ONR Far East Scientific Information Bulletin
1990-09-01
In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by
NASA Astrophysics Data System (ADS)
Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua
2017-08-01
Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.
Mosey, Nicholas J; Woo, Tom K
2006-09-04
The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.
NASA Astrophysics Data System (ADS)
Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin
Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0
Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.
Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W
2007-04-01
Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.
An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.
Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján
2016-02-20
In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.
Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.
Borkar, Santosh Ramdas; Aidhen, Indrapal Singh
2017-04-18
Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.
Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.
Winkelmann, Kurt; Calhoun, Robert L; Mills, German
2006-12-28
Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.
Sabareesan, A T; Udgaonkar, Jayant B
2014-02-25
Proteins possessing very different structures, or even no structure, form amyloid fibrils that are very similar in internal structure. This suggests that the mechanisms by which amyloid fibrils form might be very similar, irrespective of whether the fibrils are associated with disease or with normal cellular function, or even if they have no physiological importance. In this context, it is important to have a model protein system whose amyloid fibril formation is robust in its reproducibility, which can reveal the fundamentals of the amyloid fibril reaction that may be applicable to all proteins. In this study, the aggregation mechanism of amyloid fibril formation by chain B of the heterodimeric protein monellin has been elucidated in detail. It is shown that the aggregation reaction meets all the stringent kinetic criteria of a homogeneous nucleation-dependent polymerization mechanism, which is valid over a wide range of protein concentrations. Quantitative analyses of the kinetic data using one approach based on features of the entire kinetic curve, and another based on only the initial rate of aggregation, indicate that the thermodynamic nucleus is a dimer. Spherical oligomers are observed by atomic force microscopy to form transiently early during fibril formation but are off-pathway to the direct fibril formation pathway. It is shown that amyloid fibril formation can be prevented by the addition of chain A of monellin at early stages of chain B aggregation: the two free chains combine to form native monellin, which leads to the dissociation of early aggregates.
Martinelli, Anna
2014-01-01
The reaction pathway during the formation of silica via a two-component “non-aqueou” sol-gel synthesis is studied by in situ time-resolved Raman spectroscopy. This synthetic route is followed with and without the addition of the protic ionic liquid 1-ethylimidazolium bis(trifluoromethanesulfonyl)imide (C2HImTFSI) in order to investigate its effect on the reaction pathway. We demonstrate that Raman spectroscopy is suitable to discriminate between different silica intermediates, which are produced and consumed at different rates with respect to the point of gelation. We find that half-way to gelation monomers and shorter chains are the most abundant silica species, while the formation of silica rings strongly correlates to the sol-to-gel transition. Thus, curling up of linear chains is here proposed as a plausible mechanism for the formation of small rings. These in turn act as nucleation sites for the condensation of larger rings and thus the formation of the open and polymeric silica network. We find that the protic ionic liquid does not change the reaction pathway per se, but accelerates the cyclization process, intermediated by the faster inclusion of monomeric species. PMID:24743891
E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue.
Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.
E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue
Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok
2016-01-01
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation. PMID:27685940
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
NASA Astrophysics Data System (ADS)
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
Organic reactions mediated by electrochemically generated ArS+.
Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi
2011-04-21
Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.
RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schramm, V.L.
1996-05-01
The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less
Formation of pyroglutamic acid from N-terminal glutamic acid in immunoglobulin gamma antibodies.
Chelius, Dirk; Jing, Kay; Lueras, Alexis; Rehder, Douglas S; Dillon, Thomas M; Vizel, Alona; Rajan, Rahul S; Li, Tiansheng; Treuheit, Michael J; Bondarenko, Pavel V
2006-04-01
The status of the N-terminus of proteins is important for amino acid sequencing by Edman degradation, protein identification by shotgun and top-down techniques, and to uncover biological functions, which may be associated with modifications. In this study, we investigated the pyroglutamic acid formation from N-terminal glutamic acid residues in recombinant monoclonal antibodies. Almost half the antibodies reported in the literature contain a glutamic acid residue at the N-terminus of the light or the heavy chain. Our reversed-phase high-performance liquid chromatography-mass spectrometry method could separate the pyroglutamic acid-containing light chains from the native light chains of reduced and alkylated recombinant monoclonal antibodies. Tryptic peptide mapping and tandem mass spectrometry of the reduced and alkylated proteins was used for the identification of the pyroglutamic acid. We identified the formation of pyroglutamic acid from N-terminal glutamic acid in the heavy chains and light chains of several antibodies, indicating that this nonenzymatic reaction does occur very commonly and can be detected after a few weeks of incubation at 37 and 45 degrees C. The rate of this reaction was measured in several aqueous buffers with different pH values, showing minimal formation of pyroglutamic acid at pH 6.2 and increased formation of pyroglutamic acid at pH 4 and pH 8. The half-life of the N-terminal glutamic acid was approximately 9 months in a pH 4.1 buffer at 45 degrees C. To our knowledge, we showed for the first time that glutamic acid residues located at the N-terminus of proteins undergo pyroglutamic acid formation in vitro.
Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi
2014-06-04
A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.
Brange, J
1992-01-01
Insulin decomposes by a multitude of chemical reactions [1-3]. It deamidates at two different residues by entirely different mechanisms. In acid, deamidation at AsnA21 is intramolecularly catalyzed by the protonated C-terminal, whereas above pH 6 an intermediate imide formation at residue AsnB3 leads to isoAsp and Asp derivatives. The imide formation requires a large rotation around the alpha-carbon/peptide carbonyl carbon bond at B3, corresponding to a 10 A movement of the B-chain N-terminal. The main determinant for the rate of B3 deamidation, as well as for the ratio between the two products formed, is the local conformational structure, which is highly influenced by various excipients and the physical state of the insulin. An amazing thermolysin-like, autoproteolytic cleavage of the A-chain takes place in rhombohedral insulin crystals, mediated by a concerted catalytic action by several, inter-hexameric functional groups and Zn2+. Intermolecular, covalent cross-linking of insulin molecules occurs via several mechanisms. The most prominent type of mechanism is aminolysis by the N-terminals, leading to isopeptide linkages with the A-chain side-chain amides of residues GlnA15, AsnA18 and AsnA21. The same type of reaction also leads to covalent cross-linking of the N-terminal in protamine with insulin. Disulfide exchange reactions, initiated by lysis of the A7-B7 disulfide bridge, lead mainly to formation of covalent oligo- and polymers. Activation energy (Ea) for the neutral deamidation and the aminolysis reactions was found to be 80 and 119 KJ/mol, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Samsel, R.W.; Perelson, A.S.
Red blood cells aggregate face-to-face to form long, cylindrical, straight chains and sometimes branched structures called rouleaux. Here the authors extend a kinetic model developed by R.W. Samsel and A.S. Perelson to include both the formation and dissociation of rouleaux. Thermodynamic constraints on the rate constants of the model imposed by the principle of detailed balance were examined. Incorporation of reverse reactions allows computation of mean sizes of rouleaux and straight chain segments within rouleaux, as functions of time and at equilibrium. Using the Flory-Stockmayer method from polymer chemistry, a closed-form solution was obtained for the size distribution of straightmore » chain segments within rouleaux at any point in the evolution of the reaction. The predictions of the theory compare favorably with data collected by D. Kernick, A.W.L. Jay, S. Rowlands, and L. Skibo on the kinetics of rouleaux formation. When rouleaux grow large, they may contain rings or loops and take on the appearance of a network. The importance of including the kinetics of ring closure in the development of realistic models of rouleaux formation was demonstrated.« less
Aromatic ring generation as a dust precursor in acetylene discharges
NASA Astrophysics Data System (ADS)
De Bleecker, Kathleen; Bogaerts, Annemie; Goedheer, Wim
2006-04-01
Production of aromatic hydrocarbon compounds as an intermediate step for particle formation in low-pressure acetylene discharges is investigated via a kinetic approach. The detailed chemical reaction mechanism contains 140 reactions among 55 species. The cyclic hydrocarbon chemistry is mainly based on studies of polycyclic aromatic hydrocarbon formation in cosmic environments. The model explicitly includes organic chain, cyclic molecules, radicals, and ions up to a size of 12 carbon atoms. The calculated density profiles show that the aromatic formation yields are quite significant, suggesting that aromatic compounds play a role in the underlying mechanisms of particle formation in hydrocarbon plasmas.
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less
Li, Feng; Fitz, Daniel; Fraser, Donald G; Rode, Bernd M
2010-01-01
The salt-induced peptide formation (SIPF) reaction takes place readily under mild reaction conditions and proceeds via a copper complex. Its ease of reaction and the universality for prebiotic scenarios add weights to the arguments in favour of the importance of peptide and proteins in the tug of war with the RNA world hypothesis. In addition, the SIPF reaction has a preference for L-form amino acids in dipeptide formation, casting light on the puzzle of biohomochirality, especially for the amino acids with aliphatic side chains. A detailed investigation on the behaviour of aliphatic leucine in the SIPF reaction is presented in this paper, including the catalytic effects of glycine, L- and D-histidine as well as the stereoselectivity under all the reaction conditions above. The results show a relatively low reactivity and stereoselectivity of leucine in the SIPF reaction, while both glycine and histidine enantiomers remarkably increase the yields of dileucine by factors up to 40. Moreover, a comparative study of the effectiveness of L- and D-histidine in catalysing the formation of dimethionine was also carried out and extends the scope of mutual catalysis by amino acid enantiomers in the SIPF reaction.
Evans, Christopher M; Love, Alyssa M; Weiss, Emily A
2012-10-17
This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.
Matsumoto, Kouichi; Fujie, Shunsuke; Suga, Seiji; Nokami, Toshiki; Yoshida, Jun-ichi
2009-09-28
A catalytic amount of electrochemically generated "ArS+" ("ArS+" = ArS(ArSSAr)+) initiates a cation chain reaction of dienes that involves the addition of ArSSAr associated with stereoselective intramolecular carbon-carbon bond formation, and the direct (in-cell) electrolysis of a mixture of a diene and ArSSAr with a catalytic amount of electricity also effectively initiates the reaction.
Taran, Iu A; Cihpev, K K; Stroganov, L B
1977-01-01
Kinetics of the model reaction between oligomeric planar lattice-model chains has been studied by Monte--Carlo method. Simulation of the chain's motion was performing using rules of Verdier--Stockmayer. The length of chains has been varied from 8 to 24 beads. The probabilities of breaking of a contact between two chains was given by w=exp(--U); the formation of an adjacent contact was controlled by mobility of chains. The probability of the formation of any isolated contact was given by w0=exp(--U0). Kinetic curves were obtained for mean number of contacts Z(t) with different initial conditions and U, U0 values. The estimation of mean rates of formation-breaking of contacts (V+ and V-) and their dependences on the time, U and U0 have been obtained. Rate constants for the formation-breaking of a contact (k+ and k-) were estimated as well as the distribution for k+/- over states of the binary complex. The calculations were made for the case of homopolymers, intrachain interactions were omitted.
Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?
NASA Astrophysics Data System (ADS)
Behnke, Wolfgang; Zetzsch, Cornelius
2010-05-01
We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/kBr[toluene] ~ 100). Formation of aldehydes (R-CHO) interferes with the chain reaction (1) - (3) markedly, since kBr[O3] ≈kBr[R-CHO]. The chain reaction is limited by availability of ozone (degradation of HCs by atomic Cl stops completely with vanishing ozone), of HO2 (HCs are required to form HO2) and of aerosol. The central question is: will sufficient HO2 be formed from degradation of HCs to explain the magnitude of the formed Br2 and BrCl in our experiments? We found that the formation of HO2 should be by a factor of 2-4 larger to explain the formation of Br2 and BrCl. Which other sources for the formation of HOBr besides reaction (2a) are then available? The rate of CH3O2with BrO is 25% of that with HO2 (Enami, S.; Yamanaka, T.; Nakayama, T.; Hashimoto, S.; Kawasaki, M.; Shallcross, D.E.; Nakano, Y.; Ishiwata, T., J. Phys. Chem. A, 11, 3342 - 3348, 2007), suggesting that other RO2 radicals must contribute. In our model calculations we use this rate constant for all RO2 radicals to obtain reasonable agreement between the produced HOBr and the formed BrCl and Br2 necessary for our experimental degradation results. So reaction scheme (1) - (3) should be completed by: BrO + RO2 => HOBr + products (2b) The German Science Foundation (DFG) supported this research in unit 783 (HALOPROC).
NASA Astrophysics Data System (ADS)
Gianturco, F. A.; Satta, M.; Yurtsever, E.; Wester, R.
2017-11-01
We investigate the relative efficiencies of low-temperature chemical reactions in the interstellar medium with H- anion reacting in the gas phase with cyanopolyyne neutral molecules, leading to the formation of anionic {{{C}}}x{{{N}}}- linear chains of different lengths and of H2. All the reactions turn out to be without barriers, highly exothermic reactions that provide a chemical route to the formation of anionic chains of the same length. Some of the anions have been observed in the dark molecular clouds and in the diffuse interstellar envelopes. Quantum calculations are carried out for the corresponding reactive potential energy surfaces for all the odd-numbered members of the series (x = 1, 3, 5, 7). We employ the minimum energy paths to obtain the relevant transition state configurations and use the latter within the variational transition state model to obtain the chemical rates. The present results indicate that at typical temperatures around 100 K, a set of significantly larger rate values exists for x = 3 and x = 5, while the rate values are smaller for CN- and {{{C}}}7{{{N}}}-. At those temperatures, however, all the rates turn out to be larger than the estimates in the current literature for the radiative electron attachment (REA) rates, thus indicating the greater importance of the present chemical path with respect to REA processes at those temperatures. The physical reasons for our findings are discussed in detail and linked with the existing observational findings.
21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.
Code of Federal Regulations, 2013 CFR
2013-04-01
... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...
21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.
Code of Federal Regulations, 2010 CFR
2010-04-01
... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...
21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.
Code of Federal Regulations, 2012 CFR
2012-04-01
... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...
21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.
Code of Federal Regulations, 2014 CFR
2014-04-01
... § 177.1980 of this chapter that contact food of Types I, II, IV-B, VI-B, VII-B, and VIII identified in... produced by the reaction of either ethylene glycol or glycerol with long chain monobasic acids containing... carboxylic acids in the formation of the glycerol esters being neutralized with calcium hydroxide to produce...
21 CFR 178.3780 - Polyhydric alcohol esters of long chain monobasic acids.
Code of Federal Regulations, 2011 CFR
2011-04-01
... chloride copolymer articles complying with § 177.1980 of this chapter that contact food of Types I, II, IV... 1,050 to 1,700. The esters are produced by the reaction of either ethylene glycol or glycerol with... chain alpha-olefins, the unreacted carboxylic acids in the formation of the glycerol esters being...
Hawkins, C L; Davies, M J
1998-01-01
Stimulated monocytes and neutrophils generate hypochlorite (HOCl) via the release of the enzyme myeloperoxidase and hydrogen peroxide. HOCl damages proteins by reaction with amino acid side-chains or backbone cleavage. Little information is available about the mechanisms and intermediates involved in these reactions. EPR spin trapping has been employed to identify radicals on proteins, peptides and amino acids after treatment with HOCl. Reaction with HOCl gives both high- and low-molecular-mass nitrogen-centred, protein-derived radicals; the yield of the latter increases with both higher HOCl:protein ratios and enzymic digestion. These radicals, which arise from lysine side-chain amino groups, react with ascorbate, glutathione and Trolox. Reaction of HOCl-treated proteins with excess methionine eliminates radical formation, which is consistent with lysine-derived chloramines (via homolysis of N-Cl bonds) being the radical source. Incubation of HOCl-treated proteins, after removal of excess oxidant, gives rise to both nitrogen-centred radicals, over a period of hours, and time-dependent fragmentation of the protein. Treatment with excess methionine or antioxidants (Trolox, ascorbate, glutathione) protects against fragmentation; urate and bilirubin do not. Chloramine formation and nitrogen-centred radicals are therefore key species in HOCl-induced protein fragmentation. PMID:9620862
Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert
2011-04-01
Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less
Zamora, Rosario; León, M Mercedes; Hidalgo, Francisco J
2015-09-16
Comparative formation of both 2-phenylethylamine and phenylacetaldehyde as a consequence of phenylalanine degradation by carbonyl compounds was studied in an attempt to understand if the amine/aldehyde ratio can be changed as a function of reaction conditions. The assayed carbonyl compounds were selected because of the presence in the chain of both electron-donating and electron-withdrawing groups and included alkenals, alkadienals, epoxyalkenals, oxoalkenals, and hydroxyalkenals as well as lipid hydroperoxides. The obtained results showed that the 2-phenylethylamine/phenylacetaldehyde ratio depended upon both the carbonyls and the reaction conditions. Thus, it can be increased using electron-donating groups in the chain of the carbonyl compound, small amounts of carbonyl compound, low oxygen content, increasing the pH, or increasing the temperature at pH 6. Opposed conditions (use of electron-withdrawing groups in the chain of the carbonyl compound, large amounts of carbonyl compound, high oxygen contents, low pH values, and increasing temperatures at low pH values) would decrease the 2-phenylethylamine/phenylacetaldehyde ratio, and the formation of aldehydes over amines in amino acid degradations would be favored.
Mass Chain Evaluation for A=95
DOE Office of Scientific and Technical Information (OSTI.GOV)
Basu, S.K.; Sonzogni, A.; Basu, Swapan Kr.
2011-08-01
A full evaluation of the mass chain A = 95 has been done in the ENSDF format taking into account all the available data until June 2009. Excited states populated by in-beam nuclear reactions and by radioactive decay have been considered. The 'evp' editor, developed at the NNDC, has been used for the evaluation. This mass chain was last evaluated in 1993. Many new and improved data were reported since then. A total of 13 nuclei have been evaluated.
NASA Astrophysics Data System (ADS)
Pierre, Cynthia; Torkelson, John
2009-03-01
A major challenge for the most effective recycling of poly(ethylene terephthalate) concerns the fact that initial melt processing of PET into a product leads to substantial degradation of molecular weight. Thus, recycled PET has insufficient melt viscosity for reuse in high-value applications such as melt-blowing of PET bottles. Academic and industrial research has tried to remedy this situation by synthesis and use of ``chain extenders'' that can lead to branched PET (with higher melt viscosity than the linear recycled PET) via condensation reactions with functional groups on the PET. Here we show that simple processing of PET via solid-state shear pulverization (SSSP) leads to enhanced PET melt viscosity without need for chemical additives. We hypothesize that this branching results from low levels of chain scission accompanying SSSP, leading to formation of polymeric radicals that participate in chain transfer and combination reactions with other PET chains and thereby to in situ branch formation. The pulverized PET exhibits vastly enhanced crystallization kinetics, eliminating the need to employ cold crystallization to achieve maximum PET crystallinity. Results of SSSP processing of PET will be compared to results obtained with poly(butylene terephthalate).
Control and reduction of peak temperature in self-curing resins.
Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A
2009-07-01
INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.
Salian, Vishal D; Vaughan, Asa D; Byrne, Mark E
2012-06-01
In this work, living/controlled radical polymerization (LRP) is compared with conventional free radical polymerization in the creation of highly and weakly cross-linked imprinted poly(methacrylic acid-co-ethylene glycol dimethacrylate) networks. It elucidates, for the first time, the effect of LRP on the chain level and begins to explain why the efficiency of the imprinting process is improved using LRP. Imprinted polymers produced via LRP exhibited significantly higher template affinity and capacity compared with polymers prepared using conventional methods. The use of LRP in the creation of highly cross-linked imprinted polymers resulted in a fourfold increase in binding capacity without a decrease in affinity; whereas weakly cross-linked gels demonstrated a nearly threefold increase in binding capacity at equivalent affinity when LRP was used. In addition, by adjusting the double bond conversion, we can choose to increase either the capacity or the affinity in highly cross-linked imprinted polymers, thus allowing the creation of imprinted polymers with tailorable binding parameters. Using free radical polymerization in the creation of polymer chains, as the template-monomer ratio increased, the average molecular weight of the polymer chains decreased despite a slight increase in the double bond conversion. Thus, the polymer chains formed were shorter but greater in number. Using LRP neutralized the effect of the template. The addition of chain transfer agent resulted in slow, uniform, simultaneous chain growth, resulting in the formation of longer more monodisperse chains. Reaction analysis revealed that propagation time was extended threefold in the formation of highly cross-linked polymers when LRP techniques were used. This delayed the transition to the diffusion-controlled stage of the reaction, which in turn led to the observed enhanced binding properties, decreased polydispersity in the chains, and a more homogeneous macromolecular architecture. Copyright © 2012 John Wiley & Sons, Ltd.
Orientation of chain molecules in ionotropic gels: a Brownian dynamics model
NASA Astrophysics Data System (ADS)
Woelki, Stefan; Kohler, Hans-Helmut
2003-09-01
As is known from birefringence measurements, polysaccharide molecules of ionotropic gels are preferentially orientated normal to the direction of gel growth. In this paper the orientation effect is investigated by means of an off-lattice Brownian dynamics model simulating the gel formation process. The model describes the integration of a single coarse grained phantom chain into the growing gel. The equations of motion of the chain are derived. The computer simulations show that, during the process of integration, the chain is contracting normal to the direction of gel growth. A scaling relation is obtained for the degree of contraction as a function of the length parameters of the chain, the velocity of the gel formation front and the rate constant of the crosslinking reaction. It is shown that the scaling relation, if applied to the example of ionotropic copper alginate gel, leads to reasonable predictions of the time course of the degree of contraction of the alginate chains.
Ortho and parahydrogen in interstellar material
NASA Technical Reports Server (NTRS)
Reeves, R. R.; Harteck, P.
1979-01-01
The ortho/para molecular hydrogen ratio in the interstellar medium is considered. It is shown that the ortho/para ratio will be 3:1 in practically all chemical reactions, even at relatively low temperatures. Two examples of exothermic processes that will result in the formation of a 3:1 ortho:para ratio, corresponding to a high-temperature equilibrium, are examined: H2 formation via three-body or surface recombination and catalytic recombination involving electrons and H(-) ions. Gas-phase scrambling ion reactions are also discussed, and it is suggested that virtually all the H2 equilibrated via scrambling reactions involving H(+) and H3(+) ions should exist as parahydrogen in the J ? 0 quantum state. Arguments are given that deuterium cannot interfere with the long scrambling chain that results in parahydrogen formation.
NASA Astrophysics Data System (ADS)
Zhao, Qiangli; Wang, Weina; Liu, Fengyi; Lü, Jian; Wang, Wenliang
2017-10-01
To better understand the formation mechanism of oligomeric hydroxyalkyl hydroperoxides HOROO(SCI)nH composed of stabilized Criegee intermediate (SCI) as a chain unit, the reactions of SCI with hydroxyalkyl hydroperoxides (HOROOH) and hydroxyalkylperoxy radical (HORO2) as well as HO2 radical were investigated. For the reactions of HORO2 + SCI, two preferred pathways involving a SCI insertion in HOROOH hydroperoxide bond can be found, and the formation of HOROO(SCI)H is the dominant pathway in the reaction of HOCH2(CH3)2COOH + (CH3)2COO. The structures of the HORO2, HOROOH as well as the SCIs play a crucial role in determining the reactivity of the oligomerization. Both the reactions of HORO2 + SCI + HO2 and HOROOH + SCI could be the source of the processors to the formation of secondary organic aerosol (SOA). But from the point of free energy barriers, the formation of HOROO(SCI)H prefers to follow the mechanism involving initiation by the reaction of a HORO2 and a SCI, sequential addition of SCIs, and termination by reaction with the HO2 radical. The rate coefficients show negative temperature dependence and vary in different systems depending on the reactants. The reaction process and constituents of the products can be regulated by temperature and reactants.
SuFEx-Based Polysulfonate Formation from Ethenesulfonyl Fluoride-Amine Adducts
Wang, Hua; Zhou, Feng; Ren, Gerui; ...
2017-05-18
In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less
Mechanism of Air Oxidation of the Fragrance Terpene Geraniol.
Bäcktorp, Carina; Hagvall, Lina; Börje, Anna; Karlberg, Ann-Therese; Norrby, Per-Ola; Nyman, Gunnar
2008-01-01
The fragrance terpene geraniol autoxidizes upon air exposure and forms a mixture of oxidation products, some of which are skin sensitizers. Reactions of geraniol with O2 have been studied with DFT (B3LYP) and the computational results compared to experimentally observed product ratios. The oxidation is initiated by hydrogen abstraction, forming an allylic radical which combines with an O2 molecule to yield an intermediate peroxyl radical. In the subsequent step, geraniol differs from previously studied cases, in which the radical chain reaction is propagated through intermolecular hydrogen abstraction. The hydroxy-substituted allylic peroxyl radical prefers an intramolecular rearrangement, producing observable aldehydes and the hydroperoxyl radical, which in turn can propagate the radical reaction. Secondary oxidation products like epoxides and formates were also considered, and plausible reaction pathways for formation are proposed.
The growth of carbon chains in IRC +10216 mapped with ALMA⋆
Agúndez, M.; Cernicharo, J.; Quintana-Lacaci, G.; Castro-Carrizo, A.; Velilla Prieto, L.; Marcelino, N.; Guélin, M.; Joblin, C.; Martín-Gago, J. A.; Gottlieb, C. A.; Patel, N. A.; McCarthy, M. C.
2017-01-01
Linear carbon chains are common in various types of astronomical molecular sources. Possible formation mechanisms involve both bottom-up and top-down routes. We have carried out a combined observational and modeling study of the formation of carbon chains in the C-star envelope IRC +10216, where the polymerization of acetylene and hydrogen cyanide induced by ultraviolet photons can drive the formation of linear carbon chains of increasing length. We have used ALMA to map the emission of λ 3 mm rotational lines of the hydrocarbon radicals C2H, C4H, and C6H, and the CN-containing species CN, C3N, HC3N, and HC5N with an angular resolution of ~1″. The spatial distribution of all these species is a hollow, 5-10″ wide, spherical shell located at a radius of 10-20″ from the star, with no appreciable emission close to the star. Our observations resolve the broad shell of carbon chains into thinner sub-shells which are 1-2″ wide and not fully concentric, indicating that the mass loss process has been discontinuous and not fully isotropic. The radial distributions of the species mapped reveal subtle differences: while the hydrocarbon radicals have very similar radial distributions, the CN-containing species show more diverse distributions, with HC3N appearing earlier in the expansion and the radical CN extending later than the rest of the species. The observed morphology can be rationalized by a chemical model in which the growth of polyynes is mainly produced by rapid gas-phase chemical reactions of C2H and C4H radicals with unsaturated hydrocarbons, while cyanopolyynes are mainly formed from polyynes in gas-phase reactions with CN and C3N radicals. PMID:28469283
T.E. KLEINDIENST, E.W. CORSE, F.T. BLANCHARD, W.A. LONNEMAN
Carbonyl compounds are important constituents in urban and global atmospheres. n urban atmospheres these compounds frequently serve to initiate photochemical smog and certainly sustain the chain reactions leading to ozone formation. easurement of carbonyl compounds under atmosphe...
Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides
NASA Astrophysics Data System (ADS)
Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.
Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.
Ionizing radiation-induced destruction of benzene and dienes in aqueous media.
Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E
2006-05-01
Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.
Scheer, Adam M.; Welz, Oliver; Vasu, Subith S.; ...
2015-04-13
The low-temperature oxidation of three cyclic ketones, cyclopentanone (CPO; C 5H 8O), cyclohexanone (CHO; C 6H 10 O), and 2-methyl-cyclopentanone (2-Me-CPO; CH 3–C 5H7 O), is studied between 550 and 700 K and at 4 or 8 Torr total pressure. Initial fuel radicals R are formedvia fast H-abstraction from the ketones by laser-photolytically generated chlorine atoms. Intermediates and products from the subsequent reactions of these radicals in the presence of excess O 2 are probed with time and isomeric resolution using multiplexed photoionization mass spectrometry with tunable synchrotron ionizing radiation. For CPO and CHO the dominant product channel in themore » R + O 2 reactions is chain-terminating HO 2-elimination yielding the conjugated cyclic coproducts 2-cyclopentenone and 2-cyclohexenone, respectively. Results on oxidation of 2-Me-CPO also show a dominant contribution from HO 2-elimination. Moreover, the photoionization spectrum of the co-product suggests formation of 2-methyl-2-cyclopentenone and/or 2-cyclohexenone, resulting from a rapid Dowd–Beckwith rearrangement, preceding addition to O 2, of the initial (2-oxocyclopentyl)methyl radical to 3-oxocyclohexyl. Cyclic ethers, markers for hydroperoxyalkyl radicals (QOOH), key intermediates in chain-propagating and chain-branching low-temperature combustion pathways, are only minor products. The interpretation of the experimental results is supported by stationary point calculations on the potential energy surfaces of the associated R + O 2 reactions at the CBS-QB3 level. Furthermore, the calculations indicate that HO 2-elimination channels are energetically favored and product formation via QOOH is disfavored. Lastly, the prominence of chain-terminating pathways linked with HO 2 formation in low-temperature oxidation of cyclic ketones suggests little low-temperature reactivity of these species as fuels in internal combustion engines.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scheer, Adam M.; Welz, Oliver; Vasu, Subith S.
The low-temperature oxidation of three cyclic ketones, cyclopentanone (CPO; C 5H 8O), cyclohexanone (CHO; C 6H 10 O), and 2-methyl-cyclopentanone (2-Me-CPO; CH 3–C 5H7 O), is studied between 550 and 700 K and at 4 or 8 Torr total pressure. Initial fuel radicals R are formedvia fast H-abstraction from the ketones by laser-photolytically generated chlorine atoms. Intermediates and products from the subsequent reactions of these radicals in the presence of excess O 2 are probed with time and isomeric resolution using multiplexed photoionization mass spectrometry with tunable synchrotron ionizing radiation. For CPO and CHO the dominant product channel in themore » R + O 2 reactions is chain-terminating HO 2-elimination yielding the conjugated cyclic coproducts 2-cyclopentenone and 2-cyclohexenone, respectively. Results on oxidation of 2-Me-CPO also show a dominant contribution from HO 2-elimination. Moreover, the photoionization spectrum of the co-product suggests formation of 2-methyl-2-cyclopentenone and/or 2-cyclohexenone, resulting from a rapid Dowd–Beckwith rearrangement, preceding addition to O 2, of the initial (2-oxocyclopentyl)methyl radical to 3-oxocyclohexyl. Cyclic ethers, markers for hydroperoxyalkyl radicals (QOOH), key intermediates in chain-propagating and chain-branching low-temperature combustion pathways, are only minor products. The interpretation of the experimental results is supported by stationary point calculations on the potential energy surfaces of the associated R + O 2 reactions at the CBS-QB3 level. Furthermore, the calculations indicate that HO 2-elimination channels are energetically favored and product formation via QOOH is disfavored. Lastly, the prominence of chain-terminating pathways linked with HO 2 formation in low-temperature oxidation of cyclic ketones suggests little low-temperature reactivity of these species as fuels in internal combustion engines.« less
Altuntepe, Emrah; Emel'yanenko, Vladimir N; Forster-Rotgers, Maximilian; Sadowski, Gabriele; Verevkin, Sergey P; Held, Christoph
2017-10-01
Levulinic acid was esterified with methanol, ethanol, and 1-butanol with the final goal to predict the maximum yield of these equilibrium-limited reactions as function of medium composition. In a first step, standard reaction data (standard Gibbs energy of reaction Δ R g 0 ) were determined from experimental formation properties. Unexpectedly, these Δ R g 0 values strongly deviated from data obtained with classical group contribution methods that are typically used if experimental standard data is not available. In a second step, reaction equilibrium concentrations obtained from esterification catalyzed by Novozym 435 at 323.15 K were measured, and the corresponding activity coefficients of the reacting agents were predicted with perturbed-chain statistical associating fluid theory (PC-SAFT). The so-obtained thermodynamic activities were used to determine Δ R g 0 at 323.15 K. These results could be used to cross-validate Δ R g 0 from experimental formation data. In a third step, reaction-equilibrium experiments showed that equilibrium position of the reactions under consideration depends strongly on the concentration of water and on the ratio of levulinic acid: alcohol in the initial reaction mixtures. The maximum yield of the esters was calculated using Δ R g 0 data from this work and activity coefficients of the reacting agents predicted with PC-SAFT for varying feed composition of the reaction mixtures. The use of the new Δ R g 0 data combined with PC-SAFT allowed good agreement to the measured yields, while predictions based on Δ R g 0 values obtained with group contribution methods showed high deviations to experimental yields.
Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format
EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...
Supercoil Formation During DNA Melting
NASA Astrophysics Data System (ADS)
Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan
2009-03-01
Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.
Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku
2013-08-22
Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.
FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI
Ekstedt, Richard D.; Stollerman, Gene H.
1960-01-01
Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267
Eichhöfer, Andreas; Buth, Gernot
2016-11-01
Reactions of [Co(N(SiMe 3 ) 2 ) 2 thf] with 2.1 equiv. of MesSH (Mes = C 6 H 2 -2,4,6-(CH 3 ) 3 ) yield dark brown crystals of the one dimensional chain compound [Co(SMes) 2 ]. In contrast reactions of [Co(N(SiMe 3 ) 2 ) 2 thf] with 2.1 equiv. of PhSH result in the formation of a dark brown almost X-ray amorphous powder of 'Co(SPh) 2 '. Addition of aliquots of CH 3 OH to the latter reaction resulted in the almost quantitative formation of crystalline ammonia thiolato complexes either [Co(SPh) 2 (NH 3 ) 2 ] or [Co(SPh) 2 NH 3 ]. Single crystal XRD reveals that [Co(SPh) 2 NH 3 ] forms one-dimensional chains in the crystal via μ 2 -SPh bridges whereas [Co(SPh) 2 (NH 3 ) 2 ] consists at a first glance of isolated distorted tetrahedral units. Magnetic measurements suggest strong antiferromagnetic coupling for the two chain compounds [Co(SMes) 2 ] (J = -38.6 cm -1 ) and [Co(SPh) 2 NH 3 ] (J = -27.1 cm -1 ). Interestingly, also the temperature dependence of the susceptibility of tetrahedral [Co(SPh) 2 (NH 3 ) 2 ] shows an antiferromagnetic transition at around 6 K. UV-Vis-NIR spectra display d-d bands in the NIR region between 500 and 2250 nm. Thermal gravimetric analysis of [Co(SPh) 2 (NH 3 ) 2 ] and [Co(SPh) 2 NH 3 ] reveals two well separated cleavage processes for NH 3 and SPh 2 upon heating accompanied by the stepwise formation of 'Co(SPh) 2 ' and cobalt sulfide.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Cong; Assary, Rajeev S.; Curtiss, Larry A.
2014-06-26
Upgrading of furan and small oxygenates obtained from the decomposition of cellulosic materials via formation of carbon-carbon bonds is critical to effective conversion of biomass to liquid transportation fuels. Simulation-driven molecular level understanding of carbon-carbon bond formation is required to design efficient catalysts and processes. Accurate quantum chemical methods are utilized here to predict the reaction energetics for conversion of furan (C4H4O) to C5-C8 ethers and the transformation of furfural (C5H6O2) to C13-C26 alkanes. Furan, can be coupled with various C1 to C4 lower molecular weight carbohydrates obtained from the pyrolysis via Diels-Alder type reactions in the gas phase tomore » produce C5-C8 cyclic ethers. The computed reaction barriers for these reactions (~25 kcal/mol) are lower than the cellulose activation or decomposition reactions (~50 kcal/mol). Cycloaddition of C5-C8 cyclo-ethers with furans can also occur in the gas phase, and the computed activation energy is similar to that of the first Diels-Alder reaction. Furfural, obtained from biomass, can be coupled with aldehydes or ketones with α-hydrogen atoms to form longer chain aldol products and these aldol products can undergo vapor phase hydrocycloaddition (activation barrier of ~20 kcal/mol) to form the precursors of C26 cyclic hydrocarbons. These thermochemical studies provide the basis for further vapor phase catalytic studies required for upgrading of furans/furfurals to longer chain hydrocarbons.« less
Formation of nucleoside 5'-polyphosphates from nucleotides and trimetaphosphate
NASA Technical Reports Server (NTRS)
Lohrmann, R.
1975-01-01
Nucleoside 5'-polyphosphates (N5PP) formed when solutions of nucleoside 5'-phosphates (N5P) and trimetaphosphate (TMP) are dessicated at room temperature are studied by paper chromatography, electrophoresis, and metal catalytic reactions. Divalent Mg ion exhibited superior catalytic function to other divalent metal ions in the reaction. Major reaction products are indicated. The importance of the N5PP series, TMP, and N5-triphosphate as substrates of RNA and DNA synthesis, and under postulated prebiotic conditions likely to obtain during prebiological ages of the earth, is emphasized and discussed. Alternate drying and wetting, evaporation from a prebiotic puddle, concentration of solubles in the remaining liquid phase, metal catalysis, and the role of these substances in the formation of amino acids and long-chain polyphosphates are considered.
Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles
Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon
2014-01-01
A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867
Qu, Lin; Sun, Peng; Wu, Ying; Zhang, Ke; Liu, Zhengping
2017-08-01
An efficient metal-free homodifunctional bimolecular ring-closure method is developed for the formation of cyclic polymers by combining reversible addition-fragmentation chain transfer (RAFT) polymerization and self-accelerating click reaction. In this approach, α,ω-homodifunctional linear polymers with azide terminals are prepared by RAFT polymerization and postmodification of polymer chain end groups. By virtue of sym-dibenzo-1,5-cyclooctadiene-3,7-diyne (DBA) as small linkers, well-defined cyclic polymers are then prepared using the self-accelerating double strain-promoted azide-alkyne click (DSPAAC) reaction to ring-close the azide end-functionalized homodifunctional linear polymer precursors. Due to the self-accelerating property of DSPAAC ring-closing reaction, this novel method eliminates the requirement of equimolar amounts of telechelic polymers and small linkers in traditional bimolecular ring-closure methods. It facilitates this method to efficiently and conveniently produce varied pure cyclic polymers by employing an excess molar amount of DBA small linkers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Mosca, Pietro; Mounier, Claude
2016-03-01
The automatic construction of evolution chains recently implemented in GALILEE system is based on the analysis of several ENDF files : the multigroup production cross sections present in the GENDF files processed by NJOY from the ENDF evaluation, the decay file and the fission product yields (FPY) file. In this context, this paper highlights the importance of the nucleus identification to properly interconnect the data mentioned above. The first part of the paper describes the present status of the nucleus identification among the several ENDF files focusing, in particular, on the use of the excited state number and of the isomeric state number. The second part reviews the problems encountered during the automatic construction of the depletion chains using recent ENDF data. The processing of the JEFF-3.1.1, ENDF/B-VII.0 (decay and FPY) and the JEFF-3.2 (production cross section) points out problems about the compliance or not of the nucleus identifiers with the ENDF-6 format and sometimes the inconsistencies among the various ENDF files. In addition, the analysis of EAF-2003 and EAF-2010 shows some incoherence between the ZA product identifier and the reaction identifier MT for the reactions (n, pα) and (n, 2np). As a main result of this work, our suggestion is to change the ENDF format using systematically the isomeric state number to identify the nuclei. This proposal is already compliant to a huge amount ENDF data that are not in agreement with the present ENDF format. This choice is the most convenient because, ultimately, it allows one to give human readable names to the nuclei of the depletion chains.
NASA Astrophysics Data System (ADS)
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Research on the chemical mechanism in the polyacrylate latex modified cement system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Min; Wang, Rumin, E-mail: wangmin19@mail.nwpu.edu.cn; Zheng, Shuirong
2015-10-15
In this paper, the chemical mechanism in the polyacrylate latex modified cement system was investigated by Fourier transform infrared spectra (FT-IR), X-ray photoelectron spectroscopy (XPS), gel permeation chromatography (GPC) and compact pH meter. All results have shown that the chemical reactions in the polyacrylate modified system can be divided into three stages. The hydration reactions of cement can produce large amounts of Ca(OH){sub 2} (calcium hydroxide) and lead the whole system to be alkali-rich and exothermic at the first stage. Subsequently, this environment can do great contributions to the hydrolysis of ester groups in the polyacrylate chains, resulting in themore » formation of carboxyl groups at the second stage. At the third stage, the final crosslinked network structure of the product was obtained by the reaction between the carboxyl groups in the polyacrylate latex chains and Ca(OH){sub 2}.« less
Eberhardt, M K; Santos, C; Soto, M A
1993-05-07
Co2+ ions (Co(NO3)2.6H2O) react with H2O2 only in presence of EDTA to yield OH radicals and Co3+. This reaction was carried out in unbuffered aqueous solutions (pH = 2.6). The formation of Co3+ was confirmed by spectroscopy. The Co(3+)-EDTA complex shows two typical absorptions at 382 nm and 532 nm. The Co(3+)-EDTA complex can be prepared by a number of oxidizing agents, like Fe3+, Fe(3+)-EDTA, Ag+, Ag2+, Ce4+, and hydroxyl radicals. Since Fe3+ oxidizes Co(2+)-EDTA to Co(3+)-EDTA and Fe2+ we initiate a chain reaction for .OH formation. Our results show that there are two modes for H2O2 decomposition: (1) One electron transfer to give OH radicals and (2) Decomposition of H2O2 to H2O and O2 without intermediate .OH formation. This reaction depends strongly on the pH of the buffer. The H2O2 decomposition increases with increasing pH and increasing Co2+ concentration.
Additional chain-branching pathways in the low-temperature oxidation of branched alkanes
Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...
2015-12-31
Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less
Process for biological material carbon-carbon bond formation
Hollingsworth, R.I.; Jung, S.; Mindock, C.A.
1998-12-22
A process for providing vicinal dimethyl long chain between alkyl groups of organic compounds is described. The process uses intact or disrupted cells of various species of bacteria, particularly Thermoanaerobacter sp., Sarcina sp. and Butyrivibrio sp. The process can be conducted in an aqueous reaction mixture at room temperatures. 8 figs.
Process for biological material carbon-carbon bond formation
Hollingsworth, Rawle I.; Jung, Seunho; Mindock, Carol A.
1998-01-01
A process for providing vicinal dimethyl long chain between alkyl groups of organic compounds is described. The process uses intact or disrupted cells of various species of bacteria, particularly Thermoanaerobacter sp., Sarcina sp. and Butyrivibrio sp. The process can be conducted in an aqueous reaction mixture at room temperatures.
ELECTRON SPIN RESONANCE STUDIES ON PEROXIDE RADICALS IN IRRADIATED POLYPROPYLENE (in German)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, H.; Hellwege, K.-H.; Neudoerfl, P.
1963-06-01
Peroxide radicals are formed by oxidation of carbon radicals in irradiated isotactic polypropylene. An interpretation of their ESR spectra is given. The recombination of the peroxide radicals follows a chain reaction mechanism, which is derived from the reversibility of formation of peroxide radicals, the time dependence of their concentration, and from the oxygen consumption of samples containing peroxide radicals. The reactions are discussed in view of the radiation induced oxidative degradation of polypropylene. (auth)
NASA Astrophysics Data System (ADS)
Hori, T.; Takahashi, H.; Nitta, T.
2003-10-01
The proton transfer along the chain of hydrogen bonds is involved in many chemical reactions in aqueous solution and known to play a decisive role. We have performed the hybrid quantum chemical simulations for the methanol formation reaction catalyzed by the proton transfer mechanism [CH3Cl+nH2O→CH3OH+HCl+(n-1)H2O, n=3] in supercritical water (SCW) to investigate the role of water solvent on the reaction. In the simulation, the electronic state of the chemically active solutes (CH3Cl+3H2O) has been determined quantum mechanically, while the static water solvent has been represented by a classical model. The activation free energy for the water-catalytic reaction in SCW has been found to be 9.6 kcal/mol, which is much lower than that in the gas phase (29.2 kcal/mol). The fractional charge analysis has revealed that the notable charge separation in the solute complex takes place at the transition state (TS) and the resulting huge dipole gives rise to the considerable stabilization of the TS as compared to the reactant. It has been shown that the reaction assisted by the proton transfer mechanism is energetically much favored than the ionic SN2 reaction (CH3Cl+OH-→CH3OH+Cl-, 18.8 kcal/mol). The present calculations suggest that the proton migrations through the chain of hydrogen bonds can be regarded as a probable candidate responsible for the anomalous reactivities observed in SCW.
Antioxidant pool in beer and kinetics of EPR spin-trapping.
Kocherginsky, Nikolai M; Kostetski, Yuri Yu; Smirnov, Alex I
2005-08-24
The kinetics of spin-trap adduct formation in beer oxidation exhibits an induction period if the reaction is carried out at elevated temperatures and in the presence of air. This lag period lasts until the endogenous antioxidants are almost completely depleted, and its duration is used as an indicator of the flavor stability and shelf life of beer. This paper demonstrates that the total kinetics of the process can be characterized by three parameters-the lag period, the rate of spin-trap adduct formation, and, finally, the steady-state spin-adduct concentration. A steady-state chain reaction mechanism is described, and quantitative estimates of the main kinetic parameters such as the initiation rate, antioxidant pool, effective content of organic molecules participating in the chain reactions, and the rate constant of the 1-hydroxyethyl radical EtOH(*) spin-adduct disappearance are given. An additional new dimensionless parameter is suggested to characterize the antioxidant pool-the product of the lag time and the rate of spin-trap radical formation immediately after the lag time, normalized by the steady-state concentration of the adducts. The results of spin-tapping EPR experiments are compared with the nitroxide reduction kinetics measured in the same beer samples. It is shown that although the kinetics of nitroxide reduction in beer can be used to evaluate the reducing power of beer, the latter parameter does not correlate with the antioxidant pool. The relationship of free radical processes, antioxidant pool, reducing power, and beer staling is discussed.
Chemical Modification of Polysaccharides
Cumpstey, Ian
2013-01-01
This review covers methods for modifying the structures of polysaccharides. The introduction of hydrophobic, acidic, basic, or other functionality into polysaccharide structures can alter the properties of materials based on these substances. The development of chemical methods to achieve this aim is an ongoing area of research that is expected to become more important as the emphasis on using renewable starting materials and sustainable processes increases in the future. The methods covered in this review include ester and ether formation using saccharide oxygen nucleophiles, including enzymatic reactions and aspects of regioselectivity; the introduction of heteroatomic nucleophiles into polysaccharide chains; the oxidation of polysaccharides, including oxidative glycol cleavage, chemical oxidation of primary alcohols to carboxylic acids, and enzymatic oxidation of primary alcohols to aldehydes; reactions of uronic-acid-based polysaccharides; nucleophilic reactions of the amines of chitosan; and the formation of unsaturated polysaccharide derivatives. PMID:24151557
Benett, William J.; Richards, James B.
2003-01-01
A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.
Benett, William J.; Richards, James B.
2005-05-17
A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.
Formation of interstellar methanol ice prior to the heavy CO freeze-out stage
NASA Astrophysics Data System (ADS)
Qasim, D.; Chuang, K.-J.; Fedoseev, G.; Ioppolo, S.; Boogert, A. C. A.; Linnartz, H.
2018-04-01
Context. The formation of methanol (CH3OH) on icy grain mantles during the star formation cycle is mainly associated with the CO freeze-out stage. Yet there are reasons to believe that CH3OH also can form at an earlier period of interstellar ice evolution in CO-poor and H2O-rich ices. Aims: This work focuses on CH3OH formation in a H2O-rich interstellar ice environment following the OH-mediated H-abstraction in the reaction, CH4 + OH. Experimental conditions are systematically varied to constrain the CH3OH formation yield at astronomically relevant temperatures. Methods: CH4, O2, and hydrogen atoms are co-deposited in an ultrahigh vacuum chamber at 10-20 K. OH radicals are generated by the H + O2 surface reaction. Temperature programmed desorption - quadrupole mass spectrometry (TPD-QMS) is used to characterize CH3OH formation, and is complemented with reflection absorption infrared spectroscopy (RAIRS) for CH3OH characterization and quantitation. Results: CH3OH formation is shown to be possible by the sequential surface reaction chain, CH4 + OH → CH3 + H2O and CH3 + OH → CH3OH at 10-20 K. This reaction is enhanced by tunneling, as noted in a recent theoretical investigation Lamberts et al. (2017, A&A, 599, A132). The CH3OH formation yield via the CH4 + OH route versus the CO + H route is approximately 20 times smaller for the laboratory settings studied. The astronomical relevance of the new formation channel investigated here is discussed.
Copolymer Synthesis and Characterization by Post-Polymerization Modification
NASA Astrophysics Data System (ADS)
Galvin, Casey James
This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.
Lim, Jae Kyu; Mayer, Florian; Kang, Sung Gyun; Müller, Volker
2014-01-01
Thermococcus onnurineus NA1 is known to grow by the anaerobic oxidation of formate to CO2 and H2, a reaction that operates near thermodynamic equilibrium. Here we demonstrate that this reaction is coupled to ATP synthesis by a transmembrane ion current. Formate oxidation leads to H+ translocation across the cytoplasmic membrane that then drives Na+ translocation. The ion-translocating electron transfer system is rather simple, consisting of only a formate dehydrogenase module, a membrane-bound hydrogenase module, and a multisubunit Na+/H+ antiporter module. The electrochemical Na+ gradient established then drives ATP synthesis. These data give a mechanistic explanation for chemiosmotic energy conservation coupled to formate oxidation to CO2 and H2. Because it is discussed that the membrane-bound hydrogenase with the Na+/H+ antiporter module are ancestors of complex I of mitochondrial and bacterial electron transport these data also shed light on the evolution of ion transport in complex I-like electron transport chains. PMID:25049407
Lim, Jae Kyu; Mayer, Florian; Kang, Sung Gyun; Müller, Volker
2014-08-05
Thermococcus onnurineus NA1 is known to grow by the anaerobic oxidation of formate to CO2 and H2, a reaction that operates near thermodynamic equilibrium. Here we demonstrate that this reaction is coupled to ATP synthesis by a transmembrane ion current. Formate oxidation leads to H(+) translocation across the cytoplasmic membrane that then drives Na(+) translocation. The ion-translocating electron transfer system is rather simple, consisting of only a formate dehydrogenase module, a membrane-bound hydrogenase module, and a multisubunit Na(+)/H(+) antiporter module. The electrochemical Na(+) gradient established then drives ATP synthesis. These data give a mechanistic explanation for chemiosmotic energy conservation coupled to formate oxidation to CO2 and H2. Because it is discussed that the membrane-bound hydrogenase with the Na(+)/H(+) antiporter module are ancestors of complex I of mitochondrial and bacterial electron transport these data also shed light on the evolution of ion transport in complex I-like electron transport chains.
NASA Technical Reports Server (NTRS)
Ding, P. Z.; Kawamura, K.; Ferris, J. P.
1996-01-01
The 5'-phosphorimidazolide of uridine reacts on Na(+)-montmorillonite 22A in aqueous solution to give oligomers as long as 7 mers. The maximum chain length increases to 9 mers and the overall oligomer yield increases when 9:1 ImpU, A5' ppA mixtures react under the same conditions. The oligomer yield and maximum chain length decreases with the structure of the added pyrophosphate in the order A5' ppA > A5' ppU > U5' ppU. Structure analysis of individual oligomer fractions was performed by selective enzymatic hydrolyses followed by HPLC analysis of the products. The regioselectivity for 3',5'-bond formation is 80-90% in the 9:1 ImpU, A5' ppA reaction, a percentage comparable to that observed in the 9:1 ImpA, A5' ppA reaction. Oligomerization of ImpU is inhibited by addition of dA5' ppdA, and MeppA. No oligomers containing A5' ppU were products of the 9:1 ImpU,A5' ppA reaction, a finding consistent with the simple addition of the ImpU to the A5' ppA and not the rearrangement of an ImpU-A5' ppA adduct. Concentrations of lysine or arginine which were close to that of the ImpU did not inhibit oligomer formation. Treatment of Na(+)-montmorillonite with 1 M arginine yielded arginine-montmorillonite, an amino acid-mineral adduct which did not catalyze ImpU oligomerization. Neither the 4-9 mers formed in the 9:1 ImpU, A5' ppA reaction nor the 4-9 mers formed by the base hydrolysis of poly(U) served as templates for the formation of oligo(A)s.
Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S
2014-12-19
The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.
USDA-ARS?s Scientific Manuscript database
Symptoms of abnormal proliferation of shoots resulting in formation of witches’ broom growths were observed in diseased plants of passion fruit (Passiflora edulis f. flavicarpa Deg.) in Brazil. RFLP analysis of 16S rRNA gene sequences amplified in polymerase chain reactions containing template DNAs...
Radical formation, chemical processing, and explosion of interstellar grains
NASA Technical Reports Server (NTRS)
Greenberg, J. M.
1976-01-01
The ultraviolet radiation in interstellar space is shown to create a sufficient steady-state density of free radicals in the grain mantle material consisting of oxygen, carbon, nitrogen, and hydrogen to satisfy the critical condition for initiation of chain reactions. The criterion for minimum critical particle size for maintaining the chain reaction is of the order of the larger grain sizes in a distribution satisfying the average extinction and polarization measures. The triggering of the explosion of interstellar grains leading to the ejection of complex interstellar molecules is shown to be most probable where the grains are largest and where radiation is suddenly introduced; i.e., in regions of new star formation. Similar conditions prevail at the boundaries between very dark clouds and H II regions. When the energy released by the chemical activity of the free radicals is inadequate to explode the grain, the resulting mantle material must consist of extremely large organic molecules which are much more resistant to the hostile environment of H II regions than the classical dirty-ice mantles made up of water, methane, and ammonia.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
Koga, Masafumi; Inada, Shinya; Shimizu, Sayoko; Hatazaki, Masahiro; Umayahara, Yutaka; Nishihara, Eijun
2015-01-01
Hb Himeji (β140Ala→Asp) is known as a variant hemoglobin in which glycation is enhanced and HbA1c measured by immunoassay shows a high value. The phenomenon of enhanced glycation in Hb Himeji is based on the fact that the glycation product of variant hemoglobin (HbX1c) shows a higher value than HbA1c. In this study, we investigated whether aldimine formation reaction, the first step of the Maillard early-phase reaction, is enhanced in Hb Himeji in vitro. Three non-diabetic subjects with Hb Himeji and four non-diabetic subjects without variant hemoglobin were enrolled. In order to examine aldimine formation reaction, whole blood cells were incubated with 500 mg/dl of glucose at 37°C for 1 hour and were analyzed by high-performance liquid chromatography. Both HbA1c and HbX1c were not increased in this condition. After incubation with glucose, labile HbA1c (LA1c) fraction increased in the controls (1.1±0.3%). In subjects with Hb Himeji increases in the labile HbX1c (LX1c) fraction as well as the LA1c fraction were observed, and the degree of increase in the LX1c fraction was significantly higher than that of the LA1c fraction (1.8±0.1% vs. 0.5±0.2%, P<0.01). We have shown for the first time that aldimine (LX1c) formation reaction might be enhanced in Hb Himeji in vitro. The 140th amino acid in β chain of hemoglobin is suggested to be involved in aldimine formation reaction. © 2015 by the Association of Clinical Scientists, Inc.
Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua
2017-11-01
In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.
Effect of Heterogeneous Chemical Reactions on the Köhler Activation of Aqueous Organic Aerosols.
Djikaev, Yuri S; Ruckenstein, Eli
2018-05-03
We study some thermodynamic aspects of the activation of aqueous organic aerosols into cloud droplets considering the aerosols to consist of liquid solution of water and hydrophilic and hydrophobic organic compounds, taking into account the presence of reactive species in the air. The hydrophobic (surfactant) organic molecules on the surface of such an aerosol can be processed by chemical reactions with some atmospheric species; this affects the hygroscopicity of the aerosol and hence its ability to become a cloud droplet either via nucleation or via Köhler activation. The most probable pathway of such processing involves atmospheric hydroxyl radicals that abstract hydrogen atoms from hydrophobic organic molecules located on the aerosol surface (first step), the resulting radicals being quickly oxidized by ubiquitous atmospheric oxygen molecules to produce surface-bound peroxyl radicals (second step). These two reactions play a crucial role in the enhancement of the Köhler activation of the aerosol and its evolution into a cloud droplet. Taking them and a third reaction (next in the multistep chain of relevant heterogeneous reactions) into account, one can derive an explicit expression for the free energy of formation of a four-component aqueous droplet on a ternary aqueous organic aerosol as a function of four independent variables of state of a droplet. The results of numerical calculations suggest that the formation of cloud droplets on such (aqueous hydrophilic/hydrophobic organic) aerosols is most likely to occur as a Köhler activation-like process rather than via nucleation. The model allows one to determine the threshold parameters of the system necessary for the Köhler activation of such aerosols, which are predicted to be very sensitive to the equilibrium constant of the chain of three heterogeneous reactions involved in the chemical aging of aerosols.
Yommee, Suriyakit; Bozzelli, Joseph W
2016-01-28
Cyclopentadienone has one carbonyl and two olefin groups resulting in 4n + 2 π-electrons in a cyclic five-membered ring structure. Thermochemical and kinetic parameters for the initial reactions of cyclopentadienone radicals with O2 and the thermochemical properties for cyclopentadienone-hydroperoxides, alcohols, and alkenyl, alkoxy, and peroxy radicals were determined by use of computational chemistry. The CBS-QB3 composite and B3LYP density functional theory methods were used to determine the enthalpies of formation (ΔfH°298) using the isodesmic reaction schemes with several work reactions for each species. Entropy and heat capacity, S°(T) and Cp°(T) (50 K ≤ T ≤ 5000 K) are determined using geometric parameters, internal rotor potentials, and frequencies from B3LYP/6-31G(d,p) calculations. Standard enthalpies of formation are reported for parent molecules as cyclopentadienone, cyclopentadienone with alcohol, hydroperoxide substituents, and the cyclopentadienone-yl vinylic, alkoxy, and peroxy radicals corresponding to loss of a hydrogen atom from the carbon and oxygen sites. Entropy and heat capacity vs temperature also are reported for the parent molecules and for radicals. The thermochemical analysis shows The R(•) + O2 well depths are deep, on the order of 50 kcal mol(-1), and the R(•) + O2 reactions to RO + O (chain branching products) for cyclopentadienone-2-yl and cyclopentadienone-3-yl have unusually low reaction (ΔHrxn) enthalpies, some 20 or so kcal/mol below the entrance channels. Chemical activation kinetics using quantum RRK analysis for k(E) and master equation for falloff are used to show that significant chain branching as a function of temperature and pressure can occur when these vinylic radicals are formed.
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
1,2-diketones promoted degradation of poly(epsilon-caprolactone)
NASA Astrophysics Data System (ADS)
Danko, Martin; Borska, Katarina; Ragab, Sherif Shaban; Janigova, Ivica; Mosnacek, Jaroslav
2012-07-01
Photochemical reactions of Benzil and Camphorquinone were used for modification of poly(ɛ-caprolactone) polymer films. Photochemistry of dopants was followed by infrared spectroscopy, changes on polymer chains of matrix were followed by gel permeation chromatography. Benzoyl peroxide was efficiently photochemically generated from benzyl in solid polymer matrix in the presence of air. Following decomposition of benzoyl peroxide led to degradation of matrix. Photochemical transformation of benzil in vacuum led to hydrogen abstraction from the polymer chains in higher extent, which resulted to chains recombination and formation of gel. Photochemical transformation of camphorquinone to corresponding camphoric peroxide was not observed. Only decrease of molecular weight of polymer matrix doped with camphorquinone was observed during the irradiation.
Kempkes, L J M; Boles, G C; Martens, J; Berden, G; Armentrout, P B; Oomens, J
2018-03-08
Peptide deamidation of asparaginyl residues is a spontaneous post-translational modification that is believed to play a role in aging and several diseases. It is also a well-known small-molecule loss channel in the MS/MS spectra of protonated peptides. Here we investigate the deamidation reaction, as well as other decomposition pathways, of the protonated dipeptide asparagine-valine ([AsnVal + H] + ) upon low-energy activation in a mass spectrometer. Using a combination of infrared ion spectroscopy, guided ion beam tandem mass spectrometry, and theoretical calculations, we have been able to identify product ion structures and determine the energetics and mechanisms for decomposition. Deamidation proceeds via ammonia loss from the asparagine side chain, initiated by a nucleophilic attack of the peptide bond oxygen on the γ-carbon of the Asn side chain. This leads to the formation of a furanone ring containing product ion characterized by a threshold energy of 129 ± 5 kJ/mol (15 kJ/mol higher in energy than dehydration of [AsnVal + H] + , the lowest energy dissociation channel available to the system). Competing formation of a succinimide ring containing product, as has been observed for protonated asparagine-glycine ([AsnGly + H] + ) and asparagine-alanine ([AsnAla + H] + ), was not observed here. Quantum-chemical modeling of the reaction pathways confirms these subtle differences in dissociation behavior. Measured reaction thresholds are in agreement with predicted theoretical reaction energies computed at several levels of theory.
Mahrwald, R
2015-09-21
The aggressive and strong development of organocatalysis provides several protocols for the convenient utilization of the carbonyl function of unprotected carbohydrates in C-C-bond formation processes. These amine-catalyzed mechanisms enable multiple cascade-protocols for the synthesis of a wide range of carbohydrate-derived compound classes. Several, only slightly different protocols, have been developed for the application of 1,3-dicarbonyl compounds in the stereoselective chain-elongation of unprotected carbohydrates and the synthesis of highly functionalized C-glycosides of defined configuration. In addition, C-glycosides can also be accessed by amine-catalyzed reactions with methyl ketones. By a one-pot cascade reaction of isocyanides with unprotected aldoses and amino acids access to defined configured glycopeptide mimetics is achieved. Depending on the reaction conditions different origins to control the installation of configuration during the bond-formation process were observed.
Li, Yang; Hong, Jiali; Wei, Renjian; Zhang, Yingying; Tong, Zaizai; Zhang, Xinghong; Du, Binyang; Xu, Junting; Fan, Zhiqiang
2015-02-01
It is a long-standing challenge to combine mixed monomers into multiblock copolymer (MBC) in a one-pot/one-step polymerization manner. We report the first example of MBC with biodegradable polycarbonate and polyester blocks that were synthesized from highly efficient one-pot/one-step polymerization of cyclohexene oxide (CHO), CO 2 and ε-caprolactone (ε-CL) in the presence of zinc-cobalt double metal cyanide complex and stannous octoate. In this protocol, two cross-chain exchange reactions (CCER) occurred at dual catalysts respectively and connected two independent chain propagation procedures ( i.e. , polycarbonate formation and polyester formation) simultaneously in a block-by-block manner, affording MBC without tapering structure. The multiblock structure of MBC was determined by the rate ratio of CCER to the two chain propagations and could be simply tuned by various kinetic factors. This protocol is also of significance due to partial utilization of renewable CO 2 and improved mechanical properties of the resultant MBC.
Kuang, Qun F; Abebe, Adal; Evans, Jason; Sugumaran, Manickam
2017-08-01
Tunichromes are 1,2-dehydrodopa containing bioactive peptidyl derivatives found in blood cells of several tunicates. They have been implicated in metal sequestering, tunic formation, wound healing and defense reaction. Earlier studies conducted on these compounds indicate their extreme liability, high reactivity and easy oxidative polymerization. Their reactions are also complicated by the presence of multiple dehydrodopyl units. Since they have been invoked in crosslinking and covalent binding, to understand the reactivities of these novel compounds, we have taken a simple model compound that possess the tunichrome reactive group viz., 1,2-dehydro-N-acetyldopamine (Dehydro NADA) and examined its reaction with N-acetylcysteine in presence of oxygen under both enzymatic and nonenzymatic conditions. Ultraviolet and visible spectral studies of reaction mixtures containing dehydro NADA and N-acetylcysteine in different molar ratios indicated the production of side chain and ring adducts of N-acetylcysteine to dehydro NADA. Liquid chromatography and mass spectral studies supported this contention and confirmed the production of several different products. Mass spectral analysis of these products show the potentials of dehydro NADA to form side chain adducts that can lead to polymeric products. This is the first report demonstrating the ability of dehydro dopyl units to form adducts and crosslinks with amino acid side chains. Copyright © 2017 Elsevier Inc. All rights reserved.
Catalytic strategy for carbon−carbon bond scission by the cytochrome P450 OleT
Grant, Job L.; Mitchell, Megan E.; Makris, Thomas Michael
2016-01-01
OleT is a cytochrome P450 that catalyzes the hydrogen peroxide-dependent metabolism of Cn chain-length fatty acids to synthesize Cn-1 1-alkenes. The decarboxylation reaction provides a route for the production of drop-in hydrocarbon fuels from a renewable and abundant natural resource. This transformation is highly unusual for a P450, which typically uses an Fe4+−oxo intermediate known as compound I for the insertion of oxygen into organic substrates. OleT, previously shown to form compound I, catalyzes a different reaction. A large substrate kinetic isotope effect (≥8) for OleT compound I decay confirms that, like monooxygenation, alkene formation is initiated by substrate C−H bond abstraction. Rather than finalizing the reaction through rapid oxygen rebound, alkene synthesis proceeds through the formation of a reaction cycle intermediate with kinetics, optical properties, and reactivity indicative of an Fe4+−OH species, compound II. The direct observation of this intermediate, normally fleeting in hydroxylases, provides a rationale for the carbon−carbon scission reaction catalyzed by OleT. PMID:27555591
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Controllable conversion of quasi-freestanding polymer chains to graphene nanoribbons
NASA Astrophysics Data System (ADS)
Ma, Chuanxu; Xiao, Zhongcan; Zhang, Honghai; Liang, Liangbo; Huang, Jingsong; Lu, Wenchang; Sumpter, Bobby G.; Hong, Kunlun; Bernholc, J.; Li, An-Ping
2017-03-01
In the bottom-up synthesis of graphene nanoribbons (GNRs) from self-assembled linear polymer intermediates, surface-assisted cyclodehydrogenations usually take place on catalytic metal surfaces. Here we demonstrate the formation of GNRs from quasi-freestanding polymers assisted by hole injections from a scanning tunnelling microscope (STM) tip. While catalytic cyclodehydrogenations typically occur in a domino-like conversion process during the thermal annealing, the hole-injection-assisted reactions happen at selective molecular sites controlled by the STM tip. The charge injections lower the cyclodehydrogenation barrier in the catalyst-free formation of graphitic lattices, and the orbital symmetry conservation rules favour hole rather than electron injections for the GNR formation. The created polymer-GNR intraribbon heterostructures have a type-I energy level alignment and strongly localized interfacial states. This finding points to a new route towards controllable synthesis of freestanding graphitic layers, facilitating the design of on-surface reactions for GNR-based structures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Hua; Zhou, Feng; Ren, Gerui
In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less
NASA Astrophysics Data System (ADS)
Han, Yuemei; Kawamura, Kimitaka; Chen, Qingcai; Mochida, Michihiro
2016-02-01
A laboratory study on the heterogeneous reactions of straight-chain aldehydes was performed by exposing n-octanal, nonanal, and decanal vapors to ambient aerosol particles. The aerosol and blank filters were extracted using methanol. The extracts were nebulized and the resulting compositions were examined using a high-resolution time-of-flight aerosol mass spectrometer. The mass spectral analysis showed that the exposures of the aldehydes to aerosol samples increased the peak intensities in the high mass range. The peaks in the mass spectra of the aerosol samples after exposure to different aldehydes were characterized by a homologous series of peak shifts due to the addition of multiple CH2 units. This result is explained by the formation of high-molecular-weight (HMW) compounds that contain single or multiple aldehyde moieties. The HMW fragment peaks for the blank filters exposed to n-aldehydes were relatively weak, indicating an important contribution from the ambient aerosol components to the formation of the HMW compounds. Among the factors affecting the overall interaction of aldehydes with atmospheric aerosol components, gas phase diffusion possibly limited the reactions under the studied conditions; therefore, their occurrence to a similar degree in the atmosphere is not ruled out, at least for the reactions involving n-nonanal and decanal. The major formation pathways for the observed HMW products may be the self-reactions of n-aldehydes mediated by atmospheric aerosol components and the reactions of n-aldehydes with organic aerosol components. The observed formation of HMW compounds encourages further investigations into their effects on the aerosol properties as well as the organic aerosol mass in the atmosphere.
2016-01-01
Hemozoin is a unique biomineral that results from the sequestration of toxic free heme liberated as a consequence of hemoglobin degradation in the malaria parasite. Synthetic neutral lipid droplets (SNLDs) and phospholipids were previously shown to support the rapid formation of β-hematin, abiological hemozoin, under physiologically relevant pH and temperature, though the mechanism by which heme crystallization occurs remains unclear. Detergents are particularly interesting as a template because they are amphiphilic molecules that spontaneously organize into nanostructures and have been previously shown to mediate β-hematin formation. Here, 11 detergents were investigated to elucidate the physicochemical properties that best recapitulate crystal formation in the parasite. A strong correlation between the detergent’s molecular structure and the corresponding kinetics of β-hematin formation was observed, where higher molecular weight polar chains promoted faster reactions. The larger hydrophilic chains correlated to the detergent’s ability to rapidly sequester heme into the lipophilic core, allowing for crystal nucleation to occur. The data presented here suggest that detergent nanostructures promote β-hematin formation in a similar manner to SNLDs and phospholipids. Through understanding mediator properties that promote optimal crystal formation, we are able to establish an in vitro assay to probe this drug target pathway. PMID:27175104
Structure and Reaction Mechanism of Basil Eugenol Synthase
Louie, Gordon V.; Baiga, Thomas J.; Bowman, Marianne E.; Koeduka, Takao; Taylor, John H.; Spassova, Snejina M.; Pichersky, Eran; Noel, Joseph P.
2007-01-01
Phenylpropenes, a large group of plant volatile compounds that serve in multiple roles in defense and pollinator attraction, contain a propenyl side chain. Eugenol synthase (EGS) catalyzes the reductive displacement of acetate from the propenyl side chain of the substrate coniferyl acetate to produce the allyl-phenylpropene eugenol. We report here the structure determination of EGS from basil (Ocimum basilicum) by protein x-ray crystallography. EGS is structurally related to the short-chain dehydrogenase/reductases (SDRs), and in particular, enzymes in the isoflavone-reductase-like subfamily. The structure of a ternary complex of EGS bound to the cofactor NADP(H) and a mixed competitive inhibitor EMDF ((7S,8S)-ethyl (7,8-methylene)-dihydroferulate) provides a detailed view of the binding interactions within the EGS active site and a starting point for mutagenic examination of the unusual reductive mechanism of EGS. The key interactions between EMDF and the EGS-holoenzyme include stacking of the phenyl ring of EMDF against the cofactor's nicotinamide ring and a water-mediated hydrogen-bonding interaction between the EMDF 4-hydroxy group and the side-chain amino moiety of a conserved lysine residue, Lys132. The C4 carbon of nicotinamide resides immediately adjacent to the site of hydride addition, the C7 carbon of cinnamyl acetate substrates. The inhibitor-bound EGS structure suggests a two-step reaction mechanism involving the formation of a quinone-methide prior to reduction. The formation of this intermediate is promoted by a hydrogen-bonding network that favors deprotonation of the substrate's 4-hydroxyl group and disfavors binding of the acetate moiety, akin to a push-pull catalytic mechanism. Notably, the catalytic involvement in EGS of the conserved Lys132 in preparing the phenolic substrate for quinone methide formation through the proton-relay network appears to be an adaptation of the analogous role in hydrogen bonding played by the equivalent lysine residue in other enzymes of the SDR family. PMID:17912370
1,2-diketones promoted degradation of poly(epsilon-caprolactone)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Danko, Martin; Borska, Katarina; Ragab, Sherif Shaban
2012-07-11
Photochemical reactions of Benzil and Camphorquinone were used for modification of poly({epsilon}-caprolactone) polymer films. Photochemistry of dopants was followed by infrared spectroscopy, changes on polymer chains of matrix were followed by gel permeation chromatography. Benzoyl peroxide was efficiently photochemically generated from benzyl in solid polymer matrix in the presence of air. Following decomposition of benzoyl peroxide led to degradation of matrix. Photochemical transformation of benzil in vacuum led to hydrogen abstraction from the polymer chains in higher extent, which resulted to chains recombination and formation of gel. Photochemical transformation of camphorquinone to corresponding camphoric peroxide was not observed. Only decreasemore » of molecular weight of polymer matrix doped with camphorquinone was observed during the irradiation.« less
Measurement of peroxy radicals in the urban atmosphere by PERCA-LIF technique
NASA Astrophysics Data System (ADS)
Sadanaga, Y.; Matsumoto, J.; Sakurai, K.; Kato, S.; Nomaguchi, T.; Bandow, H.; Kajii, Y.
2002-12-01
A new instrument has been developed for measuring peroxy radicals (RO2) using the Chemical Amplifier-Laser Induced Fluorescence (PERCA-LIF) technique. RO2 was converted to NO2 via a chain reaction by the addition of NO and CO in a 1/4" Teflon tube. NO2 was detected by LIF using Nd:YAG laser (532 nm, 5W at 10kHz). More selective detection of NO2 is enabled by the LIF than by luminol chemiluminescence because of free from the interference by other oxidants when using luminol. LIF technique can be more sensitive detection of NO2 than the luminol detector. Optimum conditions were investigated by varying reaction time (i.e. the length of reaction tube) and the concentrations of NO and CO. Maximum chain length of approximately 300 was obtained in dry conditions using a H2O/O2 simultaneous photolysis method. Experiments were performed to characterize the dependence of the chain length on humidity for this instrument. In August 2002, RO2 measurements were performed in Osaka using this method. Maximum concentrations of RO2 in the daytime were approximately 100 pptv. Nighttime observations were also conducted and significant concentrations of RO2 were detected just after the sunset. Existence of formation processes in the dark condition was investigated.
Simple model of inhibition of chain-branching combustion processes
NASA Astrophysics Data System (ADS)
Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.
2017-11-01
A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.
NASA Astrophysics Data System (ADS)
Oǧuz, Ismail-Can; Mineva, Tzonka; Guesmi, Hazar
2018-01-01
The reactivity of various Pd ensembles on the Au—Pd(100) alloy catalyst toward CO oxidation was investigated by using density functional theory (DFT). This study was prompted by the search for efficient catalysts operating at low temperature for the CO oxidation reaction that is of primary environmental importance. To this aim, we considered Pd modified Au(100) surfaces including Pd monomers, Pd dimers, second neighboring Pd atoms, and Pd chains in a comparative study of the minimum energy reaction pathways. The effect of dispersion interactions was included in the calculations of the O2 dissociation reaction pathway by using the DFT-D3 scheme. The addition of the dispersion interaction strongly improves the adsorption ability of O2 on the Au—Pd surface but does not affect the activation energy barriers of the Transitions States (TSs). As for O2 to dissociate, it is imperative that the TS has lower activation energy than the O2 desorption energy. DFT-D3 is found to favor, in some cases, O2 dissociation on configurations being identified from uncorrected DFT calculations as inactive. This is the case of the second neighboring Pd configuration for which uncorrected DFT predicts positive Gibbs free energy (ΔG) of the O2 adsorption, therefore an endergonic reaction. With the addition of D3 correction, ΔG becomes negative that reveals a spontaneous O2 adsorption. Among the investigated Au—Pd (100) ensembles, the Pd chain dissociates most easily O2 and highly stabilizes the dissociated O atoms; however, it has an inferior reactivity toward CO oxidation and CO2 formation. Indeed, CO strongly adsorbs on the palladium bridge sites and therefore poisoning the surface Pd chain. By contrast, the second neighboring Pd configuration that shows somewhat lower ability to dissociate O2 turns out to be more reactive in the CO2 formation step. These results evidence the complex effect of Pd ensembles on the CO oxidation reaction. Associative CO oxidation proceeds with high energy barriers on all the considered Pd ensembles and should be excluded, in agreement with experimental observations.
USDA-ARS?s Scientific Manuscript database
Chitin, a polymer of beta-1,4-linked N-acetylglucosamine (GlcNAc), is a key component of the cell walls of fungi and the exoskeletons of arthropods. Chitin synthases (CSs) transfer GlcNAc from UDP-GlcNAc to pre-existing chitin chains in reactions that are typically stimulated by free GlcNAc. The eff...
Vallelian, Florence; Garcia-Rubio, Ines; Puglia, Michele; Kahraman, Abdullah; Deuel, Jeremy W; Engelsberger, Wolfgang R; Mason, Ronald P; Buehler, Paul W; Schaer, Dominik J
2015-08-01
Extracellular or free hemoglobin (Hb) accumulates during hemolysis, tissue damage, and inflammation. Heme-triggered oxidative reactions can lead to diverse structural modifications of lipids and proteins, which contribute to the propagation of tissue damage. One important target of Hb׳s peroxidase reactivity is its own globin structure. Amino acid oxidation and crosslinking events destabilize the protein and ultimately cause accumulation of proinflammatory and cytotoxic Hb degradation products. The Hb scavenger haptoglobin (Hp) attenuates oxidation-induced Hb degradation. In this study we show that in the presence of hydrogen peroxide (H2O2), Hb and the Hb:Hp complex share comparable peroxidative reactivity and free radical generation. While oxidation of both free Hb and Hb:Hp complex generates a common tyrosine-based free radical, the spin-trapping reaction with 5,5-dimethyl-1-pyrroline N-oxide (DMPO) yields dissimilar paramagnetic products in Hb and Hb:Hp, suggesting that radicals are differently redistributed within the complex before reacting with the spin trap. With LC-MS(2) mass spectrometry we assigned multiple known and novel DMPO adduct sites. Quantification of these adducts suggested that the Hb:Hp complex formation causes extensive delocalization of accessible free radicals with drastic reduction of the major tryptophan and cysteine modifications in the β-globin chain of the Hb:Hp complex, including decreased βCys93 DMPO adduction. In contrast, the quantitative changes in DMPO adduct formation on Hb:Hp complex formation were less pronounced in the Hb α-globin chain. In contrast to earlier speculations, we found no evidence that free Hb radicals are delocalized to the Hp chain of the complex. The observation that Hb:Hp complex formation alters free radical distribution in Hb may help to better understand the structural basis for Hp as an antioxidant protein. Copyright © 2015 Elsevier Inc. All rights reserved.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Chain-reaction crash in traffic flow controlled by taillights
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2015-02-01
We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.
Self-Healing of Unentangled Polymer Networks with Reversible Bonds
Stukalin, Evgeny B.; Cai, Li-Heng; Kumar, N. Arun; Leibler, Ludwik; Rubinstein, Michael
2013-01-01
Self-healing polymeric materials are systems that after damage can revert to their original state with full or partial recovery of mechanical strength. Using scaling theory we study a simple model of autonomic self-healing of unentangled polymer networks. In this model one of the two end monomers of each polymer chain is fixed in space mimicking dangling chains attachment to a polymer network, while the sticky monomer at the other end of each chain can form pairwise reversible bond with the sticky end of another chain. We study the reaction kinetics of reversible bonds in this simple model and analyze the different stages in the self-repair process. The formation of bridges and the recovery of the material strength across the fractured interface during the healing period occur appreciably faster after shorter waiting time, during which the fractured surfaces are kept apart. We observe the slowest formation of bridges for self-adhesion after bringing into contact two bare surfaces with equilibrium (very low) density of open stickers in comparison with self-healing. The primary role of anomalous diffusion in material self-repair for short waiting times is established, while at long waiting times the recovery of bonds across fractured interface is due to hopping diffusion of stickers between different bonded partners. Acceleration in bridge formation for self-healing compared to self-adhesion is due to excess non-equilibrium concentration of open stickers. Full recovery of reversible bonds across fractured interface (formation of bridges) occurs after appreciably longer time than the equilibration time of the concentration of reversible bonds in the bulk. PMID:24347684
Umehara, K; Kudo, S; Hirao, Y; Morita, S; Uchida, M; Odomi, M; Miyamoto, G
2000-08-01
The metabolism of 1-(3,4-dichlorobenzyl)-5-octylbiguanide (OPB-2045), a new potent biguanide antiseptic, was investigated using rat and dog liver preparations to elucidate the mechanism of OPB-2045 metabolite formation, in which the octyl side chain is reduced to four, five, or six carbon atoms. Chemical structures of metabolites were characterized by 1H NMR, fast atom bombardment/mass spectrometry, and liquid chromatography/electrospray ionization-tandem mass spectrometry. Three main metabolites were observed during incubation of OPB-2045 with rat liver S9: 2-octanol (M-1), 3-octanol (M-2), and 4-octanol (M-3). In the incubation of OPB-2045 with dog liver S9, eight metabolites were observed, seven of which being M-1, M-2, M-3, 2-octanone (M-4), threo-2,3-octandiol (M-5), erythro-2,3-octandiol (M-6), and 1,2-octandiol (M-7). M-5 and M-6 were further biotransformed to a ketol derivative and C-C bond cleavage metabolite (hexanoic acid derivative), an in vivo end product, in the incubation with dog liver microsomes. The reactions required NADPH as a cofactor and were significantly inhibited by the various inhibitors of cytochrome P450 (i.e., CO, n-octylamine, SKF 525-A, metyrapone, and alpha-naphthoflavone). The results indicate that the degraded products of OPB-2045 are produced by C-C bond cleavage after monohydroxylation, dihydroxylation, and ketol formation at the site of the octyl side chain with possible involvement of cytochrome P450 systems. This aliphatic C-C bond cleavage by sequential oxidative reactions may play an important role in the metabolism of other drugs or endogenous compounds that possess aliphatic chains.
Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?
Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D
2016-07-14
The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres.
Endogenous ethanol affects biopolyester molecular weight in recombinant Escherichia coli.
Hiroe, Ayaka; Hyakutake, Manami; Thomson, Nicholas M; Sivaniah, Easan; Tsuge, Takeharu
2013-11-15
In biopolyester synthesis, polyhydroxyalkanoate (PHA) synthase (PhaC) catalyzes the polymerization of PHA in bacterial cells, followed by a chain transfer (CT) reaction in which the PHA polymer chain is transferred from PhaC to a CT agent. Accordingly, the frequency of CT reaction determines PHA molecular weight. Previous studies have shown that exogenous alcohols are effective CT agents. This study aimed to clarify the effect of endogenous ethanol as a CT agent for poly[(R)-3-hydroxybutyrate] [P(3HB)] synthesis in recombinant Escherichia coli, by comparing with that of exogenous ethanol. Ethanol supplementation to the culture medium reduced P(3HB) molecular weights by up to 56% due to ethanol-induced CT reaction. NMR analysis of P(3HB) polymers purified from the culture supplemented with (13)C-labeled ethanol showed the formation of a covalent bond between ethanol and P(3HB) chain at the carboxyl end. Cultivation without ethanol supplementation resulted in the reduction of P(3HB) molecular weight with increasing host-produced ethanol depending on culture aeration. On the other hand, production in recombinant BW25113(ΔadhE), an alcohol dehydrogenase deletion strain, resulted in a 77% increase in molecular weight. Analysis of five E. coli strains revealed that the estimated number of CT reactions was correlated with ethanol production. These results demonstrate that host-produced ethanol acts as an equally effective CT agent as exogenous ethanol, and the control of ethanol production is important to regulate the PHA molecular weight.
Sotelo, Pablo H.; Collazo, Noberto; Zuñiga, Roberto; Gutiérrez-González, Matías; Catalán, Diego; Ribeiro, Carolina Hager; Aguillón, Juan Carlos; Molina, María Carmen
2012-01-01
Phage display library technology is a common method to produce human antibodies. In this technique, the immunoglobulin variable regions are displayed in a bacteriophage in a way that each filamentous virus displays the product of a single antibody gene on its surface. From the collection of different phages, it is possible to isolate the virus that recognizes specific targets. The most common form in which to display antibody variable regions in the phage is the single chain variable fragment format (scFv), which requires assembly of the heavy and light immunoglobulin variable regions in a single gene. In this work, we describe a simple and efficient method for the assembly of immunoglobulin heavy and light chain variable regions in a scFv format. This procedure involves a two-step reaction: (1) DNA amplification to produce the single strand form of the heavy or light chain gene required for the fusion; and (2) mixture of both single strand products followed by an assembly reaction to construct a complete scFv gene. Using this method, we produced 6-fold more scFv encoding DNA than the commonly used splicing by overlap extension PCR (SOE-PCR) approach. The scFv gene produced by this method also proved to be efficient in generating a diverse scFv phage display library. From this scFv library, we obtained phages that bound several non-related antigens, including recombinant proteins and rotavirus particles. PMID:22692130
Bessaire, Thomas; Tarres, Adrienne; Stadler, Richard H; Delatour, Thierry
2014-01-01
This study is the first to examine the role of choline and glycine betaine, naturally present in some foods, in particular in cereal grains, to generate N,N-dimethylpiperidinium (mepiquat) under Maillard conditions via transmethylation reactions involving the nucleophile piperidine. The formation of mepiquat and its intermediates piperidine - formed by cyclisation of free lysine in the presence of reducing sugars - and N-methylpiperidine were monitored over time (240°C, up to 180 min) using high-resolution mass spectrometry in a model system comprised of a ternary mixture of lysine/fructose/alkylating agent (choline or betaine). The reaction yield was compared with data recently determined for trigonelline, a known methylation agent present naturally in coffee beans. The role of choline and glycine betaine in nucleophilic displacement reactions was further supported by experiments carried out with stable isotope-labelled precursors (¹³C- and deuterium-labelled). The results unequivocally demonstrated that the piperidine ring of mepiquat originates from the carbon chain of lysine, and that either choline or glycine betaine furnishes the N-methyl groups. The kinetics of formation of the corresponding demethylated products of both choline and glycine betaine, N,N-demethyl-2-aminoethanol and N,N-dimethylglycine, respectively, were also determined using high-resolution mass spectrometry.
Effect of perception irregularity on chain-reaction crash in low visibility
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2015-06-01
We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.
Viscosity Relaxation in Molten HgZnTe
NASA Technical Reports Server (NTRS)
Su, Ching-Hua; Lehoczky, S. L.; Kim, Yeong Woo; Baird, James K.; Whitaker, Ann F. (Technical Monitor)
2001-01-01
Rotating cup measurements of the viscosity of the pseudo-binary melt, HgZnTe have shown that the isothermal liquid with zinc mole fraction 0.16 requires tens of hours of equilibration time before a steady viscous state can be achieved. Over this relaxation period, the viscosity at 790 C increases by a factor of two, while the viscosity at 810 C increases by 40%. Noting that the Group VI elements tend to polymerize when molten, we suggest that the viscosity of the melt is enhanced by the slow formation of Te atom chains. To explain the build-up of linear Te n-mers, we propose a scheme, which contains formation reactions with second order kinetics that increase the molecular weight, and decomposition reactions with first order kinetics that inactivate the chains. The resulting rate equations can be solved for the time dependence of each molecular weight fraction. Using these molecular weight fractions, we calculate the time dependence of the average molecular weight. Using the standard semi-empirical relation between polymer average molecular weight and viscosity, we then calculate the viscosity relaxation curve. By curve fitting, we find that the data imply that the rate constant for n-mer formation is much smaller than the rate constant for n-mer deactivation, suggesting that Te atoms only weakly polymerize in molten HgZnTe. The steady state toward which the melt relaxes occurs as the rate of formation of an n-mer becomes exactly balanced by the sum of the rate for its deactivation and the rate for its polymerization to form an (n+1)-mer.
Seidler, Konstanze; Griesser, Markus; Kury, Markus; Reghunathan, Harikrishna; Dorfinger, Peter; Koch, Thomas; Svirkova, Anastasiya; Marchetti-Deschmann, Martina; Stampfl, Jürgen; Moszner, Norbert; Gorsche, Christian; Liska, Robert
2018-05-04
Photoinitiated radical polymer network formation is lacking freedom for tailored network design. Resulting inhomogeneous network architectures and brittle material behavior of such glassy-type networks limit the commercial application of photopolymers in 3D printing, biomedicine or microelectronics. An ester-activated vinyl sulfonate ester (EVS) is presented for the rapid formation of tailored methacrylate-based networks with nearly no retardation, reduced shrinkage stress, high monomer conversion and improved material toughness. Laser flash photolysis followed by theoretical calculations and photoreactor studies elucidate the fast chain transfer reaction and exceptional regulating ability of EVS. Final photopolymer networks exhibit high tensile strength, improved elongation at break and high impact resistance, while maintaining high modulus and hardness at ambient conditions. These findings make EVS an exceptional candidate for the 3D printing of tough photopolymers. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chain-reaction crash on a highway in high visibility
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2016-05-01
We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.
Effect of vehicular size on chain-reaction crash
NASA Astrophysics Data System (ADS)
Nagatani, Takashi
2015-11-01
We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.
Kinetic aspects of chain growth in Fischer-Tropsch synthesis.
Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M
2017-04-28
Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.
Solvent-Free Lipase-Catalyzed Synthesis of Diacylgycerols as Low-Calorie Food Ingredients.
Vázquez, Luis; González, Noemí; Reglero, Guillermo; Torres, Carlos
2016-01-01
Problems derived from obesity and overweight have recently promoted the development of fat substitutes and other low-calorie foods. On the one hand, fats with short- and medium-chain fatty acids are a source of quick energy, easily hydrolyzable and hardly stored as fat. Furthermore, 1,3-diacylglycerols are not hydrolyzed to 2-monoacylglycerols in the gastrointestinal tract, reducing the formation of chylomicron and lowers the serum level of triacylglycerols by decreasing its resynthesis in the enterocyte. In this work, these two effects were combined to synthesize short- and medium-chain 1,3-diacylglycerols, leading to a product with great potential as for their low-calorie properties. Lipase-catalyzed transesterification reactions were performed between short- and medium-chain fatty acid ethyl esters and glycerol. Different variables were investigated, such as the type of biocatalyst, the molar ratio FAEE:glycerol, the adsorption of glycerol on silica gel, or the addition of lecithin. Best reaction conditions were evaluated considering the percentage of 1,3-DAG produced and the reaction rate. Except Novozym 435 (Candida antarctica), other lipases required the adsorption of glycerol on silica gel to form acylglycerols. Lipases that gave the best results with adsorption were Novozym 435 and Lipozyme RM IM (Rhizomucor miehei) with 52 and 60.7% DAG at 32 h, respectively. Because of its specificity for sn-1 and sn-3 positions, lipases leading to a higher proportion of 1,3-DAG vs. 1,2-DAG were Lipozyme RM IM (39.8 and 20.9%, respectively) and Lipase PLG (Alcaligenes sp.) (35.9 and 19.3%, respectively). By adding 1% (w/w) of lecithin to the reaction with Novozym 435 and raw glycerol, the reaction rate was considerably increased from 41.7 to 52.8% DAG at 24 h.
Solvent-Free Lipase-Catalyzed Synthesis of Diacylgycerols as Low-Calorie Food Ingredients
Vázquez, Luis; González, Noemí; Reglero, Guillermo; Torres, Carlos
2016-01-01
Problems derived from obesity and overweight have recently promoted the development of fat substitutes and other low-calorie foods. On the one hand, fats with short- and medium-chain fatty acids are a source of quick energy, easily hydrolyzable and hardly stored as fat. Furthermore, 1,3-diacylglycerols are not hydrolyzed to 2-monoacylglycerols in the gastrointestinal tract, reducing the formation of chylomicron and lowers the serum level of triacylglycerols by decreasing its resynthesis in the enterocyte. In this work, these two effects were combined to synthesize short- and medium-chain 1,3-diacylglycerols, leading to a product with great potential as for their low-calorie properties. Lipase-catalyzed transesterification reactions were performed between short- and medium-chain fatty acid ethyl esters and glycerol. Different variables were investigated, such as the type of biocatalyst, the molar ratio FAEE:glycerol, the adsorption of glycerol on silica gel, or the addition of lecithin. Best reaction conditions were evaluated considering the percentage of 1,3-DAG produced and the reaction rate. Except Novozym 435 (Candida antarctica), other lipases required the adsorption of glycerol on silica gel to form acylglycerols. Lipases that gave the best results with adsorption were Novozym 435 and Lipozyme RM IM (Rhizomucor miehei) with 52 and 60.7% DAG at 32 h, respectively. Because of its specificity for sn-1 and sn-3 positions, lipases leading to a higher proportion of 1,3-DAG vs. 1,2-DAG were Lipozyme RM IM (39.8 and 20.9%, respectively) and Lipase PLG (Alcaligenes sp.) (35.9 and 19.3%, respectively). By adding 1% (w/w) of lecithin to the reaction with Novozym 435 and raw glycerol, the reaction rate was considerably increased from 41.7 to 52.8% DAG at 24 h. PMID:26904539
NO2-initiated multiphase oxidation of SO2 by O2 on CaCO3 particles
NASA Astrophysics Data System (ADS)
Yu, Ting; Zhao, Defeng; Song, Xiaojuan; Zhu, Tong
2018-05-01
The reaction of SO2 with NO2 on the surface of aerosol particles has been suggested to be important in sulfate formation during severe air pollution episodes in China. However, we found that the direct oxidation of SO2 by NO2 was slow and might not be the main reason for sulfate formation in ambient air. In this study, we investigated the multiphase reaction of SO2 with an O2 / NO2 mixture on single CaCO3 particles using Micro-Raman spectroscopy. The reaction converted the CaCO3 particle to a Ca(NO3)2 droplet, with CaSO4 ⚫ 2H2O solid particles embedded in it, which constituted a significant fraction of the droplet volume at the end of the reaction. The reactive uptake coefficient of SO2 for sulfate formation was on the order of 10-5, which was higher than that for the multiphase reaction of SO2 directly with NO2 by 2-3 orders of magnitude. According to our observations and the literature, we found that in the multiphase reaction of SO2 with the O2 / NO2 mixture, O2 was the main oxidant of SO2 and was necessary for radical chain propagation. NO2 acted as the initiator of radical formation, but not as the main oxidant. The synergy of NO2 and O2 resulted in much faster sulfate formation than the sum of the reaction rates with NO2 and with O2 alone. We estimated that the multiphase oxidation of SO2 by O2 initiated by NO2 could be an important source of sulfate and a sink of SO2, based on the calculated lifetime of SO2 regarding the loss through the multiphase reaction versus the loss through the gas-phase reaction with OH radicals. Parameterization of the reactive uptake coefficient of the reaction observed in our laboratory for further model simulation is needed, as well as an integrated assessment based on field observations, laboratory study results, and model simulations to evaluate the importance of the reaction in ambient air during severe air pollution episodes, especially in China.
A mechanistic study on the synthesis of β-Sialon whiskers from coal fly ash
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, H.; Wang, P.Y.; Yu, J.L., E-mail: jianglong.yu@newcastle.edu.au
2015-05-15
Graphical abstract: The appearance of bead-like whiskers indicated that the growth mechanism of the β-Sialon whiskers was different from the conventional one, in which a chain of droplets were formed and then consumed to participate in the formation of the whiskers. - Highlights: • β-Sialon whiskers were synthesized using waste fly ash by carbothemal reduction reaction under nitrogen atmosphere. • Rod-like β-Sialon whiskers with a diameter of 100–500 nm were formed. • Bead-like whiskers as intermediate morphology of the growing β-Sialon whiskers were found with increasing sintering time. • The growth mechanism of β-Sialon whiskers was different from the conventionalmore » VLS mechanism. • A chain of droplets were formed and participated in the formation of the whiskers. - Abstract: β-Sialon whiskers were produced at 1420 °C through carbothemal reduction reaction under nitrogen atmosphere using fly ash from coal-fired power plants. The effects of sintering time on the phase formation and morphology of the products were investigated by X-ray diffraction (XRD), scanning electron microscope (SEM) and energy dispersive spectrometer (EDS) techniques. Rod-like β-Sialon whiskers with the diameter of 100–500 nm were successfully formed. With increasing sintering time, bead-like morphology during the growth process of the whiskers was found, and growth mechanism of β-Sialon whiskers was also discussed in detail. The growth mechanism proposed in this study was different from the conventional vapor–liquid–solid (VLS) mechanism.« less
The pyrolytic degradation of wood-derived lignin from pulping process.
Shen, D K; Gu, S; Luo, K H; Wang, S R; Fang, M X
2010-08-01
Lignin is a key component in the biomass with a complex polymeric structure of the phenyl-C(3) alkyl units. The kraft lignin from the wood pulping process is tested in TG-FTIR and Py-GC-MS. The samples are pyrolyzed in TGA coupled with FTIR from 30 to 900 degrees C at the heating rate of 20 and 40K/min. The evolution of phenolic compounds in the initial pyrolysis stage of lignin is determined by FTIR, while the second stage is mainly attributed to the production of the low molecular weight species. A bench-scale fast pyrolysis unit is employed to investigate the effect of temperature on the product yield and composition. It is found that the guaiacol-type and syringol-type compounds as the primary products of lignin pyrolysis are predominant in bio-oil, acting as the significant precursors for the formation of the derivatives such as the phenol-, cresol- and catechol-types. A series of free-radical chain-reactions, concerning the cracking of different side-chain structures and the methoxy groups on aromatic ring, are proposed to demonstrate the formation pathways for the typical compounds in bio-oil by closely relating lignin structure to the pyrolytic mechanisms. The methoxy group (-OCH(3)) is suggested to work as an important source for the formation of the small volatile species (CO, CO(2) and CH(4)) through the relevant free radical coupling reactions. (c) 2010 Elsevier Ltd. All rights reserved.
Radically Different Kinetics at Low Temperatures
NASA Astrophysics Data System (ADS)
Sims, Ian
2014-06-01
The use of the CRESU (Cinétique de Réaction en Ecoulement Supersonique Uniforme, or Reaction Kinetics in Uniform Supersonic Flow) technique coupled with pulsed laser photochemical kinetics methods has shown that reactions involving radicals can be very rapid at temperatures down to 10 K or below. The results have had a major impact in astrochemistry and planetology, as well as proving an exacting test for theory. The technique has also been applied to the formation of transient complexes of interest both in atmospheric chemistry and combustion. Until now, all of the chemical reactions studied in this way have taken place on attractive potential energy surfaces with no overall barrier to reaction. The F + H2 {→} HF + H reaction does possess a substantial energetic barrier ({\\cong} 800 K), and might therefore be expected to slow to a negligible rate at very low temperatures. In fact, this H-atom abstraction reaction does take place efficiently at low temperatures due entirely to tunneling. I will report direct experimental measurements of the rate of this reaction down to a temperature of 11 K, in remarkable agreement with state-of-the-art quantum reactive scattering calculations by François Lique (Université du Havre) and Millard Alexander (University of Maryland). It is thought that long chain cyanopolyyne molecules H(C2)nCN may play an important role in the formation of the orange haze layer in Titan's atmosphere. The longest carbon chain molecule observed in interstellar space, HC11N, is also a member of this series. I will present new results, obtained in collaboration with Jean-Claude Guillemin (Ecole de Chimie de Rennes) and Stephen Klippenstein (Argonne National Labs), on reactions of C2H, CN and C3N radicals (using a new LIF scheme by Hoshina and Endo which contribute to the low temperature formation of (cyano)polyynes. H. Sabbah, L. Biennier, I. R. Sims, Y. Georgievskii, S. J. Klippenstein, I. W. M. Smith, Science 317, 102 (2007). S. D. Le Picard, M. Tizniti, A. Canosa, I. R. Sims, I. W. M. Smith, Science 328, 1258 (2010). H. Sabbah, L. Biennier, S. J. Klippenstein, I. R. Sims, B. R. Rowe, J. Phys. Chem. Lett. 1, 2962 (2010). M. Tizniti, S. D. Le Picard, F. Lique, C. Berteloite, A. Canosa, M. H. Alexander, I. R. Sims, Nature Chemistry 6, 141 (2014). S. Cheikh Sid Ely, S. B. Morales, J. C. Guillemin, S. J. Klippenstein, I. R. Sims, J. Phys. Chem. A 117, 12155 (2013). K. Hoshina, Y. Endo, J. Chem. Phys. 127, 184304 (2007).
Xing, Shiyou; Lv, Pengmei; Wang, Jiayan; Fu, Junying; Fan, Pei; Yang, Lingmei; Yang, Gaixiu; Yuan, Zhenhong; Chen, Yong
2017-01-25
For high caloricity and stability in bio-aviation fuels, a certain content of aromatic hydrocarbons (AHCs, 8-25 wt%) is crucial. Fatty acids, obtained from waste or inedible oils, are a renewable and economic feedstock for AHC production. Considerable amounts of AHCs, up to 64.61 wt%, were produced through the one-step hydroprocessing of fatty acids over Ni/HZSM-5 catalysts. Hydrogenation, hydrocracking, and aromatization constituted the principal AHC formation processes. At a lower temperature, fatty acids were first hydrosaturated and then hydrodeoxygenated at metal sites to form long-chain hydrocarbons. Alternatively, the unsaturated fatty acids could be directly deoxygenated at acid sites without first being saturated. The long-chain hydrocarbons were cracked into gases such as ethane, propane, and C 6 -C 8 olefins over the catalysts' Brønsted acid sites; these underwent Diels-Alder reactions on the catalysts' Lewis acid sites to form AHCs. C 6 -C 8 olefins were determined as critical intermediates for AHC formation. As the Ni content in the catalyst increased, the Brønsted-acid site density was reduced due to coverage by the metal nanoparticles. Good performance was achieved with a loading of 10 wt% Ni, where the Ni nanoparticles exhibited a polyhedral morphology which exposed more active sites for aromatization.
Kinetic modeling of methyl butanoate in shock tube.
Huynh, Lam K; Lin, Kuang C; Violi, Angela
2008-12-25
An increased necessity for energy independence and heightened concern about the effects of rising carbon dioxide levels have intensified the search for renewable fuels that could reduce our current consumption of petrol and diesel. One such fuel is biodiesel, which consists of the methyl esters of fatty acids. Methyl butanoate (MB) contains the essential chemical structure of the long-chain fatty acids and a shorter, but similar, alkyl chain. This paper reports on a detailed kinetic mechanism for MB that is assembled using theoretical approaches. Thirteen pathways that include fuel decomposition, isomerization, and propagation steps were computed using ab initio calculations [J. Org. Chem. 2008, 73, 94]. Rate constants from first principles for important reactions in CO(2) formation, namely CH(3)OCO=CH(3) + CO(2) (R1) and CH(3)OCO=CH(3)O + CO (R2) reactions, are computed at high levels of theory and implemented in the mechanism. Using the G3B3 potential energy surface together with the B3LYP/6-31G(d) gradient, Hessian and geometries, the rate constants for reactions R1 and R2 are calculated using the Rice-Ramsperger-Kassel-Marcus theory with corrections from treatments for tunneling, hindered rotation, and variational effects. The calculated rate constants of reaction R1 differ from the data present in the literature by at most 20%, while those of reaction R2 are about a factor of 4 lower than the available values. The new kinetic model derived from ab initio simulations is combined with the kinetic mechanism presented by Fisher et al. [Proc. Combust. Inst. 2000, 28, 1579] together with the addition of the newly found six-centered unimolecular elimination reaction that yields ethylene and methyl acetate, MB = C(2)H(4) + CH(3)COOCH(3). This latter pathway requires the inclusion of the CH(3)COOCH(3) decomposition model suggested by Westbrook et al. [Proc. Combust. Inst. 2008, accepted]. The newly composed kinetic mechanism for MB is used to study the CO(2) formation during the pyrolysis of MB as well as to investigate the autoignition of MB in a shock tube reactor at different temperatures and pressures. The computed results agree very well with experimental data present in the literature. Sensitivity and flux (rate-of-production) analyses are carried out for the CO(2) formation with the new MB mechanism, together with available reaction mechanisms, to assess the importance of various kinetic pathways for each regime. With the new mechanism, the flux analyses for the formation of C(2)H species, one of the most important species for ignition delay time, are also presented at different conditions. In addition to giving a better chemical insight of the pyrolysis/oxidation of MB, the results suggest ways to improve the mechanism's capability to predict CO(2) formation and ignition delay times in pyrolysis and oxidation conditions.
Prebiotic-Like Condensations of Cyanamide and Glyoxal: Revisiting Intractable Biotars.
Lavado, Nieves; Escamilla, Juan Carlos; Ávalos, Martín; Babiano, Reyes; Cintas, Pedro; Jiménez, José Luis; Palacios, Juan Carlos
2016-09-12
We report a detailed investigation into the nature of products that are generated by the reactions of cyanamide and glyoxal, two small molecules of astrochemical and prebiotic significance, under different experimental conditions. The experimental data suggest that the formation of oligomeric structures is related in part to the formation of insoluble tholins in the presence of oxygen-containing molecules. Although oligomerization proceeds well in water, product isolation turned out to be impractical. Instead, solid precipitates were obtained easily in acetone. Crude mixtures have been thoroughly scrutinized by spectroscopic methods, in particular NMR and mass spectroscopy (ESI mode), which are all consistent with the generation of a few functional groups that are embedded into regular chains of five- and six-membered rings, thereby pointing to a supramolecular organization. Three different models of cross-condensation and chain growth are suggested. These synthetic explorations provide further insights into the formation of complex organic matter in interstellar scenarios and extraterrestrial bodies that might have played a pivotal role in chemical evolution. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy
2015-01-01
Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.
NASA Astrophysics Data System (ADS)
Chang, Qiang; Herbst, Eric
2016-03-01
The recent discovery of methyl formate and dimethyl ether in the gas phase of cold cores with temperatures as cold as 10 K challenges our previous astrochemical models concerning the formation of complex organic molecules (COMs). The strong correlation between the abundances and distributions of methyl formate and dimethyl ether further shows that current astrochemical models may be missing important chemical processes in cold astronomical sources. We investigate a scenario in which COMs and the methoxy radical can be formed on dust grains via a so-called chain reaction mechanism, in a similar manner to CO2. A unified gas-grain microscopic-macroscopic Monte Carlo approach with both normal and interstitial sites for icy grain mantles is used to perform the chemical simulations. Reactive desorption with varying degrees of efficiency is included to enhance the nonthermal desorption of species formed on cold dust grains. In addition, varying degrees of efficiency for the surface formation of methoxy are also included. The observed abundances of a variety of organic molecules in cold cores can be reproduced in our models. The strong correlation between the abundances of methyl formate and dimethyl ether in cold cores can also be explained. Nondiffusive chemical reactions on dust grain surfaces may play a key role in the formation of some COMs.
Roberts, E S; Vaz, A D; Coon, M J
1991-01-01
As we have briefly described elsewhere, cytochrome P-450 catalyzes the oxidative deformylation of cyclohexane carboxaldehyde to yield cyclohexene and formic acid in a reaction believed to involve a peroxyhemiacetal-like adduct formed between the substrate and molecular oxygen-derived hydrogen peroxide. This reaction is a useful model for the demethylation reactions catalyzed by the steroidogenic P-450s, aromatase, and lanosterol demethylase. In the present study, the cytochrome P-450-catalyzed formation of olefinic products from a series of xenobiotic aldehydes has been demonstrated. Isobutyraldehyde and trimethylacetaldehyde, but not propionaldehyde, are converted to the predicted olefinic products, suggesting a requirement for branching at the alpha carbon. In addition, the four C5 aldehydes of similar hydrophobicity were compared for their ability to undergo the reaction. The straight-chain valeraldehyde gave no olefinic products with five different rabbit liver microsomal P-450 isozymes. However, increasing activity was seen with the other isomers in the order of isovaleraldehyde, 2-methylbutyraldehyde, and trimethylacetaldehyde, with all of the P-450 cytochromes. The catalytic rate with trimethylacetaldehyde is highest with antibiotic-inducible P-450 form 3A6, followed by phenobarbital-inducible form 2B4 and ethanol-inducible form 2E1. Citronellal, a beta-branched aldehyde that is found in many essential oils and is widely used as an odorant and a flavorant, was found to undergo the oxidative deformylation reaction to yield 2,6-dimethyl-1,5-heptadiene, but only with P-450 2B4. The oxidative cleavage reaction with olefin formation appears to be widespread, as judged by the variety of aldehydes that serve as substrates and of P-450 cytochromes that serve as catalysts. PMID:1924356
Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi
2018-08-27
A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.
Enantioselective Synthesis of SNAP-7941
Goss, Jennifer M.; Schaus, Scott E.
2009-01-01
An enantioselective synthesis of SNAP-7941, a potent melanin concentrating hormone receptor antagonist, was achieved using two organocatalytic methods. The first method utilized to synthesize the enantioenriched dihydropyrimidone core was the Cinchona alkaloid-catalyzed Mannich reaction of β-keto esters to acyl imines and the second was chiral phosphoric acid-catalyzed Biginelli reaction. Completion of the synthesis was accomplished via selective urea formation at the N3 position of the dihydropyrimidone with the 3-(4-phenylpiperidin-1-yl)propyl amine side chain fragment. The synthesis of SNAP-7921 highlights the utility of asymmetric organocatalytic methods in the construction of an important class of chiral heterocycles. PMID:18767801
Husby, G.; Natvig, J. B.
1972-01-01
Amyloid fibrils were isolated from eleven amyloid-laden organs of six patients. By alkaline degradation, soluble units were obtained which gave antibody formation in rabbits. Gel precipitation and haemagglutination inhibition were used to characterize antigens of the amyloid. Evidence was obtained that amyloids from different organs of the same individual were identical in the antigenicity. In contrast, amyloids from different individuals each showed unique individual specificity. Besides this, antigenic cross-reactions were noted between the amyloid preparations. Finally, evidence for antigenic cross-reactivity between certain amyloid preparations and immunoglobulin light chains was obtained. ImagesFig. 2Fig. 3Fig. 4Fig. 5Fig. 6 PMID:4624554
[Britton Chance (1913-2010)--from sailing to biophysics and biochemistry and back].
Wojtczak, Lech
2011-01-01
A short CV of Britton Chance, an outstanding American biophysicist and biochemists, who has passed away in November 2010, is presented. Chance invented and applied in biochemical research fast recording of difference spectra during chemical reactions. Due to this technique he discovered and studied formation of enzyme-substrate complexes as exemplified by the peroxidase reaction. He also described spectral changes of electron carriers of mitochondrial respiratory chain that accompany transition from the resting to the active (phosphorylating) states. Applying vibrating platinum electrode, he recorded changes in the rate of oxygen uptake by isolated mitochondria in resting and phosphorylating states and defined the so-called respiratory states, called after his name. He was the first to describe formation of reactive oxygen species by mitochondria. Britton Chance was a devoted yachtsman and won a gold medal for the United States in sailing at the 1952 Olympic Games in Helsinki.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dagaut, P.; Reuillon, M.; Boettner, J.C.
1994-12-31
The oxidation of TR0 kerosene (jet A1 aviation fuel) was studied in a jet-stirred reactor (JSR) at pressures extending from 10 to 40 atm, in the temperature range 750--1,150 K. A large number of reaction intermediates were identified, and their concentrations were followed for reaction yields ranging from low conversion to the formation of the final products. A reference hydrocarbon, n-decane, studied under the same experimental conditions gave very similar experimental concentration profiles for the main oxidation products. Because of the strong analogy between n-decane and kerosene oxidation kinetics, a detailed chemical kinetic reaction mechanisms describing the oxidation of n-decanemore » was built to reproduce the present experimental results. This mechanisms includes 573 elementary reactions, most of them being reversible, among 90 chemical species. A reasonably good prediction of the concentrations of major species was obtained by computation, covering the whole range of temperature, pressures, and equivalence ratios of the experiments. A kinetic analysis performed to identify the dominant reaction steps of the mechanism shows that, under the conditions of the present study (intermediate temperature and high pressure), HO{sub 2} radicals are important chain carriers leading to the formation of the branching agent H{sub 2}O{sub 2}.« less
Low-cost synthesis and physical characterization of thieno[3,4-c]pyrrole-4,6-dione-based polymers.
Berrouard, Philippe; Dufresne, Stéphane; Pron, Agnieszka; Veilleux, Justine; Leclerc, Mario
2012-09-21
The improved synthesis of thieno[3,4-c]pyrrole-4,6-dione (TPD) monomers, including Gewald thiophene ring formation, a Sandmeyer-type reaction, and neat condensation with an amine, is presented. This protocol enables faster, cheaper, and more efficient preparation of TPD units in comparison to traditional methods. Furthermore, a series of TPD homo- and pseudohomopolymers bearing various alkyl chains was synthesized via a direct heteroarylation polymerization (DHAP) procedure. UV-visible absorption and powder X-ray diffraction measurements revealed the relationship between the ratio of branched to linear alkyl chains and the optoelectronic properties of the polymers as well as their packing in the solid state.
A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.
Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat
2016-12-01
To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.
Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A
2011-07-01
The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.
Song, Yunke; Zhang, Yi; Wang, Tza-Huei
2013-04-08
Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and a tedious assay processes. In this report, an assay technology is proposed which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single-molecule coincidence detection, and the superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single-molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hetényi, Anasztázia; Szakonyi, Zsolt; Klika, Karel D; Pihlaja, Kalevi; Fülöp, Ferenc
2003-03-21
Both cis and trans isomers of amino diols 3-6 were prepared stereoselectively. In the reactions between 3-6 and phenyl isothiocyanate, the ring closure proceeded regioselectively and resulted only in spiro derivatives of 2-phenyliminooxazolidines 9, 10, 13, and 14. The reaction of cis- (or trans-)1-aminomethylcyclohexane-1,2-diol 4 (or 6) with 1 equiv of an aromatic aldehyde 15a-g in EtOH at room temperature resulted in a complex, multicomponent equilibrium mixture of 16a-g and 18a-g (or 17a-g and 19a-g), in each case consisting of a five-component, ring-chain tautomeric system 16A-E (or 17A-E), involving the Schiff base, two epimeric spirooxazolidines, two epimeric condensed 1,3-oxazines, and some of the four tricyclic compounds 18A-D (or 19A-D). The five-component, ring-chain equilibria were found to be adequately described by the Hammett-Brown linear free energy equation.
Press Releases | Argonne National Laboratory
Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18
Selective Formation of Ser-His Dipeptide via Phosphorus Activation
NASA Astrophysics Data System (ADS)
Shu, Wanyun; Yu, Yongfei; Chen, Su; Yan, Xia; Liu, Yan; Zhao, Yufen
2018-04-01
The Ser-His dipeptide is the shortest active peptide. This dipeptide not only hydrolyzes proteins and DNA but also catalyzes the formation of peptides and phosphodiester bonds. As a potential candidate for the prototype of modern hydrolase, Ser-His has attracted increasing attention. To explore if Ser-His could be obtained efficiently in the prebiotic condition, we investigated the reactions of N-DIPP-Ser with His or other amino acids in an aqueous system. We observed that N-DIPP-Ser incubated with His can form Ser-His more efficiently than with other amino acids. A synergistic effect involving the two side chains of Ser and His is presumed to be the critical factor for the selectivity of this specific peptide formation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wujcik, Kevin H.; Wang, Dunyang Rita; Pascal, Tod A.
Lithium sulfur (Li-S) batteries are well known for their high theoretical specific capacities, but are plagued with scientific obstacles that make practical implementation of the technology impossible. The success of Li-S batteries will likely necessitate the use of thick sulfur cathodes that enable high specific energy densities. However, little is known about the fundamental reaction mechanisms and chemical processes that take place in thick cathodes, as most research has focused on studying thinner cathodes that enable high performance. In this study, in situ X-ray absorption spectroscopy at the sulfur K-edge is used to examine the back of a 115 μmmore » thick Li-S cathode during discharge. Our results show that in such systems, where electrochemical reactions between sulfur and lithium are likely to proceed preferentially toward the front of the cathode, lithium polysulfide dianions formed in this region diffuse to the back of the cathode during discharge. We show that high conversion of elemental sulfur is achieved by chemical reactions between elemental sulfur and polysulfide dianions of intermediate chain length (Li 2S x, 4 ≤ x ≤ 6). Our work suggests that controlling the formation and diffusion of intermediate chain length polysulfide dianions is crucial for insuring full utilization of thick sulfur cathodes.« less
Stability in chemical and biological systems: Multistage polyenzymatic reactions
NASA Astrophysics Data System (ADS)
Varfolomeev, S. D.; Lukovenkov, A. V.
2010-08-01
General principles of the theory of stability of solutions to differential equations are considered. The stability of equations describing the dynamics of changes in reagent concentrations in polyenzymatic biochemical chains is analyzed. Various mechanisms of formation of stable and unstable stationary states are considered, and unbalanced regimes and collapse are analyzed. The influence of systems of toxins and drugs on stability is studied. An interpretation of pathological processes based on stability theory is given.
Effect of short-chain fatty acids on the formation of amylose microparticles by amylosucrase.
Lim, Min-Cheol; Park, Kyu-Hwan; Choi, Jong-Hyun; Lee, Da-Hee; Letona, Carlos Andres Morales; Baik, Moo-Yeol; Park, Cheon-Seok; Kim, Young-Rok
2016-10-20
Amylose microparticles can be produced by self-assembly of amylose molecules through an amylosucrase-mediated synthesis. Here we investigated the role of short-chain fatty acids in the formation of amylose microparticles and the fate of these fatty acids at the end of the reaction. The rate of self-assembly and production yields of amylose microparticles were significantly enhanced in the presence of fatty acids. The effect was dependent on the length of the fatty acid carbon tail; butanoic acid (C4) was the most effective, followed by hexanoic acid (C6) and octanoic acid (C8). The amylose microparticles were investigated by carrying out SEM, XRD, Raman, NMR, FT-IR and DSC analysis. The size, morphology and crystal structure of the resulting amylose microparticles were comparable with those of amylose microparticles produced without fatty acids. The results indicated the carboxyl group of the fatty acid to be responsible for promoting the self-assembly of amylose chains to form microparticles. The fatty acids were eventually removed from the microstructure through the tight association of amylose double helices to form the amylose microparticles. Copyright © 2016 Elsevier Ltd. All rights reserved.
The high-throughput synthesis and phase characterisation of amphiphiles: a sweet case study.
Feast, George C; Hutt, Oliver E; Mulet, Xavier; Conn, Charlotte E; Drummond, Calum J; Savage, G Paul
2014-03-03
A new method for the discovery of amphiphiles by using high-throughput (HT) methods to synthesise and characterise a library of galactose- and glucose-containing amphiphilic compounds is presented. The copper-catalysed azide–alkyne cycloaddition (CuAAC) “click” reaction between azide-tethered simple sugars and alkyne-substituted hydrophobic tails was employed to synthesise a library of compounds with systematic variations in chain length and unsaturation in a 24-vial array format. The liquid–crystalline phase behaviour was characterised in a HT manner by using synchrotron small-angle X-ray scattering (SSAXS). The observed structural variation with respect to chain parameters, including chain length and degree of unsaturation, is discussed, as well as hydration effects and degree of hydrogen bonding between head groups. The validity of our HT screening approach was verified by resynthesising a short-chain glucose amphiphile. A separate phase analysis of this compound confirmed the presence of numerous lyotropic liquid–crystalline phases.
In vitro Fab display: a cell-free system for IgG discovery
Stafford, Ryan L.; Matsumoto, Marissa L.; Yin, Gang; Cai, Qi; Fung, Juan Jose; Stephenson, Heather; Gill, Avinash; You, Monica; Lin, Shwu-Hwa; Wang, Willie D.; Masikat, Mary Rose; Li, Xiaofan; Penta, Kalyani; Steiner, Alex R.; Baliga, Ramesh; Murray, Christopher J.; Thanos, Christopher D.; Hallam, Trevor J.; Sato, Aaron K.
2014-01-01
Selection technologies such as ribosome display enable the rapid discovery of novel antibody fragments entirely in vitro. It has been assumed that the open nature of the cell-free reactions used in these technologies limits selections to single-chain protein fragments. We present a simple approach for the selection of multi-chain proteins, such as antibody Fab fragments, using ribosome display. Specifically, we show that a two-chain trastuzumab (Herceptin) Fab domain can be displayed in a format which tethers either the heavy or light chain to the ribosome while retaining functional antigen binding. Then, we constructed synthetic Fab HC and LC libraries and performed test selections against carcinoembryonic antigen (CEA) and vascular endothelial growth factor (VEGF). The Fab selection output was reformatted into full-length immunoglobulin Gs (IgGs) and directly expressed at high levels in an optimized cell-free system for immediate screening, purification and characterization. Several novel IgGs were identified using this cell-free platform that bind to purified CEA, CEA positive cells and VEGF. PMID:24586053
Sulfate aerosols and polar stratospheric cloud formation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolbert, M.A.
Before the discovery of the Antarctic ozone hole, it was generally assumed that gas-phase chemical reactions controlled the abundance of stratospheric ozone. However, the massive springtime ozone losses over Antarctica first reported by Farman et al in 1985 could not be explained on the basis of gas-phase chemistry alone. In 1986, Solomon et al suggested that chemical reactions occurring on the surfaces of polar stratospheric clouds (PSCs) could be important for the observed ozone losses. Since that time, an explosion of laboratory, field, and theoretical research in heterogeneous atmospheric chemistry has occurred. Recent work has indicated that the most importantmore » heterogeneous reaction on PSCs is ClONO[sub 2] + HCl [yields] Cl[sub 2] + HNO[sub 3]. This reaction converts inert chlorine into photochemically active Cl[sub 2]. Photolysis of Cl[sub 2] then leads to chlorine radicals capable of destroying ozone through very efficient catalytic chain reactions. New observations during the second Airborne Arctic Stratospheric Expedition found stoichiometric loss of ClONO[sub 2] and HCl in air processed by PSCs in accordance with reaction 1. Attention is turning toward understanding what kinds of aerosols form in the stratospheric, their formation mechanism, surface area, and specific chemical reactivity. Some of the latest findings, which underline the importance of aerosols, were presented at a recent National Aeronautics and Space Administration workshop in Boulder, Colorado.« less
Reaction kinetics of hydrogen atom abstraction from isopentanol by the H atom and HO2˙ radical.
Parab, Prajakta Rajaram; Heufer, K Alexander; Fernandes, Ravi Xavier
2018-04-25
Isopentanol is a potential next-generation biofuel for future applications to Homogeneous Charge Compression Ignition (HCCI) engine concepts. To provide insights into the combustion behavior of isopentanol, especially to its auto-ignition behavior which is linked both to efficiency and pollutant formation in real combustion systems, detailed quantum chemical studies for crucial reactions are desired. H-Abstraction reaction rates from fuel molecules are key initiation steps for chain branching required for auto-ignition. In this study, rate constants are determined for the hydrogen atom abstraction reactions from isopentanol by the H atom and HO2˙ radical by implementing the CBS-QB3 composite method. For the treatment of the internal rotors, a Pitzer-Gwinn-like approximation is applied. On comparing the computed reaction energies, the highest exothermicity (ΔE = -46 kJ mol-1) is depicted for Hα abstraction by the H atom whereas the lowest endothermicity (ΔE = 29 kJ mol-1) is shown for the abstraction of Hα by the HO2˙ radical. The formation of hydrogen bonding is found to affect the kinetics of the H atom abstraction reactions by the HO2˙ radical. Further above 750 K, the calculated high pressure limit rate constants indicate that the total contribution from delta carbon sites (Cδ) is predominant for hydrogen atom abstraction by the H atom and HO2˙ radical.
Cysteine Racemization on IgG Heavy and Light Chains
Zhang, Qingchun; Flynn, Gregory C.
2013-01-01
Under basic pH conditions, the heavy chain 220-light chain 214 (H220-L214) disulfide bond, found in the flexible hinge region of an IgG1, can convert to a thioether. Similar conditions also result in racemization of the H220 cysteine. Here, we report that racemization occurs on both H220 and L214 on an IgG1 with a λ light chain (IgG1λ) but almost entirely on H220 of an IgGl with a κ light chain (IgG1κ) under similar conditions. Likewise, racemization was detected at significant levels on H220 and L214 on endogenous human IgG1λ but only at the H220 position on IgG1κ. Low but measurable levels of d-cysteines were found on IgG2 cysteines in the hinge region, both with monoclonal antibodies incubated under basic pH conditions and on antibodies isolated from human serum. A simplified reaction mechanism involving reversible β-elimination on the cysteine is presented that accounts for both base-catalyzed racemization and thioether formation at the hinge disulfide. PMID:24142697
Simulated digestion of Vitis vinifera seed powder: polyphenolic content and antioxidant properties.
Janisch, Kerstin M; Olschläger, Carolin; Treutter, Dieter; Elstner, Erich F
2006-06-28
There is increasing evidence that reactive oxygen species arising from several enzymatic reactions are mediators of inflammatory events. Plant preparations have the potential for scavenging such reactive oxygen species. Flavans and procyanidins are bioavailable and stable during the process of cooking. This study used conditions that mimicked digestion of Vitis vinifera seed powder in the stomach (acidic preparation) and small intestine (neutral preparation). The flavonoids of these two preparations were released during simulated digestion and were determined with HPLC analysis. Biochemical model reactions relevant for the formation of reactive oxygen species in vivo at inflammatory sites were used to determine the antioxidant properties of the two preparations. The inhibition of the indicator reaction for the formation of reactive oxygen species represents a potential mechanism of the physiological activity of the corresponding preparation. The results of this work show clearly that the polyphenols released during the simulated digestion of the two preparations have good scavenging potential against superoxide radicals, hydroxyl radicals, and singlet oxygen. They protect low-density lipoprotein against copper-induced oxidation due to the copper-chelating properties and their chain-breaking abilities in lipid peroxidation.
Remote carboxylation of halogenated aliphatic hydrocarbons with carbon dioxide
NASA Astrophysics Data System (ADS)
Juliá-Hernández, Francisco; Moragas, Toni; Cornella, Josep; Martin, Ruben
2017-05-01
Catalytic carbon-carbon bond formation has enabled the streamlining of synthetic routes when assembling complex molecules. It is particularly important when incorporating saturated hydrocarbons, which are common motifs in petrochemicals and biologically relevant molecules. However, cross-coupling methods that involve alkyl electrophiles result in catalytic bond formation only at specific and previously functionalized sites. Here we describe a catalytic method that is capable of promoting carboxylation reactions at remote and unfunctionalized aliphatic sites with carbon dioxide at atmospheric pressure. The reaction occurs via selective migration of the catalyst along the hydrocarbon side-chain with excellent regio- and chemoselectivity, representing a remarkable reactivity relay when compared with classical cross-coupling reactions. Our results demonstrate that site-selectivity can be switched and controlled, enabling the functionalization of less-reactive positions in the presence of a priori more reactive ones. Furthermore, we show that raw materials obtained in bulk from petroleum processing, such as alkanes and unrefined mixtures of olefins, can be used as substrates. This offers an opportunity to integrate a catalytic platform en route to valuable fatty acids by transforming petroleum-derived feedstocks directly.
Introduction to Polymer Chemistry.
ERIC Educational Resources Information Center
Harris, Frank W.
1981-01-01
Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)
Boss, Linda; Oehme, Ramona; Billig, Susan; Birkemeyer, Claudia; Layer, Gunhild
2017-12-01
Heme d 1 is a modified tetrapyrrole playing an important role in denitrification by acting as the catalytically essential cofactor in the cytochrome cd 1 nitrite reductase of many denitrifying bacteria. In the course of heme d 1 biosynthesis, the two propionate side chains on pyrrole rings A and B of the intermediate 12,18-didecarboxysiroheme are removed from the tetrapyrrole macrocycle. In the final heme d 1 molecule, the propionate groups are replaced by two keto functions. Although it was speculated that the Radical S-adenosyl-l-methionine (SAM) enzyme NirJ might be responsible for the removal of the propionate groups and introduction of the keto functions, this has not been shown experimentally, so far. Here, we demonstrate that NirJ is a Radical SAM enzyme carrying two iron-sulfur clusters. While the N-terminal [4Fe-4S] cluster is essential for the initial SAM cleavage reaction, it is not required for substrate binding. NirJ tightly binds its substrate 12,18-didecarboxysiroheme and, thus, can be purified in complex with the substrate. By using the purified NirJ/substrate complex in an in vitro enzyme activity assay, we show that NirJ indeed catalyzes the removal of the two propionate side chains under simultaneous SAM cleavage. However, under the reaction conditions employed, no keto group formation is observed indicating that an additional cofactor or enzyme is needed for this reaction. © 2017 Federation of European Biochemical Societies.
Dechlorination of short chain chlorinated paraffins by nanoscale zero-valent iron.
Zhang, Zhi-Yong; Lu, Mang; Zhang, Zhong-Zhi; Xiao, Meng; Zhang, Min
2012-12-01
In this study, nanoscale zero-valent iron (NZVI) particles were synthesized and used for the reductive dehalogenation of short chain chlorinated paraffins (SCCPs) in the laboratory. The results show that the dechlorination rate of chlorinated n-decane (CP(10)) by NZVI increased with decreased solution pH. Increasing the loading of NZVI enhanced the dechlorination rate of CP(10). With an increase in temperature, the degradation rate increased. The reduction of CP(10) by NZVI was accelerated with increasing the concentration of humic acid up to 15 mg/L but then was inhibited. The dechlorination of CP(10) within the initial 18 h followed pseudo-first order rate model. The formation of intermediate products indicates a stepwise dechlorination pathway of SCCPs by NZVI. The carbon chain length and chlorination degree of SCCPs have a polynominal impact on dechlorination reactions. Copyright © 2012 Elsevier B.V. All rights reserved.
Polymerization as a Model Chain Reaction
ERIC Educational Resources Information Center
Morton, Maurice
1973-01-01
Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)
On-Surface Pseudo-High-Dilution Synthesis of Macrocycles: Principle and Mechanism.
Fan, Qitang; Wang, Tao; Dai, Jingya; Kuttner, Julian; Hilt, Gerhard; Gottfried, J Michael; Zhu, Junfa
2017-05-23
Macrocycles have attracted much attention due to their specific "endless" topology, which results in extraordinary properties compared to related linear (open-chain) molecules. However, challenges still remain in their controlled synthesis with well-defined constitution and geometry. Here, we report the successful application of the (pseudo-)high-dilution method to the conditions of on-surface synthesis in ultrahigh vacuum. This approach leads to high yields (up to 84%) of cyclic hyperbenzene ([18]-honeycombene) via an Ullmann-type reaction from 4,4″-dibromo-meta-terphenyl (DMTP) as precursor on a Ag(111) surface. The mechanism of macrocycle formation was explored in detail using scanning tunneling microscopy and X-ray photoemission spectroscopy. We propose that the dominant pathway for hyperbenzene (MTP) 6 formation is the stepwise desilverization of an organometallic (MTP-Ag) 6 macrocycle, which forms via cyclization of (MTP-Ag) 6 chains under pseudo-high-dilution conditions. The high probability of cyclization on the stage of the organometallic phase results from the reversibility of the C-Ag bond. The case is different from that in solution, in which cyclization typically occurs on the stage of a covalently bonded open-chain precursor. This difference in the cyclization mechanism on a surface compared to that in solution stems mainly from the 2D confinement exerted by the surface template, which hinders the flipping of chain segments necessary for cyclization.
The dynamics of complex formation between amylose brushes on gold and fatty acids by QCM-D.
Cao, Zheng; Tsoufis, Theodoros; Svaldo-Lanero, Tiziana; Duwez, Anne-Sophie; Rudolf, Petra; Loos, Katja
2013-10-14
Amylose brushes were synthesized by enzymatic polymerization with glucose-1-phosphate as monomer and rabbit muscle phosphorylase b as catalyst on gold-covered surfaces of a quartz crystal microbalance. Fourier transform infrared (FT-IR) spectra confirmed the presence of the characteristic absorption peaks of amylose between 3100 cm(-1) and 3500 cm(-1). The thickness of the amylose brushes-measured by Spectroscopic Ellipsometry--can be tailored from 4 to 20 nm, depending on the reaction time. The contour length of the stretched amylose chains on gold surfaces has been evaluated by single molecule force spectroscopy, and a total chain length of about 20 nm for 16.2 nm thick amylose brushes was estimated. X-ray photoelectron spectroscopy (XPS) was employed to characterize the amylose brushes before and after the adsorption of fatty acids. The dynamics of inclusion complex formation between amylose brushes and two fatty acids (octanoic acid and myristic acid) with different chain length was investigated as a function of time using a quartz crystal microbalance with dissipation monitoring (QCM-D) immersed in the liquid phase. QCM-D signals including the frequency and dissipation shifts elucidated the effects of the fatty acid concentration, the solvent types, the chain length of the fatty acids and the thickness of the amylose brushes on the dynamics of fatty acid molecule adsorption on the amylose brush-modified sensor surfaces.
DOE R&D Accomplishments Database
Weinberg, Alvin M.; Noderer, L. C.
1951-05-15
The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.
Wong, Lindsay L; Lee, Nahyoung Grace; Amarnani, Dhanesh; Choi, Catherine J; Bielenberg, Diane R; Freitag, Suzanne K; D'Amore, Patricia A; Kim, Leo A
2016-09-01
The human orbit is an environment that is vulnerable to inflammation and edema in the setting of autoimmune thyroid disease. Our study investigated the tenet that orbital adipose tissue lacks lymphatic vessels and analyzed the clinicopathologic differences between patients with acute and chronic thyroid eye disease (TED). The underlying molecular mediators of blood and lymphatic vessel formation within the orbital fat also were evaluated. Retrospective cohort study. The study included fat specimens from 26 orbits of 15 patients with TED undergoing orbital decompression. Orbital fat specimens from patients without TED as well as cadaveric orbital fat served as controls. Tissue specimens were processed as formalin-fixed, paraffin-embedded sections or frozen cryosections for immunohistochemistry. Total RNA was extracted and analyzed via quantitative (real-time) reverse-transcription polymerase chain reaction. Clinicopathologic correlation was made by determining the clinical activity score (CAS) of each patient with TED. Samples were examined for vascular and lymphatic markers including podoplanin, lymphatic vessel endothelial hyaluronan receptor 1 (LYVE-1), and cluster of differentiation 31 (CD31) by immunohistochemistry, as well as for mRNA levels of vascular endothelial growth factor (VEGF), VEGF receptors, semaphorin 3F, neuropilin 1, neuropilin 2, podoplanin, and LYVE-1 by quantitative (real-time) reverse-transcription polymerase chain reaction. Clinicopathologic correlation revealed increased staining of CD31-positive blood vessels in patients with acute TED with a CAS more than 4, as well as rare staining of podoplanin-positive lymphatic vessels within acutely inflamed orbital fat tissue. Additionally, quantitative (real-time) reverse-transcription polymerase chain reaction analysis demonstrated increased expression of VEGF receptor (VEGFR) 2 as well as VEGF signaling molecules VEGF-A, VEGF-C, and VEGF-D. In acute TED, compared with chronic TED and control orbital fat, there is increased blood vessel density, suggesting neovascularization and rare lymphatic vessels suggestive of limited lymphangiogenesis. This proangiogenic and prolymphangiogenic microenvironment is likely the result of the increased expression of VEGFR-2, VEGF-A, VEGF-C, and VEGF-D. These findings imply that orbital edema in acute TED may be mediated, in part, by both the formation of new, immature blood vessels and the formation of lymphatic capillaries that are functionally incapable of draining interstitial fluid. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
Resolving the HONO formation mechanism in the ionosphere via ab initio molecular dynamic simulations
He, Rongxing; Li, Lei; Zhong, Jie; Zhu, Chongqin; Francisco, Joseph S.; Zeng, Xiao Cheng
2016-01-01
Solar emission produces copious nitrosonium ions (NO+) in the D layer of the ionosphere, 60 to 90 km above the Earth’s surface. NO+ is believed to transfer its charge to water clusters in that region, leading to the formation of gaseous nitrous acid (HONO) and protonated water cluster. The dynamics of this reaction at the ionospheric temperature (200–220 K) and the associated mechanistic details are largely unknown. Using ab initio molecular dynamics (AIMD) simulations and transition-state search, key structures of the water hydrates—tetrahydrate NO+(H2O)4 and pentahydrate NO+(H2O)5—are identified and shown to be responsible for HONO formation in the ionosphere. The critical tetrahydrate NO+(H2O)4 exhibits a chain-like structure through which all of the lowest-energy isomers must go. However, most lowest-energy isomers of pentahydrate NO+(H2O)5 can be converted to the HONO-containing product, encountering very low barriers, via a chain-like or a three-armed, star-like structure. Although these structures are not the global minima, at 220 K, most lowest-energy NO+(H2O)4 and NO+(H2O)5 isomers tend to channel through these highly populated isomers toward HONO formation. PMID:27071120
He, Rongxing; Li, Lei; Zhong, Jie; Zhu, Chongqin; Francisco, Joseph S; Zeng, Xiao Cheng
2016-04-26
Solar emission produces copious nitrosonium ions (NO(+)) in the D layer of the ionosphere, 60 to 90 km above the Earth's surface. NO(+) is believed to transfer its charge to water clusters in that region, leading to the formation of gaseous nitrous acid (HONO) and protonated water cluster. The dynamics of this reaction at the ionospheric temperature (200-220 K) and the associated mechanistic details are largely unknown. Using ab initio molecular dynamics (AIMD) simulations and transition-state search, key structures of the water hydrates-tetrahydrate NO(+)(H2O)4 and pentahydrate NO(+)(H2O)5-are identified and shown to be responsible for HONO formation in the ionosphere. The critical tetrahydrate NO(+)(H2O)4 exhibits a chain-like structure through which all of the lowest-energy isomers must go. However, most lowest-energy isomers of pentahydrate NO(+)(H2O)5 can be converted to the HONO-containing product, encountering very low barriers, via a chain-like or a three-armed, star-like structure. Although these structures are not the global minima, at 220 K, most lowest-energy NO(+)(H2O)4 and NO(+)(H2O)5 isomers tend to channel through these highly populated isomers toward HONO formation.
Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins
NASA Astrophysics Data System (ADS)
Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John
2017-01-01
DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.
Summary of Research/Publications
NASA Technical Reports Server (NTRS)
1997-01-01
Summary of research/publications include:(1) Comment on broadening of water microwave lines by collisions with helium atoms; (2) Calculations of ion-molecule deuterium fractionation reactions involving HD; (3) Ab initio predictions on the rotational spectra of carbon-chain carbene molecules; (4) Theoretical IR spectra of ionized naphthalene; (5) Improved collisional excitation rates for interstellar water; (6) Calculations on the competition between association and reaction for C3H+ + H2; (7) Theoretical infrared spectra of some model polycyclic aromatic hydrocarbons: effect of ionization; (8) Calculations concerning interstellar isomeric abundance ratios for C3H and C3H2; (9) New calculations on the ion-molecule processes C2H2+ + H2 C2H3+ + H and C2H2+ + H2 C2H4+; (10) Anisotropic rigid rotor potential energy function for H2O-H2; (11) A correlated ab initio study of linear carbon-chain radicals CnH (n=2-7); (12) Ab initio characterization of MgCCH, MgCCH+, and MgC2 and pathways to their formation in the interstellar medium; (13) Why HOC+ is detectable in interstellar clouds: The rate of the reaction between HOC+ and H2; (14) A correlated ab initio study of the X 2A 1 and A 2E states of MgCH3; (15) On the stability of interstellar carbon clusters: The rate of the reaction between C3 and O; and (16) The rate of the reaction between CN and C2H2 at interstellar temperatures.
Insulin structure and stability.
Brange, J; Langkjoer, L
1993-01-01
Insulin is composed of 51 amino acids in two peptide chains (A and B) linked by two disulfide bonds. The three-dimensional structure of the insulin molecule (insulin monomer), essentially the same in solution and in solid phase, exists in two main conformations. These differ in the extent of helix in the B chain which is governed by the presence of phenol or its derivatives. In acid and neutral solutions, in concentrations relevant for pharmaceutical formulation, the insulin monomer assembles to dimers and at neutral pH, in the presence of zinc ions, further to hexamers. Many crystalline modifications of insulin have been identified but only those with the hexamer as the basic unit are utilized in preparations for therapy. The insulin hexamer forms a relatively stable unit but some flexibility remains within the individual molecules. The intrinsic flexibility at the ends of the B chain plays an important role in governing the physical and chemical stability of insulin. A variety of chemical changes of the primary structure (yielding insulin derivatives), and physical modifications of the secondary to quaternary structures (resulting in "denaturation," aggregation, and precipitation) are known to affect insulin and insulin preparations during storage and use (Fig. 8). The tendency of insulin to undergo structural transformation resulting in aggregation and formation of insoluble insulin fibrils has been one of the most intriguing and widely studied phenomena in relation to insulin stability. Although the exact mechanism of fibril formation is still obscure, it is now clear that the initial step is an exposure of certain hydrophobic residues, normally buried in the three-dimensional structure, to the surface of the insulin monomer. This requires displacement of the COOH-terminal B-chain residues from their normal position which can only be accomplished via monomerization of the insulin. Therefore, most methods stabilizing insulin against fibrillation share the property of being able to counteract associated insulin from being disassembled. Chemical deterioration of insulin during storage of pharmaceutical preparations is mainly due to two categories of chemical reactions, hydrolysis and intermolecular transformation reactions leading to insulin HMWT products. The predominant hydrolysis reaction is deamidation of Asn residues which in acid solution takes place at residue A21, in neutral medium at residue B3. An amazing hydrolytic cleavage of the backbone A chain, presumably autocatalyzed by an adjacent insulin molecule, has been identified in insulin preparations containing rhombohedral crystals in combination with free zinc ions.(ABSTRACT TRUNCATED AT 400 WORDS)
Ruf, Alexander; Kanawati, Basem; Schmitt-Kopplin, Philippe
2018-03-27
Dihydroxymagnesium carboxylates [(OH) 2 MgO 2 CR] were probed for decarboxylation on a theoretical level, by utilizing both Møller-Plesset perturbation theory (MP2) and density functional theory (B3LYP-DFT) computations. This study is connected to the question of whether this recently introduced, astrobiologically relevant chemical class may form Grignard-type reagent molecules. To extract trends for a broad molecular mass range, different linear alkyl chain lengths between C 4 and C 11 were computed. The forward energy barrier for decarboxylation reactions increases linearly as a function of the ligand's chain length. Decarboxylation-type fragmentations of these organomagnesium compounds seem to be improbable in non-catalytic, low energetic environments. A high forward energy barrier (E MP2 > 55 kcal mol -1 ) towards a described transition state restricts the release of CO 2 . Nevertheless, we propose the release of CO 2 on a theoretical level, as been revealed via an intramolecular nucleophilic attack mechanism. Once the challenging transition state for decarboxylation is overcome, a stable Mg-C bond is formed. These mechanistic insights were gained by help of natural bond orbital analysis. The Cα atom (first carbon atom in the ligand chain attached to the carboxyl group) is thought to prefer binding towards the electrophilic magnesium coordination center, rather than towards the electrophilic CO 2 -carbon atom. Additionally, the putatively formed Grignard-type OH-bearing product molecules possess a more polarized Mg-C bond in comparison to RMgCl species. Therefore, carbanion formation from OH-bearing Grignard-type molecules is made feasible for triggering C-C bond formation reactions. Graphical abstract This study asks whether recently introduced, astrobiologically dihydroxymagnesium carboxylates form Grignard-type reagent molecules via decarboxylative fragmentation.
Control of polymer network topology in semi-batch systems
NASA Astrophysics Data System (ADS)
Wang, Rui; Olsen, Bradley; Johnson, Jeremiah
Polymer networks invariably possess topological defects: loops of different orders. Since small loops (primary loops and secondary loops) both lower the modulus of network and lead to stress concentration that causes material failure at low deformation, it is desirable to greatly reduce the loop fraction. We have shown that achieving loop fraction close to zero is extremely difficult in the batch process due to the slow decay of loop fraction with the polymer concentration and chain length. Here, we develop a modified kinetic graph theory that can model network formation reactions in semi-batch systems. We demonstrate that the loop fraction is not sensitive to the feeding policy if the reaction volume maintains constant during the network formation. However, if we initially put concentrated solution of small junction molecules in the reactor and continuously adding polymer solutions, the fractions of both primary loop and higher-order loops will be significantly reduced. There is a limiting value (nonzero) of loop fraction that can be achieved in the semi-batch system in condition of extremely slow feeding rate. This minimum loop fraction only depends on a single dimensionless variable, the product of concentration and with single chain pervaded volume, and defines an operating zone in which the loop fraction of polymer networks can be controlled through adjusting the feeding rate of the semi-batch process.
Xu, Jun; Guo, Baohua; Zhang, Zengmin; Wu, Qiong; Zhou, Quan; Chen, Jinchun; Chen, Guoqiang; Li, Guodong
2005-06-30
A mathematical model is proposed for predicting the copolymer composition of the microbially synthesized polyhydroxyalkanoate (PHA) copolymers. Based on the biochemical reactions involved in the precursor formation and polymerization pathways, the model correlates the copolymer composition with the cultivation conditions, the enzyme levels and selectivity, and the metabolic pathways. It suggests the following points: (1) in the case of a sole carbon source, the copolymer composition depends mainly on the topology of the metabolic pathways and the selectivity of both the enzymes involved in the precursor formation and the polymerization route; (2) the copolymer composition can be varied in a wide range via alteration of the flux ratio of different types of monomers channeled from two or more independent and simultaneous pathways; (3) the enzymes which should be over-expressed or inhibited to obtain the desired copolymer composition can be predicted. For example, inhibition of the beta-oxidation pathway will increase the content of the monomer units with longer chain length. To test the model, various experiments were envisaged by varying cultivation time, concentration and chain length of the sole carbon source, and molar ratio of the cosubstrates. The predictions from the model agree well with the experimental results. Therefore, the proposed model will be useful in predicting the PHA copolymer composition under different biochemical reaction conditions. In other words, it can provide a guide for the synthesis of desired PHA copolymers.
Code of Federal Regulations, 2014 CFR
2014-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2013 CFR
2013-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2012 CFR
2012-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Emilio Segrè and Spontaneous Fission
fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as
Wujcik, Kevin H.; Wang, Dunyang Rita; Pascal, Tod A.; ...
2016-12-01
Lithium sulfur (Li-S) batteries are well known for their high theoretical specific capacities, but are plagued with scientific obstacles that make practical implementation of the technology impossible. The success of Li-S batteries will likely necessitate the use of thick sulfur cathodes that enable high specific energy densities. However, little is known about the fundamental reaction mechanisms and chemical processes that take place in thick cathodes, as most research has focused on studying thinner cathodes that enable high performance. In this study, in situ X-ray absorption spectroscopy at the sulfur K-edge is used to examine the back of a 115 μmmore » thick Li-S cathode during discharge. Our results show that in such systems, where electrochemical reactions between sulfur and lithium are likely to proceed preferentially toward the front of the cathode, lithium polysulfide dianions formed in this region diffuse to the back of the cathode during discharge. We show that high conversion of elemental sulfur is achieved by chemical reactions between elemental sulfur and polysulfide dianions of intermediate chain length (Li 2S x, 4 ≤ x ≤ 6). Our work suggests that controlling the formation and diffusion of intermediate chain length polysulfide dianions is crucial for insuring full utilization of thick sulfur cathodes.« less
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Thermoswitchable Janus Gold Nanoparticles with Stimuli-Responsive Hydrophilic Polymer Brushes.
Niu, Xiaoqin; Ran, Fen; Chen, Limei; Lu, Gabriella Jia-En; Hu, Peiguang; Deming, Christopher P; Peng, Yi; Rojas-Andrade, Mauricio D; Chen, Shaowei
2016-05-03
Well-defined thermoswitchable Janus gold nanoparticles with stimuli-responsive hydrophilic polymer brushes were fabricated by combining ligand exchange reactions and the Langmuir technique. Stimuli-responsive polydi(ethylene glycol) methyl ether methacrylate was prepared by addition-fragmentation chain-transfer polymerization. The polymer brushes were then anchored onto the nanoparticle surface by interfacial ligand exchange reactions with hexanethiolate-protected gold nanoparticles, leading to the formation of a hydrophilic (polymer) hemisphere and a hydrophobic (hexanethiolate) one. The resulting Janus nanoparticles showed temperature-switchable wettability, hydrophobicity at high temperatures, and hydrophilicity at low temperatures, due to thermally induced conformational transition of the polymer ligands. The results further highlight the importance of interfacial engineering in the deliberate functionalization of nanoparticle materials.
NASA Astrophysics Data System (ADS)
Kuznietsova, I.; Rudzinski, K. J.; Szmigielski, R.; Laboratory of the Environmental Chemistry
2011-12-01
Atmospheric aerosols exhibit an important role in the environment. They have implications on human health and life, and - in the larger scale - on climate, the Earth's radiative balance and the cloud's formation. Organic matter makes up a significant fraction of atmospheric aerosols (~35% to ~90%) and may originate from direct emissions (primary organic aerosol, POA) or result from complex physico-chemical processes of volatile organic compounds (secondary organic aerosol, SOA). Isoprene (2-methyl-buta-1,3-diene) is one of the relevant volatile precursor of ambient SOA in the atmosphere. It is the most abundant non-methane hydrocarbon emitted to the atmosphere as a result of living vegetation. According to the recent data, the isoprene emission rate is estimated to be at the level of 500 TgC per year. While heterogeneous transformations of isoprene have been well documented, aqueous-phase reactions of this hydrocarbon with radical species that lead to the production of new class of wet SOA components such as polyols and their sulfate esters (organosulfates), are still poorly recognized. The chain reactions of isoprene with sulfoxy radical-anions (SRA) are one of the recently researched route leading to the formation of organosulfates in the aqueous phase. The letter radical species originate from the auto-oxidation of sulfur dioxide in the aqueous phase and are behind the phenomenon of atmospheric acid rain formation. This is a complicated chain reaction that is catalyzed by transition metal ions, such as manganese(II), iron(III) and propagated by sulfoxy radical anions . The presented work addresses the chemical interaction of isoprene with sulfoxy radical-anions in the water solution in the presence of nitrite ions and nitrous acid, which are important trace components of the atmosphere. We showed that nitrite ions and nitrous acid significantly altered the kinetics of the auto-oxidation of SO2 in the presence of isoprene at different solution acidity from 2 to 8.7. The presence of nitrogen-containing inorganic salts strongly impact the formation of novel organosulfur products, whereas no organonitrates were observed. A detailed characterization of these products with the triple-quadruple negative electrospray mass spectrometry (-)ESI-MS/MS revealed oxygenated polar species with C-5 skeleton bearing SO3H (MW 182, 180) and SO2H (MW 166, 164) moieties on the hydroxyl group. The structures of these products were firmly confirmed by comparison of their liquid chromatography and mass spectrometry behaviors with that corresponding to the synthesized model compounds. It is believed that newly discovered highly polar low molecular weight compounds may contribute to the growth of wet aerosol particles by the formation of higher molecular weight species.
Chain Reaction Polymerization.
ERIC Educational Resources Information Center
McGrath, James E.
1981-01-01
The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)
Characterizing Chain Processes in Visible Light Photoredox Catalysis
Cismesia, Megan A.
2015-01-01
The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708
Goblirsch, Brandon R.; Jensen, Matthew R.; Mohamed, Fatuma A.; Wackett, Lawrence P.; Wilmot, Carrie M.
2016-01-01
Phylogenetically diverse microbes that produce long chain, olefinic hydrocarbons have received much attention as possible sources of renewable energy biocatalysts. One enzyme that is critical for this process is OleA, a thiolase superfamily enzyme that condenses two fatty acyl-CoA substrates to produce a β-ketoacid product and initiates the biosynthesis of long chain olefins in bacteria. Thiolases typically utilize a ping-pong mechanism centered on an active site cysteine residue. Reaction with the first substrate produces a covalent cysteine-thioester tethered acyl group that is transferred to the second substrate through formation of a carbon-carbon bond. Although the basics of thiolase chemistry are precedented, the mechanism by which OleA accommodates two substrates with extended carbon chains and a coenzyme moiety—unusual for a thiolase—are unknown. Gaining insights into this process could enable manipulation of the system for large scale olefin production with hydrocarbon chains lengths equivalent to those of fossil fuels. In this study, mutagenesis of the active site cysteine in Xanthomonas campestris OleA (Cys143) enabled trapping of two catalytically relevant species in crystals. In the resulting structures, long chain alkyl groups (C12 and C14) and phosphopantetheinate define three substrate channels in a T-shaped configuration, explaining how OleA coordinates its two substrates and product. The C143A OleA co-crystal structure possesses a single bound acyl-CoA representing the Michaelis complex with the first substrate, whereas the C143S co-crystal structure contains both acyl-CoA and fatty acid, defining how a second substrate binds to the acyl-enzyme intermediate. An active site glutamate (Gluβ117) is positioned to deprotonate bound acyl-CoA and initiate carbon-carbon bond formation. PMID:27815501
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goblirsch, Brandon R.; Jensen, Matthew R.; Mohamed, Fatuma A.
Phylogenetically diverse microbes that produce long chain, olefinic hydrocarbons have received much attention as possible sources of renewable energy biocatalysts. One enzyme that is critical for this process is OleA, a thiolase superfamily enzyme that condenses two fatty acyl-CoA substrates to produce a β-ketoacid product and initiates the biosynthesis of long chain olefins in bacteria. Thiolases typically utilize a ping-pong mechanism centered on an active site cysteine residue. Reaction with the first substrate produces a covalent cysteine-thioester tethered acyl group that is transferred to the second substrate through formation of a carbon-carbon bond. Although the basics of thiolase chemistry aremore » precedented, the mechanism by which OleA accommodates two substrates with extended carbon chains and a coenzyme moiety—unusual for a thiolase—are unknown. Gaining insights into this process could enable manipulation of the system for large scale olefin production with hydrocarbon chains lengths equivalent to those of fossil fuels. In this study, mutagenesis of the active site cysteine in Xanthomonas campestris OleA (Cys143) enabled trapping of two catalytically relevant species in crystals. In the resulting structures, long chain alkyl groups (C12 and C14) and phosphopantetheinate define three substrate channels in a T-shaped configuration, explaining how OleA coordinates its two substrates and product. The C143A OleA co-crystal structure possesses a single bound acyl-CoA representing the Michaelis complex with the first substrate, whereas the C143S co-crystal structure contains both acyl-CoA and fatty acid, defining how a second substrate binds to the acyl-enzyme intermediate. An active site glutamate (Gluβ117) is positioned to deprotonate bound acyl-CoA and initiate carbon-carbon bond formation.« less
Reaction Paths and Chemical Activation Reactions of 2-Methyl-5-Furanyl Radical with 3O2.
Hudzik, Jason M; Bozzelli, Joseph W
2017-10-05
Interest in high-energy substituted furans has been increasing due to their occurrence in biofuel production and their versatility in conversion to other useful products. Methylfurans are the simplest substituted furans and understanding their reaction pathways, thermochemical properties, including intermediate species stability, and chemical kinetics would aid in the study of larger furans. Furan ring C-H bonds have been shown to be extremely strong, approximately 120 kcal mol -1 , due in part to the placement of the oxygen atom and aromatic-like resonance, both within the ring. The thermochemistry and kinetics of the oxidation of 2-methyfuran radical at position 5 of the furan ring, 2-methyl-5-furanyl radical (2MF5j), is analyzed. The resulting chemically activated species, 2MF5OOj radical, has a well depth of 51 kcal mol -1 below the 2MF5j + O 2 reactants; this is 4-5 kcal mol -1 deeper than that of phenyl and vinyl radical plus O 2 , with both of these reactions known to undergo chain branching. Important, low-energy reaction pathways include chain branching dissociations, intramolecular abstractions, group transfers, and radical oxygen additions. Enthalpies of formation, entropies, and heat capacities for the stable molecules, radicals, and transition-state species are analyzed using computational methods. Calculated ΔH ° f 298 values were determined using an isodesmic work reaction from the CBS-QB3 composite method. Elementary rate parameters are from saddle point transition-state structures and compared to variational transition-state analysis for the barrierless reactions. Temperature- and pressure-dependent rate constants which are calculated using QRRK and master equation analysis is used for falloff and stabilization.
New synthesis of maleic anhydride modified polyolefins and their applications
NASA Astrophysics Data System (ADS)
Lu, Bing
Maleic anhydride (MA) modified polyolefins are the most useful commercial functional polyolefins. The current technology of producing MA modified polyolefins, mainly free radical modification, usually results in low MA graft contents, extensive side reactions, and poor control of graft structures. In this thesis, we show a new synthetic route for preparing MA modified polyolefins with excellent control of polymer structures and MA concentrations. The synthesis is based on the "reactive" polyolefin copolymers, i.e. polyolefins containing p-methylstyrene or alkylborane groups. The p-methylstyrene copolymers lead to selectively grafting reactions on the p-methyl groups, greatly reducing the side reactions on the polyolefin backbone. The MA graft content was proportional to the concentration of p-methylstyrene. In the borane approach, under controlled selective oxidation, the alkylborane containing PP polymers formed the "stable" polymeric radical in situ which initiated the graft-from reaction. By varying the monomer concentrations of MA and styrene, reaction time and temperature, a broad range of MA modified PP polymers were prepared from a single MA terminated or grafted PP to a very long SMA segment blocked or grafted PP, and there is no detectable side reaction on the PP backbone. MA modified polyolefins were investigated in the applications of glass fiber reinforced PP, elastomer toughened Nylon, and polyolefin/Nylon blends. The MA modified polyolefin compatibilizers showed the significant improved mechanical properties and morphology of the blends. The effectiveness of compatibilization depends on the MA concentration, molecular weight of the polyolefin segments, the structure of the compatibilizers, and the composition of the blend. By amidation or imidation reaction of MA modified PP with amine terminated PP, long chain branched PP polymers were also prepared. The results of IR, GPC, intrinsic viscosity and DSC studies clearly indicate the formation of long chain branched PP.
Formation of RNA oligomers on montmorillonite: site of catalysis
NASA Technical Reports Server (NTRS)
Ertem, G.; Ferris, J. P.
1998-01-01
Certain montmorillonites catalyze the self condensation of the 5'-phosphorimidazolide of nucleosides in pH 8 aqueous electrolyte solutions at ambient temperatures leading to formation of RNA oligomers. In order to establish the nature of the sites on montmorillonite responsible for this catalytic activity, oligomerization reactions were run with montmorillonites which had been selectively modified (I) at the edges by (a) fluoride treatment, (b) silylation, (c) metaphosphate treatment of the anion exchange sites (II) in the interlayer by (a) saturation with quaternary alkylammonium ions of increasing size, (b) aluminum polyoxo cations. High pressure liquid chromatography, HPLC, analysis of condensation products for their chain lengths and yields indicated that modification at the edges did not affect the catalytic activity to a significant extent, while blocking the interlayer strongly inhibited product formation.
Growth of carbon chains in IRC +10216 mapped with ALMA
NASA Astrophysics Data System (ADS)
Agúndez, M.; Cernicharo, J.; Quintana-Lacaci, G.; Castro-Carrizo, A.; Velilla Prieto, L.; Marcelino, N.; Guélin, M.; Joblin, C.; Martín-Gago, J. A.; Gottlieb, C. A.; Patel, N. A.; McCarthy, M. C.
2017-05-01
Linear carbon chains are common in various types of astronomical molecular sources. Possible formation mechanisms involve both bottom-up and top-down routes. We have carried out a combined observational and modeling study of the formation of carbon chains in the C-star envelope IRC +10216, where the polymerization of acetylene and hydrogen cyanide induced by ultraviolet photons can drive the formation of linear carbon chains of increasing length. We have used ALMA to map the emission of λ 3 mm rotational lines of the hydrocarbon radicals C2H, C4H, and C6H, and the CN-containing species CN, C3N, HC3N, and HC5N with an angular resolution of 1''. The spatial distribution of all these species is a hollow 5-10'' wide spherical shell located at a radius of 10-20'' from the star, with no appreciable emission close to the star. Our observations resolve the broad shell of carbon chains into thinner subshells that are 1-2'' wide and not fully concentric, indicating that the mass-loss process has been discontinuous and not fully isotropic. The radial distributions of the species mapped reveal subtle differences: while the hydrocarbon radicals have very similar radial distributions, the CN-containing species show more diverse distributions, with HC3N appearing earlier in the expansion and the radical CN extending later than the rest of the species. The observed morphology can be rationalized by a chemical model in which the growth of polyynes is mainly produced by rapid gas-phase chemical reactions of C2H and C4H radicals with unsaturated hydrocarbons, while cyanopolyynes are mainly formed from polyynes in gas-phase reactions with CN and C3N radicals. Based on observations carried out with ALMA and the IRAM 30 m Telescope. ALMA is a partnership of ESO (representing its member states), NSF (USA) and NINS (Japan), together with NRC (Canada) and NSC and ASIAA (Taiwan), in cooperation with the Republic of Chile. The Joint ALMA Observatory is operated by ESO, AUI/NRAO and NAOJ. IRAM is supported by INSU/CNRS (France), MPG (Germany) and IGN (Spain). This paper makes use of the following ALMA data: ADS/JAO.ALMA#2013.1.00432.S.Data cube (FITS file) is available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/601/A4
Formation of Glycerol through Hydrogenation of CO Ice under Prestellar Core Conditions
NASA Astrophysics Data System (ADS)
Fedoseev, G.; Chuang, K.-J.; Ioppolo, S.; Qasim, D.; van Dishoeck, E. F.; Linnartz, H.
2017-06-01
Observational studies reveal that complex organic molecules (COMs) can be found in various objects associated with different star formation stages. The identification of COMs in prestellar cores, I.e., cold environments in which thermally induced chemistry can be excluded and radiolysis is limited by cosmic rays and cosmic-ray-induced UV photons, is particularly important as this stage sets up the initial chemical composition from which ultimately stars and planets evolve. Recent laboratory results demonstrate that molecules as complex as glycolaldehyde and ethylene glycol are efficiently formed on icy dust grains via nonenergetic atom addition reactions between accreting H atoms and CO molecules, a process that dominates surface chemistry during the “CO freeze-out stage” in dense cores. In the present study we demonstrate that a similar mechanism results in the formation of the biologically relevant molecule glycerol—HOCH2CH(OH)CH2OH—a three-carbon-bearing sugar alcohol necessary for the formation of membranes of modern living cells and organelles. Our experimental results are fully consistent with a suggested reaction scheme in which glycerol is formed along a chain of radical-radical and radical-molecule interactions between various reactive intermediates produced upon hydrogenation of CO ice or its hydrogenation products. The tentative identification of the chemically related simple sugar glyceraldehyde—HOCH2CH(OH)CHO—is discussed as well. These new laboratory findings indicate that the proposed reaction mechanism holds much potential to form even more complex sugar alcohols and simple sugars.
Organizer and axes formation as a self-organizing process.
Meinhardt, H
2001-01-01
It is a widely held view that axis formation is based essentially on pre-localized determinants. However, the robustness of early development, the pattern regulation observed after experimental interferences and the existence of systems that don't require maternal determinants suggest that self-regulating pattern forming systems are also involved. A model is proposed that allows axes formation by a chain of reactions based on local self-enhancement and long-range inhibition. Their appropriate linkage ensures that the intermediary patterns emerge in the correct sequence and have the correct spatial relation to each other. Specifically, the model comprises the following events: the generation of a pole by a pattern-forming process, the formation of a second organizer eccentric to the pole (e.g. the Nieuwkoop center), the ecto-meso-endo subdivision, the generation of the Spemann-Mangold organizer with its anterior-posterior subdivision under the influence of the Nieuwkoop center, the conversion of the Spemann-Mangold organizer (a hot spot) into the notochord (a hot stripe), and the marking of the left side of the organism by a patterning reaction influenced by the midline. The pattern forming reactions do not depend on but can make use of maternally pre-localized determinants or asymmetries. Comparison with known genes and molecules reveals that many of the expected ingredients are present. Computer simulations show that the model accounts for many regulatory features reported in the literature. The computer simulations are available in an animated form at.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru
2016-09-15
It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.
Zhu, Hui; Shuman, Stewart
2005-04-01
NAD+-dependent DNA ligase (LigA) is essential for bacterial growth and a potential target for antimicrobial drug discovery. Here we queried the role of 14 conserved amino acids of Escherichia coli LigA by alanine scanning and thereby identified five new residues within the nucleotidyltransferase domain as being essential for LigA function in vitro and in vivo. Structure activity relationships were determined by conservative mutagenesis for the Glu-173, Arg-200, Arg-208, and Arg-277 side chains, as well as four other essential side chains that had been identified previously (Lys-115, Asp-117, Asp-285, and Lys-314). In addition, we identified Lys-290 as important for LigA activity. Reference to the structure of Enterococcus faecalis LigA allowed us to discriminate three classes of essential/important side chains that: (i) contact NAD+ directly (Lys-115, Glu-173, Lys-290, and Lys-314); (ii) comprise the interface between the NMN-binding domain (domain Ia) and the nucleotidyltransferase domain or comprise part of a nick-binding site on the surface of the nucleotidyltransferase domain (Arg-200 and Arg-208); or (iii) stabilize the active site fold of the nucleotidyltransferase domain (Arg-277). Analysis of mutational effects on the isolated ligase adenylylation and phosphodiester formation reactions revealed different functions for essential side chains at different steps of the DNA ligase pathway, consistent with the proposal that the active site is serially remodeled as the reaction proceeds.
A GC-MS method for the detection of toluene and ethylbenzene in volatile substance abuse.
El-Haj, B M; Al-Amri, A M; Hassan, M H; Bin-Khadem, R K; Al-Hadi, A A
2000-09-01
The interference of some substances with the gas chromatography-flame ionization detection and gas chromatography-Fourier transform infrared detection of toluene and ethylbenzene in volatile substance abuse poses problems. A gas chromatography-mass spectrometry (GC-MS) method that will overcome such interference has been developed for the detection of toluene and/or ethylbenzene in the headspace of preparations and products containing these substances and in the headspace of blood samples in the cases of volatile substance abuse. The method is based on converting toluene to benzoic acid via the formation of benzotrichloride. The latter compound was obtained upon the reaction of toluene with chlorine gas under direct sunlight conditions. In the presence of water, benzotrichloride was converted to benzoic acid. Ethylbenzene was converted to benzoic acid and two phenylethanols via the formation of side chain chloro-substituted phenylethanes followed by reaction with water. The chloro-substituted phenylethanes were obtained by the reaction of ethylbenzene with chlorine under direct sunlight conditions. The benzoic acid resulting from toluene and/or ethylbenzene and the two phenylethanols resulting from ethylbenzene were detected by GC-MS as their trimethylsilyl (TMS) derivatives. For the method to be viable for the detection of volatile substance abuse, the chlorination reactions were effected in the gaseous state.
Formation of a xerogel in reduced gravity using the acid catalysed silica sol-gel reaction
NASA Astrophysics Data System (ADS)
Pienaar, Christine L.; Steinberg, Theodore A.
2006-01-01
An acid catalysed silica sol-gel reaction was used to create a xerogel in reduced gravity. Samples were formed in a special apparatus which utilised vacuum and heating to speed up the gelation process. Testing was conducted aboard NASA's KC-135 aircraft which flies a parabolic trajectory, producing a series of 25 second reduced gravity periods. The samples formed in reduced gravity were compared against a control sample formed in normal gravity. 29Si NMR and nitrogen adsorption/desorption techniques yielded information on the molecular and physical structure of the xerogels. The microstructure of the reduced gravity samples contained more Q 4 groups and less Q 3 and Q2 groups than the control sample. The pore size of the reduced gravity samples was also larger than the control sample. This indicated that in a reduced gravity environment, where convection is lessened due to the removal of buoyancy forces, the microstructure formed through cyclisation reactions rather than bimolecularisation reactions. The latter requires the movement of molecules for reactions to occur whereas cyclisation only requires a favourable configuration. Q 4 groups are stabilised when contained in a ring structure and are unlikely to undergo repolymerisation. Thus reduced gravity favoured the formation of a xerogel through cyclisation, producing a structure with more highly coordinated Q groups. The xerogel formed in normal gravity contained both chain and ring structures as bimolecularisation reactions were able to effectively compete with cyclisation.
Caldés, Catalina; Vilanova, Bartolomé; Adrover, Miquel; Donoso, Josefa; Muñoz, Francisco
2013-04-01
Schiff bases (SBs) are the initial products of non-enzymatic glycation reactions, which are associated to some diabetes-related diseases. In this work, we used physiological pH and temperature conditions to study the formation kinetics of the SBs of 1,2-dihexanoyl-sn-glycero-3-phosphoethanolamine (DPHE) and 1,2-dihexanoyl-sn-glycero-3-phospho-l-serine (DHPS) with various glycating compounds and with pyridoxal 5'-phosphate (an effective glycation inhibitor). Based on the obtained results, the hydrophobic environment simultaneously decreases the nucleophilic character of the amino group (k1) and increases its pKa, thereby increasing the formation rate of SB (kobs). Therefore, the presence of hydrophobic chains in aminophospholipids facilitates the formation and stabilization of SBs, and also, in a biological environment, their glycation. Additionally, the results confirm the inhibitory action of B6 vitamers on aminophospholipid glycation. Copyright © 2013 Elsevier Ltd. All rights reserved.
Masunov, Artëm E; Wait, Elizabeth; Vasu, Subith S
2017-08-03
The supercritical carbon dioxide diluent is used to control the temperature and to increase the efficiency in oxycombustion fossil fuel energy technology. It may affect the rates of combustion by altering mechanisms of chemical reactions, compared to the ones at low CO 2 concentrations. Here, we investigate potential energy surfaces of the four elementary reactions in the CH 3 + O 2 reactive system in the presence of one CO 2 molecule. In the case of reaction CH 3 + O 2 → CH 2 O + OH (R1 channel), van der Waals (vdW) complex formation stabilizes the transition state and reduces the activation barrier by ∼2.2 kcal/mol. Alternatively, covalently bonded CO 2 may form a six-membered ring transition state and reduce the activation barrier by ∼0.6 kcal/mol. In case of reaction CH 3 + O 2 → CH 3 O + O (R2 channel), covalent participation of CO 2 lowers the barrier for the rate limiting step by 3.9 kcal/mol. This is expected to accelerate the R2 process, important for the branching step of the radical chain reaction mechanism. For the reaction CH 3 + O 2 → CHO + H 2 O (R3 channel) with covalent participation of CO 2 , the activation barrier is lowered by 0.5 kcal/mol. The reaction CH 2 O + OH → CHO + H 2 O (R4 channel) involves hydrogen abstraction from formaldehyde by OH radical. Its barrier is reduced from 7.1 to 0.8 kcal/mol by formation of vdW complex with spectator CO 2 . These new findings are expected to improve the kinetic reaction mechanism describing combustion processes in supercritical CO 2 medium.
NASA Astrophysics Data System (ADS)
Lee, Austin W. H.; Kim, Dongho; Gates, Byron D.
2018-04-01
The thickness of alcohol based monolayers on silicon oxide surfaces were investigated using angle-resolved X-ray photoelectron spectroscopy (ARXPS). Advantages of using alcohols as building blocks for the formation of monolayers include their widespread availability, ease of handling, and stability against side reactions. Recent progress in microwave assisted reactions demonstrated the ease of forming uniform monolayers with alcohol based reagents. The studies shown herein provide a detailed investigation of the thickness of monolayers prepared from a series of aliphatic alcohols of different chain lengths. Monolayers of 1-butanol, 1-hexanol, 1-octanol, 1-decanol, and 1-dodecanol were each successfully formed through microwave assisted reactions and characterized by ARXPS techniques. The thickness of these monolayers consistently increased by ∼1.0 Å for every additional methylene (CH2) within the hydrocarbon chain of the reagents. Tilt angles of the molecules covalently attached to silicon oxide surfaces were estimated to be ∼35° for each type of reagent. These results were consistent with the observations reported for thiol based or silane based monolayers on either gold or silicon oxide surfaces, respectively. The results of this study also suggest that the alcohol based monolayers are uniform at a molecular level.
Ashraf, Jalaluddin Mohammad; Rabbani, Gulam; Ahmad, Saheem; Hasan, Qambar; Khan, Rizwan Hasan; Alam, Khursheed; Choi, Inho
2015-01-01
Advanced glycation end products (AGEs) culminate from the non-enzymatic reaction between a free carbonyl group of a reducing sugar and free amino group of proteins. 3-deoxyglucosone (3-DG) is one of the dicarbonyl species that rapidly forms several protein-AGE complexes that are believed to be involved in the pathogenesis of several diseases, particularly diabetic complications. In this study, the generation of AGEs (Nε-carboxymethyl lysine and pentosidine) by 3-DG in H1 histone protein was characterized by evaluating extent of side chain modification (lysine and arginine) and formation of Amadori products as well as carbonyl contents using several physicochemical techniques. Results strongly suggested that 3-DG is a potent glycating agent that forms various intermediates and AGEs during glycation reactions and affects the secondary structure of the H1 protein. Structural changes and AGE formation may influence the function of H1 histone and compromise chromatin structures in cases of secondary diabetic complications. PMID:26121680
Holland, Brendan J; Adcock, Jacqui L; Nesterenko, Pavel N; Peristyy, Anton; Stevenson, Paul G; Barnett, Neil W; Conlan, Xavier A; Francis, Paul S
2014-09-09
Sodium polyphosphate is commonly used to enhance chemiluminescence reactions with acidic potassium permanganate through a dual enhancement mechanism, but commercially available polyphosphates vary greatly in composition. We have examined the influence of polyphosphate composition and concentration on both the dual enhancement mechanism of chemiluminescence intensity and the stability of the reagent under analytically useful conditions. The average chain length (n) provides a convenient characterisation, but materials with similar values can exhibit markedly different distributions of phosphate oligomers. There is a minimum polyphosphate chain length (∼6) required for a large enhancement of the emission intensity, but no further advantage was obtained using polyphosphate materials with much longer average chain lengths. Providing there is a sufficient average chain length, the optimum concentration of polyphosphate is dependent on the analyte and in some cases, may be lower than the quantities previously used in routine detection. However, the concentration of polyphosphate should not be lowered in permanganate reagents that have been partially reduced to form high concentrations of the key manganese(III) co-reactant, as this intermediate needs to be stabilised to prevent formation of insoluble manganese(IV). Copyright © 2014 Elsevier B.V. All rights reserved.
Macías, Mario A.; Pandolfi, Enrique; Schapiro, Valeria; Silveira, Gustavo P.; Vilela, Guilherme D.; Suescun, Leopoldo
2017-01-01
The absolute configuration, i.e. (3aR,3′aR,7aS,7′aS), of the title compound, C18H26O4, synthesized via a palladium-catalyzed homocoupling reaction, was determined on the basis of the synthetic pathway and was confirmed by X-ray diffraction. The homocoupled molecule is formed by two chemically identical moieties built up from two five- and six-membered fused rings. The supramolecular assembly is controlled mainly by C—H⋯O interactions that lead to the formation of hydrogen-bonded chains of molecules along the [001] direction, while weak dipolar interactions and van der Waals forces hold the chains together in the crystal structure. PMID:28083142
Zhou, Xing; Fang, Changqing; Lei, Wanqing; Du, Jie; Huang, Tingyi; Li, Yan; Cheng, Youliang
2016-01-01
Water plays important roles in organic reactions such as polyurethane synthesis, and the aqueous solution environment affects polymer morphology and other properties. This paper focuses on the morphology and surface properties of waterborne polyurethane resulting from the organic reaction in water involving different forms (solid and liquid), temperatures and aqueous solutions. We provide evidence from TEM observations that the appearance of polyurethane nanoparticles in aqueous solutions presents diverse forms, including imperfect spheres, perfect spheres, perfect and homogenous spheres and tubes. Based on the results on FTIR, GPC, AFM and XRD experiments, we suggest that the shape of the nanoparticles may be decided by the crimp degree (i.e., the degree of polyurethane chains intertangling in the water environment) and order degree, which are determined by the molecular weight (Mn) and hydrogen bonds. Meanwhile, solid water and high-temperature water can both reduce hard segments that gather on the polyurethane film surface to reduce hydrophilic groups and produce a soft surface. Our findings show that water may play key roles in aqueous polymer formation and bring order to molecular chains. PMID:27687001
Low NO Concentration Dependence of Reductive Nitrosylation Reaction of Hemoglobin*
Tejero, Jesús; Basu, Swati; Helms, Christine; Hogg, Neil; King, S. Bruce; Kim-Shapiro, Daniel B.; Gladwin, Mark T.
2012-01-01
The reductive nitrosylation of ferric (met)hemoglobin is of considerable interest and remains incompletely explained. We have previously observed that at low NO concentrations the reaction with tetrameric hemoglobin occurs with an observed rate constant that is at least 5 times faster than that observed at higher concentrations. This was ascribed to a faster reaction of NO with a methemoglobin-nitrite complex. We now report detailed studies of this reaction of low NO with methemoglobin. Nitric oxide paradoxically reacts with ferric hemoglobin with faster observed rate constants at the lower NO concentration in a manner that is not affected by changes in nitrite concentration, suggesting that it is not a competition between NO and nitrite, as we previously hypothesized. By evaluation of the fast reaction in the presence of allosteric effectors and isolated β- and α-chains of hemoglobin, it appears that NO reacts with a subpopulation of β-subunit ferric hemes whose population is influenced by quaternary state, redox potential, and hemoglobin dimerization. To further characterize the role of nitrite, we developed a system that oxidizes nitrite to nitrate to eliminate nitrite contamination. Removal of nitrite does not alter reaction kinetics, but modulates reaction products, with a decrease in the formation of S-nitrosothiols. These results are consistent with the formation of NO2/N2O3 in the presence of nitrite. The observed fast reductive nitrosylation observed at low NO concentrations may function to preserve NO bioactivity via primary oxidation of NO to form nitrite or in the presence of nitrite to form N2O3 and S-nitrosothiols. PMID:22493289
Tsusaki, Keiji; Watanabe, Hikaru; Yamamoto, Takuo; Nishimoto, Tomoyuki; Chaen, Hiroto; Fukuda, Shigeharu
2012-01-01
Highly branched α-glucan molecules exhibit low digestibility for α-amylase and glucoamylase, and abundant in α-(1→3)-, α-(1→6)-glucosidic linkages and α-(1→6)-linked branch points where another glucosyl chain is initiated through an α-(1→3)-linkage. From a culture supernatant of Paenibacillus sp. PP710, we purified α-glucosidase (AGL) and α-amylase (AMY), which were involved in the production of highly branched α-glucan from maltodextrin. AGL catalyzed the transglucosylation reaction of a glucosyl residue to a nonreducing-end glucosyl residue by α-1,6-, α-1,4-, and α-1,3-linkages. AMY catalyzed the hydrolysis of the α-1,4-linkage and the intermolecular or intramolecular transfer of maltooligosaccharide like cyclodextrin glucanotransferase (CGTase). It also catalyzed the transfer of an α-1,4-glucosyl chain to a C3- or C4-hydroxyl group in the α-1,4- or α-1,6-linked nonreducing-end residue or the α-1,6-linked residue located in the other chains. Hence AMY was regarded as a novel enzyme. We think that the mechanism of formation of highly branched α-glucan from maltodextrin is as follows: α-1,6- and α-1,3-linked residues are generated by the transglucosylation of AGL at the nonreducing ends of glucosyl chains. Then AMY catalyzes the transfer of α-1,4-chains to C3- or C4-hydroxyl groups in the α-1,4- or α-1,6-linked residues generated by AGL. Thus the concerted reactions of both AGL and AMY are necessary to produce the highly branched α-glucan from maltodextrin.
Influence of ester-modified lipids on bilayer structure.
Villanueva, Diana Y; Lim, Joseph B; Klauda, Jeffery B
2013-11-19
Lipid membranes function as barriers for cells to prevent unwanted chemicals from entering the cell and wanted chemicals from leaving. Because of their hydrophobic interior, membranes do not allow water to penetrate beyond the headgroup region. We performed molecular simulations to examine the effects of ester-modified lipids, which contain ester groups along their hydrocarbon chains, on bilayer structure. We chose two lipids from those presented in Menger et al. [J. Am. Chem. Soc. 2006, 128, 14034] with ester groups in (1) the upper half of the lipid chain (MEPC) and (2) the middle and end of the lipid chain (MGPC). MGPC (30%)/POPC bilayers formed stable water pores of diameter 5-7 Å, but MGPC (22%)/POPC and MEPC (30%)/POPC bilayers did not form these defects. These pores were similar to those formed during electroporation; i.e., the head groups lined the pore and allowed water and ions to transport across the bilayer. However, we found that lateral organization of the MGPC lipids into clusters, instead of an electric field or charge disparity as in electroporation, was essential for pore formation. On the basis of this, we propose an overall mechanism for pore formation. The similarities between the ester-modified lipids and byproducts of lipid peroxidation with multiple hydrophilic groups in the middle of the chain suggest that free radical reactions with unsaturated lipids and sterols result in fundamental changes that may be similar to what is seen in bilayers with ester-modified lipids.
Peroxy radical detection by chemical amplification (PERCA)
NASA Technical Reports Server (NTRS)
Stedman, D. H.
1986-01-01
Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.
Araújo, Maria Elisa Melo Branco de; Campos, Paula Renata Bueno; Alberto, Thiago Grando; Contesini, Fabiano Jares; Carvalho, Patrícia de Oliveira
The search for new biocatalysts has aroused great interest due to the variety of micro-organisms and their role as enzyme producers. Native lipases from Aspergillus niger and Rhizopus javanicus were used to enrich the n-3 long-chain polyunsaturated fatty acids content in the triacylglycerols of soybean oil by acidolysis with free fatty acids from sardine oil in solvent-free media. For the immobilization process, the best lipase/support ratios were 1:3 (w/w) for Aspergillus niger lipase and 1:5 (w/w) for Rhizopus javanicus lipase using Amberlite MB-1. Both lipases maintained constant activity for 6 months at 4°C. Reaction time, sardine-free fatty acids:soybean oil mole ratio and initial water content of the lipase were investigated to determine their effects on n-3 long-chain polyunsaturated fatty acids incorporation into soybean oil. Structured triacylglycerols with 11.7 and 7.2% of eicosapentaenoic acid+docosahexaenoic acid were obtained using Aspergillus niger lipase and Rhizopus javanicus lipase, decreasing the n-6/n-3 fatty acids ratio of soybean oil (11:1 to 3.5:1 and 4.7:1, respectively). The best reaction conditions were: initial water content of lipase of 0.86% (w/w), sardine-free faty acids:soybean oil mole ratio of 3:1 and reaction time of 36h, at 40°C. The significant factors for the acidolysis reaction were the sardine-free fatty acids:soybean oil mole ratio and reaction time. The characterization of structured triacylglycerols was obtained using easy ambient sonic-spray ionization mass spectrometry. The enzymatic reaction led to the formation of many structured triacylglycerols containing eicosapentaenoic acid, docosahexaenoic acid or both polyunsaturated fatty acids. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Lebedev, A V; Ivanova, M V; Timoshin, A A; Ruuge, E K
2008-01-01
Ca2+-induced increase in the rate of pyrocatechol and dopamine oxidation by dioxygen and Ca2+-dependent acid-base properties of the catechols were studied by potentiometric titration, UV/Vis-spectrophotometry, EPR-spectroscopy, and by measurement of oxygen consumption. The effect of Ca2+ on the chain reactions of oxidation can be explained by additional deprotonation (decrease in pKai) of the catechols that accelerates one electron transport to dioxygen and formation of calcium semiquinonate, undergoing further oxidation. The described Ca2+-dependent redox-conversion of ortho-phenols proposes that an additional function of calcium in the cell can be its involvement in free radical oxidoreductive reactions at pH > pKai.
One-step solution fabrication of magnetic chains consisting of jingle-bell-shaped cobalt mesospheres
NASA Astrophysics Data System (ADS)
Liang, Fang; Guo, Lin; Zhong, QunPeng; Wen, Xiaogang; Yang, Shihe; Zheng, Wangzhi; Chen, Chinping; Zhang, Nina; Chu, Weiguo
2006-09-01
Using a one-step solution phase approach, the authors have synthesized uniform jingle bell-shaped cobalt mesopheres (550-750nm) and assembled the mesospheres into long magnetic chains (20-30μm). All of the cobalt spheres are hollow with ˜40nm thick shells but each contains an ˜200nm diameter solid ball. The nano- to mesoscale structures were realized via reaction of CoCl2•6H2O and N2H4•H2O in the presence of polyvinylpyrrolidone (PVP) in an ethylene glycol solution. Magnetic measurements show a coercivity of about 75Oe with a remnance of 9.6emu /g at 300K. We propose a possible mechanism for the formation of the nanoto mesoscale structures.
Zhao, Ping; Inoue, Kenichiro; Kouno, Isao; Yamamoto, Hirobumi
2003-01-01
Leachianone G (LG) 2′′-dimethylallyltransferase, a novel prenyl side-chain elongation enzyme, was identified in Sophora flavescens Ait. cultured cells. The enzyme transfers a dimethylallyl group to the 2′′ position of another dimethylallyl group attached at position 8 of LG to form sophoraflavanone G, a branched monoterpenoid-conjugated flavanone characteristic to this plant. This membrane-bound dimethylallyltransferase required Mg2+ (optimum concentration was 10 mm) for the reaction and had an optimum pH of 8.8. It utilized dimethylallyl diphosphate as the sole prenyl donor, and the 2′-hydroxy function in LG was indispensable to the activity. The apparent Km values for dimethylallyl diphosphate and LG were 59 and 2.3 μm, respectively. Subcellular localization of three enzymes that participated in the formation of the lavandulyl group was also investigated by sucrose density gradient centrifugation. Two prenyltransferases, naringenin 8-dimethylallyltransferase and LG 2′′-dimethylallyltransferase, were localized in the plastids, whereas 8-dimethylallylnaringenin 2′-hydroxylase, which catalyzes the crucial step in the lavandulyl-group formation, was associated with the endoplasmic reticulum. These results suggest the close cooperation between the plastids and the endoplasmic reticulum in the formation of lavandulyl groups. PMID:14551337
Discovery of ^{13}CCC in SgrB2(M)
NASA Astrophysics Data System (ADS)
Giesen, Thomas; Mookerjea, Bhaswati; Stutzki, Jürgen; Breier, Alexander A.; Buechling, Thomas; Fuchs, Guido W.
2017-06-01
Small carbon chain molecules like linear C_3 are thought to play a crucial role in the formation of larger, complex molecules, including pre-biotic species. The formation pathways of organic molecules with carbon chains as backbones is by far not well understood. Studies of isotope fractionation have proven to be a useful tool of tracing chemical reaction pathways and to elucidate formation and destruction processes of interstellar molecules. Recent velocity-resolved observations in the far-infrared have resulted in the detection of C_3 ro-vibrational transitions in the warm envelopes of star-forming hot cores W31C, W49N and DR21(OH). Multiple far-infrared transitions of C_3 have also been detected towards the Galactic center molecular clouds SgrB2(M) and Sgr B2(N). Since C^+ is involved in an important step of the formation route of the C_3 molecule, it is likely that effects of isotopic fractionation of C^+ will manifest itself in the ^{12}C_3/^{13}CCC and ^{12}C_3/C^{13}CC ratios as well. Based on high resolution THz- laboratory measurements of C_3 and its ^{13}C-isotopologues conducted at the Kassel laboratories, we used the GREAT-receiver onboard SOFIA for a first ever detection of ^{13}CCC towards SgrB2(M). In this talk we present results and possible implications of the observation.
Jung, Sung-No; Rhie, Jong Won; Kwon, Ho; Jun, Young Joon; Seo, Je-Won; Yoo, Gyeol; Oh, Deuk Young; Ahn, Sang Tae; Woo, Jihyoun; Oh, Jieun
2010-03-01
Human adipose-derived mesenchymal stem cells (MSCs) were differentiated into chondrogenic MSCs, and fibrin glue was used together to explore the feasibility of whether cartilages can be generated in vivo by injecting the differentiated cells. Mesenchymal stem cells extracted from human adipose were differentiated into chondrogenic MSCs, and such differentiated cells mixed with fibrin glue were injected subcutaneously into the back of the nude mouse. In addition to visual evaluation of the tissues formed after 4, 8, and 12 weeks, hematoxylin-eosin staining, Masson trichrome staining, measurement of glycosaminoglycan concentration using dimethylmethylene blue, agreecan through reverse transcriptase-polymerase chain reaction, type II collagen, and expression of SOX-9 were verified. Moreover, the results were compared with 2 groups of controls: 1 control group that received only injection of chondrogenic-differentiated MSC and the supporting control group that received only fibrin glue injection. For the experimental group, cartilage-like tissues were formed after 4, 8, and 12 weeks. Formation of cartilage tissues was not observed in any of 4, 8, and 12 weeks of the control group. The supporting control group had only a small structure formation after 4 weeks, but the formed structure was completely decomposed by the 8th and 12th weeks. The range of staining dramatically increased with time at 4, 8, and 12 weeks in Masson trichrome staining. The concentration of glycosaminoglycan also increased with time. The increased level was statistically significant with more than 3 times more after 8 weeks compared with 4 weeks and more than 2 times more after 12 weeks compared with 8 weeks. Also, in reverse transcriptase-polymerase chain reaction at 4, 8, and 12 weeks, all results expressed a cartilage-specific gene called aggrecan, type II collagen, and SOX-9. The study verified that the chondrogenic-differentiated MSCs derived from human adipose tissues with fibrin glue can proliferate and form new cartilage. Our findings suggest that formation of cartilages in vivo is possible.
Vagne, Quentin; Turner, Matthew S.; Sens, Pierre
2015-01-01
The formation of dynamical clusters of proteins is ubiquitous in cellular membranes and is in part regulated by the recycling of membrane components. We show, using stochastic simulations and analytic modeling, that the out-of-equilibrium cluster size distribution of membrane components undergoing continuous recycling is strongly influenced by lateral confinement. This result has significant implications for the clustering of plasma membrane proteins whose mobility is hindered by cytoskeletal “corrals” and for protein clustering in cellular organelles of limited size that generically support material fluxes. We show how the confinement size can be sensed through its effect on the size distribution of clusters of membrane heterogeneities and propose that this could be regulated to control the efficiency of membrane-bound reactions. To illustrate this, we study a chain of enzymatic reactions sensitive to membrane protein clustering. The reaction efficiency is found to be a non-monotonic function of the system size, and can be optimal for sizes comparable to those of cellular organelles. PMID:26656912
Song, Heng; Hu, Wen; Naowarojna, Nathchar; Her, Ampon Sae; Wang, Shu; Desai, Rushil; Qin, Li; Chen, Xiaoping; Liu, Pinghua
2015-01-01
Ergothioneine is a histidine thio-derivative isolated in 1909. In ergothioneine biosynthesis, the combination of a mononuclear non-heme iron enzyme catalyzed oxidative C-S bond formation reaction and a PLP-mediated C-S lyase (EgtE) reaction results in a net sulfur transfer from cysteine to histidine side-chain. This demonstrates a new sulfur transfer strategy in the biosynthesis of sulfur-containing natural products. Due to difficulties associated with the overexpression of Mycobacterium smegmatis EgtE protein, the proposed EgtE functionality remained to be verified biochemically. In this study, we have successfully overexpressed and purified M. smegmatis EgtE enzyme and evaluated its activities under different in vitro conditions: C-S lyase reaction using either thioether or sulfoxide as a substrate in the presence or absence of reductants. Results from our biochemical characterizations support the assignment of sulfoxide 4 as the native EgtE substrate and the involvement of a sulfenic acid intermediate in the ergothioneine C-S lyase reaction. PMID:26149121
Glycation Reactions of Casein Micelles.
Moeckel, Ulrike; Duerasch, Anja; Weiz, Alexander; Ruck, Michael; Henle, Thomas
2016-04-13
After suspensions of micellar casein or nonmicellar sodium caseinate had been heated, respectively, in the presence and absence of glucose for 0-4 h at 100 °C, glycation compounds were quantitated. The formation of Amadori products as indicators for the "early" Maillard reaction were in the same range for both micellar and nonmicellar caseins, indicating that reactive amino acid side chains within the micelles are accessible for glucose in a comparable way as in nonmicellar casein. Significant differences, however, were observed concerning the formation of the advanced glycation end products (AGEs), namely, N(ε)-carboxymethyllysine (CML), pyrraline, pentosidine, and glyoxal-lysine dimer (GOLD). CML could be observerd in higher amounts in nonmicellar casein, whereas in the micelles the pyrraline formation was increased. Pentosidine and GOLD were formed in comparable amounts. Furthermore, the extent of protein cross-linking was significantly higher in the glycated casein micelles than in the nonmicellar casein samples. Dynamic light scattering and scanning electron microscopy showed that glycation has no influence on the size of the casein micelles, indicating that cross-linking occurs only in the interior of the micelles, but altered the surface morphology. Studies on glycation and nonenzymatic cross-linking can contribute to the understanding of the structure of casein micelles.
Tangled nonlinear driven chain reactions of all optical singularities
NASA Astrophysics Data System (ADS)
Vasil'ev, V. I.; Soskin, M. S.
2012-03-01
Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.
Rudolph, Tobias; Barthel, Markus J; Kretschmer, Florian; Mansfeld, Ulrich; Hoeppener, Stephanie; Hager, Martin D; Schubert, Ulrich S; Schacher, Felix H
2014-05-01
Furfuryl glycidyl ether (FGE) represents a highly versatile monomer for the preparation of reversibly cross-linkable nanostructured materials via Diels-Alder reactions. Here, the use of FGE for the mid-chain functionalization of a P2VP-b-PEO diblock copolymer is reported. The material features one furan moiety at the block junction, P2VP68 -FGE-b-PEO390 , which can be subsequently addressed in Diels-Alder reactions using maleimide-functionalized counterparts. The presence of the FGE moiety enables the introduction of dyes as model labels or the formation of hetero-grafted brushes as shell on hybrid Au@Polymer nanoparticles. This renders P2VP68 -FGE-b-PEO390 , a powerful tool for selective functionalization reactions, including the modification of surfaces. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Head, Ian; Gray, Neil; Aitken, Caroline; Sherry, Angela; Jones, Martin; Larter, Stephen
2010-05-01
Microbial degradation of alkanes typically involves their conversion to fatty acids which are then catabolised by beta-oxidation. The critical step in this process is activation of the hydrocarbon. Under oxic conditions this is catalyzed by monooxygenase enzymes with the formation of long chain alcohols. In the absence of oxygen alternative alkane activation mechanisms have been observed or proposed. Fumarate addition to alkanes to form alkyl succinates is considered a central process in anaerobic hydrocarbon degradation. Comparative studies of crude oil degradation under sulphate-reducing and methanogenic conditions revealed distinctive patterns of compound class removal and metabolite formation. Alkyl succinates derived from C7 to C26 n-alkanes and branched chain alkanes were found in abundance in sulfate-reducing systems but these were not detected during methanogenic crude oil degradation. Only one other mechanism of alkane activation has been elucidated to date. This involves addition of carbon derived from bicarbonate/CO2 to C-3 of an alkane chain to form a 2-ethylalkane with subsequent removal of the ethyl group leading to the formation of a fatty acid 1 carbon shorter than the original alkane. 2-ethylalkanes have never been detected as metabolites of anaerobic alkane degradation and were not detected in crude oil-degrading methanogenic systems. Due to the range of alkanes present in crude oil it was not possible to infer the generation of C-odd acids from C-even alkanes which is characteristic of the C-3 carboxylation mechanism. Furthermore genes homologous to alkysuccinate synthetases were not detected in the methanogenic hydrocarbon degrading community by pyrosequencing of total DNA extracted from methanogenic enrichments cultures. beta-oxidation genes were detected and intriguingly, alcohol and aldehyde dehydrogenase genes were present. This offers the possibility that alkane activation in the methanogenic system does not proceed via acid metabolites, but may be initiated by an anaerobic hydroxylation reaction. This is not unprecedented and hydroxylation of ethylbenzene has been demonstrated. However the C-H bond dissociation energy of alkanes is typically considered too high to readily permit alkane hydroxylation. It is however clear that alkane activation in these methanogenic crude oil-degrading systems involves mechanisms other than the well-known fumarate-addition reactions.
Effects of side chains in helix nucleation differ from helix propagation
Miller, Stephen E.; Watkins, Andrew M.; Kallenbach, Neville R.; Arora, Paramjit S.
2014-01-01
Helix–coil transition theory connects observable properties of the α-helix to an ensemble of microstates and provides a foundation for analyzing secondary structure formation in proteins. Classical models account for cooperative helix formation in terms of an energetically demanding nucleation event (described by the σ constant) followed by a more facile propagation reaction, with corresponding s constants that are sequence dependent. Extensive studies of folding and unfolding in model peptides have led to the determination of the propagation constants for amino acids. However, the role of individual side chains in helix nucleation has not been separately accessible, so the σ constant is treated as independent of sequence. We describe here a synthetic model that allows the assessment of the role of individual amino acids in helix nucleation. Studies with this model lead to the surprising conclusion that widely accepted scales of helical propensity are not predictive of helix nucleation. Residues known to be helix stabilizers or breakers in propagation have only a tenuous relationship to residues that favor or disfavor helix nucleation. PMID:24753597
Grasso, G; Komatsu, H; Axelsen, P H
2017-09-01
Amyloid β peptides (Aβ) and metal ions are associated with oxidative stress in Alzheimer's disease (AD). Oxidative stress, acting on ω-6 polyunsaturated fatty acyl chains, produces diverse products, including 4-hydroxy-2-nonenal (HNE), which can covalently modify the Aβ that helped to produce it. To examine possible feedback mechanisms involving Aβ, metal ions and HNE production, the effects of HNE modification and fibril formation on metal ion binding was investigated. Results indicate that copper(II) generally inhibits the modification of His side chains in Aβ by HNE, but that once modified, copper(II) still binds to Aβ with high affinity. Fibril formation protects only one of the three His residues in Aβ from HNE modification, and this protection is consistent with proposed models of fibril structure. These results provide insight into a network of biochemical reactions that may be operating as a consequence of oxidative stress in AD, or as part of the pathogenic process. Copyright © 2016. Published by Elsevier Inc.
Formation of Glycerol through Hydrogenation of CO Ice under Prestellar Core Conditions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fedoseev, G.; Chuang, K.-J.; Qasim, D.
Observational studies reveal that complex organic molecules (COMs) can be found in various objects associated with different star formation stages. The identification of COMs in prestellar cores, i.e., cold environments in which thermally induced chemistry can be excluded and radiolysis is limited by cosmic rays and cosmic-ray-induced UV photons, is particularly important as this stage sets up the initial chemical composition from which ultimately stars and planets evolve. Recent laboratory results demonstrate that molecules as complex as glycolaldehyde and ethylene glycol are efficiently formed on icy dust grains via nonenergetic atom addition reactions between accreting H atoms and CO molecules,more » a process that dominates surface chemistry during the “CO freeze-out stage” in dense cores. In the present study we demonstrate that a similar mechanism results in the formation of the biologically relevant molecule glycerol—HOCH{sub 2}CH(OH)CH{sub 2}OH—a three-carbon-bearing sugar alcohol necessary for the formation of membranes of modern living cells and organelles. Our experimental results are fully consistent with a suggested reaction scheme in which glycerol is formed along a chain of radical–radical and radical–molecule interactions between various reactive intermediates produced upon hydrogenation of CO ice or its hydrogenation products. The tentative identification of the chemically related simple sugar glyceraldehyde—HOCH{sub 2}CH(OH)CHO—is discussed as well. These new laboratory findings indicate that the proposed reaction mechanism holds much potential to form even more complex sugar alcohols and simple sugars.« less
NASA Astrophysics Data System (ADS)
Boon, Byron Adrian
The palladium(II)-catalyzed oxidative macrocyclization of bis(vinylboronate esters) is demonstrated as an efficient method for the synthesis of macrocyclic dienes. The macrocyclization reactions feature mild conditions due to a palladium(II) catalytic cycle which obviates the need for a high energy oxidative addition step of standard palladium(0) catalytic cycles. Instead, this oxidative coupling is promoted by chloroacetone as a terminal re-oxidant in the catalytic cycle. An extension of the oxidative coupling/macrocyclization strategy is highlighted where molecular oxygen may be used in place of chloroacetone as the terminal re-oxidant. Homocoupling reactions of vinylboronate esters served as a template to screen reaction conditions for this method. From these experiments, multiple reaction conditions gave the oxidative homocoupling product in high yield. These reaction conditions were successfully applied to the oxidative macrocyclization of a bis(vinylboronate ester) using molecular oxygen as a re-oxidant. Syntheses of strained cyclic dienes were accomplished via the palladium(II)-catalyzed oxidative cyclizations of terminal bis(vinylboronate esters). The reactions generated strained (E,E)-1,3-dienes that underwent spontaneous 4?-electrocyclizations to form bicyclic cyclobutenes. Formation of the cyclobutenes is driven by strain in the medium-ring (E,E)-1,3-diene intermediates. Thermal ring openings of the cyclobutenes give (Z,Z)-1,3-diene products, again for thermodynamic reasons. These results are in contrast with typical acyclic trans-3,4-dialkyl cyclobutenes, which favor outward torquoselective ring-openings to give (E,E)-1,3-dienes. DFT calculations verified the thermodynamic versus kinetic control of the reactions and kinetic studies are in excellent agreement with the calculated energy changes. Investigations on the transannular Pauson-Khand reaction are also highlighted. The Pauson-Khand reaction is a powerful tool for the synthesis of cyclopentenones through the efficient [2+2+1] cycloaddition of dicobalt alkyne complexes with alkenes. While intermolecular and intramolecular variants are widely known, transannular versions of this reaction are unknown and the basis of this study. Our successful transannular Pauson-Khand reaction required a cyclic enyne incorporating one short three-membered linker chain and a rigid aryl linker in the backbone of the long linker chain. This rigidity of the aryl linker is proposed to facilitate the transannular [2+2+1] cyclization. Computational studies revealed that transannular Pauson-Khand reactions are thermodynamically favored for cyclic enynes featuring a long linker of at least 5 carbons, but with smaller chains the reactions are thermodynamically disfavored. Experimental studies show that long linking chains with more than 5 members are required to prevent to steric interactions between the dicobalt hexacarbonyl moiety and the linking chain to allow the reaction to be kinetically favored. The final part of this work highlights progress towards the total synthesis of (+)-kingianin A. This natural product was isolated as a racemic mixture from the bark of Endiandra kingiana and is an inhibitor of antiapoptotic protein Bcl-Xl, highlighting its potential use in cancer treatments. Its structure is proposed to arise from an intermolecular Diels-Alder dimerization reaction of bicyclo[4.2.0]octadiene fragments derived from an 8pi/6pi-electrocyclization cascade. Although two total syntheses of (+/-)-kingianin A have been reported, an enantioselective synthesis has not been achieved and is the purpose of this study. This synthetic route begins from L-(+)-dimethyl tartrate, a cheap and commercially available starting material, and aims to follow a biomimetic synthetic pathway featuring a substrate controlled diastereoselective palladium(II)-catalyzed oxidative cyclization and 8pi/6pi-electrocyclization cascade. Although the feasibility of this cascade pathway has not yet been realized, key synthetic transformations to install the requisite carbocyclic framework of (+)-kingianin A have been discovered, paving the way for future investigations on the palladium(II)-catalyzed coupling/electrocyclization cascade and completion of the synthesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soriano, Erika V.; McCloskey, Diane E.; Kinsland, Cynthia
2008-04-01
The crystal structures of two arginine decarboxylase mutant proteins provide insights into the mechanisms of pyruvoyl-group formation and the decarboxylation reaction. Pyruvoyl-dependent arginine decarboxylase (PvlArgDC) catalyzes the first step of the polyamine-biosynthetic pathway in plants and some archaebacteria. The pyruvoyl group of PvlArgDC is generated by an internal autoserinolysis reaction at an absolutely conserved serine residue in the proenzyme, resulting in two polypeptide chains. Based on the native structure of PvlArgDC from Methanococcus jannaschii, the conserved residues Asn47 and Glu109 were proposed to be involved in the decarboxylation and autoprocessing reactions. N47A and E109Q mutant proteins were prepared and themore » three-dimensional structure of each protein was determined at 2.0 Å resolution. The N47A and E109Q mutant proteins showed reduced decarboxylation activity compared with the wild-type PvlArgDC. These residues may also be important for the autoprocessing reaction, which utilizes a mechanism similar to that of the decarboxylation reaction.« less
Shimamura, Ken; Miyamoto, Yasuhisa; Kitazawa, Hidefumi; Kobayashi, Tsutomu; Kotani, Hidehito; Tokita, Shigeru
2009-04-01
Elongase of very-long-chain fatty acid (Elovl) 6 is a rate-limiting enzyme that is responsible for the elongation of long-chain fatty acids such as palmitoic acid (C16). Elovl6 is abundantly expressed in liver and adipose tissue, and the expression levels in these tissues are up-regulated in obese animals. Furthermore, Elovl6-deficient mice display improved glucose homeostasis and insulin sensitivity, suggesting that Elovl6 might be a potential therapeutic target for metabolic disorders. From the drug discovery point of view, it is critical to establish a high-throughput screening (HTS) assay for the identification of therapeutic agents. Conventional assay methods for fatty acid elongases include an extraction step for respective radioactive products from the reaction mixtures, which is labor-intensive and not feasible for HTS. In this study, we utilized the acyl-coenzyme A (CoA) binding protein (ACBP) as a molecular probe to detect radioactive long-chain acyl-CoA, a direct product of Elovl6. Recombinant ACBP binds stearoyl-CoA but not malonyl-CoA, enabling specific detection of the radioactive product in the homogenous reaction mixture without the liquid extraction step. Finally, combination of ACBP and scintillation proximity assay beads led to specific detection of Elovl6 activity with appropriate window and reproducibility amenable to HTS (signal-to-background noise ratio of approximately 13.0-fold, Z' = 0.85). The assay system described here has the potential to enable identification of small compounds that modify fatty acid elongase activity and assessment of the therapeutic potential of acyl-CoA elongases.
Kancharla, Pavan K; Crich, David
2013-12-18
Two N-acetyl 4O,5N-oxazolidinone-protected sialyl thioglycosides epimeric at the 7-position have been synthesized and their reactivity and stereoselectivity in glycosylation reactions have been compared. It is demonstrated that the natural 7S-donor is both more reactive and more α-selective than the unnatural 7R-isomer. The difference in reactivity is attributed to the side chain conformation and specifically to the proximity of O7 to the anomeric center. In the natural 7S-isomer, O7 is closer to the anomeric center than in its unnatural 7R-epimer and, therefore, better able to support incipient positive charge at the locus of reaction. The difference in selectivity is also attributed to the side conformation, which in the unnatural 7R-series is placed perpendicularly above the α-face of the donor and so shields it to a greater extent than in the 7S-series. These observations are consistent with earlier conclusions on the influence of the side chain conformation on reactivity and selectivity derived from conformationally locked models in the glucose and galactose series and corroborate the suggestion that those effects are predominantly stereoelectronic rather than torsional. The possible relevance of side chain conformation as a factor in the influence of glycosylation stereoselectivity by remote protecting groups and as a control element in enzymic processes for glycosidic bond formation and hydrolysis are discussed. Methods for assignment of the anomeric configuration in the sialic acid glycosides are critically surveyed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Milani, Gabriele, E-mail: milani@stru.polimi.it, E-mail: gabriele.milani@polimi.it; Hanel, Thomas; Donetti, Raffaella
2015-03-10
The basic reaction scheme due to Han and co-workers for NR vulcanized with sulphur is adopted and modified taking into account the single contributions of the different accelerators, focusing in particular on some experimental data ad hoc obtained at Pirelli’s laboratories, where NR was vulcanized at different temperatures (from 150 to 180 °C) and concentrations of sulphur, using TBBS and DPG in the mixture as co-agents. Typically, the chain reactions are initiated by the formation of macro-compounds that are responsible of the formation of the unmatured crosslinked polymer. This first reaction depends on the reciprocal concentrations of all components andmore » their chemical nature. In presence of two accelerators, it was considered that the reactions between each single accelerator and the NR raw material occur in parallel, making the reasonable assumption that there are no mutual reactions between the two accelerators. From the kinetic scheme adopted, a closed form solution was found for the crosslink density, with the only limitation that the induction period is excluded from computations. Even kinetic constants are evaluated in closed form, avoiding a numerically demanding least-squares best fitting on rheometer experimental data. Two series of experiments available, relying into rheometer curves at different temperatures and different concentrations of sulphur and accelerator, are utilized to evaluate the fitting capabilities of the mathematical model. Very good agreement between numerical output and experimental data is experienced in all cases analysed.« less
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Human cytochrome P450scc (CYP11A1) catalyzes epoxide formation with ergosterol.
Tuckey, Robert C; Nguyen, Minh N; Chen, Jianjun; Slominski, Andrzej T; Baldisseri, Donna M; Tieu, Elaine W; Zjawiony, Jordan K; Li, Wei
2012-03-01
Cytochrome P450scc (P450scc) catalyzes the cleavage of the side chain of both cholesterol and the vitamin D(3) precursor, 7-dehydrocholesterol. The aim of this study was to test the ability of human P450scc to metabolize ergosterol, the vitamin D(2) precursor, and define the structure of the major products. P450scc incorporated into the bilayer of phospholipid vesicles converted ergosterol to two major and four minor products with a k(cat) of 53 mol · min(-1) · mol P450scc(-1) and a K(m) of 0.18 mol ergosterol/mol phospholipid, similar to the values observed for cholesterol metabolism. The reaction of ergosterol with P450scc was scaled up to make enough of the two major products for structural analysis. From mass spectrometry, NMR, and comparison of the NMR data to that for similar molecules, we determined the structures of the two major products as 20-hydroxy-22,23-epoxy-22,23-dihydroergosterol and 22-keto-23-hydroxy-22,23-dihydroergosterol. Molecular modeling and nuclear Overhauser effect (or enhancement) spectroscopy spectra analysis helped to establish the configurations at C20, C22, and C23 and determine the final structures of major products as 22R,23S-epoxyergosta-5,7-diene-3β,20α-diol and 3β,23S-dihydroxyergosta-5,7-dien-22-one. It is likely that the formation of the second product is through a 22,23-epoxy (oxirane) intermediate followed by C22 hydroxylation with the formation of strained 22-hydroxy-22,23-epoxide (oxiranol), which is immediately transformed to the more stable α-hydroxyketone. Molecular modeling of ergosterol into the P450scc crystal structure positioned the ergosterol side chain consistent with formation of the above products. Thus, we have shown that P450scc efficiently catalyzes epoxide formation with ergosterol giving rise to novel epoxy, hydroxy, and keto derivatives, without causing cleavage of the side chain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vasil'ev, Vasilii I; Soskin, M S
2013-02-28
A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less
Matsuo, Toshihiko; Ichimura, Kouichi; Yoshino, Tadashi
2011-01-01
In 2000, a 48-year-old woman developed a left orbital mass with lacrimal gland involvement and then, in 2003, a right orbital mass with lacrimal gland involvement, both of which were diagnosed as extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue (MALT lymphoma). She underwent 30 Gy external beam radiation to bilateral orbital lesions. The lymphoma cells in both lesions did not share the same clonality, as shown by amplification by polymerase chain reaction of the immunoglobulin heavy chain gene. Immunoglobulin light chain analysis by immunohistochemistry and messenger RNA in situ hybridization showed λ chain monotype in the left orbital lesion but κ chain monotype in the right orbital lesion. She developed recurrent left orbital mass with high uptake on fluorodeoxyglucose positron emission tomography fused with computed tomography in 2010, and excisional biopsy disclosed the formation of follicles and infiltration with immunoglobulin G4 (IgG4)-positive plasma cells mainly in interfollicular areas. The immunoglobulin light chain analysis showed the λ chain and κ chain bitype. With the immunohistopathological diagnosis of IgG4-related disease, the serum IgG4 level was found to show elevation at 376 mg/dL, and the patient chose observation. This is the first reported case of development of IgG4-related disease after bilataral orbital MALT lymphoma with external beam radiotherapy.
Saetta, A; Fanourakis, G; Agapitos, E; Davaris, P S
2000-01-01
Several studies suggest that certain viral and bacterial pathogens may contribute to the process of atherogenesis. However, this relation between infectious agents and atherosclerosis has not yet been established with certainty. The aim of this study was to investigate the presence of CMV in carotid endarterectomies from 40 patients suffering from atherosclerosis using immunohistochemistry and the polymerase chain reaction (PCR). None of the specimens examined gave a positive result, indicating absence of CMV particles or CMV DNA sequences in the walls of carotid arteries. This finding suggests it is possible that CMV infection may not play a major role in the formation of atheroma. Therefore, further investigation is required in order to clarify the etiology of atherosclerosis.
Surface modification and antimicrobial properties of cellulose nanocrystals
NASA Astrophysics Data System (ADS)
Bespalova, Yulia A.
Surface modification of cellulose nanocrystals (CNC) was performed by acetylation and subsequent reaction with various tertiary amines with different lengths of alkyl groups. Chloroacetic anhydride (95%) was used for acetylation. The acetylation of CNC was confirmed using IR spectroscopy. The bands associated with C=0 stretching (1740 cm-1) and C-Cl stretching (793 cm -1) was present in the acetylated CNC but they were absent in the neat CNC. It has been suggested that the primary hydroxyl groups of CNC are substituted by chloro acetyl groups during acetylation reaction. Subsequent reaction of chloro acetylated CNC with N, N - Dimethyl ethylamine, N, N - Dimethyl hexylamine, N, N - Dimethyl dodecylamine, N, N - Dimethyl hexadecylamine and N, N - Dimethyl decylamine formed quaternary ammonium salts. These quaternary ammonium salts were characterized by FTIR and solid state13C NMR spectroscopy. FTIR spectra of five types of quaternary ammonium salts of CNC are similar and they showed infrared bands at 2905 -1 and 2850 cm-1, attributed to symmetrical and unsymmetrical C-H stretching vibration. The absence of C-Cl band at 793 cm-1 proves that quaternary salt formation was successful. The 13C NMR spectrum of quaternary ammonium modified CNC with N, N - Dimethyl dodecylamine shows several additional resonances ranging from 14.5 ppm to 58.0 ppm when compared to 13C NMR spectrum of pure CNC. This evidence proves that long alkyl chains have been added to the pure CNC. The disc diffusion method confirmed that quaternary ammonium modified CNCs with a chain longer than ten carbons are effective antimicrobial agents against Staphylococcus aureus and E. coli bacteria. Pure CNC and quaternary ammonium modified CNCs with an alkyl chain length of ten or less were not able to inhibit bacteria growth.
Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru
2017-11-28
Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.
Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe
2012-12-01
We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.
Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong
2017-12-15
In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.
Klančnik, Anja; Zorko, Špela; Toplak, Nataša; Kovač, Minka; Bucar, Franz; Jeršek, Barbara; Smole Možina, Sonja
2018-03-01
The food-borne pathogen Campylobacter jejuni can cause bacterial gastrointestinal infections. Biofilm formation amplifies the risk of human infection by improving survival and persistence of C. jejuni in food processing environments and its transmission through the food chain. We aimed to control C. jejuni using an alternative strategy of low doses of Juniperus communis fruit preparations to target bacterial adhesion properties in the first step of biofilm formation. First, we defined the anti-Campylobacter activity of a juniper fruit crude extract and its fractionated biflavonoids, flavone glycosides, and purified amentoflavone, of juniper fruit essential oil and of juniper fruit postdistillation waste material extract. For accurate quantification of adherent C. jejuni, we optimised digital Polymerase Chain Reaction (PCR) and quantitative real-time PCR for construction of standard curves and quantification. We show for the first time that juniper fruit formulations can effectively inhibit adhesion of C. jejuni to polystyrene. Furthermore, ≥94% of the antiadhesion activity of juniper fruit crude extract and juniper fruit essential oil remained under food-related conditions: modified culture medium with glucose, or a stainless steel surface, or mixed co-cultures of C. jejuni and Listeria monocytogenes. This study indicates that addition of juniper fruit formulations can control growth and adhesion of C. jejuni and thus limit food chain transmission of campylobacters. Copyright © 2017 John Wiley & Sons, Ltd.
Method-Unifying View of Loop-Formation Kinetics in Peptide and Protein Folding.
Jacob, Maik H; D'Souza, Roy N; Schwarzlose, Thomas; Wang, Xiaojuan; Huang, Fang; Haas, Elisha; Nau, Werner M
2018-04-26
Protein folding can be described as a probabilistic succession of events in which the peptide chain forms loops closed by specific amino acid residue contacts, herein referred to as loop nodes. To measure loop rates, several photophysical methods have been introduced where a pair of optically active probes is incorporated at selected chain positions and the excited probe undergoes contact quenching (CQ) upon collision with the second probe. The quenching mechanisms involved triplet-triplet energy transfer, photoinduced electron transfer, and collision-induced fluorescence quenching, where the fluorescence of Dbo, an asparagine residue conjugated to 2,3-diazabicyclo[2.2.2]octane, is quenched by tryptophan. The discrepancy between the loop rates afforded from these three CQ techniques has, however, remained unresolved. In analyzing this discrepancy, we now report two short-distance FRET methods where Dbo acts as an energy acceptor in combination with tryptophan and naphtylalanine, two donors with largely different fluorescence lifetimes of 1.3 and 33 ns, respectively. Despite the different quenching mechanisms, the rates from FRET and CQ methods were, surprisingly, of comparable magnitude. This combination of FRET and CQ data led to a unifying physical model and to the conclusion that the rate of loop formation in folding reactions varies not only with the kind and number of residues that constitute the chain but also in particular with the size and properties of the residues that constitute the loop node.
The influence of sodium lauryl sulfate on the crystal phases of titania by hydrothermal method
NASA Astrophysics Data System (ADS)
Liu, Chaohong; Wang, Xin
2012-11-01
In this paper, we prepared TiO2 nanostructures by a hydrothermal method and investigated the influence of the SO4^{2-} ion and the effect of long alkyl chains of sodium dodecyl sulfate on the crystal phases of TiO2 by experiments and theoretical calculations. The results indicate that the absorption of the H+HSO4 fragment on rutile (110) is more stable than that of the 2H+SO4 fragment and more favorable to the formation of anatase. The absorption and steric effects of sodium dodecyl sulfate on the surfaces of TiO2 grains also have an important influence on the formation of mixed crystals by changing the speed and the way of octahedral TiO6 units combining. Based on the above facts, we revised the original reaction scheme for crystalline titania formation by previous authors.
Catalytic behavior of ‘Pt-atomic chain encapsulated gold nanotube’: A density functional study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nigam, Sandeep, E-mail: snigam@barc.gov.in; Majumder, Chiranjib
2016-05-23
With an aim to design novel material and explore its catalytic performance towards CO oxidation, Pt atomic chain was introduced inside gold nanotube (Au-NT). Theoretical calculations at the level of first principles formalism was carried out to investigate the atomic and electronic properties of the composite. Geometrically Pt atoms prefer to align in zig-zag fashion. Significant electronic charge transfer from inside Pt atoms to the outer wall Au atoms is observed. Interaction of O{sub 2} with Au-NT wall follows by injection of additional electronic charge in the anti-bonding orbital of oxygen molecule leading to activation of the O-O bond. Furthermore » interaction of CO molecule with the activated oxygen molecule leads to spontaneous oxidation reaction and formation of CO{sub 2}.« less
A supramolecular miktoarm star polymer based on porphyrin metal complexation in water.
Hou, Zhanyao; Dehaen, Wim; Lyskawa, Joël; Woisel, Patrice; Hoogenboom, Richard
2017-07-25
A novel supramolecular miktoarm star polymer was successfully constructed in water from a pyridine end-decorated polymer (Py-PmDEGA) and a metalloporphyrin based star polymer (ZnTPP-(PEG) 4 ) via metal-ligand coordination. The Py-PmDEGA moiety was prepared via a combination of reversible addition-fragmentation chain transfer polymerization (RAFT) and subsequent aminolysis and Michael addition reactions to introduce the pyridine end-group. The ZnTPP(PEG) 4 star-polymer was synthesized by the reaction between tetrakis(p-hydroxyphenyl)porphyrin and toluenesulfonyl-PEG, followed by insertion of a zinc ion into the porphyrin core. The formation of a well-defined supramolecular AB 4 -type miktoarm star polymer was unambiguously demonstrated via UV-Vis spectroscopic titration, isothermal titration calorimetry (ITC) and diffusion ordered NMR spectroscopy (DOSY).
Experimental interstellar organic chemistry: Preliminary findings
NASA Technical Reports Server (NTRS)
Khare, B. N.; Sagan, C.
1971-01-01
In a simulation of interstellar organic chemistry in dense interstellar clouds or on grain surfaces, formaldehyde, water vapor, ammonia and ethane are deposited on a quartz cold finger and ultraviolet-irradiated in high vacuum at 77K. The HCHO photolytic pathway which produces an aldehyde radical and a superthermal hydrogen atom initiates solid phase chain reactions leading to a range of new compounds, including methanol, ethanol, acetaldehyde, acetonitrile, acetone, methyl formate, and possibly formic acid. Higher nitriles are anticipated. Genetic relations among these interstellar organic molecules (e.g., the Cannizzaro and Tischenko reactions) must exist. Some of them, rather than being synthesized from smaller molecules, may be degradation products of larger organic molecules, such as hexamethylene tetramine, which are candidate consitituents of the interstellar grains. The experiments reported here may also be relevant to cometary chemistry.
Supplement to Theory of Neutron Chain Reactions
DOE R&D Accomplishments Database
Weinberg, Alvin M.; Noderer, L. C.
1952-05-26
General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)
Involvement of the chloroplast plastoquinone pool in the Mehler reaction.
Vetoshkina, Daria V; Ivanov, Boris N; Khorobrykh, Sergey A; Proskuryakov, Ivan I; Borisova-Mubarakshina, Maria M
2017-09-01
Light-dependent oxygen reduction in the photosynthetic electron transfer chain, i.e. the Mehler reaction, has been studied using isolated pea thylakoids. The role of the plastoquinone pool in the Mehler reaction was investigated in the presence of dinitrophenyl ether of 2-iodo-4-nitrothymol (DNP-INT), the inhibitor of plastohydroquinone oxidation by cytochrome b6/f complex. Oxygen reduction rate in the presence of DNP-INT was higher than in the absence of the inhibitor in low light at pH 6.5 and 7.6, showing that the capacity of the plastoquinone pool to reduce molecular oxygen in this case exceeded that of the entire electron transfer chain. In the presence of DNP-INT, appearance of superoxide anion radicals outside thylakoid membrane represented approximately 60% of the total superoxide anion radicals produced. The remaining 40% of the produced superoxide anion radicals was suggested to be trapped by plastohydroquinone molecules within thylakoid membrane, leading to the formation of hydrogen peroxide (H 2 O 2 ). To validate the reaction of superoxide anion radical with plastohydroquinone, xanthine/xanthine oxidase system was integrated with thylakoid membrane in order to generate superoxide anion radical in close vicinity of plastohydroquinone. Addition of xanthine/xanthine oxidase to the thylakoid suspension resulted in a decrease in the reduction level of the plastoquinone pool in the light. The obtained data provide additional clarification of the aspects that the plastoquinone pool is involved in both reduction of oxygen to superoxide anion radicals and reduction of superoxide anion radicals to H 2 O 2 . Significance of the plastoquinone pool involvement in the Mehler reaction for the acclimation of plants to light conditions is discussed. © 2017 Scandinavian Plant Physiology Society.
Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar
2009-01-01
The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559
Enhanced photo(geno)toxicity of demethylated chlorpromazine metabolites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palumbo, Fabrizio
Chlorpromazine (CPZ) is an anti-psychotic drug widely used to treat disorders such as schizophrenia or manic-depression. Unfortunately, CPZ exhibits undesirable side effects such as phototoxic and photoallergic reactions in humans. In general, the influence of drug metabolism on this type of reactions has not been previously considered in photosafety testing. Thus, the present work aims to investigate the possible photo(geno)toxic potential of drug metabolites, using CPZ as an established reference compound. In this case, the metabolites selected for the study are demethylchlorpromazine (DMCPZ), didemethylchlorpromazine (DDMCPZ) and chlorpromazine sulfoxide (CPZSO). The demethylated CPZ metabolites DMCPZ and DDMCPZ maintain identical chromophore tomore » the parent drug. In this work, it has been found that the nature of the aminoalkyl side chain modulates the hydrophobicity and the photochemical properties (for instance, the excited state lifetimes), but it does not change the photoreactivity pattern, which is characterized by reductive photodehalogenation, triggered by homolytic carbon-chlorine bond cleavage with formation of highly reactive aryl radical intermediates. Accordingly, these metabolites are phototoxic to cells, as revealed by the 3T3 NRU assay; their photo-irritation factors are even higher than that of CPZ. The same trend is observed in photogenotoxicity studies, both with isolated and with cellular DNA, where DMCPZ and DDMCPZ are more active than CPZ itself. In summary, side-chain demethylation of CPZ, as a consequence of Phase I biotransformation, does not result a photodetoxification. Instead, it leads to metabolites that exhibit in an even enhanced photo(geno)toxicity. - Highlights: • Demethylated CPZ metabolites are phototoxic to cells, as revealed by the NRU assay. • Single cell electrophoresis (Comet Assay) confirms the photodamage to cellular DNA. • DNA single strand breaks formation is observed on agarose gel electrophoresis. • Photochemical and EPR studies support generation of aryl radicals by C-Cl cleavage. • The aminoalkyl side chain of metabolites modulates the photo(geno)toxic potential.« less
Goblirsch, Brandon R; Jensen, Matthew R; Mohamed, Fatuma A; Wackett, Lawrence P; Wilmot, Carrie M
2016-12-23
Phylogenetically diverse microbes that produce long chain, olefinic hydrocarbons have received much attention as possible sources of renewable energy biocatalysts. One enzyme that is critical for this process is OleA, a thiolase superfamily enzyme that condenses two fatty acyl-CoA substrates to produce a β-ketoacid product and initiates the biosynthesis of long chain olefins in bacteria. Thiolases typically utilize a ping-pong mechanism centered on an active site cysteine residue. Reaction with the first substrate produces a covalent cysteine-thioester tethered acyl group that is transferred to the second substrate through formation of a carbon-carbon bond. Although the basics of thiolase chemistry are precedented, the mechanism by which OleA accommodates two substrates with extended carbon chains and a coenzyme moiety-unusual for a thiolase-are unknown. Gaining insights into this process could enable manipulation of the system for large scale olefin production with hydrocarbon chains lengths equivalent to those of fossil fuels. In this study, mutagenesis of the active site cysteine in Xanthomonas campestris OleA (Cys 143 ) enabled trapping of two catalytically relevant species in crystals. In the resulting structures, long chain alkyl groups (C 12 and C 14 ) and phosphopantetheinate define three substrate channels in a T-shaped configuration, explaining how OleA coordinates its two substrates and product. The C143A OleA co-crystal structure possesses a single bound acyl-CoA representing the Michaelis complex with the first substrate, whereas the C143S co-crystal structure contains both acyl-CoA and fatty acid, defining how a second substrate binds to the acyl-enzyme intermediate. An active site glutamate (Gluβ 117 ) is positioned to deprotonate bound acyl-CoA and initiate carbon-carbon bond formation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
A theoretical and shock tube kinetic study on hydrogen abstraction from phenyl formate.
Ning, Hongbo; Liu, Dapeng; Wu, Junjun; Ma, Liuhao; Ren, Wei; Farooq, Aamir
2018-06-12
The hydrogen abstraction reactions of phenyl formate (PF) by different radicals (H/O(3P)/OH/HO2) were theoretically investigated. We calculated the reaction energetics for PF + H/O/OH using the composite method ROCBS-QB3//M06-2X/cc-pVTZ and that for PF + HO2 at the M06-2X/cc-pVTZ level of theory. The high-pressure limit rate constants were calculated using the transition state theory in conjunction with the 1-D hindered rotor approximation and tunneling correction. Three-parameter Arrhenius expressions of rate constants were provided over the temperature range of 500-2000 K. To validate the theoretical calculations, the overall rate constants of PF + OH → Products were measured in shock tube experiments at 968-1128 K and 1.16-1.25 atm using OH laser absorption. The predicted overall rate constants agree well with the shock tube data (within 15%) over the entire experimental conditions. Rate constant analysis indicates that the H-abstraction at the formic acid site dominates the PF consumption, whereas the contribution of H-abstractions at the aromatic ring increases with temperature. Additionally, comparisons of site-specific H-abstractions from PF with methyl formate, ethyl formate, benzene, and toluene were performed to understand the effects of the aromatic ring and side-chain substituent on H-abstraction rate constants.
Zhou, Yu; Pearson, John E; Auerbach, Anthony
2005-12-01
We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.
Formation of highly oxygenated organic molecules from aromatic compounds
NASA Astrophysics Data System (ADS)
Molteni, Ugo; Bianchi, Federico; Klein, Felix; El Haddad, Imad; Frege, Carla; Rossi, Michel J.; Dommen, Josef; Baltensperger, Urs
2018-02-01
Anthropogenic volatile organic compounds (AVOCs) often dominate the urban atmosphere and consist to a large degree of aromatic hydrocarbons (ArHCs), such as benzene, toluene, xylenes, and trimethylbenzenes, e.g., from the handling and combustion of fuels. These compounds are important precursors for the formation of secondary organic aerosol. Here we show that the oxidation of aromatics with OH leads to a subsequent autoxidation chain reaction forming highly oxygenated molecules (HOMs) with an O : C ratio of up to 1.09. This is exemplified for five single-ring ArHCs (benzene, toluene, o-/m-/p-xylene, mesitylene (1,3,5-trimethylbenzene) and ethylbenzene), as well as two conjugated polycyclic ArHCs (naphthalene and biphenyl). We report the elemental composition of the HOMs and show the differences in the oxidation patterns of these ArHCs. A potential pathway for the formation of these HOMs from aromatics is presented and discussed. We hypothesize that AVOCs may contribute substantially to new particle formation events that have been detected in urban areas.
Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.
Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S
2017-11-01
Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.
Jeong, Myung-Joon; Dupont, Anne-Laurence; de la Rie, E René
2014-01-30
To better understand the degradation of cellulose upon the formation of a tideline at the wet-dry interface when paper is suspended in water, the production of chemical species involved in oxidation reactions was studied. The quantitation of hydroperoxides and hydroxyl radicals was carried out in reverse phase chromatography using triphenylphosphine and terephthalic acid, respectively, as chemical probes. Both reactive oxygen species were found in the tideline immediately after its formation, in the range of micromoles and nanomoles per gram of paper, respectively. The results indicate that hydroxyl radicals form for the most part in paper before the tideline experiment, whereas hydroperoxides appear to be produced primarily during tideline formation. Iron sulfate impregnation of the paper raised the production of hydroperoxides. After hygrothermal aging in sealed vials the hydroxyl radical content in paper increased significantly. When aged together in the same vial, tideline samples strongly influenced the degradation of samples from other areas of the paper (multi-sample aging). Different types of antioxidants were added to the paper before the tideline experiment to investigate their effect on the oxidation reactions taking place. In samples treated with iron sulfate or artificially aged, the addition of Irgafos 168 (tris(2,4-ditert-butylphenyl) phosphate) and Tinuvin 292 (bis(1,2,2,6,6-pentamethyl-4-piperidyl) sebacate and methyl 1,2,2,6,6-pentamethyl-4-piperidyl sebacate) reduced the concentration of hydroperoxides and hydroxyl radicals, respectively. Tinuvin 292 was also found to considerably lower the rate of cellulose chain scission reactions during hygrothermal aging of the paper. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao, X. T.; Showkat, A. M.; Wang, Z.
2015-03-30
Noble fluorescence nanocomposite compound based on barium titanate nanoparticles (BTO), polystyrene (PSt), and terbium ion (Tb{sup 3+}) was synthesized by a combination of surface-initiated reversible addition-fragmentation chain transfer (RAFT) polymerization, Friedel-Crafts alkylation reaction and coordinate chemistry. Initially, a modification of surface of BTO was conducted by an exchange process with S-benzyl S’-trimethoxysilylpropyltrithiocarbonate to create macro-initiator for polymerization of styrene. Subsequently, aryl carboxylic acid functionalized polystyrene grafted barium titanate (BTO-g-PSt-COOH) was generated by substitution reaction between 4-(Chloromethyl) benzoic acid and PSt chains. The coordination of the nanohybrids with Tb{sup 3+} ions afforded fluorescent Tb{sup 3+} tagged aryl carboxylic acid functionalized polystyrenemore » grafted barium titanate (BTO-g-PSt-Tb{sup 3+}) complexes. Structure, morphology, and fluorescence properties of nanohybrid complexes were investigated by respective physical and spectral studies. FT-IR and SEM analyses confirmed the formation of BTO-g-PSt-Tb{sup 3+}nanohybrids. Furthermore, TGA profiles demonstrated the grafting of aryl carboxylic acid functionalized polystyrene on BTO surface. Optical properties of BTO-g-PSt-Tb{sup 3+} complexes were investigated by fluorescence spectroscopy.« less
NASA Astrophysics Data System (ADS)
Shinohara, Naoki; Sunagawa, Naoki; Tamura, Satoru; Yokoyama, Ryusuke; Ueda, Minoru; Igarashi, Kiyohiko; Nishitani, Kazuhiko
2017-04-01
Cellulose is an economically important material, but routes of its industrial processing have not been fully explored. The plant cell wall - the major source of cellulose - harbours enzymes of the xyloglucan endotransglucosylase/hydrolase (XTH) family. This class of enzymes is unique in that it is capable of elongating polysaccharide chains without the requirement for activated nucleotide sugars (e.g., UDP-glucose) and in seamlessly splitting and reconnecting chains of xyloglucan, a naturally occurring soluble analogue of cellulose. Here, we show that a recombinant version of AtXTH3, a thus far uncharacterized member of the Arabidopsis XTH family, catalysed the transglycosylation between cellulose and cello-oligosaccharide, between cellulose and xyloglucan-oligosaccharide, and between xyloglucan and xyloglucan-oligosaccharide, with the highest reaction rate observed for the latter reaction. In addition, this enzyme formed cellulose-like insoluble material from a soluble cello-oligosaccharide in the absence of additional substrates. This newly found activity (designated “cellulose endotransglucosylase,” or CET) can potentially be involved in the formation of covalent linkages between cellulose microfibrils in the plant cell wall. It can also comprise a new route of industrial cellulose functionalization.
Catalytic Hydroxylation of Polyethylenes
2017-01-01
Polyolefins account for 60% of global plastic consumption, but many potential applications of polyolefins require that their properties, such as compatibility with polar polymers, adhesion, gas permeability, and surface wetting, be improved. A strategy to overcome these deficiencies would involve the introduction of polar functionalities onto the polymer chain. Here, we describe the Ni-catalyzed hydroxylation of polyethylenes (LDPE, HDPE, and LLDPE) in the presence of mCPBA as an oxidant. Studies with cycloalkanes and pure, long-chain alkanes were conducted to assess precisely the selectivity of the reaction and the degree to which potential C–C bond cleavage of a radical intermediate occurs. Among the nickel catalysts we tested, [Ni(Me4Phen)3](BPh4)2 (Me4Phen = 3,4,7,8,-tetramethyl-1,10-phenanthroline) reacted with the highest turnover number (TON) for hydroxylation of cyclohexane and the highest selectivity for the formation of cyclohexanol over cyclohexanone (TON, 5560; cyclohexanol/(cyclohexanone + ε-caprolactone) ratio, 10.5). The oxidation of n-octadecane occurred at the secondary C–H bonds with 15.5:1 selectivity for formation of an alcohol over a ketone and 660 TON. Consistent with these data, the hydroxylation of various polyethylene materials by the combination of [Ni(Me4Phen)3](BPh4)2 and mCPBA led to the introduction of 2.0 to 5.5 functional groups (alcohol, ketone, alkyl chloride) per 100 monomer units with up to 88% selectivity for formation of alcohols over ketones or chloride. In contrast to more classical radical functionalizations of polyethylene, this catalytic process occurred without significant modification of the molecular weight of the polymer that would result from chain cleavage or cross-linking. Thus, the resulting materials are new compositions in which hydroxyl groups are located along the main chain of commercial, high molecular weight LDPE, HDPE, and LLDPE materials. These hydroxylated polyethylenes have improved wetting properties and serve as macroinitiators to synthesize graft polycaprolactones that compatibilize polyethylene–polycaprolactone blends. PMID:28852704
Umamaheswari, A; Venkateswarlu, K
2004-06-01
Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
NASA Astrophysics Data System (ADS)
Riva, Matthieu; Budisulistiorini, Sri Hapsari; Zhang, Zhenfa; Gold, Avram; Thornton, Joel A.; Turpin, Barbara J.; Surratt, Jason D.
2017-03-01
Ozonolysis of alkenes results in the formation of primary ozonides (POZs), which can subsequently decompose into carbonyl compounds and stabilized Criegee intermediates (sCIs). The sCIs generated from isoprene ozonolysis include the simplest congener, formaldehyde oxide (CH2OO), and isomers of C4-sCI. Although the bimolecular reaction with H2O is expected to be the main fate of sCIs, it was reported that sCIs can also react with carboxylic acids and/or organic hydroperoxides leading to gas-phase oligomeric compounds. While the impact of the gas-phase composition (H2O, sCI scavenger) on the formation of such products was recently studied, their fate remains unclear. In the present work, formation of oligomeric hydroperoxides from isoprene ozonolysis, proposed as reaction products composed of the sCI as a chain unit and formed from the insertion of sCI into a hydroperoxide or a carboxylic acid, was systematically examined in the presence of aerosol with varying compositions. The effect of hydroxyl (OH) radicals on the gas- and particle-phase compositions was investigated using diethyl ether as an OH radical scavenger. Thirty-four oligomeric compounds resulting from the insertion of sCIs into organic hydroperoxides or carboxylic acids were identified using iodide chemical ionization high-resolution mass spectrometry. Large reactive uptake onto acidified sulfate aerosol was observed for most of the characterized gaseous oligomeric species, whereas the presence of organic coatings and the lack of aerosol water significantly reduced or halted the reactive uptake of these species. These results indicate that highly oxidized molecules, such as hydroperoxides, could undergo multiphase reactions, which are significantly influenced by the chemical composition of seed aerosol. Furthermore, in addition to functionalization and accretion, decomposition and re-volatilization should be considered in SOA formation.
NASA Astrophysics Data System (ADS)
Kovaleva, Elizaveta; Austrheim, Håkon O.; Klötzli, Urs S.
2017-07-01
In this study, we report the occurrence of zircon coronae textures in metapelitic granulites of the Ivrea-Verbano Zone. Unusual zircon textures are spatially associated with Fe-Ti oxides and occur as (1) vermicular-shaped aggregates 50-200 µm long and 5-20 µm thick and as (2) zircon coronae and fine-grained chains, hundreds of micrometers long and ≤ 1 µm thick, spatially associated with the larger zircon grains. Formation of such textures is a result of zircon precipitation during cooling after peak metamorphic conditions, which involved: (1) decomposition of Zr-rich ilmenite to Zr-bearing rutile, and formation of the vermicular-shaped zircon during retrograde metamorphism and hydration; and (2) recrystallization of Zr-bearing rutile to Zr-depleted rutile intergrown with quartz, and precipitation of the submicron-thick zircon coronae during further exhumation and cooling. We also observed hat-shaped grains that are composed of preexisting zircon overgrown by zircon coronae during stage (2). Formation of vermicular zircon (1) preceded ductile and brittle deformation of the host rock, as vermicular zircon is found both plastically and cataclastically deformed. Formation of thin zircon coronae (2) was coeval with, or immediately after, brittle deformation as coronae are found to fill fractures in the host rock. The latter is evidence of local, fluid-aided mobility of Zr. This study demonstrates that metamorphic zircon can nucleate and grow as a result of hydration reactions and mineral breakdown during cooling after granulite-facies metamorphism. Zircon coronae textures indicate metamorphic reactions in the host rock and establish the direction of the reaction front.
Lindén, Carl Fredrik; Žabka, Ján; Polášek, Miroslav; Zymak, Illia; Geppert, Wolf D
2018-02-21
A theoretical and experimental investigation of the reaction C 5 N - + C 2 H 2 has been carried out. This reaction is of astrophysical interest since the growth mechanism of large anions that have been detected in Titan's upper atmosphere by the Cassini plasma spectrometer are still largely unknown. The experimental studies have been performed using a tandem quadrupole mass spectrometer which allows identification of the different reaction channels and assessment of their reaction thresholds. Results of these investigations were compared with the predictions of ab initio calculations, which identified possible pathways leading to the observed products and their thermodynamical properties. These computations yielded that the majority of these products are only accessible via energy barriers situated more than 1 eV above the reactant energies. In many cases, the thresholds predicted by the ab initio calculations are in good agreement with the experimentally observed ones. For example, the chain elongation reaction leading to C 7 N - , although being slightly exoergic, possesses an energy barrier of 1.91 eV. Therefore, the title reaction can be regarded to be somewhat unlikely to be responsible for the formation of large anions in cold environments such as interstellar medium or planetary ionospheres.
Xu, Libin; Korade, Zeljka; Porter, Ned A.
2010-01-01
Free radical chain oxidation of highly oxidizable 7-dehydrocholesterol (7-DHC) initiated by 2,2′-azobis(4-methoxy-2,4-dimethylvaleronitrile) was carried out at 37°C in benzene for 24 hours. Fifteen oxysterols derived from 7-DHC were isolated and characterized with 1D- and 2D-NMR spectroscopy and mass spectrometry. A mechanism that involves abstraction of hydrogen atoms at C-9 and/or C-14 is proposed to account for the formation of all of the oxysterols and the reaction progress profile. In either the H-9 or H-14 mechanism, a pentadienyl radical intermediate is formed after abstraction of H-9 or H-14 by a peroxyl radical. This step is followed by the well-precedented transformations observed in peroxidation reactions of polyunsaturated fatty acids such as oxygen addition, peroxyl radical 5-exo cyclization, and SHi carbon radical attack on the peroxide bond. The mechanism for peroxidation of 7-DHC also accounts for the formation of numerous oxysterol natural products isolated from fungal species, marine sponges, and cactaceous species. In a cell viability test, the oxysterol mixture from 7-DHC peroxidation was found to be cytotoxic to Neuro2a neuroblastoma cells in the micromolar concentration range. We propose that the high reactivity of 7-DHC and the oxysterols generated from its peroxidation may play important roles in the pathogenesis of Smith-Lemli-Opitz syndrome (SLOS), X-linked dominant chondrodysplasia punctata (CDPX2), and cerebrotendinous xanthomatosis (CTX), all of these being metabolic disorders having an elevated level of 7-DHC. PMID:20121089
Synthesis of polyrotaxanes from acetyl-β-cyclodextrin
NASA Astrophysics Data System (ADS)
Ristić, I. S.; Nikolić, L.; Nikolić, V.; Ilić, D.; Budinski-Simendić, J.
2011-12-01
Polyrotaxanes are intermediary products in the synthesis of topological gels. They are created by inclusion complex formation of hydrophobic linear macromolecules with cyclodextrins or their derivatives. Then, pairs of cyclodextrin molecules with covalently linkage were practically forming the nodes of the semi-flexible polymer network. Such gels are called topological gels and they can absorb huge quantities of water due to the net flexibility allowing the poly(ethylene oxide) chains to slide through the cyclodextrin cavities, without being pulled out altogether. For polyrotaxane formation poly(ethylene oxide) was used like linear macromolecules. There are hydroxyl groups at poly(ethylene oxide) chains, whereby the linking of the voluminous molecules should be made. To avoid the reaction of cyclodextrin OH groups with stoppers, they should be protected by, e.g., acetylation. In this work, the acetylation of the OH groups of β-cyclodextrin was performed by acetic acid anhydride with iodine as the catalyst. The acetylation reaction was assessed by the FTIR and HPLC method. By the HPLC analysis was found that the acetylation was completed in 20 minutes. Inserting of poly(ethylene oxide) with 4000 g/mol molecule mass into acetyl-β-cyclodextrin with 2:1 poly(ethylene oxide) monomer unit to acetyl-β-cyclodextrin ratio was also monitored by FTIR, and it was found that the process was completed in 12 h at the temperature of 10°C. If the process is performed at temperatures above 10°C, or for periods longer than 12 hours, the process of uncontrolled hydrolysis of acetate groups was initiated.
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Abiotic synthesis of organic compounds from carbon disulfide under hydrothermal conditions.
Rushdi, Ahmed I; Simoneit, Bernd R T
2005-12-01
Abiotic formation of organic compounds under hydrothermal conditions is of interest to bio, geo-, and cosmochemists. Oceanic sulfur-rich hydrothermal systems have been proposed as settings for the abiotic synthesis of organic compounds. Carbon disulfide is a common component of magmatic and hot spring gases, and is present in marine and terrestrial hydrothermal systems. Thus, its reactivity should be considered as another carbon source in addition to carbon dioxide in reductive aqueous thermosynthesis. We have examined the formation of organic compounds in aqueous solutions of carbon disulfide and oxalic acid at 175 degrees C for 5 and 72 h. The synthesis products from carbon disulfide in acidic aqueous solutions yielded a series of organic sulfur compounds. The major compounds after 5 h of reaction included dimethyl polysulfides (54.5%), methyl perthioacetate (27.6%), dimethyl trithiocarbonate (6.8%), trithianes (2.7%), hexathiepane (1.4%), trithiolanes (0.8%), and trithiacycloheptanes (0.3%). The main compounds after 72 h of reaction consisted of trithiacycloheptanes (39.4%), pentathiepane (11.6%), tetrathiocyclooctanes (11.5%), trithiolanes (10.6%), tetrathianes (4.4%), trithianes (1.2%), dimethyl trisulfide (1.1%), and numerous minor compounds. It is concluded that the abiotic formation of aliphatic straight-chain and cyclic polysulfides is possible under hydrothermal conditions and warrants further studies.
Miranda, Ronald-Alexander; Finocchio, Elisabetta; Llorca, Jordi; Medina, Francisco; Ramis, Gianguido; Sueiras, Jesús E; Segarra, Anna M
2013-10-07
PLLs were synthesized by the ring-opening polycondensation (ROP) method using α-L-leucine N-carboxyanhydride (NCA) and initialized by triethylamine (Et3N), water or rehydrated hydrotalcite (HTrus). The role of temperature, different initiators and water in ROP was further investigated. In general, the initiators used in the polymerization reaction lead to PLL alpha-helical chains containing 5-40 monomers with NCA endgroups via a monomer-activated mechanism. However, the water has a twofold effect on ROP, as both a nucleophile and a base, which involves competition between two different types of initiating mechanisms (nucleophilic attack or deprotonation of the NCA monomer) in the polymerization reaction. This competition provides as a main product NCA endgroups with an alpha-helical structure and leads to the formation of the PLL cyclic-chains and beta-sheet structures which reduce the polymer Mw and the PD of the polypeptide. Furthermore, the water can hydrolyze the NCA endgroups resulting in PLL alpha-helical chains that contain living groups as the main product. On the other hand, the HTrus presents a double role: as both an initiator and a support. The polymers synthesized in the presence of HTrus presented a HT-carboxylate endgroup. The PLLs immobilized in HTrus through an anion-exchange method performed for just 30 minutes presented the PLL immobilized in the interlayer space of the HTrus. The PLL chains of the immobilized counterpart are stabilized by H-bonding with the M-OH of the HT structure. All the polypeptides and biohybrid materials synthesized have been characterized using different techniques (EA, ICP, XRD, Raman, MALDI-TOF, ESI-TOF, FT-IR at increasing temperatures, TG/DT analyses and TEM).
Zhong, Ziyi; Ng, Vivien; Luo, Jizhong; Teh, Siew-Pheng; Teo, Jaclyn; Gedanken, Aharon
2007-05-22
Copper oxide with various morphologies was synthesized by the hydrolysis of Cu(ac)2 with urea under mild hydrothermal conditions. In the synthesis, a series of organic amines with one or two amine groups (monoamine and diamine), including isobutylamine, octylamine (OLA), dodecylamine, octadecylamine (monoamines), ethylenediamine dihydrochloride, and hexamethylenediamine (diamines), was used as the "structure-directing agent". The monoamines led to the formation of one-dimensional (1D) aggregates of the copper oxide precursor particles (Pre-CuO), while the diamines led to the formation of two-dimensional (2D) aggregates. In both cases, the shorter carbon-chain amine molecules showed a stronger structure-directing function than that of the longer carbon-chain amine molecules. Next, in a series of syntheses, OLA was selected for further study, and the experimental parameters were systematically manipulated. When the hydrolysis was adjusted to a very slow rate by coupling the hydrolysis reaction with an esterification reaction, 1D aggregates of Pre-CuO were formed; when the hydrolysis rate was in the middle range, spherical Pre-CuO architectures composed of smaller linear aggregates were formed. However, under the high hydrolysis rates achieved by increasing the precipitation agent (urea) or by conducting the reaction at high temperatures (>/=120 degrees C), only Pre-CuO nanoparticles with a featureless morphology were formed. The formed spherical Pre-CuO architectures can be converted to a porous structure (CuOx) after removing the OLA molecules via calcination. Compared to the 1D and 2D aggregates, this porous architecture is highly thermally stable and did not collapse even after calcination at 500 degrees C. Preliminary results showed that the porous structure can be used both as a catalyst support and as a catalyst for the oxidation of CO at low temperatures.
Zhao, Yue; Wingen, Lisa M; Perraud, Véronique; Greaves, John; Finlayson-Pitts, Barbara J
2015-05-21
Ozonolysis of alkenes is an important source of secondary organic aerosol (SOA) in the atmosphere. However, the mechanisms by which stabilized Criegee intermediates (SCI) react to form and grow the particles, and in particular the contributions from oligomers, are not well understood. In this study, ozonolysis of trans-3-hexene (C6H12), as a proxy for small alkenes, was investigated with an emphasis on the mechanisms of particle formation and growth. Ozonolysis experiments were carried out both in static Teflon chambers (18-20 min reaction times) and in a glass flow reactor (24 s reaction time) in the absence and presence of OH or SCI scavengers, and under different relative humidity (RH) conditions. The chemical composition of polydisperse and size-selected SOA particles was probed using different mass spectrometric techniques and infrared spectroscopy. Oligomers having SCI as the chain unit are found to be the dominant components of such SOA particles. The formation mechanism for these oligomers suggested by our results follows the sequential addition of SCI to organic peroxy (RO2) radicals, in agreement with previous studies by Moortgat and coworkers. Smaller particles are shown to have a relatively greater contribution from longer oligomers. Higher O/C ratios are observed in smaller particles and are similar to those of oligomers resulting from RO2 + nSCI, supporting a significant role for longer oligomers in particle nucleation and early growth. Under atmospherically relevant RH of 30-80%, water vapor suppresses oligomer formation through scavenging SCI, but also enhances particle nucleation. Under humid conditions, or in the presence of formic or hydrochloric acid as SCI scavengers, peroxyhemiacetals are formed by the acid-catalyzed particle phase reaction between oligomers from RO2 + nSCI and a trans-3-hexene derived carbonyl product. In contrast to the ozonolysis of trans-3-hexene, oligomerization involving RO2 + nSCI does not appear to be prevalent in the ozonolysis of α-cedrene (C15H24), indicating different particle formation mechanisms for small and large complex alkenes that need to be taken into account in atmospheric models.
Nitrenes, carbenes, diradicals, and ylides. Interconversions of reactive intermediates.
Wentrup, Curt
2011-06-21
Rearrangements of aromatic and heteroaromatic nitrenes and carbenes can be initiated with either heat or light. The thermal reaction is typically induced by flash vacuum thermolysis, with isolation of the products at low temperatures. Photochemical experiments are conducted either under matrix isolation conditions or in solution at ambient temperature. These rearrangements are usually initiated by ring expansion of the nitrene or carbene to a seven-membered ring ketenimine, carbodiimide, or allene (that is, a cycloheptatetraene or an azacycloheptatetraene when a nitrogen is involved). Over the last few years, we have found that two types of ring opening take place as well. Type I is an ylidic ring opening that yields nitrile ylides or diazo compounds as transient intermediates. Type II ring opening produces either dienylnitrenes (for example, from 2-pyridylnitrenes) or 1,7-(1,5)-diradicals (such as those formed from 2-quinoxalinylnitrenes), depending on which of these species is better stabilized by resonance. In this Account, we describe our achievements in elucidating the nature of the ring-opened species and unraveling the connections between the various reactive intermediates. Both of these ring-opening reactions are found, at least in some cases, to dominate the subsequent chemistry. Examples include the formation of ring-opened ketenimines and carbodiimides, as well as the ring contraction reactions that form five-membered ring nitriles (such as 2- and 3-cyanopyrroles from pyridylnitrenes, N-cyanoimidazoles from 2-pyrazinyl and 4-pyrimidinylnitrenes, N-cyanopyrazoles from 2-pyrimidinylnitrenes and 3-pyridazinylnitrenes, and so forth). The mechanisms of formation of the open-chain and ring-contraction products were unknown at the onset of this study. In the course of our investigation, several reactions with three or more consecutive reactive intermediates have been unraveled, such as nitrene, seven-membered cyclic carbodiimide, and open-chain nitrile ylide. It has been possible in some cases to observe them all and determine their interrelationships by means of a combination of matrix-isolation spectroscopy, photochemistry, flash vacuum thermolysis, and computational chemistry. These studies have led to a deeper understanding of the nature of reactive intermediates and chemical reactivity. Moreover, the results indicate new directions for further exploration: ring-opening reactions of carbenes, nitrenes, and cyclic cumulenes can be expected in many other systems.
Enzymatic transformation of hydrocarbons by methanotrophic organisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patel, R.N.; Hou, C.T.
Soluble methane monooxygenase from a facultative methane-utilizing organism, Methylobacterium sp. CRL-26 or R6, catalyzed the NAD(P)H-dependent epoxidation/hydroxylation of a variety of hydrocarbons, including terminal alkenes, internal alkenes, substituted alkenes, branch-chain alkenes, alkanes (C1-C8), substituted alkanes, branch-chain alkanes, carbon monoxide, ether, cyclic and aromatic compounds. The NAD -linked dehydrogenases such as formate dehydrogenase or secondary alcohol dehydrogenase in the presence of formate or secondary alcohol, respectively, regenerated NAD/NADH required for the methane monooxygenase in a coupled enzymes reactions. Oxidation of secondary alcohols to the corresponding methylketones in methanotrophs is catalyzed by an NAD -dependent, zinc-containing, secondary alcohol hydrogenase. Primary alcohols weremore » oxidized to the corresponding aldehydes by a phenazine methosulfate-dependent, pyrollo quinoline quinone (methoxatin or PQQ) containing, methanol dehydrogenase. Oxidation of aldehydes (C1 to C10) to the corresponding carboxylic acids is catalyzed by a heme-containing aldehyde dehydrogenase. Methanotrophs have been considered potentially useful for single cell protein (SCP), amino acids, and biopolymer production at the expense of growth on cheap and readily available C1 compounds. 80 references, 1 figure, 6 tables.« less
Shah, Parag K; Stansbury, Jeffrey W; Bowman, Christopher N
2017-08-14
A new addition-fragmentation chain transfer (AFT) capable moiety was incorporated into a dimethacrylate monomer that participated readily in network formation by copolymerizing with multifunctional methacrylates or acrylates. The process of AFT occurred simultaneously with photopolymerization of the AFT monomer (AFM) and other (meth)acrylate monomers leading to polymer stress relaxation via network reconfiguration. At low loading levels of the AFM, a significant reduction in shrinkage stress, especially for acrylate monomers, was observed with nominal effects on conversion. At higher loading levels of the AFM, the photopolymerization reaction kinetics and final double bond conversion were significantly lowered along with a delay in the gel-point conversion. Electron paramagnetic resonance studies during polymerization revealed the presence of a distinct radical species that was present in proportional quantities to the AFM content in the system. The lifetime and the character of the persistent radicals were altered due to the presence of the distinctive radical, in turn affecting the polymerization kinetics. With polymerization conducted at higher irradiance, the differential conversion between the control resin and samples with moderate AFM content was minimal, especially for the methacrylate-based formulations.
NASA Astrophysics Data System (ADS)
Hamzah, M.; Khenfouch, M.; Rjeb, A.; Sayouri, S.; Houssaini, D. S.; Darhouri, M.; Srinivasu, VV
2018-03-01
Polyethylene is the most commonly used plastic in daily life, covering wide areas of application e.g. this polymer is used as a greenhouses covering material. This article investigates the effect of photo-oxidation on commercial unstabilised Low Density Polyethylene (uLDPE), as result of outdoor weathering factors. In this study, the samples were exposed for four months to the natural weather. The physico-chemical effects of natural ageing were studied by attenuated total reflection Fourier transform infrared (ATR-FTIR) and X-ray photoelectron (XPS) spectroscopy to elucidate the chemical composition, the nature of chemical bonds established and further to interrogate the changes that occur on the surface of the uLDPE samples. The main chemical change of uLDPE results in the formation of different kinds of carbonyl and vinyl groups identifiable in the ATR-FTIR and XPS spectra. The degree of crystallinity for these samples was calculated in terms of time exposure. An increase in the degree of crystallinity due to chemicrystallization was observed, which we indicative of the occurrences of chain scission. During outdoor exposure it was found that the photo-oxidation results in the formation of chain scission occurrences via Norrish type II reactions.
Chemistry and biotechnology of carotenoids.
Namitha, K K; Negi, P S
2010-09-01
Carotenoids are one of the most widespread groups of pigments in nature and more than 600 of these have been identified. Beside provitamin A activity, carotenoids are important as antioxidants and protective agents against various diseases. They are isoprenoids with a long polyene chain containing 3 to 15 conjugated double bonds, which determines their absorption spectrum. Cyclization at one or both ends occurs in hydrocarbon carotene, while xanthophylls are formed by the introduction of oxygen. In addition, modifications involving chain elongation, isomerization, or degradation are also found. The composition of carotenoids in food may vary depending upon production practices, post-harvest handling, processing, and storage. In higher plants they are synthesized in the plastid. Both mevalonate dependent and independent pathway for the formation of isopentenyl diphosphate are known. Isopentenyl diphosphate undergoes a series of addition and condensation reactions to form phytoene, which gets converted to lycopene. Cyclization of lycopene either leads to the formation of β-carotene and its derivative xanthophylls, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin or α-carotene and lutein. Even though most of the carotenoid biosynthetic genes have been cloned and identified, some aspects of carotenoid formation and manipulation in higher plants especially remain poorly understood. In order to enhance the carotenoid content of crop plants to a level that will be required for the prevention of diseases, there is a need for research in both the basic and the applied aspects.
Held, Philipp Alexander; Gao, Hong-Ying; Liu, Lacheng; Mück-Lichtenfeld, Christian; Timmer, Alexander; Mönig, Harry; Barton, Dennis; Neugebauer, Johannes; Fuchs, Harald; Studer, Armido
2016-08-08
Herein we report the on-surface oxidative homocoupling of 6,6'-(1,4-buta-1,3-diynyl)bis(2-naphthoic acid) (BDNA) via bisacylperoxide formation on different Au substrates. By using this unprecedented dehydrogenative polymerization of a biscarboxylic acid, linear poly-BDNA with a chain length of over 100 nm was prepared. It is shown that the monomer BDNA can be prepared in situ at the surface via on-surface Glaser coupling of 6-ethynyl-2-naphthoic acid (ENA). Under the Glaser coupling conditions, BDNA directly undergoes polymerization to give the polymeric peroxide (poly-BDNA) representing a first example of an on-surface domino reaction. It is shown that the reaction outcome varies as a function of surface topography (Au(111) or Au(100)) and also of the surface coverage, to give branched polymers, linear polymers, or 2D metal-organic networks. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Technical Reports Server (NTRS)
Meador, Mary Ann B.; Johnston, J. Christopher; Cavano, Paul J.; Frimer, Aryeh A.
1997-01-01
The oxidative degradation of PMR (for polymerization of monomeric reactants) polyimides at elevated temperatures was followed by cross-polarized magic angle spinning (Cp-MAS) NMR. C-13 labeling of selected sites in the polymers allowed for direct observation of the transformations arising from oxidation processes. As opposed to model compound studies, the reactions were followed directly in the polymer. The labeling experiments confirm the previously reported oxidation of the methylene carbon to ketone in the methylenedianiline portion of the polymer chain. They also show the formation of two other oxidized species, acid and ester, from this same carbon. In addition, the technique provides the first evidence of the kind of degradation reactions that are occurring in the nadic end caps. Several PMR formulations containing moieties determined to be present after oxidation, as suggested by the labeling study, were synthesized. Weight loss, FTIR, and natural abundance NMR of these derivatives were followed during aging. In this way, weight loss could be related to the observed transformations.
Fast analysis of radionuclide decay chain migration
NASA Astrophysics Data System (ADS)
Chen, J. S.; Liang, C. P.; Liu, C. W.; Li, L.
2014-12-01
A novel tool for rapidly predicting the long-term plume behavior of an arbitrary length radionuclide decay chain is presented in this study. This fast tool is achieved based on generalized analytical solutions in compact format derived for a set of two-dimensional advection-dispersion equations coupled with sequential first-order decay reactions in groundwater system. The performance of the developed tool is evaluated by a numerical model using a Laplace transform finite difference scheme. The results of performance evaluation indicate that the developed model is robust and accurate. The developed model is then used to fast understand the transport behavior of a four-member radionuclide decay chain. Results show that the plume extents and concentration levels of any target radionuclide are very sensitive to longitudinal, transverse dispersion, decay rate constant and retardation factor. The developed model are useful tools for rapidly assessing the ecological and environmental impact of the accidental radionuclide releases such as the Fukushima nuclear disaster where multiple radionuclides leaked through the reactor, subsequently contaminating the local groundwater and ocean seawater in the vicinity of the nuclear plant.
NASA Astrophysics Data System (ADS)
Sha, Jing-Quan; Yang, Xi-Ya; Sheng, Ning; Liu, Guo-Dong; Li, Ji-Sen; Yang, Jian-Bo
2018-07-01
A new polyoxometalate based hybrid compound containing Ag-Ag chain, [Ag29(trz)18][SiWV7WVI5O40] (Ag29SiW12), was synthesized by the simple one-step hydrothermal reaction of silver nitrate, 1, 2, 3- triazole (trz), and [SiW12O40]4- polyanion. Single crystal X-ray diffraction analysis shows that the [SiW12O40]4- polyanions as coordinating guests were successfully encapsulated into the metal-organic framework host matrix. The Keggin [SiW12O40]n- polyanions as templates and trz molecules as the small and delicate ligands play the decisive factors to the formation of silver chain. In addition, to improve the photocatalytic activity of the new compound Ag29SiW12, its polypyrrole (PPy) composite (PPy@Ag29SiW12) has been prepared and exhibits excellent photocatalytic activity (93.1% for MB and 48.8% for RhB) and selectivity adsorption (16.2 mg/g for MB and 1.60 mg/g for RhB) for organic dyes under the visible light radiation.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Characterization of the Deoxyguanosine–Lysine Cross-Link of Methylglyoxal
2015-01-01
Methylglyoxal is a mutagenic bis-electrophile that is produced endogenously from carbohydrate precursors. Methylglyoxal has been reported to induce DNA–protein cross-links (DPCs) in vitro and in cultured cells. Previous work suggests that these cross-links are formed between guanine and either lysine or cysteine side chains. However, the chemical nature of the methylglyoxal induced DPC have not been determined. We have examined the reaction of methylglyoxal, deoxyguanosine (dGuo), and Nα-acetyllysine (AcLys) and determined the structure of the cross-link to be the N2-ethyl-1-carboxamide with the lysine side chain amino group (1). The cross-link was identified by mass spectrometry and the structure confirmed by comparison to a synthetic sample. Further, the cross-link between methylglyoxal, dGuo, and a peptide (AcAVAGKAGAR) was also characterized. The mechanism of cross-link formation is likely to involve an Amadori rearrangement. PMID:24801980
Resonant electron capture by aspartame and aspartic acid molecules.
Muftakhov, M V; Shchukin, P V
2016-12-30
The processes for dissociative electron capture are the key mechanisms for decomposition of biomolecules, proteins in particular, under interaction with low-energy electrons. Molecules of aspartic acid and aspartame, i.e. modified dipeptides, were studied herein to define the impact of the side functional groups on peptide chain decomposition in resonant electron-molecular reactions. The processes of formation and decomposition of negative ions of both aspartame and aspartic acid were studied by mass spectrometry of negative ions under resonant electron capture. The obtained mass spectra were interpreted under thermochemical analysis by quantum chemical calculations. Main channels of negative molecular ions fragmentation were found and characteristic fragment ions were identified. The СООН fragment of the side chain in aspartic acid is shown to play a key role like the carboxyl group in amino acids and aliphatic oligopeptides. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
The mechanism of proton conduction in phosphoric acid
NASA Astrophysics Data System (ADS)
Vilčiauskas, Linas; Tuckerman, Mark E.; Bester, Gabriel; Paddison, Stephen J.; Kreuer, Klaus-Dieter
2012-06-01
Neat liquid phosphoric acid (H3PO4) has the highest intrinsic proton conductivity of any known substance and is a useful model for understanding proton transport in other phosphate-based systems in biology and clean energy technologies. Here, we present an ab initio molecular dynamics study that reveals, for the first time, the microscopic mechanism of this high proton conductivity. Anomalously fast proton transport in hydrogen-bonded systems involves a structural diffusion mechanism in which intramolecular proton transfer is driven by specific hydrogen bond rearrangements in the surrounding environment. Aqueous media transport excess charge defects through local hydrogen bond rearrangements that drive individual proton transfer reactions. In contrast, strong, polarizable hydrogen bonds in phosphoric acid produce coupled proton motion and a pronounced protic dielectric response of the medium, leading to the formation of extended, polarized hydrogen-bonded chains. The interplay between these chains and a frustrated hydrogen-bond network gives rise to the high proton conductivity.
Splendore-Hoeppli phenomenon in a cat with osteomyelitis caused by Streptococcus species.
França, Silvia de Araujo; Braga, Juliana Fortes Vilarinho; Moreira, Matheus Vilardo Loes; Silva, Vitor Cesar Martins; Souza, Erick Ferry; Pereira, Luiz Carlos; Rezende, Cleuza Maria de Faria; Ecco, Roselene
2014-02-01
A 9-month-old male neutered mixed-breed cat had a history of chronic lameness of the right hind limb, which was non-responsive to antibiotic treatment. Hematologic analysis revealed marked neutrophilia and mild monocytosis. Radiography revealed extensive loss of cortical bone, and replacement with irregular and disorganized bone. There was loss of the normal cortico-medullary distinction, and the medullary cavity had an irregular radiodensity suggestive of osteomyelitis. Surgical curettage and antibiotics did not improve the clinical condition, and amputation was performed. Grossly, the skin over the right tibia was ulcerated with a viscous and granular exudate. At histopathology, there was marked diffuse pyogranulomatous dermatitis, myositis, periostitis and osteomyelitis associated with Splendore-Hoeppli phenomenon. In addition, there was marrow osteoproliferation and multifocal cortical loss, reabsorption, fibroplasia and endosteal bone formation. Gram staining revealed myriad slightly elongated Gram-positive bacteria, arranged in pairs or single chains, confirmed by polymerase chain reaction as Streptococcus species.
Wang, Yong; Zhao, Yajun; Ye, Yunsheng; Peng, Haiyan; Zhou, Xingping; Xie, Xiaolin; Wang, Xianhong; Wang, Fosong
2018-03-26
The one-step synthesis of well-defined CO 2 -based diblock copolymers was achieved by simultaneous ring-opening copolymerization (ROCOP) of CO 2 /epoxides and RAFT polymerization of vinyl monomers using a trithiocarbonate compound bearing a carboxylic group (TTC-COOH) as the bifunctional chain transfer agent (CTA). The double chain-transfer effect allows for independent and precise control over the molecular weight of the two blocks and ensures narrow polydispersities of the resultant block copolymers (1.09-1.14). Notably, an unusual axial group exchange reaction between the aluminum porphyrin catalyst and TTC-COOH impedes the formation of homopolycarbonates. By taking advantage of the RAFT technique, it is able to meet the stringent demand for functionality control to well expand the application scopes of CO 2 -based polycarbonates. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp
2013-06-28
Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less
McNeill, Luke A.; Brown, Toby J. N.; Sami, Malkit; Clifton, Ian J.; Burzlaff, Nicolai I.; Claridge, Timothy D. W.; Adlington, Robert M.; Baldwin, Jack E.
2017-01-01
Abstract Isopenicillin N synthase (IPNS) catalyses the four‐electron oxidation of a tripeptide, l‐δ‐(α‐aminoadipoyl)‐l‐cysteinyl‐d‐valine (ACV), to give isopenicillin N (IPN), the first‐formed β‐lactam in penicillin and cephalosporin biosynthesis. IPNS catalysis is dependent upon an iron(II) cofactor and oxygen as a co‐substrate. In the absence of substrate, the carbonyl oxygen of the side‐chain amide of the penultimate residue, Gln330, co‐ordinates to the active‐site metal iron. Substrate binding ablates the interaction between Gln330 and the metal, triggering rearrangement of seven C‐terminal residues, which move to take up a conformation that extends the final α‐helix and encloses ACV in the active site. Mutagenesis studies are reported, which probe the role of the C‐terminal and other aspects of the substrate binding pocket in IPNS. The hydrophobic nature of amino acid side‐chains around the ACV binding pocket is important in catalysis. Deletion of seven C‐terminal residues exposes the active site and leads to formation of a new type of thiol oxidation product. The isolated product is shown by LC‐MS and NMR analyses to be the ene‐thiol tautomer of a dithioester, made up from two molecules of ACV linked between the thiol sulfur of one tripeptide and the oxidised cysteinyl β‐carbon of the other. A mechanism for its formation is proposed, supported by an X‐ray crystal structure, which shows the substrate ACV bound at the active site, its cysteinyl β‐carbon exposed to attack by a second molecule of substrate, adjacent. Formation of this product constitutes a new mode of reaction for IPNS and non‐heme iron oxidases in general. PMID:28703303
McNeill, Luke A; Brown, Toby J N; Sami, Malkit; Clifton, Ian J; Burzlaff, Nicolai I; Claridge, Timothy D W; Adlington, Robert M; Baldwin, Jack E; Rutledge, Peter J; Schofield, Christopher J
2017-09-18
Isopenicillin N synthase (IPNS) catalyses the four-electron oxidation of a tripeptide, l-δ-(α-aminoadipoyl)-l-cysteinyl-d-valine (ACV), to give isopenicillin N (IPN), the first-formed β-lactam in penicillin and cephalosporin biosynthesis. IPNS catalysis is dependent upon an iron(II) cofactor and oxygen as a co-substrate. In the absence of substrate, the carbonyl oxygen of the side-chain amide of the penultimate residue, Gln330, co-ordinates to the active-site metal iron. Substrate binding ablates the interaction between Gln330 and the metal, triggering rearrangement of seven C-terminal residues, which move to take up a conformation that extends the final α-helix and encloses ACV in the active site. Mutagenesis studies are reported, which probe the role of the C-terminal and other aspects of the substrate binding pocket in IPNS. The hydrophobic nature of amino acid side-chains around the ACV binding pocket is important in catalysis. Deletion of seven C-terminal residues exposes the active site and leads to formation of a new type of thiol oxidation product. The isolated product is shown by LC-MS and NMR analyses to be the ene-thiol tautomer of a dithioester, made up from two molecules of ACV linked between the thiol sulfur of one tripeptide and the oxidised cysteinyl β-carbon of the other. A mechanism for its formation is proposed, supported by an X-ray crystal structure, which shows the substrate ACV bound at the active site, its cysteinyl β-carbon exposed to attack by a second molecule of substrate, adjacent. Formation of this product constitutes a new mode of reaction for IPNS and non-heme iron oxidases in general. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
An Experimental and Kinetic Modeling Study of Methyl Decanoate Combustion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sarathy, S M; Thomson, M J; Pitz, W J
2009-12-04
Biodiesel is a mixture of long chain fatty acid methyl esters derived from fats and oils. This research study presents opposed-flow diffusion flame data for one large fatty acid methyl ester, methyl decanoate, and uses the experiments to validate an improved skeletal mechanism consisting of 648 species and 2998 reactions. The results indicate that methyl decanoate is consumed via abstraction of hydrogen atoms to produce fuel radicals, which lead to the production of alkenes. The ester moiety in methyl decanoate leads to the formation of low molecular weight oxygenated compounds such as carbon monoxide, formaldehyde, and ketene.
Modeling competitive substitution in a polyelectrolyte complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu
2015-12-28
We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less
NASA Astrophysics Data System (ADS)
Mendez, M.; Ciuraru, R.; Gosselin, S.; Batut, S.; Visez, N.; Petitprez, D.
2013-06-01
The heterogeneous reaction of Cl. radicals with sub-micron palmitic acid (PA) particles was studied in an aerosol flow tube in the presence or in the absence of O2. Fine particles were generated by homogeneous condensation of PA vapors and introduced in the reactor where chlorine atoms are produced by photolysis of Cl2 using UV lamps surrounding the reactor. The effective reactive uptake coefficient (γ) has been determined from the rate loss of PA measured by GC/MS analysis of reacted particles as a function of the chlorine exposure. In the absence of O2, γ = 14 ± 5 indicates efficient secondary chemistry involving Cl2. GC/MS analyses have shown the formation of monochlorinated and polychlorinated compounds in the oxidized particles. Although, the PA particles are solid, the complete mass can be consumed. In the presence of oxygen, the reaction is still dominated by secondary chemistry but the propagation chain length is smaller than in the absence of O2 which leads to an uptake coefficient γ = 3 ± 1. In the particulate phase, oxocarboxylic acids and dicarboxylic acids are identified by GC/MS. Formation of alcohols and monocarboxylic acids are also suspected. All these results show that solid organic particles could be efficiently oxidized by gas-phase radicals not only on their surface, but also in bulk by mechanisms which are still unclear. Furthermore the identified reaction products are explained by a chemical mechanism showing the pathway of the formation of more functionalized products. They help to understand the aging of primary tropospheric aerosol containing fatty acids.
Mishanina, Tatiana V.; Yadav, Pramod K.; Ballou, David P.; Banerjee, Ruma
2015-01-01
The first step in the mitochondrial sulfide oxidation pathway is catalyzed by sulfide quinone oxidoreductase (SQR), which belongs to the family of flavoprotein disulfide oxidoreductases. During the catalytic cycle, the flavin cofactor is intermittently reduced by sulfide and oxidized by ubiquinone, linking H2S oxidation to the electron transfer chain and to energy metabolism. Human SQR can use multiple thiophilic acceptors, including sulfide, sulfite, and glutathione, to form as products, hydrodisulfide, thiosulfate, and glutathione persulfide, respectively. In this study, we have used transient kinetics to examine the mechanism of the flavin reductive half-reaction and have determined the redox potential of the bound flavin to be −123 ± 7 mV. We observe formation of an unusually intense charge-transfer (CT) complex when the enzyme is exposed to sulfide and unexpectedly, when it is exposed to sulfite. In the canonical reaction, sulfide serves as the sulfur donor and sulfite serves as the acceptor, forming thiosulfate. We show that thiosulfate is also formed when sulfide is added to the sulfite-induced CT intermediate, representing a new mechanism for thiosulfate formation. The CT complex is formed at a kinetically competent rate by reaction with sulfide but not with sulfite. Our study indicates that sulfide addition to the active site disulfide is preferred under normal turnover conditions. However, under pathological conditions when sulfite concentrations are high, sulfite could compete with sulfide for addition to the active site disulfide, leading to attenuation of SQR activity and to an alternate route for thiosulfate formation. PMID:26318450
Mishanina, Tatiana V; Yadav, Pramod K; Ballou, David P; Banerjee, Ruma
2015-10-09
The first step in the mitochondrial sulfide oxidation pathway is catalyzed by sulfide quinone oxidoreductase (SQR), which belongs to the family of flavoprotein disulfide oxidoreductases. During the catalytic cycle, the flavin cofactor is intermittently reduced by sulfide and oxidized by ubiquinone, linking H2S oxidation to the electron transfer chain and to energy metabolism. Human SQR can use multiple thiophilic acceptors, including sulfide, sulfite, and glutathione, to form as products, hydrodisulfide, thiosulfate, and glutathione persulfide, respectively. In this study, we have used transient kinetics to examine the mechanism of the flavin reductive half-reaction and have determined the redox potential of the bound flavin to be -123 ± 7 mV. We observe formation of an unusually intense charge-transfer (CT) complex when the enzyme is exposed to sulfide and unexpectedly, when it is exposed to sulfite. In the canonical reaction, sulfide serves as the sulfur donor and sulfite serves as the acceptor, forming thiosulfate. We show that thiosulfate is also formed when sulfide is added to the sulfite-induced CT intermediate, representing a new mechanism for thiosulfate formation. The CT complex is formed at a kinetically competent rate by reaction with sulfide but not with sulfite. Our study indicates that sulfide addition to the active site disulfide is preferred under normal turnover conditions. However, under pathological conditions when sulfite concentrations are high, sulfite could compete with sulfide for addition to the active site disulfide, leading to attenuation of SQR activity and to an alternate route for thiosulfate formation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V
2011-03-14
Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chang, Wenqiang; Li, Ying; Zhang, Li; Cheng, Aixia; Liu, Yongqing; Lou, Hongxiang
2012-01-01
Candida albicans is one of the most prevalent human opportunistic pathogens. C. albicans undergoes a yeast-to-hyphal transition that has been identified as a virulence factor as well as a critical element for mature biofilm formation. A previous study in our lab showed retigeric acid B (RAB), a lichen derived pentacyclic triterpenoid, displayed synergistic antifungal activity with azoles. We now showed that this combination also proved to be adequate in combating the formation of hyphae in vitro. In vivo tests with mice demonstrated RAB could markedly enhance the efficacy of fluconazole to promote the host's longevity through inhibiting hyphae formation and adherence to host cells. It was also observed that RAB and azoles interacted synergistically to block the formation of biofilm. Our data suggested the attenuated yeast-to-hyphal switch contributed to the defect of mature biofilm formation. Moreover, quantitative real-time polymerase chain reaction (qPCR) analysis showed RAB could reduce the transcript level of MDR1, a multidrug efflux pump, and caused a slight transcriptional reduction for another drug pump related gene CDR1. Taken together, our work provides a potential application to combat candidiasis using the combination of RAB and azoles.
Bone formation in vitro and in nude mice by human osteosarcoma cells.
Ogose, A; Motoyama, T; Hotta, T; Watanabe, H; Takahashi, H E
1995-01-01
Osteosarcomas contain variable amounts of bony tissue, but the mechanism of bone formation by osteosarcoma is not well understood. While a number of cultured human osteosarcoma cell lines have been established, they are maintained by different media and differ qualitatively with regard to bone formation. We examined different media for their ability to support bone formation in vitro and found the alpha-modification of Eagle's minimal essential medium supplemented with beta glycerophosphate was best for this purpose, because it contained the proper calcium and phosphate concentrations. Subsequently, we compared seven human osteosarcoma cell lines under the same experimental conditions to clarify their ability to induce bone formation. NOS-1 cells most frequently exhibited features of bone formation in vitro and in nude mice. Collagen synthesis by tumour cells themselves seemed to be the most important factor for bone volume. However, even HuO9 cells, which lacked collagen synthesis and failed to form bone in vitro, successfully formed tumours containing bone in nude mice. Histological analysis of HuO9 cells in diffusion chambers implanted in nude mice and the findings of polymerase chain reaction indicated that the phenomenon was probably due to bone morphogenetic protein.
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Versatility of Alkyne-Modified Poly(Glycidyl Methacrylate) Layers for Click Reactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soto-Cantu, Dr. Erick; Lokitz, Bradley S; Hinestrosa Salazar, Juan Pablo
2011-01-01
Functional soft interfaces are of interest for a variety of technologies. We describe three methods for preparing substrates with alkyne groups, which show versatility for 'click' chemistry reactions. Two of the methods have the same root: formation of thin, covalently attached, reactive interfacial layers of poly(glycidyl methacrylate) (PGMA) via spin coating onto silicon wafers followed by reactive modification with either propargylamine or 5-hexynoic acid. The amine or the carboxylic acid moieties react with the epoxy groups of PGMA, creating interfacial polymer layers decorated with alkyne groups. The third method consists of using copolymers comprising glycidyl methacrylate and propargyl methacrylate (pGP).more » The pGP copolymers are spin coated and covalently attached on silicon wafers. For each method, we investigate the factors that control film thickness and content of alkyne groups using ellipsometry, and study the nanophase structure of the films using neutron reflectometry. Azide-terminated polymers of methacrylic acid and 2-vinyl-4,4-dimethylazlactone synthesized via reversible addition-fragmentation chain transfer polymerization were attached to the alkyne-modified substrates using 'click' chemistry, and grafting densities in the range of 0.007-0.95 chains nm{sup -2} were attained. The maximum density of alkyne groups attained by functionalization of PGMA with propargylamine or 5-hexynoic acid was approximately 2 alkynes nm{sup -3}. The alkyne content obtained by the three decorating approaches was sufficiently high that it was not the limiting factor for the click reaction of azide-capped polymers.« less
Duong, Hien T T; Jung, Kenward; Kutty, Samuel K; Agustina, Sri; Adnan, Nik Nik M; Basuki, Johan S; Kumar, Naresh; Davis, Thomas P; Barraud, Nicolas; Boyer, Cyrille
2014-07-14
Biofilms are increasingly recognized as playing a major role in human infectious diseases, as they can form on both living tissues and abiotic surfaces, with serious implications for applications that rely on prolonged exposure to the body such as implantable biomedical devices or catheters. Therefore, there is an urgent need to develop improved therapeutics to effectively eradicate unwanted biofilms. Recently, the biological signaling molecule nitric oxide (NO) was identified as a key regulator of dispersal events in biofilms. In this paper, we report a new class of core cross-linked star polymers designed to store and release nitric oxide, in a controlled way, for the dispersion of biofilms. First, core cross-linked star polymers were prepared by reversible addition-fragmentation chain transfer polymerization (RAFT) via an arm first approach. Poly(oligoethylene methoxy acrylate) chains were synthesized by RAFT polymerization, and then chain extended in the presence of 2-vinyl-4,4-dimethyl-5-oxazolone monomer (VDM) with N,N-methylenebis(acrylamide) employed as a cross-linker to yield functional core cross-linked star polymers. Spermine was successfully attached to the star core by reaction with VDM. Finally, the secondary amine groups were reacted with NO gas to yield NO-core cross-linked star polymers. The core cross-linked star polymers were found to release NO in a controlled, slow delivery in bacterial cultures showing great efficacy in preventing both cell attachment and biofilm formation in Pseudomonas aeruginosa over time via a nontoxic mechanism, confining bacterial growth to the suspended liquid.
Jiang, Wenjing; Jiao, Chengqi; Meng, Yinshan; Zhao, Liang; Liu, Qiang
2017-01-01
The preparation of single-chain magnets (SCMs) with photo-switchable bistable states is essential for the development of high-density photo-recording devices. However, the reversible switching of the SCM behavior upon light irradiation is a formidable challenge. Here we report a well-isolated double zigzag chain {[Fe(bpy)(CN)4]2[Co(phpy)2]}·2H2O (bpy = 2,2′-bipyridine, phpy = 4-phenylpyridine), which exhibits reversible redox reactions with interconversion between FeIIILS(μ-CN)CoIIHS(μ-NC)FeIIILS (LS = low-spin, HS = high-spin) and FeIIILS(μ-CN)CoIIILS(μ-NC)FeIILS linkages under alternating irradiation with 808 and 532 nm lasers. The bidirectional photo-induced metal-to-metal charge transfer results in significant changes of anisotropy and intrachain magnetic interactions, reversibly switching the SCM behavior. The on-switching SCM behavior driven by light irradiation at 808 nm could be reversibly switched off by irradiation at 532 nm. The results provide an additional and independent way to control the bistable states of SCMs by switching in the 0 → 1 → 0 sequence, with potential applications in high density storage and molecular switches. PMID:29629126
Tran, Ashley; Williams, Geoffrey; Younus, Shagufta; Ali, Nujhat N; Blair, Sandra L; Nizkorodov, Sergey A; Al-Abadleh, Hind A
2017-09-05
The role of transition metals in the formation and aging of secondary organic aerosol (SOA) from aliphatic and aromatic precursors in heterogeneous/multiphase reactions is not well understood. The reactivity of soluble Fe(III) toward known benzene photooxidation products that include fumaric (trans-butenedioic) and muconic (trans,trans-2,4-hexadienedioic) acids was investigated. Efficient formation of brightly colored nanoparticles was observed that are mostly rod- or irregular-shaped depending on the structure of the organic precursor. The particles were characterized for their optical properties, growth rate, elemental composition, iron content, and oxidation state. Results indicate that these particles have mass absorption coefficients on the same order as black carbon and larger than that of biomass burning aerosols. The particles are also amorphous in nature and consist of polymeric chains of Fe centers complexed to carboxylate groups. The oxidation state of Fe was found to be in between Fe(III) and Fe(II) in standard compounds. The organic reactant to iron molar ratio and pH were found to affect the particle growth rate. Control experiments using maleic acid (cis-butenedioic acid) and succinic acid (butanedioic acid) produced no particles. The formation of particles reported herein could account for new pathways that lead to SOA and brown carbon formation mediated by transition metals. In addition, the multiple chemically active components in these particles (iron, organics, and acidic groups) may have an effect on their chemical reactivity (enhanced uptake of trace gases, catalysis, and production of reactive oxygen species) and their likely poor cloud/ice nucleation properties.
Chiang, T M; Beachey, E H; Kang, A H
1975-09-10
The denatured alpha1(I) chain and the cyanogen bromide peptide, alpha1(I)-CB5, of chick skin collagen cause the release of serotonin and leakage of lactic dehydrogenase from human platelets in a manner similar to the release reaction mediated by adenosine diphosphate and native collagen. These peptides also cause a decrease in the level of adenosine 3':5'-monophosphate (cAMP) in platelets. Adenylate cyclase activity of platelets is partially inhibited by these peptides as well as by native collagen, ADP, and epinephrine, but cAMP phosphodiesterase activity is unaltered by these substances. In contrast, the level of platelet guanosine 3':5'-monophosphate (cGMP) is increased by the collagen peptides as well as the other aggregating agents. The increase is associated with increased guanylate cyclase, but normal cGMP phosphodiesterase activities of platelets. Optical rotatory and viscometric measurements of the alpha1 chains and alpha1-CB5 of chick skin in 0.01 M phosphate/0.15 M sodium chloride, pH 7.4, at various temperatures as a function of time indicate that no detectable renaturation occurs at 37 degrees for at least 30 min of observation. Molecular sieve chromatography of alpha1-CB5 in the phosphate buffer at 37 degrees shows that its elution position is identical to that performed under denaturing conditions (at 45 degrees) with no evidence of higher molecular weight aggregates, and the alpha1-CB5 glycopeptide fraction eluting from the column at the position of its monomer retains the platelet aggregating activity. Additionally, electron microscopic examination of the platelet-rich plasma that had been reacted with these peptides fail to show any ordered collagen structures. These data indicate that the denatured alpha1 chain and alpha1-CB5 glycopeptide of chick skin collagen mediate platelet aggregation through the "physiologic" release reaction in a manner similar to that induced by other aggregating agents such as ADP, epinephrine, or native collagen, and support the conclusion that the aggregating activity of the alpha1 chain and alpha1-CB5 is not likely to be due to the formation of polymerized products.
Silicon-based sleeve devices for chemical reactions
Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.
1996-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Silicon-based sleeve devices for chemical reactions
Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.
1996-12-31
A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.
Ishida; Wu; Shi; Fujita; Sauvage; Hammond; Wijelath
2000-03-01
Previous studies of neointima formation on Dacron vascular grafts mainly focused on the late stages using immunohistochemistry staining for von Willebrand factor (vWF) and smooth muscle (SM) alpha-actin. However, it is impossible to use immunohistochemistry to study the early events of neointima formation, because graft samples lack sufficient cellular material. Therefore, we used reverse transcriptase-polymerase chain reaction (RT-PCR) to demonstrate dynamic changes of SM and endothelial markers during the early stages of neointima formation. Preclotted Dacron grafts were implanted in the descending thoracic aorta of 14 mongrel dogs. Specimens were retrieved at 1-4 weeks. Total RNAs were extracted from mid-portion of graft flow surfaces, and RT-PCR for vWF, SM myosin heavy chain (MHC), and SM alpha-actin were performed and expressed as a ratio to the ribosome s17 signal. SM MHC and vWF mRNA expression was low at 1-2 weeks but elevated at 3-4 weeks (P < 0.05). However, SM alpha-actin mRNA levels were expressed consistently throughout the study period. At 3-4 weeks, vWF mRNA expression was inversely correlated to thrombus formation on the graft flow surface. Increased expressions of SM MHC and vWF mRNA corresponded to the formation of neointima and an endothelial layer at the later stages. However, SM alpha-actin mRNA expression did not vary during the healing process. The application of RT-PCR should permit further studies of gene regulation in the early vascular graft healing process in vivo. This model can also be used to study the molecular events that are involved in SM cell differentiation.
NASA Astrophysics Data System (ADS)
Magenau, Andrew Jackson David
The primary objectives of this research were twofold: (1) development of synthetic procedures for combining quasiliving carbocationic polymerization (QLCCP) of isobutylene (IB) and reversible addition fragmentation chain transfer (RAFT) polymerization for block copolymer synthesis; (2) utilization of efficient, robust, and modular chemistries for facile functionalization of polyisobutylene (PIB). In the first study block copolymers consisting of PIB, and either PMMA or PS block segments, were synthesized by a site transformation approach combining living cationic and reversible addition-fragmentation chain transfer (RAFT) polymerizations. The initial PIB block was synthesized via quasiliving cationic polymerization using the TMPCl/TiCl4 initiation system and was subsequently converted into a hydroxylterminated PIB. Site transformation of the hydroxyl-terminated PIB into a macro chain transfer agent (PIB-CTA) was accomplished by N,N'-dicyclohexylcarbodiimide/dimethylaminopyridine-catalyzed esterification with 4-cyano-4-(dodecylsulfanylthiocarbonylsulfanyl)pentanoic acid. In the second study another site transformation approach was developed to synthesize a novel block copolymer, composed of PIB and PNIPAM segments. The PIB block was prepared via quasiliving cationic polymerization and end functionalized by in-situ quenching to yield telechelic halogen-terminated PIB. Azido functionality was obtained by displacement of the terminal halogen through nucleophilic substitution, which was confirmed by both 1H and 13C NMR. Coupling of an alkyne-functional chain transfer agent (CTA) to azido PIB was successfully accomplished through a copper catalyzed click reaction. Structure of the resulting PIB-based macro-CTA was verified with 1H NMR, FTIR, and GPC; whereas coupling reaction kinetics were monitored by real time variable temperature (VT) 1H NMR. In a third study, a click chemistry functionalization procedure was developed based upon the azide-alkyne 1,3-dipolar cycloaddition reaction. 1-(o-Azidoalkyl)pyrrolyl-terminated PIB was successfully synthesized both by substitution of the terminal halide of 1-(o-haloalkyl)pyrrolyl-terminated PIB with sodium azide and by in situ quenching of quasiliving PIB with a 1-(o-azidoalkyl)pyrrole. GPC indicated the absence of coupled PIB under optimized conditions, confirming exclusive mono-substitution on each pyrrole ring. In a fourth study, radical thiol-ene hydrothiolation "Click" chemistry was explored and adapted to easily and rapidly modify exo -olefin PIB with an array of thiol compounds bearing useful functionalities, including primary halogen, primary amine, primary hydroxyl, and carboxylic acid. The thiol-ene "click" procedure was shown to be applicable to both mono and difunctional exo-olefin polyisobutylene. Telechelic mono- and difunctional exo-olefin PIBs were synthesized via quasiliving cationic polymerization followed by quenching with the hindered amine, 1,2,2,6,6-pentamethylpiperidine. Lower reaction temperatures were found to increase exo-olefin conversion to near quantitative amounts. In the fifth study, thiol-terminated polyisobutylene (PIB-SH) was synthesized by reaction of thiourea with alpha,o-bromine-terminated PIB in a three step one-pot procedure. First the alkylisothiouronium salt was produced using a 1:1 (v:v) DMF:heptane cosolvent mixture at 90°C. Hydrolysis of the salt by aqueous base produced thiolate chain ends, which were then acidified to form the desired thiol functional group. An extension of this reaction was performed by a sequential thiol-ene/thiol-yne procedure to produce tetra-hydroxy functionalized PIB. 1H NMR was used to confirm formation of both alkyne and tetrahydroxyl functional species. Further utility of PIB-SH was demonstrated by base catalyzed thiol-isocyanate reactions. A model reaction was conducted with phenyl isocyanate in THF using triethylamine as the catalyst. Last, conversion of PIB-SH directly into a RAFT macro-CTA was accomplished, as shown by 1H NMR, by treatment of PIB-SH with triethylamine in carbon disulfide and subsequent alkylation with 2-bromopropionic acid. (Abstract shortened by UMI.)
Attaran, Bahareh; Falsafi, Tahereh; Ghorbanmehr, Nassim
2017-02-21
To evaluate the role of biofilm formation on the resistance of Helicobacter pylori ( H. pylori ) to commonly prescribed antibiotics, the expression rates of resistance genes in biofilm-forming and planktonic cells were compared. A collection of 33 H. pylori isolates from children and adult patients with chronic infection were taken for the present study. The isolates were screened for biofilm formation ability, as well as for polymerase chain reaction (PCR) reaction with HP1165 and hp1165 efflux pump genes. Susceptibilities of the selected strains to antibiotic and differences between susceptibilities of planktonic and biofilm-forming cell populations were determined. Quantitative real-time PCR (qPCR) analysis was performed using 16S rRNA gene as a H. pylori -specific primer, and two efflux pumps-specific primers, hp1165 and hefA . The strains were resistant to amoxicillin, metronidazole, and erythromycin, except for one strain, but they were all susceptible to tetracycline. Minimum bactericidal concentrations of antibiotics in the biofilm-forming cells were significantly higher than those of planktonic cells. qPCR demonstrated that the expression of efflux pump genes was significantly higher in the biofilm-forming cells as compared to the planktonic ones. The present work demonstrated an association between H. pylori biofilm formation and decreased susceptibility to all the antibiotics tested. This decreased susceptibility to antibiotics was associated with enhanced functional activity of two efflux pumps: hp1165 and hefA .
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing
2016-10-01
The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H
2002-07-01
Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.
Flahaut, Nicolas A L; Wiersma, Anne; van de Bunt, Bert; Martens, Dirk E; Schaap, Peter J; Sijtsma, Lolke; Dos Santos, Vitor A Martins; de Vos, Willem M
2013-10-01
Lactococcus lactis subsp. cremoris MG1363 is a paradigm strain for lactococci used in industrial dairy fermentations. However, despite of its importance for process development, no genome-scale metabolic model has been reported thus far. Moreover, current models for other lactococci only focus on growth and sugar degradation. A metabolic model that includes nitrogen metabolism and flavor-forming pathways is instrumental for the understanding and designing new industrial applications of these lactic acid bacteria. A genome-scale, constraint-based model of the metabolism and transport in L. lactis MG1363, accounting for 518 genes, 754 reactions, and 650 metabolites, was developed and experimentally validated. Fifty-nine reactions are directly or indirectly involved in flavor formation. Flux Balance Analysis and Flux Variability Analysis were used to investigate flux distributions within the whole metabolic network. Anaerobic carbon-limited continuous cultures were used for estimating the energetic parameters. A thorough model-driven analysis showing a highly flexible nitrogen metabolism, e.g., branched-chain amino acid catabolism which coupled with the redox balance, is pivotal for the prediction of the formation of different flavor compounds. Furthermore, the model predicted the formation of volatile sulfur compounds as a result of the fermentation. These products were subsequently identified in the experimental fermentations carried out. Thus, the genome-scale metabolic model couples the carbon and nitrogen metabolism in L. lactis MG1363 with complete known catabolic pathways leading to flavor formation. The model provided valuable insights into the metabolic networks underlying flavor formation and has the potential to contribute to new developments in dairy industries and cheese-flavor research.
Ubiquitin chain specificities of E6AP E3 ligase and its HECT domain.
Kobayashi, Fuminori; Nishiuchi, Takumi; Takaki, Kento; Konno, Hiroki
2018-02-05
Ubiquitination of target proteins is accomplished by isopeptide bond formation between the carboxy group of the C-terminal glycine (Gly) residue of ubiquitin (Ub) and the ɛ-amino group of lysine (Lys) on the target proteins. The formation of an isopeptide bond between Ubs that gives rise to a poly-Ub chain on the target proteins and the types of poly-Ub chains formed depend on which of the seven Lys residues or N-terminal methionine (Met) residue on Ub is used for chain elongation. To understand the linkage specificity mechanism of Ub chains on E3, the previous study established an assay to monitor the formation of a free diubiquitin chain (Ub 2 chain synthesis assay) by HECT type E3 ligase. In this study, we investigated Ub 2 chain specificity using E6AP HECT domain. We here demonstrate the importance of the N-terminal domain of full length E6AP for Ub 2 chain specificity. Copyright © 2017 Elsevier Inc. All rights reserved.
Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix
2016-03-01
Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays.
Kalia, Neena; Auger, Jocelyn M; Atkinson, Ben; Watson, Steve P
2008-05-01
The role of collagen receptor complex GPVI-FcR gamma-chain, PLCgamma2 and LAT in laser-induced thrombosis is unclear. Controversy surrounds whether collagen is exposed in this model or whether thrombosis is dependent on thrombin. This study hypothesized that collagen exposure plays a critical role in thrombus formation in this model, which was tested by investigating contributions of FcR gamma-chain, LAT, PLCgamma2 and thrombin. Thrombi were monitored using intravital microscopy in anesthetized wild-type and FcR gamma-chain, LAT and PLCgamma2 knockout mice. Hirudin (thrombin inhibitor) was administered to wild-type and FcR gamma-chain knockout mice. Significantly reduced thrombus formation was observed in FcR gamma-chain and PLCgamma2 knockouts with a greater decrease observed in LAT knockouts. Dramatic reduction was observed in wild-types treated with hirudin, with abolished thrombus formation only observed in FcR gamma-chain knockouts treated with hirudin. GPVI-FcR gamma-chain, LAT and PLCgamma2 are essential for thrombus generation and stability in this laser-induced model of injury. More importantly, a greater role for LAT was identified, which may reflect a role for it downstream of a second matrix protein receptor. However, inhibition of platelet activation by matrix proteins and thrombin generation are both required to maximally prevent thrombus formation.
Kinetics of Chemical Reactions in Flames
NASA Technical Reports Server (NTRS)
Zeldovich, Y.; Semenov, N.
1946-01-01
In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
Chemical stability of insulin. 3. Influence of excipients, formulation, and pH.
Brange, J; Langkjaer, L
1992-01-01
The influence of auxiliary substances and pH on the chemical transformations of insulin in pharmaceutical formulation, including various hydrolytic and intermolecular cross-linking reactions, was studied. Bacteriostatic agents had a profound stabilizing effect--phenol > m-cresol > methylparaben--on deamidation as well as on insulin intermolecular cross-linking reactions. Of the isotonicity substances, NaCl generally had a stabilizing effect whereas glycerol and glucose led to increased chemical deterioration. Phenol and sodium chloride exerted their stabilizing effect through independent mechanisms. Zinc ions, in concentrations that promote association of insulin into hexamers, increase the stability, whereas higher zinc content had no further influence. Protamine gave rise to additional formation of covalent protamine-insulin products which increased with increasing protamine concentration. The impact of excipients on the chemical processes seems to be dictated mainly via an influence on the three-dimensional insulin structure. The effect of the physical state of the insulin on the chemical stability was also complex, suggesting an intricate dependence of intermolecular proximity of involved functional groups. At pH values below five and above eight, insulin degrades relatively fast. At acid pH, deamidation at residue A21 and covalent insulin dimerization dominates, whereas disulfide reactions leading to covalent polymerization and formation of A- and B-chains prevailed in alkaline medium. Structure-reactivity relationship is proposed to be a main determinant for the chemical transformation of insulin.
Wang, F; Zhang, Y Q; Ding, J; Yu, L X
2017-10-18
To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.
Theoretical Modeling of Interstellar Chemistry
NASA Technical Reports Server (NTRS)
Charnley, Steven
2009-01-01
The chemistry of complex interstellar organic molecules will be described. Gas phase processes that may build large carbon-chain species in cold molecular clouds will be summarized. Catalytic reactions on grain surfaces can lead to a large variety of organic species, and models of molecule formation by atom additions to multiply-bonded molecules will be presented. The subsequent desorption of these mixed molecular ices can initiate a distinctive organic chemistry in hot molecular cores. The general ion-molecule pathways leading to even larger organics will be outlined. The predictions of this theory will be compared with observations to show how possible organic formation pathways in the interstellar medium may be constrained. In particular, the success of the theory in explaining trends in the known interstellar organics, in predicting recently-detected interstellar molecules, and, just as importantly, non-detections, will be discussed.
Wershaw, R. L.; Leenheer, J.A.; Kennedy, K.R.; Noyes, T.I.
1996-01-01
Oxidative degradation of plant tissue leads to the formation of natural dissolved organic carbon (DOC) and humus. Infrared (IR) and 13C nuclear magnetic resonance (NMR) spectrometry have been used to elucidate the chemical reactions of the early stages of degradation that give rise to DOC derived from litter and compost. The results of this study indicate that oxidation of the lignin components of plant tissue follows the sequence of O-demethylation, and hydroxylation followed by ring-fission, chain-shortening, and oxidative removal of substituents. Oxidative ring-fission leads to the formation of carboxylic acid groups on the cleaved ends of the rings and, in the process, transforms phenolic groups into aliphatic alcoholic groups. The carbohydrate components are broken down into aliphatic hydroxy acids and aliphatic alcohols.
Kinetics of Internal-Loop Formation in Polypeptide Chains: A Simulation Study
Doucet, Dana; Roitberg, Adrian; Hagen, Stephen J.
2007-01-01
The speed of simple diffusional motions, such as the formation of loops in the polypeptide chain, places one physical limit on the speed of protein folding. Many experimental studies have explored the kinetics of formation of end-to-end loops in polypeptide chains; however, protein folding more often requires the formation of contacts between interior points on the chain. One expects that, for loops of fixed contour length, interior loops will form more slowly than end-to-end loops, owing to the additional excluded volume associated with the “tails”. We estimate the magnitude of this effect by generating ensembles of randomly coiled, freely jointed chains, and then using the theory of Szabo, Schulten, and Schulten to calculate the corresponding contact formation rates for these ensembles. Adding just a few residues, to convert an end-to-end loop to an internal loop, sharply decreases the contact rate. Surprisingly, the relative change in rate increases for a longer loop; sufficiently long tails, however, actually reverse the effect and accelerate loop formation slightly. Our results show that excluded volume effects in real, full-length polypeptides may cause the rates of loop formation during folding to depart significantly from the values derived from recent loop-formation experiments on short peptides. PMID:17208979
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Modeling qRT-PCR dynamics with application to cancer biomarker quantification.
Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A
2017-01-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.
2016-01-01
Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
Microfabricated electrochemiluminescence cell for chemical reaction detection
Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.
2003-01-01
A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Kutyavin, Igor V.
2013-01-01
Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-01-01
To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-04-01
To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.
Xu, Jianguo; Wu, Zai-Sheng; Chen, Yanru; Zheng, Tingting; Le, Jingqing; Jia, Lee
2017-02-14
In this work, we have proposed a chain anadiplosis-structured DNA nanowire by using two well-defined assembly strands (AS1 and AS2). The presence of a target analyte would drive the single-stranded AS1 dissociate from the pre-formatted nanowire, converting into a fully double-stranded form responsible for extensive accumulation of G-rich cleavage fragment1 (GCF1) because of an autonomously performed polymerization/nicking/displacement process. In turn, the produced GCF1 is able to hybridize with the un-peeled AS2, allowing the replication over AS2 to occur and generate large amounts of G-rich cleavage fragment2 (GCF2) with the ability to hybridize with the un-peeled AS1, thereafter initiating new enzymatic reactions for further collection of GCF1. Because the reactions occur repeatedly, the assembled nanowires gradually dissociated and completely collapsed in the end, achieving the goal of substantial signal amplification for the colorimetric readout of the target analytes. The sensing feasibility is firstly verified by one trigger primer (TP), and then exemplified with the detection of the target, the kras oncogene, with high sensitivity and specificity. As a proof-of-concept strategy, the intelligent signal readout pathway and desired assay ability provide unique insights into the materials research and biological studies.
Spatiotemporal expression of caveolin-1 and EMMPRIN during mouse tooth development.
Shi, Lu; Li, Lingyun; Wang, Ding; Li, Shu; Chen, Zhi; An, Zhengwen
2016-06-01
Caveolin-1 is a scaffolding protein involved in the formation of cholesterol-rich caveolae lipid rafts within the plasma membrane and is capable of collecting signaling molecules into the caveolae and regulating their activity, including extracellular matrix metalloproteinase inducer (EMMPRIN). However, detailed expression patterns of caveolin-1 and EMMPRIN in the developing dental germ are largely unknown. The present study investigated the expression patterns of caveolin-1 and EMMPRIN in the developing mouse tooth germ by immunohistochemistry and real-time polymerase chain reaction. At the bud stage, caveolin-1 expression was initiated in the epithelium bud and mesenchymal cells, while EMMPRIN was weakly expressed at this stage. At the cap stage, caveolin-1 protein was located in the lingual part of the tooth germ; however, EMMPRIN protein was located in the labial part. From the bell stage to 2 days postnatal, caveolin-1 expression was detected in the ameloblasts and cervical loop area; with EMMPRIN expression in the ameloblasts and odontoblasts. Real-time polymerase chain reaction results showed that both caveolin-1 and EMMPRIN mRNA levels increased gradually with progression of developmental stages, and peaked at day two postnatal. The current finding suggests that both caveolin-1 and EMMPRIN take part in mouse tooth development, especially in the differentiation and organization of odontogenic tissues.
A Hierarchy of Homodesmotic Reactions for Thermochemistry
Schleyer, Paul v. R.
2009-01-01
Chemical equations that balance bond types and atom hybridization to different degrees are often used in computational thermochemistry, for example, to increase accuracy when lower levels of theory are employed. We expose the widespread confusion over such classes of equations and demonstrate that the two most widely used definitions of “homodesmotic” reactions are not equivalent. New definitions are introduced and a consistent hierarchy of reaction classes (RC1 – RC5) for hydrocarbons is constructed: isogyric (RC1) ⊇ isodesmic (RC2) ⊇ hypohomodesmotic (RC3) ⊇ homodesmotic (RC4) ⊇ hyperhomodesmotic (RC5). Each of these successively conserves larger molecular fragments. The concept of isodesmic bond separation reactions is generalized to all classes in this hierarchy, providing a unique sectioning of a given molecule for each reaction type. Several ab initio and density functional methods are applied to the bond separation reactions of 38 hydrocarbons containing five or six carbon atoms. RC4 and RC5 reactions provide bond separation enthalpies with errors consistently less than 0.4 kcal mol−1 across a wide range of theoretical levels, performing significantly better than the other reaction types and far superior to atomization routes. Our recommended bond separation reactions were demonstrated by determining the enthalpies of formation (at 298 K) of 1,3,5-hexatriyne (163.7 ± 0.4 kcal mol−1), 1,3,5,7-octatetrayne (217.6 ± 0.6 kcal mol−1), the larger polyynes C10H2 through C26H2, and an infinite acetylenic carbon chain. PMID:19182999
Li, Qiaqia; Li, Chao; Chen, Jinbo; Liu, Peihua; Cui, Yu; Zhou, Xinyi; Li, Huihuang; Zu, Xiongbing
2018-06-01
To explore the function of NORAD in bladder cancer (BC), and to verify whether NORAD could be used as a biomarker to determine preoperative presence of progression and lymph node metastasis. To our knowledge, it is the first study investigating NORAD and its implications in BC. BC specimens of 90 patients underwent bladder cystectomy or transurethral resection between January 2012 to December 2016 were tested by fluorescence in situ hybridization. The association between NORAD expression and clinicopathological features and prognosis of the patients was analyzed using Kaplan-Meier survival analysis and Cox regression analysis. Quantitative real-time polymerase chain reaction was performed in 4 BC cell lines and 10 fresh tumor sample together with adjacent tissues. MTT, colony formation assay, and Annexin-V apoptosis detection were performed after knockdown of NORAD using shRNA in TSSCUP cells. Western blot was performed to related proteins extracted from these cells. Fluorescence in situ hybridization indicated that high NORAD expression was associated with more advanced histological grade and clinical stage for patients with BC. Higher NORAD expression resulted in lower overall survival, and was an independent prognostic indicator. Real-time polymerase chain reaction showed that the expression of NORAD in BC tissues was higher than those measured in adjacent normal tissues. MTT and colony formation assay demonstrated that knockdown of NORAD results in lower proliferation in TSSCUP cells, whereas PUM2 expression was upregulated and E2F3 downregulated. High NORAD expression could serve as an independent prognostic factor for overall survival of patients with transitional BC. NORAD could be considered as a promising candidate for novel biomarker and therapeutic target for human BC. Copyright © 2018 Elsevier Inc. All rights reserved.
Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions
NASA Astrophysics Data System (ADS)
Zlokazov, V. B.; Utyonkov, V. K.
2017-07-01
The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.
Antiangiogenic effects and mechanisms of trans-ethyl p-methoxycinnamate from Kaempferia galanga L.
He, Zhi-Heng; Yue, Grace Gar-Lee; Lau, Clara Bik-San; Ge, Wei; But, Paul Pui-Hay
2012-11-14
Kaempferia galanga L. (Zingiberaceae) is an aromatic herb and a popular spice used as a condiment in Asian cuisine. The ethanol extract of the dried plant and its successive four subfractions were investigated on zebrafish model by quantitative endogenous alkaline phosphatase assay. Both n-hexane and ethyl acetate fractions had antiangiogenic activity, and two major active components (trans-ethyl p-methoxycinnamate and kaempferol) showed potent antiangiogenic effects on wild-type zebrafish. Because of its much stronger effect and no antiangiogenic activity reported, trans-ethyl p-methoxycinnamate was further investigated for its action mechanism. It dose dependently inhibited vessel formation on both wild- and Tg(fli1a:EGFP)y1-type zebrafish embryos. The semiquantitative reverse transcription polymerase chain reaction assay suggested that trans-ethyl p-methoxycinnamate affects multiple molecular targets related to angiogenesis. In vitro, it specifically inhibited the migration and tube formation of human umbilical vein endothelial cells. In vivo, it could block bFGF-induced vessel formation on Matrigel plug assay.
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...
Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten
2005-03-01
We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.
A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Park, Sang-Hyuck; Wei, Shuting; Mizaikoff, Boris; Taylor, Amelia E; Favero, Cedrick; Huang, Ching-Hua
2009-03-01
Recent studies indicated that water treatment polymers such as poly(epichlorohydrin dimethylamine) (polyamine) and poly(diallyldimethylammonium chloride) (polyDADMAC) may form N-nitrosodimethylamine (NDMA) when in contact with chloramine water disinfectants. To minimize such potential risk and improve the polymer products, the mechanisms of how the polymers behave as NDMA precursors need to be elucidated. Direct chloramination of polymers and intermediate monomers in reagent water was conducted to probe the predominant mechanisms. The impact of polymer properties including polymer purity, polymer molecular weight and structure, residual dimethylamine (DMA), and other intermediate compounds involved in polymer synthesis, and reaction conditions such as pH, oxidant dose, and contact time on the NDMA formation potential (NDMA-FP) was investigated. Polymer degradation after reaction with chloramines was monitored at the molecular level using FT-IR and Raman spectroscopy. Overall, polyamines have greater NDMA-FP than polyDADMAC, and the NDMA formation from both polymers is strongly related to polymer degradation and DMA release during chloramination. Polyamines' tertiary amine chain ends play a major role in their NDMA-FP, while polyDADMACs' NDMA-FP is related to degradation of the quaternary ammonium ring group.
NASA Astrophysics Data System (ADS)
Delidovich, I. V.; Taran, O. P.; Simonov, A. N.; Matvienko, L. G.; Parmon, V. N.
2011-08-01
The article analyzes new and previously reported data on several catalytic and photochemical processes yielding biologically important molecules. UV-irradiation of formaldehyde aqueous solution yields acetaldehyde, glyoxal, glycolaldehyde and glyceraldehyde, which can serve as precursors of more complex biochemically relevant compounds. Photolysis of aqueous solution of acetaldehyde and ammonium nitrate results in formation of alanine and pyruvic acid. Dehydration of glyceraldehyde catalyzed by zeolite HZSM-5-17 yields pyruvaldehyde. Monosaccharides are formed in the course of the phosphate-catalyzed aldol condensation reactions of glycolaldehyde, glyceraldehyde and formaldehyde. The possibility of the direct synthesis of tetroses, keto- and aldo-pentoses from pure formaldehyde due to the combination of the photochemical production of glycolahyde and phosphate-catalyzed carbohydrate chain growth is demonstrated. Erythrulose and 3-pentulose are the main products of such combined synthesis with selectivity up to 10%. Biologically relevant aldotetroses, aldo- and ketopentoses are more resistant to the photochemical destruction owing to the stabilization in hemiacetal cyclic forms. They are formed as products of isomerization of erythrulose and 3-pentulose. The conjugation of the concerned reactions results in a plausible route to the formation of sugars, amino and organic acids from formaldehyde and ammonia under presumed 'prebiotic' conditions.
Assessment of the GECKO-A modeling tool using chamber observations for C12 alkanes
NASA Astrophysics Data System (ADS)
Aumont, B.; La, S.; Ouzebidour, F.; Valorso, R.; Mouchel-Vallon, C.; Camredon, M.; Lee-Taylor, J. M.; Hodzic, A.; Madronich, S.; Yee, L. D.; Loza, C. L.; Craven, J. S.; Zhang, X.; Seinfeld, J.
2013-12-01
Secondary Organic Aerosol (SOA) production and ageing is the result of atmospheric oxidation processes leading to the progressive formation of organic species with higher oxidation state and lower volatility. Explicit chemical mechanisms reflect our understanding of these multigenerational oxidation steps. Major uncertainties remain concerning the processes leading to SOA formation and the development, assessment and improvement of such explicit schemes is therefore a key issue. The development of explicit mechanism to describe the oxidation of long chain hydrocarbons is however a challenge. Indeed, explicit oxidation schemes involve a large number of reactions and secondary organic species, far exceeding the size of chemical schemes that can be written manually. The chemical mechanism generator GECKO-A (Generator for Explicit Chemistry and Kinetics of Organics in the Atmosphere) is a computer program designed to overcome this difficulty. GECKO-A generates gas phase oxidation schemes according to a prescribed protocol assigning reaction pathways and kinetics data on the basis of experimental data and structure-activity relationships. In this study, we examine the ability of the generated schemes to explain SOA formation observed in the Caltech Environmental Chambers from various C12 alkane isomers and under high NOx and low NOx conditions. First results show that the model overestimates both the SOA yields and the O/C ratios. Various sensitivity tests are performed to explore processes that might be responsible for these disagreements.
Formation of a Criegee intermediate in the low-temperature oxidation of dimethyl sulfoxide.
Asatryan, Rubik; Bozzelli, Joseph W
2008-04-07
Dimethyl sulfoxide (DMSO) is the major sulfur-containing constituent of the Marine Boundary Layer. It is a significant source of H2SO4 aerosol/particles and methane sulfonic acid via atmospheric oxidation processes, where the mechanism is not established. In this study, several new, low-temperature pathways are revealed in the oxidation of DMSO using CBS-QB3 and G3MP2 multilevel and B3LYP hybrid density functional quantum chemical methods. Unlike analogous hydrocarbon peroxy radicals the chemically activated DMSO peroxy radical, [CH3S(=O)CH2OO*]*, predominantly undergoes simple dissociation to a methylsulfinyl radical CH3S*(=O) and a Criegee intermediate, CH2OO, with the barrier to dissociation 11.3 kcal mol(-1) below the energy of the CH3S(=O)CH2* + O2 reactants. The well depth for addition of O2 to the CH3S(=O)CH2 precursor radical is 29.6 kcal mol(-1) at the CBS-QB3 level of theory. We believe that this reaction may serve an important role in atmospheric photochemical and irradiated biological (oxygen-rich) media where formation of initial radicals is facilitated even at lower temperatures. The Criegee intermediate (carbonyl oxide, peroxymethylene) and sulfinyl radical can further decompose, resulting in additional chain branching. A second reaction channel important for oxidation processes includes formation (via intramolecular H atom transfer) and further decomposition of hydroperoxide methylsulfoxide radical, *CH2S(=O)CH2OOH over a low barrier of activation. The initial H-transfer reaction is similar and common in analogous hydrocarbon radical + O2 reactions; but the subsequent very low (3-6 kcal mol(-1)) barrier (14 kcal mol(-1) below the initial reagents) to beta-scission products is not common in HC systems. The low energy reaction of the hydroperoxide radical is a beta-scission elimination of *CH2S(=O)CH2OOH into the CH2=S=O + CH2O + *OH product set. This beta-scission barrier is low, because of the delocalization of the *CH2 radical center through the -S(=O) group, to the -CH2OOH fragment in the transition state structure. The hydroperoxide methylsulfoxide radical can also decompose via a second reaction channel of intramolecular OH migration, yielding formaldehyde and a sulfur-centered hydroxymethylsulfinyl radical HOCH2S*(=O). The barrier of activation relative to initial reagents is 4.2 kcal mol(-1). Heats of formation for DMSO, DMSO carbon-centered radical and Criegee intermediate are evaluated at 298 K as -35.97 +/- 0.05, 13.0 +/- 0.2 and 25.3 +/- 0.7 kcal mol(-1) respectively using isodesmic reaction analysis. The [CH3S*(=O) + CH2OO] product set is shown to form a van der Waals complex that results in O-atom transfer reaction and the formation of new products CH3SO2* radical and CH2O. Proper orientation of the Criegee intermediate and methylsulfinyl radical, as a pre-stabilized pre-reaction complex, assist the process. The DMSO radical reaction is also compared to that of acetonyl radical.
Travelet, Christophe; Schlatter, Guy; Hébraud, Pascal; Brochon, Cyril; Lapp, Alain; Hadziioannou, Georges
2009-08-04
alpha-Cyclodextrins (alpha-CDs) have the ability to form inclusion complexes with poly(ethylene oxide) (PEO) polymer chains. These pseudo-polyrotaxanes (PPRs) can be obtained by quenching an alpha-CD/PEO mixture in water from 70 degrees C down to a lower temperature (typically in the range from 5 to 30 degrees C) thanks to favorable interactions between alpha-CD cavities and PEO chains. Moreover, starting from a liquid alpha-CD/PEO mixture at a total mass fraction of 15% w/w at 70 degrees C, the formation of PPRs with time at a lower temperature induces a white physical gel with time, and phase separation is observed. We established that PPR molecules are exclusively found in the precipitated phase although unthreaded alpha-CD molecules and unthreaded PEO chains are in the liquid phase. At 30 degrees C, the physical gel formation is much slower than at 5 degrees C. At 30 degrees C, we established that, in a first step, alpha-CDs thread onto PEO chains, forming PPR molecules which are not in good solvent conditions in water. At a higher length scale, rapid aggregation of the PPR molecules occurs, and threaded alpha-CD-based nanocylinders form (cylinder length L = 5.7 nm and cylinder radius R = 4.7 nm). At a higher length scale, alpha-CD-based nanocylinders associate in a Gaussian way, engendering the formation of precipitated domains which are responsible for the high turbidity of the studied system. At the end of this first step (i.e., after 20 min), the system still remains liquid and the PPRs are totally formed. Then, in a second step (i.e., after 150 min), the system undergoes its reorganization characterized by a compacity increase of the precipitated domains and forms a physical gel. We found that PPRs are totally formed after 20 min at 30 degrees C and that the system stays in a nongel state up to 150 min. This opens new perspectives regarding the PPR chemical modification: between these two characteristic times, we can easily envisage an efficient chemical modification of the PPR molecules in water, as for instance an end-capping reaction leading to the synthesis of polyrotaxanes.
High-throughput real-time quantitative reverse transcription PCR.
Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F
2006-02-01
Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.
Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko
2013-01-01
A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.
Towards thiol functionalization of vanadium pentoxide nanotubes using gold nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lavayen, V.; O'Dwyer, C.; Cardenas, G.
2007-04-12
Template-directed synthesis is a promising route to realize vanadate-based 1-D nanostructures, an example of which is the formation of vanadium pentoxide nanotubes and associated nanostructures. In this work, we report the interchange of long-chained alkyl amines with alkyl thiols. This reaction was followed using gold nanoparticles prepared by the Chemical Liquid Deposition (CLD) method with an average diameter of {approx}0.9nm and a stability of {approx}85 days. V{sub 2}O{sub 5} nanotubes (VOx-NTs) with lengths of {approx}2{mu}m and internal hollow diameters of 20-100nm were synthesized and functionalized in a Au-acetone colloid with a nominal concentration of {approx}4x10{sup -3}mol dm{sup -3}. The interchangemore » reaction with dodecylamine is found only to occur in polar solvents and incorporation of the gold nanoparticles is not observed in the presence of n-decane.« less
Synthesis of hydrogel via click chemistry for DNA electrophoresis.
Finetti, Chiara; Sola, Laura; Elliott, Jim; Chiari, Marcella
2017-09-01
This work introduces a novel sieving gel for DNA electrophoresis using a classical click chemistry reaction, the copper (I)-catalyzed azide-alkyne cycloaddition (CuAAC), to cross-link functional polymer chains. The efficiency of this reaction provides, under mild conditions, hydrogels with near-ideal network connectivity and improved physical properties. Hydrogel formation via click chemistry condensation of functional polymers does not involve the use of toxic monomers and UV initiation. The performance of the new hydrogel in the separation of double stranded DNA fragments was evaluated in the 2200 TapeStation system, an analytical platform, recently introduced by Agilent that combines the advantages of CE in terms of miniaturization and automation with the simplicity of use of slab gel electrophoresis. The click gel enables addition of florescent dyes prior to electrophoresis with considerable improvement of resolution and separation efficiency over conventional cross-linked polyacrylamide gels. Copyright © 2017 Elsevier B.V. All rights reserved.
Keil, Harry; Wasserman, David; Dawson, Charles R.
1944-01-01
1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415
Keil, H; Wasserman, D; Dawson, C R
1944-10-01
1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.
deWit, D; Wootton, M; Allan, B; Steyn, L
1993-01-01
A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752
Reducing the potential for processing contaminant formation in cereal products.
Curtis, Tanya Y; Postles, Jennifer; Halford, Nigel G
2014-05-01
Processing contaminants may be defined as substances that are produced in a food when it is cooked or processed, are not present or are present at much lower concentrations in the raw, unprocessed food, and are undesirable either because they have an adverse effect on product quality or because they are potentially harmful. The presence of very low levels of processing contaminants in common foods is becoming an increasingly important issue for the food industry, as developments in analytical techniques and equipment bring foods under closer and closer scrutiny. This review considers the formation of lipid oxidation products, hydrogenation of polyunsaturated fatty acids to prevent lipid oxidation and the associated risk of trans fatty acid formation. The formation of acrylamide in the Maillard reaction is described, as well as the genetic and agronomic approaches being taken to reduce the acrylamide-forming potential of cereal grain. The multiple routes for the formation of furan and associated chemicals, including hydroxymethylfurfuryl, are also described. The evolving regulatory and public perception situations for these processing contaminants and their implications for the cereal supply chain are discussed, emphasising the need for cereal breeders to engage with the contaminants issue.
Molecule-assisted ferromagnetic atomic chain formation
NASA Astrophysics Data System (ADS)
Kumar, Manohar; Sethu, Kiran Kumar Vidya; van Ruitenbeek, Jan M.
2015-06-01
One dimensional systems strongly enhance the quantum character of electron transport. Such systems can be realized in 5 d transition metals Au, Pt, and Ir, in the form of suspended monatomic chains between bulk leads. Atomic chains between ferromagnetic leads would open up many perspectives in the context of spin-dependent transport and spintronics, but the evidence suggests that for pure metals only the mentioned three 5 d metals are susceptible to chain formation. It has been argued that the stability of atomic chains made up from ferromagnetic metals is compromised by the same exchange interaction that produces the local moments. Here we demonstrate that magnetic atomic chains can be induced to form in break junctions under the influence of light molecules. Explicitly, we find deuterium assisted chain formation in the 3 d ferromagnetic transition metals Fe and Ni. Chain lengths up to eight atoms are formed upon stretching the ferromagnetic atomic contact in deuterium atmosphere at cryogenic temperatures. From differential conductance spectra vibronic states of D2 can be identified, confirming the presence of deuterium in the atomic chains. Shot noise spectroscopy indicates the presence of weakly spin polarized transmission channels.
Microfabricated sleeve devices for chemical reactions
Northrup, M. Allen
2003-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Effects of reaction-kinetic parameters on modeling reaction pathways in GaN MOVPE growth
NASA Astrophysics Data System (ADS)
Zhang, Hong; Zuo, Ran; Zhang, Guoyi
2017-11-01
In the modeling of the reaction-transport process in GaN MOVPE growth, the selections of kinetic parameters (activation energy Ea and pre-exponential factor A) for gas reactions are quite uncertain, which cause uncertainties in both gas reaction path and growth rate. In this study, numerical modeling of the reaction-transport process for GaN MOVPE growth in a vertical rotating disk reactor is conducted with varying kinetic parameters for main reaction paths. By comparisons of the molar concentrations of major Ga-containing species and the growth rates, the effects of kinetic parameters on gas reaction paths are determined. The results show that, depending on the values of the kinetic parameters, the gas reaction path may be dominated either by adduct/amide formation path, or by TMG pyrolysis path, or by both. Although the reaction path varies with different kinetic parameters, the predicted growth rates change only slightly because the total transport rate of Ga-containing species to the substrate changes slightly with reaction paths. This explains why previous authors using different chemical models predicted growth rates close to the experiment values. By varying the pre-exponential factor for the amide trimerization, it is found that the more trimers are formed, the lower the growth rates are than the experimental value, which indicates that trimers are poor growth precursors, because of thermal diffusion effect caused by high temperature gradient. The effective order for the contribution of major species to growth rate is found as: pyrolysis species > amides > trimers. The study also shows that radical reactions have little effect on gas reaction path because of the generation and depletion of H radicals in the chain reactions when NH2 is considered as the end species.
Dickman, M B; Ha, Y S; Yang, Z; Adams, B; Huang, C
2003-05-01
When certain phytopathogenic fungi contact plant surfaces, specialized infection structures (appressoria) are produced that facilitate penetration of the plant external barrier; the cuticle. Recognition of this hydrophobic host surface must be sensed by the fungus, initiating the appropriate signaling pathway or pathways for pathogenic development. Using polymerase chain reaction and primers designed from mammalian protein kinase C sequences (PKC), we have isolated, cloned, and characterized a protein kinase from Colletotrichum trifolii, causal agent of alfalfa anthracnose. Though sequence analysis indicated conserved sequences in mammalian PKC genes, we were unable to induce activity of the fungal protein using known activators of PKC. Instead, we show that the C. trifolii gene, designated LIPK (lipid-induced protein kinase) is induced specifically by purified plant cutin or long-chain fatty acids which are monomeric constituents of cutin. PKC inhibitors prevented appressorium formation and, to a lesser extent, spore germination. Overexpression of LIPK resulted in multiple, abnormally shaped appressoria. Gene replacement of lipk yielded strains which were unable to develop appressoria and were unable to infect intact host plant tissue. However, these mutants were able to colonize host tissue following artificial wounding, resulting in typical anthracnose lesions. Taken together, these data indicate a central role in triggering infection structure formation for this protein kinase, which is induced specifically by components of the plant cuticle. Thus, the fungus is able to sense and use host surface chemistry to induce a protein kinase-mediated pathway that is required for pathogenic development.
Zhao, Jiong-Peng; Yang, Qian; Liu, Zhong-Yi; Zhao, Ran; Hu, Bo-Wen; Du, Miao; Chang, Ze; Bu, Xian-He
2012-07-04
A magnetic isolated chain-based substituted cobalt-formate framework was obtained with isonicotine as a spacer. In the chain, canted antiferromagnetic interactions exist in between the Co(II) ions, and slow magnetic relaxation is detected at low temperature. For the block effects of the isonicotine ligands, the complex could be considered as a peculiar example of a weak ferromagnetic single-chain-magnet.
Greaves, Tamar L; Broomhall, Hayden; Weerawardena, Asoka; Osborne, Dale A; Canonge, Bastien A; Drummond, Calum J
2017-12-14
The phase behaviour of n-alkylammonium (C6 to C16) nitrates and formates has been characterised using synchrotron small angle and wide angle X-ray scattering (SAXS/WAXS), differential scanning calorimetry (DSC), cross polarised optical microscopy (CPOM) and Fourier transform infrared spectroscopy (FTIR). The protic salts may exist as crystalline, liquid crystalline or ionic liquid materials depending on the alkyl chain length and temperature. n-Alkylammonium nitrates with n ≥ 6 form thermotropic liquid crystalline (LC) lamellar phases, whereas n ≥ 8 was required for the formate series to form this LC phase. The protic ionic liquid phase showed an intermediate length scale nanostructure resulting from the segregation of the polar and nonpolar components of the ionic liquid. This segregation was enhanced for longer n-alkyl chains, with a corresponding increase in the correlation length scale. The crystalline and liquid crystalline phases were both lamellar. Phase transition temperatures, lamellar d-spacings, and liquid correlation lengths for the n-alkylammonium nitrates and formates were compared with those for n-alkylammonium chlorides and n-alkylamines. Plateau regions in the liquid crystalline to liquid phase transition temperatures as a function of n for the n-alkylammonium nitrates and formates are consistent with hydrogen-bonding and cation-anion interactions between the ionic species dominating alkyl chain-chain van der Waals interactions, with the exception of the mid chained hexyl- and heptylammonium formates. The d-spacings of the lamellar phases for both the n-alkylammonium nitrates and formates were consistent with an increase in chain-chain layer interdigitation within the bilayer-based lamellae with increasing alkyl chain length, and they were comparable to the n-alkylammonium chlorides.
Acyl Chain Preference in Foam Cell Formation from Mouse Peritoneal Macrophages.
Fujiwara, Yuko; Hama, Kotaro; Tsukahara, Makoto; Izumi-Tsuzuki, Ryosuke; Nagai, Toru; Ohe-Yamada, Mihoko; Inoue, Keizo; Yokoyama, Kazuaki
2018-01-01
Macrophage foam cells play critical roles in the initiation and development of atherosclerosis by synthesizing and accumulating cholesteryl ester (CE) in lipid droplets. However, in analyzing lipid metabolism in foam cell formation, studies have focused on the sterol group, and little research has been done on the acyl chains. Therefore, we adapted a model system using liposomes containing particular acyl chains and examined the effect of various acyl chains on foam cell formation. Of the phosphatidylserine (PS) liposomes tested containing PS, phosphatidylcholine, and cholesterol, we found that unsaturated (C18:1), but not saturated (C16:0 and C18:0), PS liposomes induced lipid droplet formation, indicating that foam cell formation depends on the nature of the acyl chain of the PS liposomes. Experiments on the uptake and accumulation of cholesterol from liposomes by adding [ 14 C]cholesterol suggested that foam cell formation could be induced only when cholesterol was converted to CE in the case of C18:1 PS liposomes. Both microscopic observations and metabolic analysis suggest that cholesterol incorporated into either C16:0 or C18:0 PS liposomes may stay intact after being taken in by endosomes. The [ 14 C]C18:1 fatty acyl chain in the C18:1 PS liposome was used to synthesize CE and triacylglycerol (TG). Interestingly, the [ 14 C]C16:0 in the C18:1 PS liposome was metabolized to sphingomyelin rather than being incorporated into either CE or TG, which could be because of enzymatic acyl chain selectivity. In conclusion, our results indicate that the acyl chain preference of macrophages could have some impact on their progression to foam cells.
Ternary Phase-Separation Investigation of Sol-Gel Derived Silica from Ethyl Silicate 40
Wang, Shengnan; Wang, David K.; Smart, Simon; Diniz da Costa, João C.
2015-01-01
A ternary phase-separation investigation of the ethyl silicate 40 (ES40) sol-gel process was conducted using ethanol and water as the solvent and hydrolysing agent, respectively. This oligomeric silica precursor underwent various degrees of phase separation behaviour in solution during the sol-gel reactions as a function of temperature and H2O/Si ratios. The solution composition within the immiscible region of the ES40 phase-separated system shows that the hydrolysis and condensation reactions decreased with decreasing reaction temperature. A mesoporous structure was obtained at low temperature due to weak drying forces from slow solvent evaporation on one hand and formation of unreacted ES40 cages in the other, which reduced network shrinkage and produced larger pores. This was attributed to the concentration of the reactive sites around the phase-separated interface, which enhanced the condensation and crosslinking. Contrary to dense silica structures obtained from sol-gel reactions in the miscible region, higher microporosity was produced via a phase-separated sol-gel system by using high H2O/Si ratios. This tailoring process facilitated further condensation reactions and crosslinking of silica chains, which coupled with stiffening of the network, made it more resistant to compression and densification. PMID:26411484
Enzymatic preparation of structured oils containing short-chain fatty acids.
Kanda, Ayato; Namiki, Fusako; Hara, Setsuko
2010-01-01
Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.
The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...
29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.
Code of Federal Regulations, 2010 CFR
2010-07-01
... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...
Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."
ERIC Educational Resources Information Center
Phelps, Tara L.; And Others
1996-01-01
Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…
Determining Annealing Temperatures for Polymerase Chain Reaction
ERIC Educational Resources Information Center
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
USDA-ARS?s Scientific Manuscript database
A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...
Everaers, Ralf; Rosa, Angelo
2012-01-07
The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.
Northrup, M. Allen
2003-08-05
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Study of the dynamics of the MoO2-Mo2C system for catalytic partial oxidation reactions
NASA Astrophysics Data System (ADS)
Cuba Torres, Christian Martin
On a global scale, the energy demand is largely supplied by the combustion of non-renewable fossil fuels. However, their rapid depletion coupled with environmental and sustainability concerns are the main drivers to seek for alternative energetic strategies. To this end, the sustainable generation of hydrogen from renewable resources such as biodiesel would represent an attractive alternative solution to fossil fuels. Furthermore, hydrogen's lower environmental impact and greater independence from foreign control make it a strong contender for solving this global problem. Among a wide variety of methods for hydrogen production, the catalytic partial oxidation offers numerous advantages for compact and mobile fuel processing systems. For this reaction, the present work explores the versatility of the Mo--O--C catalytic system under different synthesis methods and reforming conditions using methyl oleate as a surrogate biodiesel. MoO2 exhibits good catalytic activity and exhibits high coke-resistance even under reforming conditions where long-chain oxygenated compounds are prone to form coke. Moreover, the lattice oxygen present in MoO2 promotes the Mars-Van Krevelen mechanism. Also, it is introduced a novel beta-Mo2C synthesis by the in-situ formation method that does not utilize external H2 inputs. Herein, the MoO 2/Mo2C system maintains high catalytic activity for partial oxidation while the lattice oxygen serves as a carbon buffer for preventing coke formation. This unique feature allows for longer operation reforming times despite slightly lower catalytic activity compared to the catalysts prepared by the traditional temperature-programmed reaction method. Moreover, it is demonstrated by a pulse reaction technique that during the phase transformation of MoO2 to beta-Mo2C, the formation of Mo metal as an intermediate is not responsible for the sintering of the material wrongly assumed by the temperature-programmed method.
Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh
2014-01-01
Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.
Shrink-induced sorting using integrated nanoscale magnetic traps.
Nawarathna, Dharmakeerthi; Norouzi, Nazila; McLane, Jolie; Sharma, Himanshu; Sharac, Nicholas; Grant, Ted; Chen, Aaron; Strayer, Scott; Ragan, Regina; Khine, Michelle
2013-02-11
We present a plastic microfluidic device with integrated nanoscale magnetic traps (NSMTs) that separates magnetic from non-magnetic beads with high purity and throughput, and unprecedented enrichments. Numerical simulations indicate significantly higher localized magnetic field gradients than previously reported. We demonstrated >20 000-fold enrichment for 0.001% magnetic bead mixtures. Since we achieve high purity at all flow-rates tested, this is a robust, rapid, portable, and simple solution to sort target species from small volumes amenable for point-of-care applications. We used the NSMT in a 96 well format to extract DNA from small sample volumes for quantitative polymerase chain reaction (qPCR).
Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-09-15
We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn
2015-01-01
Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198
Haslam, Tegan M; Haslam, Richard; Thoraval, Didier; Pascal, Stéphanie; Delude, Camille; Domergue, Frédéric; Fernández, Aurora Mañas; Beaudoin, Frédéric; Napier, Johnathan A; Kunst, Ljerka; Joubès, Jérôme
2015-03-01
The extension of very-long-chain fatty acids (VLCFAs) for the synthesis of specialized apoplastic lipids requires unique biochemical machinery. Condensing enzymes catalyze the first reaction in fatty acid elongation and determine the chain length of fatty acids accepted and produced by the fatty acid elongation complex. Although necessary for the elongation of all VLCFAs, known condensing enzymes cannot efficiently synthesize VLCFAs longer than 28 carbons, despite the prevalence of C28 to C34 acyl lipids in cuticular wax and the pollen coat. The eceriferum2 (cer2) mutant of Arabidopsis (Arabidopsis thaliana) was previously shown to have a specific deficiency in cuticular waxes longer than 28 carbons, and heterologous expression of CER2 in yeast (Saccharomyces cerevisiae) demonstrated that it can modify the acyl chain length produced by a condensing enzyme from 28 to 30 carbon atoms. Here, we report the physiological functions and biochemical specificities of the CER2 homologs CER2-LIKE1 and CER2-LIKE2 by mutant analysis and heterologous expression in yeast. We demonstrate that all three CER2-LIKEs function with the same small subset of condensing enzymes, and that they have different effects on the substrate specificity of the same condensing enzyme. Finally, we show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. © 2015 American Society of Plant Biologists. All Rights Reserved.
Haslam, Tegan M.; Haslam, Richard; Thoraval, Didier; Pascal, Stéphanie; Delude, Camille; Domergue, Frédéric; Fernández, Aurora Mañas; Beaudoin, Frédéric; Napier, Johnathan A.; Kunst, Ljerka; Joubès, Jérôme
2015-01-01
The extension of very-long-chain fatty acids (VLCFAs) for the synthesis of specialized apoplastic lipids requires unique biochemical machinery. Condensing enzymes catalyze the first reaction in fatty acid elongation and determine the chain length of fatty acids accepted and produced by the fatty acid elongation complex. Although necessary for the elongation of all VLCFAs, known condensing enzymes cannot efficiently synthesize VLCFAs longer than 28 carbons, despite the prevalence of C28 to C34 acyl lipids in cuticular wax and the pollen coat. The eceriferum2 (cer2) mutant of Arabidopsis (Arabidopsis thaliana) was previously shown to have a specific deficiency in cuticular waxes longer than 28 carbons, and heterologous expression of CER2 in yeast (Saccharomyces cerevisiae) demonstrated that it can modify the acyl chain length produced by a condensing enzyme from 28 to 30 carbon atoms. Here, we report the physiological functions and biochemical specificities of the CER2 homologs CER2-LIKE1 and CER2-LIKE2 by mutant analysis and heterologous expression in yeast. We demonstrate that all three CER2-LIKEs function with the same small subset of condensing enzymes, and that they have different effects on the substrate specificity of the same condensing enzyme. Finally, we show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. PMID:25596184
Layh-Schmitt, Gerlinde; Yang, Eva Y.; Kwon, Grace; Colbert, Robert A.
2013-01-01
Objective To determine whether HLA-B27 expression alters the response of bone marrow monocytes (BMMo) from HLA-B27/human β2-microglobulin transgenic (B27-Tg) rats to tumor necrosis factor-α (TNFα), and whether this affects cells involved in bone homeostasis. Methods BMMo were treated with receptor activator of NF-κB ligand or TNFα to promote osteoclast formation. Osteoclasts were quantified by counting. Gene expression was measured using quantitative polymerase chain reaction, and protein was detected by enzyme-linked immunosorbent assay, immunoblotting, or immunofluorescence. Effects of endogenously produced cytokines on osteoclast formation were determined with neutralizing antibodies. Results TNFα enhanced osteoclast formation 2.5-fold in HLA-B27-expressing cells compared to either wild type or HLA-B7/human β2-microglobulin expressing monocytes. TNFα induced approximately 4-fold upregulation of HLA-B27, which was associated with accumulation of misfolded heavy chains, binding of the ER chaperone BiP, and activation of an ER stress response, which was not seen with HLA-B7. No differences were seen with RANKL-induced osteoclastogenesis. Enhanced interleukin-1α (IL-1α) production from ER stressed B27-Tg BMMo was found to be necessary and sufficient for enhanced osteoclast formation. However, B27-Tg BMMo also produced more interferon-β (IFNβ), which attenuated the effect of IL-1α on osteoclast formation. Conclusions HLA-B27-induced ER stress alters the response of BMMo from B27-Tg rats to TNFα, which is associated with enhanced production of IL-1α and IFNβ, cytokines that exhibit opposing effects on osteoclast formation. The altered response of cells expressing HLA-B27 to pro-inflammatory cytokines suggests that this MHC class I allele may contribute to the pathogenesis of spondyloarthritis and its unique phenotype through downstream effects involving alterations in bone homeostasis. PMID:23666508
Sterically controlled mechanochemistry under hydrostatic pressure
NASA Astrophysics Data System (ADS)
Yan, Hao; Yang, Fan; Pan, Ding; Lin, Yu; Hohman, J. Nathan; Solis-Ibarra, Diego; Li, Fei Hua; Dahl, Jeremy E. P.; Carlson, Robert M. K.; Tkachenko, Boryslav A.; Fokin, Andrey A.; Schreiner, Peter R.; Galli, Giulia; Mao, Wendy L.; Shen, Zhi-Xun; Melosh, Nicholas A.
2018-02-01
Mechanical stimuli can modify the energy landscape of chemical reactions and enable reaction pathways, offering a synthetic strategy that complements conventional chemistry. These mechanochemical mechanisms have been studied extensively in one-dimensional polymers under tensile stress using ring-opening and reorganization, polymer unzipping and disulfide reduction as model reactions. In these systems, the pulling force stretches chemical bonds, initiating the reaction. Additionally, it has been shown that forces orthogonal to the chemical bonds can alter the rate of bond dissociation. However, these bond activation mechanisms have not been possible under isotropic, compressive stress (that is, hydrostatic pressure). Here we show that mechanochemistry through isotropic compression is possible by molecularly engineering structures that can translate macroscopic isotropic stress into molecular-level anisotropic strain. We engineer molecules with mechanically heterogeneous components—a compressible (‘soft’) mechanophore and incompressible (‘hard’) ligands. In these ‘molecular anvils’, isotropic stress leads to relative motions of the rigid ligands, anisotropically deforming the compressible mechanophore and activating bonds. Conversely, rigid ligands in steric contact impede relative motion, blocking reactivity. We combine experiments and computations to demonstrate hydrostatic-pressure-driven redox reactions in metal-organic chalcogenides that incorporate molecular elements that have heterogeneous compressibility, in which bending of bond angles or shearing of adjacent chains activates the metal-chalcogen bonds, leading to the formation of the elemental metal. These results reveal an unexplored reaction mechanism and suggest possible strategies for high-specificity mechanosynthesis.
An improved reaction path optimization method using a chain of conformations
NASA Astrophysics Data System (ADS)
Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro
2018-05-01
The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.
NASA Astrophysics Data System (ADS)
Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.
2018-05-01
It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.
High-throughput microfluidic single-cell digital polymerase chain reaction.
White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L
2013-08-06
Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.
Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.
2012-01-01
The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Kaisheng; Henan Normal University, School of Chemistry and Environmental Science, Key Laboratory of Green Chemical Media and Reactions, Xin xiang, Henan 453007; Lu, Weiwei
A novel method was proposed for successful fabrication of CuS nanostructures with various morphologies. At the ionic liquids (ILs)-modulated CHCl{sub 3}-H{sub 2}O interface, copper cupferronate [Cu(cup){sub 2}] in CHCl{sub 3} reacted with thiourea in water to generate CuS nanostructures via a solvothermal reaction process. The effects of alkyl chain length of imidazolium cations and nature of anions of the ILs, molar ratio of Cu(cup){sub 2} to thiourea, the reaction temperature and time on the morphology of the products were studied systematically. It was shown that by changing alkyl chain length of imidazolium cations and nature of anions of the ILs,more » CuS nanostructures with various morphologies, including flowers, urchins, large nanodisks and nanoparticles, could be obtained at the liquid-liquid interface, and the ILs played important template roles in directing the formation of CuS nanostructures. Furthermore, the as-prepared CuS samples exhibited high catalytic activity for photodegradation of methyl orange and thermal decomposition of ammonium perchlorate. - Graphical abstract: At the ionic liquids-modulated CHCl{sub 3}-H{sub 2}O interface, the CuS nanostructures with the various morphologies of flowers, urchins, large nanodisks and nanoparticles have been successfully prepared via a solvothermal reaction process. Highlights: Black-Right-Pointing-Pointer The properties of oil-H{sub 2}O interface can be modulated by employing different ILs. Black-Right-Pointing-Pointer The modulated interface has been used to prepare CuS nanostructures with various morphologies. Black-Right-Pointing-Pointer The CuS samples exhibited high catalytic activity for the photodegradation of methyl orange.« less
Modulation of frustration in folding by sequence permutation.
Nobrega, R Paul; Arora, Karunesh; Kathuria, Sagar V; Graceffa, Rita; Barrea, Raul A; Guo, Liang; Chakravarthy, Srinivas; Bilsel, Osman; Irving, Thomas C; Brooks, Charles L; Matthews, C Robert
2014-07-22
Folding of globular proteins can be envisioned as the contraction of a random coil unfolded state toward the native state on an energy surface rough with local minima trapping frustrated species. These substructures impede productive folding and can serve as nucleation sites for aggregation reactions. However, little is known about the relationship between frustration and its underlying sequence determinants. Chemotaxis response regulator Y (CheY), a 129-amino acid bacterial protein, has been shown previously to populate an off-pathway kinetic trap in the microsecond time range. The frustration has been ascribed to premature docking of the N- and C-terminal subdomains or, alternatively, to the formation of an unproductive local-in-sequence cluster of branched aliphatic side chains, isoleucine, leucine, and valine (ILV). The roles of the subdomains and ILV clusters in frustration were tested by altering the sequence connectivity using circular permutations. Surprisingly, the stability and buried surface area of the intermediate could be increased or decreased depending on the location of the termini. Comparison with the results of small-angle X-ray-scattering experiments and simulations points to the accelerated formation of a more compact, on-pathway species for the more stable intermediate. The effect of chain connectivity in modulating the structures and stabilities of the early kinetic traps in CheY is better understood in terms of the ILV cluster model. However, the subdomain model captures the requirement for an intact N-terminal domain to access the native conformation. Chain entropy and aliphatic-rich sequences play crucial roles in biasing the early events leading to frustration in the folding of CheY.
NASA Astrophysics Data System (ADS)
Kim, Ki-Hwan; Cho, Jun-Sik; Choi, Doo-Jin; Koh, Seok-Keun
2001-04-01
Polystyrene (PS) Petri-dishes were modified by an ion-assisted reaction (IAR) to improve wettability and to supply a suitable surface for cell culturing. Low energy Ar + ions with 1000 eV were irradiated on the surface of PS in oxygen gas environment. Water contact angles of PS were not reduced much by ion irradiation without oxygen gas and had a value of 40°. In the case of ion irradiation with flowing oxygen gas, however, the water contact angles were dropped significantly from 73° to 19°. X-ray photoelectron spectroscopy analysis showed that the hydrophilic groups were formed on the surface of PS by a chemical reaction between unstable chains induced by ion irradiation and the oxygen gas. Newly formed hydrophilic groups were identified as -(C-O)-, -(CO)- and -(CO)-O- bonds. The influence of the surface modification on growth of the rat pheochromocytoma (PC12) cells was investigated. The IAR-treated PS surfaces showed enhanced attachment and growth in PC12 cell culture test.
Tomanov, Konstantin; Nehlin, Lilian; Ziba, Ionida
2018-01-01
The small ubiquitin-related modifier (SUMO) conjugation apparatus usually attaches single SUMO moieties to its substrates, but SUMO chains have also been identified. To better define the biochemical requirements and characteristics of SUMO chain formation, mutations in surface-exposed Lys residues of Arabidopsis SUMO-conjugating enzyme (SCE) were tested for in vitro activity. Lys-to-Arg changes in the amino-terminal region of SCE allowed SUMO acceptance from SUMO-activating enzyme and supported substrate mono-sumoylation, but these mutations had significant effects on SUMO chain assembly. We found no indication that SUMO modification of SCE promotes chain formation. A substrate was identified that is modified by SUMO chain addition, showing that SCE can distinguish substrates for either mono-sumoylation or SUMO chain attachment. It is also shown that SCE with active site Cys mutated to Ser can accept SUMO to form an oxyester, but cannot transfer this SUMO moiety onto substrates, explaining a previously known dominant negative effect of this mutation. PMID:29133528
Enzymatic Addition of Alcohols to Terpenes by Squalene Hopene Cyclase Variants.
Kühnel, Lisa C; Nestl, Bettina M; Hauer, Bernhard
2017-11-16
Squalene-hopene cyclases (SHCs) catalyze the polycyclization of squalene into a mixture of hopene and hopanol. Recently, amino-acid residues lining the catalytic cavity of the SHC from Alicyclobacillus acidocaldarius were replaced by small and large hydrophobic amino acids. The alteration of leucine 607 to phenylalanine resulted in increased enzymatic activity towards the formation of an intermolecular farnesyl-farnesyl ether product from farnesol. Furthermore, the addition of small-chain alcohols acting as nucleophiles led to the formation of non-natural ether-linked terpenoids and, thus, to significant alteration of the product pattern relative to that obtained with the wild type. It is proposed that the mutation of leucine at position 607 may facilitate premature quenching of the intermediate by small alcohol nucleophiles. This mutagenesis-based study opens the field for further intermolecular bond-forming reactions and the generation of non-natural products. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stable prenucleation mineral clusters are liquid-like ionic polymers
Demichelis, Raffaella; Raiteri, Paolo; Gale, Julian D.; Quigley, David; Gebauer, Denis
2011-01-01
Calcium carbonate is an abundant substance that can be created in several mineral forms by the reaction of dissolved carbon dioxide in water with calcium ions. Through biomineralization, organisms can harness and control this process to form various functional materials that can act as anything from shells through to lenses. The early stages of calcium carbonate formation have recently attracted attention as stable prenucleation clusters have been observed, contrary to classical models. Here we show, using computer simulations combined with the analysis of experimental data, that these mineral clusters are made of an ionic polymer, composed of alternating calcium and carbonate ions, with a dynamic topology consisting of chains, branches and rings. The existence of a disordered, flexible and strongly hydrated precursor provides a basis for explaining the formation of other liquid-like amorphous states of calcium carbonate, in addition to the non-classical behaviour during growth of amorphous calcium carbonate. PMID:22186886
Park, Sang Hyuck; Padhye, Lokesh P; Wang, Pei; Cho, Min; Kim, Jae-Hong; Huang, Ching-Hua
2015-01-23
Recent studies show that cationic amine-based water treatment polymers may be important precursors that contribute to formation of the probable human carcinogen N-nitrosodimethylamine (NDMA) during water treatment and disinfection. To better understand how water treatment parameters affect NDMA formation from the polymers, the effects of in situ chloramination, breakpoint chlorination, and pre-oxidation on the NDMA formation from the polymers were investigated. NDMA formation potential (NDMA-FP) as well as dimethylamine (DMA) residual concentration were measured from poly(epichlorohydrin dimethylamine) (polyamine) and poly(diallyldimethylammonium chloride) (polyDADMAC) solutions upon reactions with oxidants including free chlorine, chlorine dioxide, ozone, and monochloramine under different treatment conditions. The results supported that dichloramine (NHCl2) formation was the critical factor affecting NDMA formation from the polymers during in situ chloramination. The highest NDMA formation from the polymers occurred near the breakpoint of chlorination. Polymer chain breakdown and transformation of the released DMA and other intermediates were important factors affecting NDMA formation from the polymers in pre-oxidation followed by post-chloramination. Pre-oxidation generally reduced NDMA-FP of the polymers; however, the treatments involving pre-ozonation increased polyDADMAC's NDMA-FP and DMA release. The strategies for reducing NDMA formation from the polymers may include the avoidance of the conditions favorable to NHCl2 formation and the avoidance of polymer exposure to strong oxidants such as ozone. Copyright © 2014 Elsevier B.V. All rights reserved.
Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei
2017-01-01
Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee
2012-07-09
Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
9 CFR 145.33 - Terminology and classification; flocks and products.
Code of Federal Regulations, 2010 CFR
2010-01-01
.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...
Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier
2005-01-01
A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.
NASA Astrophysics Data System (ADS)
Flores, Joel Diez
2011-12-01
The need to tailor polymeric architectures with specific physico-chemical properties via the simplest, cleanest, and most efficient synthetic route possible has become the ultimate goal in polymer synthesis. Recent progress in macromolecular science, such as the discoveries of controlled/"living" free radical polymerization (CRP) methods, has brought about synthetic capabilities to prepare (co)polymers with advanced topologies, predetermined molecular weights, narrow molecular weight distributions, and precisely located functional groups. In addition, the establishment of click chemistry has redefined the selected few highly efficient chemical reactions that become highly useful in post-polymerization modification strategies. Hence, the ability to make well-defined topologies afforded by controlled polymerization techniques and the facile incorporation of functionalities along the chain via click-type reactions have yielded complex architectures, allowing the investigation of physical phenomena which otherwise could not be studied with systems prepared via conventional methods. The overarching theme of the research work described in this dissertation is the fusion of the excellent attributes of reversible addition-fragmentation chain transfer (RAFT) polymerization method, which is one of the CRP techniques, and click-type chemical reactions in the precision of synthesis of advanced functional materials. Chapter IV is divided into three sections. In Section I, the direct RAFT homopolymerization of 2-(acryloyloxy)ethyl isocyanate (AOI) and subsequent post-polymerization modifications are described. The polymerization conditions were optimized in terms of the choice of RAFT chain transfer agent (CTA), polymerization temperature and the reaction medium. Direct RAFT polymerization of AOI requires a neutral CTA, and relatively low reaction temperature to yield AOI homopolymers with low polydispersities. Efficient side-chain functionalization of PAOI homopolymers was achieved via reaction with model amine, thiol and alcohol compounds yielding urea, thiourethane and urethane derivatives, respectively. Reactions with amines and thiols (in the presence of base) were rapid, quantitative and efficient. However, the reaction with alcohols catalyzed by dibutyltin dilaurate (DBTDL) was relatively slow but proceeded to completion. Selective reaction pathways for the addition of difunctional ethanolamine and mercaptoethanol were also investigated. A related strategy is described in Section II wherein a hydroxyl-containing diblock copolymer precursor was transformed into a library of functional copolymers via two sequential post-polymerization modification reactions. A diblock copolymer scaffold, poly[(N,N-dimethylacrylamide)-b-( N-(2-hydroxyethyl)acrylamide] (PDMA-b-PHEA) was first prepared. The hydroxyl groups of the HEA block were then reacted with 2-(acryloyloxy)ethylisocyanate (AOI) and allylisocyanate (AI) resulting in acrylate- and allyl-functionalized copolymer precursors, respectively. The efficiencies of Michael-type and free radical thiol addition reactions were investigated using selected thiols having alkyl, aryl, hydroxyl, carboxylic acid, amine and amino acid functionalities. The steps of RAFT polymerization, isocyanate-hydroxyl coupling and thiol-ene addition are accomplished under mild conditions, thus offering facile and modular routes to synthesize functional copolymers. The synthesis and solution studies of pH- and salt-responsive triblock copolymer are described in Section III. This system is capable of forming self-locked micellar structures which may be controlled by changing solution pH as well as ionic strength. A triblock copolymer containing a permanently hydrophilic poly(N,N-dimethylacrylamide) (PDMA) outer block, a salt-sensitive zwitterionic poly(3[2-(N-methylacrylamido)ethyl dimethylammonio]propanesulfonate) (PMAEDAPS) middle block and a pH-responsive 3-acrylamido-3-methylbutanoic acid (PAMBA) core block was synthesized using aqueous RAFT polymerization. A facile formation of "self-locking" shell cross-linked micelles is achieved by changing solution pH and salt concentration. The reversible "self-locking" is attained from the interactions of zwitterionic groups in the middle block that constitutes the shell of the micelles. The structure slowly dissociates into unimers in 2-3 days at pH above the pKa of the PAMBA block.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Jie; Cai, Qiuxia; Wan, Yan
In this study, the promotional effects of cesium promoter on higher alcohol (C2+OH) synthesis from syngas over Cs-Cu/ZnO/Al2O3 catalysts were investigated using a combined experimental and theoretical density functional theory (DFT) calculation method. In the presence of cesium, the C2+OH productivity increases from 77.1 g•kgcat-1•h-1 to 157.3 g•kgcat-1•h-1 at 583 K due to the enhancement of the initial C–C bond formation. Detailed analysis of chain growth probabilities (CGPs) confirms that initial C–C bond formation is the rate-determining step in the temperature range of 543-583 K. Addition of cesium promoter significantly increases the productivities of 2-methyl-1-propanol, while the CGPs values (C3*more » to 2-methyl-C3*) is almost unaffected. With the assistance of cesium promoter, the CGPs of the initial C–C bond formation step (C1* to C2*) could be increased from 0.13 to 0.25 at 583 K. DFT calculations indicate that the initial C–C bond formation is mainly contributed by the HCO+HCO coupling reaction over the ZnCu(211) model surface. In the presence of the Cs2O, the stabilities of key reaction intermediates such as HCO and H2CO are enhanced which facilitates both HCO+HCO and HCO+H2CO coupling reaction steps with lower activation barriers over the Cs2O-ZnCu(211) surface. The promotional effects of cesium on the C2+OH productivity are also benefited from the competitive CH+HCO coupling reaction over CH hydrogenation that leads to lower alkane formation. In addition, Bader charge analysis suggests that the presence of cesium ions would facilitate the nucleophilic reaction between HCO and H2CO for initial C–C bond formation. This work was supported by the National Natural Science Foundation of China (No. 91545114 and No. 91545203). We appreciate the joint PhD scholarship support from the China Scholarship Council. The authors would also like to thank the support from Collaborative Innovation Center of Chemistry for Energy Materials (2011-iChEM). DM was supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences. Computing time was granted by the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL). EMSL is a national scientific user facility located at Pacific Northwest National Laboratory (PNNL) and sponsored by DOE’s Office of Biological and Environmental Research. PNNL is a multiprogram national laboratory operated for DOE by Battelle Memorial Institute. We also appreciate the support from Sinochem Quanzhou Petrochemical Co. Ltd.« less
Investigation of the interfacial reaction between metal and fluorine-contained polyimides
NASA Astrophysics Data System (ADS)
Yang, Ching-Yu; Chen, J. S.; Hsu, S. L. C.
2005-07-01
In this work, thin metal films (Cr and Ta) were deposited on fluorine-contained polyimides, 6FDA-BisAAF, and 6FDA-PPD. The chemical states of the metal/polyimide samples were characterized by using x-ray photoelectron spectroscopy (XPS). XPS analysis reveals that metal-C, C-O, and metal-O bondings are present in metallized 6FDA-BisAAF and 6FDA-PPD. C-F bonds are observed in bare 6FDA-BisAAF and 6FDA-PPD however, they are not seen in the metallized samples. Disappearance of the C-F bonding is attributed to the disruption of CF3 side groups from the main chains of 6FDA-BisAAF and 6FDA-PPD when the chains are exposed to the plasma during the metal deposition. Nevertheless, the disruption of CF3 side groups also creates sites for the formation of metal-C or C-O bondings, which provide a positive adhesion strength at the metal/polyimide interface, as revealed by the tape test.
Nieva-Echevarría, Bárbara; Goicoechea, Encarnación; Guillén, María D
2017-11-15
The effect of the presence of ovalbumin and soy protein isolate on lipolysis and oxidation taking place during in vitro gastrointestinal digestion of slightly oxidized sunflower and flaxseed oils was addressed. The extent of lipolysis, the molar proportions of acyl groups/fatty acids after digestion, and the oxidation products formed were studied by Proton Nuclear Magnetic Resonance. The presence of proteins provoked a higher hydrolysis in triglycerides, a lower decrease of polyunsaturated chains, and a lower generation of oxidation compounds (conjugated dienes in chains having also hydroperoxy/hydroxy groups, epoxides and aldehydes); the formation of hydroxides was clearly favoured over that of hydroperoxides. Study of headspace composition by Solid Phase Microextraction-Gas Chromatography/Mass Spectrometry confirmed that oxidation advanced to a lesser extent in the presence of protein. Thus, amino acids/peptides released during digestion may show antioxidant properties, affecting not only the extent of lipid oxidation, but also reactions pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.
Self-reporting and refoldable profluorescent single-chain nanoparticles.
Fischer, Tobias S; Spann, Sebastian; An, Qi; Luy, Burkhard; Tsotsalas, Manuel; Blinco, James P; Mutlu, Hatice; Barner-Kowollik, Christopher
2018-05-28
We pioneer the formation of self-reporting and refoldable profluorescent single-chain nanoparticles (SCNPs) via the light-induced reaction ( λ max = 320 nm) of nitroxide radicals with a photo-active crosslinker. Whereas the tethered nitroxide moiety in these polymers fully quenches the luminescence ( i.e. fluorescence) of the aromatic backbone, nitroxide trapping of a transient C-radical leads to the corresponding closed shell alkoxyamine thereby restoring luminescence of the folded SCNP. Hence, the polymer in the folded state is capable of emitting light, while in the non-folded state the luminescence is silenced. Under oxidative conditions the initially folded SCNPs unfold, resulting in luminescence switch-off and the reestablishment of the initial precursor polymer. Critically, we show that the luminescence can be repeatedly silenced and reactivated. Importantly, the self-reporting character of the SCNPs was followed by size-exclusion chromatography (SEC), dynamic light scattering (DLS), fluorescence, electron paramagnetic resonance (EPR), nuclear magnetic resonance (NMR) and diffusion ordered NMR spectroscopy (DOSY).
Parker, A; Engel, P C
1999-01-01
Human 'electron transferring flavoprotein' (ETF) was inactivated by the thiol-specific reagent 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB). The kinetic profile showed the reaction followed pseudo-first-order kinetics during the initial phase of inactivation. Monitoring the release of 5-thio-2-nitrobenzoate (TNB) showed that modification of 1 cysteine residue was responsible for the loss of activity. The inactivation of ETF by DTNB could be reversed upon incubation with thiol-containing reagents. The loss of activity was prevented by the inclusion of medium chain acyl-CoA dehydrogenase (MCAD) and octanoyl-CoA. Cyanolysis of the DTNB modified-ETF with KCN led to the release of TNB accompanied presumably by the formation of the thio-cyano enzyme and with almost full recovery of activity. Conservation studies and the lack of 100% inactivation, however, suggested that this cysteine residue is not essential for the interaction with MCAD.
El Malah, Tamer; Ciesielski, Artur; Piot, Luc; Troyanov, Sergey I; Mueller, Uwe; Weidner, Steffen; Samorì, Paolo; Hecht, Stefan
2012-01-21
Efficient Cu-catalyzed 1,3-dipolar cycloaddition reactions have been used to prepare two series of three regioisomers of G-1 and G-2 poly(triazole-pyridine) dendrons. The G-1 and G-2 dendrons consist of branched yet conformationally pre-organized 2,6-bis(phenyl/pyridyl-1,2,3-triazol-4-yl)pyridine (BPTP) monomeric and trimeric cores, respectively, carrying one focal and either two or four peripheral alkyl side chains. In the solid state, the conformation and supramolecular organization were studied by means of a single crystal X-ray structure analysis of one derivative. At the liquid-solid interface, the self-assembly behavior was investigated by scanning tunneling microscopy (STM) on graphite surfaces. Based on the observed supramolecular organization, it appears that the subtle balance between conformational preferences inherent in the dendritic backbone on the one side and the adsorption and packing of the alkyl side chains on the graphite substrate on the other side dictate the overall structure formation in 2D.
The search for new amphiphiles: synthesis of a modular, high-throughput library
Feast, George C; Lepitre, Thomas; Mulet, Xavier; Conn, Charlotte E; Hutt, Oliver E
2014-01-01
Summary Amphiphilic compounds are used in a variety of applications due to their lyotropic liquid-crystalline phase formation, however only a limited number of compounds, in a potentially limitless field, are currently in use. A library of organic amphiphilic compounds was synthesised consisting of glucose, galactose, lactose, xylose and mannose head groups and double and triple-chain hydrophobic tails. A modular, high-throughput approach was developed, whereby head and tail components were conjugated using the copper-catalysed azide–alkyne cycloaddition (CuAAC) reaction. The tails were synthesised from two core alkyne-tethered intermediates, which were subsequently functionalised with hydrocarbon chains varying in length and degree of unsaturation and branching, while the five sugar head groups were selected with ranging substitution patterns and anomeric linkages. A library of 80 amphiphiles was subsequently produced, using a 24-vial array, with the majority formed in very good to excellent yields. A preliminary assessment of the liquid-crystalline phase behaviour is also presented. PMID:25161714
The search for new amphiphiles: synthesis of a modular, high-throughput library.
Feast, George C; Lepitre, Thomas; Mulet, Xavier; Conn, Charlotte E; Hutt, Oliver E; Savage, G Paul; Drummond, Calum J
2014-01-01
Amphiphilic compounds are used in a variety of applications due to their lyotropic liquid-crystalline phase formation, however only a limited number of compounds, in a potentially limitless field, are currently in use. A library of organic amphiphilic compounds was synthesised consisting of glucose, galactose, lactose, xylose and mannose head groups and double and triple-chain hydrophobic tails. A modular, high-throughput approach was developed, whereby head and tail components were conjugated using the copper-catalysed azide-alkyne cycloaddition (CuAAC) reaction. The tails were synthesised from two core alkyne-tethered intermediates, which were subsequently functionalised with hydrocarbon chains varying in length and degree of unsaturation and branching, while the five sugar head groups were selected with ranging substitution patterns and anomeric linkages. A library of 80 amphiphiles was subsequently produced, using a 24-vial array, with the majority formed in very good to excellent yields. A preliminary assessment of the liquid-crystalline phase behaviour is also presented.
Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth
2010-04-01
To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.
D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J
2006-10-01
Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.
Ru, Jing; Gao, Feng; Yao, Min-Xia; Wu, Tao; Zuo, Jing-Lin
2014-12-28
By the reaction of chiral Mn(III) Schiff-base complexes with the dicyanoruthenate building block, [Ru(salen)(CN)2](-) (salen(2-) = N,N'-ethylenebis(salicylideneimine) dianion), two couples of enantiomerically pure chiral cyano-bridged heterobimetallic one-dimensional (1D) chain complexes, [Mn((R,R)-salcy)Ru(salen)(CN)2]n (1-(RR)) and [Mn((S,S)-salcy)Ru(salen)(CN)2]n (1-(SS)) (Salcy = N,N'-(1,2-cyclohexanediylethylene)bis(salicylideneiminato) dianion), [Mn((R,R)-salphen)Ru(salen)(CN)2]n (2-(RR)) and [Mn((S,S)-salphen)Ru(salen)(CN)2]n (2-(SS)) (salphen = N,N'-(1,2-diphenylethylene)bis(salicylideneiminato) dianion), were synthesized and structurally characterized. Circular dichroism (CD) and vibrational circular dichroism (VCD) spectra confirm the enantiomeric nature of the optically active complexes. Structural analyses reveal the formation of neutral cyano-bridged zigzag single chains in 1-(RR) and 1-(SS), and double chains in 2-(RR) and 2-(SS). Magnetic studies show that antiferromagnetic coupling is operative between Ru(III) and Mn(III) centers bridged by cyanide. Compounds 1-(RR) and 1-(SS) show metamagnetic behavior with a critical field of about 7.2 kOe at 1.9 K resulting from the intermolecular π∙∙∙π interactions. Additionally, magnetostructural correlation for some typical cyano-bridged heterobimetallic Ru(III)-Mn(III) compounds is discussed.
Lassner, M W; Lardizabal, K; Metz, J G
1996-01-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils. PMID:8742713
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Guron, Marta; Wei, Xiaolan; Carroll, Patrick J; Sneddon, Larry G
2010-07-05
The ruthenium-catalyzed metathesis reactions of dialkenyl-substituted ortho- and meta-carboranes provide excellent routes to both cyclic-substituted o-carboranes and new types of main-chain m-carborane polymers. The adjacent positions of the two olefins in the 1,2-(alkenyl)(2)-o-carboranes strongly favor the formation of ring-closed (RCM) products with the reactions of 1,2-(CH(2)=CHCH(2))(2)-1,2-C(2)B(10)H(10) (1), 1,2-(CH(2)=CH(CH(2))(3)CH(2))(2)-1,2-C(2)B(10)H(10) (2), 1,2-(CH(2)=CHSiMe(2))(2)-1,2-C(2)B(10)H(10) (3), 1,2-(CH(2)=CHCH(2)SiMe(2))(2)-1,2-C(2)B(10)H(10) (4), and 1,2-[CH(2)=CH(CH(2))(4)SiMe(2)](2)-1,2-C(2)B(10)H(10) (5) affording 1,2-(-CH(2)CH=CHCH(2)-)-C(2)B(10)H(10) (10), 1,2-[-CH(2)(CH(2))(3)CH=CH(CH(2))(3)CH(2)-]-1,2-C(2)B(10)H(10) (11), 1,2-[-SiMe(2)CH=CHSiMe(2)-]-1,2-C(2)B(10)H(10) (12), 1,2-[-SiMe(2)CH(2)CH=CHCH(2)SMe(2)-]-C(2)B(10)H(10) (13), and 1,2-[-SiMe(2)(CH(2))(4)CH=CH(CH(2))(4)SiMe(2)-]-C(2)B(10)H(10) (14), respectively, in 72-97% yields. On the other hand, the reaction of 1,2-(CH(2)-CHCH(2)OC(=O))(2)-1,2-C(2)B(10)H(10) (6) gave cyclo-[1,2-(1',8'-C(=O)OCH(2)CH=CHCH(2)OC(=O))-1,2-C(2)B(10)H(10)](2) (15a) and polymer 15b resulting from intermolecular metathesis reactions. The nonadjacent positions of the alkenyl groups in the 1,7-(alkenyl)(2)-m-carboranes, 1,7-(CH(2)=CHCH(2))(2)-1,7-C(2)B(10)H(10) (7), 1,7-(CH(2)=CH(CH(2))(3)CH(2))(2)-1,7-C(2)B(10)H(10) (8), and 1,7-(CH(2)=CHCH(2)SiMe(2))(2)-1,7-C(2)B(10)H(10) (9), disfavor the formation of RCM products, and in these cases, acyclic diene metathesis polymerizations (ADMET) produced new types of main chain m-carborane polymers. The structures of 3, 9, 11, 12, 13, and 15a were crystallographically confirmed.
New polymer systems: Chain extension by dianhydrides
NASA Technical Reports Server (NTRS)
Rhein, R. A.; Ingham, J. D.
1972-01-01
The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.
Theoretical study of chain transfer to solvent reactions of alkyl acrylates.
Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud
2014-07-24
This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.
McGuire, Victoria A; Ruiz-Zorrilla Diez, Tamara; Emmerich, Christoph H; Strickson, Sam; Ritorto, Maria Stella; Sutavani, Ruhcha V; Weiβ, Anne; Houslay, Kirsty F; Knebel, Axel; Meakin, Paul J; Phair, Iain R; Ashford, Michael L J; Trost, Matthias; Arthur, J Simon C
2016-08-08
Dimethyl fumarate (DMF) possesses anti-inflammatory properties and is approved for the treatment of psoriasis and multiple sclerosis. While clinically effective, its molecular target has remained elusive - although it is known to activate anti-oxidant pathways. We find that DMF inhibits pro-inflammatory cytokine production in response to TLR agonists independently of the Nrf2-Keap1 anti-oxidant pathway. Instead we show that DMF can inhibit the E2 conjugating enzymes involved in K63 and M1 polyubiquitin chain formation both in vitro and in cells. The formation of K63 and M1 chains is required to link TLR activation to downstream signaling, and consistent with the block in K63 and/or M1 chain formation, DMF inhibits NFκB and ERK1/2 activation, resulting in a loss of pro-inflammatory cytokine production. Together these results reveal a new molecular target for DMF and show that a clinically approved drug inhibits M1 and K63 chain formation in TLR induced signaling complexes. Selective targeting of E2s may therefore be a viable strategy for autoimmunity.
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Chemistry of alkali cation exchanged faujasite and mesoporous NaX using alkyl halides and phosphates
NASA Astrophysics Data System (ADS)
Lee, Min-Hong
The purpose of this work was to increase the reactivity of Faujasite X (NaX) zeolite toward the reactive decontamination of materials subject to nucleophilic attack by means of zeolite cation optimization and by means of the synthesis of mesoporous Faujasite X. Primary alkyl halides and trialkyl phosphates have been the test materials on which the cation-optimized and mesoporous zeolites have been tested. In the alkali cation optimization work, reactions of methyl iodide and 1-chloropropane with alkali metal cation exchanged Faujasite zeolite X were investigated at room temperature. The reactivity of the framework and the product formation were shown to depend on zeolite framework counter-cation. A quantitative study of zeolite product formation has been carried out, primarily using solid-state NMR spectroscopy. Large alkali cations showed preference toward substitution chemistry. In contrast, alkyl halide exposed LiX and NaX zeolites underwent both substitution and elimination. Subsequently introduced water molecules led to hydrolysis of framework species that was sensitive to framework counter-cation. The mesoporous NaX zeolites work undertakes to test whether an improvement in surface chemical reactivity can be achieved by introducing mesopores into the already reactive nucleophilic microporous NaX zeolite. Incorporation of the polydiallyl dimethyl ammonium chloride (PDADMAC) template and the formation of mesopores in Faujasite X zeolite (NaX) were successful and well-characterized. The mesopores are proposed to have occurred from incorporation of the cationic PDADMAC polymer into the zeolite by compensating zeolite framework charge. Subsequent sodium cation exchange of calcined mesoporous NaX was shown to restore the chemical reactivity characteristic of as-synthesized NaX. Trialkyl organophosphorous compounds underwent substitution reactions. The reactivity of both microporous and mesoporous Faujasite zeolite X and the product formation was shown to depend on the length of the alkyl chain. Although introduced mesopores alleviated the limited reagent diffusion to reactive sites due to the microporosity of the NaX zeolites, no marked improvement in the product yields was achieved with either the 1-chloroalkanes or the trialkyl phosphates test compounds, regardless of alkyl chain length. The disappointing results have been attributed to lack of substantial net increase in the numbers of zeolite nucleophilic sites accompanying mesopore introduction.
Katzmann, E.; Eibauer, M.; Lin, W.; Pan, Y.; Plitzko, J. M.
2013-01-01
Magnetotactic bacteria (MTB) align along the Earth's magnetic field by the activity of intracellular magnetosomes, which are membrane-enveloped magnetite or greigite particles that are assembled into well-ordered chains. Formation of magnetosome chains was found to be controlled by a set of specific proteins in Magnetospirillum gryphiswaldense and other MTB. However, the contribution of abiotic factors on magnetosome chain assembly has not been fully explored. Here, we first analyzed the effect of growth conditions on magnetosome chain formation in M. gryphiswaldense by electron microscopy. Whereas higher temperatures (30 to 35°C) and high oxygen concentrations caused increasingly disordered chains and smaller magnetite crystals, growth at 20°C and anoxic conditions resulted in long chains with mature cuboctahedron-shaped crystals. In order to analyze the magnetosome chain in electron microscopy data sets in a more quantitative and unbiased manner, we developed a computerized image analysis algorithm. The collected data comprised the cell dimensions and particle size and number as well as the intracellular position and extension of the magnetosome chain. The chain analysis program (CHAP) was used to evaluate the effects of the genetic and growth conditions on magnetosome chain formation. This was compared and correlated to data obtained from bulk magnetic measurements of wild-type (WT) and mutant cells displaying different chain configurations. These techniques were used to differentiate mutants due to magnetosome chain defects on a bulk scale. PMID:24096429
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
USDA-ARS?s Scientific Manuscript database
Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...
MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS
Wigner, E.P.; Weinberg, A.M.
1961-01-24
A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)
This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...
ERIC Educational Resources Information Center
Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary
2006-01-01
We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…
Adewale, B; Mafe, M A; Oyerinde, J P O
2005-01-01
Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang
2014-01-01
A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528
Di Stefano, Stefano; Ercolani, Gianfranco
2017-01-26
An extension of the Jacobson-Stockmayer theory is presented to include the reversible formation of [2]catenanes in a ring-chain system under thermodynamic control. The extended theory is based on the molar catenation constant, measuring the ease of catenation of two ring oligomers, whose expression was obtained in a previous work. Two scenarios have been considered: that of "thick" (hydrocarbon-like) chains and that of "thin" (DNA-like) chains. In the case of "thick" chains, the formation of catenanes can be neglected, unless in the unlikely case of a very large value of the equilibrium constant for linear propagation (K ≈ 10 8 mol -1 L, or larger). For K tending to infinity, the system becomes a chain-free system where only ring-catenane equilibria occur. Under this condition, there is a critical concentration below which only rings are present at equilibrium and above which the ring fraction remains constant, and the excess monomer is converted only into catenanes. In the case of "thin" chains, the formation of catenanes cannot be neglected even for values of K as low as 10 2 mol -1 L, thus justifying the use of the extended theory.
HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.
Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La
2014-03-01
The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.
Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique
2013-01-01
To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.
Fávaro-Pípi, Elaine; Bossini, Paulo; de Oliveira, Poliani; Ribeiro, Juliana Uema; Tim, Carla; Parizotto, Nivaldo A; Alves, Jose Marcos; Ribeiro, Daniel Araki; Selistre de Araújo, Heloísa Sobreiro; Renno, Ana Claudia Muniz
2010-12-01
The aim of this study was to measure the temporal expression of osteogenic genes during the process of bone healing in low-intensity pulsed ultrasound (LIPUS) treated bone defects by means of histopathologic and real-time polymerase chain reaction (PCR) analysis. Animals were randomly distributed into two groups (n = 30): control group (bone defect without treatment) and LIPUS treated (bone defect treated with LIPUS). On days 7, 13 and 25 postinjury, 10 rats per group were sacrificed. Rats were treated with a 30 mW/cm(2) LIPUS. The results pointed out intense new bone formation surrounded by highly vascularized connective tissue presenting a slight osteogenic activity, with primary bone deposition was observed in the group exposed to LIPUS in the intermediary (13 days) and late stages of repair (25 days) in the treated animals. In addition, quantitative real-time polymerase chain reaction (RT-qPCR) showed an upregulation of bone morphogenetic protein 4 (BMP4), osteocalcin and Runx2 genes 7 days after the surgery. In the intermediary period, there was no increase in the expression. The expression of alkaline phosphatase, BMP4 and Runx2 was significantly increased at the last period. Our results indicate that LIPUS therapy improves bone repair in rats and upregulated osteogenic genes, mainly at the late stages of recovery. Copyright © 2010. Published by Elsevier Inc.
A new 3D nickel(II) framework composed of large rings: Ionothermal synthesis and crystal structure
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu Ling; Choi, Eun-Young; Kwon, Young-Uk
2008-11-15
Ionothermal reaction between Ni{sup 2+} and 1,3,5-benzentricarboxylic acid (H{sub 3}BTC) with [AMI]Cl (AMI=1-amyl-3-methylimidazolium) as the reaction medium produced a novel 3D mixed-ligand metal-organic framework [AMI][Ni{sub 3}(BTC){sub 2}(OAc)(MI){sub 3}] (1) (MI=1-methylimidazole) with [AMI]{sup +} incorporated in the framework. The framework is formed by connecting 2D planes, made up of 32- and 48-membered rings, through 1D chains composed of 32-membered rings. The two BTC{sup 3-} ligands in 1 show the same connectivity mode with two bidentate and one {mu}{sub 2} bridging carboxylic groups. This is a new connectivity mode to the already existing 17 in the Ni-BTC system. The role of MImore » and [AMI]Cl in the structure formation is discussed. - Graphical Abstract: A novel 3D framework [AMI][Ni{sub 3}(BTC){sub 2}(OAc)(MI){sub 3}] is obtained in ionothermal system with [AMI]{sup +} incorporating in the cavities as structure directing template and BTC{sup 3-} showing a new coordination fashion. The 3D framework is constructed by 2D layers linked with 1D double chains. The title compound has the middle thermal stability at ca. 280 deg. C.« less
Zhu, Mo; Riederer, Markus; Hildebrandt, Ulrich
2017-08-01
Asexually produced conidia of the wheat powdery mildew fungus Blumeria graminis f. sp. tritici (Bgt) are known to perceive cuticular very-long-chain aldehydes as signal substances strongly stimulating germination and differentiation of infection structures in a concentration- and chain-length-dependent manner. Conidial germination and appressorium formation are widely prevented by the presence of free water on the host surface. However, sexually produced ascospores can differentiate immersed in water. Applying a Formvar ® -based in vitro-system showed that ascospore appressorium formation was strongly induced by the presence of wheat leaf cuticular wax. Similar to conidia, ascospore appressorium formation is triggered by the presence of very-long-chain aldehydes in a chain-length-dependent manner with n-octacosanal as the most inducing aldehyde. Surface hydrophobicity positively affected ascospore germination but not appressorium formation. Ascospores required significantly more time to complete the differentiation of appressoria and exhibited a more distinct dependence on the availability of free water than their conidial counterparts. Unlike conidia, ascospores showed a more variable germination and differentiation pattern even with a single germ tube differentiating an appressorium. Despite these differences our results demonstrate that a host surface recognition principle based on cuticular very-long-chain aldehydes is a common feature of B. graminis f. sp. tritici ascospores and conidia. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction
NASA Astrophysics Data System (ADS)
Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.
2018-01-01
We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.
Glyoxal Oxidation Mechanism: Implications for the Reactions HCO + O2 and OCHCHO + HO2.
Faßheber, Nancy; Friedrichs, Gernot; Marshall, Paul; Glarborg, Peter
2015-07-16
A detailed mechanism for the thermal decomposition and oxidation of the flame intermediate glyoxal (OCHCHO) has been assembled from available theoretical and experimental literature data. The modeling capabilities of this extensive mechanism have been tested by simulating experimental HCO profiles measured at intermediate and high temperatures in previous glyoxal photolysis and pyrolysis studies. Additionally, new experiments on glyoxal pyrolysis and oxidation have been performed with glyoxal and glyoxal/oxygen mixtures in Ar behind shock waves at temperatures of 1285-1760 K at two different total density ranges. HCO concentration-time profiles have been detected by frequency modulation spectroscopy at a wavelength of λ = 614.752 nm. The temperature range of available direct rate constant data of the high-temperature key reaction HCO + O2 → CO + HO2 has been extended up to 1705 K and confirms a temperature dependence consistent with a dominating direct abstraction channel. Taking into account available literature data obtained at lower temperatures, the following rate constant expression is recommended over the temperature range 295 K < T < 1705 K: k1/(cm(3) mol(-1) s(-1)) = 6.92 × 10(6) × T(1.90) × exp(+5.73 kJ/mol/RT). At intermediate temperatures, the reaction OCHCHO + HO2 becomes more important. A detailed reanalysis of previous experimental data as well as more recent theoretical predictions favor the formation of a recombination product in contrast to the formerly assumed dominating and fast OH-forming channel. Modeling results of the present study support the formation of HOCH(OO)CHO and provide a 2 orders of magnitude lower rate constant estimate for the OH channel. Hence, low-temperature generation of chain carriers has to be attributed to secondary reactions of HOCH(OO)CHO.
The Porphobilinogen Conundrum in Prebiotic Routes to Tetrapyrrole Macrocycles
NASA Astrophysics Data System (ADS)
Taniguchi, Masahiko; Ptaszek, Marcin; Chandrashaker, Vanampally; Lindsey, Jonathan S.
2017-03-01
Attempts to develop a credible prebiotic route to tetrapyrroles have relied on enzyme-free recapitulation of the extant biosynthesis, but this process has foundered from the inability to form the pyrrole porphobilinogen ( PBG) in good yield by self-condensation of the precursor δ-aminolevulinic acid ( ALA). PBG undergoes robust oligomerization in aqueous solution to give uroporphyrinogen (4 isomers) in good yield. ALA, PBG, and uroporphyrinogen III are universal precursors to all known tetrapyrrole macrocycles. The enzymic formation of PBG entails carbon-carbon bond formation between the less stable enolate/enamine of one ALA molecule (3-position) and the carbonyl/imine (4-position) of the second ALA molecule; without enzymes, the first ALA reacts at the more stable enolate/enamine (5-position) and gives the pyrrole pseudo-PBG. pseudo-PBG cannot self-condense, yet has one open α-pyrrole position and is proposed to be a terminator of oligopyrromethane chain-growth from PBG. Here, 23 analogues of ALA have been subjected to density functional theoretical (DFT) calculations, but no motif has been identified that directs reaction at the 3-position. Deuteriation experiments suggested 5-(phosphonooxy)levulinic acid would react preferentially at the 3- versus 5-position, but a hybrid condensation with ALA gave no observable uroporphyrin. The results suggest efforts toward a biomimetic, enzyme-free route to tetrapyrroles from ALA should turn away from structure-directed reactions and focus on catalysts that orient the two aminoketones to form PBG in a kinetically controlled process, thereby avoiding formation of pseudo-PBG.
Feng, Jian; Liu, Jian-Ping; Miao, Li; He, Guo-Xiang; Li, De; Wang, Hai-Dong; Jing, Tao
2014-10-01
Percutaneous coronary interventions (PCIs) are an effective treatment for obstructive coronary artery diseases. However, the procedure's success is limited by remodeling and formation of neointima. In the present study, we engineered rat mesenchymal stem cells (MSCs) to express type 2 angiotensin II receptor (AT2R) using a tetracycline-regulated system that can strictly regulate AT2R expression. We tested the ability of the modified MSCs to reduce neointima formation following arterial injury. We subjected rats to balloon injury, and reverse transcriptase polymerase chain reaction (RT-PCR) indicated no significant AT2R expression in normal rat arteries. Low expression of AT2R was observed at 28 days after balloon-induced injury. Interestingly, MSCs alone were unable to reduce neointimal hyperplasia after balloon-induced injury; after transplantation of modified MSCs, doxycycline treatment significantly upregulated neointimal AT2R expression and inhibited osteopontin mRNA expression, as well as neointimal formation. Taken together, these results suggest that transplantation of MSCs conditionally expressing AT2R could effectively suppress neointimal hyperplasia following balloon-induced injury. Therefore, MSCs with a doxycycline-controlled gene induction system may be useful for the management of arterial injury after PCI.
Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.
Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin
2014-12-08
The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Numerical study of two disks settling in an Oldroyd-B fluid: From periodic interaction to chaining
NASA Astrophysics Data System (ADS)
Pan, Tsorng-Whay; Glowinski, Roland
2017-12-01
In this article, we present a numerical study of the dynamics of two disks sedimenting in a narrow vertical channel filled with an Oldroyd-B fluid. Two kinds of particle dynamics are observed: (i) a periodic interaction between the two disks, and (ii) the formation of a two-disk chain. For the periodic interaction of the two disks, two different motions are observed: (a) the two disks stay far apart and interact periodically, and (b) the two disks interact closely and then far apart in a periodic way, like the drafting, kissing, and tumbling of two disks sedimenting in a Newtonian fluid, due to a weak elastic force. Concerning the formation of a two-disk chain occurring at higher values of the elasticity number, either a tilted chain or a vertical chain is observed. Our simulations show that, as expected, the values of the elasticity and Mach numbers are the determining factors concerning the particle chain formation and its orientation.
Numerical study of two disks settling in an Oldroyd-B fluid: From periodic interaction to chaining.
Pan, Tsorng-Whay; Glowinski, Roland
2017-12-01
In this article, we present a numerical study of the dynamics of two disks sedimenting in a narrow vertical channel filled with an Oldroyd-B fluid. Two kinds of particle dynamics are observed: (i) a periodic interaction between the two disks, and (ii) the formation of a two-disk chain. For the periodic interaction of the two disks, two different motions are observed: (a) the two disks stay far apart and interact periodically, and (b) the two disks interact closely and then far apart in a periodic way, like the drafting, kissing, and tumbling of two disks sedimenting in a Newtonian fluid, due to a weak elastic force. Concerning the formation of a two-disk chain occurring at higher values of the elasticity number, either a tilted chain or a vertical chain is observed. Our simulations show that, as expected, the values of the elasticity and Mach numbers are the determining factors concerning the particle chain formation and its orientation.
Zhao, Jun; Zhang, Baohong; Zhu, Jianwei; Nussinov, Ruth; Ma, Buyong
2018-06-01
Amyloid formation and deposition of immunoglobulin light-chain proteins in systemic amyloidosis (AL) cause major organ failures. While the κ light-chain is dominant (λ/κ=1:2) in healthy individuals, λ is highly overrepresented (λ/κ=3:1) in AL patients. The structural basis of the amyloid formation and the sequence preference are unknown. We examined the correlation between sequence and structural stability of dimeric variable domains of immunoglobulin light chains using molecular dynamics simulations of 24 representative dimer interfaces, followed by energy evaluation of conformational ensembles for 20 AL patients' light chain sequences. We identified a stable interface with displaced N-terminal residues, provides the structural basis for AL protein fibrils formation. Proline isomerization may cause the N-terminus to adopt amyloid-prone conformations. We found that λ light-chains prefer misfolded dimer conformation, while κ chain structures are stabilized by a natively folded dimer. Our study may facilitate structure-based small molecule and antibody design to inhibit AL. This article is part of a Special Issue entitled: Accelerating Precision Medicine through Genetic and Genomic Big Data Analysis edited by Yudong Cai & Tao Huang. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Nguyen, Hong T.; Smith, Tyler B.; Hoy, Robert S.; Karayiannis, Nikos Ch.
2015-10-01
We map out the solid-state morphologies formed by model soft-pearl-necklace polymers as a function of chain stiffness, spanning the range from fully flexible to rodlike chains. The ratio of Kuhn length to bead diameter (lK/r0) increases monotonically with increasing bending stiffness kb and yields a one-parameter model that relates chain shape to bulk morphology. In the flexible limit, monomers occupy the sites of close-packed crystallites while chains retain random-walk-like order. In the rodlike limit, nematic chain ordering typical of lamellar precursors coexists with close-packing. At intermediate values of bending stiffness, the competition between random-walk-like and nematic chain ordering produces glass-formation; the range of kb over which this occurs increases with the thermal cooling rate | T ˙ | implemented in our molecular dynamics simulations. Finally, values of kb between the glass-forming and rodlike ranges produce complex ordered phases such as close-packed spirals. Our results should provide a useful initial step in a coarse-grained modeling approach to systematically determining the effect of chain stiffness on the crystallization-vs-glass-formation competition in both synthetic and colloidal polymers.
NASA Astrophysics Data System (ADS)
Yau, Yu-Chyi; Peacor, Donald R.; Essene, Eric J.
1986-09-01
Amphiboles and pyroxenes occurring in the Salton Sea Geothermal Field were found to contain coherent intergrowths of chain silicates with other than double and single chain widths by using transmission and analytical electron microscopy. Both occur in the biotite zone at the temperature (depth) interval of 310° C (1,060 m) to 330° C (1,547m) which approximately corresponds to temperatures of the greenschist facies. The amphiboles occur as euhedral fibrous crystals occupying void space and are composed primarily of irregularly alternating (010) slabs of double or triple chains, with rare quadruple and quintuple chains. Primary crystallization from solution results in euhedral crystals. Clinopyroxenes formed mainly as a porefilling cement and subordinately as prismatic crystals coexisting with fibrous amphiboles. Fine lamellae of double and triple chains are irregularly intercalated with pyroxene. AEM analyses yield formulae (Ca1.8Mg2.9Fe1.9Mn0.1) Si8O21.8(OH)1.8 (310° C) and (Ca2.0Fe2.5Mg2.3) Si8O21.8 (OH)2.0 (330° C) for amphiboles and (Ca1.1Fe0.6Mg0.3) Si2O6 for clinopyroxene. Thermodynamic calculations at Pfluid=100 bar of equilibrium reactions of (1) 3 chlorite +10 calcite + 21 quartz = 3 actinolite + 2 clinozoisite + 8 H2O + 10 CO2 and (2) actinolite+ 3 calcite+ 2 quartz = 5 clinopyroxene + H2O + 3 CO2 using Mg-end member phases indicate that formation of amphibole and pyroxene require very water-rich conditions (X_{CO_2 } < 0.06) at temperatures below 330° C.
NASA Technical Reports Server (NTRS)
Ferris, James P.; Ertem, Goezen
1994-01-01
In an attempt to investigate the prebiotic formation of phosphodiester bond in RNA, we have studied the self condensation of 5'-phosphorimidazolide of adenosine (ImpA), in aqueous solutions containing 0.2 M sodium chloride and 0.075 M magnesium chloride at pH 8 using clay minerals as catalyst. In the presence of certain montmorillonites, oligomers containing up to ten monomer units in their chain were formed, while in control experiments, where no catalyst was added, the major product was 5',5'-diadenosine diphosphate, A(sup 5')ppA. In reactions carried out with ImpA: A(sup 5')ppA mixtures at 9:1 mole ratio, oligomers of the type A(sup 5')p(pA)(sub n) and (A(sup 5')p)(sub n)A(sup 5')ppA(pA)(sub n) formed at the expense of (pA)(sub n) type oligomers. Addition of A(sup 5')ppA to the reaction mixture increased the regiospecifity of 3',5'-link formation from 67% to 79%. The condensation of the 5'-phosphorimidazolide of cytidine, ImpC, was also carried out in the presence and absence of A(sup 5')ppA under the same conditions and oligomers containing up to twelve monomer units were obtained.
NASA Astrophysics Data System (ADS)
Erickson, M. H.; Jobson, B. T.
2010-12-01
To understand secondary organic aerosol formation it is important to observe the precursors. The large hydrocarbon species found in diesel exhaust is thought to be a major contributor to SOA formation in urban environments. A new method was developed utilizing a proton transfer reaction mass spectrometer (PTR-MS) to measure long chain alkanes (C12 and above). There are two issues involved in directly measuring these alkanes. Diesel exhaust is present in relatively low concentrations, which often close or below the limits of detection. A preconcentration system was built to collect a large sample to increase our signal to noise. Lab tests show that all the alkanes fragment to a common set of m/z values. Interferences from other species occur at these m/z values. To overcome this obstacle, the preconcentration system was operated to discriminate between VOCs and IVOCs. This will allow for minimal interference and better quantification of the alkanes. The PTR-MS was outfitted with a new sample system that contains two inlets to allow for the measurement of VOCs while the IVOCs are being collected, which means a wide range of SOA precursors can be measured. Results from the Carbonaceous Aerosol and Radiative Effects Study in Sacramento, CA will be presented.
Fate of bone marrow stromal cells in a syngenic model of bone formation.
Boukhechba, Florian; Balaguer, Thierry; Bouvet-Gerbettaz, Sébastien; Michiels, Jean-François; Bouler, Jean-Michel; Carle, Georges F; Scimeca, Jean-Claude; Rochet, Nathalie
2011-09-01
Bone marrow stromal cells (BMSCs) have been demonstrated to induce bone formation when associated to osteoconductive biomaterials and implanted in vivo. Nevertheless, their role in bone reconstruction is not fully understood and rare studies have been conducted to follow their destiny after implantation in syngenic models. The aim of the present work was to use sensitive and quantitative methods to track donor and recipient cells after implantation of BMSCs in a syngenic model of ectopic bone formation. Using polymerase chain reaction (PCR) amplification of the Sex determining Region Y (Sry) gene and in situ hybridization of the Y chromosome in parallel to histological analysis, we have quantified within the implants the survival of the donor cells and the colonization by the recipient cells. The putative migration of the BMSCs in peripheral organs was also analyzed. We show here that grafted cells do not survive more than 3 weeks after implantation and might migrate in peripheral lymphoid organs. These cells are responsible for the attraction of host cells within the implants, leading to the centripetal colonization of the biomaterial by new bone.
Catalytic routes and oxidation mechanisms in photoreforming of polyols
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sanwald, Kai E.; Berto, Tobias F.; Eisenreich, Wolfgang
2016-12-01
Photocatalytic reforming of biomass-derived oxygenates leads to H 2 generation and evolution of CO 2 via parallel formation of organic intermediates through anodic oxidations on a Rh/TiO 2 photocatalyst. The reaction pathways and kinetics in the photoreforming of C 3–C 6 polyols were explored. Polyols are converted via direct and indirect hole transfer pathways resulting in (i) oxidative rupture of C–C bonds, (ii) oxidation to a-oxygen functionalized aldoses and ketoses (carbonyl group formation) and (iii) light-driven dehydration. Direct hole transfer to chemisorbed oxygenates on terminal Ti(IV)-OH groups, generating alkoxy-radicals that undergo ß-C–C-cleavage, is proposed for the oxidative C–C rupture. Carbonylmore » group formation and dehydration are attributed to indirect hole transfer at surface lattice oxygen sites [Ti_ _ _O_ _ _Ti] followed by the generation of carbon-centered radicals. Polyol chain length impacts the contribution of the oxidation mechanisms favoring the C–C bond cleavage (internal preferred over terminal) as the dominant pathway with higher polyol carbon number.« less
A conserved catalytic residue in the ubiquitin-conjugating enzyme family
Wu, Pei-Ying; Hanlon, Mary; Eddins, Michael; Tsui, Colleen; Rogers, Richard S.; Jensen, Jane P.; Matunis, Michael J.; Weissman, Allan M.; Wolberger, Cynthia P.; Pickart, Cecile M.
2003-01-01
Ubiquitin (Ub) regulates diverse functions in eukaryotes through its attachment to other proteins. The defining step in this protein modification pathway is the attack of a substrate lysine residue on Ub bound through its C-terminus to the active site cysteine residue of a Ub-conjugating enzyme (E2) or certain Ub ligases (E3s). So far, these E2 and E3 cysteine residues are the only enzyme groups known to participate in the catalysis of conjugation. Here we show that a strictly conserved E2 asparagine residue is critical for catalysis of E2- and E2/RING E3-dependent isopeptide bond formation, but dispensable for upstream and downstream reactions of Ub thiol ester formation. In constrast, the strictly conserved histidine and proline residues immediately upstream of the asparagine are dispensable for catalysis of isopeptide bond formation. We propose that the conserved asparagine side chain stabilizes the oxyanion intermediate formed during lysine attack. The E2 asparagine is the first non-covalent catalytic group to be proposed in any Ub conjugation factor. PMID:14517261
Ohno, Yusuke; Nakamichi, Shota; Ohkuni, Aya; Kamiyama, Nozomi; Naoe, Ayano; Tsujimura, Hisashi; Yokose, Urara; Sugiura, Kazumitsu; Ishikawa, Junko; Akiyama, Masashi; Kihara, Akio
2015-01-01
A skin permeability barrier is essential for terrestrial animals, and its impairment causes several cutaneous disorders such as ichthyosis and atopic dermatitis. Although acylceramide is an important lipid for the skin permeability barrier, details of its production have yet to be determined, leaving the molecular mechanism of skin permeability barrier formation unclear. Here we identified the cytochrome P450 gene CYP4F22 (cytochrome P450, family 4, subfamily F, polypeptide 22) as the long-sought fatty acid ω-hydroxylase gene required for acylceramide production. CYP4F22 has been identified as one of the autosomal recessive congenital ichthyosis-causative genes. Ichthyosis-mutant proteins exhibited reduced enzyme activity, indicating correlation between activity and pathology. Furthermore, lipid analysis of a patient with ichthyosis showed a drastic decrease in acylceramide production. We determined that CYP4F22 was a type I membrane protein that locates in the endoplasmic reticulum (ER), suggesting that the ω-hydroxylation occurs on the cytoplasmic side of the ER. The preferred substrate of the CYP4F22 was fatty acids with a carbon chain length of 28 or more (≥C28). In conclusion, our findings demonstrate that CYP4F22 is an ultra-long-chain fatty acid ω-hydroxylase responsible for acylceramide production and provide important insights into the molecular mechanisms of skin permeability barrier formation. Furthermore, based on the results obtained here, we proposed a detailed reaction series for acylceramide production. PMID:26056268
Wang, Y; Wang, J; Gao, Y
2001-07-01
To observe and compare the expression pattern of Msx-1, Msx-2 mRNA during the different stages of hard tissue formation in the first mandibular molar of mouse and investigate the relationship between the two genes. First mandibular molar germs from 1, 3, 7 and 14-days old mouse were separated and reverse transcription-polymerase chain reaction was performed on the total RNA of them using Msx-1, Msx-2 specific primers separately. Expression of both genes were detected during the different stages of hard tissue formation in the mouse first mandibular molars, but there was some interesting differences in the quantitiy between the two genes. Msx-1 transcripts appeared at the 1 day postnatally, and increase through 3 day, 7 day, then maximally expressed at 14 days postnatally; while Msx-2 mRNA was seen and expressed maximally at the 3 days postnatally, then there was a gradual reduction at 7 days, and 14 days postnatally. The homeobox gene Msx-1, Msx-2 may play a role in the events of the hard tissue formation. The complementary expression pattern of them during the specific stage of hard tissue formation indicates that there may be some functional redundancy between them during the biomineralization.
Method for polymer synthesis in a reaction well
Brennan, Thomas M.
1998-01-01
A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).
Method for polymer synthesis in a reaction well
Brennan, T.M.
1998-09-29
A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Peroxisomal fatty acid oxidation as detected by H2O2 production in intact perfused rat liver.
Foerster, E C; Fährenkemper, T; Rabe, U; Graf, P; Sies, H
1981-01-01
1. H2O2 formation associated with the metabolism of added fatty acids was quantitatively determined in isolated haemoglobin-free perfused rat liver (non-recirculating system) by two different methods. 2. Organ spectrophotometry of catalase Compound I [Sies & Chance (1970) FEBS Lett. 11, 172-176] was used to detect H2O2 formation (a) by steady-state titration with added hydrogen donor, methanol or (b) by comparison of fatty-acid responses with those of the calibration compound, urate. 3. In the use of the peroxidatic reaction of catalase, [14C]methanol was added as hydrogen donor at an optimal concentration of 1 mM in the presence of 0.2 mM-L-methionine, and 14CO2 production rates were determined. 4. Results obtained by the different methods were similar. 5. The yield of H2O2 formation, expressed as the rate of H2O2 formation in relation to the rate of fatty-acid supply, was less than 1.0 in all cases, indicating that, regardless of chain length, less than one acetyl unit was formed per mol of added fatty acid by the peroxisomal system. In particular, the standard substrate used with isolated peroxisomal preparations (C16:0 fatty acid) gave low yield (close to zero). Long-chain monounsaturated fatty acids exhibit a relatively high yield of H2O2 formation. 6. The hypolipidaemic agent bezafibrate led to slightly increased yields for most of the acids tested, but the yield with oleate was decreased to one-half the original yield. 7. It is concluded that in the intact isolated perfused rat liver the assayable capacity for peroxisomal beta-oxidation is used to only a minor degree. However, the observed rates of H2O2 production with fatty acids can account for a considerable share of the endogenous H2O2 production found in the intact animal. PMID:7317011
NASA Astrophysics Data System (ADS)
Tong, Lifen; Wei, Renbo; Liu, Xiaobo
2017-01-01
A novel phthalonitrile end-capped polyarylene ether nitrile (PEN-Ph)/copper phthalocyanine (CuPc) nanocomposites which possesses crosslinking reaction combined with crystallization behaviour were prepared successfully through in-situ reaction and hot-compression. In the presence of copper ion, CuPc were formed through crosslinking reaction among the phthalonitrile at the end of the PEN-Ph main chain and 1, 3, 5-Tri-(3, 4-dicyanophenoxy) benzene (TPh). Besides, the formed CuPc can play the role of nucleating agent to improve the crystallinity of the polymers. The influence of the crosslinking reaction and crystallization behaviour were investigated. The results show that the crystallization and crosslinking coexist in the system at the same time. Scanning electron microscope (SEM) images show that the crystals of the PEN-Ph grow after the hot-compressing procedure. Moreover, the glass transition temperature (Tg) increases while the crystallinity declines slightly with the low amount of copper ions. The increase of Tg is mainly caused by the crosslinking reaction, indicating that the copper can be used as a crosslinking agent in this system. Due to formation of the CuPc and the crystallization behaviour, the dielectric constant increased as expected from 3.2 to 4.9 while the dielectric loss decreased. Therefore, the PEN-Ph/CuPc in-situ nanocomposites will have a good prospect for application in electronic field.
Kinks, loops, and protein folding, with protein A as an example
Krokhotin, Andrey; Liwo, Adam; Maisuradze, Gia G.; Niemi, Antti J.; Scheraga, Harold A.
2014-01-01
The dynamics and energetics of formation of loops in the 46-residue N-terminal fragment of the B-domain of staphylococcal protein A has been studied. Numerical simulations have been performed using coarse-grained molecular dynamics with the united-residue (UNRES) force field. The results have been analyzed in terms of a kink (heteroclinic standing wave solution) of a generalized discrete nonlinear Schrödinger (DNLS) equation. In the case of proteins, the DNLS equation arises from a Cα-trace-based energy function. Three individual kink profiles were identified in the experimental three-α-helix structure of protein A, in the range of the Glu16-Asn29, Leu20-Asn29, and Gln33-Asn44 residues, respectively; these correspond to two loops in the native structure. UNRES simulations were started from the full right-handed α-helix to obtain a clear picture of kink formation, which would otherwise be blurred by helix formation. All three kinks emerged during coarse-grained simulations. It was found that the formation of each is accompanied by a local free energy increase; this is expressed as the change of UNRES energy which has the physical sense of the potential of mean force of a polypeptide chain. The increase is about 7 kcal/mol. This value can thus be considered as the free energy barrier to kink formation in full α-helical segments of polypeptide chains. During the simulations, the kinks emerge, disappear, propagate, and annihilate each other many times. It was found that the formation of a kink is initiated by an abrupt change in the orientation of a pair of consecutive side chains in the loop region. This resembles the formation of a Bloch wall along a spin chain, where the Cα backbone corresponds to the chain, and the amino acid side chains are interpreted as the spin variables. This observation suggests that nearest-neighbor side chain–side chain interactions are responsible for initiation of loop formation. It was also found that the individual kinks are reflected as clear peaks in the principal modes of the analyzed trajectory of protein A, the shapes of which resemble the directional derivatives of the kinks along the chain. These observations suggest that the kinks of the DNLS equation determine the functionally important motions of proteins. PMID:24437917
Oka, Takeshi
2006-01-01
Protonated molecular hydrogen, H3+, is the simplest polyatomic molecule. It is the most abundantly produced interstellar molecule, next only to H2, although its steady state concentration is low because of its extremely high chemical reactivity. H3+ is a strong acid (proton donor) and initiates chains of ion-molecule reactions in interstellar space thus leading to formation of complex molecules. Here, I summarize the understandings on this fundamental species in interstellar space obtained from our infrared observations since its discovery in 1996 and discuss the recent observations and analyses of H3+ in the Central Molecular Zone near the Galatic center that led to a revelation of a vast amount of warm and diffuse gas existing in the region. PMID:16894171
Improved adhesion of Ni films on X-ray damaged polytetrafluoroethylene
NASA Technical Reports Server (NTRS)
Wheeler, D. R.; Pepper, S. V.
1981-01-01
The considered investigation shows that the adhesion of evaporated Ni on polytetrafluoroethylene (PTFE) is enhanced by irradiating the PTFE surface prior to evaporation. Evidence obtained with the aid of X-ray photoelectron spectroscopy is presented concerning the association of the enhanced adhesion with an interfacial chemical reaction. Evaporated Ni clearly adheres better to the X-ray damaged PTFE surface than to the undamaged surface. There is evidence that the improved adhesion is not related to the Ni-C bond, but rather to the NiF2. A possible mechanism which may be consistent with the data is the formation of a F-Ni-C complex, where C is a member of the polymer chain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bortinger, A.
1977-01-01
Chiral polymer-supported metal complexes were catalytically active in the hydroformylation of prochiral olefins, but they induced only small optical activity. All the optical rotations in 2-phenylpropanal, obtained by the hydroformylation of styrene, were positive. In studies of asymmetric hydroformylation with homogeneous catalysts, no correlation was found between the optical inductions and ligand structure. Polymer-supported platinum catalysts having similar structure to their homogeneous counterparts showed the same high selectivity toward the formation of straight-chain aldehyde (89-95%) as the homogeneous catalysts in the hydroformylation of 1-hexene. Aldehyde yields were low (up to 45%); no reduction to alcohol occurred.
A Fluorescent In Vitro Assay to Investigate Paralog-Specific SUMO Conjugation.
Eisenhardt, Nathalie; Chaugule, Viduth K; Pichler, Andrea
2016-01-01
Protein modification with the small ubiquitin-related modifier SUMO is a potent regulatory mechanism implicated in a variety of biological pathways. In vitro sumoylation reactions have emerged as a versatile tool to identify and characterize novel SUMO enzymes as well as their substrates. Here, we present detailed protocols for the purification and fluorescent labeling of mammalian SUMO paralogs for their application in sumoylation assays. These assays provide a fast readout for in vitro SUMO chain formation activity of E3 ligases in a paralog-specific manner. Finally, we critically analyze the application of fluorescent SUMO proteins to study substrate modification in vitro revealing also the drawbacks of the system.
The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics
NASA Astrophysics Data System (ADS)
McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.
2013-10-01
The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.
Understanding Trends in Autoignition of Biofuels: Homologous Series of Oxygenated C5 Molecules
Ciesielski, Peter N.; Robichaud, David J.; Kim, Seonah; ...
2017-07-05
Oxygenated biofuels provide a renewable, domestic source of energy that can enable adoption of advanced, high-efficiency internal combustion engines, such as those based on homogeneously charged compression ignition (HCCI). Of key importance to such engines is the cetane number (CN) of the fuel, which is determined by the autoignition of the fuel under compression at relatively low temperatures (550-800 K). For the plethora of oxygenated biofuels possible, it is desirable to know the ignition delay times and the CN of these fuels to help guide conversion strategies so as to focus efforts on the most desirable fuels. For alkanes, themore » chemical pathways leading to radical chain-branching reactions giving rise to low-temperature autoignition are well-known and are highly coincident with the buildup of reactive radicals such as OH. Key in the mechanisms leading to chain branching are the addition of molecular oxygen to alkyl radicals and the rearrangement and dissociation of the resulting peroxy radials. Prediction of the temperature and pressure dependence of reactions that lead to the buildup of reactive radicals requires a detailed understanding of the potential energy surfaces (PESs) of these reactions. In this study, we used quantum mechanical modeling to systematically compare the effects of oxygen functionalities on these PESs and associated kinetics so as to understand how they affect experimental trends in autoignition and CN. The molecules studied here include pentane, pentanol, pentanal, 2-heptanone, methylpentyl ether, methyl hexanoate, and pentyl acetate. All have a saturated five-carbon alkyl chain with an oxygen functional group attached to the terminal carbon atom. The results of our systematic comparison may be summarized as follows: (1) Oxygen functionalities activate C-H bonds by lowering the bond dissociation energy (BDE) relative to alkanes. (2) The R-OO bonds in peroxy radicals adjacent to carbonyl groups are weaker than corresponding alkyl systems, leading to dissociation of ROO radicals and reducing reactivity and hence CN. (3) Hydrogen atom transfer in peroxy radicals is important in autoignition, and low barriers for ethers and aldehydes lead to high CN. (4) Peroxy radicals formed from alcohols have low barriers to form aldehydes, which reduce the reactivity of the alkyl radical. In conclusion, these findings for the formation and reaction of alkyl radicals with molecular oxygen explain the trend in CN for these common biofuel functional groups.« less
Understanding Trends in Autoignition of Biofuels: Homologous Series of Oxygenated C5 Molecules
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ciesielski, Peter N.; Robichaud, David J.; Kim, Seonah
Oxygenated biofuels provide a renewable, domestic source of energy that can enable adoption of advanced, high-efficiency internal combustion engines, such as those based on homogeneously charged compression ignition (HCCI). Of key importance to such engines is the cetane number (CN) of the fuel, which is determined by the autoignition of the fuel under compression at relatively low temperatures (550-800 K). For the plethora of oxygenated biofuels possible, it is desirable to know the ignition delay times and the CN of these fuels to help guide conversion strategies so as to focus efforts on the most desirable fuels. For alkanes, themore » chemical pathways leading to radical chain-branching reactions giving rise to low-temperature autoignition are well-known and are highly coincident with the buildup of reactive radicals such as OH. Key in the mechanisms leading to chain branching are the addition of molecular oxygen to alkyl radicals and the rearrangement and dissociation of the resulting peroxy radials. Prediction of the temperature and pressure dependence of reactions that lead to the buildup of reactive radicals requires a detailed understanding of the potential energy surfaces (PESs) of these reactions. In this study, we used quantum mechanical modeling to systematically compare the effects of oxygen functionalities on these PESs and associated kinetics so as to understand how they affect experimental trends in autoignition and CN. The molecules studied here include pentane, pentanol, pentanal, 2-heptanone, methylpentyl ether, methyl hexanoate, and pentyl acetate. All have a saturated five-carbon alkyl chain with an oxygen functional group attached to the terminal carbon atom. The results of our systematic comparison may be summarized as follows: (1) Oxygen functionalities activate C-H bonds by lowering the bond dissociation energy (BDE) relative to alkanes. (2) The R-OO bonds in peroxy radicals adjacent to carbonyl groups are weaker than corresponding alkyl systems, leading to dissociation of ROO radicals and reducing reactivity and hence CN. (3) Hydrogen atom transfer in peroxy radicals is important in autoignition, and low barriers for ethers and aldehydes lead to high CN. (4) Peroxy radicals formed from alcohols have low barriers to form aldehydes, which reduce the reactivity of the alkyl radical. In conclusion, these findings for the formation and reaction of alkyl radicals with molecular oxygen explain the trend in CN for these common biofuel functional groups.« less
Zhang, Hengzhong; Waychunas, Glenn A.; Banfield, Jillian F.
2015-07-29
Nucleation is a fundamental step in crystal growth. Of environmental and materials relevance are reactions that lead to nucleation of iron oxyhydroxides in aqueous solutions. These reactions are difficult to study experimentally due to their rapid kinetics. Here, we used classical molecular dynamics simulations to investigate nucleation of iron hydroxide/oxyhydroxide nanoparticles in aqueous solutions. Results show that in a solution containing ferric ions and hydroxyl groups, iron–hydroxyl molecular clusters form by merging ferric monomers, dimers, and other oligomers, driven by strong affinity of ferric ions to hydroxyls. When deprotonation reactions are not considered in the simulations, these clusters aggregate tomore » form small iron hydroxide nanocrystals with a six-membered ring-like layered structure allomeric to gibbsite. By comparison, in a solution containing iron chloride and sodium hydroxide, the presence of chlorine drives cluster assembly along a different direction to form long molecular chains (rather than rings) composed of Fe–O octahedra linked by edge sharing. Further, in chlorine-free solutions, when deprotonation reactions are considered, the simulations predict ultimate formation of amorphous iron oxyhydroxide nanoparticles with local atomic structure similar to that of ferrihydrite nanoparticles. Overall, our simulation results reveal that nucleation of iron oxyhydroxide nanoparticles proceeds via a cluster aggregation-based nonclassical pathway.« less
Formation of mercury sulfide from Hg(II)−thiolate complexes in natural organic matter
Alain Manceau,; Cyprien Lemouchi,; Mironel Enescu,; Anne-Claire Gaillot,; Martine Lanson,; Valerie Magnin,; Pieter Glatzel,; Poulin, Brett; Ryan, Joseph N.; Aiken, George R.; Isabelle Gautier-Lunea,; Kathryn L. Nagy,
2015-01-01
Methylmercury is the environmental form of neurotoxic mercury that is biomagnified in the food chain. Methylation rates are reduced when the metal is sequestered in crystalline mercury sulfides or bound to thiol groups in macromolecular natural organic matter. Mercury sulfide minerals are known to nucleate in anoxic zones, by reaction of the thiol-bound mercury with biogenic sulfide, but not in oxic environments. We present experimental evidence that mercury sulfide forms from thiol-bound mercury alone in aqueous dark systems in contact with air. The maximum amount of nanoparticulate mercury sulfide relative to thiol-bound mercury obtained by reacting dissolved mercury and soil organic matter matches that detected in the organic horizon of a contaminated soil situated downstream from Oak Ridge, TN, in the United States. The nearly identical ratios of the two forms of mercury in field and experimental systems suggest a common reaction mechanism for nucleating the mineral. We identified a chemical reaction mechanism that is thermodynamically favorable in which thiol-bound mercury polymerizes to mercury–sulfur clusters. The clusters form by elimination of sulfur from the thiol complexes via breaking of mercury–sulfur bonds as in an alkylation reaction. Addition of sulfide is not required. This nucleation mechanism provides one explanation for how mercury may be immobilized, and eventually sequestered, in oxygenated surface environments.
Das, Debasis; Ellington, Benjamin; Paul, Bishwajit; Marsh, E. Neil G.
2014-01-01
The biosynthesis of long-chain aliphatic hydrocarbons, which are derived from fatty acids, is widespread in Nature. The last step in this pathway involves the decarbonylation of fatty aldehydes to the corresponding alkanes or alkenes. In cyanobacteria this is catalyzed by an aldehyde deformylating oxygenase. We have investigated the mechanism of this enzyme using substrates bearing an oxirane ring adjacent to the aldehyde carbon. The enzyme catalyzed the deformylation of these substrates to produce the corresponding oxiranes. Performing the reaction in D2O allowed the facial selectivity of proton addition to be examined by 1H-NMR spectroscopy. The proton is delivered with equal probability to either face of the oxirane ring, indicating the formation of an oxiranyl radical intermediate that is free to rotate during the reaction. Unexpectedly, the enzyme also catalyzes a side reaction in which oxiranyl-aldehydes undergo tandem deformylation to furnish alkanes two carbons shorter. We present evidence that this involves the rearrangement of the intermediate oxiranyl radical formed in the first step, resulting an aldehyde that is further deformylated in a second step. These observations provide support for a radical mechanism for deformylation and, furthermore, allow the lifetime of the radical intermediate to be estimated based on prior measurements of rate constants for the rearrangement of oxiranyl radicals. PMID:24313866
Design of new disulfide-based organic compounds for the improvement of self-healing materials.
Matxain, Jon M; Asua, José M; Ruipérez, Fernando
2016-01-21
Self-healing materials are a very promising kind of materials due to their capacity to repair themselves. Among others, diphenyl disulfide-based compounds (Ph2S2) appear to be among the best candidates to develop materials with optimum self-healing properties. However, few is known regarding both the reaction mechanism and the electronic structure that make possible such properties. In this vein, theoretical approaches are of great interest. In this work, we have carried out theoretical calculations on a wide set of different disulfide compounds, both aromatic and aliphatic, in order to elucidate the prevalent reaction mechanism and the necessary electronic conditions needed for improved self-healing properties. Two competitive mechanisms were considered, namely, the metathesis and the radical-mediated mechanism. According to our calculations, the radical-mediated mechanism is the responsible for this process. The formation of sulfenyl radicals strongly depends on the S-S bond strength, which can be modulated chemically by the use of proper derivatives. At this point, amino derivatives appear to be the most promising ones. In addition to the S-S bond strength, hydrogen bonding between disulfide chains seems to be relevant to favour the contact among disulfide units. This is crucial for the reaction to take place. The calculated hydrogen bonding energies are of the same order of magnitude as the S-S bond energies. Finally, reaction barriers have been analysed for some promising candidates. Two reaction mechanisms were compared, namely, the [2+2] metathesis reaction mechanism and the [2+1] radical-mediated mechanism. No computational evidence for the existence of any transition state for the metathesis mechanism was found, which indicates that the radical-mediated mechanism is the one responsible in the self-healing process of these materials. Interestingly, the calculated reaction barriers are around 10 kcal mol(-1) regardless the substituent employed. All these results suggest that the radical formation and the structural role of the hydrogen bonding prevale over kinetics. Having this in mind, as a conclusion, some new compounds are proposed for the design of future self-healing materials with improved features.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walser, Maggie L.; Dessiaterik, Yury; Laskin, Julia
2008-02-08
Secondary organic aerosol (SOA) particles formed from the ozone-initiated oxidation of limonene are characterized by high-resolution electrospray ionization mass spectrometry in both the positive and negative ion modes. The mass spectra reveal a large number of both monomeric (m/z < 300) and oligomeric (m/z > 300) products of oxidation. A combination of high resolving power (m/Δm ~60,000) and Kendrick mass defect analysis makes it possible to unambiguously determine the composition for hundreds of individual compounds in SOA samples. Van Krevelen analysis shows that the SOA compounds are heavily oxidized, with average O:C ratios of 0.43 and 0.50 determined from themore » positive and negative ion mode spectra, respectively. An extended reaction mechanism for the formation of the first generation SOA molecular components is proposed. The mechanism includes known isomerization and addition reactions of the carbonyl oxide intermediates generated during the ozonation of limonene, and numerous isomerization pathways for alkoxy radicals resulting from the decomposition of unstable carbonyl oxides. The isomerization reactions yield numerous products with a progressively increasing number of alcohol and carbonyl groups, whereas C-C bond scission reactions in alkoxy radicals shorten the carbon chain. Together these reactions yield a large number of isomeric products with broadly distributed masses. A qualitative agreement is found between the number and degree of oxidation of the predicted and measured reaction products in the monomer range.« less
Theoretical and computer models of detonation in solid explosives
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tarver, C.M.; Urtiew, P.A.
1997-10-01
Recent experimental and theoretical advances in understanding energy transfer and chemical kinetics have led to improved models of detonation waves in solid explosives. The Nonequilibrium Zeldovich - von Neumann - Doring (NEZND) model is supported by picosecond laser experiments and molecular dynamics simulations of the multiphonon up-pumping and internal vibrational energy redistribution (IVR) processes by which the unreacted explosive molecules are excited to the transition state(s) preceding reaction behind the leading shock front(s). High temperature, high density transition state theory calculates the induction times measured by laser interferometric techniques. Exothermic chain reactions form product gases in highly excited vibrational states,more » which have been demonstrated to rapidly equilibrate via supercollisions. Embedded gauge and Fabry-Perot techniques measure the rates of reaction product expansion as thermal and chemical equilibrium is approached. Detonation reaction zone lengths in carbon-rich condensed phase explosives depend on the relatively slow formation of solid graphite or diamond. The Ignition and Growth reactive flow model based on pressure dependent reaction rates and Jones-Wilkins-Lee (JWL) equations of state has reproduced this nanosecond time resolved experimental data and thus has yielded accurate average reaction zone descriptions in one-, two- and three- dimensional hydrodynamic code calculations. The next generation reactive flow model requires improved equations of state and temperature dependent chemical kinetics. Such a model is being developed for the ALE3D hydrodynamic code, in which heat transfer and Arrhenius kinetics are intimately linked to the hydrodynamics.« less
Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen
NASA Astrophysics Data System (ADS)
Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.
2017-12-01
The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.
Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping
2017-03-15
This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
Ledford, Chelsea; McMahon, Monica; Whitesell, Ashley; Khan, Ghalib; Kandagatla, Suneel K; Hurst, Dow P; Reggio, Patricia H; Raner, Gregory M
2017-02-01
To develop a model for binding and catalysis associated with the stimulation of 4-fluorophenol (4-FP) oxidation in the presence of long chain aldehydes by the enzymatic catalyst, cytochrome P450 BM3 -F87G. A variation of the Michaeli-Menten kinetic model was employed to describe interactions at the active site of the enzyme, along with computer aided modeling approaches. In addition to the hydroquinone product arising from de-fluorination of 4-FP, a second product (p-fluorocatechol) was also observed and, like the hydroquinone, its rate of formation increased in the presence of the aldehyde. When only aldehyde was present with the enzyme, BM3-F87G catalyzed its oxidation to the corresponding carboxylic acid; however, this activity was inhibited when 4-FP was added to the reaction. A 3D computer model of the active site containing both aldehyde and 4-FP was generated, guided by these kinetic observations. Finally, partitioning between the two phenolic products was examined with an emphasis on the conditions directing the initial epoxidation at either the 2,3- or 3,4-positions on the substrate. Temperature, reaction time, substrate concentration, and the structure of the aldehyde had no substantial effect on the overall product ratios, however the NADPH coupling efficiency decreased when unsaturated aldehydes were included, or when the temperature of the reaction was reduced. The unsaturated aldehyde, trans-2-decenal, stimulates BM3-F87G catalyzed oxidation of 4-fluorophenol through a cooperative active site binding mode that doesn't influence product distributions or coupling efficiencies, while 4-fluorophenol acts as a competitive inhibitor of aldehyde oxidation.
Zhao, Xiangbo; Khajo, Abdelahad; Jarrett, Sanchez; Suarez, Javier; Levitsky, Yan; Burger, Richard M.; Jarzecki, Andrzej A.; Magliozzo, Richard S.
2012-01-01
Catalase activity of the dual-function heme enzyme catalase-peroxidase (KatG) depends on several structural elements, including a unique adduct formed from covalently linked side chains of three conserved amino acids (Met-255, Tyr-229, and Trp-107, Mycobacterium tuberculosis KatG numbering) (MYW). Mutagenesis, electron paramagnetic resonance, and optical stopped-flow experiments, along with calculations using density functional theory (DFT) methods revealed the basis of the requirement for a radical on the MYW-adduct, for oxyferrous heme, and for conserved residues Arg-418 and Asp-137 in the rapid catalase reaction. The participation of an oxyferrous heme intermediate (dioxyheme) throughout the pH range of catalase activity is suggested from our finding that carbon monoxide inhibits the activity at both acidic and alkaline pH. In the presence of H2O2, the MYW-adduct radical is formed normally in KatG[D137S] but this mutant is defective in forming dioxyheme and lacks catalase activity. KatG[R418L] is also catalase deficient but exhibits normal formation of the adduct radical and dioxyheme. Both mutants exhibit a coincidence between MYW-adduct radical persistence and H2O2 consumption as a function of time, and enhanced subunit oligomerization during turnover, suggesting that the two mutations disrupting catalase turnover allow increased migration of the MYW-adduct radical to protein surface residues. DFT calculations showed that an interaction between the side chain of residue Arg-418 and Tyr-229 in the MYW-adduct radical favors reaction of the radical with the adjacent dioxyheme intermediate present throughout turnover in WT KatG. Release of molecular oxygen and regeneration of resting enzyme are thereby catalyzed in the last step of a proposed catalase reaction. PMID:22918833
Peller, L
1977-02-08
The free-energy change of phosphodiester bond formation from nucleoside triphosphates is more favorable than with nucleoside diphosphates as substrates. Base-stacking interactions can make significant contributions to both delta G degrees ' values. Pyrophosphate hydrolysis when it accompanies the former reaction dominates all thermodynamic considerations. Three experimental situations are discussed in which high-molecular-weight polynucleotides are synthesized without a strong driving force for covalent bond formation. For one of these, a kinetic scheme is presented which encompasses an early narrow Poisson distribution of chain lengths with ultimate passage to a disperse equilibrium population of chain sizes. Hydrolytic removal of pyrophosphate expands the time scale for this undesirable process by a factor of 10(9), while it enormously elevates the thermodynamic ceiling for the average degrees of polymerization in the other two examples. The electron micrographically revealed broad size population from an early study of partial replication of a T7 DNA template is found to adhere (fortuitously) to a disperse most probable representation. Some possible origins are examined for the branched structures in this product, as well as in a later investigation of replication of this nucleic acid. The achievement of both very high molecular weights and sharply peaked size distributions in polynucleotides synthesized in vitro will require coupling to inorganic pyrophosphatase action as in vivo.
Bossi, A; Whitcombe, M J; Uludag, Y; Fowler, S; Chianella, I; Subrahmanyam, S; Sanchez, I; Piletsky, S A
2010-05-15
A "grafting from" approach has been used for controlled deposition of cross-linked polymers by living radical polymerisation. Borosilicate glass was modified with N,N-diethylaminodithiocarbamoylpropyl(trimethoxy)silane, in order to confine the iniferter reactive groups solely at its surface, then placed in solution with monomers and cross-linker. The polymerisation was initiated by UV irradiation. Formation of the cross-linked polymers was studied in terms of time course of the reaction, type of monomers incorporated and influence of oxygen. Grafted surfaces were characterised by AFM, FT-IR, ellipsometry and contact angle measurements. The ability to control the grafted layer improved dramatically when the chain terminator agent, N,N-N',N'-tetraethyl thiuram disulphide (TED) was added. Upon irradiation TED increases the concentration of passive capping radicals and decreases the possibility of recombination of active macro-radicals, thus prolonging their lifetime. In the absence of TED the thickness of produced coatings was below 10 nm. TED added at different concentrations assisted in the formation of grafted layers of 10-130 nm thickness. Iniferter chemistry in the presence of TED can be used for growing nanometre-scale polymer layers on solid supports. It constitutes a robust general platform for controlled grafting and offer a general solution to address the needs of surface derivatisation in sensors technology. 2010 Elsevier B.V. All rights reserved.
Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo
2005-01-01
Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi
2013-10-17
Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.
Li 2S Film Formation on Lithium Anode Surface of Li–S batteries
Liu, Zhixiao; Bertolini, Samuel; Balbuena, Perla B.; ...
2016-02-02
The precipitation of lithium sulfide (Li 2S) on the Li metal anode surface adversely impacts the performance of lithium–sulfur (Li–S) batteries. In this work, a first-principles approach including density functional theory (DFT) and ab initio molecular dynamics (AIMD) simulations is employed to theoretically elucidate the Li 2S/Li metal surface interactions and the nucleation and growth of a Li 2S film on the anode surface due to long-chain polysulfide decomposition during battery operation. DFT analyses of the energetic properties and electronic structures demonstrate that a single molecule adsorption on Li surface releases energy forming chemical bonds between the S atoms andmore » Li atoms from the anode surface. Reaction pathways of the Li 2S film formation on Li metal surfaces are investigated based on DFT calculations. It is found that a distorted Li 2S (111) plane forms on a Li(110) surface and a perfect Li 2S (111) plane forms on a Li(111) surface. The total energy of the system decreases along the reaction pathway; hence Li 2S film formation on the Li anode surface is thermodynamically favorable. Finally, the calculated difference charge density of the Li 2S film/Li surface suggests that the precipitated film would interact with the Li anode via strong chemical bonds. AIMD simulations reveal the role of the anode surface structure and the origin of the Li 2S formation via decomposition of Li 2S 8 polysulfide species formed at the cathode side and dissolved in the electrolyte medium in which they travel to the anode side during battery cycling.« less
ESR study of electron reactions with esters and triglycerides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sevilla, M.D.; Morehouse, K.M.; Swarts, S.
1981-04-02
Reactions which occurred after electron attachment at 77K to a number of small carboxylic acid esters and triglycerides in an aqueous glass are reported. Most ester anions are found to decay on warming to form alkyl radicals by ..beta.. scission: RC(O/sup -/)OR' ..-->.. RCO/sub 2//sup -/ + R'.. The alkyl radical (R'.) produced by annealing is found to abstract hydrogen from the parent ester at an ..cap alpha..-carbon site, R'.+ R''CH/sub 2/CO/sub 2/R' ..-->.. R''CHCO/sub 2/R', or in the case of ethyl formate from the formate hydrogen, CH/sub 3/CH/sub 2/.+ HCO/sub 2/C/sub 2/H/sub 5/ ..-->.. C/sub 2/H/sub 6/ +.CO/sub 2/C/submore » 2/H/sub 5/. Results found for the methyl formate anion suggest hydrogen abstraction by the anion itself may compete with alkyl radical formation. The anion of the triglyceride triacetin is found to undergo an analogous mechanism to the ester anions producing the propane diol diester radical, .CH/sub 2/CH(Ac)CH/sub 2/(Ac), Ac = acetate. This species subsequently abstracts hydrogen from the parent compound to produce the ..cap alpha..-carbon radical, .CH/sub 2/CO/sub 2/R. Results found after annealing the tripropionin radical anion give evidence for abstraction from the ..cap alpha.. carbon in the propionate side groups producing CH/sub 3/CHCO/sub 2/R. Studies of a ..gamma..-irradiated ester (ethyl myristate) and two triglycerides (tripalmitin and tristearin) yield results which suggest that the mechanism of ester anion decay found in aqueous glasses applies to ..gamma..-irradiated neat long-chain esters and triglycerides. Results found in this work are compared to the results of product analysis.« less
Li 2S Film Formation on Lithium Anode Surface of Li–S batteries
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Zhixiao; Bertolini, Samuel; Balbuena, Perla B.
The precipitation of lithium sulfide (Li 2S) on the Li metal anode surface adversely impacts the performance of lithium–sulfur (Li–S) batteries. In this work, a first-principles approach including density functional theory (DFT) and ab initio molecular dynamics (AIMD) simulations is employed to theoretically elucidate the Li 2S/Li metal surface interactions and the nucleation and growth of a Li 2S film on the anode surface due to long-chain polysulfide decomposition during battery operation. DFT analyses of the energetic properties and electronic structures demonstrate that a single molecule adsorption on Li surface releases energy forming chemical bonds between the S atoms andmore » Li atoms from the anode surface. Reaction pathways of the Li 2S film formation on Li metal surfaces are investigated based on DFT calculations. It is found that a distorted Li 2S (111) plane forms on a Li(110) surface and a perfect Li 2S (111) plane forms on a Li(111) surface. The total energy of the system decreases along the reaction pathway; hence Li 2S film formation on the Li anode surface is thermodynamically favorable. Finally, the calculated difference charge density of the Li 2S film/Li surface suggests that the precipitated film would interact with the Li anode via strong chemical bonds. AIMD simulations reveal the role of the anode surface structure and the origin of the Li 2S formation via decomposition of Li 2S 8 polysulfide species formed at the cathode side and dissolved in the electrolyte medium in which they travel to the anode side during battery cycling.« less
Li2S Film Formation on Lithium Anode Surface of Li-S batteries.
Liu, Zhixiao; Bertolini, Samuel; Balbuena, Perla B; Mukherjee, Partha P
2016-02-01
The precipitation of lithium sulfide (Li2S) on the Li metal anode surface adversely impacts the performance of lithium-sulfur (Li-S) batteries. In this study, a first-principles approach including density functional theory (DFT) and ab initio molecular dynamics (AIMD) simulations is employed to theoretically elucidate the Li2S/Li metal surface interactions and the nucleation and growth of a Li2S film on the anode surface due to long-chain polysulfide decomposition during battery operation. DFT analyses of the energetic properties and electronic structures demonstrate that a single molecule adsorption on Li surface releases energy forming chemical bonds between the S atoms and Li atoms from the anode surface. Reaction pathways of the Li2S film formation on Li metal surfaces are investigated based on DFT calculations. It is found that a distorted Li2S (111) plane forms on a Li(110) surface and a perfect Li2S (111) plane forms on a Li(111) surface. The total energy of the system decreases along the reaction pathway; hence Li2S film formation on the Li anode surface is thermodynamically favorable. The calculated difference charge density of the Li2S film/Li surface suggests that the precipitated film would interact with the Li anode via strong chemical bonds. AIMD simulations reveal the role of the anode surface structure and the origin of the Li2S formation via decomposition of Li2S8 polysulfide species formed at the cathode side and dissolved in the electrolyte medium in which they travel to the anode side during battery cycling.
Lin, Jian; Qie, Meiying; Zhang, Linjuan; Wang, Xiaomei; Lin, Yuejian; Liu, Wei; Bao, Hongliang; Wang, Jianqiang
2017-11-20
Systematic control of the molar ratio between thorium hydroxides and selenic acid and their reaction temperature under hydrothermal conditions results in four novel thorium-based selenate complexes, namely, [Th 8 O 4 (OH) 8 (SeO 4 ) 6 (H 2 O) 16 ]·(SeO 4 ) 2 ·13H 2 O (Th-1), [Th 8 O 4 (OH) 8 (SeO 4 ) 8 (H 2 O) 13 ]·7H 2 O (Th-2), Th(OH) 2 (SeO 4 )H 2 O (Th-3), and Th 3 (SeO 4 ) 6 (H 2 O) 6 ·2.5H 2 O (Th-4), as well as the thorium mixed selenite selenate compound Th(SeO 3 )(SeO 4 ) (Th-5). Smaller [H 2 SeO 4 ]/[Th(IV)] ratio or lower temperature give rise to the formation of octameric [Th 8 (μ 3 -O) 4 (μ 2 -OH) 8 ] 16+ cores in Th-1/Th-2 and infinite [Th(μ 2 -OH) 2 H 2 O] 2+ chains in Th-3, respectively. Increasing the [H 2 SeO 4 ]/[Th(IV)] ratio or elevating the temperature generates a microporous (11.3 Å voids) open-framework Th-4, a monomeric thorium species without oxo/hydroxyl ligands, and a three-dimensional thorium structure Th-5. Formation of these compounds suggests that variables including acidity and temperature play a critical role in the hydrolysis and oligomerization of Th IV ions. Increasing acidity limits the deprotonation of water molecules and formation of nucleophilic hydroxo/oxo-aquo Th species, and high temperature appears to suppress the olation/oxolation hydrolysis reactions, which in both ways limit the formation of the thorium oligomers.
Single step, pH induced gold nanoparticle chain formation in lecithin/water system.
Sharma, Damyanti
2013-07-01
Gold nanoparticle (AuNP) chains have been formed by a single step method in a lecithin/water system where lecithin itself plays the role of a reductant and a template for AuNP chain formation. Two preparative strategies were explored: (1) evaporating lecithin solution with aqueous gold chloride (HAuCl4) at different pHs and (2) dispersing lecithin vesicles in aqueous HAuCl4 solutions of various pHs in the range of 2.5-11.3. In method 1, at initial pH 2.5, 20-50 nm AuNPs are found attached to lecithin vesicles. When pH is raised to 5.5 there are no vesicles present and 20 nm monodisperse particles are found aggregating. Chain formation of fine nanoparticles (3-5 nm) is observed from neutral to basic pH, between 6.5-10.3 The chains formed are hundreds of nanometers to micrometer long and are usually 2-3 nanoparticles wide. On further increasing pH to 11.3, particles form disk-like or raft-like structures. When method (ii) was used a little chain formation was observed. Most of the nanoparticles formed were found either sitting together as raft like structures or scattered on lecithin structures. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.
2015-07-01
Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.
A Bullet-Block Experiment that Explains the Chain Fountain
NASA Astrophysics Data System (ADS)
Pantaleone, J.; Smith, R.
2018-05-01
It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.
A Transmissible Plasmid Controlling Camphor Oxidation in Pseudomonas putida
Rheinwald, J. G.; Chakrabarty, A. M.; Gunsalus, I. C.
1973-01-01
Earlier papers demonstrated an extensive genetic exchange among fluorescent Pseudomonads; this one documents for genes specifying enzymes of peripheral dissimilation an extrachromosomal array, segregation, and frequent interstrain transfer. An hypothesis is presented of a general mechanism for the formation and maintenance of metabolic diversity. The example used, the path of oxidative cleavage of the carbocyclic rings of the bicyclic monoterpene D- and L-camphor, terminates in acetate release and isobutyrate chain debranching. By transduction, two gene linkage groups are shown for the reactions before and after isobutyrate. The group for reactions before isobutyrate is plasmid borne, contransferable by conjugation, mitomycin curable, and shows a higher segregation rate from cells that are multiplasmid rather than carrying a single plasmid. The genes that code for isobutyrate and essential anaplerotic and amphibolic metabolism are chromosomal. By conjugation plasmid-borne genes are transferred at a higher frequency than are chromosomal, and are transferred in homologous crosses more frequently than between heterologous species. Most isobutyrate-positive fluorescent pseudomonad strains will accept and express the camphor plasmid. PMID:4351810
Homochiral polymerization-driven selective growth of graphene nanoribbons
NASA Astrophysics Data System (ADS)
Sakaguchi, Hiroshi; Song, Shaotang; Kojima, Takahiro; Nakae, Takahiro
2017-01-01
The surface-assisted bottom-up fabrication of graphene nanoribbons (GNRs), which consists of the radical polymerization of precursors followed by dehydrogenation, has attracted attention because of the method's ability to control the edges and widths of the resulting ribbon. Although these reactions on a metal surface are believed to be catalytic, the mechanism has remained unknown. Here, we demonstrate 'conformation-controlled surface catalysis': the two-zone chemical vapour deposition of a 'Z-bar-linkage' precursor, which represents two terphenyl units linked in a 'Z' shape, results in the efficient formation of acene-type GNRs with a width of 1.45 nm through optimized cascade reactions. These precursors exhibit flexibility that allows them to adopt chiral conformations with height asymmetry on a Au(111) surface, which enables the production of self-assembled homochiral polymers in a chain with a planar conformation, followed by dehydrogenation via a conformation-controlled mechanism. This is conceptually analogous to enzymatic catalysis and will be useful for the fabrication of new nanocarbon materials.
The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...
Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio
2014-02-07
An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.
USDA-ARS?s Scientific Manuscript database
This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...
Concentration-dependence of the explosion characteristics of chlorine dioxide gas.
Jin, Ri-ya; Hu, Shuang-qi; Zhang, Yin-ghao; Bo, Tao
2009-07-30
The explosion characteristics of chlorine dioxide gas have been studied for the first time in a cylindrical exploder with a shell capacity of 20 L. The experimental results have indicated that the lower concentration limit for the explosive decomposition of chlorine dioxide gas is 9.5% ([ClO(2)]/[air]), whereas there is no corresponding upper concentration limit. Under the experimental conditions, and within the explosion limits, the pressure of explosion increases with increasing concentration of chlorine dioxide gas; the maximum pressure of explosion relative to the initial pressure was measured as 0.024 MPa at 10% ClO(2) and 0.641 MPa at 90% ClO(2). The induction time (the time from the moment of sparking to explosion) has also been found to depend on the concentration of chlorine dioxide gas; thus, at 10% ClO(2) the induction time was 2195 ms, but at 90% ClO(2) the induction time was just 8 ms. The explosion reaction mechanism of ClO(2) is of a degenerate chain-branching type involving the formation of a stable intermediate (Cl(2)O(3)), from which the chain-branching occurs. Chain initiation takes place at the point of ignition and termination takes place at the inner walls of the exploder.
Formation and structural phase transition in Co atomic chains on a Cu(775) surface
DOE Office of Scientific and Technical Information (OSTI.GOV)
Syromyatnikov, A. G.; Kabanov, N. S.; Saletsky, A. M.
The formation of Co atomic chains on a Cu(775) surface is investigated by the kinetic Monte Carlo method. It is found that the length of Co atomic chains formed as a result of self-organization during epitaxial growth is a random quantity and its mean value depends on the parameters of the experiment. The existence of two structural phases in atomic chains is detected using the density functional theory. In the first phase, the separations between an atom and its two nearest neighbors in a chain are 0.230 and 0.280 nm. In the second phase, an atomic chain has identical atomicmore » spacings of 0.255 nm. It is shown that the temperature of the structural phase transition depends on the length of the atomic chain.« less
Polymer-based microfluidic chips for isothermal amplification of nucleic acids
NASA Astrophysics Data System (ADS)
Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.
2017-11-01
Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.
Polymerase chain reaction with phase change as intrinsic thermal control
NASA Astrophysics Data System (ADS)
Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei
2013-04-01
This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.
Oxidation of phenolic acids by soil iron and manganese oxides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lehmann, R.G.; Cheng, H.H.; Harsh, J.B.
Phenolic acids are intermediary metabolites of many aromatic chemicals and may be involved in humus formation, allelopathy, and nutrient availability. Depending on their structures, six phenolic acids were shown to react at different rates with oxidized forms of Fe and Mn in a Palouse soil (fine-silty, mixed, mesic Pachic Ultic Haploxeroll). Increasing methoxy substitution on the aromatic ring of phenolic acids increased the reaction rate. Reaction rate was also increased for longer carboxyl-containing side chains. After 4 h reaction, little of the applied (10 mg kg/sup -1/ soil) p-hydroxybenzoic or p-coumaric acids had reacted, while 0 to 5, 70, 90,more » and 100% of the vanillic, ferulic, syringic, and sinapic acids, respectively, had reacted. After 72 h under conditions limiting microbial growth, none of the p-hydroxybenzoic, 30% of the p-coumaric, and 50% of the vanillic acids had reacted. The reaction was shown to be predominantly chemical, and not biological, since phenolic acid extractabilities were similar for Palouse soil and for Palouse soil pretreated with LiOBr to remove organic matter. When the Palouse soil was pretreated with a sodium dithionite-citrate solution to remove Fe and Mn oxides, none of the phenolic acids reacted after 1 h. The reaction of sinapic acid with Palouse soil was shown to produce Fe(II) and soluble Mn as reaction products. The reaction of phenolic acids with soil was thus shown to be an oxidation of the phenolic acids, coupled with a reduction of soil Fe and Mn oxides.« less
Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun
2014-05-28
3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.
Intact carbohydrate structures as part of the melanoidin skeleton.
Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W
2002-03-27
Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.
THE RADIATIVE NEUTRON CAPTURE ON 2H, 6Li, 7Li, 12C AND 13C AT ASTROPHYSICAL ENERGIES
NASA Astrophysics Data System (ADS)
Dubovichenko, Sergey; Dzhazairov-Kakhramanov, Albert; Burkova, Natalia
2013-05-01
The continued interest in the study of radiative neutron capture on atomic nuclei is due, on the one hand, to the important role played by this process in the analysis of many fundamental properties of nuclei and nuclear reactions, and, on the other hand, to the wide use of the capture cross-section data in the various applications of nuclear physics and nuclear astrophysics, and, also, to the importance of the analysis of primordial nucleosynthesis in the Universe. This paper is devoted to the description of results for the processes of the radiative neutron capture on certain light atomic nuclei at thermal and astrophysical energies. The consideration of these processes is done within the framework of the potential cluster model (PCM), general description of which was given earlier. The methods of usage of the results obtained, based on the phase shift analysis intercluster potentials, are demonstrated in calculations of the radiative capture characteristics. The considered capture reactions are not part of stellar thermonuclear cycles, but involve in the basic reaction chain of primordial nucleosynthesis in the course of the Universe formation.
Quéméneur, Marianne; Bes, Méline; Postec, Anne; Mei, Nan; Hamelin, Jérôme; Monnin, Christophe; Chavagnac, Valérie; Payri, Claude; Pelletier, Bernard; Guentas-Dombrowsky, Linda; Gérard, Martine; Pisapia, Céline; Gérard, Emmanuelle; Ménez, Bénédicte; Ollivier, Bernard; Erauso, Gaël
2014-12-01
The shallow submarine hydrothermal field of the Prony Bay (New Caledonia) discharges hydrogen- and methane-rich fluids with low salinity, temperature (< 40°C) and high pH (11) produced by the serpentinization reactions of the ultramafic basement into the lagoon seawater. They are responsible for the formation of carbonate chimneys at the lagoon seafloor. Capillary electrophoresis single-strand conformation polymorphism fingerprinting, quantitative polymerase chain reaction and sequence analysis of 16S rRNA genes revealed changes in microbial community structure, abundance and diversity depending on the location, water depth, and structure of the carbonate chimneys. The low archaeal diversity was dominated by few uncultured Methanosarcinales similar to those found in other serpentinization-driven submarine and subterrestrial ecosystems (e.g. Lost City, The Cedars). The most abundant and diverse bacterial communities were mainly composed of Chloroflexi, Deinococcus-Thermus, Firmicutes and Proteobacteria. Functional gene analysis revealed similar abundance and diversity of both Methanosarcinales methanoarchaea, and Desulfovibrionales and Desulfobacterales sulfate-reducers in the studied sites. Molecular studies suggest that redox reactions involving hydrogen, methane and sulfur compounds (e.g. sulfate) are the energy driving forces of the microbial communities inhabiting the Prony hydrothermal system.