Valéria Cristina Rodrigues; Pardini, Maria Inês de Moura Campos

2017-01-01

Transforming growth factor beta 1 (TGFB1) and platelet-derived growth factor (PDGF) are the main cytokines related to hepatic fibrogenesis. RNA isolated from the platelets and hepatic tissue of 43 HCV carriers was used for quantitative polymerase chain reaction to determine TGFB1, PDGFA, and PDGFB RNA expression. The mRNA expression of PDGFA in platelets was significantly lower in the group with advanced fibrosis than in the group with early-stage fibrosis. TGFB1 was more frequently expressed in platelets than in hepatic tissue, which was different from PDGFB. A pathway mediated by overexpression of TGFB1 via PDGFA in megakaryocytes could be involved in the development of fibrosis.

Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

PubMed Central

2009-01-01

Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916

Racial Differences in the Extracellular Matrix and Histone Acetylation of the Lamina Cribrosa and Peripapillary Sclera.

PubMed

Park, Hae-Young Lopilly; Kim, Jie Hyun; Jung, Younhea; Park, Chan Kee

2017-08-01

We investigated the extracellular matrix (ECM) of the lamina cribrosa (LC) and peripapillary sclera (PPS) and compared histone acetylation and related enzymes to identify racial differences between Korean and Caucasian donor eyes. Posterior segment tissues were obtained from 30 Caucasian donors and 42 age and axial length-matched Korean donors. Histone modification was assessed for histone deacetylase (HDAC) 2, HDAC3, and acetylated histone H3. The promoter regions of the major ECM in the LC and PPS including collagen type I and III, and elastic fiber components (elastin and fibrillin-1) and lysyl oxidase enzymes including lysyl oxidase-like 1 and 2 (LOXL2) were evaluated by chromatin immunoprecipitation (ChIP) assay. Protein and mRNA expression of major ECM components were assessed using real-time polymerase chain reaction analysis, western blot analysis, and immunohistochemical staining. HDAC2 and HDAC3 expression levels were decreased and acetylated histone H3 was increased in the LC and PPS of Korean eyes than Caucasian eyes. The promoter regions of LOXL2, elastin, and fribrillin-1 genes were highly acetylated in Korean LC. Expression of LOXL2 and elastic fiber components (elastin and fibrillin-1) were significantly increased in Korean LC and PPS than Caucasians according to the real-time polymerase chain reaction, western blot analyses, and quantification of elastic fiber staining. Histone acetylation status differed in the promoter regions of the elastic fiber components and LOXL2 in the LC and PPS according to race. Further study to reveal the association with these findings to the pathogenesis of glaucoma in Korean eyes is needed.

Expression of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) in bladder transitional cell carcinoma.

PubMed

Ham, Won Sik; Lee, Joo Hyoung; Yu, Ho Song; Choi, Young Deuk

2008-10-01

An analysis of differentially expressed genes (DEGs) between bladder transitional cell carcinoma (TCC) and the surrounding urothelium to help identify what lies behind the mechanism of multifocal tumor development has not yet been performed. We sought to find a new DEG related to the development of bladder TCC. Thirty-nine bladder TCC tissues paired with normal-appearing urothelium tissues obtained from the same patient were used as subjects. Initially, we compared the messenger RNA (mRNA) profiles between normal-appearing urothelium and TCC tissue of 1 patient by using annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) and selective amplification of family members (SAFM) PCR to identify potential DEGs. To validate the results of the ACP data, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on those of all 39 patients. Among the several DEGs discovered in the ACP data, 1 DEG was chosen as the candidate for the RT-PCR, that is present or markedly upregulated in normal-appearing urothelial tissue compared with TCC tissue. Gene sequence searching revealed that this DEG is chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI). Downregulation of COUP-TFI mRNA expression in TCC tissue compared to normal-appearing urothelium tissue of the same patient, irrespective of tumor stage and grade, was confirmed by RT-PCR in 39 patients. Our results suggest that the loss of COUP-TFI may play a role in the transition from normal epithelium to TCC. Further characterization of the COUP-TFI gene is expected to give us informations about bladder TCC tumorigenesis.

Transgenic cloned sheep overexpressing ovine toll-like receptor 4.

PubMed

Deng, Shoulong; Li, Guiguan; Zhang, Jinlong; Zhang, Xiaosheng; Cui, Maosheng; Guo, Yong; Liu, Guoshi; Li, Guangpeng; Feng, Jianzhong; Lian, Zhengxing

2013-07-01

An ovine fetal fibroblast cell line highly expressing TLR4 was established by inserting TLR4 into a reconstructive p3S-LoxP plasmid. Transgenic sheep overexpressing TLR4 were produced by transferring TLR4-transfected fetal fibroblasts into metaphase (M)II-stage enucleated oocytes (using SCNT). Because reconstructed embryos derived from MII-stage enucleated oocytes matured in vivo using a delayed-activated method had a higher pregnancy rate (18.52%) than that from MII-stage enucleated oocytes matured in vitro, the former procedure was used. Nine TLR4-transgenic live births were confirmed using polymerase chain reaction and Southern blot analysis. Increased expression of TLR4 at mRNA and protein levels in ear tissues of transgenic lambs were verified using reverse transcription polymerase chain reaction and immunohistochemistry, respectively. More toll-like receptor 4 protein was expressed by peripheral blood monocytes and/or macrophages collected from 3-month-old TLR4-transgenic than nontransgenic lambs at 0, 1, and 4 hours after lipopolysaccharide stimulation. Furthermore, interferon-γ and tumor necrosis factor α secreted by monocytes and/or macrophages of TLR4-transgenic lambs were significantly higher at 1 hour. Therefore, lipopolysaccharide-induced inflammatory responses from monocytes and/or macrophages occurred sooner in TLR4-transgenic lambs, consistent with an enhanced host immune response. In conclusion, transgenic sheep overexpressing TLR4 are a primary model to investigate the role of transgenic animals in disease resistance and have potential for breeding sheep with disease resistance. Copyright © 2013 Elsevier Inc. All rights reserved.

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

MicroRNA-150 Is up-regulated in extranodal marginal zone lymphoma of MALT type.

PubMed

Gebauer, Niklas; Kuba, Johannes; Senft, Andrea; Schillert, Arne; Bernard, Veronica; Thorns, Christoph

2014-01-01

The mechanisms promoting malignant transformation from chronic Helicobacter pylori-gastritis to gastric extranodal marginal zone lymphoma (MALT lymphoma) are insufficiently characterized. This follow-up study aimed to validate candidate microRNAs (miRs) in the process of neoplastic transformation. MicroRNA expression signatures (n=20) were generated for a total of 60 cases of gastric lesions ranging from Wotherspoon 0-5 employing a quantitative real-time polymerase chain reaction (PCR) approach. Morphological and immunohistochemical characterization of the cohort was supplemented by PCR-based immunoglobulin heavy chain recombination studies. Quantitative expression of miR-150, miR-142.3p, miR-375 and miR-494 was significantly de-regulated in samples from MALT lymphoma compared to those from gastritis. The previously reported up-regulation of miR-150 in marginal zone lymphoma of MALT type was verified in an independent cohort of lymphoma samples employing a modified methodology. This further substantiates the role of miR-150 as a potential oncomiR in MALT lymphoma.

Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls

PubMed Central

Fassah, Dilla Mareistia; Jeong, Jin Young

2018-01-01

Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; p<0.01) and protein levels (1.4 fold; p< 0.05) of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05). Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05) and lactate dehydrogenase B (2.2 fold; p<0.01) genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05) and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05) genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; p<0.01) and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06) genes for propionate incorporation. Conclusion Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition. PMID:29502393

Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls.

PubMed

Fassah, Dilla Mareistia; Jeong, Jin Young; Baik, Myunggi

2018-04-01

This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Castration increased the mRNA (3.6 fold; p<0.01) and protein levels (1.4 fold; p< 0.05) of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05). Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05) and lactate dehydrogenase B (2.2 fold; p<0.01) genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05) and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05) genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; p<0.01) and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06) genes for propionate incorporation. Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition.

[Primary investigation of the relationship between glucocorticoid induced leucine zipper and inflammatory reaction].

PubMed

Bai, Xiang-jun; Li, Bo; Wang, Hai-ping; Yang, Zhao-hui; Li, Si-qi

2007-01-01

To investigate the mechanism of the action of glucocorticoid induced leucine zipper (GILZ) in inflammatory reaction. Human monocyte cell line THP-1 cells were divided into two groups and cultured in non-serum RPMI1640 medium.In one group the cells were treated with dexamethasone (DEX). Twelve hours later total RNA and total protein were abstracted in both two groups. The mRNA encoding for expression of GILZ was semiquantitatively detected by reserve transcriptase-polymerase chain reaction (RT-PCR). Protein expression of nuclear factor-KappaB (NF-KappaB) p65 and activator protein-1 (AP-1) were assessed by Western blotting. Peripheral blood of 10 trauma patients [injury severity score (ISS) >or=16 scores] were collected and the leukocytes were isolated within 24 hours after trauma. The leukocytes were divided into two groups and cultured in non-serum medium. In one group the cells were treated with DEX. Twelve hours later total RNA and total protein were abstracted in both two groups. The mRNA encoding for expression of GILZ was semiquantitatively detected by RT-PCR. Protein expression of NF-KappaB p65 and AP-1 were assessed by Western blotting. Stimulated by DEX, the expression of GILZ mRNA was increased both in THP-1 cells and the leukocytes of trauma patients compared with those of control groups (both P<0.01). Whereas, protein expressions of NF-KappaB p65 and AP-1 of THP-1 cells and leukocytes in peripheral blood of trauma patients were decreased in the stimulation groups compared with those of control groups (all P<0.01). The expression of GILZ gene is up-regulated by glucocorticoid. Overexpression of GILZ inhibits NF-KappaB and AP-1 activities, suggesting that GILZ possesses anti-inflammatory function.

Relationships between the transcriptome and physiological indicators of reproduction in female rainbow trout over an annual cycle.

PubMed

Hook, Sharon E; Nagler, James J; Cavileer, Tim; Verducci, Joseph; Liu, Yushi; Hayton, William; Schultz, Irvin R

2011-02-01

Normal transcriptomic patterns along the brain-pituitary-gonad-liver (BPGL) axis should be better characterized if endocrine-disrupting compound-induced changes in gene expression are to be understood. Female rainbow trout were studied over a complete year-long reproductive cycle. Tissue samples from pituitary, ovary, and liver were collected for microarray analysis using the 16K Genomic Research on Atlantic Salmon Project (GRASP) microarray and for quantitative polymerase chain reaction measures of estrogen receptor (ER) isoform messenger RNA (mRNA) levels. Plasma was collected to determine levels of circulating estradiol-17β (E2), follicle-stimulating hormone (FSH), and luteinizing hormone (LH). As an a priori hypothesis, changes in gene expression were correlated to either circulating levels of E2, FSH, and LH, or ER mRNAs quantified by quantitative polymerase chain reaction. In the liver, most transcriptomic patterns correlated to levels of either E2, LH, or ERs. Fewer ovarian transcripts could be correlated to levels of E2, ERα, or FSH. No significant associations were obvious in the pituitary. As a post hoc hypothesis, changes in transcript abundance were compared with microarray features with known roles in gonadal maturation. Many altered transcripts in the ovary correlated to transcript levels of estradiol 17-beta-dehydrogenase 8 or 17 B HSD12, or to glycoprotein alpha chain 1 or 2. In the pituitary, genes involved with the growth axis (e.g., growth hormone, insulin-related growth factor binding protein) correlated with the most transcripts. These results suggest that transcriptional networks along the BPGL axis may be regulated by factors other than circulating steroid hormones. © 2010 SETAC.

Expression of the cell-surface heparan sulfate proteoglycan syndecan-2 in developing rat anterior pituitary gland.

PubMed

Horiguchi, Kotaro; Syaidah, Rahimi; Fujiwara, Ken; Tsukada, Takehiro; Ramadhani, Dini; Jindatip, Depicha; Kikuchi, Motoshi; Yashiro, Takashi

2013-09-01

In the anterior pituitary gland, folliculo-stellate cells and five types of hormone-producing cells are surrounded by an extracellular matrix (ECM) essential for these cells to perform their respective roles. Syndecans-type I transmembrane cell-surface heparan sulfate proteoglycans act as major ECM coreceptors via their respective heparan sulfate chains and efficiently transduce intracellular signals through the convergent action of their transmembrane and cytoplasmic domains. The syndecans comprise four family members in vertebrates: syndecan-1, -2, -3 and -4. However, whether syndecans are produced in the pituitary gland or whether they have a role as a coreceptor is not known. We therefore used (1) reverse transcription plus the polymerase chain reaction to analyze the expression of syndecan genes and (2) immunohistochemical techniques to identify the cells that produce the syndecans in the anterior pituitary gland of adult rat. Syndecan-2 mRNA expression was clearly detected in the corticotropes of the anterior pituitary gland. Moreover, the expression of syndecan-2 in the developing pituitary gland had a distinct temporospatial pattern. To identify the cells expressing syndecan-2 in the developing pituitary gland, we used double-immunohistochemistry for syndecan-2 and the cell markers E-cadherin (immature cells) and Ki-67 (proliferating cells). Some E-cadherin- and Ki-67-immunopositive cells expressed syndecan-2. Therefore, syndecan-2 expression occurs in developmentally regulated patterns and syndecan-2 probably has different roles in adult and developing anterior pituitary glands.

Ethanol extracts of black pepper or turmeric down-regulated SIRT1 protein expression in Daudi culture cells.

PubMed

Nishimura, Yuri; Kitagishi, Yasuko; Yoshida, Hitomi; Okumura, Naoko; Matsuda, Satoru

2011-01-01

SIRT1 is a mammalian candidate molecule involved in longevity and diverse metabolic processes. The present study aimed to determine the effects of certain herbs and spices on SIRT1 expression. Human cell lines Daudi, Jurkat, U937 and K562 were cultured in RPMI-1640. Herb and spice powders were prepared and the supernatants were collected. RT-PCR was used to quantify the expression level of the gene. Protein samples were then analyzed by Western blotting. Western blotting revealed the down-regulation of SIRT1 protein expression in Daudi cells treated with extracts of black pepper or turmeric. On the other hand, the effect on the SIRT1 gene expression examined by reverse transcription polymerase chain reaction was unaltered. In conclusion, component(s) of certain herbs and spices may induce the down-regulation of SIRT1 protein.

A Novel mRNA Level Subtraction Method for Quick Identification of Target-Orientated Uniquely Expressed Genes Between Peanut Immature Pod and Leaf

PubMed Central

2010-01-01

Subtraction technique has been broadly applied for target gene discovery. However, most current protocols apply relative differential subtraction and result in great amount clone mixtures of unique and differentially expressed genes. This makes it more difficult to identify unique or target-orientated expressed genes. In this study, we developed a novel method for subtraction at mRNA level by integrating magnetic particle technology into driver preparation and tester–driver hybridization to facilitate uniquely expressed gene discovery between peanut immature pod and leaf through a single round subtraction. The resulting target clones were further validated through polymerase chain reaction screening using peanut immature pod and leaf cDNA libraries as templates. This study has resulted in identifying several genes expressed uniquely in immature peanut pod. These target genes can be used for future peanut functional genome and genetic engineering research. PMID:21406066

A novel EML4-ALK variant: exon 6 of EML4 fused to exon 19 of ALK.

PubMed

Penzel, Roland; Schirmacher, Peter; Warth, Arne

2012-07-01

Cytotoxic chemotherapy remains the mainstay of treatment for most patients with advanced disease. Recently, anaplastic lymphoma kinase (ALK) expression as a major target for successful treatment with ALK inhibitors was detected in a subset of non-small-cell lung carcinomas, usually as a result of echinoderm microtubule-associated protein-like 4 (EML4)-ALK rearrangements. Although the chromosomal breakpoint within the EML4 gene varied, the breakpoint within ALK was most frequently reported within intron 19 or rarely in exon 20. Therefore, the different EML4-ALK variants so far contain the same 3' portion of ALK starting with exon 20. Here, we report a novel EML4-ALK variant detected by reverse transcription polymerase chain reaction analysis. Subsequent sequencing revealed an EML4-ALK fusion variant in which exon 6 of EML4 was fused to exon 19 of ALK. It occurred in a predominant solid pulmonary adenocarcinoma of a 65-year-old woman with a clear split signal of ALK in fluorescence in situ hybridization analysis and a weakly homogeneous ALK expression in immunohistochemical staining. Because of the growing number of fusion variants a primary reverse transcription polymerase chain reaction-based screening for ALK-positive non-small-cell lung carcinoma patients may not be sufficient for predictive diagnostics but transcript-based approaches and sequencing of ALK fusion variants might finally contribute to an optimized selection of patients.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Basic Fibroblast Growth Factor Regulates Gene and Protein Expression Related to Proliferation, Differentiation, and Matrix Production of Human Dental Pulp Cells.

PubMed

Chang, Ya-Ching; Chang, Mei-Chi; Chen, Yi-Jane; Liou, Ji-Uei; Chang, Hsiao-Hua; Huang, Wei-Ling; Liao, Wan-Chuen; Chan, Chiu-Po; Jeng, Po-Yuan; Jeng, Jiiang-Huei

2017-06-01

Basic fibroblast growth factor (bFGF) plays differential effects on the proliferation, differentiation, and extracellular matrix turnover in various tissues. However, limited information is known about the effect of bFGF on dental pulp cells. The purposes of this study were to investigate whether bFGF influences the cell differentiation and extracellular matrix turnover of human dental pulp cells (HDPCs) and the related gene and protein expression as well as the role of the mitogen-activated protein kinase (MEK)/extracellular-signal regulated kinase (ERK) signaling pathway. The expression of fibroblast growth factor receptors (FGFRs) in HDPCs was also studied. The expression of FGFR1 and FGFR2 in HDPCs was investigated by reverse-transcription polymerase chain reaction. HDPCs were treated with different concentrations of bFGF. Cell proliferation was evaluated using the 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay. Cell differentiation was evaluated using alkaline phosphatase (ALP) staining. Changes in messenger expression of cyclin B1 and tissue inhibitor of metalloproteinase (TIMP) 1 were determined by reverse-transcription polymerase chain reaction. Changes in protein expression of cdc2, TIMP-1, TIMP-2, and collagen I were determined by Western blotting. U0126 was used to clarify the role of MEK/ERK signaling. HDPCs expressed both FGFR1 and FGFR2. Cell viability was stimulated by 50-250 ng/mL bFGF. The expression and enzyme activities of ALP were inhibited by 10-500 ng/mL bFGF. At similar concentrations, bFGF stimulates cdc2, cyclin B1, and TIMP-1 messenger RNA and protein expression. bFGF showed little effect on TIMP-2 and partly inhibited collagen I expression of pulp cells. U0126 (a MEK/ERK inhibitor) attenuated the bFGF-induced increase of cyclin B1, cdc2, and TIMP-1. bFGF may be involved in pulpal repair and regeneration by activation of FGFRs to regulate cell growth; stimulate cdc2, cyclin B1, and TIMP-1 expression; and inhibit ALP. These events are partly associated with MEK/ERK signaling. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Resistance of Legionella and Acanthamoeba mauritaniensis to heat treatment as determined by relative and quantitative polymerase chain reactions.

PubMed

Dobrowsky, Penelope H; Khan, Sehaam; Khan, Wesaal

2017-10-01

Legionella and Acanthamoeba spp. persist in harvested rainwater pasteurized at high temperatures (> 72°C) and the interaction mechanisms exhibited between these organisms need to be elucidated. The resistance of two Legionella reference strains (Legionella pneumophila ATCC 33152 and Legionella longbeachae ATCC 33462), three environmental strains [Legionella longbeachae (env.), Legionella norrlandica (env.) and Legionella rowbothamii (env.)] and Acanthamoeba mauritaniensis ATCC 50676 to heat treatment (50-90°C) was determined by monitoring culturability and viability [ethidium monoazide quantitative polymerase chain reaction (EMA-qPCR)]. The expression of metabolic and virulence genes of L. pneumophila ATCC 33152 (lolA, sidF, csrA) and L. longbeachae (env.) (lolA) in co-culture with A. mauritaniensis ATCC 50676 during heat treatment (50-90°C) was monitored using relative qPCR. While the culturability (CFU/mL) and viability (gene copies/mL) of the Legionella strains reduced significantly (p < 0.05) following heat treatment (60-90°C), L. longbeachae (env.) and L. pneumophila ATCC 33152 were culturable following heat treatment at 50-60°C. Metabolically active trophozoites and dormant cysts of A. mauritaniensis ATCC 50676 were detected at 50°C and 60-90°C, respectively. For L. pneumophila ATCC 33152, lolA expression remained constant, sidF expression increased and the expression of csrA decreased during co-culture with A. mauritaniensis ATCC 50676. For L. longbeachae (env.), while lolA was up-regulated at 50-70°C, expression was not detected at 80-90°C and in co-culture. In conclusion, while heat treatment may reduce the number of viable Legionella spp. in monoculture, results indicate that the presence of A. mauritaniensis increases the virulence of L. pneumophila during heat treatment. The virulence of Legionella spp. in co-culture with Acanthamoeba spp. should thus be monitored in water distribution systems where temperature (heat) is utilized for treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

Association of the Interleukin-27 Gene Expression and Hepatitis B Virus Infection in Liver Transplanted Patients.

PubMed

Zare, Abdolhossein; Karimi, Mohammad Hossein; Rashki, Ahmad; Geramizadeh, Bita; Afshari, Afsoon; Miri, Hamid Reza; Yaghobi, Ramin

2017-10-01

Hepatitis B viral infection is among the most common causes of cirrhosis and hepatocellular carcinoma and a frequent viral indication for liver transplant. Cytokine-mediated immunity plays a critical role in introducing and promoting hepatitis B virus outcomes and in graft microenvironment. Interleukin 27 is a heterodimeric cytokine and a member of interleukin-6/interleukin-12 family. Interleukin-27 shows a broad range of pro- and antiinflammatory properties and plays a determining role during immune responses in combating hepatitis B virus. Therefore, in this study, the possible association between expressions of interleukin-27 gene with hepatitis B virus infection was evaluated in liver transplant patients. In a cross-sectional study from liver transplant patients with the risk of hepatitis B virus infection who admitted to Namazi Hospital affiliated to Shiraz University of Medical Sciences, 50 patients were selected and subgrouped to 25 hepatitis B virus-infected and 25 noninfected ones between years 2011 and 2013. The 25 healthy controls also were enrolled in this study. The presence of hepatitis B virus infection was assessed using polymerase chain reaction and enzyme-linked immunosorbent assay protocols in liver transplant patients. In addition, the interleukin-27 gene expression level was analyzed using an in-house-SYBER Green real time polymerase chain reaction method. The rate of interleukin-27 gene expression level was statistically analyzed in studied patient groups and controls using the Livak (2-▵▵CT) method. The expression level of interleukin-27 gene was increased 10.27- and 2.36-fold in hepatitis B virus-infected and uninfected liver transplanted patients compared with healthy controls. Hepatitis B virus infection can lead to overexpression of interleukin-27 gene in liver transplant patients compared with uninfected ones and controls. However, further studies are needed to characterize the effective antihepatitis B virus effects of interleukin-27 in liver transplant patients.

Association Study between an SNP in CD147 and Its Expression With Acute Coronary Syndrome in a Jiangsu Chinese Population.

PubMed

Yan, Jinchuan; Mao, Yu; Wang, Cuiping; Wang, Zhongqun

2015-10-01

CD147 is an important molecule in the inflammation and proteolysis process. This molecule crucially contributes to the initial and progression of atherosclerotic lesions. A single nucleotide polymorphism in CD147 gene, the rs8259 T/A in the 3'-untranslated region, is responsible for its expression in various cells. This study assessed whether the genetic variation rs8259 is associated with acute coronary syndrome (ACS) and CD147. A total of 943 ACS subjects and 439 stable angina subjects, and 851 controls were genotyped for rs8259 polymorphism by polymerase chain reaction restriction fragment length polymorphism and DNA-sequencing method. Plasma soluble CD147 (sCD147) level was measured by enzyme-linked immunosorbent assay. CD147 mRNA and protein expression in peripheral blood mononuclear cells were tested by real-time quantitative polymerase chain reaction and western blot, respectively. We found that TT genotype and T-allele frequency of CD147 rs8259 in ACS patients were much lower than the other patient groups. Significant difference was not observed between stable angina and controls. CD147 T allele was negatively related to ACS. ACS patients exhibited the highest CD147 expression in peripheral blood mononuclear cells and plasma sCD147 level. The plasma sCD147 levels in the culprit vessel were higher than those in the radial artery. In ACS patients, AA gene carriers had the highest CD147 levels, whereas TT gene carriers had the lowest CD147 levels. Linear regression analysis showed that genotypes and disease conditions contributed 49% to the change of the plasma CD147 level. These results suggested that the single nucleotide polymorphism of CD147 gene rs8259 T/A was associated with ACS susceptibility. Allele T gene may decrease the relative risk of suffering from ACS through downregulation of CD147 expression.

Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

PubMed

Tanaka, Yohei; Nakayama, Jun

2016-01-01

Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (P<0.05). We found that NIR irradiation induced the upregulated expression of EGFR in human corneal cells. Since over half of the solar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.

PubMed

Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F

1995-12-01

Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.

Quantitation of apolipoprotein epsilon gene expression by competitive polymerase chain reaction in a patient with familial apolipoprotein E deficiency.

PubMed

Dobmeyer, J M; Rexin, M; Dobmeyer, T S; Klein, S A; Rossol, R; Feussner, G

1998-06-22

A simple method of obtaining semiquantitative and reliable data on apolipoprotein (apo) sigma gene expression is described. We detected apo sigma specific sequences by reverse transcription (rT)-PCR. For quantitative measurement, an apo sigma DNA standard was produced allowing the development of a competitive PCR-method. The efficiency of RNA extraction and cDNA synthesis was controlled by quantitation of a housekeeping gene (glyceraldehyde-3-phosphatedehydrogenase, G3PDH) in separate reactions. To imitate a defined induction of apo sigma gene expression, serial twofold dilutions of total RNA were reversely transcribed and the respective cDNAs used to perform a competitive apo sigma and G3PDH PCR. The change in apo sigma cDNA and G3PDH cDNA was 1.7-2.3-fold with an expected value of 2.0-fold. Standard deviations in three independently performed experiments were within a range of < 15% of the mean, indicating low intra-assay variation and high reproducibility. To illustrate this method, apo sigma gene expression was measured in a patient with complete lack of functional active apo E in comparison to healthy controls. The method presented here might be valuable in assessment of apo sigma gene expression in human disease.

[Expression of cell adhesion molecules in acute leukemia cell].

PubMed

Ju, Xiaoping; Peng, Min; Xu, Xiaoping; Lu, Shuqing; Li, Yao; Ying, Kang; Xie, Yi; Mao, Yumin; Xia, Fang

2002-11-01

To investigate the role of cell adhesion molecule in the development and extramedullary infiltration (EI) of acute leukemia. The expressions of neural cell adhesion molecule (NCAM) gene, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM-1) genes in 25 acute leukemia patients bone marrow cells were detected by microarray and reverse transcriptase-polymerase chain reaction (RT-PCR). The expressions of NCAM, ICAM-1 and VCAM-1 gene were significantly higher in acute leukemia cells and leukemia cells with EI than in normal tissues and leukemia cells without EI, respectively, both by cDNA microarray and by RT-PCR. The cDNA microarray is a powerful technique in analysis of acute leukemia cells associated genes. High expressions of cell adhesion molecule genes might be correlated with leukemia pathogenesis and infiltration of acute leukemia cell.

Gallium-68-labeled anti-HER2 single-chain Fv fragment: development and in vivo monitoring of HER2 expression.

PubMed

Ueda, Masashi; Hisada, Hayato; Temma, Takashi; Shimizu, Yoichi; Kimura, Hiroyuki; Ono, Masahiro; Nakamoto, Yuji; Togashi, Kaori; Saji, Hideo

2015-02-01

We aimed to develop a gallium-68 (Ga-68)-labeled single-chain variable fragment (scFv) targeting the human epidermal growth factor receptor 2 (HER2) to rapidly and noninvasively evaluate the status of HER2 expression. Anti-HER2 scFv was labeled with Ga-68 by using deferoxamine (Df) as a bifunctional chelate. Biodistribution of [(68)Ga]Df-anti-HER2 scFv was examined with tumor-bearing mice and positron emission tomography (PET) imaging was performed. The changes in HER2 expression after anti-HER2 therapy were monitored by PET imaging. [(68)Ga]Df-anti-HER2 scFv was obtained with high radiochemical yield after only a 5-min reaction at room temperature. The probe showed high accumulation in HER2-positive xenografts and the intratumoral distribution of radioactivity coincided with HER2-positive regions. Furthermore, [(68)Ga]Df-anti-HER2 scFv helped visualize HER2-positive xenografts and monitor the changes in HER2 expression after anti-HER2 therapy. [(68)Ga]Df-anti-HER2 scFv could be a promising probe to evaluate HER2 status by in vivo PET imaging, unless trastuzumab is prescribed as part of the therapy.

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

Analysis of the major epitope of the alpha2 chain of bovine type I collagen in children with bovine gelatin allergy.

PubMed

Hori, Hisae; Hattori, Shunji; Inouye, Sakae; Kimura, Akinori; Irie, Shinkichi; Miyazawa, Hiroshi; Sakaguchi, Masahiro

2002-10-01

Anaphylaxis to measles, mumps, and rubella vaccines has been reported. It has been found that most of these reactions to live vaccines are caused by type I allergy with the bovine gelatin present in the vaccines as an allergen. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. We previously reported that allergic reactions to gelatin are caused by the type I collagen alpha2 (alpha2[I]) chain. To aid in the development of gelatin that has little or no allergenicity in human subjects, we investigated epitopes of bovine alpha2(I) chain with use of IgE in gelatin-sensitive children. Serum samples were collected from 15 patients who had systemic allergic reactions to vaccines and high levels of specific IgE to bovine gelatin. Eleven overlapping recombinant proteins that cover bovine alpha2(I) were prepared with a bacterial expression vector. We examined IgE reactivity to these recombinant proteins by means of ELISA. Fifteen peptides covering a major reactive recombinant protein were synthesized. The IgE-reacting epitope was identified by means of IgE-ELISA inhibition with these synthetic peptides and pooled serum from the patients. We found that of the 15 patients, 13 showed IgE reactivity to a recombinant protein (no. 3) spanning the central region of the collagenous domain ((418)Gly-(662)Pro). Furthermore, all 13 patients showed IgE reactivity to the 4-kd recombinant protein (no. 3a) spanning the region from (461)Pro to (500)Glu. In IgE-ELISA inhibition we found that a minimum IgE epitope of gelatin allergen was composed of the 10-amino-acid sequence (485)Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro(494). This sequence is not observed in the human type I collagen alpha1 and alpha2 chains, nor is it found in the bovine type I collagen alpha1 chain. We found that Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro is a major IgE epitope of the alpha2 chain of bovine type I collagen in patients with gelatin allergy. The degree of anaphylaxis to gelatin in vaccines might be reduced by digestion of this IgE-binding site in gelatin.

Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

PubMed Central

Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

2015-01-01

Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Interleukin-9 enhances interleukin-5 receptor expression, differentiation, and survival of human eosinophils.

PubMed

Gounni, A S; Gregory, B; Nutku, E; Aris, F; Latifa, K; Minshall, E; North, J; Tavernier, J; Levit, R; Nicolaides, N; Robinson, D; Hamid, Q

2000-09-15

Interleukin-9 (IL-9) has been implicated in the pathogenesis of allergic disorders. To examine the interaction between IL-9 and eosinophils, we evaluated mature peripheral blood eosinophils for their expression of the specific alpha-subunit of the IL-9 receptor (IL-9R-alpha). The expression of IL-9R-alpha by human eosinophils was detected at the messenger RNA (mRNA) and protein levels by reverse transcriptase-polymerase chain reaction (RT-PCR), flow cytometry, and immunocytochemical analysis, respectively. Functional analyses demonstrated that recombinant human (rh)IL-9 inhibited in vitro peripheral blood human eosinophil apoptosis in a concentration-dependent manner. We then examined the role of IL-9 in eosinophil differentiation using the human cord blood CD34(+) cells and human promyelocytic leukemia cells (HL-60). The addition of IL-9 to CD34(+) cells cultured in IL-3 and IL-5 enhanced eosinophil development, and IL-9 alone induced the expression of IL-5R-alpha. IL-9 also up-regulated the IL-5R-alpha chain cell surface expression during terminal eosinophil differentiation of the HL-60 cell line. Our findings suggest that IL-9 may potentiate in vivo eosinophil function by increasing their survival and IL-5-mediated differentiation and maturation. Taken together, these results suggest a mechanism by which IL-9 potentiates airway and tissue eosinophilia.

Expression of apoptotic genes in immature and in vitro matured equine oocytes and cumulus cells.

PubMed

Leon, P M M; Campos, V F; Kaefer, C; Begnini, K R; McBride, A J A; Dellagostin, O A; Seixas, F K; Deschamps, J C; Collares, T

2013-08-01

The gene expression of Bax, Bcl-2, survivin and p53, following in vitro maturation of equine oocytes, was compared in morphologically distinct oocytes and cumulus cells. Cumulus-oocyte complexes (COC) were harvested and divided into two groups: G1 - morphologically healthy cells; and G2 - less viable cells or cells with some degree of atresia. Total RNA was isolated from both immature and in vitro matured COC and real-time reverse transcription polymerase chain reaction (qRT-PCR) was used to quantify gene expression. Our results showed there was significantly higher expression of survivin (P < 0.05) and lower expression of p53 (P < 0.01) in oocytes compared with cumulus cells in G1. No significant difference in gene expression was observed following in vitro maturation or in COC derived from G1 and G2. However, expression of the Bax gene was significantly higher in cumulus cells from G1 (P < 0.02).

Expression of ATF4 and VEGF in chorionic villus tissue in early spontaneous abortion.

PubMed

Chai, Luwei; Ling, Kang; He, Xiaoxi; Yang, Rong

2013-10-01

To explore the relationship between early spontaneous abortion (SA) and the expression of activating transcription factor 4 (ATF4) and vascular endothelial growth factor (VEGF). The expression of ATF4 and VEGF protein and mRNA in villi from first trimester spontaneous abortion (SA, n=30) and normal pregnancy (NP, n=30) were detected by immunohistochemistry and fluorescent quantitative polymerase chain reaction (FQ-PCR). Both protein and mRNA expressions of ATF4 and VEGF in the SA group were significantly lower than in the NP group (P<0.01). Their proteins are expressed mainly in syncytiotrophoblast, cytotrophoblast and villous stromal cells. Correlation analysis showed that the expression of ATF4 was positively correlated with that of VEGF in the SA group (r=0.717, P<0.01). Lower expression of ATF4 and VEGF genes in chorionic villus tissue may participate in the pathogenesis of spontaneous abortion. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Enhancement of cardiomyogenesis in stem cells by low intensity pulsed ultrasound

NASA Astrophysics Data System (ADS)

Teo, Ailing; Morshedi, Amir; Wang, Jen-Chieh; Lim, Mayasari; Zhou, Yufeng

2017-03-01

Low intensity pulsed ultrasound (LIPUS) has been shown to enhance bone and cartilage regeneration from stem cells. Gene expression of angiotensin II type 1 (AT1) receptor can be increased in LIPUS-treated osteoblasts. The AT1 receptor is a known mechanoreceptor in cardiomyocytes. It suggests that LIPUS may enhance cardiomyogenesis via mechanotransduction by increasing AT1 expression. Murine embryonic stem cells (ESCs) were treated daily by 10-min 1MHz LIPUS at spatial-average temporal-peak acoustic intensities of 30 mW/cm2 and 300 mW/cm2 in both continuous and pulsed wave (20% duty cycle) for 10 days. Polymerase chain reaction (PCR), immunocytochemistry, and beating rate were used to evaluate the cardiac viability quantitatively. After the treatment of LIPUS, beating rate of contractile areas and cardiac gene expression, such as α- and β-myosin heavy chain, were improved. Furthermore, no deleterious effects to the development of cardiac proteins were observed. All results suggest that LIPUS stimulation has the capacity of enhancing cardiomyogenesis from embryonic stem cells. With the benefit and the ease in incorporating LIPUS into various culture platforms, LIPUS has the potential to produce cardiomyocytes for clinical use in the future.

ICI 182,780-regulated gene expression in DU145 prostate cancer cells is mediated by estrogen receptor-beta/NFkappaB crosstalk.

PubMed

Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

2006-04-01

Estrogen receptor (ER)-beta is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-beta-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 microM ICI. Semiquantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12alpha chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-beta antisense oligonucleotide reduced cellular ER-beta mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFkappaB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-beta and the NFkappaB signaling pathway, denoting a novel mechanism of ER-beta-mediated ICI action. Therefore, combined therapies targeting ER-beta and NFkappaB signaling may be synergistic as treatment for PCa.

ICI 182,780-Regulated Gene Expression in DU145 Prostate Cancer Cells Is Mediated by Estrogen Receptor-β/NFκB Crosstalk1

PubMed Central

Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

2006-01-01

Abstract Estrogen receptor (ER)-β is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-β-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 µM ICI. Semi-quantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12α chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-β antisense oligonucleotide reduced cellular ER-β mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFκB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-α and the NFκB signaling pathway, denoting a novel mechanism of ER-β-mediated ICI action. Therefore, combined therapies targeting ER-β and NFκB signaling may be synergistic as treatment for PCa. PMID:16756716

Nitric oxide donors rescue diabetic nephropathy through oxidative-stress-and nitrosative-stress-mediated Wnt signaling pathways

PubMed Central

Hsu, Yung-Chien; Lee, Pei-Hsien; Lei, Chen-Chou; Ho, Cheng; Shih, Ya-Hsueh; Lin, Chun-Liang

2015-01-01

Aims/Introduction The role of the renal nitric oxide (NO) system in the pathophysiology of diabetic nephropathy constitutes a very challenging and fertile field for future investigation. The purpose of the present study was to investigate whether NO donors can attenuate diabetic renal fibrosis and apoptosis through modulating oxidative-and nitrosative-stress, and Wnt signaling using in vivo diabetic models. Materials and Methods Diabetic rat was induced by a single intraperitoneal injection of streptozotocin. Rats in each group were intraperitoneally given 2,2′-(hydroxynitrosohydrazino)bis-ethanamine (1 U/kg/day) and vehicle for 28 and 56 consecutive days. Expression of the oxidative-and nitrosative-stress, and Wnt signaling components were examined in kidneys from diabetic animals by quantitative reverse transcription polymerase chain reaction, western blot analysis and immunohistochemical staining. Results NO donor treatment significantly reduced the ratio of kidney weight to bodyweight and proteinuria. This treatment also significantly restored the suppressive effect of diabetes on urinary NO2 + NO3 levels. Immunohistochemistry showed that NO donor treatment significantly reduced transforming growth factor (TGF)-β1, fibronectin, cleaved caspase-3 and triphosphate-biotin nick end-labeling expression in the glomeruli of diabetic rats. We found that diabetes promoted 8-hydroxy-2′-deoxyguanosine, and peroxynitrite expression coincided with reduced endothelial NO synthase expression in glomeruli. Interestingly, NO donor treatment completely removed oxidative stress and nitrosative stress, and restored endothelial NO synthase expression in diabetic renal glomeruli. Immunohistomorphometry results showed that NO donor treatment significantly restored suppressed Wnt5a expression and β-catenin immunoreactivities in glomeruli. Based on laser-captured microdissection for quantitative reverse transcription polymerase chain reaction, diabetes significantly increased TGF-β1, and fibronectin expression coincided with depressed Wnt5a expression. NO donor treatment reduced TGF-β1, fibronectin activation, and the suppressing effect of diabetes on Wnt5a and β-catenin expression in renal glomeruli. Conclusions NO donor treatment alleviates extracellular matrix accumulation and apoptosis in diabetic nephropathy in vivo by not only preventing the diabetes-mediated oxidative and nitrostative stress, but also restoring downregulation of endothelial NO synthase expression and Wnt/β-catenin signaling. These findings suggest that modulation of NO is a viable alternative strategy for rescuing diabetic renal injury. PMID:25621130

Loss of PTEN Expression Is Associated With High MicroRNA 24 Level and Poor Prognosis in Patients With Tongue Squamous Cell Carcinoma.

PubMed

Zhao, Jingzhu; Chi, Jiadong; Gao, Ming; Zhi, Jingtai; Li, Yigong; Zheng, Xiangqian

2017-07-01

The aim of this study was to detect the relationship between phosphatase and tensin homolog deletion on chromosome 10 (PTEN) and microRNA 24 (miR-24) and correlate PTEN expression with important clinical parameters of patients with tongue squamous cell carcinoma (TSCC). In this retrospective case series, all TSCC patients treated at Tianjin Medical University Cancer Institute and Hospital between March 2005 and October 2011 were retrospectively reviewed. Demographic information and clinical data (histologic type, clinical stage, tumor differentiation, and so on) were collected. The miR-24 level was detected by quantitative reverse transcription-polymerase chain reaction. The PTEN level was analyzed by immunohistochemistry and quantitative reverse transcription-polymerase chain reaction. Data analyses were performed by Spearman correlation analysis, Pearson χ 2 test, and paired t test. Kaplan-Meier curves, log-rank analyses, and a Cox proportional hazards model were used to evaluate the prognostic value of PTEN. A total of 90 patients (aged 59.4 ± 9.5 years, 53 men and 37 women) were identified. Loss of PTEN expression was detected in 28 of 90 tumors (31.1%). The PTEN messenger RNA level was negatively correlated with the miR-24 level (r = -0.569, P < .01). PTEN expression also was negatively correlated with the miR-24 level (r = -0.621, P < .01). Furthermore, PTEN expression was significantly lower in cancer tissues than in adjacent normal tissues, and its expression was negatively correlated with clinical stage (P < .01) and positively correlated with differentiation (P < .05) in TSCC patients. In addition, the Kaplan-Meier curve indicated that loss of PTEN expression resulted in poor survival of TSCC patients (P < .01). Multivariate analysis indicated that PTEN expression level and clinical stage may be independent prognostic factors for TSCC patients. This study suggested that PTEN expression was negatively correlated with the miR-24 level in TSCC. The loss of PTEN expression may serve as a predictor of unfavorable prognosis for TSCC patients. Copyright © 2017 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Medium-chain triglycerides promote macrophage reverse cholesterol transport and improve atherosclerosis in ApoE-deficient mice fed a high-fat diet.

PubMed

Zhang, Xinsheng; Zhang, Yong; Liu, Yinghua; Wang, Jin; Xu, Qing; Yu, Xiaoming; Yang, Xueyan; Liu, Zhao; Xue, Changyong

2016-09-01

We previously observed that medium-chain triglycerides (MCTs) could reduce body fat mass and improve the metabolism of cholesterol. We hypothesized that MCTs can improve atherosclerosis by promoting the reverse cholesterol transport (RCT) process. Therefore, the objective of this study was to investigate the roles of MCTs in macrophage RCT and the progression of atherosclerosis. To test this hypothesis, 30 4-week-old ApoE-deficient (ApoE(-/-)) mice were randomly divided into 2 groups and fed a diet of 2% MCTs or long-chain triglycerides (LCTs) for 16 weeks. Ten age- and sex-matched C57BL/6J mice were fed a diet of 2% LCTs as the control. Macrophage-to-feces RCT was assessed in vivo by intraperitoneal injection of RAW 264.7 macrophages containing (3)H-labeled cholesterol, and atherosclerotic plaques were measured. The mRNA and protein expressions were determined by reverse transcriptase polymerase chain reaction and Western blot analyses, respectively. There was a greater decrease in body fat mass, atherosclerotic plaques, and an improvement in serum lipid profiles. In addition, the MCT mice group showed an increase in (3)H-tracer in the feces and a decrease in the liver. Significantly higher levels of mRNA and protein expression of hepatic ATP-binding cassette transporter A1, ATP-binding cassette transporter G5, cholesterol 7α-hydroxylase, and intestinal ATP-binding cassette transporter G8, as well as lower levels of expression of intestinal Niemann-Pick C1-like 1, were found in the MCT group. These results suggest that MCTs could obviously promote macrophage RCT and improve atherosclerosis in ApoE(-/-) mice, indicating that MCTs have the potential to prevent cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

PubMed

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

Development-related expression patterns of protein-coding and miRNA genes involved in porcine muscle growth.

PubMed

Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W

2014-11-27

Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.

GREM1 is expressed in the cancer-associated myofibroblasts of basal cell carcinomas.

PubMed

Kim, Hye Sung; Shin, Myung Soo; Cheon, Min Seok; Kim, Jae Wang; Lee, Cheol; Kim, Woo Ho; Kim, Young Sill; Jang, Bo Gun

2017-01-01

Cancer-associated fibroblasts (CAFs) play important roles in cancer progression through their complex interactions with cancer cells. The secreted bone morphogenetic protein antagonist, gremlin1 (GREM1) is expressed by the CAFs of basal cell carcinomas (BCCs), and promotes the growth of cancer cells. In this study, we investigated the expression of GREM1 mRNAs in various benign and malignant skin tumors, including various BCC subtypes. Analysis by RNA in situ hybridization (ISH) revealed that fibroblasts in the scar tissue expressed GREM1 and α-smooth muscle actin (α-SMA), whereas resident fibroblasts in the dermis of the normal skin did not express GREM1. Real-time polymerase chain reaction analysis showed significantly higher GREM1 expression in skin cancers and pilomatricomas (PMCs) than in other benign skin tumors. Tissue microarrays analyzed by RNA ISH for GREM1 expression also demonstrated that 23% of BCCs, 42% of squamous cell carcinomas, 20% of melanomas, and 90% of PMCs were positive for GREM1 expression, whereas trichoepitheliomas, eccrine poromas, hidradenomas, and spiradenomas were negative for GREM1 expression. Most BCCs that were GREM1 expression positive were of desmoplastic or mixed subtypes, and GREM1 expression was localized to activated myofibroblasts at the tumoral-stromal interface. Interestingly, most PMCs harbored GREM1-expressing fibroblasts, probably because of the inflammatory responses caused by foreign body reactions to keratin. Additionally, in BCCs, stromal GREM1 expression had a strong correlation with CD10 expression. In conclusion, GREM1 is frequently expressed by myofibroblasts in scars or in the stroma of basal cell carcinomas, suggesting that GREM1 expression can be a marker for activated myofibroblasts in the cancer stroma or in scar tissue.

ETS-1 Expression Is Hypoxia-independent in Glioblastoma-derived Endothelial and Mesenchymal Stem-like Cells.

PubMed

Koessinger, Dominik; Albrecht, Valerie; Faber, Florian; Jaehnert, Irene; Schichor, Christian

2018-06-01

Tumor cells infiltrating the brain are a typical hallmark of glioblastoma. Invasiveness of glioma cells has been associated with ETS proto-oncogene 1 (ETS-1). In non-glial tumors, ETS-1 expression has been linked to hypoxia. However, it is not known whether hypoxia regulates ETS-1 expression in glioblastoma. The spatial distribution of ETS-1 expression in primary glioblastoma was assessed using immunohistochemistry. ETS-1 expression in glioblastoma-derived mesenchymal stem-like cells (gbMSLCs) was determined using immunocytochemistry. The effect of hypoxia on ETS-1 expression of gbMSLCs, glioma cell lines and glioblastoma-derived endothelial cells was assessed using polymerase chain reaction and immunoblotting. Our immunohistochemical studies revealed ETS-1 expression in stromal and endothelial glioblastoma cells. Stromal ETS-1 expression in glioblastoma correlated with microvessel density. gbMSLCs were found to express ETS-1. In all examined cell lines, ETS-1 transcription and expression were independent of hypoxia. In glioblastoma, ETS-1-expression is not dependent on hypoxia, but correlates with tumor vascularization. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

An ophthalmic solution of a peroxisome proliferator-activated receptor gamma agonist prevents corneal inflammation in a rat alkali burn model

PubMed Central

Uchiyama, Masaaki; Masuda, Yukinari; Nagasaka, Shinya; Fukuda, Yuh; Takahashi, Hiroshi

2013-01-01

Purpose We clarified the effects of an ophthalmic solution of a peroxisome proliferator-activated receptor gamma (PPARγ) agonist on corneal inflammation and wound healing after alkali burn injury in rats. Methods After alkali exposure, either an ophthalmic solution with 0.1% pioglitazone hydrochloride (the PPARγ group) or vehicle (the vehicle group) was topically applied to the cornea until day 14. Histological, immunohistochemical, and real-time reverse transcription polymerase chain reaction analysis were performed. Results After alkali injury, PPARγ expression increased, with the infiltration of many inflammatory cells. The infiltration of neutrophils and macrophages started from the corneal limbus within 6 h, and developed in the corneal center by day 7, with associated neovascularization. The accumulation of α-smooth muscle actin-positive myofibroblasts and the deposition of type III collagen were noted on day 14. The histological changes were suppressed significantly by treatment with the ophthalmic solution of the PPARγ agonist. In addition, the number of infiltrating M2 macrophages in the cornea was increased by PPARγ agonist treatment. In real-time reverse transcription polymerase chain reaction analysis, the messenger ribonucleic acid expression levels of interleukin-1β (IL-1β), IL-6, IL-8, monocyte chemoattractant protein-1, tumor necrosis factor-α, transforming growth factor beta 1, and vascular endothelial growth factor-A were decreased in the PPARγ group compared to the vehicle group in the early periods of corneal inflammation. Conclusions The ophthalmic solution of the PPARγ agonist inhibited inflammation, decreased the fibrotic reaction, and prevented neovascularization in the cornea from the early phase after alkali burn injury. The ophthalmic solution of the PPARγ agonist may provide a new treatment strategy with useful clinical applications for corneal inflammation and wound healing. PMID:24194635

Effect of The Receptor Activator of Nuclear Factor кB and RANK Ligand on In Vitro Differentiation of Cord Blood CD133(+) Hematopoietic Stem Cells to Osteoclasts.

PubMed

Kalantari, Nasim; Abroun, Saeid; Soleimani, Masoud; Kaviani, Saeid; Azad, Mehdi; Eskandari, Fatemeh; Habibi, Hossein

2016-01-01

Receptor activator of nuclear factor-kappa B ligand (RANKL) appears to be an osteoclast-activating factor, bearing an important role in the pathogenesis of multiple myeloma. Some studies demonstrated that U-266 myeloma cell line and primary myeloma cells expressed RANK and RANKL. It had been reported that the expression of myeloid and monocytoid markers was increased by co-culturing myeloma cells with hematopoietic stem cells (HSCs). This study also attempted to show the molecular mechanism of RANK and RANKL on differentiation capability of human cord blood HSC to osteoclast, as well as expression of calcitonin receptor (CTR) on cord blood HSC surface. In this experimental study, CD133(+) hematopoietic stem cells were isolated from umbilical cord blood and cultured in the presence of macrophage colony-stimulating factor (M-CSF) and RANKL. Osteoclast differentiation was characterized by using tartrate-resistant acid phosphatase (TRAP) staining, giemsa staining, immunophenotyping, and reverse transcription-polymerase chain reaction (RT-PCR) assay for specific genes. Hematopoietic stem cells expressed RANK before and after differentiation into osteoclast. Compared to control group, flow cytometric results showed an increased expression of RANK after differentiation. Expression of CTR mRNA showed TRAP reaction was positive in some differentiated cells, including osteoclast cells. Presence of RANKL and M-CSF in bone marrow could induce HSCs differentiation into osteoclast.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Role of Loop-Clamping Side Chains in Catalysis by Triosephosphate Isomerase.

PubMed

Zhai, Xiang; Amyes, Tina L; Richard, John P

2015-12-09

The side chains of Y208 and S211 from loop 7 of triosephosphate isomerase (TIM) form hydrogen bonds to backbone amides and carbonyls from loop 6 to stabilize the caged enzyme-substrate complex. The effect of seven mutations [Y208T, Y208S, Y208A, Y208F, S211G, S211A, Y208T/S211G] on the kinetic parameters for TIM catalyzed reactions of the whole substrates dihydroxyacetone phosphate and d-glyceraldehyde 3-phosphate [(k(cat)/K(m))(GAP) and (k(cat)/K(m))DHAP] and of the substrate pieces glycolaldehyde and phosphite dianion (k(cat)/K(HPi)K(GA)) are reported. The linear logarithmic correlation between these kinetic parameters, with slope of 1.04 ± 0.03, shows that most mutations of TIM result in an identical change in the activation barriers for the catalyzed reactions of whole substrate and substrate pieces, so that the transition states for these reactions are stabilized by similar interactions with the protein catalyst. The second linear logarithmic correlation [slope = 0.53 ± 0.16] between k(cat) for isomerization of GAP and K(d)(⧧) for phosphite dianion binding to the transition state for wildtype and many mutant TIM-catalyzed reactions of substrate pieces shows that ca. 50% of the wildtype TIM dianion binding energy, eliminated by these mutations, is expressed at the wildtype Michaelis complex, and ca. 50% is only expressed at the wildtype transition state. Negative deviations from this correlation are observed when the mutation results in a decrease in enzyme reactivity at the catalytic site. The main effect of Y208T, Y208S, and Y208A mutations is to cause a reduction in the total intrinsic dianion binding energy, but the effect of Y208F extends to the catalytic site.

Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

PubMed

Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

2018-02-01

Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

An inducible HSP70 gene from the midge Chironomus dilutus: Characterization and transcription profile under environmental stress

USGS Publications Warehouse

Karouna-Renier, N. K.; Rao, K.R.

2009-01-01

In the present study, we identified and characterized an inducible heat shock protein 70 (HSP70) from the midge Chironomus dilutus and investigated the transcriptional profile of the gene under baseline and environmentally stressful conditions. Using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), we observed increased expression of CD-HSP70-1 in response to both heat shock and copper stress. We also investigated the expression of this gene during midge development. All C. dilutus developmental stages expressed CD-HSP70-1 under normal conditions, although at extremely low levels. Phylogenetic analysis of the amino acid sequence demonstrated distinct clustering of this gene with inducible HSP70s from other insect species. ?? 2008 The Authors.

Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

PubMed

Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

1994-03-01

Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

[Determination of mRNA-transcripts and heat shock proteins HSP70 and HSP90 in retina of the adult Spanish Ribbed Newt Pleurodeles waltl].

PubMed

Avdonin, P P; Markitantova, Yu V; Poplinskaya, V A; Grigoryan, E N

2013-01-01

Expression of genes and heat shock proteins in normal intact retina of the Spanish Ribbed Newt Pleurodeles waltl was studied using polymerase chain reaction, Western blot hybridization, and immunohistochemistry. It was shown that the proteins HSP70 and HSP90, as well as their encoding transcripts of relevant genes, are constitutively expressed in eye tissues. These proteins were distributed differentially, and they were characterized by expression of different levels in the retina: HSP70 dominated in the external retina, while HSP90 dominated in the internal one, in particular, in Muller glial cells and the optic nerve. Transcripts and heat shock proteins HSP70 and HSP90 were also found in the retinal pigment epithelium and eye growth zone.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

1990-10-01

The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

Fiber transformation and replacement in low-frequency stimulated rabbit fast-twitch muscles.

PubMed

Schuler, M; Pette, D

1996-08-01

The fast-to-slow conversion of rabbit skeletal muscles by chronic low-frequency (10 Hz, 12 h daily) stimulation involves (1) sequential fast-to-slow fiber-type transitions in the order of type IID-->type IIA-->type I, and (2) the replacement of deteriorating fast-twitch glycolytic fibers by new fibers derived from satellite cells and myotubes. These two processes were analyzed in 30- and 60-day stimulated extensor digitorum longus and tibialis anterior muscles. Fast-to-slow transforming fibers were identified by myofibrillar actomyosin histochemistry as type C fibers and immunohistochemically by their reaction with monoclonal antibodies specific to slow and fast myosin heavy chain isoforms. In situ hybridization of mRNA specific to the myosin heavy chain I isoform identified all fibers expressing slow myosin, i.e., type I and C fibers. The fraction of transforming fibers ranged between 35% and 50% in 30-day stimulated muscles. The percentage of type I fibers (20%) was threefold elevated in extensor digitorum longus muscle, but unaltered (3.5%) in tibialis anterior muscle, suggesting that fast-to-slow fiber conversion was more advanced in the former than in the latter. Fiber replacement was indicated by the finding that the fiber populations of both muscles contained 15% myotubes or small fibers with central nuclei. In situ hybridization revealed that myotubes and small regenerating fibers uniformly expressed myosin heavy chain I mRNA. Similarly, high percentages of slow-myosin-expressing myotubes and small fibers were found in 60-day stimulated muscles.

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

DTIC Science & Technology

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

Insulin chains as efficient fusion tags for prokaryotic expression of short peptides.

PubMed

Deng, Ligang; Xue, Xiaoying; Shen, Cangjie; Song, Xiaohan; Wang, Chunyang; Wang, Nan

2017-10-01

Insulin chains are usually expressed in Escherichia coli as fusion proteins with different tags, including various low molecular weight peptide tags. The objective of this study was to determine if insulin chains could facilitate the recombinant expression of other target proteins, with an emphasis on low molecular weight peptides. A series of short peptides were fused to mini-proinsulin, chain B or chain A, and induced for expression in Escherichia coli. All the tested peptides including glucagon-like peptide 1 (GLP-1), a C-terminal extended GLP-1, oxyntomodulin, enfuvirtide, linaclotide, and an unstructured artificial peptide were expressed with reasonable yields, identified by Tricine-SDS-PAGE and immunoblotting. All recombinant products were expressed in inclusion bodies. The effective accumulation of products was largely attributed to the insoluble expression induced by fusion with insulin chains, and was confirmed by the fusion expression of transthyretin. Insulin chains thus show promise as efficient fusion tags for mass production of heterologous peptides in prokaryotes. Copyright © 2017 Elsevier Inc. All rights reserved.

Effect of Heterogeneous Chemical Reactions on the Köhler Activation of Aqueous Organic Aerosols.

PubMed

Djikaev, Yuri S; Ruckenstein, Eli

2018-05-03

We study some thermodynamic aspects of the activation of aqueous organic aerosols into cloud droplets considering the aerosols to consist of liquid solution of water and hydrophilic and hydrophobic organic compounds, taking into account the presence of reactive species in the air. The hydrophobic (surfactant) organic molecules on the surface of such an aerosol can be processed by chemical reactions with some atmospheric species; this affects the hygroscopicity of the aerosol and hence its ability to become a cloud droplet either via nucleation or via Köhler activation. The most probable pathway of such processing involves atmospheric hydroxyl radicals that abstract hydrogen atoms from hydrophobic organic molecules located on the aerosol surface (first step), the resulting radicals being quickly oxidized by ubiquitous atmospheric oxygen molecules to produce surface-bound peroxyl radicals (second step). These two reactions play a crucial role in the enhancement of the Köhler activation of the aerosol and its evolution into a cloud droplet. Taking them and a third reaction (next in the multistep chain of relevant heterogeneous reactions) into account, one can derive an explicit expression for the free energy of formation of a four-component aqueous droplet on a ternary aqueous organic aerosol as a function of four independent variables of state of a droplet. The results of numerical calculations suggest that the formation of cloud droplets on such (aqueous hydrophilic/hydrophobic organic) aerosols is most likely to occur as a Köhler activation-like process rather than via nucleation. The model allows one to determine the threshold parameters of the system necessary for the Köhler activation of such aerosols, which are predicted to be very sensitive to the equilibrium constant of the chain of three heterogeneous reactions involved in the chemical aging of aerosols.

Changes in Hepatic TRβ Protein Expression, Lipogenic Gene Expression, and Long-Chain Acylcarnitine Levels During Chronic Hyperthyroidism and Triiodothyronine Withdrawal in a Mouse Model.

PubMed

Ohba, Kenji; Sinha, Rohit Anthony; Singh, Brijesh Kumar; Iannucci, Liliana Felicia; Zhou, Jin; Kovalik, Jean-Paul; Liao, Xiao-Hui; Refetoff, Samuel; Sng, Judy Chia Ghee; Leow, Melvin Khee-Shing; Yen, Paul Michael

2017-06-01

Thyroid hormone (TH) has important roles in regulating hepatic metabolism. It was previously reported that most hepatic genes activated by a single triiodothyronine (T3) injection became desensitized after multiple injections, and that approximately 10% of target genes did not return to basal expression levels after T3 withdrawal, despite normalization of serum TH and thyrotropin (TSH) levels. To determine the possible mechanism(s) for desensitization and incomplete recovery of hepatic target gene transcription and their effects on metabolism, mRNA and/or protein expression levels of key regulators of TH action were measured, as well as metabolomic changes after chronic T3 treatment and withdrawal. Adult male mice were treated with daily injections of T3 (20 μg/100 g body weight) for 14 days followed by the cessation of T3 for 10 days. Livers were harvested at 6 hours, 24 hours, and 14 days after the first T3 injection, and at 10 days after withdrawal, and then analyzed by quantitative reverse transcription polymerase chain reaction, Western blotting, and metabolomics. Although TH receptor (TRα and TRβ) mRNAs decreased slightly after chronic T3 treatment, only TRβ protein decreased before returning to basal expression level after withdrawal. The expression of other regulators of TH action was unchanged. TRβ protein expression was also decreased in adult male monocarboxylate transporter-8 (Mct8)-knockout mice, an in vivo model of chronic intrahepatic hyperthyroidism. Previously, increased hepatic long-chain acylcarnitine levels were found after acute TH treatment. However, in this study, long-chain acylcarnitine levels were unchanged after chronic T3, and paradoxically increased after T3 withdrawal. Pathway analyses of the previous microarray results showed upregulation of lipogenic genes after acute T3 treatment and withdrawal. Phosphorylation of acetyl-CoA carboxylase also decreased after T3 withdrawal. Decreased hepatic TRβ protein expression occurred after chronic T3 exposure in adult male wild-type and Mct8-knockout mice. Gene array pathway and metabolomics analyses showed abnormalities in hepatic lipogenic gene expression and acylcarnitine levels, respectively, after withdrawal, despite normalization of serum TSH and TH levels. These findings may help explain the variable clinical presentations of some patients during hyperthyroidism and recovery, since TRβ protein, target gene expression, and metabolic adaptive changes can occur in individual tissues without necessarily being reflected by circulating TH and TSH concentrations.

Changes in Hepatic TRβ Protein Expression, Lipogenic Gene Expression, and Long-Chain Acylcarnitine Levels During Chronic Hyperthyroidism and Triiodothyronine Withdrawal in a Mouse Model

PubMed Central

Ohba, Kenji; Sinha, Rohit Anthony; Singh, Brijesh Kumar; Iannucci, Liliana Felicia; Zhou, Jin; Kovalik, Jean-Paul; Liao, Xiao-Hui; Refetoff, Samuel; Sng, Judy Chia Ghee; Leow, Melvin Khee-Shing; Yen, Paul Michael

2017-01-01

Background: Thyroid hormone (TH) has important roles in regulating hepatic metabolism. It was previously reported that most hepatic genes activated by a single triiodothyronine (T3) injection became desensitized after multiple injections, and that approximately 10% of target genes did not return to basal expression levels after T3 withdrawal, despite normalization of serum TH and thyrotropin (TSH) levels. To determine the possible mechanism(s) for desensitization and incomplete recovery of hepatic target gene transcription and their effects on metabolism, mRNA and/or protein expression levels of key regulators of TH action were measured, as well as metabolomic changes after chronic T3 treatment and withdrawal. Methods: Adult male mice were treated with daily injections of T3 (20 μg/100 g body weight) for 14 days followed by the cessation of T3 for 10 days. Livers were harvested at 6 hours, 24 hours, and 14 days after the first T3 injection, and at 10 days after withdrawal, and then analyzed by quantitative reverse transcription polymerase chain reaction, Western blotting, and metabolomics. Results: Although TH receptor (TRα and TRβ) mRNAs decreased slightly after chronic T3 treatment, only TRβ protein decreased before returning to basal expression level after withdrawal. The expression of other regulators of TH action was unchanged. TRβ protein expression was also decreased in adult male monocarboxylate transporter-8 (Mct8)-knockout mice, an in vivo model of chronic intrahepatic hyperthyroidism. Previously, increased hepatic long-chain acylcarnitine levels were found after acute TH treatment. However, in this study, long-chain acylcarnitine levels were unchanged after chronic T3, and paradoxically increased after T3 withdrawal. Pathway analyses of the previous microarray results showed upregulation of lipogenic genes after acute T3 treatment and withdrawal. Phosphorylation of acetyl-CoA carboxylase also decreased after T3 withdrawal. Conclusions: Decreased hepatic TRβ protein expression occurred after chronic T3 exposure in adult male wild-type and Mct8-knockout mice. Gene array pathway and metabolomics analyses showed abnormalities in hepatic lipogenic gene expression and acylcarnitine levels, respectively, after withdrawal, despite normalization of serum TSH and TH levels. These findings may help explain the variable clinical presentations of some patients during hyperthyroidism and recovery, since TRβ protein, target gene expression, and metabolic adaptive changes can occur in individual tissues without necessarily being reflected by circulating TH and TSH concentrations. PMID:28457184

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

PubMed

Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

2016-11-01

Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560-568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. © 2016 Peeters et al.

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis

PubMed Central

Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh

2016-01-01

Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016;5:560–568. DOI: 10.1302/2046-3758.511.BJR-2016-0033.R3. PMID:27881439

Modulation of smooth muscle tonus in the lower urinary tract: interplay of myosin light-chain kinase (MLCK) and MLC phosphatase (MLCP).

PubMed

Lin, Guiting; Fandel, Thomas M; Shindel, Alan W; Wang, Guifang; Banie, Lia; Ning, Hongxiu; Lue, Tom F; Lin, Ching-Shwun

2011-07-01

To assess and compare the expression and activity of myosin light-chain kinase (MLCK) and MLC phosphatase (MLCP) in rat bladder and urethra. Bladder and urethral smooth muscles were obtained from 2-month-old female Sprague-Dawley rats. They were analysed by real-time polymerase chain reaction for the mRNA expression of MLCK and myosin phosphatase-targeting subunit of protein phosphatase type 1 (MYPT1, a subunit of MLCP). Levels of MLCK and MYPT1 mRNA expression were determined as a ratio to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The tissues were also analysed by Western blotting for MLCK and MYPT1 protein expression as a ratio to the expression of β-actin. A two-step enzymatic activity assay using phosphorylated and dephosphorylated smooth muscle myosin was used to assess MLCK and MLCP activity. MLCK mRNA expression was higher in the bladder than in the urethra [mean (sd) ratio to GAPDH: 0.26 (0.17) vs 0.14 (0.12); P = 0.09]. MYPT1 mRNA expression was significantly higher in the bladder than in the urethra [mean (sd) ratio to GAPDH: 2.31 (1.04) vs 0.56 (0.36); P = 0.001]. Expression of both MLCK and MYPT1 protein was significantly higher in the bladder compared with the urethra [mean (sd) ratio to β-actin: 1.63 (0.25) vs 0.91 (0.29) and 0.97 (0.10) vs 0.37 (0.29), respectively; both P < 0.001]. Enzymatic assay identified significantly greater MLCK activity in the bladder than in the urethra. While, MLCP activity was lower in the bladder than in the urethra. In healthy young female rats, MLCK activity is higher and MLCP activity is lower in the bladder relative to the urethra. These differences probably play a role in modulating the functional differences between bladder and urethral smooth muscle tone. © 2010 THE AUTHORS. BJU INTERNATIONAL © 2010 BJU INTERNATIONAL.

A polysaccharide-peptide complex from abalone mushroom (Pleurotus abalonus) fruiting bodies increases activities and gene expression of antioxidant enzymes and reduces lipid peroxidation in senescence-accelerated mice.

PubMed

Li, L; Ng, T B; Song, M; Yuan, F; Liu, Z K; Wang, C L; Jiang, Y; Fu, M; Liu, F

2007-06-01

The antioxidant effects of a polysaccharide-peptide complex (F22) from mushroom (Pleurotus abalonus)-fruiting bodies were studied. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) in the liver, kidney, and brain of senescence-accelerated mice showed a marked increase after treatment with the polysaccharide-peptide complex. Concurrently, the gene expression levels of SOD, CAT, and GPx, as determined with real-time polymerase chain reaction, were up-regulated in the liver, kidney, and brain, whereas the MDA content in these organs declined. The maximal lifespan of the mice was prolonged.

GPER Promoter Methylation Controls GPER Expression in Breast Cancer Patients.

PubMed

Weissenborn, Christine; Ignatov, Tanja; Nass, Norbert; Kalinski, Thomas; Dan Costa, Serban; Zenclussen, Ana Claudia; Ignatov, Atanas

2017-02-07

Recently, we found that G-protein-coupled estrogen receptor (GPER) protein expression decreased during breast carcinogenesis, and that GPER promoter is methylated. Here we analyzed GPER promoter methylation in 260 primary breast cancer specimens by methylation-specific polymerized chain reaction. The results demonstrated that GPER protein down-regulation significantly correlated with GPER promoter hypermethylation (p < .001). Comparison of 108 tumors and matched normal breast tissues indicated a significant GPER down-regulation in cancer tissues correlating with GPER promoter hypermethylation (p < .001). The latter was an unfavorable factor for overall survival of patients with triple-negative breast cancer (p = .025). Thus GPER promoter hypermethylation might be used as a prognostic factor.

Multifocal Epithelial Hyperplasia of Oral Cavity Expressing HPV 16 Gene: A Rare Entity

PubMed Central

Prabhat, M. P. V.; Raja Lakshmi, Chintamaneni; Sai Madhavi, N.; Bhavana, Sujana Mulk; Sarat, Gummadapu; Ramamohan, Kodali

2013-01-01

Focal epithelial hyperplasia is a rare contagious disease caused by human papilloma virus. Usually HPV involves either cutaneous or mucosal surfaces, whereas concomitant mucocutaneous involvement is extremely rare. We report such a unique case of multifocal epithelial hyperplasia involving multiple sites of oral cavity along with skin lesions in a 65-year-old female. We also discuss the probable multifactorial etiology and variable clinical presentations of the lesions, including evidence of HPV 16 expression, as detected by polymerase chain reaction. The present report illustrates the need for careful examination and prompt diagnosis of the disease, as it might be associated with high risk genotypes such as HPV 16 and 18. PMID:24455323

Characterization of an Arxula adeninivorans alcohol dehydrogenase involved in the metabolism of ethanol and 1-butanol.

PubMed

Kasprzak, Jakub; Rauter, Marion; Riechen, Jan; Worch, Sebastian; Baronian, Kim; Bode, Rüdiger; Schauer, Frieder; Kunze, Gotthard

2016-05-01

In this study, alcohol dehydrogenase 1 from Arxula adeninivorans (Aadh1p) was identified and characterized. Aadh1p showed activity with short and medium chain length primary alcohols in the forward reaction and their aldehydes in the reverse reaction. Aadh1p has 64% identity with Saccharomyces cerevisiae Adh1p, is localized in the cytoplasm and uses NAD(+) as cofactor. Gene expression analysis showed a low level increase in AADH1 gene expression with ethanol, pyruvate or xylose as the carbon source. Deletion of the AADH1 gene affects growth of the cells with 1-butanol, ethanol and glucose as the carbon source, and a strain which overexpressed the AADH1 gene metabolized 1-butanol more rapidly. An ADH activity assay indicated that Aadh1p is a major enzyme for the synthesis of ethanol and the degradation of 1-butanol in A. adeninivorans. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Variation of M3 muscarinic receptor expression in different prostate tissues and its significance.

PubMed

Song, Wei; Yuan, Mingzhen; Zhao, Shengtian

2009-08-01

To detect the expression of the muscarinic receptor (M receptor) in different prostate tissues and analyze the role of its subtype in prostatic oncogenesis. Thirty-six cases of normal prostate and benign prostatic hyperplasia, and 8 cases of prostatic tumor, were used in this study from the Shandong University, Shandong, China, between 2003-2006. The protein expressions of M1, M2, and M3 receptors in each group were determined by Western-blotting. The gene expressions of the M3 receptor and vascular endothelial growth factors (VEGF) in each group were determined by reverse transcriptase-polymerase chain reaction. The protein and gene expressions of the M3 receptor in the prostatic carcinoma group were higher than that of benign prostatic hyperplasia group (p=0.0001) and normal prostate group (p=0.0001). The M3 receptor and VEGF showed positive straight-line correlations of gene expressions with the 3 groups (r=0.4999, p=0.0001). The M3 receptor may have a close relationship with prostatic oncogenesis.

Characterization of the Expression of Basigin Gene Products Within the Pineal Gland of Mice.

PubMed

Tokar, Derek; van Ekeris, Leslie; Linser, Paul J; Ochrietor, Judith D

2017-08-01

The expression of Basigin gene products and monocarboxylate transporter-1 (MCT1) has been investigated within the mammalian neural retina and suggests a role for these proteins in cellular metabolism within that tissue. The purpose of the present study was to investigate the expression of these same proteins in the pineal gland of the mouse brain. Mouse pineal gland and neural retina RNA and protein were subjected to quantitative reverse transcription-polymerase chain reaction and immunoblotting analyses. In addition, paraffin-embedded sections of each tissue were analyzed for expression of Basigin gene products and MCT1 via immunohistochemistry. The results indicate that MCT1 and Basigin variant-2, but not Basigin variant-1, are expressed within the mouse pineal gland. The expression of Basigin variant-2 and MCT1 was localized to the capsule surrounding the gland. The position and relative amounts of the gene products suggest that they play a much less prominent role within the pineal gland than in the neural retina.

Aberrant Expression of Xist in Aborted Porcine Fetuses Derived from Somatic Cell Nuclear Transfer Embryos

PubMed Central

Yuan, Lin; Wang, Anfeng; Yao, Chaogang; Huang, Yongye; Duan, Feifei; Lv, Qinyan; Wang, Dongxu; Ouyang, Hongsheng; Li, Zhanjun; Lai, Liangxue

2014-01-01

Cloned pigs generated by somatic cell nuclear transfer (SCNT) show a greater ratio of early abortion during mid-gestation than normal controls. X-linked genes have been demonstrated to be important for the development of cloned embryos. To determine the relationship between the expression of X-linked genes and abortion of cloned porcine fetuses, the expression of X-linked genes were investigated by quantitative real-time polymerase chain reaction (q-PCR) and the methylation status of Xist DMR was performed by bisulfate-specific PCR (BSP). q-PCR analysis indicated that there was aberrant expression of X-linked genes, especially the upregulated expression of Xist in both female and male aborted fetuses compared to control fetuses. Results of BSP suggested that hypomethylation of Xist occurred in aborted fetuses, whether male or female. These results suggest that the abnormal expression of Xist may be associated with the abortion of fetuses derived from somatic cell nuclear transfer embryos. PMID:25429426

Gene expression in the rectus abdominus muscle of patients with and without pelvic organ prolapse.

PubMed

Hundley, Andrew F; Yuan, Lingwen; Visco, Anthony G

2008-02-01

The objective of the study was to compare gene expression in a group of actin and myosin-related proteins in the rectus muscle of 15 patients with pelvic organ prolapse and 13 controls. Six genes previously identified by microarray GeneChip analysis were examined using real-time quantitative reverse transcriptase-polymerase chain reaction analysis, including 2 genes showing differential expression in pubococcygeus muscle. Samples and controls were run in triplicate in multiplexed wells, and levels of gene expression were analyzed using the comparative critical threshold method. One gene, MYH3, was 3.2 times overexpressed in patients with prolapse (P = .032), but no significant differences in expression were seen for the other genes examined. An age-matched subset of 9 patients and controls showed that MYH3 gene expression was no longer significantly different (P = .058). Differential messenger ribonucleic acid levels of actin and myosin-related genes in patients with pelvic organ prolapse and controls may be limited to skeletal muscle from the pelvic floor.

Expression profile and distribution of Efhc1 gene transcript during rodent brain development.

PubMed

Conte, Fábio F; Ribeiro, Patrícia A O; Marchesini, Rafael B; Pascoal, Vinícius D B; Silva, Joelcimar M; Oliveira, Amanda R; Gilioli, Rovílson; Sbragia, Lourenço; Bittencourt, Jackson C; Lopes-Cendes, Iscia

2009-09-01

One of the putative causative genes for juvenile myoclonic epilepsy (JME) is EFHC1. We report here the expression profile and distribution of Efhc1 messenger RNA (mRNA) during mouse and rat brain development. Real-time polymerase chain reaction revealed that there is no difference in the expression of Efhc1 mRNA between right and left hemispheres in both species. In addition, the highest levels of Efhc1 mRNA were found at intra-uterine stages in mouse and in adulthood in rat. In common, there was a progressive decrease in Efhc1 expression from 1-day-old neonates to 14-day-old animals in both species. In situ hybridization studies showed that rat and mouse Efhc1 mRNAs are expressed in ependymal cells of ventricle walls. Our findings suggest that Efhc1 expression is more important during initial phases of brain development and that at this stage it could be involved in key developmental mechanisms underlying JME.

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, Meliponini) development.

PubMed

Santana, Flávia A; Nunes, Francis M F; Vieira, Carlos U; Machado, Maria Alice M S; Kerr, Warwick E; Silva, Wilson A; Bonetti, Ana Maria

2006-03-01

We have compared gene expression, using the Differential Display Reverse Transcriptase-Polymerase Chain Reaction (DDRT-PCR) technique, by means of mRNA profile in Melipona scutellaris during ontogenetic postembryonic development, in adult worker, and in both Natural and Juvenile Hormone III-induced adult queen. Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. The combination HT11G-AP05 revealed in L1 and L2 a product which matches to thioredoxin reductase protein domain in the Clostridium sporogenes, an important protein during cellular oxidoreduction processes. This study represents the first molecular evidence of differential gene expression profiles toward a description of the genetic developmental traits in the genus Melipona.

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Effects of Trichostatin A on drug uptake transporters in primary rat hepatocyte cultures

PubMed Central

Ramboer, Eva; Rogiers, Vera; Vanhaecke, Tamara; Vinken, Mathieu

2015-01-01

The present study was set up to investigate the effects of Trichostatin A (TSA), a prototypical epigenetic modifier, on the expression and activity of hepatic drug uptake transporters in primary cultured rat hepatocytes. To this end, the expression of the sinusoidal transporters sodium-dependent taurocholate cotransporting polypeptide (Ntcp) and organic anion transporting polypeptide 4 (Oatp4) was monitored by real-time quantitative reverse transcriptase polymerase chain reaction analysis and immunoblotting. The activity of the uptake transporters was analyzed using radiolabeled substrates and chemical inhibitors. Downregulation of the expression and activity of Oatp4 and Ntcp was observed as a function of the cultivation time and could not be counteracted by TSA. In conclusion, the epigenetic modifier TSA does not seem to exert a positive effect on the expression and activity of the investigated uptake transporters in primary rat hepatocyte cultures. PMID:26648816

Expression of placental protein 14 by the new endometrial cancer cell line MFE-280 in vitro and by endometrial carcinomas in vivo.

PubMed

Hackenberg, R; Loos, S; Nia, A H; Kunzmann, R; Schulz, K D

1998-01-01

MFE-280 endometrial cancer cells express PP14 (placental protein 14) in vitro. PP14 is normally found in the secretory endometrium and in placental tissue. MFE-280 cells, which are tumorigenic in nude mice, were derived from a recurrent, poorly differentiated endometrial carcinoma. The cells were initially grown in suspension culture and later transferred to monolayer cultures. Karyotyping revealed near-diploidy with a complex heterogeneous aberration pattern. MFE-280 cells were positive for the cytokeratins 7, 8, 18 and 19 as well as for vimentin. The expression of PP14 in MFE-280 cells was demonstrated by immunochemistry and reverse transcriptase--polymerase chain reaction. PP14-mRNA was also detected in one out of five endometrial cancer specimen. In tumor tissue the expression of PP14 was not dependent on progestins.

Multidimensional quantitative analysis of mRNA expression within intact vertebrate embryos.

PubMed

Trivedi, Vikas; Choi, Harry M T; Fraser, Scott E; Pierce, Niles A

2018-01-08

For decades, in situ hybridization methods have been essential tools for studies of vertebrate development and disease, as they enable qualitative analyses of mRNA expression in an anatomical context. Quantitative mRNA analyses typically sacrifice the anatomy, relying on embryo microdissection, dissociation, cell sorting and/or homogenization. Here, we eliminate the trade-off between quantitation and anatomical context, using quantitative in situ hybridization chain reaction (qHCR) to perform accurate and precise relative quantitation of mRNA expression with subcellular resolution within whole-mount vertebrate embryos. Gene expression can be queried in two directions: read-out from anatomical space to expression space reveals co-expression relationships in selected regions of the specimen; conversely, read-in from multidimensional expression space to anatomical space reveals those anatomical locations in which selected gene co-expression relationships occur. As we demonstrate by examining gene circuits underlying somitogenesis, quantitative read-out and read-in analyses provide the strengths of flow cytometry expression analyses, but by preserving subcellular anatomical context, they enable bi-directional queries that open a new era for in situ hybridization. © 2018. Published by The Company of Biologists Ltd.

Increases in intracellular calcium via activation of potentially multiple phospholipase C isozymes in mouse olfactory neurons

PubMed Central

Szebenyi, Steven A.; Ogura, Tatsuya; Sathyanesan, Aaron; AlMatrouk, Abdullah K.; Chang, Justin; Lin, Weihong

2014-01-01

Phospholipase C (PLC) and internal Ca2+ stores are involved in a variety of cellular functions. However, our understanding of PLC in mammalian olfactory sensory neurons (OSNs) is generally limited to its controversial role in odor transduction. Here we employed single-cell Ca2+ imaging and molecular approaches to investigate PLC-mediated Ca2+ responses and its isozyme gene transcript expression. We found that the pan-PLC activator m-3M3FBS (25 μM) induces intracellular Ca2+ increases in vast majority of isolated mouse OSNs tested. Both the response amplitude and percent responding cells depend on m-3M3FBS concentrations. In contrast, the inactive analog o-3M3FBS fails to induce Ca2+ responses. The m-3M3FBS-induced Ca2+ increase is blocked by the PLC inhibitor U73122, while its inactive analog U73433 has no effect. Removal of extracellular Ca2+ does not change significantly the m-3M3FBS-induced Ca2+ response amplitude. Additionally, in the absence of external Ca2+, we found that a subset of OSNs respond to an odorant mixture with small Ca2+ increases, which are significantly suppressed by U73122. Furthermore, using reverse transcription polymerase chain reaction and real-time quantitative polymerase chain reaction, we found that multiple PLC isozyme gene transcripts are expressed in olfactory turbinate tissue in various levels. Using RNA in situ hybridization analysis, we further show expression of β4, γ1, γ2 gene transcripts in OSNs. Taken together, our results establish that PLC isozymes are potent enzymes for mobilizing intracellular Ca2+ in mouse OSNs and provide molecular insight for PLC isozymes-mediated complex cell signaling and regulation in the peripheral olfactory epithelium. PMID:25374507

Adipose-derived mesenchymal stromal cells from aged patients with coronary artery disease keep mesenchymal stromal cell properties but exhibit characteristics of aging and have impaired angiogenic potential.

PubMed

Efimenko, Anastasia; Dzhoyashvili, Nina; Kalinina, Natalia; Kochegura, Tatiana; Akchurin, Renat; Tkachuk, Vsevolod; Parfyonova, Yelena

2014-01-01

Tissue regeneration is impaired in aged individuals. Adipose-derived mesenchymal stromal cells (ADSCs), a promising source for cell therapy, were shown to secrete various angiogenic factors and improve vascularization of ischemic tissues. We analyzed how patient age affected the angiogenic properties of ADSCs. ADSCs were isolated from subcutaneous fat tissue of patients with coronary artery disease (CAD; n = 64, 43-77 years old) and without CAD (n = 31, 2-82 years old). ADSC phenotype characterized by flow cytometry was CD90(+)/CD73(+)/CD105(+)/CD45(-)/CD31(-) for all samples, and these cells were capable of adipogenic and osteogenic differentiation. ADSCs from aged patients had shorter telomeres (quantitative reverse transcription polymerase chain reaction) and a tendency to attenuated telomerase activity. ADSC-conditioned media (ADSC-CM) stimulated capillary-like tube formation by endothelial cells (EA.hy926), and this effect significantly decreased with the age of patients both with and without CAD. Angiogenic factors (vascular endothelial growth factor, placental growth factor, hepatocyte growth factor, angiopoetin-1, and angiogenin) in ADSC-CM measured by enzyme-linked immunosorbent assay significantly decreased with patient age, whereas levels of antiangiogenic factors thrombospondin-1 and endostatin did not. Expression of angiogenic factors in ADSCs did not change with patient age (real-time polymerase chain reaction); however, gene expression of factors related to extracellular proteolysis (urokinase and its receptor, plasminogen activator inhibitor-1) and urokinase-type plasminogen activator receptor surface expression increased in ADSCs from aged patients with CAD. ADSCs from aged patients both with and without CAD acquire aging characteristics, and their angiogenic potential declines because of decreasing proangiogenic factor secretion. This could restrict the effectiveness of autologous cell therapy with ADSCs in aged patients.

Role of methotrexate exposure in apoptosis and proliferation during early neurulation.

PubMed

Wang, Xiuwei; Wang, Jianhua; Guan, Tao; Xiang, Qian; Wang, Mingsheng; Guan, Zhen; Li, Guannan; Zhu, Zhiqiang; Xie, Qiu; Zhang, Ting; Niu, Bo

2014-08-01

Apoptosis and proliferation play important roles in embryonic development and are required for neural tube closure. The antifolate drug methotrexate (MTX) induces folate dysmetabolism by inhibition of dihydrofolate reductase and causes abnormal apoptosis and proliferation. In this study, we established an animal model of neural tube defects (NTDs) using MTX to investigate the role of apoptosis and proliferation in NTDs caused by folate deficiency. Differential gene expressions were studied by microarray and reverse transcription-polymerase chain reaction in the NTD animal model. Results showed that 30.8% of NTDs were caused by using MTX in treatment regimens. Microarray indicated that 166 genes were significantly different between the control and NTD mice, including four apoptosis-related genes (Endog, Trp53, Casp3, Bax) and three proliferation-related genes (Ptch1, Pla2g4a, Foxg1). Levels of Endog, Trp53, Casp3, Bax (fold change>1.5) were upregulated but Ptch1, Pla2g4a, Foxg1 (fold change<0.67) were downregulated (P<0.05). These results were confirmed by reverse transcription-polymerase chain reaction. TUNEL, immunohistochemical assays and Western blot were further used to detect apoptosis and proliferation in the NTD animal model. It was found that apoptosis in neuroepithelial cells was increased as determined by TUNEL (P<0.05). Expressions of caspase-3 were significantly enhanced (P<0.05) but expressions of phosphohistone H3 were greatly decreased (P<0.05). These results concluded that MTX caused a folate and folate-associated dysmetabolism, and further induced abnormal apoptosis and proliferation, which may play a critical role in the occurrence of NTDs caused by folate deficiency. Copyright © 2013 John Wiley & Sons, Ltd.

Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

PubMed Central

Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

2012-01-01

Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of blueberry flavonoid biosynthesis. PMID:22086422

Auraptene Attenuates Malignant Properties of Esophageal Stem-Like Cancer Cells.

PubMed

Saboor-Maleki, Saffiyeh; Rassouli, Fatemeh B; Matin, Maryam M; Iranshahi, Mehrdad

2017-08-01

The high incidence of esophageal squamous cell carcinoma has been reported in selected ethnic populations including North of Iran. Low survival rate of esophageal carcinoma is partially due to the presence of stem-like cancer cells with chemotherapy resistance. In the current study, we aimed to determine the effects of auraptene, an interesting dietary coumarin with various biological activities, on malignant properties of stem-like esophageal squamous cell carcinoma, in terms of sensitivity to anticancer drugs and expression of specific markers. To do so, the half maximal inhibitory concentration values of auraptene, cisplatin, paclitaxel, and 5-fluorouracil were determined on esophageal carcinoma cells (KYSE30 cell line). After administrating combinatorial treatments, including nontoxic concentrations of auraptene + cisplatin, paclitaxel, or 5-fluorouracil, sensitivity of cells to chemical drugs and also induced apoptosis were assessed. In addition, quantitative real-time polymerase chain reaction was used to study changes in the expression of tumor suppressor proteins 53 and 21 ( P53 and P21), cluster of differentiation 44 ( CD44), and B cell-specific Moloney murine leukemia virus integration site 1 ( BMI-1) upon treatments. Results of thiazolyl blue assay revealed that auraptene significantly ( P < .05) increased toxicity of cisplatin, paclitaxel, and 5-fluorouracil in KYSE30 cells, specifically 72 hours after treatment. Conducting an apoptosis assay using flow cytometry also confirmed the synergic effects of auraptene. Results of quantitative real-time polymerase chain reaction revealed significant ( P < .05) upregulation of P53 and P21 upon combinatorial treatments and also downregulation of CD44 and BMI-1 after auraptene administration. Current study provided evidence, for the first time, that auraptene attenuates the properties of esophageal stem-like cancer cells through enhancing sensitivity to chemical agents and reducing the expression of CD44 and BMI-1 markers.

Merkel cell carcinoma: histopathologic and prognostic features according to the immunohistochemical expression of Merkel cell polyomavirus large T antigen correlated with viral load.

PubMed

Leroux-Kozal, Valérie; Lévêque, Nicolas; Brodard, Véronique; Lesage, Candice; Dudez, Oriane; Makeieff, Marc; Kanagaratnam, Lukshe; Diebold, Marie-Danièle

2015-03-01

Merkel cell carcinoma (MCC) is a neuroendocrine skin malignancy frequently associated with Merkel cell polyomavirus (MCPyV), which is suspected to be oncogenic. In a series of MCC patients, we compared clinical, histopathologic, and prognostic features according to the expression of viral large T antigen (LTA) correlated with viral load. We evaluated the LTA expression by immunohistochemistry using CM2B4 antibody and quantified viral load by real-time polymerase chain reaction. We analyzed formalin-fixed, paraffin-embedded (FFPE) tissue samples (n = 36) and corresponding fresh-frozen biopsies when available (n = 12), of the primary tumor and/or metastasis from 24 patients. MCPyV was detected in 88% and 58% of MCC patients by real-time polymerase chain reaction and immunohistochemistry, respectively. The relevance of viral load measurements was demonstrated by the strong consistency of viral load level between FFPE and corresponding frozen tissues as well as between primary tumor and metastases. From FFPE samples, 2 MCC subgroups were distinguished based on a viral load threshold defined by the positivity of CM2B4 immunostaining. In the LTA-negative subgroup with no or low viral load (nonsignificant), tumor cells showed more anisokaryosis (P = .01), and a solar elastosis around the tumor was more frequently observed (P = .03). LTA-positive MCCs with significant viral load had a lower proliferation index (P = .03) and a longer survival of corresponding patients (P = .008). Depending on MCPyV involvement, 2 MCC subgroups can be distinguished on histopathologic criteria, and the CM2B4 antibody is able to differentiate them reliably. Furthermore, the presence of a significant viral load in tumors is predictive of better prognosis. Copyright © 2015 Elsevier Inc. All rights reserved.

Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism.

PubMed

Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A; Zaharia, L Irina; Schernthaner, Johann P; Gesell, Andreas; Abrams, Suzanne R; Kennedy, James A; Constabel, C Peter

2012-01-01

Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3'-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3'5'-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of blueberry flavonoid biosynthesis.

Diazotrophic bacterioplankton in a coral reef lagoon: phylogeny, diel nitrogenase expression and response to phosphate enrichment.

PubMed

Hewson, Ian; Moisander, Pia H; Morrison, Amanda E; Zehr, Jonathan P

2007-05-01

We investigated diazotrophic bacterioplankton assemblage composition in the Heron Reef lagoon (Great Barrier Reef, Australia) using culture-independent techniques targeting the nifH fragment of the nitrogenase gene. Seawater was collected at 3 h intervals over a period of 72 h (i.e. over diel as well as tidal cycles). An incubation experiment was also conducted to assess the impact of phosphate (PO(4)3*) availability on nifH expression patterns. DNA-based nifH libraries contained primarily sequences that were most similar to nifH from sediment, microbial mat and surface-associated microorganisms, with a few sequences that clustered with typical open ocean phylotypes. In contrast to genomic DNA sequences, libraries prepared from gene transcripts (mRNA amplified by reverse transcription-polymerase chain reaction) were entirely cyanobacterial and contained phylotypes similar to those observed in open ocean plankton. The abundance of Trichodesmium and two uncultured cyanobacterial phylotypes from previous studies (group A and group B) were studied by quantitative-polymerase chain reaction in the lagoon samples. These were detected as transcripts, but were not detected in genomic DNA. The gene transcript abundance of these phylotypes demonstrated variability over several diel cycles. The PO(4)3* enrichment experiment had a clearer pattern of gene expression over diel cycles than the lagoon sampling, however PO(4)3* additions did not result in enhanced transcript abundance relative to control incubations. The results suggest that a number of diazotrophs in bacterioplankton of the reef lagoon may originate from sediment, coral or beachrock surfaces, sloughing into plankton with the flooding tide. The presence of typical open ocean phylotype transcripts in lagoon bacterioplankton may indicate that they are an important component of the N cycle of the coral reef.

Alteration of the Alkaloid Profile in Genetically Modified Tobacco Reveals a Role of Methylenetetrahydrofolate Reductase in Nicotine N-Demethylation1[C][W][OA

PubMed Central

Hung, Chiu-Yueh; Fan, Longjiang; Kittur, Farooqahmed S.; Sun, Kehan; Qiu, Jie; Tang, She; Holliday, Bronwyn M.; Xiao, Bingguang; Burkey, Kent O.; Bush, Lowell P.; Conkling, Mark A.; Roje, Sanja; Xie, Jiahua

2013-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme of the tetrahydrofolate (THF)-mediated one-carbon (C1) metabolic network. This enzyme catalyzes the reduction of 5,10-methylene-THF to 5-methyl-THF. The latter donates its methyl group to homocysteine, forming methionine, which is then used for the synthesis of S-adenosyl-methionine, a universal methyl donor for numerous methylation reactions, to produce primary and secondary metabolites. Here, we demonstrate that manipulating tobacco (Nicotiana tabacum) MTHFR gene (NtMTHFR1) expression dramatically alters the alkaloid profile in transgenic tobacco plants by negatively regulating the expression of a secondary metabolic pathway nicotine N-demethylase gene, CYP82E4. Quantitative real-time polymerase chain reaction and alkaloid analyses revealed that reducing NtMTHFR expression by RNA interference dramatically induced CYP82E4 expression, resulting in higher nicotine-to-nornicotine conversion rates. Conversely, overexpressing NtMTHFR1 suppressed CYP82E4 expression, leading to lower nicotine-to-nornicotine conversion rates. However, the reduced expression of NtMTHFR did not affect the methionine and S-adenosyl-methionine levels in the knockdown lines. Our finding reveals a new regulatory role of NtMTHFR1 in nicotine N-demethylation and suggests that the negative regulation of CYP82E4 expression may serve to recruit methyl groups from nicotine into the C1 pool under C1-deficient conditions. PMID:23221678

Delivery of Na/I symporter gene into skeletal muscle using nanobubbles and ultrasound: visualization of gene expression by PET.

PubMed

Watanabe, Yukiko; Horie, Sachiko; Funaki, Yoshihito; Kikuchi, Youhei; Yamazaki, Hiromichi; Ishii, Keizo; Mori, Shiro; Vassaux, Georges; Kodama, Tetsuya

2010-06-01

The development of nonviral gene delivery systems is essential in gene therapy, and the use of a minimally invasive imaging methodology can provide important clinical endpoints. In the current study, we present a new methodology for gene therapy-a delivery system using nanobubbles and ultrasound as a nonviral gene delivery method. We assessed whether the gene transfer allowed by this methodology was detectable by PET and bioluminescence imaging. Two kinds of reported vectors (luciferase and human Na/I symporter [hNIS]) were transfected or cotransfected into the skeletal muscles of normal mice (BALB/c) using the ultrasound-nanobubbles method. The kinetics of luciferase gene expression were analyzed in vivo using bioluminescence imaging. At the peak of gene transfer, PET of hNIS expression was performed using our recently developed PET scanner, after (124)I injection. The imaging data were confirmed using reverse-transcriptase polymerase chain reaction amplification, biodistribution, and a blocking study. The imaging potential of the 2 methodologies was evaluated in 2 mouse models of human pathology (McH/lpr-RA1 mice showing vascular disease and C57BL/10-mdx Jic mice showing muscular dystrophy). Peak luciferase gene activity was observed in the skeletal muscle 4 d after transfection. On day 2 after hNIS and luciferase cotransfection, the expression of these genes was confirmed by reverse-transcriptase polymerase chain reaction on a muscle biopsy. PET of the hNIS gene, biodistribution, the blocking study, and autoradiography were performed on day 4 after transfection, and it was indicated that hNIS expression was restricted to the site of plasmid administration (skeletal muscle). Similar localized PET and (124)I accumulation were successfully obtained in the disease-model mice. The hNIS gene was delivered into the skeletal muscle of healthy and disease-model mice by the ultrasound-nanobubbles method, and gene expression was successfully visualized with PET. The combination of ultrasound-nanobubble gene transfer and PET may be applied to gene therapy clinical protocols.

Differentiation of human foreskin fibroblast-derived induced pluripotent stem cells into hepatocyte-like cells.

PubMed

Wang, Jianjun; Zhao, Ping; Wan, Zhihong; Jin, Xueyuan; Cheng, Yongqian; Yan, Tao; Qing, Song; Ding, Ning; Xin, Shaojie

2016-10-01

The aim of this study was to investigate the differentiation potential of induced pluripotent stem cells (iPSCs) derived from human foreskin fibroblasts (HFFs) into hepatocyte-like cells (HLCs). The iPSCs were firstly induced by transduction of OCT4, SOX2, KLF4, and c-MYC into HFFs using retrovirus. Afterwards, expressions of pluripotency factors were identified by semiquantitative reverse transcription-polymerase chain reaction and immunofluorescence staining, and karyotype, embryoid, and teratoma were observed by microscope. Then, iPSCs were gradually differentiated into endoderm cells, hepatic progenitor cells, and mature HLCs by special culture medium. During this process, differentiation efficiency into each kind of cells was evaluated by detecting SOX17, HNF4a, and ALB using flow cytometry, respectively. Besides, enzyme-linked immunosorbent assay was conducted to detect the secretion of ALB in iPSC-induced HLCs and quantitative reverse transcription-polymerase chain reaction was performed to detect the expression levels of hepatocyte-specific genes. The iPSCs were successfully induced by HFFs, which exhibited typical embryonic stem cells morphology, positive alkaline phosphatase staining, normal diploid karyotype, and positive expression of various pluripotency factors. Meanwhile, spherical embryoid and teratoma with 3 germ layers were formed by iPSCs. The iPSCs were consecutively induced into endoderm cells, hepatic progenitor cells and mature HLCs, and the differentiation efficiency was 55.7 ± 2.9%, 45.7 ± 4.8%, and 35.0 ± 3.9%, respectively. Besides, the secretion of ALB and expression of various hepatocyte-specific genes was highly detected in iPSC-induced HLCs. The iPSCs were successfully derived from HFFs and then differentiated into HLCs, which proved a new source for hepatocyte transplantation. HFFs were successfully induced into iPSCs by transduction of OCT4, SOX2, KLF4, and c-MYC. Positive expressions of various pluripotency factors were exhibited in HFFs-induced iPSCs. The iPSCs were consecutively induced into endoderm cells, hepatic progenitor cells, and mature HLCs. Various hepatocyte-specific genes were highly expressed in iPSC-induced HLCs. Copyright © 2016 John Wiley & Sons, Ltd.

Association of EGFR mutation or ALK rearrangement with expression of DNA repair and synthesis genes in never-smoker women with pulmonary adenocarcinoma.

PubMed

Ren, Shengxiang; Chen, Xiaoxia; Kuang, Peng; Zheng, Limou; Su, Chunxia; Li, Jiayu; Li, Bing; Wang, Yongshen; Liu, Lu; Hu, Qiong; Zhang, Jie; Tang, Liang; Li, Xuefei; Zhou, Caicun; Schmid-Bindert, Gerald

2012-11-15

Epidermal growth factor receptor (EGFR) mutation and anaplastic lymphoma kinase (ALK) rearrangement may predict the outcome of targeted drug therapy and also are associated with the efficacy of chemotherapy in patients with nonsmall cell lung cancer (NSCLC). The authors of this report investigated the relation of EGFR mutation or ALK rearrangement status and the expression of DNA repair or synthesis genes, including excision repair cross-complementing 1 (ERCC1), ribonucleotide reductase subunit M1 (RRM1), thymidylate synthetase (TS), and breast cancer-early onset (BRCA1), as a potential explanation for these observations. In total, 104 resected lung adenocarcinomas from women who were nonsmokers were analyzed concurrently for EGFR mutations, ALK rearrangements, and mRNA expression of the ERCC1, RRM1, TS, and BRCA1 genes. EGFR mutations were detected with a proprietary detection kit, ALK rearrangements were detected by polymerase chain reaction analysis, and genetic mRNA expression was detected by real-time polymerase chain reaction analysis. Of 104 patients, 73 (70.2%) had EGFR mutations, and 10 (9.6%) had ALK rearrangements. ERCC1 mRNA levels in patients who had EGFR mutations were 3.44 ± 1.94 × 10(-3) , which were significantly lower than the levels in patients who were positive for ALK rearrangements and in patients who were negative for both biomarkers (4.60 ± 1.95 × 10(-3) and 4.95 ± 2.33 × 10(-3) , respectively; P = .010). However, TS mRNA levels were significantly lower in patients who had EGFR mutations (1.15 ± 1.38 × 10(-3) vs 2.69 ± 3.97 × 10(-3) ; P = .006) or ALK rearrangements (1.21 ± 0.78 × 10(-3) vs 2.69 ± 3.97 × 10(-3) ; P = .020) than in patients who were negative for both biomarkers. NSCLC specimens that harbored activating EGFR mutations were more likely to express low ERCC1 and TS mRNA levels, whereas patients with NSCLC who had ALK rearrangement were more likely to express low TS mRNA levels. Copyright © 2012 American Cancer Society.

Lower Female Genital Tract Tumors With Adenoid Cystic Differentiation: P16 Expression and High-risk HPV Detection.

PubMed

Xing, Deyin; Schoolmeester, J Kenneth; Ren, Zhiyong; Isacson, Christina; Ronnett, Brigitte M

2016-04-01

Lower female genital tract tumors with adenoid cystic differentiation are rare, and data on their relationship with high-risk human papillomavirus (HPV) are limited. Here we report the clinicopathologic features from a case series. Tumors with adenoid cystic differentiation, either pure or as part of a carcinoma with mixed differentiation, arising in the lower female genital tract were evaluated by means of immunohistochemical analysis for p16 expression and in situ hybridization using 1 or more probes for high-risk HPV (a high-risk probe covering multiple types, a wide-spectrum probe, and separate type-specific probes for HPV16 and HPV18) and when possible by polymerase chain reaction for high-risk HPV. Six cervical carcinomas with adenoid cystic differentiation admixed with various combinations of at least 1 other pattern of differentiation, including adenoid basal tumor (epithelioma and/or carcinoma), squamous cell carcinoma (basaloid or keratinizing), and small cell carcinoma were identified in patients ranging in age from 50 to 86 years (mean, 73 y; median, 76 y). All of these tumors were characterized by diffuse p16 expression. High-risk HPV was detected in 5 of 6 tested cases: 4 cases by in situ hybridization (all positive for HPV-wide-spectrum and HPV16) and 1 by polymerase chain reaction (HPV45). Seven pure adenoid cystic carcinomas (6 vulvar and 1 cervical) were identified in patients ranging in age from 27 to 74 years (mean, 48 y; median, 48 y). All of these tumors were characterized by variable p16 expression ranging from very limited to more extensive but never diffuse. No high-risk HPV was detected in any of these pure tumors. Lower female genital tract carcinomas with adenoid cystic differentiation appear to comprise 2 pathogenetically distinct groups. Cervical carcinomas with mixed differentiation, including adenoid cystic, adenoid basal, squamous, and small cell components, are etiologically related to high-risk HPV and can be identified by diffuse p16 expression. Pure vulvar and cervical adenoid cystic carcinomas appear to be unrelated to high-risk HPV and are distinguished from the mixed carcinomas by nondiffuse p16 expression.

Alternative splicing produces transcripts coding for alpha and beta chains of a hetero-dimeric phosphagen kinase.

PubMed

Ellington, W Ross; Yamashita, Daisuke; Suzuki, Tomohiko

2004-06-09

Glycocyamine kinase (GK) catalyzes the reversible phosphorylation of glycocyamine (guanidinoacetate), a reaction central to cellular energy homeostasis in certain animals. GK is a member of the phosphagen kinase enzyme family and appears to have evolved from creatine kinase (CK) early in the evolution of multi-cellular animals. Prior work has shown that GK from the polychaete Neanthes (Nereis) diversicolor exits as a hetero-dimer in vivo and that the two polypeptide chains (termed alpha and beta) are coded for by unique transcripts. In the present study, we demonstrate that the GK from a congener Nereis virens is also hetero-dimeric and is coded for by alpha and beta transcripts, which are virtually identical to the corresponding forms in N. diversicolor. The GK gene from N. diversicolor was amplified by PCR. Sequencing of the PCR products showed that the alpha and beta chains are the result of alternative splicing of the GK primary mRNA transcript. These results also strongly suggest that this gene underwent an early tandem exon duplication event. Full-length cDNAs for N. virens GKalpha and GKbeta were individually ligated into expression vectors and the resulting constructs used to transform Escherichia coli expression hosts. Regardless of expression conditions, minimal GK activity was observed in both GKalpha and GKbeta constructs. Inclusion bodies for both were harvested, unfolded in urea and alpha chains, beta chains and mixtures of alpha and beta chains were refolded by sequential dialysis. Only modest amounts of GK activity were observed when alpha and beta were refolded individually. In contrast, when refolded the alpha and beta mixture yielded highly active hetero-dimers, as validated by size exclusion chromatography, electrophoresis and mass spectrometry, with a specific activity comparable to that of natural GK. The above evidence suggests that there is a preference for hetero-dimer formation in the GKs from these two polychaetes. The evolution of the alternate splicing and an additional exon in these GKs, producing alpha and beta transcripts, can be viewed as a possible compensation for a mutation(s) in the original gene, which most likely coded for a homo-dimeric protein.

Adiabatic coarse-graining and simulations of stochastic biochemical networks

PubMed Central

Sinitsyn, N. A.; Hengartner, Nicolas; Nemenman, Ilya

2009-01-01

We propose a universal approach for analysis and fast simulations of stiff stochastic biochemical networks, which rests on elimination of fast chemical species without a loss of information about mesoscopic, non-Poissonian fluctuations of the slow ones. Our approach is similar to the Born–Oppenheimer approximation in quantum mechanics and follows from the stochastic path integral representation of the cumulant generating function of reaction events. In applications with a small number of chemical reactions, it produces analytical expressions for cumulants of chemical fluxes between the slow variables. This allows for a low-dimensional, interpretable representation and can be used for high-accuracy, low-complexity coarse-grained numerical simulations. As an example, we derive the coarse-grained description for a chain of biochemical reactions and show that the coarse-grained and the microscopic simulations agree, but the former is 3 orders of magnitude faster. PMID:19525397

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

Expression and biological effects of high levels of serum IgE in epsilon heavy chain transgenic mice.

PubMed

Adamczewski, M; Köhler, G; Lamers, M C

1991-03-01

We have generated and examined transgenic mice carrying a rearranged immunoglobulin transgene coding for the heavy chain of an IgE antibody. These mice produce the secreted form of the recombinant epsilon heavy chain. Serum IgE levels were increased at least 100-fold over control values. Transgenic epsilon mRNA was detected in spleen and thymus, not in liver and heart. Transgenic epsilon production in vitro was slightly up-regulated by T cells, but not affected by interleukin 4 in vitro or Nippostrongylus infestation in vivo. The B cell and T cell compartments and antigen-specific IgE, IgG1 and IgM responses as well as the increase in endogenous IgE after Nippostrongylus infestation in transgenic mice were normal. These data indicate that the presence of high levels of transgenic IgE did not induce class-specific suppressive mechanisms. Transgenic IgE bound to Fc epsilon receptor type I and Fc epsilon receptor type II and mediated histamine release from mast cells in vitro and an allergic skin reaction in vivo. It inhibited an ovalbumin-specific skin reaction in ovalbumin-immunized transgenic mice only during the initial phases of the immune response. This result has a bearing on the feasibility of immune therapy of allergic diseases with substances that block binding of IgE to its receptors.

Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

NASA Astrophysics Data System (ADS)

Maginnis, P. A.; West, M.; Dullerud, G. E.

2016-10-01

We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a ;black-box;, i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

Clonal T-Cell Receptor γ-Chain Gene Rearrangements in Differential Diagnosis of Lymphomatoid Papulosis From Skin Metastasis of Nodal Anaplastic Large-Cell Lymphoma

PubMed Central

Akilov, Oleg E.; Pillai, Raju K.; Grandinetti, Lisa M.; Kant, Jeffrey A.; Geskin, Larisa

2012-01-01

Background In patients with a history of nodal anaplastic large-cell lymphoma (ALCL), differentiation of type C lymphomatoid papulosis from cutaneous involvement of systemic ALCL may be challenging because the 2 entities may exhibit identical histologic features. Although metastatic ALCL generally carries the same clone as the primary lymphoma, expression of a distinct clone likely represents a distinct process. Observations A 54-year-old white man had a history of anaplastic lymphoma kinase 1–negative ALCL in the right inguinal lymph node 6 years ago. A complete response was achieved after 6 cycles of CHOP (cyclophosphamide, doxorubicin, vincristine [Oncovin], and prednisone administered in 21-day cycles) and radiation therapy. After 3½ years, the patient observed waxing and waning papules and nodules. Examination of the biopsy specimen revealed a dense CD30+ lymphocytic infiltrate; no evidence of systemic malignancy was evident on positron emission tomography. Although clinically the presentation was consistent with lymphomatoid papulosis, metastatic ALCL had to be excluded. Polymerase chain reaction analysis with T-cell receptor γ-chain gene rearrangement (TCR-γR) was performed on the original lymph node and new skin lesions. Results of the TCR-γR analysis were positive for clonality in both lesions. However, separate clonal processes were identified. The identification of distinct clones supported the clinical impression of lymphomatoid papulosis. Conclusion Polymerase chain reaction analysis of TCR-γR is a useful method for distinguishing different clonal processes and is recommended when differentiation of primary and secondary lymphoproliferative disorders is required. PMID:21844453

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

Stability analysis and stabilization strategies for linear supply chains

NASA Astrophysics Data System (ADS)

Nagatani, Takashi; Helbing, Dirk

2004-04-01

Due to delays in the adaptation of production or delivery rates, supply chains can be dynamically unstable with respect to perturbations in the consumption rate, which is known as “bull-whip effect”. Here, we study several conceivable production strategies to stabilize supply chains, which is expressed by different specifications of the management function controlling the production speed in dependence of the stock levels. In particular, we will investigate, whether the reaction to stock levels of other producers or suppliers has a stabilizing effect. We will also demonstrate that the anticipation of future stock levels can stabilize the supply system, given the forecast horizon τ is long enough. To show this, we derive linear stability conditions and carry out simulations for different control strategies. The results indicate that the linear stability analysis is a helpful tool for the judgement of the stabilization effect, although unexpected deviations can occur in the non-linear regime. There are also signs of phase transitions and chaotic behavior, but this remains to be investigated more thoroughly in the future.

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

Two assays for measuring fibrosis: reverse transcriptase-polymerase chain reaction of collagen alpha(1) (III) mRNA is an early predictor of subsequent collagen deposition while a novel serum N-terminal procollagen (III) propeptide assay reflects manifest fibrosis in carbon tetrachloride-treated rats.

PubMed

Kauschke, S G; Knorr, A; Heke, M; Kohlmeyer, J; Schauer, M; Theiss, G; Waehler, R; Burchardt, E R

1999-11-15

Using a novel quantitative reverse transcriptase-polymerase chain reaction assay, we have determined the amount of specific mRNA for procollagen alpha(1) (III) (PIIIP) in the carbon tetrachloride (CCl(4)) model of liver fibrosis in rats. After a single week of CCl(4) application, the amount of PIIIP mRNA was increased approximately 10 times over the untreated control group and continued to increase to approximately 30 times after 7 weeks of intoxication. In this model substantial fibrosis was demonstrated by computer-aided morphometry after 5 to 7 weeks of treatment. Using recombinant murine N-terminal procollagen alpha(1) (III) propeptide (PIIINP), a novel sensitive immunoassay for the measurement of circulating PIIINP in rodent sera was established. An increase in PIIINP serum levels was observed after 5 to 7 weeks of CCl(4) intoxication. Our results suggest PIIIP gene expression is an early marker of tissue fibrosis. Early PIIIP gene expression is correlated with the extent of the subsequent fibrosis. PIIIP mRNA levels increase much earlier than conventional histological examination or PIIINP levels. PIIINP measurements with our new serum assay, on the other hand, are a good noninvasive marker of manifest fibrosis but are a poor marker of fibrogenesis. Copyright 1999 Academic Press.

Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

PubMed

Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

2017-01-01

Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

Human gingival fibroblasts express functional chemokine receptor CXCR6.

PubMed

Hosokawa, Y; Hosokawa, I; Ozaki, K; Nakae, H; Matsuo, T

2009-06-01

We have reported that CXCL16, a recently discovered transmembrane chemokine, is expressed in human gingival fibroblasts (HGF). However, it is not known whether HGF express CXCR6, the receptor for CXCL16, or CXCL16 affects HGF biology. We have shown that HGF expressed CXCR6 by reverse transcription-polymerase chain reaction and flow cytometric analysis. Moreover, we elucidated that tumour necrosis factor (TNF)-alpha and cytosine-guanine dinucleotide (CpG) DNA (Toll-like receptor-9 ligand) treatment enhanced CXCR6 expression by HGF. Interleukin (IL)-4, IL-13 and CpG DNA up-regulated CXCR6 expression by TNF-alpha-stimulated HGF. On the other hand, IL-1beta and interferon-gamma inhibited CXCR6 expression on TNF-alpha-treated HGF. CXCL16 treatment induced HGF proliferation and phosphorylation of extracellular regulated kinase (ERK) and protein kinase B (AKT) in HGF. In conclusion, HGF expressed CXCR6 functionally, because CXCL16 induced HGF proliferation and ERK and AKT phosphorylation in HGF. These results indicate that CXCL16 may play an important role in the pathogenesis and remodelling in periodontally diseased tissues.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Quantitative Detection of Low-Abundance Transcripts at Single-Cell Level in Human Epidermal Keratinocytes by Digital Droplet Reverse Transcription-Polymerase Chain Reaction.

PubMed

Auvré, Frédéric; Coutier, Julien; Martin, Michèle T; Fortunel, Nicolas O

2018-05-08

Genetic and epigenetic characterization of the large cellular diversity observed within tissues is essential to understanding the molecular networks that ensure the regulation of homeostasis, repair, and regeneration, but also pathophysiological processes. Skin is composed of multiple cell lineages and is therefore fully concerned by this complexity. Even within one particular lineage, such as epidermal keratinocytes, different immaturity statuses or differentiation stages are represented, which are still incompletely characterized. Accordingly, there is presently great demand for methods and technologies enabling molecular investigation at single-cell level. Also, most current methods used to analyze gene expression at RNA level, such as RT-qPCR, do not directly provide quantitative data, but rather comparative ratios between two conditions. A second important need in skin biology is thus to determine the number of RNA molecules in a given cell sample. Here, we describe a workflow that we have set up to meet these specific needs, by means of transcript quantification in cellular micro-samples using flow cytometry sorting and reverse transcription-digital droplet polymerase chain reaction. As a proof-of-principle, the workflow was tested for the detection of transcription factor transcripts expressed at low levels in keratinocyte precursor cells. A linear correlation was found between quantification values and keratinocyte input numbers in a low quantity range from 40 cells to 1 cell. Interpretable signals were repeatedly obtained from single-cell samples corresponding to estimated expression levels as low as 10-20 transcript copies per keratinocyte or less. The present workflow may have broad applications for the detection and quantification of low-abundance nucleic acid species in single cells, opening up perspectives for the study of cell-to-cell genetic and molecular heterogeneity. Interestingly, the process described here does not require internal references such as house-keeping gene expression, as it is initiated with defined cell numbers, precisely sorted by flow cytometry.

miR-758-3p: a blood-based biomarker that’s influence on the expression of CERP/ABCA1 may contribute to the progression of obesity to metabolic syndrome

PubMed Central

O’Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O’Driscoll, Lorraine

2018-01-01

Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p’s predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome. PMID:29507696

Association of Wnt1-inducible signaling pathway protein-1 with the proliferation, migration and invasion in gastric cancer cells.

PubMed

Jia, Shuqin; Qu, Tingting; Feng, Mengmeng; Ji, Ke; Li, Ziyu; Jiang, Wenguo; Ji, Jiafu

2017-06-01

Wnt1-inducible signaling pathway protein-1 is a cysteine-rich protein that belongs to the CCN family, which has been implicated in mediating the occurrence and progression through distinct molecular mechanisms in several tumor types. However, the association of Wnt1-inducible signaling pathway protein-1 with gastric cancer and the related molecular mechanisms remain to be elucidated. Therefore, this study aimed to clarify the biological role of Wnt1-inducible signaling pathway protein-1 in the proliferation, migration, and invasion in gastric cancer cells and further investigated the associated molecular mechanism on these biological functions. We first detected the expression level of Wnt1-inducible signaling pathway protein-1 in gastric cancer, and the reverse transcription polymerase chain reaction have shown that Wnt1-inducible signaling pathway protein-1 expression levels were upregulated in gastric cancer tissues. The expression of Wnt1-inducible signaling pathway protein-1 in gastric cancer cell lines was also detected by quantitative real-time polymerase chain reaction and Western blotting. Furthermore, two gastric cancer cell lines with high expression of Wnt1-inducible signaling pathway protein-1 were selected to explore the biological function of Wnt1-inducible signaling pathway protein-1 in gastric cancer. Function assays indicated that knockdown of Wnt1-inducible signaling pathway protein-1 suppressed cell proliferation, migration, and invasion in BGC-823 and AGS gastric cancer cells. Further investigation of mechanisms suggested that cyclinD1 was identified as one of Wnt1-inducible signaling pathway protein-1 related genes to accelerate proliferation in gastric cancer cells. In addition, one pathway of Wnt1-inducible signaling pathway protein-1 induced migration and invasion was mainly through the enhancement of epithelial-to-mesenchymal transition progression. Taken together, our findings presented the first evidence that Wnt1-inducible signaling pathway protein-1 was upregulated in gastric cancer and acted as an oncogene by promoting proliferation, migration, and invasion in gastric cancer cells.

miR-758-3p: a blood-based biomarker that's influence on the expression of CERP/ABCA1 may contribute to the progression of obesity to metabolic syndrome.

PubMed

O'Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O'Driscoll, Lorraine

2018-02-06

Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p's predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome.

In vitro biocompatibility, inflammatory response, and osteogenic potential of 4 root canal sealers: Sealapex, Sankin apatite root sealer, MTA Fillapex, and iRoot SP root canal sealer.

PubMed

Chang, Seok-Woo; Lee, So-Youn; Kang, Soo-Kyung; Kum, Kee-Yeon; Kim, Eun-Cheol

2014-10-01

The objective of this study was to compare the cytotoxicity, inflammatory response, osteogenic effect, and the signaling mechanism of these biologic activities of 4 calcium compound-based root canal sealers (ie, Sealapex [Sybron Kerr, WA], apatite root sealer [ARS; Dentsply Sankin, Tokyo, Japan], MTA Fillapex [Angelus Indústria de Produtos Odontológicos S/A, Londrina, PR, Brazil], and iRoot SP [Innovative BioCreamix Inc, Vancouver, Canada]) in human periodontal ligament cells. Cytotoxicity was assessed using the 3-(4,5-dimethylthiazolyl-2-yl)-2,5-diphenyltetrazolium bromide assay. Levels of inflammatory mediators were measured by enzyme-linked immunosorbent assay, reverse-transcription polymerase chain reaction, and Western blot analysis. Osteogenic potential was evaluated by alkaline phosphatase activity, alizarin red staining, and marker genes by reverse-transcription polymerase chain reaction. The signal transduction pathways were examined by Western blotting. None of the sealers were cytotoxic. ARS, MTA Fillapex, and iRoot SP induced a lower expression of proinflammatory mediators than Sealapex. All sealers increased ALP activity and the formation of mineralized nodules and up-regulated the expression of osteoblastic marker messenger RNA. ARS, MTA Fillapex, and iRoot SP showed superior osteogenic potential compared with Sealapex. The expression and/or activation of integrin receptors and downstream signaling molecules, including focal adhesion kinase, paxillin, Akt, mitogen-activated protein kinase, and nuclear factor κB, was induced by ARS, MTA Fillapex, and iRoot SP treatment but not by Sealapex treatment. We show for the first time that ARS, MTA Fillapex, and iRoot SP induce a lower expression of inflammatory mediators and enhance osteoblastic differentiation of PDLCs via the integrin-mediated signaling pathway compared with Sealapex. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Aberrant EPHB4 gene methylation and childhood acute lymphoblastic leukemia

PubMed Central

Li, Yuhua; Wang, Huihui; Chen, Xiaowen; Mai, Huirong; Li, Changgang; Wen, Feiqiu

2017-01-01

The present study aimed to investigate the association between aberrant DNA methylation of the promoter region of the ephrin type-B receptor 4 (EPHB4) gene and the development of childhood acute lymphoblastic leukemia (ALL). Bisulfite sequencing polymerase chain reaction (BSP) was performed to determine the methylation density of cytosine-guanine pair islands in the promoter region of EPHB4, in bone marrow samples from 40 children with ALL. The mRNA and protein expression levels of EPHB4 were detected using reverse transcription-quantitative polymerase chain reaction and western blot analysis. A total of 10 children with idiopathic thrombocytopenic purpura (ITP) were recruited as controls. The results revealed that the average methylation density of the bone marrow samples from the patients with ALL was significantly higher, compared with the patients with ITP (P=0.046). The relative mRNA expression levels of EPHB4 in the patients with ITP (25.08±4.03) and the patients with ALL without methylation (12.33±2.16) were significantly higher, compared with that observed in the patients with ALL with methylation (6.48±2.73; P<0.01). Pearson analysis revealed a significant negative linear correlation between EPHB4 gene methylation and its expression levels (r=−0.957; P<0.01). Western blot analysis indicated that EPHB4 protein expression levels were low in the methylated ALL samples. An evaluation of the two-year disease-free survival (DFS) of the patients with ALL was performed, which revealed that the patients with unmethylated ALL exhibited a significantly higher two-year DFS rate, as compared with patients with methylated ALL (P=0.036). These results suggest that the methylation of the EPHB4 gene is prevalent in childhood ALL and may result in expressional inactivation, which consequently promotes ALL pathogenesis and is associated with an unfavorable prognosis. Therefore, the EPHB4 gene may function as a potential tumor suppressor in childhood ALL. PMID:29085439

miR-370 mimic inhibits replication of Japanese encephalitis virus in glioblastoma cells.

PubMed

Li, Wenjuan; Cheng, Peng; Nie, Shangdan; Cui, Wen

2016-01-01

Japanese encephalitis (JE) is one of the most severe viral infections of the central nervous system. No effective treatment for JE currently exists, because its pathogenesis remains largely unknown. The present study was designed to screen the potential microRNAs (miRNAs) involved in JE. Glioblastoma cells were collected, after being infected with the Japanese encephalitis virus (JEV). Total miRNAs were extracted and analyzed using an miRNA chip. One of the most severely affected miRNAs was selected, and the role of miR-370 in JEV infection was investigated. Cell viability and apoptosis of the host cells were evaluated. JEV replication was detected via analysis of gene E expression. Real-time polymerase chain reaction was used to determine the levels of endogenous miR-370 and expression of innate immunity-related genes. Following JEV infection, 114 miRNAs were affected, as evidenced by the miRNA chip. Among them, 30 miRNAs were upregulated and 84 were downregulated. The changes observed in five miRNAs were confirmed by real-time polymerase chain reaction. One of the significantly downregulated miRNAs was miR-370. Therefore, miR-370 mimic was transfected into the cells, following which the levels of endogenous miR-370 were significantly elevated. Concurrently, JEV replication was significantly reduced 24 hours after transfection of miR-370 mimic. Functionally, miR-370 mimic mitigated both JEV-induced apoptosis and the inhibition of host cell proliferation. Following JEV infection, interferon-β and nuclear factor-kappa B were upregulated, whereas miR-370 mimic prevented the upregulation of the genes induced by JEV infection. The present study demonstrated that miR-370 expression in host cells is downregulated following JEV infection, which further mediates innate immunity-related gene expression. Taken together, miR-370 mimic might be useful to prevent viral replication and infection-induced host cell injury.

Chorioamnionitis Occurring in Women With Preterm Rupture of the Fetal Membranes Is Associated With a Dynamic Increase in mRNAs Coding Cytokines in the Maternal Circulation

PubMed Central

Gordon, Lavinia; Kapoor, Jada; Walker, Susan P.; Whitehead, Clare; Kaitu’u-Lino, Tu’uhevaha J.; Pell, Gabrielle; Hannan, Natalie J.; Tong, Stephen

2015-01-01

Background: Preterm prelabor rupture of the fetal membranes (PPROM) is a significant contributor to the morbidity and mortality of preterm birth, particularly in the setting of chorioamnionitis. No sensitive or specific diagnostic or predictive test currently exists for the accurate diagnosis of chorioamnionitis. Our aim was to measure messenger RNA (mRNA) coding cytokines in the maternal blood and examine whether they were increased in association with chorioamnionitis at delivery. Methods/Results: We performed a prospective cohort study of women recruited with PPROM at a mean gestational age of 28.9 weeks at risk of developing chorioamnionitis. Blood was sampled from participants, and the expression of mRNA coding for proinflammatory genes was measured in women with and without chorioamnionitis at the time of delivery as well as gestation-matched healthy controls. Expression was measured using quantitative polymerase chain reaction (PCR) and also digital PCR. Interleukin 1β (IL1B) mRNA expression in maternal blood was elevated in women with chorioamnionitis compared to gestation-matched controls. Importantly, among women admitted with PPROM, digital PCR confirmed a significant increase in IL1B expression in maternal blood in women with chorioamnionitis compared to women without chorioamnionitis. Polymerase chain reaction array revealed that CD14, nuclear factor of κ light polypeptide gene enhancer in B-cells 1 (NFKB1), and tumor necrosis factor receptor super family-interacting serine–threonine kinase 1 mRNA were significantly increased in women with chorioamnionitis compared to controls. Digital PCR confirmed that NFKB1 mRNA was significantly increased in patients with chorioamnionitis compared to controls and that CD14 levels increased over time in patients with PPROM having chorioamnionitis. Conclusion: Measuring circulating proinflammatory mRNA in women with PPROM may distinguish those with chorioamnionitis from those without, in turn providing better targeted therapies and appropriate timing of delivery. PMID:25616398

HLA Class I Depleted hESC as a Source of Hypoimmunogenic Cells for Tissue Engineering Applications.

PubMed

Karabekian, Zaruhi; Ding, Hao; Stybayeva, Gulnaz; Ivanova, Irina; Muselimyan, Narine; Haque, Amranul; Toma, Ian; Posnack, Nikki G; Revzin, Alexander; Leitenberg, David; Laflamme, Michael A; Sarvazyan, Narine

2015-10-01

Rapidly improving protocols for the derivation of autologous cells from stem cell sources is a welcome development. However, there are many circumstances when off-the-shelf universally immunocompatible cells may be needed. Embryonic stem cells (ESCs) provide a unique opportunity to modify the original source of differentiated cells to minimize their rejection by nonautologous hosts. Immune rejection of nonautologous human embryonic stem cell (hESC) derivatives can be reduced by downregulating human leukocyte antigen (HLA) class I molecules, without affecting the ability of these cells to differentiate into specific lineages. Beta-2-microglobulin (B2M) expression was decreased by lentiviral transduction using human anti-HLA class I light-chain B2M short hairpin RNA. mRNA levels of B2M were decreased by 90% in a RUES2-modified hESC line, as determined by quantitative real time-polymerase chain reaction analysis. The transduced cells were selected under puromycin pressure and maintained in an undifferentiated state. The latter was confirmed by Oct4 and Nanog expression, and by the formation of characteristic round-shaped colonies. B2M downregulation led to diminished HLA-I expression on the cell surface, as determined by flow cytometry. When used as target cells in a mixed lymphocyte reaction assay, transduced hESCs and their differentiated derivatives did not stimulate allogeneic T-cell proliferation. Using a cardiac differentiation protocol, transduced hESCs formed a confluent layer of cardiac myocytes and maintained a low level of B2M expression. Transduced hESCs were also successfully differentiated into a hepatic lineage, validating their capacity to differentiate into multiple lineages. HLA-I depletion does not preclude hESC differentiation into cardiac or hepatic lineages. This methodology can be used to engineer tissue from nonautologous hESC sources with improved immunocompatibility.

HLA Class I Depleted hESC as a Source of Hypoimmunogenic Cells for Tissue Engineering Applications

PubMed Central

Karabekian, Zaruhi; Ding, Hao; Stybayeva, Gulnaz; Ivanova, Irina; Muselimyan, Narine; Haque, Amranul; Toma, Ian; Posnack, Nikki G.; Revzin, Alexander; Leitenberg, David; Laflamme, Michael A.

2015-01-01

Background: Rapidly improving protocols for the derivation of autologous cells from stem cell sources is a welcome development. However, there are many circumstances when off-the-shelf universally immunocompatible cells may be needed. Embryonic stem cells (ESCs) provide a unique opportunity to modify the original source of differentiated cells to minimize their rejection by nonautologous hosts. Hypothesis: Immune rejection of nonautologous human embryonic stem cell (hESC) derivatives can be reduced by downregulating human leukocyte antigen (HLA) class I molecules, without affecting the ability of these cells to differentiate into specific lineages. Methods and Results: Beta-2-microglobulin (B2M) expression was decreased by lentiviral transduction using human anti-HLA class I light-chain B2M short hairpin RNA. mRNA levels of B2M were decreased by 90% in a RUES2-modified hESC line, as determined by quantitative real time-polymerase chain reaction analysis. The transduced cells were selected under puromycin pressure and maintained in an undifferentiated state. The latter was confirmed by Oct4 and Nanog expression, and by the formation of characteristic round-shaped colonies. B2M downregulation led to diminished HLA-I expression on the cell surface, as determined by flow cytometry. When used as target cells in a mixed lymphocyte reaction assay, transduced hESCs and their differentiated derivatives did not stimulate allogeneic T-cell proliferation. Using a cardiac differentiation protocol, transduced hESCs formed a confluent layer of cardiac myocytes and maintained a low level of B2M expression. Transduced hESCs were also successfully differentiated into a hepatic lineage, validating their capacity to differentiate into multiple lineages. Conclusions: HLA-I depletion does not preclude hESC differentiation into cardiac or hepatic lineages. This methodology can be used to engineer tissue from nonautologous hESC sources with improved immunocompatibility. PMID:26218149

Anti-aging effects of Piper cambodianum P. Fourn. extract on normal human dermal fibroblast cells and a wound-healing model in mice.

PubMed

Lee, Hyunji; Hong, Youngeun; Kwon, So Hee; Park, Jongsun; Park, Jisoo

2016-01-01

Aging of skin is associated with environmental factors such as ultraviolet rays, air pollution, gravity, and genetic factors, all of which can lead to wrinkling of skin. Previous reports suggest that the wound repair is impaired by the aging process and strategies to manipulate the age-related wound healing are necessary in order to stimulate repair. Several traditional plant extracts are well-known for their properties of skin protection and care. Piper cambodianum P. Fourn. (PPF), a member of Piperacecae, is a plant found in Vietnam that might have therapeutic properties. Therefore, the effects of PPF stem and leaf extract on aging process were investigated in vitro and in vivo. PPF extract dissolved in methanol was investigated using Western blotting, real-time quantitative reverse transcription-polymerase chain reaction, flow cytometry, and cell wound-healing assays. We assessed the anti-aging effect of PPF in mouse using the wound-healing assay. The results were analyzed by Student's unpaired t-test; *P<0.05 and **P<0.01 were considered to indicate significant and highly significant values, respectively, compared with corresponding controls. PPF treatment demonstrated in vitro and in vivo anti-aging activity. Western blot analysis of PPF-treated normal human dermal fibroblast cells showed a dose-dependent increase in the expression of extracellular matrix genes such as collagen and elastin, but decreased expression of the aging gene matrix metalloproteinase-3. Quantitative polymerase chain reaction showed that PPF-treated cells displayed dose-dependent increase in messenger RNA expression levels of collagen, elastin, and hyaluronan synthase-2 and decreased expression levels of matrix metalloproteinase-1 aging gene. PPF treatment led to decreased production of reactive oxygen species in cells subjected to ultraviolet irradiation. Furthermore, PPF extract showed positive wound-healing effects in mice. This study demonstrated the anti-aging and wound-healing effects of PPF extract. Therefore, PPF extract represents a promising new therapeutic agent for anti-aging and wound-healing treatments.

Effect of human vascular endothelial growth factor gene transfer on endogenous vascular endothelial growth factor mRNA expression in a rat fibroblast and osteoblast culture model.

PubMed

Li, Ru; Li, Claire H; Nauth, Aaron; McKee, Michael D; Schemitsch, Emil H

2010-09-01

Vascular endothelial growth factor (VEGF) plays an important role in promoting angiogenesis and osteogenesis during fracture repair. Our previous studies have shown that cell-based VEGF gene therapy enhances bone healing of a rabbit tibia segmental bone defect in vivo. The aim of this project was to examine the effect of exogenous human VEGF on the endogenous rat VEGF messenger RNA (mRNA) expression in a cell-based gene transfer model. Rat fibroblasts and osteoblasts were harvested from the dermal tissue and periosteum, respectively, of Fisher 344 rats. The cells were then cultured and transfected with pcDNA-human VEGF using Superfect reagent (Qiagen). Four experimental groups were created: 1) fibroblast-VEGF; 2) osteoblast-VEGF; 3) nontransfected fibroblast controls; and 4) nontransfected osteoblast controls. The cultured cells were harvested at 1, 3, and 7 days after the gene transfection. The total mRNA was extracted (Trizol; Invitrogen); both human VEGF and rat VEGF mRNA were measured by reverse transcriptase-polymerase chain reaction and quantified by VisionWorksLS. The human VEGF165 mRNA was detected by reverse transcriptase-polymerase chain reaction from transfected fibroblasts and osteoblasts at 1, 3, and 7 days after gene transfection. The human VEGF165 levels peaked at Day 1 and then gradually reduced expression in both transfected fibroblasts and osteoblasts. Two endogenous rat VEGF isoforms were detected in this cell culture model: rat VEGF120 and rat VEGF164. We compared the rat VEGF120 and rat VEGF164 expression level of the fibroblasts or osteoblasts that were transfected with human VEGF165, with nontransfected control cells. Both the transfected fibroblasts and osteoblasts showed greater expression of rat VEGF164 than nontransfected controls at Day 1 (peak level) and Day 3, but not at Day 7. The expression of rat VEGF120 was lower in transfected fibroblasts, but higher in transfected osteoblasts, than the relevant control groups at any time point after transfection. In addition, human VEGF gene transfection increased osteoblast cell proliferation after 3 days. These in vitro results suggest that cell-based human VEGF gene therapy is not only effective at causing human VEGF expression, but also enhances endogenous rat VEGF mRNA expression in both fibroblasts and osteoblasts, particularly the rat VEGF164 isoform.

Oligodendrocyte precursor cell transplantation promotes functional recovery following contusive spinal cord injury in rats and is associated with altered microRNA expression

PubMed Central

Yang, Jin; Xiong, Liu-Lin; Wang, You-Cui; He, Xiang; Jiang, Ling; Fu, Song-Jun; Han, Xue-Fei; Liu, Jia; Wang, Ting-Hua

2018-01-01

It has been reported that oligodendrocyte precursor cells (OPCs) may be used to treat contusive spinal cord injury (SCC), and may alter microRNA (miRNA/miR) expression following SCC in rats. However, the association between miRNA expression and the treatment of rats with SCC with OPC transplantation remain unclear. The present study transplanted OPCs into the spinal cord of rats with SCC and subsequently used the Basso, Beattie and Bresnahan (BBB) score to assess the functional recovery and pain scores. An miRNA assay was performed to detect differentially expressed miRNAs in the spinal cord of SCC rats transplanted with OPCs, compared with SCC rats transplanted with medium. Quantitative polymerase chain reaction was used to verify significantly altered miRNA expression levels. The results demonstrated that OPC transplantation was able to improve motor recovery and relieve mechanical allodynia in rats with SCC. In addition, through a miRNA assay, 45 differentially expressed miRNAs (40 upregulated miRNAs and 5 downregulated miRNAs) were detected in the spinal cord of rats in the OPC group compared with in the Medium group. Differentially expressed miRNAs were identified according to the following criteria: Fold change >2 and P<0.05. Furthermore, quantitative polymerase chain reaction was used to verify the most highly upregulated (miR-375-3p and miR-1-3p) and downregulated (miR-363-3p, miR-449a-5p and miR-3074) spinal cord miRNAs that were identified in the miRNA assay. In addition, a bioinformatics analysis of these miRNAs indicated that miR-375 and miR-1 may act primarily to inhibit cell proliferation and apoptosis via transcriptional and translational regulation, whereas miR-363, miR-449a and miR-3074 may act primarily to inhibit cell proliferation and neuronal differentiation through transcriptional regulation. These results suggested that OPC transplantation may promote functional recovery of rats with SCC, which may be associated with the expression of various miRNAs in the spinal cord, including miR-375-3p, miR-1-3p, miR-363-3p, miR-449a-5p and miR-3074. PMID:29115639

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Whitening Effect of Watersoluble Royal Jelly from South Korea.

PubMed

Han, Sang Mi; Kim, Jung Min; Hong, In Phyo; Woo, Soon Ok; Kim, Se Gun; Jang, Hye Ri; Park, Kwan Kyu; Pak, Sok Cheon

2015-01-01

Royal jelly has been widely used as a health supplement worldwide. However, royal jelly has been implicated in allergic reactions, and we developed a water-soluble royal jelly (WSRJ) without the allergy inducing protein. In this study, we aimed to identify the anti-melanogenic efficacy of WSRJ. B16F1 melanoma cells were first treated with 10 nM α-melanocyte stimulating hormone (α-MSH) and then with various doses of WSRJ. In addition, we investigated the mRNA and protein expression of melanogenesis-related genes such as tyrosinase, tyrosinase related protein-1 (TRP-1) and TRP-2 by reverse transcription-polymerase chain reaction and western blotting. WSRJ directly inhibited tyrosinase and cellular tyrosinase activity, which decreased melanin synthesis in α-MSH stimulated B16F1 melanoma cells a level comparable to that observed with arbutin. WSRJ decreased the mRNA and protein expressions of tyrosinase, TRP-1, and TRP-2, which was comparable to that observed with arbutin. WSRJ has strong anti-melanogenic activity, which invoice direct inhibition of tyrosinase enzyme activity and suppression of expression of melanogenesis related genes. Results from this study suggests that WSRJ is a potential candidate for the treatment of skin pigmentation.

OsbZIP58, a basic leucine zipper transcription factor, regulates starch biosynthesis in rice endosperm.

PubMed

Wang, Jie-Chen; Xu, Heng; Zhu, Ying; Liu, Qiao-Quan; Cai, Xiu-Ling

2013-08-01

Starch composition and the amount in endosperm, both of which contribute dramatically to seed yield, cooking quality, and taste in cereals, are determined by a series of complex biochemical reactions. However, the mechanism regulating starch biosynthesis in cereal seeds is not well understood. This study showed that OsbZIP58, a bZIP transcription factor, is a key transcriptional regulator controlling starch synthesis in rice endosperm. OsbZIP58 was expressed mainly in endosperm during active starch synthesis. osbzip58 null mutants displayed abnormal seed morphology with altered starch accumulation in the white belly region and decreased amounts of total starch and amylose. Moreover, osbzip58 had a higher proportion of short chains and a lower proportion of intermediate chains of amylopectin. Furthermore, OsbZIP58 was shown to bind directly to the promoters of six starch-synthesizing genes, OsAGPL3, Wx, OsSSIIa, SBE1, OsBEIIb, and ISA2, and to regulate their expression. These findings indicate that OsbZIP58 functions as a key regulator of starch synthesis in rice seeds and provide new insights into seed quality control.

Cloning, expression, and characterization of a novel (S)-specific alcohol dehydrogenase from Lactobacillus kefir.

PubMed

Chen, Qilei; Hu, Youjia; Zhao, Wenjie; Zhu, Chunbao; Zhu, Baoquan

2010-01-01

A gene encoding a novel (S)-specific NADH-dependent alcohol dehydrogenase (LK-ADH) was isolated from the genomic DNA of Lactobacillus kefir DSM 20587 by thermal asymmetric interlaced-polymerase chain reaction. The nucleotide sequence of (S)-LK-ADH gene (adhS) was determined, which consists of an open reading frame of 1,044 bp, coding for 347 amino acids with a molecular mass of 37.065 kDa. After a BLAST similarity search in GenBank database, the amino acid sequence of (S)-LK-ADH showed some homologies to several zinc containing medium-chain alcohol dehydrogenases. This novel gene was deposited into GenBank with the accession number of EU877965. adhS gene was subcloned into plasmid pET-28a(+), and recombinant (S)-LK-ADH was successfully expressed in E. coli BL21(DE3) by isopropyl-beta-D-1-thiogalactopyranoside induction. Purified enzyme showed a high enantioselectivity in the reduction of acetophenone to (S)-phenylethanol with an ee value of 99.4%. The substrate specificity and cofactor preference of recombinant (S)-LK-ADH were also tested.

Characterization of T cell repertoire changes in acute Kawasaki disease

PubMed Central

1993-01-01

Kawasaki disease (KD) is an acute multisystem vasculitis of unknown etiology that is associated with marked activation of T cells and monocyte/macrophages. Using a quantitative polymerase chain reaction (PCR) technique, we recently found that the acute phase of KD is associated with the expansion of T cells expressing the V beta 2 and V beta 8.1 gene segments. In the present work, we used a newly developed anti-V beta 2 monoclonal antibody (mAb) and studied a new group of KD patients to extend our previous PCR results. Immunofluorescence analysis confirmed that V beta 2-bearing T cells are selectively increased in patients with acute KD. The increase occurred primarily in the CD4 T cell subset. The percentages of V beta 2+ T cells as determined by mAb reactivity and flow cytometry correlated linearly with V beta expression as quantitated by PCR. However, T cells from acute KD patients appeared to express proportionately higher levels of V beta 2 transcripts per cell as compared with healthy controls or convalescent KD patients. Sequence analysis of T cell receptor beta chain genes of V beta 2 and V beta 8.1 expressing T cells from acute KD patients showed extensive junctional region diversity. These data showing polyclonal expansion of V beta 2+ and V beta 8+ T cells in acute KD provide additional insight into the immunopathogenesis of this disease. PMID:8094737

Lipoprotein-associated phospholipase A(2), platelet-activating factor acetylhydrolase, is expressed by macrophages in human and rabbit atherosclerotic lesions.

PubMed

Häkkinen, T; Luoma, J S; Hiltunen, M O; Macphee, C H; Milliner, K J; Patel, L; Rice, S Q; Tew, D G; Karkola, K; Ylä-Herttuala, S

1999-12-01

We studied the expression of lipoprotein-associated phospholipase A(2) (Lp-PLA(2)), an enzyme capable of hydrolyzing platelet-activating factor (PAF), PAF-like phospholipids, and polar-modified phosphatidylcholines, in human and rabbit atherosclerotic lesions. Oxidative modification of low-density lipoprotein, which plays an important role in atherogenesis, generates biologically active PAF-like modified phospholipid derivatives with polar fatty acid chains. PAF is known to have a potent proinflammatory activity and is inactivated by its hydrolysis. On the other hand, lysophosphatidylcholine and oxidized fatty acids released from oxidized low-density lipoprotein as a result of Lp-PLA(2) activity are thought to be involved in the progression of atherosclerosis. Using combined in situ hybridization and immunocytochemistry, we detected Lp-PLA(2) mRNA and protein in macrophages in both human and rabbit atherosclerotic lesions. Reverse transcriptase-polymerase chain reaction analysis indicated an increased expression of Lp-PLA(2) mRNA in human atherosclerotic lesions. In addition, approximately 6-fold higher Lp-PLA(2) activity was detected in atherosclerotic aortas of Watanabe heritable hyperlipidemic rabbits compared with normal aortas from control rabbits. It is concluded that (1) macrophages in both human and rabbit atherosclerotic lesions express Lp-PLA(2), which could cleave any oxidatively modified phosphatidylcholine present in the lesion area, and (2) modulation of Lp-PLA(2) activity could lead to antiatherogenic effects in the vessel wall.

Localization of type IV collagen a 1 to a 6 chains in basement membrane during mouse molar germ development.

PubMed

Nagai, N; Nakano, K; Sado, Y; Naito, I; Gunduz, M; Tsujigiwa, H; Nagatsuka, H; Ninomiya, Y; Siar, C H

2001-10-01

The dental basement membrane (BM) putatively mediates epithelial-mesenchymal interactions during tooth morphogenesis and cytodifferentiation. Type IV collagen alpha chains, a major network-forming protein of the dental BM, was studied and results disclosed distinct expression patterns at different stages of mouse molar germ development. At the dental placode and bud stage, the BM of the oral epithelium expressed alpha 1, alpha 2, alpha 5 and alpha 6 chains while the gubernaculum dentis, in addition to the above four chains, also expressed a 4 chain. An asymmetrical expression for alpha 4, alpha 5 and alpha 6 chains was observed at the bud stage. At the early bell stage, the BM associated with the inner enamel epithelium (IEE) of molar germ expressed alpha 1, alpha 2 and alpha 4 chains while the BM of the outer enamel epithelium (OEE) expressed only alpha 1 and a 2 chains. With the onset of dentinogenesis, the collagen a chain profile of the IEE BM gradually disappeared. Howeverfrom the early to late bell stage, the gubernaculum dentis consistently expressed alpha 1, alpha 2, alpha 5 and a 6 chains resembling fetal oral mucosa. These findings suggest that stage- and position-specific distribution of type IV collagen alpha subunits occur during molar germ development and that these changes are essential for molar morphogenesis and cytodifferentiation.

Systemic administration of lipopolysaccharide increases the expression of aquaporin-4 in the rat anterior pituitary gland.

PubMed

Kuwahara-Otani, Sachi; Maeda, Seishi; Tanaka, Koichi; Hayakawa, Tetsu; Seki, Makoto

2013-01-01

We investigated the effects of lipopolysaccharide (LPS)-induced endotoxemia on the expression of aquaporin-4 (AQP4) in the rat anterior pituitary gland, using the real-time polymerase chain reaction and immunohistochemistry. After intraperitoneal injection of LPS, the level of AQP4 mRNA doubled at 2, 4 and 8 hr. Immunohistochemical analysis showed an increase with time in AQP4 immunostaining in folliculo-stellate cells following LPS injection; the intensity of immunoreactivity peaked at 8 hr. At the same time, some cyst-like structures, formed by AQP4-positive cells, were observed. These findings indicate that LPS induces the expression of AQP4 in the anterior pituitary gland. The present results should provide an important key to elucidate the pathogenesis of the anterior pituitary gland during endotoxemia.

Cloning and expression of L-asparaginase gene in Escherichia coli.

PubMed

Wang, Y; Qian, S; Meng, G; Zhang, S

2001-08-01

The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.

CD86 expression as a surrogate cellular biomarker for pharmacological inhibition of the histone demethylase lysine-specific demethylase 1.

PubMed

Lynch, James T; Cockerill, Mark J; Hitchin, James R; Wiseman, Daniel H; Somervaille, Tim C P

2013-11-01

There is a lack of rapid cell-based assays that read out enzymatic inhibition of the histone demethylase LSD1 (lysine-specific demethylase 1). Through transcriptome analysis of human acute myeloid leukemia THP1 cells treated with a tranylcypromine-derivative inhibitor of LSD1 active in the low nanomolar range, we identified the cell surface marker CD86 as a sensitive surrogate biomarker of LSD1 inhibition. Within 24h of enzyme inhibition, there was substantial and dose-dependent up-regulation of CD86 expression, as detected by quantitative polymerase chain reaction, flow cytometry, and enzyme-linked immunosorbent assay. Thus, the use of CD86 expression may facilitate screening of compounds with putative LSD1 inhibitory activities in cellular assays. Copyright © 2013 Elsevier Inc. All rights reserved.

Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

PubMed

Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta

2014-03-01

Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.

Blood-induced differential gene expression in Anopheles dirus evaluated using RNA sequencing.

PubMed

Mongkol, W; Nguitragool, W; Sattabongkot, J; Kubera, A

2018-06-08

Malaria parasites are transmitted through blood feeding by female Anopheline mosquitoes. Unveiling the blood-feeding process will improve understanding of vector biology. Anopheles dirus (Diptera: Culicidae) is one of the primary malaria vectors in the Greater Mekong Subregion, the epicentre of malaria drug resistance. In this study, differential gene expression between sugar- and blood-fed An. dirus was investigated by RNA sequencing (RNA-seq). A total of 589 transcripts were found to be upregulated and 703 transcripts downregulated as a result of blood feeding. Transcriptional differences were found in genes involved in blood digestion, peritrophic matrix formation, oogenesis and vitellogenesis. The expression levels of several genes were validated by quantitative reverse transcription polymerase chain reaction. The present results provide better understanding of An. dirus biology in relation to its blood feeding. © 2018 The Royal Entomological Society.

Gene expression profiling in melasma in Korean women.

PubMed

Chung, Bo Young; Noh, Tai Kyung; Yang, Sang Hwa; Kim, Il Hwan; Lee, Mi Woo; Yoon, Tae Jin; Chang, Sung Eun

2014-01-01

There has been a paucity of data about the difference in gene expression between melasma lesional skin and normal adjacent one. Our aim was to identify novel genes involved in the pathogenesis of melasma. We performed a microarray analysis and confirmed the results on quantitative real-time polymerase chain reaction (qRT-PCR) in Korean women with melasma. There were 334 genes whose degree of expression showed a significant difference between melasma lesional skin and normal adjacent one. Of these, five were confirmed on qRT-PCR. In melasma lesional skin, there were down-regulation of genes involved in the PPAR signaling pathway and up-regulation of genes involved in neuronal component and the functions of stratum corneum barrier. This result suggests that the pathogenesis of melasma might be associated with novel genes involved in the above signaling pathway in Korean women.

Purification and characterization of human pancreatic polypeptide expressed in E. coli.

PubMed

Griko, Y V; Kapanadze, M D

1995-08-04

The region of cDNA encoding human pancreatic polypeptide (hPP) was obtained by polymerase chain reaction (PCR) and subcloned into an expression vector. The pancreatic polypeptide gene was expressed in Escherichia coli in two versions: as a cleavable fusion protein with IgG-binding synthetic ZZ domains of protein A from Staphylococcus aureus or with the 1-48 fragment of lambda Cro repressor. Site-specific hydrolysis by hydroxylamine was used to cleave the fusion protein, releasing the human polypeptide. The structure of the obtained hPP has been studied by scanning microcalorimetry and circular dichroism spectrometry. It has been shown that hPP in solutions close to neutral has a compact and unique spatial structure with an extended hydrophobic core. This structure is stable at 20 degrees C and co-operatively breaks down upon heating from this temperature.

Expression of small leucine-rich proteoglycans in rat anterior pituitary gland.

PubMed

Horiguchi, Kotaro; Syaidah, Rahimi; Fujiwara, Ken; Tsukada, Takehiro; Ramadhani, Dini; Jindatip, Depicha; Kikuchi, Motoshi; Yashiro, Takashi

2013-01-01

Proteoglycans are components of the extracellular matrix and comprise a specific core protein substituted with covalently linked glycosaminoglycan chains. Small leucine-rich proteoglycans (SLRPs) are a major family of proteoglycans and have key roles as potent effectors in cellular signaling pathways. Research during the last two decades has shown that SLRPs regulate biological functions in many tissues such as skin, tendon, kidney, liver, and heart. However, little is known of the expression of SLRPs, or the characteristics of the cells that produce them, in the anterior pituitary gland. Therefore, we have determined whether SLRPs are present in rat anterior pituitary gland. We have used real-time reverse transcription with the polymerase chain reaction to analyze the expression of SLRP genes and have identified the cells that produce SLRPs by using in situ hybridization with a digoxigenin-labeled cRNA probe. We have clearly detected the mRNA expression of SLRP genes, and cells expressing decorin, biglycan, fibromodulin, lumican, proline/arginine-rich end leucine-rich repeat protein (PRELP), and osteoglycin are located in the anterior pituitary gland. We have also investigated the possible double-staining of SLRP mRNA and pituitary hormones, S100 protein (a marker of folliculostellate cells), desmin (a marker of capillary pericytes), and isolectin B4 (a marker of endothelial cells). Decorin, biglycan, fibromodulin, lumican, PRELP, and osteoglycin mRNA have been identified in S100-protein-positive and desmin-positive cells. Thus, we conclude that folliculostellate cells and pericytes produce SLRPs in rat anterior pituitary gland.

Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii

PubMed Central

Nikitkova, A.E.; Haase, E.M.; Scannapieco, F.A.

2012-01-01

SUMMARY Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml−1 amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, regulate AbpA expression in S. gordonii. PMID:22759313

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Differential expression of connexin 43 in human autoimmune thyroid disease.

PubMed

Jiang, Xiao-Yan; Feng, Xiao-Hong; Li, Guo-Yan; Zhao, Qian; Yin, Hui-Qing

2010-05-01

Gap junctions provide a pathway for cell-to-cell communication. Reduced thyroid epithelial cell-cell communication has been reported in some animal models of autoimmune thyroid disease. In order to assess whether this change was similar to human autoimmune thyroid disease, we identified some connexin proteins and their corresponding mRNA in human thyroid gland. The aim of our study was to explore the expression of connexin 43 (Cx43) in the thyroid gland from normal and diseased human thyroid tissue by immunohistochemistry and reverse transcription polymerase chain reaction (RT-PCR). The expression levels of Cx43 in Grave's disease were significantly increased in comparison with those of normal thyroid tissue. There was a significant decrease in expression of Cx43 in Hashimoto's thyroiditis, compared with normal thyroid tissue. These data indicate that changes of Cx43 expression in human autoimmune thyroid disease were associated with variations in thyroid function and hormone secretion. 2009 Elsevier GmbH. All rights reserved.

Identification of Potential Anticancer Activities of Novel Ganoderma lucidum Extracts Using Gene Expression and Pathway Network Analysis

PubMed Central

Kao, Chi H.J.; Bishop, Karen S.; Xu, Yuanye; Han, Dug Yeo; Murray, Pamela M.; Marlow, Gareth J.; Ferguson, Lynnette R.

2016-01-01

Ganoderma lucidum (lingzhi) has been used for the general promotion of health in Asia for many centuries. The common method of consumption is to boil lingzhi in water and then drink the liquid. In this study, we examined the potential anticancer activities of G. lucidum submerged in two commonly consumed forms of alcohol in East Asia: malt whiskey and rice wine. The anticancer effect of G. lucidum, using whiskey and rice wine-based extraction methods, has not been previously reported. The growth inhibition of G. lucidum whiskey and rice wine extracts on the prostate cancer cell lines, PC3 and DU145, was determined. Using Affymetrix gene expression assays, several biologically active pathways associated with the anticancer activities of G. lucidum extracts were identified. Using gene expression analysis (real-time polymerase chain reaction [RT-PCR]) and protein analysis (Western blotting), we confirmed the expression of key genes and their associated proteins that were initially identified with Affymetrix gene expression analysis. PMID:27006591

Serum immunoreactivity of cancer/testis antigen OY-TES-1 and its tissues expression in glioma.

PubMed

Li, Xisheng; Yan, Jun; Fan, Rong; Luo, Bin; Zhang, Qingmei; Lin, Yongda; Zhou, Sufang; Luo, Guorong; Xie, Xiaoxun; Xiao, Shaowen

2017-05-01

OY-TES-1 is a member of the cancer/testis antigen family that is expressed in healthy testis tissue and certain types of cancerous tissue. The present study aimed to analyze the expression pattern of OY-TES-1 and serum anti-OY-TES-1 antibody concentration in patients with glioma. OY-TES-1 mRNA was detected in 28/36 (78%) of glioma cases using conventional reverse transcription polymerase chain reaction (RT-PCR) analysis. RT-quantitative-PCR revealed that OY-TES-1 was expressed at a higher level in glioma tissues compared with normal adult tissues (with the exception of testis tissue). Anti-OY-TES-1 antibodies were present in the serum of 5/36 (14%) of patients with glioma, but absent in all the serum samples from 107 healthy donors. Immunohistochemical analysis demonstrated that OY-TES-1 protein was expressed in all glioma tissues from patients with anti-OY-TES-1 antibody seropositivity. These results suggest that OY-TES-1 is a novel candidate for glioma immunotherapy.

Salivary FOXP2 expression and oral feeding success in premature infants.

PubMed

Zimmerman, Emily; Maki, Monika; Maron, Jill

2016-01-01

The objective of the study is to determine whether salivary FOXP2 gene expression levels at the initiation of oral feeding attempts are predictive of oral feeding success in the premature newborn. In this prospective study, saliva samples from 21 premature infants (13 males; birth gestational age [GA]: 30-34 wk) were collected around the initiation of oral feeding trials. Total RNA was extracted and underwent reverse transcription-quantitative polymerase chain reaction amplification for FOXP2. Oral feeding success was denoted by the days required to attain full oral feeds. A linear regression model, controlling for sex, birth GA, and weight at salivary collection, revealed that FOXP2 expression was significantly associated with oral feeding success (P = 0.002). The higher the expression level of FOXP2, the shorter the duration to feed. Salivary FOXP2 expression levels are significantly associated with oral feeding success in the preterm infant. FOXP2 may serve as a novel and informative biomarker to noninvasively assess infant feeding skills to reduce morbidities and length of stay.

Cassava (Manihot esculenta Krantz) genome harbors KNOX genes differentially expressed during storage root development.

PubMed

Guo, D; Li, H L; Tang, X; Peng, S Q

2014-12-18

In plants, homeodomain proteins play a critical role in regulating various aspects of plant growth and development. KNOX proteins are members of the homeodomain protein family. The KNOX transcription factors have been reported from Arabidopsis, rice, and other higher plants. The recent publication of the draft genome sequence of cassava (Manihot esculenta Krantz) has allowed a genome-wide search for M. esculenta KNOX (MeKNOX) transcription factors and the comparison of these positively identified proteins with their homologs in model plants. In the present study, we identified 12 MeKNOX genes in the cassava genome and grouped them into two distinct subfamilies based on their domain composition and phylogenetic analysis. Furthermore, semi-quantitative reverse transcription polymerase chain reaction analysis was performed to elucidate the expression profiles of these genes in different tissues and during various stages of root development. The analysis of MeKNOX expression profiles of indicated that 12 MeKNOX genes display differential expressions either in their transcript abundance or expression patterns.

Low-intensity red and infrared lasers on XPA and XPC gene expression

NASA Astrophysics Data System (ADS)

Fonseca, A. S.; Magalhães, L. A. G.; Mencalha, A. L.; Ferreira-Machado, S. C.; Geller, M.; Paoli, F.

2014-09-01

Laser devices emit monochromatic, coherent, and highly collimated intense beams of light that are useful for a number of biomedical applications. However, for low-intensity lasers, possible adverse effects of laser light on DNA are still controversial. In this work, the expression of XPA and XPC genes in skin and muscle tissue exposed to low-intensity red and infrared lasers was evaluated. Skin and muscle tissue of Wistar rats were exposed to low-intensity red and infrared lasers at different fluences in continuous mode emission. Skin and muscle tissue samples were withdrawn for total RNA extraction, cDNA synthesis, and evaluation of actin gene expression by quantitative polymerase chain reaction. Data obtained show that laser radiation alters the expression of XPA and XPC mRNA differently in skin and muscle tissue of Wistar rats, depending on physical (fluence and wavelength) and biological (tissue) parameters. Laser light could modify expression of genes related to the nucleotide excision repair pathway at fluences and wavelengths used in clinical protocols.

CXCR6-CXCL16 interaction in the pathogenesis of Juvenile Idiopathic Arthritis.

PubMed

Martini, Giorgia; Cabrelle, Anna; Calabrese, Fiorella; Carraro, Samuela; Scquizzato, Elisa; Teramo, Antonella; Facco, Monica; Zulian, Francesco; Agostini, Carlo

2008-11-01

In order to evaluate the role of CXCR6/CXCL16 in driving lymphocyte migration into inflamed joints of children with oligoarticular Juvenile Idiopathic Arthritis (JIA) we analysed CXCR6 expression and functional capability in lymphocytes from synovial fluid (SF) by flow cytometry, by real-time polymerase chain reaction (RT-PCR) and migration assays. Furthermore, CXCR6 and CXCL16 expression in synovial tissue (ST) was analysed by immunohistochemistry. T cells isolated from SF of patients with JIA expressed CXCR6 which was functionally active as shown by chemotactic assays. The same cells expressed CXCR3 and it exerted a migratory activity in response to CXCL10. CXCL16 and CXCR6 were intensively expressed on the synovium cells, respectively on macrophages, synoviocytes and endothelial cells and on lymphocytes, synoviocytes and endothelial cells. Taken together, these data suggest that CXCR6 and CXCR3 act coordinately with respective ligands and are involved in the pathophysiology of JIA-associated inflammatory processes.

Expression of Genes Encoding the Enzymes for Glycogen and Trehalose Metabolism in L3 and L4 Larvae of Anisakis simplex.

PubMed

Łopieńska-Biernat, E; Zaobidna, E A; Dmitryjuk, M

2015-01-01

Trehalose and glycogen metabolism plays an important role in supporting life processes in many nematodes, including Anisakis simplex. Nematodes, cosmopolitan helminths parasitizing sea mammals and humans, cause a disease known as anisakiasis. The aim of this study was to investigate the expression of genes encoding the enzymes involved in the metabolism of trehalose and glycogen-trehalose-6-phosphate synthase (TPS), trehalose-6-phosphate phosphatase (TPP), glycogen synthase (GS), and glycogen phosphorylase (GP)-in stage L3 and stage L4 larvae of A. simplex. The expression of mRNA all four genes, tps, tpp, gs, and gp, was examined by real-time polymerase chain reaction. The A. simplex ribosomal gene (18S) was used as a reference gene. Enzymatic activity was determined. The expression of trehalose enzyme genes was higher in L3 than in L4 larvae, but an inverse relationship was noted for the expression of gs and gp genes.

Expression of Genes Encoding the Enzymes for Glycogen and Trehalose Metabolism in L3 and L4 Larvae of Anisakis simplex

PubMed Central

Łopieńska-Biernat, E.; Zaobidna, E. A.; Dmitryjuk, M.

2015-01-01

Trehalose and glycogen metabolism plays an important role in supporting life processes in many nematodes, including Anisakis simplex. Nematodes, cosmopolitan helminths parasitizing sea mammals and humans, cause a disease known as anisakiasis. The aim of this study was to investigate the expression of genes encoding the enzymes involved in the metabolism of trehalose and glycogen—trehalose-6-phosphate synthase (TPS), trehalose-6-phosphate phosphatase (TPP), glycogen synthase (GS), and glycogen phosphorylase (GP)—in stage L3 and stage L4 larvae of A. simplex. The expression of mRNA all four genes, tps, tpp, gs, and gp, was examined by real-time polymerase chain reaction. The A. simplex ribosomal gene (18S) was used as a reference gene. Enzymatic activity was determined. The expression of trehalose enzyme genes was higher in L3 than in L4 larvae, but an inverse relationship was noted for the expression of gs and gp genes. PMID:26783451

Expression of the Mir-133 and Bcl-2 could be affected by swimming training in the heart of ovariectomized rats.

PubMed

Habibi, Parisa; Alihemmati, Alireza; NourAzar, Alireza; Yousefi, Hadi; Mortazavi, Safieh; Ahmadiasl, Nasser

2016-04-01

The beneficial and more potent role of exercise to prevent heart apoptosis in ovariectomized rats has been known. The aim of this study was to examine the effects of swimming training on cardiac expression of Bcl-2, and Mir-133 levels and glycogen changes in the myocyte. Forty animals were separated into four groups as control, sham, ovariectomy (OVX) and ovariectomized group with 8 weeks swimming training (OVX.E). Training effects were evaluated by measuring lipid profiles, Bcl-2 and Mir-133 expression levels in the cardiac tissue. Grafts were analyzed by reverse transcription-polymerase chain reaction for Bcl-2 mRNA and Mir-133 and by Western blot for Bcl-2 protein. Ovariectomy down-regulated Bcl-2 and Mir-133 expression levels in the cardiac tissue, and swimming training up-regulated their expression significantly (P<0.05). Our results showed that regular exercise as a physical replacement therapy could prevent and improve the effects of estrogen deficiency in the cardia.

Adoptive transfer of T regulatory cells inhibits lipopolysaccharide-induced inflammation in fetal brain tissue in a late-pregnancy preterm birth mouse model.

PubMed

Wang, Fan; Xiao, Mi; Chen, Ru-Juan; Lin, Xiao-Jie; Siddiq, Muhammad; Liu, Li

2017-02-01

To evaluate the effect of regulatory T cells (Tregs) on the inflammation resulting from lipopolysaccharide (LPS) challenge in prenatal brain tissue, Tregs isolated from pregnant mice were transferred into model mice, and the expression levels of fork head family transcription factor (Foxp3), interleukin-6 (IL-6), CD68 (a marker of microglia), and toll-like receptor 4 (TLR-4) were assessed in the fetal brain tissue. Foxp3, IL-6, and TLR-4 expression were detected by polymerase chain reaction and Western blot; CD68 expression level was detected using immunochemical analysis. Foxp3, IL-6, TLR-4, and CD68 expressions in fetal brain were significantly induced by maternal LPS administration, and the increased expression levels were markedly reduced by adoptive transfer of Tregs. Maternal LPS exposure significantly induced inflammation in perinatal brain tissue, and Tregs negatively regulated this LPS-induced inflammation. © 2016 International Federation for Cell Biology.

Expression levels of seven candidate genes in human peripheral blood mononuclear cells and their association with preeclampsia

PubMed Central

Garza-Veloz, I.; Carrillo-Sanchez, K.; Martinez-Gaytan, V.; Cortes-Flores, R.; Ochoa-Torres, M. A.; Guerrero, G. G.; Rodriguez-Sanchez, I. P.; Cancela-Murrieta, C. O.; Zamudio-Osuna, M.; Badillo-Almaraz, J. I.; Castruita-De la Rosa, C.

2014-01-01

Objective To evaluate the peripheral blood mononuclear cell (PBMC) expression levels of hemeoxygenase 1 (HMOX-1), superoxide dismutase 1 (SOD-1), vascular endothelial growth factor A (VEGF-A), transforming growth factor beta 1 (TGF-β1), interleukin (IL)-6, IL-15 and AdipoQ genes to study their association with preeclampsia (PE). Methods A total of 177 pregnant women were recruited: 108 cases and 69 controls. Quantification of gene expression was measured by quantitative real-time polymerase chain reaction (PCR) using TaqMan probes. Results Underexpression of VEGF-A and TGF-β1 was a constant in most of the cases (80.91% and 76.36%, respectively) and their expression was associated with onset and/or severity of disease (p values < 0.05). IL-6, IL-15 and AdipoQ, showed low or no expression in PBMC samples evaluated. Conclusion PBMC underexpression of VEGF-A and TGF-β1 is a hallmark of PE in the study population. PMID:24295154

Expression of TRPC5 is decreased in the sperm of patients with varicocele-associated asthenozoospermia

PubMed Central

Zhu, Guangbin; Xie, Changying; Yang, Zhonghua; Wang, Yongzhi; Chen, Dong; Wang, Xinghuan

2018-01-01

The present study aimed to determine whether the expression of transient receptor potential channel 5 (TRPC5) protein is altered in spermatozoa of patients with varicocele-associated asthenozoospermia. TRPC5 expression in spermatozoa was determined by polymerase chain reaction and western blotting analyses, and indirect immunofluorescence was used for identification and immunolocalization of the TRPC5 channel in human sperm. Sperm motility and superoxide dismutase (SOD) activity were also determined with a computer-assisted semen analysis system and assay kit, respectively. Compared with levels in control subjects, it was identified that TRPC5 protein expression, SOD activity and cellular motility in the sperm of patients with varicocele-associated asthenozoospermia were reduced (P<0.001). Furthermore, the expression of TRPC5 was positively correlated with sperm motility (r=0.781, P<0.001) and SOD activity (r=0.933, P<0.001), indicated by partial correlation analysis. The present study may provide a novel target for the study and treatment of varicocele-associated asthenozoospermia.

Effect of thermal stress on HSP90 expression of Bali cattle in Barru district, South Sulawesi

NASA Astrophysics Data System (ADS)

Aritonang, S. B.; Yuniati, R.; Abinawanto, Imron, M.; Bowolaksono, A.

2017-07-01

Heat shock protein 90-kDa is induced stress protein that expressed in response to stress and play crucial roles in environmental stress tolerance and adaptation. This study aimed to determine effect of environmental heat stress on the HSP90 expression of Bali cattle. Heat stress was measured by temperature humidity index in the morning and evening across 5-days on August 2016. The blood samples of Bali cattle were taken from venous jungularis. HSP90 was derived from RNA isolation of whole blood then was followed reverse transcription two steps. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed to analyze the transcript variants of HSP90, followed by comparative ΔΔCt to determine HSP90 expression. The results of temperature and humidity index (THI) measurement indicated THI on afternoon was higher than in the morning. The difference in environmental conditions in the morning and afternoon effected changes on rectal temperature but neither did on Hsp90 expression.

Expression of very low density lipoprotein receptor mRNA in circulating human monocytes: its up-regulation by hypoxia.

PubMed

Nakazato, K; Ishibashi, T; Nagata, K; Seino, Y; Wada, Y; Sakamoto, T; Matsuoka, R; Teramoto, T; Sekimata, M; Homma, Y; Maruyama, Y

2001-04-01

Although very low density lipoprotein (VLDL) receptor expression by macrophages has been shown in the vascular wall, it is not clear whether or not circulating monocytes express the VLDL receptor. We investigated the expression of VLDL receptor mRNA in human peripheral blood monocytes and monocyte-derived macrophages by reverse transcriptase polymerase chain reaction (RT-PCR) and nucleotide sequencing after subcloning of PCR product. VLDL receptor mRNA was detected both in peripheral blood monocytes and monocyte-derived macrophages. Expression of VLDL receptor mRNA was upregulated by hypoxia in monocytes, whereas treatment with oxidized LDL, interleukin-1beta or monocyte chemoattractant protein-1 did not affect the levels of VLDL receptor mRNA in monocytes and macrophages. The present study shows a novel response of VLDL receptor mRNA to hypoxia, suggesting a role for VLDL receptor in the metabolism of lipoproteins in the vascular wall and the development of atherosclerosis.

MicroRNA-124-3p expression and its prospective functional pathways in hepatocellular carcinoma: A quantitative polymerase chain reaction, gene expression omnibus and bioinformatics study.

PubMed

He, Rong-Quan; Yang, Xia; Liang, Liang; Chen, Gang; Ma, Jie

2018-04-01

The present study aimed to explore the potential clinical significance of microRNA (miR)-124-3p expression in the hepatocarcinogenesis and development of hepatocellular carcinoma (HCC), as well as the potential target genes of functional HCC pathways. Reverse transcription-quantitative polymerase chain reaction was performed to evaluate the expression of miR-124-3p in 101 HCC and adjacent non-cancerous tissue samples. Additionally, the association between miR-124-3p expression and clinical parameters was also analyzed. Differentially expressed genes identified following miR-124-3p transfection, the prospective target genes predicted in silico and the key genes of HCC obtained from Natural Language Processing (NLP) were integrated to obtain potential target genes of miR-124-3p in HCC. Relevant signaling pathways were assessed with protein-protein interaction (PPI) networks, Gene Ontology (GO) enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Protein Annotation Through Evolutionary Relationships (PANTHER) pathway enrichment analysis. miR-124-3p expression was significantly reduced in HCC tissues compared with expression in adjacent non-cancerous liver tissues. In HCC, miR-124-3p was demonstrated to be associated with clinical stage. The mean survival time of the low miR-124-3p expression group was reduced compared with that of the high expression group. A total of 132 genes overlapped from differentially expressed genes, miR-124-3p predicted target genes and NLP identified genes. PPI network construction revealed a total of 109 nodes and 386 edges, and 20 key genes were identified. The major enriched terms of three GO categories included regulation of cell proliferation, positive regulation of cellular biosynthetic processes, cell leading edge, cytosol and cell projection, protein kinase activity, transcription activator activity and enzyme binding. KEGG analysis revealed pancreatic cancer, prostate cancer and non-small cell lung cancer as the top three terms. Angiogenesis, the endothelial growth factor receptor signaling pathway and the fibroblast growth factor signaling pathway were identified as the most significant terms in the PANTHER pathway analysis. The present study confirmed that miR-124-3p acts as a tumor suppressor in HCC. miR-124-3p may target multiple genes, exerting its effect spatiotemporally, or in combination with a diverse range of processes in HCC. Functional characterization of miR-124-3p targets will offer novel insight into the molecular changes that occur in HCC progression.

Isolation and characterization of the trophectoderm from the Arabian camel (Camelus dromedarius).

PubMed

Saadeldin, Islam M; Swelum, Ayman Abdel-Aziz; Elsafadi, Mona; Moumen, Abdullah F; Alzahrani, Faisal A; Mahmood, Amer; Alfayez, Musaad; Alowaimer, Abdullah N

2017-09-01

We isolated and characterized trophoblast from in vivo-derived camel embryos and compared with embryonic stem-like cells. Camel embryos were flushed on day 8 post-insemination and used to derive trophectoderm and embryonic stem-like cells under feeder-free culture conditions using a basement membrane matrix. Embryos were evaluated for the expression of POU5F1, MYC, KLF4, SOX2, CDX2, and KRT8 mRNA transcripts by relative quantitative polymerase chain reaction. Camel embryos grew and expanded to ∼4.5 mm and maintained their vesicular shape in vitro for 21 days post-insemination. Trophoblast and embryonic stem-like cell lines grew under feeder-free culture conditions and showed distinct morphological criteria and normal chromosomal counts. Embryonic stem-like cells showed positive staining in the alkaline phosphatase reaction. Trophoblast cells showed a significant increase in CDX2, KRT8, KLF4, and SOX2 expression compared with embryonic stem-like cells and whole embryos. Embryonic stem-like cells showed a significant decrease in CDX2 expression and increase in SOX2 and KRT8 expression compared to embryonic expression. POU5F1 and MYC expression showed no difference between embryos and both cell lines. We characterized embryo survival in vitro, particularly the derivation of trophectoderm and embryonic stem-like cells, providing a foundation for further analysis of early embryonic development and placentation in camels. Copyright © 2017 Elsevier Ltd. All rights reserved.

Human NRDRB1, an alternatively spliced isoform of NADP(H)-dependent retinol dehydrogenase/reductase enhanced enzymatic activity of benzil.

PubMed

Yan, Yinxia; Song, Xuhong; Liu, Gefei; Su, Zhongjing; Du, Yongming; Sui, Xuxia; Chang, Xiaolan; Huang, Dongyang

2012-01-01

Human NRDRB1, a 226 amino acid alternatively spliced isoform of the NADP(H)- dependent retinol dehydrogenase/reductase (NRDR), lacks the complete coding region of exon 3, but preserves all the important functional motifs for NRDR catalytic activity. Nevertheless, its tissue distribution and physiological function remain to be elucidated. Expression of NRDRB1 and NRDR in cells and tissues was analyzed by semi-quantitative polymerase chain reaction (PCR) and western blot. NRDRB1 was expressed as a His(6) fusion protein and subjected to kinetics assays. Recombinant NRDRB1 had 1.2 to 8.6 fold higher k(cat)/K(m) values than recombinant NRDR, depending on the substrate. NRDRB1 catalyzed the NADPH-dependent reduction of α-dicarbonyl compounds, such as isatin, 9,10-phenanthrenequinone, and especially benzil. The significantly high catalytic activity and the relatively high expression in human liver of NRDRB1 conferred cellular resistance to benzil-induced cell toxicity and over-expression of NRDRB1 in low expressing Ec109 cells significantly enhanced cell tolerance toward benzil. Based on its substrate specificity, catalytic activity and relatively high expression in human liver tissue, our results suggest that NRDRB1, an alternatively spliced isoform of NRDR in vivo functions better than NRDR as a dicarbonyl reductase for xenobiotics containing reactive carbonyls. Our study is the first reporting this phenomenon of the enzymes involved in biochemical reactions. Copyright © 2012 S. Karger AG, Basel.

Acylsugar Acylhydrolases: Carboxylesterase-Catalyzed Hydrolysis of Acylsugars in Tomato Trichomes1[OPEN

PubMed Central

Gilgallon, Karin; Ghosh, Banibrata

2016-01-01

Glandular trichomes of cultivated tomato (Solanum lycopersicum) and many other species throughout the Solanaceae produce and secrete mixtures of sugar esters (acylsugars) on the plant aerial surfaces. In wild and cultivated tomato, these metabolites consist of a sugar backbone, typically glucose or sucrose, and two to five acyl chains esterified to various positions on the sugar core. The aliphatic acyl chains vary in length and branching and are transferred to the sugar by a series of reactions catalyzed by acylsugar acyltransferases. A phenotypic screen of a set of S. lycopersicum M82 × Solanum pennellii LA0716 introgression lines identified a dominant genetic locus on chromosome 5 from the wild relative that affected total acylsugar levels. Genetic mapping revealed that the reduction in acylsugar levels was consistent with the presence and increased expression of two S. pennellii genes (Sopen05g030120 and Sopen05g030130) encoding putative carboxylesterase enzymes of the α/β-hydrolase superfamily. These two enzymes, named ACYLSUGAR ACYLHYDROLASE1 (ASH1) and ASH2, were shown to remove acyl chains from specific positions of certain types of acylsugars in vitro. A survey of related genes in M82 and LA0716 identified another trichome-expressed ASH gene on chromosome 9 (M82, Solyc09g075710; LA0716, Sopen09g030520) encoding a protein with similar activity. Characterization of the in vitro activities of the SpASH enzymes showed reduced activities with acylsugars produced by LA0716, presumably contributing to the high-level production of acylsugars in the presence of highly expressed SpASH genes. PMID:26811191

Expression of the Pokemon proto-oncogene in nasopharyngeal carcinoma cell lines and tissues.

PubMed

Jiao, Wei; Liu, Fei; Tang, Feng-Zhu; Lan, Jiao; Xiao, Rui-Ping; Chen, Xing-Zhou; Ye, Hui-Lan; Cai, Yong-Lin

2013-01-01

To study the differentiated expression of the proto-oncogene Pokemon in nasopharyngeal carcinoma (NPC) cell lines and tissues, mRNA and protein expression levels of CNE1, CNE2, CNE3 and C666-1 were detected separately by reverse transcription polymerase chain reaction (RT-PCR), real-time PCR and Western-blotting. The immortalized nasopharyngeal epithelial cell line NP69 was used as a control. The Pokemon protein expression level in biopsy specimens from chronic rhinitis patients and undifferentiated non keratinizing NPC patients was determined by Western-blotting and arranged from high to low: C666-1>CNE1>CNE2> CNE3>NP69. The Pokemon mRNA expression level was also arranged from high to low: CNE1>CNE2>NP69>C666-1>CNE3. Pokemon expression of NP69 and C666-1 obviously varied from mRNA to protein. The Pokemon protein level of NPC biopsy specimens was obviously higher than in chronic rhinitis. The data suggest that high Pokemon protein expression is closely associated with undifferentiated non-keratinizing NPC and may provide useful information for NPC molecular target therapy.

Expression of Spindle and Kinetochore-Associated Protein 1 Is Associated with Poor Prognosis in Papillary Thyroid Carcinoma

PubMed Central

Dong, Chao; Wang, Xiao-li; Ma, Bin-lin

2015-01-01

Aim. Spindle and kinetochore-associated protein 1 (SKA1) is one subtype of SKA, whose protein can make spindle microtubules attach steadily to the kinetochore in the middle of mitosis. At present, there are fewer researches on the relationship between SKA1 expression and tumor development. Methods. In this study, immunohistochemical analysis was used to determine the expression of SKA1 in papillary thyroid carcinoma (PTC) and adjacent tissues. We used quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot analysis to further verify the results. Results. We found that SKA1 expression was significantly higher in PTC tissues than normal adjacent tissues (P < 0.05). There existed a significant correlation among a higher SKA1 expression, including lymphoid node (P = 0.005), clinical stage (P = 0.015), and extrathyroid invasion (P = 0.004). Survival analysis showed high SKA1 expression in PTC patients more likely to relapse after surgery. Conclusion. High SKA1 expression is predictive of poor prognosis of PTC, implying that SKA1 may be a promising new target for targeted therapies for PTC. PMID:26063960

Analysis of differential gene expression by bead-based fiber-optic array in nonfunctioning pituitary adenomas.

PubMed

Jiang, Z; Gui, S; Zhang, Y

2011-05-01

Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.

Pattern of somatostatin receptors expression in normal and bladder cancer tissue samples.

PubMed

Karavitakis, Markos; Msaouel, Pavlos; Michalopoulos, Vassilis; Koutsilieris, Michael

2014-06-01

Known risks factors for bladder cancer progression and recurrence are limited regarding their prognostic ability. Therefore identification of molecular determinants of disease progression could provide with more specific prognostic information and could be translated into new approaches for biomarker development. In the present study we evaluated, the expression patterns of somatostatin receptors 1-5 (SSTRs) in normal and tumor bladder tissues. The expression of SSTR1-5 was characterized in 45 normal and bladder cancer tissue samples using reverse transcriptase-polymerase chain reaction (RT-PCR). SSTR1 was expressed in 24 samples, SSTR2 in 15, SSTR3 in 23, SSTR4 in 16 and SSTR5 in all but one sample. Bladder cancer tissue samples expressed lower levels of SSTR3. Co-expression of SSTRs was associated with superficial disease. Our results demonstrate, for the first time, that there is expression of SSTR in normal and bladder cancer urothelium. Further studies are required to evaluate the prognostic and therapeutic significance of these findings. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Placental expression of D6 decoy receptor in preeclampsia

PubMed Central

Cho, Geum Joon; Lee, Eun Sung; Jin, Hye Mi; Lee, Ji Hye; Kim, Yeun Sun; Seol, Hyun-Joo; Hong, Soon-Cheol; Kim, Hai-Joong

2015-01-01

Objective The purpose of this study was to investigate the expression of the D6 decoy receptor that can bind chemokines and target them for degradation, resulting in inhibition of inflammation in placentas from preeclamptic and normal pregnancies. Methods The current study was carried out in 35 pregnant women (23 patients with preeclampsia and 12 healthy, normotensive pregnant women) during the third trimester of pregnancy. The expressions of D6 decoy receptor in the placenta were determined with real time reverse transcriptase polymerase chain reaction and western blotting. Results The mRNA and protein of D6 decoy receptor were detected in all of placentas from preeclamptic and normal pregnancies. Placental D6 decoy receptor mRNA expression was significantly lower in patients with preeclampsia than in patients with normal pregnancies. Western blot analyses revealed decreased protein expression in cases of preeclampsia. Conclusion The expression of the D6 decoy receptor in preeclamptic placentas was significantly lower than in normal placentas. Further studies are needed to clarify the underlying mechanisms that link decreased expression of placental D6 decoy receptor and preeclampsia. PMID:26430656

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

Quantification of the Influence of Extracellular Laccase and Intracellular Reactions on the Isomer-Specific Biotransformation of the Xenoestrogen Technical Nonylphenol by the Aquatic Hyphomycete Clavariopsis aquatica▿

PubMed Central

Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar

2009-01-01

The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559

Discovery of J Chain in African Lungfish (Protopterus dolloi, Sarcopterygii) Using High Throughput Transcriptome Sequencing: Implications in Mucosal Immunity

PubMed Central

Tacchi, Luca; Larragoite, Erin; Salinas, Irene

2013-01-01

J chain is a small polypeptide responsible for immunoglobulin (Ig) polymerization and transport of Igs across mucosal surfaces in higher vertebrates. We identified a J chain in dipnoid fish, the African lungfish (Protopterus dolloi) by high throughput sequencing of the transcriptome. P. dolloi J chain is 161 aa long and contains six of the eight Cys residues present in mammalian J chain. Phylogenetic studies place the lungfish J chain closer to tetrapod J chain than to the coelacanth or nurse shark sequences. J chain expression occurs in all P. dolloi immune tissues examined and it increases in the gut and kidney in response to an experimental bacterial infection. Double fluorescent in-situ hybridization shows that 88.5% of IgM+ cells in the gut co-express J chain, a significantly higher percentage than in the pre-pyloric spleen. Importantly, J chain expression is not restricted to the B-cell compartment since gut epithelial cells also express J chain. These results improve our current view of J chain from a phylogenetic perspective. PMID:23967082

Mapping genes to human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah

1996-05-01

For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

Blastic natural killer cell leukaemia in a dog--a case report.

PubMed

Bonkobara, Makoto; Saito, Taro; Yamashita, Masahiro; Tamura, Kyoichi; Yagihara, Hiroko; Isotani, Mayu; Sato, Takashi; Washizu, Tsukimi

2007-11-01

A case of canine non-T, non-B lymphoid leukaemia was determined to be of natural killer (NK) cell lineage by detecting specific expression of canine CD56 mRNA by reverse transcriptase polymerase chain reaction analysis. Although NK cells are usually considered to be morphologically large granular lymphocytes, the malignant NK cells in this case were agranular and blast-like, resembling human blastic NK cell leukaemia. The prognosis of human NK cell leukaemia is usually poor. In this case, the dog died 10 days after initial presentation, despite chemotherapy.

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.

Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

PubMed

Walker, J; Tait, A

1997-11-01

A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

High temperature kinetic study of the reactions H + O2 = OH + O and O + H2 = OH + H in H2/O2 system by shock tube-laser absorption spectroscopy

NASA Technical Reports Server (NTRS)

Ryu, Si-Ok; Hwang, Soon Muk; Dewitt, Kenneth J.

1995-01-01

The reactions: (1) H + O2 = OH + O; and (2) O + H2 = OH + H are the most important elementary reactions in gas phase combustion. They are the main chain-branching reaction in the oxidation of H2 and hydrocarbon fuels. In this study, rate coefficients of the reactions and have been measured over a wide range of composition, pressure, density and temperature behind the reflected shock waves. The experiments were performed using the shock tube - laser absorption spectroscopic technique to monitor OH radicals formed in the shock-heated H2/O2/Ar mixtures. The OH radicals were detected using the P(1)(5) line of (0,0) band of the A(exp 2) Sigma(+) from X(exp 2) Pi transition of OH at 310.023 nm (air). The data were analyzed with the aid of computer modeling. In the experiments great care was exercised to obtain high time resolution, linearity and signal-to-noise. The results are well represented by the Arrhenius expressions. The rate coefficient expression for reaction (1) obtained in this study is k(1) = (7.13 +/- 0.31) x 10(exp 13) exp(-6957+/- 30 K/T) cu cm/mol/s (1050 K less than or equal to T less than or equal to 2500 K) and a consensus expression for k(1) from a critical review of the most recent evaluations of k(1) (including our own) is k(1) = 7.82 x 10(exp 13) exp(-7105 K/T) cu cm/mol/s (960 K less than or equal to T less than or equal to 5300 K). The rate coefficient expression of k(2) is given by k(2) = (1.88 +/- 0.07) x 10(exp 14) exp(-6897 +/- 53 K/T) cu cm/mol/s (1424 K less than or equal to T less than or equal to 2427 K). For k(1), the temperature dependent A-factor and the correlation between the values of k(1) and the inverse reactant densities were not found. In the temperature range of this study, non-Arrhenius expression of k(2) which shows the upward curvature was not supported.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Expression of Cytochrome P450s in the Liver of Rats Administered with Socheongryong-tang, a Traditional Herbal Formula

PubMed Central

Jin, Seong Eun; Ha, Hyekyung; Seo, Chang-Seob; Shin, Hyeun-Kyoo; Jeong, Soo-Jin

2016-01-01

Objective: The purpose of this study was to investigate the potential influences of Socheongryong-tang (SCRT) on the messenger ribonucleic acid (mRNA) and protein expression of cytochrome P450 (CYP450) in vivo. Materials and Methods: SCRT was orally administered to either male or female Sprague-Dawley rats once daily at doses of 0, 1000, 2000, or 5000 mg/kg/day for 13 weeks. The mRNA expression of CYP450s (CYP1A1, 1A2, 2B1/2, 2C11, 2E1, 3A1, 3A2, and 4A1) in liver tissues was measured by reverse transcription polymerase chain reaction. And then, the protein expression of CYP1A1 and CYP2B1/2 in liver tissues was analyzed by the Western blot. Results: We found no significant influence in the mRNA expression of hepatic CYP1A2, 2C11, 2E1, 3A1, 3A2, and 4A1 after repeated administration of SCRT for 13 weeks. By contrast, the mRNA and protein expression of hepatic CYP1A1 was increased by repeated SCRT treatment in male rats, but not in female rats. The mRNA and protein expression of hepatic CYP2B1/2 in both genders was increased by administration of SCRT. Conclusion: A caution is needed when SCRT is co-administered with substrates of CYP2B1/2 for clinical usage. In case of male, an attention is also required when SCRT and drugs metabolized by CYP1A1 are taken together. Our findings provide information regarding the safety and effectiveness of SCRT when combined with conventional drugs. SUMMARY Oral administration of Socheongryong-tang for 13 weeks did not affect the mRNA expression of hepatic CYP1A2, 2C11, 2E1, 3A1, 3A2, and 4A1In male rats, oral administration of Socheongryong-tang for 13 weeks induced the mRNA and protein expression of hepatic CYP1A1 and CYP2B1/2In female rats, oral administration of Socheongryong-tang for 13 weeks induced the mRNA and protein expression of hepatic CYP2B1/2. Abbreviations used: SCRT: Socheongryong-tang, CYP450: Cytochrome P450, HPLC: High performance liquid chromatography, RT-PCR: Reverse transcription polymerase chain reaction. PMID:27601852

Single-Cell RT-PCR in Microfluidic Droplets with Integrated Chemical Lysis.

PubMed

Kim, Samuel C; Clark, Iain C; Shahi, Payam; Abate, Adam R

2018-01-16

Droplet microfluidics can identify and sort cells using digital reverse transcription polymerase chain reaction (RT-PCR) signals from individual cells. However, current methods require multiple microfabricated devices for enzymatic cell lysis and PCR reagent addition, making the process complex and prone to failure. Here, we describe a new approach that integrates all components into a single device. The method enables controlled exposure of isolated single cells to a high pH buffer, which lyses cells and inactivates reaction inhibitors but can be instantly neutralized with RT-PCR buffer. Using our chemical lysis approach, we distinguish individual cells' gene expression with data quality equivalent to more complex two-step workflows. Our system accepts cells and produces droplets ready for amplification, making single-cell droplet RT-PCR faster and more reliable.

Real-time polymerase chain reaction analysis of MDM2 and CDK4 expression using total RNA from core-needle biopsies is useful for diagnosing adipocytic tumors

PubMed Central

2014-01-01

Background Diagnosing adipocytic tumors can be challenging because it is often difficult to morphologically distinguish between benign, intermediate and malignant adipocytic tumors, and other sarcomas that are histologically similar. Recently, a number of tumor-specific chromosome translocations and associated fusion genes have been identified in adipocytic tumors and atypical lipomatous tumors/well-differentiated liposarcomas (ALT/WDL), which have a supernumerary ring and/or giant chromosome marker with amplified sequences of the MDM2 and CDK4 genes. The purpose of this study was to investigate whether quantitative real-time polymerase chain reaction (PCR) could be used to amplify MDM2 and CDK4 from total RNA samples obtained from core-needle biopsy sections for the diagnosis of ALT/WDL. Methods A series of lipoma (n = 124) and ALT/WDL (n = 44) cases were analyzed for cytogenetic analysis and lipoma fusion genes, as well as for MDM2 and CDK4 expression by real-time PCR. Moreover, the expression of MDM2 and CDK4 in whole tissue sections was compared with that in core-needle biopsy sections of the same tumor in order to determine whether real-time PCR could be used to distinguish ALT/WDL from lipoma at the preoperative stage. Results In whole tissue sections, the medians for MDM2 and CDK4 expression in ALT/WDL were higher than those in the lipomas (P < 0.05). Moreover, karyotype subdivisions with rings and/or giant chromosomes had higher MDM2 and CDK4 expression levels compared to karyotypes with 12q13-15 rearrangements, other abnormal karyotypes, and normal karyotypes (P < 0.05). On the other hand, MDM2 and CDK4 expression levels in core-needle biopsy sections were similar to those in whole-tissue sections (MDM2: P = 0.6, CDK4: P = 0.8, Wilcoxon signed-rank test). Conclusion Quantitative real-time PCR of total RNA can be used to evaluate the MDM2 and CDK4 expression levels in core-needle biopsies and may be useful for distinguishing ALT/WDL from adipocytic tumors. Thus, total RNA from core-needle biopsy sections may have potential as a routine diagnostic tool for other tumors where gene overexpression is a feature of the tumor. PMID:24965044

Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

PubMed Central

Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

2015-01-01

Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

The influence of TLR4 agonist lipopolysaccharides on hepatocellular carcinoma cells and the feasibility of its application in treating liver cancer.

PubMed

Gu, Junsheng; Sun, Ranran; Shen, Shen; Yu, Zujiang

2015-01-01

This study was designed to explore the influence of Toll-like receptor 4 (TLR4) agonist lipopolysaccharides (LPS) on liver cancer cell and the feasibility to perform liver cancer adjuvant therapy. Human liver cancer cell lines HepG2, H7402, and PLC/PRF/5 were taken as models, and the expression of TLRs mRNA was detected by real time-polymerase chain reaction method semiquantitatively. WST-1 method was used to detect the influence of LPS on the proliferation ability of liver cancer cells; propidium iodide (PI) single staining and Annexin V/PI double staining were used to test the influence of LPS on the cell cycle and apoptosis, respectively, on human liver cancer cell line H7402. Fluorescent quantitative polymerase chain reaction and Western blot method were used to determine the change of expression of Cyclin D1. The results demonstrated that most TLRs were expressed in liver cancer cells; stimulating TLR4 by LPS could upregulate TLR4 mRNA and the protein level, activate NF-κB signaling pathway downstream of TLR4, and mediate the generation of inflammatory factors IL-6, IL-8, and TNF-α; LPS was found to be able to strengthen the proliferation ability of liver cancer cells, especially H7402 cells; the expression of Cyclin D1 rose and H7402 cells were promoted to transit from G1 stage to S stage under the stimulation of LPS, but cell apoptosis was not affected. It was also found that LPS was able to activate signal transducer and activator of transcription -3 (STAT3) signaling pathway in H7402 cells and meanwhile significantly increase the initiation activity of STAT3; proliferation promoting effect of LPS to liver cancer cells remarkably lowered once STAT3 was blocked or inhibited. Thus, TLR4 agonist LPS is proved to be able to induce liver cancer cells to express inflammation factors and mediate liver cancer cell proliferation and generation of multidrug resistance by activating the cyclooxygenase-2/prostaglandin signal axis as well as the STAT3 pathway.

Expression of macrophage migration inhibitory factor in footpad skin lesions with diabetic neuropathy.

PubMed

Up Noh, Sun; Lee, Won-Young; Kim, Won-Serk; Lee, Yong-Taek; Jae Yoon, Kyung

2018-01-01

Background Diabetic neuropathy originating in distal lower extremities is associated with pain early in the disease course, overwhelming in the feet. However, the pathogenesis of diabetic neuropathy remains unclear. Macrophage migration inhibitory factor has been implicated in the onset of neuropathic pain and the development of diabetes. Objective of this study was to observe pain syndromes elicited in the footpad of diabetic neuropathy rat model and to assess the contributory role of migration inhibitory factor in the pathogenesis of diabetic neuropathy. Methods Diabetic neuropathy was made in Sprague Dawley rats by streptozotocin. Pain threshold was evaluated using von Frey monofilaments for 24 weeks. On comparable experiment time after streptozotocin injection, all footpads were prepared for following procedures; glutathione assay, terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling staining, immunohistochemistry staining, real-time reverse transcription polymerase chain reaction, and Western blot. Additionally, human HaCaT skin keratinocytes were treated with methylglyoxal, transfected with migration inhibitory factor/control small interfering RNA, and prepared for real-time reverse transcription polymerase chain reaction and Western blot. Results As compared to sham group, pain threshold was significantly reduced in diabetic neuropathy group, and glutathione was decreased in footpad skin, simultaneously, cell death was increased. Over-expression of migration inhibitory factor, accompanied by low expression of glyoxalase-I and intraepidermal nerve fibers, was shown on the footpad skin lesions of diabetic neuropathy. But, there was no significance in expression of neurotransmitters and inflammatory mediators such as transient receptor potential vanilloid 1, mas-related G protein coupled receptor D, nuclear factor kappa B, tumor necrosis factor-alpha, and interleukin-6 between diabetic neuropathy group and sham group. Intriguingly, small interfering RNA-transfected knockdown of the migration inhibitory factor gene in methylglyoxal-treated skin keratinocytes increased expression of glyoxalase-I and intraepidermal nerve fibers in comparison with control small interfering RNA-transfected cells, which was decreased by induction of methylglyoxal. Conclusions Our findings suggest that migration inhibitory factor can aggravate diabetic neuropathy by suppressing glyoxalase-I and intraepidermal nerve fibers on the footpad skin lesions and provoke pain. Taken together, migration inhibitory factor might offer a pharmacological approach to alleviate pain syndromes in diabetic neuropathy.

Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

PubMed Central

Tanaka, Yohei; Nakayama, Jun

2016-01-01

Background and objective Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. Materials and methods DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths. Results A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05). Conclusion We found that NIR irradiation induced the upregulated expression of EGFR in human corneal cells. Since over half of the solar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage. PMID:27536083

Overexpression of Both ERG11 and ABC2 Genes Might Be Responsible for Itraconazole Resistance in Clinical Isolates of Candida krusei

PubMed Central

He, Xiaoyuan; Zhao, Mingfeng; Chen, Jinyan; Wu, Rimao; Zhang, Jianlei; Cui, Rui; Jiang, Yanyu; Chen, Jie; Cao, Xiaoli; Xing, Yi; Zhang, Yuchen; Meng, Juanxia; Deng, Qi; Sui, Tao

2015-01-01

Objective To study the main molecular mechanisms responsible for itraconazole resistance in clinical isolates of Candida krusei. Methods The 14α-demethylases encoded by ERG11 gene in the 16 C.krusei clinical isolates were amplified by polymerase chain reaction (PCR), and their nucleotide sequences were determined to detect point mutations. Meanwhile, ERG11 and efflux transporters (ABC1 and ABC2) genes were determined by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) for their expression in itraconazole-resistant (R), itraconazole-susceptible dose dependent (SDD) and itraconazole-susceptible (S) C.krusei at the mRNA level. Results We found 7-point mutations in ERG11 gene of all the C.krusei clinical isolates, including 6 synonymous mutations and 1 missense mutation (C44T). However, the missense mutation was found in the three groups. The mRNA levels of ERG11 gene in itraconazole-resistant isolates showed higher expression compared with itraconazole-susceptible dose dependent and itraconazole-susceptible ones (P = 0.015 and P = 0.002 respectively). ABC2 gene mRNA levels in itraconazole-resistant group was significantly higher than the other two groups, and the levels of their expression in the isolates appeared to increase with the decrease of susceptibility to itraconazole (P = 0.007 in SDD compared with S, P = 0.016 in SDD with R, and P<0.001 in S with R respectively). While ABC1 gene presented lower expression in itraconazole resistant strains. However, the mRNA levels of ERG11, ABC1 and ABC2 in a C.krusei (CK10) resistant to both itraconazole and voriconazole were expressed highest in all the itraconazole-resistant isolates. Conclusions There are ERG11 gene polymorphisms in clinical isolates of C.krusei. ERG11 gene mutations may not be involved in the development of itraconazole resistance in C.krusei. ERG11 and ABC2 overexpression might be responsible for the acquired itraconazole resistance of these clinical isolates. PMID:26308936

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

PubMed

Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

2002-10-15

Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

Cerebellin in the rat adrenal gland: gene expression and effects of CER and [des-Ser1]CER on the secretion and growth of cultured adrenocortical cells.

PubMed

Rucinski, Marcin; Albertin, Giovanna; Spinazzi, Raffaella; Ziolkowska, Agnieszka; Nussdorfer, Gastone G; Malendowicz, Ludwick K

2005-03-01

Cerebellin (CER) is a regulatory peptide, originally isolated from rat cerebellum, which derives from the cleavage of precerebellin (Cbln), three types of which (Cbln1-3) have been identified in humans and rats. CER is also expressed in several extra-cerebellar tissues, including adrenal gland, and evidence has been provided that CER exerts a modulatory action on human and rat adrenal gland. Hence, we have investigated the expression of Cbln1-3 mRNAs and CER protein-immunoreactivity (IR) in the various zones of rat adrenal glands, and the effects of CER and its metabolite [des-Ser(1)]CER (des-CER) on the secretion and growth of cultured rat adrenocortical cells. Reverse transcription-polymerase chain reaction showed high and low expression of Cbln2 mRNA in zona glomerulosa (ZG) and zona fasciculata-reticularis, respectively. Cbln1 was not expressed, and Cbln3 mRNA was detected only in ZG. No Cbln expression was found in adrenal medulla. Immunocytochemistry demonstrated the presence of CER-IR exclusively in the adrenal cortex, the reaction being more intense in ZG. As expected, ACTH (10(-8) M) markedly enhanced corticosterone secretion and lowered proliferation rate of cultured adrenocortical cells. CER was ineffective, while des-CER exerted an ACTH-like effect, but only at the lowest concentration (10(-10) M). Taken together, these findings allow us to conclude that CER is expressed in rat adrenal cortex, and to suggest that CER conversion to des-CER by endopeptidases is needed for CER to exert its autocrine-paracrine regulatory functions.

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

Subcellular Targeting of Methylmercury Lyase Enhances Its Specific Activity for Organic Mercury Detoxification in Plants1

PubMed Central

Bizily, Scott P.; Kim, Tehryung; Kandasamy, Muthugapatti K.; Meagher, Richard B.

2003-01-01

Methylmercury is an environmental pollutant that biomagnifies in the aquatic food chain with severe consequences for humans and other animals. In an effort to remove this toxin in situ, we have been engineering plants that express the bacterial mercury resistance enzymes organomercurial lyase MerB and mercuric ion reductase MerA. In vivo kinetics experiments suggest that the diffusion of hydrophobic organic mercury to MerB limits the rate of the coupled reaction with MerA (Bizily et al., 2000). To optimize reaction kinetics for organic mercury compounds, the merB gene was engineered to target MerB for accumulation in the endoplasmic reticulum and for secretion to the cell wall. Plants expressing the targeted MerB proteins and cytoplasmic MerA are highly resistant to organic mercury and degrade organic mercury at 10 to 70 times higher specific activity than plants with the cytoplasmically distributed wild-type MerB enzyme. MerB protein in endoplasmic reticulum-targeted plants appears to accumulate in large vesicular structures that can be visualized in immunolabeled plant cells. These results suggest that the toxic effects of organic mercury are focused in microenvironments of the secretory pathway, that these hydrophobic compartments provide more favorable reaction conditions for MerB activity, and that moderate increases in targeted MerB expression will lead to significant gains in detoxification. In summary, to maximize phytoremediation efficiency of hydrophobic pollutants in plants, it may be beneficial to target enzymes to specific subcellular environments. PMID:12586871

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Selective amplification of T-cell receptor variable region species is demonstrable but not essential in early lesions of psoriasis vulgaris: analysis by anchored polymerase chain reaction and hypervariable region size spectratyping.

PubMed

Vekony, M A; Holder, J E; Lee, A J; Horrocks, C; Eperon, I C; Camp, R D

1997-07-01

Several groups have investigated the role of T cells in the pathogenesis of psoriasis by determination of T-cell receptor (TCR) B-chain variable (V) region usage, both in chronic plaque (psoriasis vulgaris) and guttate forms, with various results. Because there are no data on TCR expression in early psoriasis vulgaris, when specific cellular immune events may be expected to be most pronounced, we have analyzed early lesions (less than 3 wk old) of ten patients, with highly reproducible results. We have developed a highly controlled anchored polymerase chain reaction (PCR) method in which TCR beta chain species are all amplified with the same primer pair and products are quantified by dot blot hybridization with BV family-specific oligonucleotide probes. Overexpression of certain TCR BV genes was observed in the majority of lesional biopsies, but in samples in which the expanded BV family formed more than 10% of total lesional BV (half of the samples analyzed), BV2 and BV6 predominated. The consistency of overexpression of these BV species between patients was much less than in previous studies of TCRBV usage in established chronic plaque psoriasis lesions. Complementarity-determining region 3 (CDR3) size spectratyping demonstrated evidence for selective clonal T cell accumulation in less than half of the lesional samples showing BV expansion. These results indicate that selective amplification of TCRBV species occurs in early psoriasis vulgaris but is not essential to the pathogenic process and may be more important in the maintenance or expansion of chronic lesions.

G Protein-Coupled Estrogen Receptor (GPER) Expression in Normal and Abnormal Endometrium

PubMed Central

Lessey, Bruce A.; Taylor, Robert N.; Wang, Wei; Bagchi, Milan K.; Yuan, Lingwen; Scotchie, Jessica; Fritz, Marc A.; Young, Steven L.

2012-01-01

Rapid estrogen effects are mediated by membrane receptors, and evidence suggests a role for both a membrane-associated form of estrogen receptor alpha (ESR1; ERα) and G-protein coupled receptor 30 (GPER; GPR30). Considering estrogen’s importance in endometrial physiology and endometriosis pathophysiology, we hypothesized that GPER could be involved in both cyclic changes in endometrial estrogen action and that aberrant expression might be seen in the eutopic endometrium of women with endometriosis. Using real-time reverse transcriptase–polymerase chain reaction (RT-PCR) and immunohistochemical analysis of normal endometrium, endometrial samples demonstrated cycle-regulated expression of GPER, with maximal expression in the proliferative phase. Eutopic and ectopic endometrium from women with endometriosis overexpressed GPER as compared to eutopic endometrium of normal participants. Ishikawa cells, an adenocarcinoma cell line, expressed GPER, with increased expression upon treatment with estrogen or an ESR1 agonist, but not with a GPER-specific agonist. Decreased expression was seen in Ishikawa cells stably transfected with progesterone receptor A. Together, these data suggest that normal endometrial GPER expression is cyclic and regulated by nuclear estrogen and progesterone receptors, while expression is dysregulated in endometriosis. PMID:22378861

G protein-coupled estrogen receptor (GPER) expression in normal and abnormal endometrium.

PubMed

Plante, Beth J; Lessey, Bruce A; Taylor, Robert N; Wang, Wei; Bagchi, Milan K; Yuan, Lingwen; Scotchie, Jessica; Fritz, Marc A; Young, Steven L

2012-07-01

Rapid estrogen effects are mediated by membrane receptors, and evidence suggests a role for both a membrane-associated form of estrogen receptor alpha (ESR1; ERα) and G-protein coupled receptor 30 (GPER; GPR30). Considering estrogen's importance in endometrial physiology and endometriosis pathophysiology, we hypothesized that GPER could be involved in both cyclic changes in endometrial estrogen action and that aberrant expression might be seen in the eutopic endometrium of women with endometriosis. Using real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical analysis of normal endometrium, endometrial samples demonstrated cycle-regulated expression of GPER, with maximal expression in the proliferative phase. Eutopic and ectopic endometrium from women with endometriosis overexpressed GPER as compared to eutopic endometrium of normal participants. Ishikawa cells, an adenocarcinoma cell line, expressed GPER, with increased expression upon treatment with estrogen or an ESR1 agonist, but not with a GPER-specific agonist. Decreased expression was seen in Ishikawa cells stably transfected with progesterone receptor A. Together, these data suggest that normal endometrial GPER expression is cyclic and regulated by nuclear estrogen and progesterone receptors, while expression is dysregulated in endometriosis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Expression profile of Lgi1 gene in mouse brain during development.

PubMed

Ribeiro, Patrícia A O; Sbragia, Lourenço; Gilioli, Rovilson; Langone, Francesco; Conte, Fábio F; Lopes-Cendes, Iscia

2008-07-01

Mutations in LGI1 were described in patients with autosomal dominant partial epilepsy with auditory features (ADPEAF), and recent clinical findings have implicated LGI1 in human brain development. However, the precise role of LGI1 in epileptogenesis remains largely unknown. The objective of this study was to determine the expression pattern of Lgi1 in mice brain during development and in adult animals. Real-time polymerase chain reaction (PCR) quantification and Western blot experiments showed a relative low expression during intrauterine stages, increasing until adulthood. In addition, we did not find significant differences between left and right hemispheres. The hippocampus presented higher levels of Lgi1 expression when compared to the neocortex and the cerebellum of adult animals; however, these results did not reach statistical significance. This study was the first to determine a specific profile of Lgi1 gene expression during central nervous system development, which suggests a possible inhibitory function in latter stages of development. In addition, we did not find differences in hemispheric expression that could explain the predominance of left-sided abnormalities in patients with ADPEAF.

[Research of expression of L-DOPA decarboxylase in laryngeal cancer].

PubMed

Lai, Shisheng; Wan, Zhili

2014-12-01

This study aimed to investigate the expression levels of L-DOPA decarboxylase (DDC) mRNA and protein in laryngeal cancer, and to determine the clinical significance of DDC in diagnosis and prognosis of laryngeal cancer. Total RNA was isolated from 106 tissue samples surgically removed from 53 laryngeal cancer patients. A quantitative real-time polymerase chain reaction (RT-PCR) methodology based on SYBR Green I fluorescent dye was developed for the quantification of mRNA levels. In addition, Western Blot analysis was performed to detect the expression level of DDC protein. DDC mRNA expression in both primary (P= 0. 000) and recurrent (P=0. 033) laryngeal cancer samples downregulated significantly compared with their nonmalignant counterparts. Moreover, expression of DDC mRNA was not associated with age and histologic grade, but the significantly decreased mRNA were correlated with early TMN stage (P=0. 021). Additionally, DDC protein was detected in both cancerous and noncancerous tissues. Expression levels of DDC may play a vital role in the progression of laryngeal cancer, which can be served as a promising biomarker for the future clinical management of laryngeal cancer patients.

Effects of Ghrelin miRNA on Inflammation and Calcium Pathway in Pancreatic Acinar Cells of Acute Pancreatitis.

PubMed

Tang, Xiping; Tang, Guodu; Liang, Zhihai; Qin, Mengbin; Fang, Chunyun; Zhang, Luyi

The study investigated the effects of endogenous targeted inhibition of ghrelin gene on inflammation and calcium pathway in an in vitro pancreatic acinar cell model of acute pancreatitis. Lentiviral expression vector against ghrelin gene was constructed and transfected into AR42J cells. The mRNA and protein expression of each gene were detected by reverse transcription polymerase chain reaction, Western blotting, or enzyme-linked immunosorbent assay. The concentration of intracellular calcium ([Ca]i) was determined by calcium fluorescence mark probe combined with laser scanning confocal microscopy. Compared with the control group, cerulein could upregulate mRNA and protein expression of inflammatory factors, calcium pathway, ghrelin, and [Ca]i. mRNA and protein expression of inflammatory factors increased significantly in cells transfected with ghrelin miRNA compared with the other groups. Intracellular calcium and expression of some calcium pathway proteins decreased significantly in cells transfected with ghrelin miRNA compared with the other groups. Targeted inhibition of ghrelin gene in pancreatic acinar cells of acute pancreatitis can upregulate the expression of the intracellular inflammatory factors and alleviate the intracellular calcium overload.

The prognostic implications of growth-related gene product β in laryngeal squamous cell carcinoma.

PubMed

Tang, Mingming; Xu, Xinjiang; Chen, Juanjuan; Huang, Jiangfei; Jiang, Bin; Han, Liang

2017-09-01

Growth-related gene product β (GROβ) is an angiogenic chemokine that belongs to the CXC chemokine family, and a number of studies have suggested that GROβ is associated with tumor development and progression. However, a number of studies have investigated the association between GROβ expression and the clinical attributes of laryngeal squamous cell carcinoma (LSCC). In the present study, one-step quantitative polymerase chain reaction and immunohistochemistry analysis were used to detect GROβ expression and evaluate the association between its expression and the clinicopathological characteristics of LSCC. The results demonstrated that the GROβ mRNA and protein expression levels were significantly increased in LSCC compared with the corresponding non-cancerous tissues. GROβ protein expression in LSCC was associated with tumor-node-metastasis stage, lymph node metastasis and histopathological grade. The Kaplan-Meier method and Cox multi-factor analysis indicated that high GROβ expression, lymph node metastasis and histopathological grade were significantly associated with poor survival of patients with LSCC. These data indicated that GROβ may be a novel prognostic biomarker of LSCC.

Gene expression-based biological test for major depressive disorder: an advanced study.

PubMed

Watanabe, Shin-Ya; Numata, Shusuke; Iga, Jun-Ichi; Kinoshita, Makoto; Umehara, Hidehiro; Ishii, Kazuo; Ohmori, Tetsuro

2017-01-01

Recently, we could distinguished patients with major depressive disorder (MDD) from nonpsychiatric controls with high accuracy using a panel of five gene expression markers ( ARHGAP24, HDAC5, PDGFC, PRNP , and SLC6A4 ) in leukocyte. In the present study, we examined whether this biological test is able to discriminate patients with MDD from those without MDD, including those with schizophrenia and bipolar disorder. We measured messenger ribonucleic acid expression levels of the aforementioned five genes in peripheral leukocytes in 17 patients with schizophrenia and 36 patients with bipolar disorder using quantitative real-time polymerase chain reaction (PCR), and we combined these expression data with our previous expression data of 25 patients with MDD and 25 controls. Subsequently, a linear discriminant function was developed for use in discriminating between patients with MDD and without MDD. This expression panel was able to segregate patients with MDD from those without MDD with a sensitivity and specificity of 64% and 67.9%, respectively. Further research to identify MDD-specific markers is needed to improve the performance of this biological test.

Progesterone receptor isoforms expression pattern in the rat brain during the estrous cycle.

PubMed

Guerra-Araiza, C; Cerbón, M A; Morimoto, S; Camacho-Arroyo, I

2000-03-24

Progesterone receptor (PR) isoforms expression was determined in the hypothalamus, the preoptic area, the hippocampus and the frontal cerebral cortex of the rat at 12:00 h on each day of the estrous cycle by using reverse transcription coupled to polymerase chain reaction. Rats under a 14:10 h light-dark cycle, with lights on at 06:00 h were used. We found that PR-B isoform was predominant in the hypothalamus, the preoptic area and the frontal cerebral cortex. Both PR isoforms were similarly expressed in the hippocampus. The highest PR-B expression was found on proestrus day in the hypothalamus; on metestrus in the preoptic area; and on diestrus in the frontal cortex. We observed no changes in PR isoforms expression in the hippocampus during the estrous cycle. These results indicate that PR isoforms expression is differentially regulated during the estrous cycle in distinct brain regions and that PR-B may be involved in progesterone actions upon the hypothalamus, the preoptic area and the frontal cortex of the rat.

Decreased TIM-3 mRNA expression in peripheral blood mononuclear cells from nephropathy patients.

PubMed

Cai, X Z; Liu, N; Qiao, Y; Du, S Y; Chen, Y; Chen, D; Yu, S; Jiang, Y

2015-06-12

Increasing evidence shows that TIM-1 and TIM-3 in-fluence chronic autoimmune diseases, and their expression levels in immune cells from nephritic patients are still unknown. Real-time transcription-polymerase chain reaction analysis was used to deter-mine expression levels of TIM-1 and TIM-3 mRNA in peripheral blood mononuclear cells (PBMCs) from 36 patients with minimal change glo-merulopathy (MCG), 65 patients with lupus nephritis (LN), 78 patients with IgA nephropathy (IgAN), 55 patients with membranous nephropa-thy (MN), 22 patients with crescentic glomerulonephritis (CGN), 26 patients with anaphylactoid purpura nephritis (APN), and 63 healthy controls. TIM-3 mRNA expression significantly decreased in PBMCs from nephritic patients (LN, P < 0.0001; MCG, P < 0.0001; MN, P = 0.0031; CGN, P = 0.0464; IgAN, P = 0.0002; APN, P = 0.0392) com-pared with healthy controls. In contrast, there was no significant differ-ence in TIM-1 mRNA expression between the patients and the healthy controls. Our results suggest that insufficient expression of TIM-3 mRNA may be involved in the pathogenesis of nephropathy.

Expression of microRNA-181 determines response to treatment with azacitidine and predicts survival in elderly patients with acute myeloid leukaemia.

PubMed

Butrym, Aleksandra; Rybka, Justyna; Baczyńska, Dagmara; Poręba, Rafał; Mazur, Grzegorz; Kuliczkowski, Kazimierz

2016-10-01

MicroRNAs (miRs) are small non-coding RNAs that play important roles in cell differentiation and survival. Abnormal expression of miRs has been demonstrated in numerous types of cancer, including acute myeloid leukaemia (AML). The aim of the present study was to evaluate miR-181 expression at diagnosis and following the completion of chemotherapy in AML patients, with regard to clinical response and outcome, particularly in patients treated with azacitidine. miR-181 expression was analysed using reverse transcription-quantitative polymerase chain reaction in 95 bone marrow specimens from newly diagnosed AML patients and in 20 healthy subjects for comparison. The results revealed upregulated miR-181 expression in the total cohort of AML patients, which was correlated with longer survival. However, in a subset of older AML patients treated with azacitidine, low miR-181 expression at diagnosis was a predictor for complete remission and prolonged survival. The findings indicated that miR-181 has an important role in AML and determines response to azacitidine treatment in older AML patients.

Expression of microRNA-181 determines response to treatment with azacitidine and predicts survival in elderly patients with acute myeloid leukaemia

PubMed Central

Butrym, Aleksandra; Rybka, Justyna; Baczyńska, Dagmara; Poręba, Rafał; Mazur, Grzegorz; Kuliczkowski, Kazimierz

2016-01-01

MicroRNAs (miRs) are small non-coding RNAs that play important roles in cell differentiation and survival. Abnormal expression of miRs has been demonstrated in numerous types of cancer, including acute myeloid leukaemia (AML). The aim of the present study was to evaluate miR-181 expression at diagnosis and following the completion of chemotherapy in AML patients, with regard to clinical response and outcome, particularly in patients treated with azacitidine. miR-181 expression was analysed using reverse transcription-quantitative polymerase chain reaction in 95 bone marrow specimens from newly diagnosed AML patients and in 20 healthy subjects for comparison. The results revealed upregulated miR-181 expression in the total cohort of AML patients, which was correlated with longer survival. However, in a subset of older AML patients treated with azacitidine, low miR-181 expression at diagnosis was a predictor for complete remission and prolonged survival. The findings indicated that miR-181 has an important role in AML and determines response to azacitidine treatment in older AML patients. PMID:27698792

Arctigenin from Arctium lappa inhibits interleukin-2 and interferon gene expression in primary human T lymphocytes.

PubMed

Tsai, Wei-Jern; Chang, Chu-Ting; Wang, Guei-Jane; Lee, Tzong-Huei; Chang, Shwu-Fen; Lu, Shao-Chun; Kuo, Yuh-Chi

2011-03-25

Arctium lappa (Niubang), a Chinese herbal medicine, is used to treat tissue inflammation. This study investigates the effects of arctigenin (AC), isolated from A. lappa, on anti-CD3/CD28 Ab-stimulated cell proliferation and cytokine gene expression in primary human T lymphocytes. Cell proliferation was determined with enzyme immunoassays and the tritiated thymidine uptake method. Cytokine production and gene expression were analyzed with reverse transcription-polymerase chain reaction. AC inhibited primary human T lymphocytes proliferation activated by anti-CD3/CD28 Ab. Cell viability test indicated that the inhibitory effects of AC on primary human T lymphocyte proliferation were not due to direct cytotoxicity. AC suppressed interleukin-2 (IL-2) and interferon-γ (IFN-γ) production in a concentration-dependent manner. Furthermore, AC decreased the IL-2 and IFN-γ gene expression in primary human T lymphocytes induced by anti-CD3/CD28 Ab. Reporter gene analyses revealed that AC decreased NF-AT-mediated reporter gene expression. AC inhibited T lymphocyte proliferation and decreased the gene expression of IL-2, IFN-γ and NF-AT.

Macrophage phenotype in the epigallocatechin-3-gallate (EGCG)-modified collagen determines foreign body reaction.

PubMed

Chu, Chenyu; Liu, Li; Wang, Yufei; Wei, Shimin; Wang, Yuanjing; Man, Yi; Qu, Yili

2018-04-28

Collagen has been widely used in guided bone regeneration, and the implantation of collagen membranes will elicit the foreign body reaction (FBR). The imbalance of FBR often leads to failure of dental implants. Therefore, modulation of the FBR after implantation of collagen membranes becomes increasingly important. Macrophages, pivotal in FBR, have been distinguished into pro-inflammatory (M1) and anti-inflammatory (M2) phenotypes. Epigallocatechin-3-gallate (EGCG)-modified collagen membranes have been previously shown to regulate secretion of inflammatory factors. In this study, immunohistochemistry of CD31 showed that areas of blood vessels were significantly enlarged after implantation of EGCG-modified collagen membranes compared with those treated with pure collagen membranes. Besides, haematoxylin-eosin staining and immunofluorescence showed an increased number of M2 macrophages after implantation of EGCG-modified collagen membranes. In addition, quantitative real-time polymerase chain reaction showed that after implantation of EGCG-modified collagen membranes, expression of CXCL1 (predominant chemoattractants to neutrophils and inflammation promotors) was significantly downregulated, whereas expressions of STAB1, CCR2, CCR3, CCL2, and CCL3 (related to M2 macrophages) were significantly upregulated. From these findings, we conclude that EGCG-modified collagen membranes were able to regulate the recruitment and polarization of macrophages, so that ameliorate FBR. Copyright © 2018 John Wiley & Sons, Ltd.

Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

PubMed

Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

2006-01-01

Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

High-Throughput RT-PCR for small-molecule screening assays

PubMed Central

Bittker, Joshua A.

2012-01-01

Quantitative measurement of the levels of mRNA expression using real-time reverse transcription polymerase chain reaction (RT-PCR) has long been used for analyzing expression differences in tissue or cell lines of interest. This method has been used somewhat less frequently to measure the changes in gene expression due to perturbagens such as small molecules or siRNA. The availability of new instrumentation for liquid handling and real-time PCR analysis as well as the commercial availability of start-to-finish kits for RT-PCR has enabled the use of this method for high-throughput small-molecule screening on a scale comparable to traditional high-throughput screening (HTS) assays. This protocol focuses on the special considerations necessary for using quantitative RT-PCR as a primary small-molecule screening assay, including the different methods available for mRNA isolation and analysis. PMID:23487248

Effects of electromagnetic pulse irradiation on the mouse blood-testicle barrier.

PubMed

Hou, Wu-Gang; Zhao, Jie; Li, Zhen; Li, Wei; Li, Teng; Xiong, Li-Ze; Zhang, Yuan-Qiang

2012-07-01

To investigate the effects of electromagnetic pulse irradiation on the mouse blood-testicle barrier (BTB) and spermatogenesis. After whole body irradiation with 400 kV/m electromagnetic pulse irradiation, the mouse testicles and BTB permeability were observed using hematoxylin-eosin, Evans blue, and lanthanum nitrate as tracers. The expression of the BTB tight junction protein occludin was examined using real-time polymerase chain reaction and Western blotting. At 1, 7, and 14 days after irradiation, the BTB structure was damaged, the BTB permeability was significantly increased, numerous apoptotic or necrotic spermatogenic cells were found in the lumen, and the mRNA and protein expression levels of occludin were markedly decreased. The BTB structure and occludin expression levels had gradually recovered by 21 and 28 days after irradiation. Electromagnetic pulse irradiation damaged the structure and function of mouse BTB, resulting in apoptosis or necrosis of the spermatogenic cells. Copyright © 2012 Elsevier Inc. All rights reserved.

Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

2006-08-01

A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

Human telomerase reverse transcriptase is a promising target for cancer inhibition in squamous cell carcinomas.

PubMed

Park, Young-Jin; Kim, Eun-Kyoung; Moon, Sook; Hong, Doo-Pyo; Bae, Jung Yoon; Kim, Jin

2014-11-01

The present study aimed to investigate whether the down-regulation of human telomerase reverse transcriptase (hTERT) may induce an anti-invasive effect in oral squamous cell cancer cell lines. A genetically-engineered squamous carcinoma cell line overexpressing hTERT in immortalized oral keratinocytes transfected by human papilloma virus (HPV)-16 E6/E7 (IHOK) was used. In vivo tumorigenicity was examined using an orthotopic xenograft model of nude mice. For evaluating anti-invasive activity by knockdown of hTERT expression, transwell invasion assay and real-time polymerase chain reaction (PCR) for matrix metalloproteinases (MMP) were employed. The down-regulation of hTERT expression reduced the invasive activity and MMP expression. This result was re-confirmed in the HSC3 oral squamous carcinoma cell line. Targeting hTERT may lead to novel therapeutic approaches. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Isolation, sequence identification and tissue expression profiles of 3 novel porcine genes: ASPA, NAGA, and HEXA.

PubMed

Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa

2008-01-01

The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Purification, Characterization, and Potential Bacterial Wax Production Role of an NADPH-Dependent Fatty Aldehyde Reductase from Marinobacter aquaeolei VT8▿ †

PubMed Central

Wahlen, Bradley D.; Oswald, Whitney S.; Seefeldt, Lance C.; Barney, Brett M.

2009-01-01

Wax esters, ester-linked fatty acids and long-chain alcohols, are important energy storage compounds in select bacteria. The synthesis of wax esters from fatty acids is proposed to require the action of a four-enzyme pathway. An essential step in the pathway is the reduction of a fatty aldehyde to the corresponding fatty alcohol, although the enzyme responsible for catalyzing this reaction has yet to be identified in bacteria. We report here the purification and characterization of an enzyme from the wax ester-accumulating bacterium Marinobacter aquaeolei VT8, which is a proposed fatty aldehyde reductase in this pathway. The enzyme, a 57-kDa monomer, was expressed in Escherichia coli as a fusion protein with the maltose binding protein on the N terminus and was purified to near homogeneity by using amylose affinity chromatography. The purified enzyme was found to reduce a number of long-chain aldehydes to the corresponding alcohols coupled to the oxidation of NADPH. The highest specific activity was observed for the reduction of decanal (85 nmol decanal reduced/min/mg). Short-chain and aromatic aldehydes were not substrates. The enzyme showed no detectable catalysis of the reverse reaction, the oxidation of decanol by NADP+. The mechanism of the enzyme was probed with several site-specific chemical probes. The possible uses of this enzyme in the production of wax esters are discussed. PMID:19270127

Trehalose-Based Block Copolycations Promote Polyplex Stabilization for Lyophilization and in Vivo pDNA Delivery

PubMed Central

2015-01-01

The development and thorough characterization of nonviral delivery agents for nucleic acid and genome editing therapies are of high interest to the field of nanomedicine. Indeed, this vehicle class offers the ability to tune chemical architecture/biological activity and readily package nucleic acids of various sizes and morphologies for a variety of applications. Herein, we present the synthesis and characterization of a class of trehalose-based block copolycations designed to stabilize polyplex formulations for lyophilization and in vivo administration. A 6-methacrylamido-6-deoxy trehalose (MAT) monomer was synthesized from trehalose and polymerized via reversible addition–fragmentation chain transfer (RAFT) polymerization to yield pMAT43. The pMAT43 macro-chain transfer agent was then chain-extended with aminoethylmethacrylamide (AEMA) to yield three different pMAT-b-AEMA cationic-block copolymers, pMAT-b-AEMA-1 (21 AEMA repeats), -2 (44 AEMA repeats), and -3 (57 AEMA repeats). These polymers along with a series of controls were used to form polyplexes with plasmids encoding firefly luciferase behind a strong ubiquitous promoter. The trehalose-coated polyplexes were characterized in detail and found to be resistant to colloidal aggregation in culture media containing salt and serum. The trehalose-polyplexes also retained colloidal stability and promoted high gene expression following lyophilization and reconstitution. Cytotoxicity, cellular uptake, and transfection ability were assessed in vitro using both human glioblastoma (U87) and human liver carcinoma (HepG2) cell lines wherein pMAT-b-AEMA-2 was found to have the optimal combination of high gene expression and low toxicity. pMAT-b-AEMA-2 polyplexes were evaluated in mice via slow tail vein infusion. The vehicle displayed minimal toxicity and discouraged nonspecific internalization in the liver, kidney, spleen, and lungs as determined by quantitative polymerase chain reaction (qPCR) and fluorescence imaging experiments. Hydrodynamic infusion of the polyplexes, however, led to very specific localization of the polyplexes to the mouse liver and promoted excellent gene expression in vivo. PMID:26807438

Molecular cloning of the myo-inositol oxygenase gene from the kidney of baboons

PubMed Central

González-Álvarez, Rafael; Pérez-Ibave, Diana Cristina; Garza-Rodríguez, María Lourdes; Lugo-Trampe, Ángel; Delgado-Enciso, Iván; Tejero-Barrera, María Elizabeth; Martínez-De-Villarreal, Laura Elia; Garza-Guajardo, Raquel; Sánchez-Chaparro, María Marisela; Ruiz-Ayma, Gabriel; Barboza-Quintana, Oralia; Barrera-Saldaña, Hugo Alberto; Rocha-Pizaña, María Del Refugio; Rodríguez-Sánchez, Irám Pablo

2017-01-01

The enzyme myo-Inositol oxygenase (MIOX) is also termed ALDRL6. It is a kidney-specific member of the aldo-keto reductase family. MIOX catalyzes the first reaction involved in the myo-inositol metabolism signaling pathway and is fully expressed in mammalian tissues. MIOX catalyzes the oxidative cleavage of myo-Inositol and its epimer, D-chiro-Inositol to D-glucuronate. The dioxygen-dependent cleavage of the C6 and C1 bond in myo-Inositol is achieved by utilizing the Fe2+/Fe3+ binuclear iron center of MIOX. This enzyme has also been implicated in the complications of diabetes, including diabetic nephropathy. The MIOX gene was amplified with reverse transcription-polymerase chain reaction from baboon tissue samples, and the product was cloned and sequenced. MIOX expression in the baboon kidney is described in the present study. The percentages of nucleotide and amino acid similarities between baboons and humans were 95 and 96%, respectively. The MIOX protein of the baboon may be structurally identical to that of humans. Furthermore, the evolutionary changes, which have affected these sequences, have resulted from purifying forces. PMID:29085625

Molecular cloning of the myo-inositol oxygenase gene from the kidney of baboons.

PubMed

González-Álvarez, Rafael; Pérez-Ibave, Diana Cristina; Garza-Rodríguez, María Lourdes; Lugo-Trampe, Ángel; Delgado-Enciso, Iván; Tejero-Barrera, María Elizabeth; Martínez-De-Villarreal, Laura Elia; Garza-Guajardo, Raquel; Sánchez-Chaparro, María Marisela; Ruiz-Ayma, Gabriel; Barboza-Quintana, Oralia; Barrera-Saldaña, Hugo Alberto; Rocha-Pizaña, María Del Refugio; Rodríguez-Sánchez, Irám Pablo

2017-10-01

The enzyme myo-Inositol oxygenase (MIOX) is also termed ALDRL6. It is a kidney-specific member of the aldo-keto reductase family. MIOX catalyzes the first reaction involved in the myo-inositol metabolism signaling pathway and is fully expressed in mammalian tissues. MIOX catalyzes the oxidative cleavage of myo-Inositol and its epimer, D-chiro-Inositol to D-glucuronate. The dioxygen-dependent cleavage of the C6 and C1 bond in myo-Inositol is achieved by utilizing the Fe 2+ /Fe 3+ binuclear iron center of MIOX. This enzyme has also been implicated in the complications of diabetes, including diabetic nephropathy. The MIOX gene was amplified with reverse transcription-polymerase chain reaction from baboon tissue samples, and the product was cloned and sequenced. MIOX expression in the baboon kidney is described in the present study. The percentages of nucleotide and amino acid similarities between baboons and humans were 95 and 96%, respectively. The MIOX protein of the baboon may be structurally identical to that of humans. Furthermore, the evolutionary changes, which have affected these sequences, have resulted from purifying forces.

In vitro cytokine expression by peripheral mononuclear cells in herbal drug-induced skin eruption.

PubMed

Norisugi, Osamu; Yoshihisa, Yoko; Shimizu, Kyoko; Shimizu, Tadamichi

2014-01-01

Herbal medicine is widely used worldwide and is associated with side-effects such as skin eruptions. Herbal drugs are often produced by combining multiple crude drugs, mostly of plant origin. Determining which medi-cinal plants are associated with the herbal drugs that induce skin eruptions can therefore be difficult. This study investigated mRNA expression of several cytokines in peripheral mononuclear cells (PBMCs) from two patients with herbal drug-induced skin eruptions; one reacted to keishi-bukuryo-gan (KBG), composed of 5 medicinal plants, and the other patient reacted to senna. PBMCs (1×106) from the 2 patients were cultured for 24 h with the supernatant from the medicinal plants from KBG or senna in various concentrations, and a reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed. A high mRNA level of interleukin (IL)-4 and IL-5 was detected in PBMCs stimulated by KBG and two of its components. Senna stimulated a high level of IL-4 and IL-5 mRNA levels in PBMCs from patient with senna-induced drug reaction.

Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

PubMed

Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

2004-03-01

The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

Poly(adenylic acid) complementary DNA real-time polymerase chain reaction in pancreatic ductal juice in patients undergoing pancreaticoduodenectomy.

PubMed

Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K

2010-03-01

There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

A polymerase chain reaction-based methodology to detect gene doping.

PubMed

Carter, Adam; Flueck, Martin

2012-04-01

The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1.

PubMed

Pan, Ling; Pasternak, David A; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W; Pan, Ying-Xian

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3' or 5' splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function.

Growth of Rhodococcus sp. strain BCP1 on gaseous n-alkanes: new metabolic insights and transcriptional analysis of two soluble di-iron monooxygenase genes

PubMed Central

Cappelletti, Martina; Presentato, Alessandro; Milazzo, Giorgio; Turner, Raymond J.; Fedi, Stefano; Frascari, Dario; Zannoni, Davide

2015-01-01

Rhodococcus sp. strain BCP1 was initially isolated for its ability to grow on gaseous n-alkanes, which act as inducers for the co-metabolic degradation of low-chlorinated compounds. Here, both molecular and metabolic features of BCP1 cells grown on gaseous and short-chain n-alkanes (up to n-heptane) were examined in detail. We show that propane metabolism generated terminal and sub-terminal oxidation products such as 1- and 2-propanol, whereas 1-butanol was the only terminal oxidation product detected from n-butane metabolism. Two gene clusters, prmABCD and smoABCD—coding for Soluble Di-Iron Monooxgenases (SDIMOs) involved in gaseous n-alkanes oxidation—were detected in the BCP1 genome. By means of Reverse Transcriptase-quantitative PCR (RT-qPCR) analysis, a set of substrates inducing the expression of the sdimo genes in BCP1 were assessed as well as their transcriptional repression in the presence of sugars, organic acids, or during the cell growth on rich medium (Luria–Bertani broth). The transcriptional start sites of both the sdimo gene clusters were identified by means of primer extension experiments. Finally, proteomic studies revealed changes in the protein pattern induced by growth on gaseous- (n-butane) and/or liquid (n-hexane) short-chain n-alkanes as compared to growth on succinate. Among the differently expressed protein spots, two chaperonins and an isocytrate lyase were identified along with oxidoreductases involved in oxidation reactions downstream of the initial monooxygenase reaction step. PMID:26029173

The effects of biodegradable poly(lactic-co-glycolic acid)-based microspheres loaded with quercetin on stemness, viability and osteogenic differentiation potential of stem cell spheroids.

PubMed

Lee, H; Nguyen, T T; Kim, M; Jeong, J-H; Park, J-B

2018-05-31

Quercetin has been reported to exert many beneficial effects on the protection against various diseases, such as diabetes, cancer, and inflammation. The aim of this study is to evaluate the potential osteogenic differentiation ability of mesenchymal stem cells in the presence of quercetin. Quercetin-loaded poly(lactic-co-glycolic acid) microspheres were prepared using an electrospraying technique. Characterization of the microspheres was evaluated with a scanning electron microscope and release profile. Three-dimensional cell spheroids were fabricated using silicon elastomer-based concave microwells. Qualitative results of cellular viability were seen under a confocal microscope, and quantitative cellular viability was evaluated using the Cell Counting Kit-8 assay. The alkaline phosphatase activity and Alizarin Red S staining were performed. A quantitative real-time polymerase chain reaction and a western blot analysis were performed. Spheroids were well formed irrespective of quercetin concentration. Most of the cells in spheroids emitted green fluorescence, and the morphology was round without significant changes. The application of quercetin-loaded microspheres produced a significant increase in the alkaline phosphatase activity. The real-time polymerase chain reaction results showed a significant increase in Runx2, and western blot results showed higher expression of Runx2 protein expression. Biodegradable microspheres loaded with quercetin produced prolonged release profiles with increased mineralization. Microspheres loaded with quercetin can be used for the enhancement of osteoblastic differentiation in cell therapy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low-CO(2) atmosphere.

PubMed

Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V

2003-12-01

This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

PubMed Central

Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

1997-01-01

A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

Identification and Analysis of a Gene from Calendula officinalis Encoding a Fatty Acid Conjugase

PubMed Central

Qiu, Xiao; Reed, Darwin W.; Hong, Haiping; MacKenzie, Samuel L.; Covello, Patrick S.

2001-01-01

Two homologous cDNAs, CoFad2 and CoFac2, were isolated from a Calendula officinalis developing seed by a polymerase chain reaction-based cloning strategy. Both sequences share similarity to FAD2 desaturases and FAD2-related enzymes. In C. officinalis plants CoFad2 was expressed in all tissues tested, whereas CoFac2 expression was specific to developing seeds. Expression of CoFad2 cDNA in yeast (Saccharomyces cerevisiae) indicated it encodes a Δ12 desaturase that introduces a double bond at the 12 position of 16:1(9Z) and 18:1(9Z). Expression of CoFac2 in yeast revealed that the encoded enzyme acts as a fatty acid conjugase converting 18:2(9Z, 12Z) to calendic acid 18:3(8E, 10E, 12Z). The enzyme also has weak activity on the mono-unsaturates 16:1(9Z) and 18:1(9Z) producing compounds with the properties of 8,10 conjugated dienes. PMID:11161042

FAS and FAS-L Genotype and Expression in Patients With Recurrent Pregnancy Loss

PubMed Central

Banzato, Priscilla Chamelete Andrade; Daher, Silvia; Traina, Évelyn; Torloni, Maria Regina; Gueuvoghlanian-Silva, Bárbara Yasmin; Puccini, Renata Fiorini; Pendeloski, Karen Priscilla Tezotto

2013-01-01

We assessed FAS and FAS-L gene polymorphisms and messenger RNA (mRNA) levels in patients with recurrent pregnancy loss (RPL). This case–control study compared 129 women with RPL with 235 healthy multiparous women (control group). Genomic DNA and total mRNA were extracted from whole blood, and polymorphisms genotyping was performed by polymerase chain reaction (PCR). Messenger RNA expression levels were analyzed by real-time PCR. Data were analyzed by chi-square and Fisher exact tests; P < .05 was considered significant. There were no significant differences in the FAS (670 A/G) genotype or allelic frequencies between the RPL and control groups. We found significant differences in the FAS-L (844 C/T) genotype and allelic frequencies between women with RPL and controls. Patients with RPL had significantly higher FAS-L expression. Our data suggest that FAS-L gene polymorphism is associated with increased susceptibility to RPL. Moreover, women with RPL seem to abnormally express FAS-FAS-L molecules. PMID:23420824

Gene Expression Profiling in Fish Toxicology: A Review.

PubMed

Kumar, Girish; Denslow, Nancy D

In this review, we present an overview of transcriptomic responses to chemical exposures in a variety of fish species. We have discussed the use of several molecular approaches such as northern blotting, differential display reverse transcription-polymerase chain reaction (DDRT-PCR), suppression subtractive hybridization (SSH), real time quantitative PCR (RT-qPCR), microarrays, and next-generation sequencing (NGS) for measuring gene expression. These techniques have been mainly used to measure the toxic effects of single compounds or simple mixtures in laboratory conditions. In addition, only few studies have been conducted to examine the biological significance of differentially expressed gene sets following chemical exposure. Therefore, future studies should focus more under field conditions using a multidisciplinary approach (genomics, proteomics and metabolomics) to understand the synergetic effects of multiple environmental stressors and to determine the functional significance of differentially expressed genes. Nevertheless, recent developments in NGS technologies and decreasing costs of sequencing holds the promise to uncover the complexity of anthropogenic impacts and biological effects in wild fish populations.

Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma.

PubMed

Ambrosio, Maria R; Rocca, Bruno J; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T; Tripodi, Sergio A; Tosi, Piero

2015-01-01

Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis.

Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma

PubMed Central

Ambrosio, Maria R.; Rocca, Bruno J.; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T.; Tripodi, Sergio A.; Tosi, Piero

2015-01-01

Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis. PMID:26425551

Glutamic acid promotes monacolin K production and monacolin K biosynthetic gene cluster expression in Monascus.

PubMed

Zhang, Chan; Liang, Jian; Yang, Le; Chai, Shiyuan; Zhang, Chenxi; Sun, Baoguo; Wang, Chengtao

2017-12-01

This study investigated the effects of glutamic acid on production of monacolin K and expression of the monacolin K biosynthetic gene cluster. When Monascus M1 was grown in glutamic medium instead of in the original medium, monacolin K production increased from 48.4 to 215.4 mg l -1 , monacolin K production increased by 3.5 times. Glutamic acid enhanced monacolin K production by upregulating the expression of mokB-mokI; on day 8, the expression level of mokA tended to decrease by Reverse Transcription-polymerase Chain Reaction. Our findings demonstrated that mokA was not a key gene responsible for the quantity of monacolin K production in the presence of glutamic acid. Observation of Monascus mycelium morphology using Scanning Electron Microscope showed glutamic acid significantly increased the content of Monascus mycelium, altered the permeability of Monascus mycelium, enhanced secretion of monacolin K from the cell, and reduced the monacolin K content in Monascus mycelium, thereby enhancing monacolin K production.

Gene expression changes in honey bees induced by sublethal imidacloprid exposure during the larval stage.

PubMed

Wu, Ming-Cheng; Chang, Yu-Wen; Lu, Kuang-Hui; Yang, En-Cheng

2017-09-01

Honey bee larvae exposed to sublethal doses of imidacloprid show behavioural abnormalities as adult insects. Previous studies have demonstrated that this phenomenon originates from abnormal neural development in response to imidacloprid exposure. Here, we further investigated the global gene expression changes in the heads of newly emerged adults and observed that 578 genes showed more than 2-fold changes in gene expression after imidacloprid exposure. This information might aid in understanding the effects of pesticides on the health of pollinators. For example, the genes encoding major royal jelly proteins (MRJPs), a group of multifunctional proteins with significant roles in the sustainable development of bee colonies, were strongly downregulated. These downregulation patterns were further confirmed through analyses using quantitative reverse transcription-polymerase chain reaction on the heads of 6-day-old nurse bees. To our knowledge, this study is the first to demonstrate that sublethal doses of imidacloprid affect mrjp expression and likely weaken bee colonies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Mutations in TET2 and DNMT3A genes are associated with changes in global and gene-specific methylation in acute myeloid leukemia.

PubMed

Ponciano-Gómez, Alberto; Martínez-Tovar, Adolfo; Vela-Ojeda, Jorge; Olarte-Carrillo, Irma; Centeno-Cruz, Federico; Garrido, Efraín

2017-10-01

Acute myeloid leukemia is characterized by its high biological and clinical heterogeneity, which represents an important barrier for a precise disease classification and accurate therapy. While epigenetic aberrations play a pivotal role in acute myeloid leukemia pathophysiology, molecular signatures such as change in the DNA methylation patterns and genetic mutations in enzymes needed to the methylation process can also be helpful for classifying acute myeloid leukemia. Our study aims to unveil the relevance of DNMT3A and TET2 genes in global and specific methylation patterns in acute myeloid leukemia. Peripheral blood samples from 110 untreated patients with acute myeloid leukemia and 15 healthy control individuals were collected. Global 5-methylcytosine and 5-hydroxymethylcytosine in genomic DNA from peripheral blood leukocytes were measured by using the MethylFlashTM Quantification kits. DNMT3A and TET2 expression levels were evaluated by real-time quantitative polymerase chain reaction. The R882A hotspot of DNMT3A and exons 6-10 of TET2 were amplified by polymerase chain reaction and sequenced using the Sanger method. Methylation patterns of 16 gene promoters were evaluated by pyrosequencing after treating DNA with sodium bisulfite, and their transcriptional products were measured by real-time quantitative polymerase chain reaction.Here, we demonstrate altered levels of 5-methylcytosine and 5-hydroxymethylcytosine and highly variable transcript levels of DNMT3A and TET2 in peripheral blood leukocytes from acute myeloid leukemia patients. We found a mutation prevalence of 2.7% for DNMT3A and 11.8% for TET2 in the Mexican population with this disease. The average overall survival of acute myeloid leukemia patients with DNMT3A mutations was only 4 months. In addition, we showed that mutations in DNMT3A and TET2 may cause irregular DNA methylation patterns and transcriptional expression levels in 16 genes known to be involved in acute myeloid leukemia pathogenesis. Our findings suggest that alterations in DNMT3A and TET2 may be associated with acute myeloid leukemia prognosis. Furthermore, alterations in these enzymes affect normal methylation patterns in acute myeloid leukemia- specific genes, which in turn, may influence patient survival.

Orbital Angiogenesis and Lymphangiogenesis in Thyroid Eye Disease: An Analysis of Vascular Growth Factors with Clinical Correlation.

PubMed

Wong, Lindsay L; Lee, Nahyoung Grace; Amarnani, Dhanesh; Choi, Catherine J; Bielenberg, Diane R; Freitag, Suzanne K; D'Amore, Patricia A; Kim, Leo A

2016-09-01

The human orbit is an environment that is vulnerable to inflammation and edema in the setting of autoimmune thyroid disease. Our study investigated the tenet that orbital adipose tissue lacks lymphatic vessels and analyzed the clinicopathologic differences between patients with acute and chronic thyroid eye disease (TED). The underlying molecular mediators of blood and lymphatic vessel formation within the orbital fat also were evaluated. Retrospective cohort study. The study included fat specimens from 26 orbits of 15 patients with TED undergoing orbital decompression. Orbital fat specimens from patients without TED as well as cadaveric orbital fat served as controls. Tissue specimens were processed as formalin-fixed, paraffin-embedded sections or frozen cryosections for immunohistochemistry. Total RNA was extracted and analyzed via quantitative (real-time) reverse-transcription polymerase chain reaction. Clinicopathologic correlation was made by determining the clinical activity score (CAS) of each patient with TED. Samples were examined for vascular and lymphatic markers including podoplanin, lymphatic vessel endothelial hyaluronan receptor 1 (LYVE-1), and cluster of differentiation 31 (CD31) by immunohistochemistry, as well as for mRNA levels of vascular endothelial growth factor (VEGF), VEGF receptors, semaphorin 3F, neuropilin 1, neuropilin 2, podoplanin, and LYVE-1 by quantitative (real-time) reverse-transcription polymerase chain reaction. Clinicopathologic correlation revealed increased staining of CD31-positive blood vessels in patients with acute TED with a CAS more than 4, as well as rare staining of podoplanin-positive lymphatic vessels within acutely inflamed orbital fat tissue. Additionally, quantitative (real-time) reverse-transcription polymerase chain reaction analysis demonstrated increased expression of VEGF receptor (VEGFR) 2 as well as VEGF signaling molecules VEGF-A, VEGF-C, and VEGF-D. In acute TED, compared with chronic TED and control orbital fat, there is increased blood vessel density, suggesting neovascularization and rare lymphatic vessels suggestive of limited lymphangiogenesis. This proangiogenic and prolymphangiogenic microenvironment is likely the result of the increased expression of VEGFR-2, VEGF-A, VEGF-C, and VEGF-D. These findings imply that orbital edema in acute TED may be mediated, in part, by both the formation of new, immature blood vessels and the formation of lymphatic capillaries that are functionally incapable of draining interstitial fluid. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus).

PubMed

Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua

2013-09-15

Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression. Copyright © 2013 Elsevier B.V. All rights reserved.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

PubMed

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

PRL-3 promotes breast cancer progression by downregulating p14ARF-mediated p53 expression.

PubMed

Xie, Hua; Wang, Hao

2018-03-01

Prior studies have demonstrated that phosphatase of regenerating liver-3 (PRL-3) serves avital function in cell proliferation and metastasis in breast cancer. However, the molecular mechanisms underlying the function of PRL-3 in breast cancer remain unknown. PRL-3 expression was analyzed in 24 pairs of breast cancer and normal tissues using the reverse transcription-quantitative polymerase chain reaction assay. The results of the present study identified that the expression of PLR-3 in breast cancer tissues was increased 4.2-fold, compared with normal tissues. Notably, overexpression of PRL-3 significantly promoted the proliferation of cancer cells and inhibited endogenous p53 expression by downregulating the expression level of p14 alternate reading frame (p14 ARF ). In addition, decreased expression levels of PRL-3 resulted in decreased breast cancer cell proliferation and increased expression level of p14 ARF . These results suggested that PRL-3 enhances cell proliferation by downregulating p14 ARF expression, which results in decreased levels ofp53. The results of the present study demonstrated that PRL-3 promotes tumor proliferation by affecting the p14 ARF -p53 axis, and that it may serve as a prognostic marker for patients with breast cancer.

Tripartite motif-containing 29 (TRIM29) is a novel marker for lymph node metastasis in gastric cancer.

PubMed

Kosaka, Yoshimasa; Inoue, Hiroshi; Ohmachi, Takahiro; Yokoe, Takeshi; Matsumoto, Toshifumi; Mimori, Koshi; Tanaka, Fumiaki; Watanabe, Masahiko; Mori, Masaki

2007-09-01

Tripartite motif-containing 29 (TRIM29) belongs to the TRIM protein family, which has unique structural characteristics, including multiple zinc finger motifs and a leucine zipper motif. TRIM29, also known as ataxia telangiectasia group D complementing gene, possesses radiosensitivity suppressor functions. Although TRIM29 has been reported to be underexpressed in prostate and breast cancer, its expression in gastrointestinal cancer has not been studied. By use of real-time reverse transcriptase-polymerase chain reaction, we analyzed TRIM29 mRNA expression status with respect to various clinicopathological parameters in 124 patients with gastric cancer. An immunohistochemical study was also conducted. The expression of TRIM29 was far higher in gastric cancer tumor tissue. Increased TRIM29 mRNA expression was markedly associated with such parameters as histological grade, large tumor size, extent of tumor invasion, and lymph node metastasis. In the TRIM29 high-expression group, it was an independent predictor for lymph node metastasis. Furthermore, patients with high TRIM29 mRNA expression showed a far poorer survival rate than those with low TRIM29 mRNA expression. TRIM29 expression may serve as a good marker of lymph node metastasis in gastric cancer.

Conditional expression of the type 2 angiotensin II receptor in mesenchymal stem cells inhibits neointimal formation after arterial injury.

PubMed

Feng, Jian; Liu, Jian-Ping; Miao, Li; He, Guo-Xiang; Li, De; Wang, Hai-Dong; Jing, Tao

2014-10-01

Percutaneous coronary interventions (PCIs) are an effective treatment for obstructive coronary artery diseases. However, the procedure's success is limited by remodeling and formation of neointima. In the present study, we engineered rat mesenchymal stem cells (MSCs) to express type 2 angiotensin II receptor (AT2R) using a tetracycline-regulated system that can strictly regulate AT2R expression. We tested the ability of the modified MSCs to reduce neointima formation following arterial injury. We subjected rats to balloon injury, and reverse transcriptase polymerase chain reaction (RT-PCR) indicated no significant AT2R expression in normal rat arteries. Low expression of AT2R was observed at 28 days after balloon-induced injury. Interestingly, MSCs alone were unable to reduce neointimal hyperplasia after balloon-induced injury; after transplantation of modified MSCs, doxycycline treatment significantly upregulated neointimal AT2R expression and inhibited osteopontin mRNA expression, as well as neointimal formation. Taken together, these results suggest that transplantation of MSCs conditionally expressing AT2R could effectively suppress neointimal hyperplasia following balloon-induced injury. Therefore, MSCs with a doxycycline-controlled gene induction system may be useful for the management of arterial injury after PCI.

Carbachol induces TGF-alpha expression and colonic epithelial cell proliferation in sensory-desensitised rats.

PubMed

Bulut, Kerem; Felderbauer, Peter; Hoeck, Karoline; Schmidt, Wolfgang E; Hoffmann, Peter

2010-03-01

Signals for the expression of the peptide growth factors epidermal growth factor and transforming growth factor-alpha (TGFalpha) in the gastrointestinal mucosa are largely unknown. We have shown earlier that extrinsic afferents in the gastrointestinal tract induce TGFalpha expression in colonic mucosa via the deliberation of neurotransmitters substance P and calcitonin gene-related peptide. The aim of our present study was to determine the effects of carbachol on mucosal TGFalpha expression and epithelial cell proliferation in vivo. Rats were divided in three groups. Group 1 was treated with vehicle only, group 2 received one single subcutaneous injection of 250 microg/kg of carbachol and animals in group 3 were sensory-desensitised prior to the injection of 250 microg/kg carbachol. TGFalpha expression and epithelial cell proliferation was evaluated by polymerase chain reaction, Western blot analysis and bromodeoxyuridine staining. Carbachol induced a significant increase in mucosal epithelial cell proliferation and TGFalpha expression. Sensory desensitisation did neither abolish the increased TGFalpha expression nor the increase in epithelial cell proliferation. Parasympathetic pathways are involved in the control of TGFalpha expression in gastrointestinal mucosa as well as in epithelial cell proliferation.

[Effects of cytosolic bacteria on cyclic GMP-AMP synthase expression in human gingival tissues and periodontal ligament cells].

PubMed

Xiaojun, Yang; Yongmei, Tan; Zhihui, Tian; Ting, Zhou; Wanghong, Zhao; Jin, Hou

2017-04-01

This work aims to determine the effect of cytosolic bacteria on the expression of cyclic GMP-AMP synthase (cGAS) in human periodontal ligament cells (hPDLCs) and gingival tissues. The ability of Porphyromonas gingivalis (P. gingivalis) to invade hPDLCs was detected using laser scanning confocal microscope assay at a multiplicity of infection of 10. P. gingivalis-infected cells were sorted by fluorescence-activated cell sorting (FACS). Then, quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and Western blot were used to detect cGAS expression in infected cells. Finally, the location and expression of cGAS in inflammatory and normal gingival tissues were investigated by immunohistochemistry. P. gingivalis actively invaded hPDLCs. Moreover, cGAS expression significantly increased in P. gingivalis-infected cells. Although cGAS was expressed in the epithelial and subepithelial cells of both inflamed and normal gingival tissues, cGAS expression significantly increased in inflamed gingival tissues. Cytosolic bacteria can upregulate cGAS expression in infected cells. These data suggest that cGAS may act as pattern-recognition receptors and participate in recognizing cytosolic nucleic acid pathogen-associated molecular patterns.
.

Immunoglobulin class switching to IgG4 in Warthin tumor and analysis of serum IgG4 levels and IgG4-positive plasma cells in the tumor.

PubMed

Aga, Mitsuharu; Kondo, Satoru; Yamada, Kazunori; Wakisaka, Naohiro; Yagi-Nakanishi, Sayaka; Tsuji, Akira; Endo, Kazuhira; Murono, Shigeyuki; Ito, Makoto; Muramatsu, Masamichi; Kawano, Mitsuhiro; Yoshizaki, Tomokazu

2014-04-01

We previously reported a case of immunoglobulin (Ig)G4-related immune inflammation in Warthin tumor. Increased serum IgG4 levels and tissue infiltration of IgG4-positive plasma cells are characteristics of IgG4-related disease (IgG4-RD), a newly emerging clinicopathological entity. However, the relationship between IgG4-RD and Warthin tumor remains to be elucidated. We aimed to investigate the involvement of systemic and local IgG4 production and class-switch recombination in Warthin tumor. We examined serum IgG4 levels and also analyzed the involvement of IgG4-positive plasma cells in Warthin tumors (18 cases) compared with those of pleomorphic adenomas (19 cases) as controls. Furthermore, in specimens of Warthin tumors (3 cases), pleomorphic adenomas (2 cases), and IgG4-RDs (2 cases), we examined messenger RNA expression of activation-induced cytidine deaminase, IgG4 germline transcripts and productive IgG4 by reverse transcription polymerase chain reaction. Serum IgG4 levels were increased in 5 of 18 Warthin tumors and not in any of the 19 pleomorphic adenomas. Infiltration of IgG4-positive plasma cells was detected in 4 Warthin tumors and none in the pleomorphic adenomas. Moreover, activation-induced cytidine deaminase, IgG4 germline transcripts, and productive IgG4 messenger RNA were found to be expressed in 2 of 3 Warthin tumors as well as IgG4-RDs by reverse transcription polymerase chain reaction, but not in pleomorphic adenomas. In conclusion, immunoglobulin class switching to IgG4 may be involved in the pathogenesis of Warthin tumor, and it is possible that certain inflammatory background with an immune reaction is involved in the pathogenesis of Warthin tumor. © 2013.

Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

PubMed

Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

2017-01-01

Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological samples in order to validate this method and then generate a diagnostic kit for Paracoccidioidomycosis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

High-throughput multiplex HLA-typing by ligase detection reaction (LDR) and universal array (UA) approach.

PubMed

Consolandi, Clarissa

2009-01-01

One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

PubMed

Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

2013-03-01

The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits.

PubMed

Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin

2017-01-20

The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits' hearts after SXSM treatment. Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain.

Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits

PubMed Central

Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin

2017-01-01

Background: The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits’ hearts after SXSM treatment. Methods: Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. Results: There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Conclusions: Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain. PMID:28091410

Radiation-induced interleukin-6 expression through MAPK/p38/NF-kappaB signaling pathway and the resultant antiapoptotic effect on endothelial cells through Mcl-1 expression with sIL6-Ralpha.

PubMed

Chou, Chia-Hung; Chen, Shee-Uan; Cheng, Jason Chia-Hsien

2009-12-01

To investigate the mechanism of interleukin-6 (IL-6) activity induced by ionizing radiation. Human umbilical vascular endothelial cells (HUVECs) were irradiated with different doses to induce IL-6. The IL-6 promoter assay and reverse transcriptase-polymerase chain reaction (RT-PCR) were used to examine transcriptional regulation. Specific chemical inhibitors, decoy double-stranded oligodeoxynucleotides, and Western blotting were conducted to investigate the signal transduction pathway. Recombinant soluble human IL-6 receptor alpha-chain (sIL6-Ralpha) and specific small interfering RNA were used to evaluate the biologic function of radiation-induced IL-6. Four grays of radiation induced the highest level of IL-6 protein. The promoter assay and RT-PCR data revealed that the induction of IL-6 was mediated through transcriptional regulation. The p38 inhibitor SB203580, by blocking nuclear factor-kappaB (NF-kappaB) activation, prevented both the transcriptional and translational regulation of radiation-induced IL-6 expression. The addition of sIL6-Ralpha rescued HUVECs from radiation-induced death in an IL-6 concentratio-dependent manner. The antiapoptotic effect of combined sIL6-Ralpha and radiation-induced IL-6 was inhibited by mcl-1-specific small interfering RNA. Radiation transcriptionally induces IL-6 expression in endothelial cells through mitogen-activated protein kinase/p38-mediated NF-kappaB/IkappaB (inhibitor of NF-kappaB) complex activation. In the presence of sIL6-Ralpha, radiation-induced IL-6 expression acts through Mcl-1 expression to rescue endothelial cells from radiation-induced death.

Dynamic Changes of Smooth Muscle and Endothelial Markers in the Early Healing Process of Dacron Vascular Grafts in the Dog, Using RT-PCR.

PubMed

Ishida; Wu; Shi; Fujita; Sauvage; Hammond; Wijelath

2000-03-01

Previous studies of neointima formation on Dacron vascular grafts mainly focused on the late stages using immunohistochemistry staining for von Willebrand factor (vWF) and smooth muscle (SM) alpha-actin. However, it is impossible to use immunohistochemistry to study the early events of neointima formation, because graft samples lack sufficient cellular material. Therefore, we used reverse transcriptase-polymerase chain reaction (RT-PCR) to demonstrate dynamic changes of SM and endothelial markers during the early stages of neointima formation. Preclotted Dacron grafts were implanted in the descending thoracic aorta of 14 mongrel dogs. Specimens were retrieved at 1-4 weeks. Total RNAs were extracted from mid-portion of graft flow surfaces, and RT-PCR for vWF, SM myosin heavy chain (MHC), and SM alpha-actin were performed and expressed as a ratio to the ribosome s17 signal. SM MHC and vWF mRNA expression was low at 1-2 weeks but elevated at 3-4 weeks (P < 0.05). However, SM alpha-actin mRNA levels were expressed consistently throughout the study period. At 3-4 weeks, vWF mRNA expression was inversely correlated to thrombus formation on the graft flow surface. Increased expressions of SM MHC and vWF mRNA corresponded to the formation of neointima and an endothelial layer at the later stages. However, SM alpha-actin mRNA expression did not vary during the healing process. The application of RT-PCR should permit further studies of gene regulation in the early vascular graft healing process in vivo. This model can also be used to study the molecular events that are involved in SM cell differentiation.

[Influence of over expression of CsRCA on photosynthesis of cucumber seedlings under high temperature stress.

PubMed

Bi, Huan Gai; Dong, Xu Bing; Liu, Pei Pei; Li, Qing Ming; Ai, Xi Zhen

2016-07-01

In the present work, transgenic cucumber seedlings over expressing CsRCA and wild-type cucumber seedlings '08-1'at three-leaf stage exposed to high temperature (40 ℃, PFD 600 μmol· m -2 · s -1 ) were used to study the regulatory mechanism of photosynthesis by CsRCA. The results showed that the mRNA abundance of rbcL and rbcS as well as the activities of ribulose bisphosphate carboxylic enzyme (Rubisco) and Rubisco activase (RCA) were significantly higher in CsRCA over-expressing cucumber seedlings than in wild type (WT). Following 2-h exposure to high temperature, a notable decrease was observed in photosynthetic rate (P n ), photochemical perfor-mance index based on the absorption of light energy (PI ABS ), activities of Rubisco and RCA as well as the relative expression of rbcL, rbcS and CsRCA in both wild-type cucumber seedlings and transgenic cucumber seedlings. It was found that high temperature stress led to higher W k , a parameter of chlorophyll (Chl) a fluorescence OJIP curve. Furthermore, high temperature greatly reduced the efficiency of electron transfer along the electron transport chain beyond Q A (ψ 0 ) and the quantum yield for electron transport (φ E0 ), indicating that PSII oxygen complexes (OEC) and electron transport chain downstream Q A were inhibited by high temperature. However, the inhibition could be alleviated by over expressing CsRCA in cucumber seedlings. Taken together, our data suggested that over expressing CsRCA improves photosynthesis in cucumber seedlings under high temperature stress by enhancing activities of the Rubisco and RCA, and maintaining the number of active reaction centers.

Comparison of the expression of neurotransmitter and muscular genesis markers in the postnatal male mouse masseter and trigeminal ganglion during development.

PubMed

Kamata, Hiroaki; Karibe, Hiroyuki; Sato, Iwao

2018-06-01

Calcitonin gene-related peptide (CGRP) is released by motor neurons and affects skeletal muscle fiber and transient receptor potential cation channel subfamily V member 1 (TRPV1), an important marker of pain modulation. However, the expression of CGRP and TRPV1 in the trigeminal ganglion (TG) during changes and in feeding patterns has not been described. We used real-time reverse transcription polymerase chain reaction and in situ hybridization to investigate the mRNA expression levels of CGRP and TRPV1 in the TG. The expression of myosin heavy-chain (MyHC) isoforms was also investigated in the masseter muscle (MM) during the transition from sucking to mastication, an important functional trigger for muscle. The mRNA and protein levels of CGRP increased in the MM and TG from postnatal day 10 (P10) to P20 in male mice. The protein levels of TRPV1 were almost constant in the TG from P10 to P20, in contrast to increases in the MM. The mRNA abundance of TRPV1 in the TG and MM was increased from P10 to P20. The localization of an antisense probe was used to count CGRP cell numbers and found to differentiate the ophthalmic, maxillary, and mandibular nerve divisions of the TG. In particular, the number of CGRP + cells per 10,000 μm 2 in the maxillary and mandibular divisions of the TG gradually changed from P10 to P20. The expression of CGRP and TRPV1 in the TG and MM and the patterns of expression of different MyHC isoforms were affected by changes in feeding during male mouse development. © 2017 Wiley Periodicals, Inc.