Sample records for chain reaction functional

  1. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  2. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  3. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  4. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  5. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

    PubMed

    Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

    2014-02-21

    In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

  7. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  8. Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

    NASA Astrophysics Data System (ADS)

    Verma, Anand Mohan; Kishore, Nanda

    2017-02-01

    The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

  9. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  10. Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

    PubMed

    Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

    1995-01-01

    Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

  11. Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

    NASA Astrophysics Data System (ADS)

    Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

    Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

  12. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  13. Guaiacol hydrodeoxygenation mechanism on Pt(111): Insights from density functional theory and linear free energy relations

    USDA-ARS?s Scientific Manuscript database

    In this study density functional theory (DFT) was used to study the adsorption of guaiacol and its initial hydrodeoxygenation (HDO) reactions on Pt(111). Previously reported Brønsted–Evans–Polanyi (BEP) correlations for small open chain molecules are found to be inadequate in estimating the reaction...

  14. Spark Plasma Sintering for Nanostructured Smart Materials

    DTIC Science & Technology

    2009-03-02

    polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

  15. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  16. Catalytic and reactive polypeptides and methods for their preparation and use

    DOEpatents

    Schultz, Peter

    1994-01-01

    Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like.

  17. Polyisobutylene chain end transformations: Block copolymer synthesis and click chemistry functionalizations

    NASA Astrophysics Data System (ADS)

    Magenau, Andrew Jackson David

    The primary objectives of this research were twofold: (1) development of synthetic procedures for combining quasiliving carbocationic polymerization (QLCCP) of isobutylene (IB) and reversible addition fragmentation chain transfer (RAFT) polymerization for block copolymer synthesis; (2) utilization of efficient, robust, and modular chemistries for facile functionalization of polyisobutylene (PIB). In the first study block copolymers consisting of PIB, and either PMMA or PS block segments, were synthesized by a site transformation approach combining living cationic and reversible addition-fragmentation chain transfer (RAFT) polymerizations. The initial PIB block was synthesized via quasiliving cationic polymerization using the TMPCl/TiCl4 initiation system and was subsequently converted into a hydroxylterminated PIB. Site transformation of the hydroxyl-terminated PIB into a macro chain transfer agent (PIB-CTA) was accomplished by N,N'-dicyclohexylcarbodiimide/dimethylaminopyridine-catalyzed esterification with 4-cyano-4-(dodecylsulfanylthiocarbonylsulfanyl)pentanoic acid. In the second study another site transformation approach was developed to synthesize a novel block copolymer, composed of PIB and PNIPAM segments. The PIB block was prepared via quasiliving cationic polymerization and end functionalized by in-situ quenching to yield telechelic halogen-terminated PIB. Azido functionality was obtained by displacement of the terminal halogen through nucleophilic substitution, which was confirmed by both 1H and 13C NMR. Coupling of an alkyne-functional chain transfer agent (CTA) to azido PIB was successfully accomplished through a copper catalyzed click reaction. Structure of the resulting PIB-based macro-CTA was verified with 1H NMR, FTIR, and GPC; whereas coupling reaction kinetics were monitored by real time variable temperature (VT) 1H NMR. In a third study, a click chemistry functionalization procedure was developed based upon the azide-alkyne 1,3-dipolar cycloaddition reaction. 1-(o-Azidoalkyl)pyrrolyl-terminated PIB was successfully synthesized both by substitution of the terminal halide of 1-(o-haloalkyl)pyrrolyl-terminated PIB with sodium azide and by in situ quenching of quasiliving PIB with a 1-(o-azidoalkyl)pyrrole. GPC indicated the absence of coupled PIB under optimized conditions, confirming exclusive mono-substitution on each pyrrole ring. In a fourth study, radical thiol-ene hydrothiolation "Click" chemistry was explored and adapted to easily and rapidly modify exo -olefin PIB with an array of thiol compounds bearing useful functionalities, including primary halogen, primary amine, primary hydroxyl, and carboxylic acid. The thiol-ene "click" procedure was shown to be applicable to both mono and difunctional exo-olefin polyisobutylene. Telechelic mono- and difunctional exo-olefin PIBs were synthesized via quasiliving cationic polymerization followed by quenching with the hindered amine, 1,2,2,6,6-pentamethylpiperidine. Lower reaction temperatures were found to increase exo-olefin conversion to near quantitative amounts. In the fifth study, thiol-terminated polyisobutylene (PIB-SH) was synthesized by reaction of thiourea with alpha,o-bromine-terminated PIB in a three step one-pot procedure. First the alkylisothiouronium salt was produced using a 1:1 (v:v) DMF:heptane cosolvent mixture at 90°C. Hydrolysis of the salt by aqueous base produced thiolate chain ends, which were then acidified to form the desired thiol functional group. An extension of this reaction was performed by a sequential thiol-ene/thiol-yne procedure to produce tetra-hydroxy functionalized PIB. 1H NMR was used to confirm formation of both alkyne and tetrahydroxyl functional species. Further utility of PIB-SH was demonstrated by base catalyzed thiol-isocyanate reactions. A model reaction was conducted with phenyl isocyanate in THF using triethylamine as the catalyst. Last, conversion of PIB-SH directly into a RAFT macro-CTA was accomplished, as shown by 1H NMR, by treatment of PIB-SH with triethylamine in carbon disulfide and subsequent alkylation with 2-bromopropionic acid. (Abstract shortened by UMI.)

  18. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  19. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  20. Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

    PubMed

    Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

    2008-04-01

    Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

  1. Functionalization of multi-walled carbon nanotubes with thermo-responsive azide-terminated poly(N-isopropylacrylamide) via click reactions.

    PubMed

    Su, Xin; Shuai, Ya; Guo, Zanru; Feng, Yujun

    2013-04-18

    Covalently functionalized multi-walled carbon nanotubes (MWNTs) were prepared by grafting well-defined thermo-responsive poly(N-isopropylacrylamide) (PNIPAM) via click reactions. First, azide-terminated poly(N-isopropylacrylamide) (N3-PNIPAM) was synthesized by reversible addition fragmentation chain-transfer (RAFT) polymerization, and then the N₃-PNIPAM moiety was connected onto MWNTs by click chemistry. The products were characterized by means of FT-IR, TGA and TEM. The results show that the modification of MWNTs is very successful and MWNTs functionalized by N₃-PNIPAM (MWNTs-PNIPAM) have good solubility and stability in water. TEM images show the functionalized MWNTs are dispersed individually, indicating that the bundles of original MWNTs are separated into individual tubes by surface modification with polymer chains. These MWNTs modified with PNIPAM represent a potential nano-material for preparation of hydrophilic composite materials.

  2. Reaction pathways of propene pyrolysis.

    PubMed

    Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

    2010-05-01

    The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

  3. The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

    1990-05-01

    There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

  4. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Hua; Zhou, Feng; Ren, Gerui

    In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less

  6. Utilization of oxygen difluoride for syntheses of fluoropolymers

    NASA Technical Reports Server (NTRS)

    Toy, M. S. (Inventor)

    1976-01-01

    The reaction oxygen difluoride, OF2, with ethylenically unsaturated fluorocarbon compounds is examined. Depending upon the fluorocarbon material and reaction conditions, OF2 can chain extend fluoropolyenes, convert functional perfluorovinyl groups to acyl fluoride and/or epoxide groups, and act as a monomer for an addition type copolymerization with diolefins.

  7. Chemical reactions directed Peptide self-assembly.

    PubMed

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  8. Chemical Reactions Directed Peptide Self-Assembly

    PubMed Central

    Rasale, Dnyaneshwar B.; Das, Apurba K.

    2015-01-01

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

  9. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  10. Structure-Function of the Cytochrome b 6f Complex of Oxygenic Photosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cramer, W. A.; Yamashita, E.; Baniulis, D.

    2014-03-20

    Structure–function of the major integral membrane cytochrome b 6f complex that functions in cyanobacteria, algae, and green plants to transfer electrons between the two reaction center complexes in the electron transport chain of oxygenic photosynthesis is discussed in the context of recently obtained crystal structures of the complex and soluble domains of cytochrome f and the Rieske iron–sulfur protein. The energy-transducing function of the complex, generation of the proton trans-membrane electrochemical potential gradient, centers on the oxidation/reduction pathways of the plastoquinol/plastoquinone (QH 2/Q), the proton donor/acceptor within the complex. These redox reactions are carried out by five redox prosthetic groupsmore » embedded in each monomer, the high potential two iron–two sulfur cluster and the heme of cytochrome f on the electropositive side (p) of the complex, two noncovalently bound b-type hemes that cross the complex and the membrane, and a covalently bound c-type heme (c n) on the electronegative side (n). These five redox-active groups are organized in high- (cyt f/[2Fe–2S] and low-potential (hemes b p, b n, c n) electron transport pathways that oxidize and reduce the quinol and quinone on the p- and n-sides in a Q-cycle-type mechanism, while translocating as many as 2 H + to the p-side aqueous side for every electron transferred through the high potential chain to the photosystem I reaction center. The presence of heme c n and the connection of the n-side of the membrane and b 6f complex to the cyclic electron transport chain indicate that the Q cycle in the oxygenic photosynthetic electron transport chain differs from those connected to the bc 1 complex in the mitochondrial respiratory chain and the chain in photosynthetic bacteria. Inferences from the structure and C2 symmetry of the complex for the pathway of QH 2/Q transfer within the complex, problems posed by the presence of lipid in the inter-monomer cavity, and the narrow portal for QH2 passage through the p-side oxidation site proximal to the [2Fe–2S] cluster are discussed.« less

  11. Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

    PubMed

    Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

    2016-05-01

    A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Mechanism of the coupling of diazonium to single-walled carbon nanotubes and its consequences.

    PubMed

    Schmidt, Grégory; Gallon, Salomé; Esnouf, Stéphane; Bourgoin, Jean-Philippe; Chenevier, Pascale

    2009-01-01

    On the tube: The coupling of diazonium ions onto single-walled carbon nanotubes is shown to proceed through a radical chain reaction by kinetic analysis of the absorption peak drop (see picture). Radical species are also revealed by ESR. Metallic (m) nanotubes play a special catalytic role in the functionalization of semiconducting (sc) nanotubes.Due to its simplicity and versatility, diazonium coupling is the most widely used method for carbon nanotube (CNT) functionalization to increase CNT processability and add new functionalities. Yet, its mechanism is so far mostly unknown. Herein, we use kinetic analysis to shed light on this complex mechanism. A free-radical chain reaction is revealed by absorption spectroscopy and ESR. Metallic CNTs are shown to play an unexpected catalytic role. The step determining the selectivity towards metallic CNTs is identified by a Hammett correlation. A mechanistic model is proposed that predicts reactivity and selectivity as a function of diazonium electrophilicity and metallic-to-semiconducting CNT ratio, thus opening perspectives of controlled high-yield functionalization and purification.

  13. Precision synthesis of functional materials via RAFT polymerization and click-type chemical reactions

    NASA Astrophysics Data System (ADS)

    Flores, Joel Diez

    2011-12-01

    The need to tailor polymeric architectures with specific physico-chemical properties via the simplest, cleanest, and most efficient synthetic route possible has become the ultimate goal in polymer synthesis. Recent progress in macromolecular science, such as the discoveries of controlled/"living" free radical polymerization (CRP) methods, has brought about synthetic capabilities to prepare (co)polymers with advanced topologies, predetermined molecular weights, narrow molecular weight distributions, and precisely located functional groups. In addition, the establishment of click chemistry has redefined the selected few highly efficient chemical reactions that become highly useful in post-polymerization modification strategies. Hence, the ability to make well-defined topologies afforded by controlled polymerization techniques and the facile incorporation of functionalities along the chain via click-type reactions have yielded complex architectures, allowing the investigation of physical phenomena which otherwise could not be studied with systems prepared via conventional methods. The overarching theme of the research work described in this dissertation is the fusion of the excellent attributes of reversible addition-fragmentation chain transfer (RAFT) polymerization method, which is one of the CRP techniques, and click-type chemical reactions in the precision of synthesis of advanced functional materials. Chapter IV is divided into three sections. In Section I, the direct RAFT homopolymerization of 2-(acryloyloxy)ethyl isocyanate (AOI) and subsequent post-polymerization modifications are described. The polymerization conditions were optimized in terms of the choice of RAFT chain transfer agent (CTA), polymerization temperature and the reaction medium. Direct RAFT polymerization of AOI requires a neutral CTA, and relatively low reaction temperature to yield AOI homopolymers with low polydispersities. Efficient side-chain functionalization of PAOI homopolymers was achieved via reaction with model amine, thiol and alcohol compounds yielding urea, thiourethane and urethane derivatives, respectively. Reactions with amines and thiols (in the presence of base) were rapid, quantitative and efficient. However, the reaction with alcohols catalyzed by dibutyltin dilaurate (DBTDL) was relatively slow but proceeded to completion. Selective reaction pathways for the addition of difunctional ethanolamine and mercaptoethanol were also investigated. A related strategy is described in Section II wherein a hydroxyl-containing diblock copolymer precursor was transformed into a library of functional copolymers via two sequential post-polymerization modification reactions. A diblock copolymer scaffold, poly[(N,N-dimethylacrylamide)-b-( N-(2-hydroxyethyl)acrylamide] (PDMA-b-PHEA) was first prepared. The hydroxyl groups of the HEA block were then reacted with 2-(acryloyloxy)ethylisocyanate (AOI) and allylisocyanate (AI) resulting in acrylate- and allyl-functionalized copolymer precursors, respectively. The efficiencies of Michael-type and free radical thiol addition reactions were investigated using selected thiols having alkyl, aryl, hydroxyl, carboxylic acid, amine and amino acid functionalities. The steps of RAFT polymerization, isocyanate-hydroxyl coupling and thiol-ene addition are accomplished under mild conditions, thus offering facile and modular routes to synthesize functional copolymers. The synthesis and solution studies of pH- and salt-responsive triblock copolymer are described in Section III. This system is capable of forming self-locked micellar structures which may be controlled by changing solution pH as well as ionic strength. A triblock copolymer containing a permanently hydrophilic poly(N,N-dimethylacrylamide) (PDMA) outer block, a salt-sensitive zwitterionic poly(3[2-(N-methylacrylamido)ethyl dimethylammonio]propanesulfonate) (PMAEDAPS) middle block and a pH-responsive 3-acrylamido-3-methylbutanoic acid (PAMBA) core block was synthesized using aqueous RAFT polymerization. A facile formation of "self-locking" shell cross-linked micelles is achieved by changing solution pH and salt concentration. The reversible "self-locking" is attained from the interactions of zwitterionic groups in the middle block that constitutes the shell of the micelles. The structure slowly dissociates into unimers in 2-3 days at pH above the pKa of the PAMBA block.

  14. Peptidomimetics via copper-catalyzed azide-alkyne cycloadditions.

    PubMed

    Angell, Yu L; Burgess, Kevin

    2007-10-01

    This critical review concerns the impact of copper-mediated alkyne-azide cycloadditions on peptidomimetic studies. It discusses how this reaction has been used to insert triazoles into peptide chains, to link peptides to other functionalities (e.g. carbohydrates, polymers, and labels), and as a basis for evolution of less peptidic compounds as pharmaceutical leads. It will be of interest to those studying this click reaction, peptidomimetic secondary structure and function, and to medicinal chemists.

  15. SuFEx-Based Polysulfonate Formation from Ethenesulfonyl Fluoride-Amine Adducts

    DOE PAGES

    Wang, Hua; Zhou, Feng; Ren, Gerui; ...

    2017-05-18

    In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less

  16. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  17. Modular in situ-Functionalization Strategy: Multicomponent Polymerization via Palladium/Norbornene Cooperative Catalysis.

    PubMed

    Yoon, Ki-Young; Dong, Guangbin

    2018-05-23

    Herein, we report the palladium/norbornene cooperatively catalyzed polymerization, which simplifies synthesis of functional aromatic polymers, including conjugated polymers. Specifically, an A2B2C-type multicomponent polymerization is developed using ortho-amination/ipso-alkynylation reaction for preparing various amine-functionalized arylacetylene-containing polymers. Within a single catalytic cycle, the amine side-chains are site-selectively installed in situ via C-H activation during the polymerization process, which represents a major difference from conventional cross-coupling polymerizations. This in situ-functionalization strategy enables modular incorporation of functional side-chains from simple monomers, thereby conveniently affording a diverse range of functional polymers. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  19. Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions.

    PubMed

    Mailloux, Ryan J; Jin, Xiaolei; Willmore, William G

    2014-01-01

    Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling.

  20. Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

    PubMed

    He, Peng; He, Lin

    2009-07-13

    We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

  1. Chemoselective O-acylation of hydroxyamino acids and amino alcohols under acidic reaction conditions: History, scope and applications

    PubMed Central

    2015-01-01

    Summary Amino acids, whether natural, semisynthetic or synthetic, are among the most important and useful chiral building blocks available for organic chemical synthesis. In principle, they can function as inexpensive, chiral and densely functionalized starting materials. On the other hand, the use of amino acid starting materials routinely necessitates protective group chemistry, and in reality, large-scale preparations of even the simplest side-chain derivatives of many amino acids often become annoyingly strenuous due to the necessity of employing protecting groups, on one or more of the amino acid functionalities, during the synthetic sequence. However, in the case of hydroxyamino acids such as hydroxyproline, serine, threonine, tyrosine and 3,4-dihydroxyphenylalanine (DOPA), many O-acyl side-chain derivatives are directly accessible via a particularly expedient and scalable method not commonly applied until recently. Direct acylation of unprotected hydroxyamino acids with acyl halides or carboxylic anhydrides under appropriately acidic reaction conditions renders possible chemoselective O-acylation, furnishing the corresponding side-chain esters directly, on multigram-scale, in a single step, and without chromatographic purification. Assuming a certain degree of stability under acidic reaction conditions, the method is also applicable for a number of related compounds, such as various amino alcohols and the thiol-functional amino acid cysteine. While the basic methodology underlying this approach has been known for decades, it has evolved through recent developments connected to amino acid-derived chiral organocatalysts to become a more widely recognized procedure for large-scale preparation of many useful side-chain derivatives of hydroxyamino acids and related compounds. Such derivatives are useful in peptide chemistry and drug development, as amino acid amphiphiles for asymmetric catalysis, and as amino acid acrylic precursors for preparation of catalytically active macromolecular networks in the form of soluble polymers, crosslinked polymer beads or nanoparticulate systems. The objective of the present review is to increase awareness of the existence and convenience of this methodology, assess its competitiveness compared to newer and more elaborate procedures for chemoselective O-acylation reactions, spur its further development, and finally to chronicle the informative, but poorly documented history of its development. PMID:25977719

  2. DNA-Templated Polymerization of Side-Chain-Functionalized Peptide Nucleic Acid Aldehydes

    PubMed Central

    Kleiner, Ralph E.; Brudno, Yevgeny; Birnbaum, Michael E.; Liu, David R.

    2009-01-01

    The DNA-templated polymerization of synthetic building blocks provides a potential route to the laboratory evolution of sequence-defined polymers with structures and properties not necessarily limited to those of natural biopolymers. We previously reported the efficient and sequence-specific DNA-templated polymerization of peptide nucleic acid (PNA) aldehydes. Here, we report the enzyme-free, DNA-templated polymerization of side-chain-functionalized PNA tetramer and pentamer aldehydes. We observed that the polymerization of tetramer and pentamer PNA building blocks with a single lysine-based side chain at various positions in the building block could proceed efficiently and sequence-specifically. In addition, DNA-templated polymerization also proceeded efficiently and in a sequence-specific manner with pentamer PNA aldehydes containing two or three lysine side chains in a single building block to generate more densely functionalized polymers. To further our understanding of side-chain compatibility and expand the capabilities of this system, we also examined the polymerization efficiencies of 20 pentamer building blocks each containing one of five different side-chain groups and four different side-chain regio- and stereochemistries. Polymerization reactions were efficient for all five different side-chain groups and for three of the four combinations of side-chain regio- and stereochemistries. Differences in the efficiency and initial rate of polymerization correlate with the apparent melting temperature of each building block, which is dependent on side-chain regio- and stereochemistry, but relatively insensitive to side-chain structure among the substrates tested. Our findings represent a significant step towards the evolution of sequence-defined synthetic polymers and also demonstrate that enzyme-free nucleic acid-templated polymerization can occur efficiently using substrates with a wide range of side-chain structures, functionalization positions within each building block, and functionalization densities. PMID:18341334

  3. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  4. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  5. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  6. The Synergize effect of Chain extender to Phosporic acid catalyst to the ultimate property of Soy-Polyurethane

    NASA Astrophysics Data System (ADS)

    Elvistia Firdaus, Flora

    2016-04-01

    The polyurethanes (PUs) foam were made from vegetable oil; a soybean based polyol. The foams were categorized into flexible and semi rigid. This research is manufacturally designed polyurethane foams by a process requiring the reaction of mixture of 2, 4- and 2, 6-Toluene di Isocyanate isomers, soy polyol in the presence of other ingredients. The objective of this work was to functionalized soy-polyol using phosporic acid catalyst and chain extender, study their collaborative reaction in producing ultimate property of PU foam. Correlates the foam morphology images in accordance to mechanical properties of foams.

  7. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  8. Data on synthesis and thermo-mechanical properties of stimuli-responsive rubber materials bearing pendant anthracene groups.

    PubMed

    Manhart, Jakob; Ayalur-Karunakaran, Santhosh; Radl, Simone; Oesterreicher, Andreas; Moser, Andreas; Ganser, Christian; Teichert, Christian; Pinter, Gerald; Kern, Wolfgang; Griesser, Thomas; Schlögl, Sandra

    2016-12-01

    The photo-reversible [4πs+4πs] cycloaddition reaction of pendant anthracene moieties represents a convenient strategy to impart wavelength dependent properties into hydrogenated carboxylated nitrile butadiene rubber (HXNBR) networks. The present article provides the 1 H NMR data on the reaction kinetics of the side chain functionalization of HXNBR. 2-(Anthracene-9-yl)oxirane with reactive epoxy groups is covalently attached to the polymer side chain of HXNBR via ring opening reaction between the epoxy and the carboxylic groups. Along with the identification, 1 H NMR data on the quantification of the attached functional groups are shown in dependence on reaction time and concentration of 2-(anthracene-9-yl)oxirane. Changes in the modification yield are reflected in the mechanical properties and DMA data of photo-responsive elastomers are illustrated in dependence on the number of attached anthracene groups. DMA curves over repeated cycles of UV induced crosslinking ( λ >300 nm) and UV induced cleavage ( λ =254 nm) are further depicted, demonstrating the photo-reversibility of the thermo-mechanical properties. Interpretation and discussion of the data are provided in "Design and application of photo-reversible elastomer networks by using the [4πs+4πs] cycloaddition reaction of pendant anthracene groups" (Manhart et al., 2016) [1].

  9. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  10. Impact of Polymer Electrolyte Membrane Degradation Products on Oxygen Reduction Reaction Activity for Platinum Electrocatalysts

    DOE PAGES

    Christ, J. M.; Neyerlin, K. C.; Wang, H.; ...

    2014-10-30

    The impact of model membrane degradation compounds on the relevant electrochemical parameters for the oxygen reduction reaction (i.e. electrochemical surface area and catalytic activity), was studied for both polycrystalline Pt and carbon supported Pt electrocatalysts. Model compounds, representing previously published, experimentally determined polymer electrolyte membrane degradation products, were in the form of perfluorinated organic acids that contained combinations of carboxylic and/or sulfonic acid functionality. Perfluorinated carboxylic acids of carbon chain length C1 – C6 were found to have an impact on electrochemical surface area (ECA). The longest chain length acid also hindered the observed oxygen reduction reaction (ORR) performance, resultingmore » in a 17% loss in kinetic current (determined at 0.9 V). Model compounds containing sulfonic acid functional groups alone did not show an effect on Pt ECA or ORR activity. Lastly, greater than a 44% loss in ORR activity at 0.9V was observed for diacid model compounds DA-Naf (perfluoro(2-methyl-3-oxa-5-sulfonic pentanoic) acid) and DA-3M (perfluoro(4-sulfonic butanoic) acid), which contained both sulfonic and carboxylic acid functionalities.« less

  11. Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway.

    PubMed

    Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C; Siegel, Justin B

    2015-11-24

    The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5-C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products.

  12. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  13. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  14. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  15. Analysis of immunoglobulin heavy and light chain variable genes in post-transplant lymphoproliferative disorders.

    PubMed

    Capello, Daniela; Cerri, Michaela; Muti, Giuliana; Lucioni, Marco; Oreste, Pierluigi; Gloghini, Annunziata; Berra, Eva; Deambrogi, Clara; Franceschetti, Silvia; Rossi, Davide; Alabiso, Oscar; Morra, Enrica; Rambaldi, Alessandro; Carbone, Antonino; Paulli, Marco; Gaidano, Gianluca

    2006-12-01

    Post-transplant lymphoproliferative disorders (PTLD) derive from antigen-experienced B-cells and represent a major complication of solid organ transplantation. We characterized usage, mutation frequency and mutation pattern of immunoglobulin variable (IGV) gene rearrangements in 50 PTLD (polymorphic PTLD, n=10; diffuse large B-cell lymphoma, n=35; and Burkitt/Burkitt-like lymphoma, n=5). Among PTLD yielding clonal IGV amplimers, a functional IGV heavy chain (IGHV) rearrangement was found in 40/50 (80.0%) cases, whereas a potentially functional IGV light chain rearrangement was identified in 36/46 (78.3%) PTLD. By combining IGHV and IGV light chain rearrangements, 10/50 (20.0%) PTLD carried crippling mutations, precluding expression of a functional B-cell receptor (BCR). Immunohistochemistry showed detectable expression of IG light chains in only 18/43 (41.9%) PTLD. Failure to detect a functional IGV rearrangement associated with lack of IGV expression. Our data suggest that a large fraction of PTLD arise from germinal centre (GC)-experienced B-cells that display impaired BCR. Since a functional BCR is required for normal B-cell survival during GC transit, PTLD development may implicate rescue from apoptosis and expansion of B-cells that have failed the GC reaction. The high frequency of IGV loci inactivation appears to be a peculiar feature of PTLD among immunodeficiency-associated lymphoproliferations.

  16. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    PubMed

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  17. Effect of acyl chain length on selective biocatalytic deacylation on O-aryl glycosides and separation of anomers.

    PubMed

    Aggarwal, Neha; Arya, Anu; Mathur, Divya; Singh, Sukhdev; Tyagi, Abhilash; Kumar, Rajesh; Rana, Neha; Singh, Rajendra; Prasad, Ashok K

    2014-04-01

    It has been demonstrated that Lipozyme® TL IM (Thermomyces lanuginosus lipase immobilised on silica) can selectively deacylate the ester function involving the C-5' hydroxyl group of α-anomers over the other acyl functions of anomeric mixture of peracylated O-aryl α,β-D-ribofuranoside. The analysis of results of biocatalytic deacylation reaction revealed that the reaction time decreases with the increase in the acyl chain length from C1 to C4. The unique selectivity of Lipozyme® TL IM has been harnessed for the separation of anomeric mixture of peracylated O-aryl α,β-D-ribofuranosides, The lipase mediated selective deacylation methodology has been used for the synthesis of O-aryl α-D-ribofuranosides and O-aryl β-D-ribofuranosides in pure forms, which can be used as chromogenic substrate for the detection of pathogenic microbial parasites containing glycosidases. Copyright © 2014. Published by Elsevier Inc.

  18. Versatile Synthesis of Amino Acid Functional Polymers without Protection Group Chemistry.

    PubMed

    Brisson, Emma R L; Xiao, Zeyun; Franks, George V; Connal, Luke A

    2017-01-09

    The copolymerization of N-isopropylacrylamide (NiPAm) with aldehyde functional monomers facilitates postpolymerization functionalization with amino acids via reductive amination, negating the need for protecting groups. In reductive amination, the imine formed from the condensation reaction between an amine and an aldehyde is reduced to an amine. In this work, we categorize amino acids into four classes based on the functionality of their side chains (acidic, polar neutral, neutral, and basic) and use their amine groups in condensation reactions with aldehyde functional polymers. The dynamic nature of the imine as well as the versatility of reductive amination to functionalize a polymer with a range of amino acids is highlighted. In this manner, amino acid functional polymers are synthesized without the use of protecting groups with high yields, demonstrating the high functional group tolerance of carbonyl condensation chemistry and the subsequent reduction of the imine. Prior to the reduction of the imine bond, transimination reactions are used to demonstrate dynamic polymers that shuffle from a glycine- to a histidine-functional polymer.

  19. Significance of two distinct types of tryptophan synthase beta chain in Bacteria, Archaea and higher plants.

    PubMed

    Xie, Gary; Forst, Christian; Bonner, Carol; Jensen, Roy A

    2002-01-01

    Tryptophan synthase consists of two subunits, alpha and beta. Two distinct subgroups of beta chain exist. The major group (TrpEb_1) includes the well-studied beta chain of Salmonella typhimurium. The minor group of beta chain (TrpEb_2) is most frequently found in the Archaea. Most of the amino-acid residues important for catalysis are highly conserved between both TrpE subfamilies. Conserved amino-acid residues of TrpEb_1 that make allosteric contact with the TrpEa subunit (the alpha chain) are absent in TrpEb_2. Representatives of Archaea, Bacteria and higher plants all exist that possess both TrpEb_1 and TrpEb_2. In those prokaryotes where two trpEb genes coexist, one is usually trpEb_1 and is adjacent to trpEa, whereas the second is trpEb_2 and is usually unlinked with other tryptophan-pathway genes. TrpEb_1 is nearly always partnered with TrpEa in the tryptophan synthase reaction. However, by default at least six lineages of the Archaea are likely to use TrpEb_2 as the functional beta chain, as TrpEb_1 is absent. The six lineages show a distinctive divergence within the overall TrpEa phylogenetic tree, consistent with the lack of selection for amino-acid residues in TrpEa that are otherwise conserved for interfacing with TrpEb_1. We suggest that the standalone function of TrpEb_2 might be to catalyze the serine deaminase reaction, an established catalytic capability of tryptophan synthase beta chains. A coincident finding of interest is that the Archaea seem to use the citramalate pathway, rather than threonine deaminase (IlvA), to initiate the pathway of isoleucine biosynthesis.

  20. Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

    PubMed Central

    Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

    2014-01-01

    A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

  1. Efficient Homodifunctional Bimolecular Ring-Closure Method for Cyclic Polymers by Combining RAFT and Self-Accelerating Click Reaction.

    PubMed

    Qu, Lin; Sun, Peng; Wu, Ying; Zhang, Ke; Liu, Zhengping

    2017-08-01

    An efficient metal-free homodifunctional bimolecular ring-closure method is developed for the formation of cyclic polymers by combining reversible addition-fragmentation chain transfer (RAFT) polymerization and self-accelerating click reaction. In this approach, α,ω-homodifunctional linear polymers with azide terminals are prepared by RAFT polymerization and postmodification of polymer chain end groups. By virtue of sym-dibenzo-1,5-cyclooctadiene-3,7-diyne (DBA) as small linkers, well-defined cyclic polymers are then prepared using the self-accelerating double strain-promoted azide-alkyne click (DSPAAC) reaction to ring-close the azide end-functionalized homodifunctional linear polymer precursors. Due to the self-accelerating property of DSPAAC ring-closing reaction, this novel method eliminates the requirement of equimolar amounts of telechelic polymers and small linkers in traditional bimolecular ring-closure methods. It facilitates this method to efficiently and conveniently produce varied pure cyclic polymers by employing an excess molar amount of DBA small linkers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  3. Visualizing changes in electron distribution in coupled chains of cytochrome bc(1) by modifying barrier for electron transfer between the FeS cluster and heme c(1).

    PubMed

    Cieluch, Ewelina; Pietryga, Krzysztof; Sarewicz, Marcin; Osyczka, Artur

    2010-02-01

    Cytochrome c(1) of Rhodobacter (Rba.) species provides a series of mutants which change barriers for electron transfer through the cofactor chains of cytochrome bc(1) by modifying heme c(1) redox midpoint potential. Analysis of post-flash electron distribution in such systems can provide useful information about the contribution of individual reactions to the overall electron flow. In Rba. capsulatus, the non-functional low-potential forms of cytochrome c(1) which are devoid of the disulfide bond naturally present in this protein revert spontaneously by introducing a second-site suppression (mutation A181T) that brings the potential of heme c(1) back to the functionally high levels, yet maintains it some 100 mV lower from the native value. Here we report that the disulfide and the mutation A181T can coexist in one protein but the mutation exerts a dominant effect on the redox properties of heme c(1) and the potential remains at the same lower value as in the disulfide-free form. This establishes effective means to modify a barrier for electron transfer between the FeS cluster and heme c(1) without breaking disulfide. A comparison of the flash-induced electron transfers in native and mutated cytochrome bc(1) revealed significant differences in the post-flash equilibrium distribution of electrons only when the connection of the chains with the quinone pool was interrupted at the level of either of the catalytic sites by the use of specific inhibitors, antimycin or myxothiazol. In the non-inhibited system no such differences were observed. We explain the results using a kinetic model in which a shift in the equilibrium of one reaction influences the equilibrium of all remaining reactions in the cofactor chains. It follows a rather simple description in which the direction of electron flow through the coupled chains of cytochrome bc(1) exclusively depends on the rates of all reversible partial reactions, including the Q/QH2 exchange rate to/from the catalytic sites. 2009 Elsevier B.V. All rights reserved.

  4. Homoallylglycine residues are superior precursors to orthogonally modified thioether containing polypeptides.

    PubMed

    Perlin, Pesach; Gharakhanian, Eric G; Deming, Timothy J

    2018-06-12

    Homoallylglycine N-carboxyanhydride, Hag NCA, monomers were synthesized and used to prepare polypeptides containing Hag segments with controllable lengths of up to 245 repeats. Poly(l-homoallylglycine), GHA, was found to adopt an α-helical conformation, which provided good solubility in organic solvents and allowed high yield functionalization of its alkene side-chains via radical promoted addition of thiols. The conformations of these derivatives were shown to be switchable between α-helical and disordered states in aqueous media using thioether alkylation or oxidation reactions. Incorporation of GHA segments into block copolymers with poly(l-methionine), M, segments provided a means to orthogonally modify thioether side-chains different ways in separate copolypeptide domains. This approach allows preparation of functional polypeptides containing discrete domains of oxidized and alkylated thioether containing residues, where chain conformation and functionality of each domain can be independently modified.

  5. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  7. Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions☆

    PubMed Central

    Mailloux, Ryan J.; Jin, Xiaolei; Willmore, William G.

    2013-01-01

    Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling. PMID:24455476

  8. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  9. Copolymer Synthesis and Characterization by Post-Polymerization Modification

    NASA Astrophysics Data System (ADS)

    Galvin, Casey James

    This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

  10. Mechanism of Polyubiquitination by Human Anaphase-Promoting Complex: RING Repurposing for Ubiquitin Chain Assembly

    DOE PAGES

    Brown, Nicholas G.; Watson, Edmond R.; Weissmann, Florian; ...

    2014-10-09

    Polyubiquitination by E2 and E3 enzymes is a predominant mechanism regulating protein function. Some RING E3s, including anaphase-promoting complex/cyclosome (APC), catalyze polyubiquitination by sequential reactions with two different E2s. An initiating E2 ligates ubiquitin to an E3-bound substrate. Another E2 grows a polyubiquitin chain on the ubiquitin-primed substrate through poorly defined mechanisms. Here in this paper we show that human APC’s RING domain is repurposed for dual functions in polyubiquitination. The canonical RING surface activates an initiating E2-ubiquitin intermediate for substrate modification. However, APC engages and activates its specialized ubiquitin chain-elongating E2 UBE2S in ways that differ from current paradigms.more » During chain assembly, a distinct APC11 RING surface helps deliver a substrate-linked ubiquitin to accept another ubiquitin from UBE2S. Our data define mechanisms of APC/UBE2S-mediated polyubiquitination, reveal diverse functions of RING E3s and E2s, and provide a framework for understanding distinctive RING E3 features specifying ubiquitin chain elongation.« less

  11. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  12. Substrate Shuttling Between Active Sites of Uroporphyrinogen Decarboxylase in Not Required to Generate Coproporphyrinogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phillips, J.; Warby, C; Whitby, F

    2009-01-01

    Uroporphyrinogen decarboxylase (URO-D; EC 4.1.1.37), the fifth enzyme of the heme biosynthetic pathway, is required for the production of heme, vitamin B12, siroheme, and chlorophyll precursors. URO-D catalyzes the sequential decarboxylation of four acetate side chains in the pyrrole groups of uroporphyrinogen to produce coproporphyrinogen. URO-D is a stable homodimer, with the active-site clefts of the two subunits adjacent to each other. It has been hypothesized that the two catalytic centers interact functionally, perhaps by shuttling of reaction intermediates between subunits. We tested this hypothesis by construction of a single-chain protein (single-chain URO-D) in which the two subunits were connectedmore » by a flexible linker. The crystal structure of this protein was shown to be superimposable with wild-type activity and to have comparable catalytic activity. Mutations that impaired one or the other of the two active sites of single-chain URO-D resulted in approximately half of wild-type activity. The distributions of reaction intermediates were the same for mutant and wild-type sequences and were unaltered in a competition experiment using I and III isomer substrates. These observations indicate that communication between active sites is not required for enzyme function and suggest that the dimeric structure of URO-D is required to achieve conformational stability and to create a large active-site cleft.« less

  13. Poly(2-vinyl pyridine)-block-poly(ethylene oxide) featuring a furan group at the block junction-synthesis and functionalization.

    PubMed

    Rudolph, Tobias; Barthel, Markus J; Kretschmer, Florian; Mansfeld, Ulrich; Hoeppener, Stephanie; Hager, Martin D; Schubert, Ulrich S; Schacher, Felix H

    2014-05-01

    Furfuryl glycidyl ether (FGE) represents a highly versatile monomer for the preparation of reversibly cross-linkable nanostructured materials via Diels-Alder reactions. Here, the use of FGE for the mid-chain functionalization of a P2VP-b-PEO diblock copolymer is reported. The material features one furan moiety at the block junction, P2VP68 -FGE-b-PEO390 , which can be subsequently addressed in Diels-Alder reactions using maleimide-functionalized counterparts. The presence of the FGE moiety enables the introduction of dyes as model labels or the formation of hetero-grafted brushes as shell on hybrid Au@Polymer nanoparticles. This renders P2VP68 -FGE-b-PEO390 , a powerful tool for selective functionalization reactions, including the modification of surfaces. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. [Radiation therapy and redox imaging].

    PubMed

    Matsumoto, Ken-ichiro

    2015-01-01

    Radiation therapy kills cancer cells in part by flood of free radicals. Radiation ionizes and/or excites water molecules to create highly reactive species, i.e. free radicals and/or reactive oxygen species. Free radical chain reactions oxidize biologically important molecules and thereby disrupt their function. Tissue oxygen and/or redox status, which can influence the course of the free radical chain reaction, can affect the efficacy of radiation therapy. Prior observation of tissue oxygen and/or redox status is helpful for planning a safe and efficient course of radiation therapy. Magnetic resonance-based redox imaging techniques, which can estimate tissue redox status non-invasively, have been developed not only for diagnostic information but also for estimating the efficacy of treatment. Redox imaging is now spotlighted to achieve radiation theranostics.

  15. The Synthesis of Cellulose Graft Copolymers Using Cu(0)-Mediated Polymerization

    NASA Astrophysics Data System (ADS)

    Donaldson, Jason L.

    Cellulose is the most abundant renewable polymer on the planet and there is great interest in expanding its use beyond its traditional applications. However, its hydrophilicity and insolubility in most common solvent systems are obstacles to its widespread use in advanced materials. One way to counteract this is to attach hydrophobic polymer chains to cellulose: this allows the properties of the copolymer to be tailored by the molecular weight, density, and physical properties of the grafts. Two methods were used here to synthesize the graft copolymers: a 'grafting-from' approach, where synthetic chains were grown outward from bromoester moieties on cellulose (Cell-BiB) via Cu(0)-mediated polymerization; and a 'grafting-to' approach, where fully formed synthetic chains with terminal sulfide functionality were added to cellulose acetate with methacrylate functionality (CA-MAA) via thiol-ene Michael addition. The Cell-BiB was synthesized in the ionic liquid 1-butyl-3-methylimidazolium chloride and had a degree of substitution of 1.13. Polymerization from Cell-BiB proceeded at similar but slightly slower rate than an analogous non-polymeric initiator (EBiB). The average graft density of poly(methyl acrylate) chains was 0.71 chains/ring, with a maximum of 1.0 obtained. The graft density when grafting poly(methyl methacrylate) was only 0.15, and this appeared to be due to the slow initiation of BiB groups. Using EBiB to model the reaction and improve the design should allow this to be overcome. Chain extension experiments demonstrated the living behaviour of the polymer. The CA-MAA was synthesized by esterification with methacrylic acid. Reactions of CA-MAA with thiophenol and dodecanethiol resulted in quantitative addition of the thiol to the alkene. The grafts were synthesized by Cu(0)-mediated polymerization from a bifunctional initiator containing a disulfide bond, followed by reduction to sulfides. The synthetic polymers were successfully grafted to CA-MAA but the grafting yield was limited by the low sulfide functionality. Better retention of sulfide functionality is necessary for more efficient grafting.

  16. Expression and function of CD8 alpha/beta chains on rat and human mast cells.

    PubMed

    Kim, Mi-Sun; Kim, Sung-Hoon; Lee, Hye-Jung; Kim, Hyung-Min

    2004-03-01

    The expression and functional role of CD8 glycoprotein, a marker of cytotoxic/suppressor T lymphocytes and NK cells, were not studied on freshly isolated connective tissue type rat peritoneal mast cells, a rat mucosal type mast cell line (RBL 2H3), or human mast cell line (HMC-1). We used the reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis, immunohistochemistry and enzyme-linked immunosorbent assay. RT-PCR and Western blot analysis identified the presence of CD8 alpha/beta chains on the mast cells, and immunohistochemistry confirmed CD8alpha expression on rat or human mast cells. Functional studies demonstrated that stimulation of CD8 alpha/beta chains on rat mast cells induced the secretion of tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6), which are regarded as important mediators during infection. However, co-stimulation with stem cell factor had no effect on CD8-induced mediator secretion. Our findings demonstrate novel biological roles of CD8 molecules in mast cells.

  17. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  18. The Radical SAM enzyme NirJ catalyzes the removal of two propionate side chains during heme d1 biosynthesis.

    PubMed

    Boss, Linda; Oehme, Ramona; Billig, Susan; Birkemeyer, Claudia; Layer, Gunhild

    2017-12-01

    Heme d 1 is a modified tetrapyrrole playing an important role in denitrification by acting as the catalytically essential cofactor in the cytochrome cd 1 nitrite reductase of many denitrifying bacteria. In the course of heme d 1 biosynthesis, the two propionate side chains on pyrrole rings A and B of the intermediate 12,18-didecarboxysiroheme are removed from the tetrapyrrole macrocycle. In the final heme d 1 molecule, the propionate groups are replaced by two keto functions. Although it was speculated that the Radical S-adenosyl-l-methionine (SAM) enzyme NirJ might be responsible for the removal of the propionate groups and introduction of the keto functions, this has not been shown experimentally, so far. Here, we demonstrate that NirJ is a Radical SAM enzyme carrying two iron-sulfur clusters. While the N-terminal [4Fe-4S] cluster is essential for the initial SAM cleavage reaction, it is not required for substrate binding. NirJ tightly binds its substrate 12,18-didecarboxysiroheme and, thus, can be purified in complex with the substrate. By using the purified NirJ/substrate complex in an in vitro enzyme activity assay, we show that NirJ indeed catalyzes the removal of the two propionate side chains under simultaneous SAM cleavage. However, under the reaction conditions employed, no keto group formation is observed indicating that an additional cofactor or enzyme is needed for this reaction. © 2017 Federation of European Biochemical Societies.

  19. Magnetism in (Semi)Conducting Macrocycles of pi conjugated Polymers

    DTIC Science & Technology

    2016-12-09

    wise and avoiding a break in the continuity of the macrocycle. As a first criterion we tested the continuity of the electron orbitals over the...magnesium chloride) and post polymerization functionalization by a Sonogashira coupling reaction is required (scheme 2). Scheme 2: Synthetic...Sonogashira post - polymerization chain end functionalization and B isotopic model of the different population present in the final batch

  20. Bioelectrochemical Systems Workshop:Standardized Analyses, Design Benchmarks, and Reporting

    DTIC Science & Technology

    2012-01-01

    related to the exoelectrogenic biofilm activity, and to investigate whether the community structure is a function of design and operational parameters...where should biofilm samples be collected? The most prevalent methods of community characterization in BES studies have entailed phylogenetic ...of function associated with this genetic marker, and in methods that involve polymerase chain reaction (PCR) amplification the quantitative

  1. High fluorescence emission of carboxylic acid functionalized polystyrene/BaTiO{sub 3} nanocomposites and rare earth metal complexes: Preparation and characterization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao, X. T.; Showkat, A. M.; Wang, Z.

    2015-03-30

    Noble fluorescence nanocomposite compound based on barium titanate nanoparticles (BTO), polystyrene (PSt), and terbium ion (Tb{sup 3+}) was synthesized by a combination of surface-initiated reversible addition-fragmentation chain transfer (RAFT) polymerization, Friedel-Crafts alkylation reaction and coordinate chemistry. Initially, a modification of surface of BTO was conducted by an exchange process with S-benzyl S’-trimethoxysilylpropyltrithiocarbonate to create macro-initiator for polymerization of styrene. Subsequently, aryl carboxylic acid functionalized polystyrene grafted barium titanate (BTO-g-PSt-COOH) was generated by substitution reaction between 4-(Chloromethyl) benzoic acid and PSt chains. The coordination of the nanohybrids with Tb{sup 3+} ions afforded fluorescent Tb{sup 3+} tagged aryl carboxylic acid functionalized polystyrenemore » grafted barium titanate (BTO-g-PSt-Tb{sup 3+}) complexes. Structure, morphology, and fluorescence properties of nanohybrid complexes were investigated by respective physical and spectral studies. FT-IR and SEM analyses confirmed the formation of BTO-g-PSt-Tb{sup 3+}nanohybrids. Furthermore, TGA profiles demonstrated the grafting of aryl carboxylic acid functionalized polystyrene on BTO surface. Optical properties of BTO-g-PSt-Tb{sup 3+} complexes were investigated by fluorescence spectroscopy.« less

  2. Catalytic and reactive polypeptides and methods for their preparation and use

    DOEpatents

    Schultz, Peter

    1994-01-01

    Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like. This invention was made with Government support under Grant Contract No. AI-24695, awarded by the Department of health and Human Services, and under Grant Contract No. N 00014-87-K-0256, awarded by the Office of Naval Research. The Government has certain rights in this invention.

  3. Irreversible Heavy Chain Transfer to Chondroitin*

    PubMed Central

    Lauer, Mark E.; Hascall, Vincent C.; Green, Dixy E.; DeAngelis, Paul L.; Calabro, Anthony

    2014-01-01

    We have recently demonstrated that the transfer of heavy chains (HCs) from inter-α-inhibitor, via the enzyme TSG-6 (tumor necrosis factor-stimulated gene 6), to hyaluronan (HA) oligosaccharides is an irreversible event in which subsequent swapping of HCs between HA molecules does not occur. We now describe our results of HC transfer experiments to chondroitin sulfate A, chemically desulfated chondroitin, chemoenzymatically synthesized chondroitin, unsulfated heparosan, heparan sulfate, and alginate. Of these potential HC acceptors, only chemically desulfated chondroitin and chemoenzymatically synthesized chondroitin were HC acceptors. The kinetics of HC transfer to chondroitin was similar to HA. At earlier time points, HCs were more widely distributed among the different sizes of chondroitin chains. As time progressed, the HCs migrated to lower molecular weight chains of chondroitin. Our interpretation is that TSG-6 swaps the HCs from the larger, reversible sites on chondroitin chains, which function as HC acceptors, onto smaller chondroitin chains, which function as irreversible HC acceptors. HCs transferred to smaller chondroitin chains were unable to be swapped off the smaller chondroitin chains and transferred to HA. HCs transferred to high molecular weight HA were unable to be swapped onto chondroitin. We also present data that although chondroitin was a HC acceptor, HA was the preferred acceptor when chondroitin and HA were in the same reaction mixture. PMID:25135638

  4. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  5. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  6. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  7. Free energy landscapes of short peptide chains using adaptively biased molecular dynamics

    NASA Astrophysics Data System (ADS)

    Karpusenka, Vadzim; Babin, Volodymyr; Roland, Christopher; Sagui, Celeste

    2009-03-01

    We present the results of a computational study of the free energy landscapes of short polypeptide chains, as a function of several reaction coordinates meant to distinguish between several known types of helices. The free energy landscapes were calculated using the recently developed adaptively biased molecular dynamics method followed up with equilibrium ``umbrella correction'' runs. Specific polypeptides investigated include small chains of pure and mixed alanine, glutamate, leucine, lysine and methionine (all amino acids with strong helix-forming propensities), as well as glycine, proline(having a low helix forming propensities), tyrosine, serine and arginine. Our results are consistent with the existing experimental and other theoretical evidence.

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  11. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  12. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  13. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  14. Rational steering of insulin binding specificity by intra-chain chemical crosslinking

    NASA Astrophysics Data System (ADS)

    Viková, Jitka; Collinsová, Michaela; Kletvíková, Emília; Buděšínský, Miloš; Kaplan, Vojtěch; Žáková, Lenka; Veverka, Václav; Hexnerová, Rozálie; Aviñó, Roberto J. Tarazona; Straková, Jana; Selicharová, Irena; Vaněk, Václav; Wright, Daniel W.; Watson, Christopher J.; Turkenburg, Johan P.; Brzozowski, Andrzej M.; Jiráček, Jiří

    2016-01-01

    Insulin is a key hormone of human metabolism with major therapeutic importance for both types of diabetes. New insulin analogues with more physiological profiles and better glycemic control are needed, especially analogues that preferentially bind to the metabolic B-isoform of insulin receptor (IR-B). Here, we aimed to stabilize and modulate the receptor-compatible conformation of insulin by covalent intra-chain crosslinking within its B22-B30 segment, using the CuI-catalyzed Huisgen 1,3-dipolar cycloaddition reaction of azides and alkynes. This approach resulted in 14 new, systematically crosslinked insulin analogues whose structures and functions were extensively characterized and correlated. One of the analogues, containing a B26-B29 triazole bridge, was highly active in binding to both IR isoforms, with a significant preference for IR-B. Our results demonstrate the potential of chemistry-driven modulation of insulin function, also shedding new light on the functional importance of hormone’s B-chain C-terminus for its IR-B specificity.

  15. Synthesis of well-defined bisbenzoin end-functionalized poly(ε-caprolactone) macrophotoinitiator by combination of ROP and click chemistry and its use in the synthesis of star copolymers by photoinduced free radical promoted cationic polymerization

    PubMed Central

    Uyar, Zafer; Degirmenci, Mustafa; Genli, Nasrettin; Yilmaz, Ayse

    2017-01-01

    Abstract A new well-defined bisbenzoin group end-functionalized poly(ε-caprolactone) macrophotoinitiator (PCL-(PI)2) was synthesized by combination of ring opening polymerization (ROP) and click chemistry. The ROP of ε-CL monomer in bulk at 110 °C, by means of a hydroxyl functional initiator namely, 3-cyclohexene-1-methanol in conjunction with stannous-2-ethylhexanoate, (Sn(Oct)2), yielded a well-defined PCL with a cyclohexene end-chain group (PCL-CH). The bromination and subsequent azidation of the cyclohexene end-chain group gave bisazido functionalized poly(ε-caprolactone) (PCL-(N3)2). Separately, an acetylene functionalized benzoin photoinitiator (PI-alkyne) was synthesized by using benzoin and propargyl bromide. Then the click reaction between PCL-(N3)2 and PI-alkyne was performed by Cu(I) catalysis. The spectroscopic studies revealed that poly(ε-caprolactone) with bisbenzoin photoactive functional group at the chain end (PCL-(PI)2) with controlled chain length and low-polydispersity was obtained. This PCL-(PI)2 macrophotoinitiator was used as a precursor in photoinduced free radical promoted cationic polymerization to synthesize an AB2-type miktoarm star copolymer consisting of poly(ε-caprolactone) (PCL, as A block) and poly(cyclohexene oxide) (PCHO, as B block), namely PCL(PCHO)2. PMID:29491778

  16. The long underestimated carbonyl function of carbohydrates – an organocatalyzed shot into carbohydrate chemistry.

    PubMed

    Mahrwald, R

    2015-09-21

    The aggressive and strong development of organocatalysis provides several protocols for the convenient utilization of the carbonyl function of unprotected carbohydrates in C-C-bond formation processes. These amine-catalyzed mechanisms enable multiple cascade-protocols for the synthesis of a wide range of carbohydrate-derived compound classes. Several, only slightly different protocols, have been developed for the application of 1,3-dicarbonyl compounds in the stereoselective chain-elongation of unprotected carbohydrates and the synthesis of highly functionalized C-glycosides of defined configuration. In addition, C-glycosides can also be accessed by amine-catalyzed reactions with methyl ketones. By a one-pot cascade reaction of isocyanides with unprotected aldoses and amino acids access to defined configured glycopeptide mimetics is achieved. Depending on the reaction conditions different origins to control the installation of configuration during the bond-formation process were observed.

  17. Structure-guided mutational analysis of the nucleotidyltransferase domain of Escherichia coli NAD+-dependent DNA ligase (LigA).

    PubMed

    Zhu, Hui; Shuman, Stewart

    2005-04-01

    NAD+-dependent DNA ligase (LigA) is essential for bacterial growth and a potential target for antimicrobial drug discovery. Here we queried the role of 14 conserved amino acids of Escherichia coli LigA by alanine scanning and thereby identified five new residues within the nucleotidyltransferase domain as being essential for LigA function in vitro and in vivo. Structure activity relationships were determined by conservative mutagenesis for the Glu-173, Arg-200, Arg-208, and Arg-277 side chains, as well as four other essential side chains that had been identified previously (Lys-115, Asp-117, Asp-285, and Lys-314). In addition, we identified Lys-290 as important for LigA activity. Reference to the structure of Enterococcus faecalis LigA allowed us to discriminate three classes of essential/important side chains that: (i) contact NAD+ directly (Lys-115, Glu-173, Lys-290, and Lys-314); (ii) comprise the interface between the NMN-binding domain (domain Ia) and the nucleotidyltransferase domain or comprise part of a nick-binding site on the surface of the nucleotidyltransferase domain (Arg-200 and Arg-208); or (iii) stabilize the active site fold of the nucleotidyltransferase domain (Arg-277). Analysis of mutational effects on the isolated ligase adenylylation and phosphodiester formation reactions revealed different functions for essential side chains at different steps of the DNA ligase pathway, consistent with the proposal that the active site is serially remodeled as the reaction proceeds.

  18. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guan, Jiwen; Song, Yang, E-mail: yang.song@uwo.ca; Department of Chemistry, University of Western Ontario, London, Ontario N6A 5B7

    The polymerization process of condensed styrene to produce polystyrene as an industrially important polymeric material was investigated using a novel approach by combining external compression with ultraviolet radiation. The reaction evolution was monitored as a function of time and the reaction products were characterized by in situ Fourier transform infrared spectroscopy. By optimizing the loading pressures, we observed highly efficient and selective production of polystyrene of different tacticities. Specifically, at relatively low loading pressures, infrared spectra suggest that styrene monomers transform to amorphous atactic polystyrene (APS) with minor crystalline isotactic polystyrene. In contrast, APS was found to be the solemore » product when polymerization occurs at relatively higher loading pressures. The time-dependent reaction profiles allow the examination of the polymerization kinetics by analyzing the rate constant and activation volume as a function of pressure. As a result, an optimized pressure condition, which allows a barrierless reaction to proceed, was identified and attributed to the very desirable reaction yield and kinetics. Finally, the photoinitiated reaction mechanism and the growth geometry of the polymer chains were investigated from the energy diagram of styrene and by the topology analysis of the crystal styrene. This study shows strong promise to produce functional polymeric materials in a highly efficient and controlled manner.« less

  20. Hydrophobic Coatings by Thiol-Ene Click Functionalization of Silsesquioxanes with Tunable Architecture.

    PubMed

    Dirè, Sandra; Bottone, Davide; Callone, Emanuela; Maniglio, Devid; Génois, Isabelle; Ribot, François

    2017-08-08

    The hydrolysis-condensation of trialkoxysilanes under strictly controlled conditions allows the production of silsesquioxanes (SSQs) with tunable size and architecture ranging from ladder to cage-like structures. These nano-objects can serve as building blocks for the preparation of hybrid organic/inorganic materials with selected properties. The SSQs growth can be tuned by simply controlling the reaction duration in the in situ water production route (ISWP), where the kinetics of the esterification reaction between carboxylic acids and alcohols rules out the extent of organosilane hydrolysis-condensation. Tunable SSQs with thiol functionalities (SH-NBBs) are suitable for further modification by exploiting the simple thiol-ene click reaction, thus allowing for modifying the wettability properties of derived coatings. In this paper, coatings were prepared from SH-NBBs with different architecture onto cotton fabrics and paper, and further functionalized with long alkyl chains by means of initiator-free UV-induced thiol-ene coupling with 1-decene (C10) and 1-tetradecene (C14). The coatings appeared to homogeneously cover the natural fibers and imparted a multi-scale roughness that was not affected by the click functionalization step. The two-step functionalization of cotton and paper warrants a stable highly hydrophobic character to the surface of natural materials that, in perspective, suggests a possible application in filtration devices for oil-water separation. Furthermore, the purification of SH-NBBs from ISWP by-products was possible during the coating process, and this step allowed for the fast, initiator-free, click-coupling of purified NBBs with C10 and C14 in solution with a nearly quantitative yield. Therefore, this approach is an alternative route to get sol-gel-derived, ladder-like, and cage-like SSQs functionalized with long alkyl chains.

  1. High transparent shape memory gel

    NASA Astrophysics Data System (ADS)

    Gong, Jin; Arai, Masanori; Kabir, M. H.; Makino, Masato; Furukawa, Hidemitsu

    2014-03-01

    Gels are a new material having three-dimensional network structures of macromolecules. They possess excellent properties as swellability, high permeability and biocompatibility, and have been applied in various fields of daily life, food, medicine, architecture, and chemistry. In this study, we tried to prepare new multi-functional and high-strength gels by using Meso-Decoration (Meso-Deco), one new method of structure design at intermediate mesoscale. High-performance rigid-rod aromatic polymorphic crystals, and the functional groups of thermoreversible Diels-Alder reaction were introduced into soft gels as crosslinkable pendent chains. The functionalization and strengthening of gels can be realized by meso-decorating the gels' structure using high-performance polymorphic crystals and thermoreversible pendent chains. New gels with good mechanical properties, novel optical properties and thermal properties are expected to be developed.

  2. Meso-decorated self-healing gels: network structure and properties

    NASA Astrophysics Data System (ADS)

    Gong, Jin; Sawamura, Kensuke; Igarashi, Susumu; Furukawa, Hidemitsu

    2013-04-01

    Gels are a new material having three-dimensional network structures of macromolecules. They possess excellent properties as swellability, high permeability and biocompatibility, and have been applied in various fields of daily life, food, medicine, architecture, and chemistry. In this study, we tried to prepare new multi-functional and high-strength gels by using Meso-Decoration (Meso-Deco), one new method of structure design at intermediate mesoscale. High-performance rigid-rod aromatic polymorphic crystals, and the functional groups of thermoreversible Diels-Alder reaction were introduced into soft gels as crosslinkable pendent chains. The functionalization and strengthening of gels can be realized by meso-decorating the gels' structure using high-performance polymorphic crystals and thermoreversible pendent chains. New gels with good mechanical properties, novel optical properties and thermal properties are expected to be developed.

  3. Sustainable Engineering and Improved Recycling of PET for High-Value Applications: Transforming Linear PET to Lightly Branched PET with a Novel, Scalable Process

    NASA Astrophysics Data System (ADS)

    Pierre, Cynthia; Torkelson, John

    2009-03-01

    A major challenge for the most effective recycling of poly(ethylene terephthalate) concerns the fact that initial melt processing of PET into a product leads to substantial degradation of molecular weight. Thus, recycled PET has insufficient melt viscosity for reuse in high-value applications such as melt-blowing of PET bottles. Academic and industrial research has tried to remedy this situation by synthesis and use of ``chain extenders'' that can lead to branched PET (with higher melt viscosity than the linear recycled PET) via condensation reactions with functional groups on the PET. Here we show that simple processing of PET via solid-state shear pulverization (SSSP) leads to enhanced PET melt viscosity without need for chemical additives. We hypothesize that this branching results from low levels of chain scission accompanying SSSP, leading to formation of polymeric radicals that participate in chain transfer and combination reactions with other PET chains and thereby to in situ branch formation. The pulverized PET exhibits vastly enhanced crystallization kinetics, eliminating the need to employ cold crystallization to achieve maximum PET crystallinity. Results of SSSP processing of PET will be compared to results obtained with poly(butylene terephthalate).

  4. Omega-functionalized fatty acids, alcohols, and ethers via olefin metathesis

    USDA-ARS?s Scientific Manuscript database

    Methyl 17-hydroxy stearate was converted to methyl octadec-16-enoate using copper sulfate adsorbed on silica gel. This compound, possessing unsaturation at the opposite end of the chain from the carboxylate, served as a useful substrate for the olefin metathesis reaction. As a result, several fatt...

  5. Ubiquitin Chains Modified by the Bacterial Ligase SdeA Are Protected from Deubiquitinase Hydrolysis.

    PubMed

    Puvar, Kedar; Zhou, Yiyang; Qiu, Jiazhang; Luo, Zhao-Qing; Wirth, Mary J; Das, Chittaranjan

    2017-09-12

    The SidE family of Legionella pneumophila effectors is a unique group of ubiquitin-modifying enzymes. Along with catalyzing NAD + -dependent ubiquitination of certain host proteins independent of the canonical E1/E2/E3 pathway, they have also been shown to produce phosphoribosylated free ubiquitin. This modified ubiquitin product is incompatible with conventional E1/E2/E3 ubiquitination processes, with the potential to lock down various cellular functions that are dependent on ubiquitin signaling. Here, we show that in addition to free ubiquitin, Lys63-, Lys48-, Lys11-, and Met1-linked diubiquitin chains are also modified by SdeA in a similar fashion. Both the proximal and distal ubiquitin moieties are targeted in the phosphoribosylation reaction. Furthermore, this renders the ubiquitin chains unable to be processed by a variety of deubiquitinating enzymes. These observations broaden the scope of SdeA's modulatory functions during Legionella infection.

  6. Entropy driven chain effects on ligation chemistry† †Electronic supplementary information (ESI) available: Synthetic details, applied MHKS parameters, SEC chromatograms of all samples, (HT) NMR data, experimental debonding values, SANS measurements, computational data (energy contributions and geometries in the form of Gaussian archive entries). See DOI: 10.1039/c4sc02908a Click here for additional data file.

    PubMed Central

    Pahnke, Kai; Brandt, Josef; Gryn'ova, Ganna; Lindner, Peter; Schweins, Ralf; Schmidt, Friedrich Georg

    2015-01-01

    We report the investigation of fundamental entropic chain effects that enable the tuning of modular ligation chemistry – for example dynamic Diels–Alder (DA) reactions in materials applications – not only classically via the chemistry of the applied reaction sites, but also via the physical and steric properties of the molecules that are being joined. Having a substantial impact on the reaction equilibrium of the reversible ligation chemistry, these effects are important when transferring reactions from small molecule studies to larger or other entropically very dissimilar systems. The effects on the DA equilibrium and thus the temperature dependent degree of debonding (%debond) of different cyclopentadienyl (di-)functional poly(meth-)acrylate backbones (poly(methyl methacrylate), poly(iso-butyl methacrylate), poly(tert-butyl methacrylate), poly(iso-butyl acrylate), poly(n-butyl acrylate), poly(tert-butyl acrylate), poly(methyl acrylate) and poly(isobornyl acrylate)), linked via a difunctional cyanodithioester (CDTE) were examined via high temperature (HT) NMR spectroscopy as well as temperature dependent (TD) SEC measurements. A significant impact of not only chain mass and length with a difference in the degree of debonding of up to 30% for different lengths of macromonomers of the same polymer type but – remarkably – as well the chain stiffness with a difference in bonding degrees of nearly 20% for isomeric poly(butyl acrylates) is found. The results were predicted, reproduced and interpreted via quantum chemical calculations, leading to a better understanding of the underlying entropic principles. PMID:29560194

  7. Chemical stability of insulin. 4. Mechanisms and kinetics of chemical transformations in pharmaceutical formulation.

    PubMed

    Brange, J

    1992-01-01

    Insulin decomposes by a multitude of chemical reactions [1-3]. It deamidates at two different residues by entirely different mechanisms. In acid, deamidation at AsnA21 is intramolecularly catalyzed by the protonated C-terminal, whereas above pH 6 an intermediate imide formation at residue AsnB3 leads to isoAsp and Asp derivatives. The imide formation requires a large rotation around the alpha-carbon/peptide carbonyl carbon bond at B3, corresponding to a 10 A movement of the B-chain N-terminal. The main determinant for the rate of B3 deamidation, as well as for the ratio between the two products formed, is the local conformational structure, which is highly influenced by various excipients and the physical state of the insulin. An amazing thermolysin-like, autoproteolytic cleavage of the A-chain takes place in rhombohedral insulin crystals, mediated by a concerted catalytic action by several, inter-hexameric functional groups and Zn2+. Intermolecular, covalent cross-linking of insulin molecules occurs via several mechanisms. The most prominent type of mechanism is aminolysis by the N-terminals, leading to isopeptide linkages with the A-chain side-chain amides of residues GlnA15, AsnA18 and AsnA21. The same type of reaction also leads to covalent cross-linking of the N-terminal in protamine with insulin. Disulfide exchange reactions, initiated by lysis of the A7-B7 disulfide bridge, lead mainly to formation of covalent oligo- and polymers. Activation energy (Ea) for the neutral deamidation and the aminolysis reactions was found to be 80 and 119 KJ/mol, respectively.

  8. Cyclopentadienone Oxidation Reaction Kinetics and Thermochemistry for the Alcohols, Hydroperoxides, and Vinylic, Alkoxy, and Alkylperoxy Radicals.

    PubMed

    Yommee, Suriyakit; Bozzelli, Joseph W

    2016-01-28

    Cyclopentadienone has one carbonyl and two olefin groups resulting in 4n + 2 π-electrons in a cyclic five-membered ring structure. Thermochemical and kinetic parameters for the initial reactions of cyclopentadienone radicals with O2 and the thermochemical properties for cyclopentadienone-hydroperoxides, alcohols, and alkenyl, alkoxy, and peroxy radicals were determined by use of computational chemistry. The CBS-QB3 composite and B3LYP density functional theory methods were used to determine the enthalpies of formation (ΔfH°298) using the isodesmic reaction schemes with several work reactions for each species. Entropy and heat capacity, S°(T) and Cp°(T) (50 K ≤ T ≤ 5000 K) are determined using geometric parameters, internal rotor potentials, and frequencies from B3LYP/6-31G(d,p) calculations. Standard enthalpies of formation are reported for parent molecules as cyclopentadienone, cyclopentadienone with alcohol, hydroperoxide substituents, and the cyclopentadienone-yl vinylic, alkoxy, and peroxy radicals corresponding to loss of a hydrogen atom from the carbon and oxygen sites. Entropy and heat capacity vs temperature also are reported for the parent molecules and for radicals. The thermochemical analysis shows The R(•) + O2 well depths are deep, on the order of 50 kcal mol(-1), and the R(•) + O2 reactions to RO + O (chain branching products) for cyclopentadienone-2-yl and cyclopentadienone-3-yl have unusually low reaction (ΔHrxn) enthalpies, some 20 or so kcal/mol below the entrance channels. Chemical activation kinetics using quantum RRK analysis for k(E) and master equation for falloff are used to show that significant chain branching as a function of temperature and pressure can occur when these vinylic radicals are formed.

  9. Chain Rule Approach for Calculating the Time-Derivative of Flux

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Langenbrunner, James R.; Booker, Jane M.

    The reaction history (gamma-flux observable) is mathematically studied by using the chain rule for taking the total-time derivatives. That is, the total time-derivative of flux is written as the product of the ion temperature derivative with respect to time and the derivative of the flux with respect to ion temperature. Some equations are derived using the further simplification that the fusion reactivity is a parametrized function of ion temperature, T. Deuterium-tritium (D-T) fusion is used as the application with reactivity calculations from three established reactivity parametrizations.

  10. TCTEX1D4 Interactome in Human Testis: Unraveling the Function of Dynein Light Chain in Spermatozoa

    PubMed Central

    Freitas, Maria João; Korrodi-Gregório, Luís; Morais-Santos, Filipa; da Cruz e Silva, Edgar

    2014-01-01

    Abstract Studies were designed to identify the TCTEX1D4 interactome in human testis, with the purpose of unraveling putative protein complexes essential to male reproduction and thus novel TCTEX1D4 functions. TCTEX1D4 is a dynein light chain that belongs to the DYNT1/TCTEX1 family. In spermatozoa, it appears to be important to sperm motility, intraflagellar transport, and acrosome reaction. To contribute to the knowledge on TCTEX1D4 function in testis and spermatozoa, a yeast two-hybrid assay was performed in testis, which allowed the identification of 40 novel TCTEX1D4 interactors. Curiously, another dynein light chain, TCTEX1D2, was identified and its existence demonstrated for the first time in human spermatozoa. Immunofluorescence studies proved that TCTEX1D2 is an intra-acrosomal protein also present in the midpiece, suggesting a role in cargo movement in human spermatozoa. Further, an in silico profile of TCTEX1D4 revealed that most TCTEX1D4 interacting proteins were not previously characterized and the ones described present a very broad nature. This reinforces TCTEX1D4 as a dynein light chain that is capable of interacting with a variety of functionally different proteins. These observations collectively contribute to a deeper molecular understanding of the human spermatozoa function. PMID:24606217

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rongle Zhang; Jie Chang; Yuanyuan Xu

    A new kinetic model of the Fischer-Tropsch synthesis (FTS) is proposed to describe the non-Anderson-Schulz-Flory (ASF) product distribution. The model is based on the double-polymerization monomers hypothesis, in which the surface C{sub 2}{asterisk} species acts as a chain-growth monomer in the light-product range, while C{sub 1}{asterisk} species acts as a chain-growth monomer in the heavy-product range. The detailed kinetic model in the Langmuir-Hinshelwood-Hougen-Watson type based on the elementary reactions is derived for FTS and the water-gas-shift reaction. Kinetic model candidates are evaluated by minimization of multiresponse objective functions with a genetic algorithm approach. The model of hydrocarbon product distribution ismore » consistent with experimental data (

  12. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  13. Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?

    PubMed

    Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D

    2016-07-14

    The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres.

  14. ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation.

    PubMed

    Haslam, Tegan M; Haslam, Richard; Thoraval, Didier; Pascal, Stéphanie; Delude, Camille; Domergue, Frédéric; Fernández, Aurora Mañas; Beaudoin, Frédéric; Napier, Johnathan A; Kunst, Ljerka; Joubès, Jérôme

    2015-03-01

    The extension of very-long-chain fatty acids (VLCFAs) for the synthesis of specialized apoplastic lipids requires unique biochemical machinery. Condensing enzymes catalyze the first reaction in fatty acid elongation and determine the chain length of fatty acids accepted and produced by the fatty acid elongation complex. Although necessary for the elongation of all VLCFAs, known condensing enzymes cannot efficiently synthesize VLCFAs longer than 28 carbons, despite the prevalence of C28 to C34 acyl lipids in cuticular wax and the pollen coat. The eceriferum2 (cer2) mutant of Arabidopsis (Arabidopsis thaliana) was previously shown to have a specific deficiency in cuticular waxes longer than 28 carbons, and heterologous expression of CER2 in yeast (Saccharomyces cerevisiae) demonstrated that it can modify the acyl chain length produced by a condensing enzyme from 28 to 30 carbon atoms. Here, we report the physiological functions and biochemical specificities of the CER2 homologs CER2-LIKE1 and CER2-LIKE2 by mutant analysis and heterologous expression in yeast. We demonstrate that all three CER2-LIKEs function with the same small subset of condensing enzymes, and that they have different effects on the substrate specificity of the same condensing enzyme. Finally, we show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. © 2015 American Society of Plant Biologists. All Rights Reserved.

  15. ECERIFERUM2-LIKE Proteins Have Unique Biochemical and Physiological Functions in Very-Long-Chain Fatty Acid Elongation1[OPEN

    PubMed Central

    Haslam, Tegan M.; Haslam, Richard; Thoraval, Didier; Pascal, Stéphanie; Delude, Camille; Domergue, Frédéric; Fernández, Aurora Mañas; Beaudoin, Frédéric; Napier, Johnathan A.; Kunst, Ljerka; Joubès, Jérôme

    2015-01-01

    The extension of very-long-chain fatty acids (VLCFAs) for the synthesis of specialized apoplastic lipids requires unique biochemical machinery. Condensing enzymes catalyze the first reaction in fatty acid elongation and determine the chain length of fatty acids accepted and produced by the fatty acid elongation complex. Although necessary for the elongation of all VLCFAs, known condensing enzymes cannot efficiently synthesize VLCFAs longer than 28 carbons, despite the prevalence of C28 to C34 acyl lipids in cuticular wax and the pollen coat. The eceriferum2 (cer2) mutant of Arabidopsis (Arabidopsis thaliana) was previously shown to have a specific deficiency in cuticular waxes longer than 28 carbons, and heterologous expression of CER2 in yeast (Saccharomyces cerevisiae) demonstrated that it can modify the acyl chain length produced by a condensing enzyme from 28 to 30 carbon atoms. Here, we report the physiological functions and biochemical specificities of the CER2 homologs CER2-LIKE1 and CER2-LIKE2 by mutant analysis and heterologous expression in yeast. We demonstrate that all three CER2-LIKEs function with the same small subset of condensing enzymes, and that they have different effects on the substrate specificity of the same condensing enzyme. Finally, we show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. PMID:25596184

  16. Orientation of chain molecules in ionotropic gels: a Brownian dynamics model

    NASA Astrophysics Data System (ADS)

    Woelki, Stefan; Kohler, Hans-Helmut

    2003-09-01

    As is known from birefringence measurements, polysaccharide molecules of ionotropic gels are preferentially orientated normal to the direction of gel growth. In this paper the orientation effect is investigated by means of an off-lattice Brownian dynamics model simulating the gel formation process. The model describes the integration of a single coarse grained phantom chain into the growing gel. The equations of motion of the chain are derived. The computer simulations show that, during the process of integration, the chain is contracting normal to the direction of gel growth. A scaling relation is obtained for the degree of contraction as a function of the length parameters of the chain, the velocity of the gel formation front and the rate constant of the crosslinking reaction. It is shown that the scaling relation, if applied to the example of ionotropic copper alginate gel, leads to reasonable predictions of the time course of the degree of contraction of the alginate chains.

  17. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  18. A versatile platform for precise synthesis of asymmetric molecular brush in one shot.

    PubMed

    Xu, Binbin; Feng, Chun; Huang, Xiaoyu

    2017-08-24

    Asymmetric molecular brushes emerge as a unique class of nanostructured polymers, while their versatile synthesis keeps a challenge for chemists. Here we show the synthesis of well-defined asymmetric molecular double-brushes comprising two different side chains linked to the same repeat unit along the backbone by one-pot concurrent atom transfer radical polymerization (ATRP) and Cu-catalyzed azide/alkyne cycloaddition (CuAAC) reaction. The double-brushes are based on a poly(Br-acrylate-alkyne) homopolymer possessing an alkynyl for CuAAC reaction and a 2-bromopropionate initiating group for ATRP in each repeat unit. The versatility of this one-shot approach is demonstrated by CuAAC reaction of alkynyl/poly(ethylene oxide)-N 3 and ATRP of various monomers. We also show the quantitative conversion of pentafluorophenyl ester groups to amide groups in side chains, allowing for the further fabrication of diverse building blocks. This work provides a versatile platform for facile synthesis of Janus-type double-brushes with structural and functional control, in a minimum number of reactions.Producing well-defined polymer compositions and structures facilitates their use in many different applications. Here the authors show the synthesis of well-defined asymmetric double-brushes by a one-pot concurrent atom transfer radical polymerization and Cu-catalyzed Click reaction.

  19. Selective binding of carotenoids with a shorter conjugated chain to the LH2 antenna complex and those with a longer conjugated chain to the reaction center from Rubrivivax gelatinosus.

    PubMed

    Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo

    2007-06-19

    Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.

  20. Ubiquitin Lysine 63 Chain–Forming Ligases Regulate Apical Dominance in Arabidopsis[W][OA

    PubMed Central

    Yin, Xiao-Jun; Volk, Sara; Ljung, Karin; Mehlmer, Norbert; Dolezal, Karel; Ditengou, Franck; Hanano, Shigeru; Davis, Seth J.; Schmelzer, Elmon; Sandberg, Göran; Teige, Markus; Palme, Klaus; Pickart, Cecile; Bachmair, Andreas

    2007-01-01

    Lys-63–linked multiubiquitin chains play important roles in signal transduction in yeast and in mammals, but the functions for this type of chain in plants remain to be defined. The RING domain protein RGLG2 (for RING domain Ligase2) from Arabidopsis thaliana can be N-terminally myristoylated and localizes to the plasma membrane. It can form Lys-63–linked multiubiquitin chains in an in vitro reaction. RGLG2 has overlapping functions with its closest sequelog, RGLG1, and single mutants in either gene are inconspicuous. rglg1 rglg2 double mutant plants exhibit loss of apical dominance and altered phyllotaxy, two traits critically influenced by the plant hormone auxin. Auxin and cytokinin levels are changed, and the plants show a decreased response to exogenously added auxin. Changes in the abundance of PIN family auxin transport proteins and synthetic lethality with a mutation in the auxin transport regulator BIG suggest that the directional flow of auxin is modulated by RGLG activity. Modification of proteins by Lys-63–linked multiubiquitin chains is thus important for hormone-regulated, basic plant architecture. PMID:17586653

  1. Understanding Trends in Autoignition of Biofuels: Homologous Series of Oxygenated C5 Molecules

    DOE PAGES

    Ciesielski, Peter N.; Robichaud, David J.; Kim, Seonah; ...

    2017-07-05

    Oxygenated biofuels provide a renewable, domestic source of energy that can enable adoption of advanced, high-efficiency internal combustion engines, such as those based on homogeneously charged compression ignition (HCCI). Of key importance to such engines is the cetane number (CN) of the fuel, which is determined by the autoignition of the fuel under compression at relatively low temperatures (550-800 K). For the plethora of oxygenated biofuels possible, it is desirable to know the ignition delay times and the CN of these fuels to help guide conversion strategies so as to focus efforts on the most desirable fuels. For alkanes, themore » chemical pathways leading to radical chain-branching reactions giving rise to low-temperature autoignition are well-known and are highly coincident with the buildup of reactive radicals such as OH. Key in the mechanisms leading to chain branching are the addition of molecular oxygen to alkyl radicals and the rearrangement and dissociation of the resulting peroxy radials. Prediction of the temperature and pressure dependence of reactions that lead to the buildup of reactive radicals requires a detailed understanding of the potential energy surfaces (PESs) of these reactions. In this study, we used quantum mechanical modeling to systematically compare the effects of oxygen functionalities on these PESs and associated kinetics so as to understand how they affect experimental trends in autoignition and CN. The molecules studied here include pentane, pentanol, pentanal, 2-heptanone, methylpentyl ether, methyl hexanoate, and pentyl acetate. All have a saturated five-carbon alkyl chain with an oxygen functional group attached to the terminal carbon atom. The results of our systematic comparison may be summarized as follows: (1) Oxygen functionalities activate C-H bonds by lowering the bond dissociation energy (BDE) relative to alkanes. (2) The R-OO bonds in peroxy radicals adjacent to carbonyl groups are weaker than corresponding alkyl systems, leading to dissociation of ROO radicals and reducing reactivity and hence CN. (3) Hydrogen atom transfer in peroxy radicals is important in autoignition, and low barriers for ethers and aldehydes lead to high CN. (4) Peroxy radicals formed from alcohols have low barriers to form aldehydes, which reduce the reactivity of the alkyl radical. In conclusion, these findings for the formation and reaction of alkyl radicals with molecular oxygen explain the trend in CN for these common biofuel functional groups.« less

  2. Understanding Trends in Autoignition of Biofuels: Homologous Series of Oxygenated C5 Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ciesielski, Peter N.; Robichaud, David J.; Kim, Seonah

    Oxygenated biofuels provide a renewable, domestic source of energy that can enable adoption of advanced, high-efficiency internal combustion engines, such as those based on homogeneously charged compression ignition (HCCI). Of key importance to such engines is the cetane number (CN) of the fuel, which is determined by the autoignition of the fuel under compression at relatively low temperatures (550-800 K). For the plethora of oxygenated biofuels possible, it is desirable to know the ignition delay times and the CN of these fuels to help guide conversion strategies so as to focus efforts on the most desirable fuels. For alkanes, themore » chemical pathways leading to radical chain-branching reactions giving rise to low-temperature autoignition are well-known and are highly coincident with the buildup of reactive radicals such as OH. Key in the mechanisms leading to chain branching are the addition of molecular oxygen to alkyl radicals and the rearrangement and dissociation of the resulting peroxy radials. Prediction of the temperature and pressure dependence of reactions that lead to the buildup of reactive radicals requires a detailed understanding of the potential energy surfaces (PESs) of these reactions. In this study, we used quantum mechanical modeling to systematically compare the effects of oxygen functionalities on these PESs and associated kinetics so as to understand how they affect experimental trends in autoignition and CN. The molecules studied here include pentane, pentanol, pentanal, 2-heptanone, methylpentyl ether, methyl hexanoate, and pentyl acetate. All have a saturated five-carbon alkyl chain with an oxygen functional group attached to the terminal carbon atom. The results of our systematic comparison may be summarized as follows: (1) Oxygen functionalities activate C-H bonds by lowering the bond dissociation energy (BDE) relative to alkanes. (2) The R-OO bonds in peroxy radicals adjacent to carbonyl groups are weaker than corresponding alkyl systems, leading to dissociation of ROO radicals and reducing reactivity and hence CN. (3) Hydrogen atom transfer in peroxy radicals is important in autoignition, and low barriers for ethers and aldehydes lead to high CN. (4) Peroxy radicals formed from alcohols have low barriers to form aldehydes, which reduce the reactivity of the alkyl radical. In conclusion, these findings for the formation and reaction of alkyl radicals with molecular oxygen explain the trend in CN for these common biofuel functional groups.« less

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samsel, R.W.; Perelson, A.S.

    Red blood cells aggregate face-to-face to form long, cylindrical, straight chains and sometimes branched structures called rouleaux. Here the authors extend a kinetic model developed by R.W. Samsel and A.S. Perelson to include both the formation and dissociation of rouleaux. Thermodynamic constraints on the rate constants of the model imposed by the principle of detailed balance were examined. Incorporation of reverse reactions allows computation of mean sizes of rouleaux and straight chain segments within rouleaux, as functions of time and at equilibrium. Using the Flory-Stockmayer method from polymer chemistry, a closed-form solution was obtained for the size distribution of straightmore » chain segments within rouleaux at any point in the evolution of the reaction. The predictions of the theory compare favorably with data collected by D. Kernick, A.W.L. Jay, S. Rowlands, and L. Skibo on the kinetics of rouleaux formation. When rouleaux grow large, they may contain rings or loops and take on the appearance of a network. The importance of including the kinetics of ring closure in the development of realistic models of rouleaux formation was demonstrated.« less

  4. Kinetics and Quantitative Structure—Activity Relationship Study on the Degradation Reaction from Perfluorooctanoic Acid to Trifluoroacetic Acid

    PubMed Central

    Gong, Chen; Sun, Xiaomin; Zhang, Chenxi; Zhang, Xue; Niu, Junfeng

    2014-01-01

    Investigation of the degradation kinetics of perfluorooctanoic acid (PFOA) has been carried out to calculate rate constants of the main elementary reactions using the multichannel Rice-Ramsperger-Kassel-Marcus theory and canonical variational transition state theory with small-curvature tunneling correction over a temperature range of 200~500 K. The Arrhenius equations of rate constants of elementary reactions are fitted. The decarboxylation is role step in the degradation mechanism of PFOA. For the perfluorinated carboxylic acids from perfluorooctanoic acid to trifluoroacetic acid, the quantitative structure–activity relationship of the decarboxylation was analyzed with the genetic function approximation method and the structure–activity model was constructed. The main parameters governing rate constants of the decarboxylation reaction from the eight-carbon chain to the two-carbon chain were obtained. As the structure–activity model shows, the bond length and energy of C1–C2 (RC1–C2 and EC1–C2) are positively correlated to rate constants, while the volume (V), the energy difference between EHOMO and ELUMO (ΔE), and the net atomic charges on atom C2 (QC2) are negatively correlated. PMID:25196516

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weinstein, J.; Bielski, H.J.

    The rates of reaction of HO/sub 2/ and O/sub 2//sup -/ with hydrogen peroxide, known as the Haber--Weiss reactions, were studied by /sup 60/Co ..gamma.. radiolysis as a function of pH at 23.5/sup 0/C. The numerical values for the two rate constants, k/sub HO/sub 2/+H/sub 2/O/sub 2// = (0.50 +- 0.09) M/sup -1/ s/sup -1/ and k/sub O/sub 2/-+H/sub 2/O/sub 2// = (0.13 +- 0.07) M/sup -1/ s/sup -1/, were computed from molecular oxygen yields which result from the radiation-induced chain decomposition of aqueous hydrogen peroxide solutions. The experimental results are consistent with a chain mechanism which takes into accountmore » the dissociation of HO/sub 2/ in equilibrium O/sub 2//sup -/ + H/sup +/ (pK = 4.7) and the competition between the Haber--Weiss reactions (HO/sub 2/ + H/sub 2/O/sub 2/ and O/sub 2//sup -/ + H/sub 2/O/sub 2/) and the recombination reactions of the superoxide and perhydroxyl radicals (HO/sub 2/ + HO/sub 2/ and HO/sub 2/ + O/sub 2//sup -/).« less

  6. UNC Center for Dynamic Combinatorial Chemistry

    DTIC Science & Technology

    2014-04-09

    Thioester Exchange, Organic Letters (04 2010) Chung, Schiltz, Lee, and Gagne. The Effect of Gas-Phase Reactions on the Quantitation of Cyclic...Figure 6.1c) These monomers have L-tryptophan, L-leucine, L- phenylalanine , and the sequential L-proline and D-proline functions. These functions...are known as the parts of three hydrophobic side chains in the tumor suppressor protein p53 and make direct contacts deep in the MDM2 cleft (Figure

  7. Chemical Modification of Cellulose Esters for Oral Drug Delivery

    NASA Astrophysics Data System (ADS)

    Meng, Xiangtao

    Polymer functional groups have critical impacts upon physical, chemical and mechanical properties, and thus affect the specific applications of the polymer. Functionalization of cellulose esters and ethers has been under extensive investigation for applications including drug delivery, cosmetics, food ingredients, and automobile coating. In oral delivery of poorly water-soluble drugs, amorphous solid dispersion (ASD) formulations have been used, prepared by forming miscible blends of polymers and drugs to inhibit crystallization and enhance bioavailability of the drug. The Edgar and Taylor groups have revealed that some cellulose o-carboxyalkanoates were highly effective as ASD polymers, with the pendant carboxylic acid groups providing both specific polymer-drug interactions and pHtriggered release through swelling of the ionized polymer matrix. While a variety of functional groups such as hydroxyl and amide groups are also of interest, cellulose functionalization has relied heavily on classical methods such as esterification and etherification for appending functional groups. These methods, although they have been very useful, are limited in two respects. First, they typically employ harsh reaction conditions. Secondly, each synthetic pathway is only applicable for one or a narrow group of functionalities due to restrictions imposed by the required reaction conditions. To this end, there is a great impetus to identify novel reactions in cellulose modification that are mild, efficient and ideally modular. In the initial effort to design and synthesize cellulose esters for oral drug delivery, we developed several new methods in cellulose functionalization, which can overcome drawbacks of conventional synthetic pathways, provide novel cellulose derivatives that are otherwise inaccessible, and present a platform for structure-property relationship study. Cellulose o-hydroxyalkanoates were previously difficult to access as the hydroxyl groups, if not protected, react with carboxylic acid/carbonyl during a typical esterification reaction or ring opening of lactones, producing cellulose-g-polyester and homopolyester. We demonstrated the viability of chemoselective olefin hydroboration-oxidation in the synthesis of cellulose o-hydroxyesters in the presence of ester groups. Cellulose esters with terminally olefinic side chains were transformed to the target products by two-step, one-pot hydroborationoxidation reactions, using 9-borabicyclo[3.3.1]nonane (9-BBN) as hydroboration agent, followed by oxidizing the organoborane intermediate to a primary alcohol using mildly alkaline H2O2. The use of 9-BBN as hydroboration agent and sodium acetate as base catalyst in oxidation successfully avoided cleavage of ester linkages by borane reduction and base catalyzed hydrolysis. With the impetus of modular and efficient synthesis, we introduced olefin crossmetathesis (CM) in polysaccharide functionalization. Using Grubbs type catalyst, cellulose esters with terminally olefinic side chains were reacted with various CM partners including acrylic acid, acrylates and acrylamides to afford families of functionalized cellulose esters. Molar excesses of CM partners were used in order to suppress potential crosslinking caused by self-metathesis between terminally olefinic side chains. Amide CM partners can chelate with the ruthenium catalyst and cause low conversions in conventional solvents such as THF. While the inherent reactivity toward CM and tendency of acrylamides to chelate Ru is influenced by the acrylamide N-substituents, employing acetic acid as a solvent significantly improved the conversion of certain acrylamides. We observed that the CM products are prone to crosslinking during storage, and found that the crosslinking is likely caused by free radical abstraction of gamma-hydrogen of the alpha,beta-unsaturation and subsequent recombination. We further demonstrated successful hydrogenation of these alpha,beta-unsaturated acids, esters, and amides, thereby eliminating the potential for radical-induced crosslinking during storage. The alpha,beta-unsaturation on CM products can cause crosslinking due to gamma-H abstraction and recombination if not reduced immediately after reaction. Instead of eliminating the double bond by hydrogenation, we described a method to make use of these reactive conjugated olefins by post-CM thiol-Michael addition. Under amine catalysis, different CM products and thiols were combined and reacted. Using proper thiols and catalyst, complete conversion can be achieved under mild reaction conditions. The combination of the two modular reactions creates versatile access to multi-functionalized cellulose derivatives. Compared with conventional reactions, these reactions enable click or click-like conjugation of functional groups onto cellulose backbone. The modular profile of the reactions enables clean and informative structure-property relationship studies for ASD. These approaches also provide opportunities for the synthesis of chemically and architecturally diverse cellulosic polymers that are otherwise difficult to access, opening doors for many other applications such as antimicrobial, antifouling, in vivo drug delivery, and bioconjugation. We believe that the cellulose functionalization approaches we pioneered can be expanded to the modification of other polysaccharides and polymers, and that these reactions will become useful tools in the toolbox of polymer/polysaccharide chemists.

  8. Highly efficient and selective pressure-assisted photon-induced polymerization of styrene

    NASA Astrophysics Data System (ADS)

    Guan, Jiwen; Song, Yang

    2016-06-01

    The polymerization process of condensed styrene to produce polystyrene as an industrially important polymeric material was investigated using a novel approach by combining external compression with ultraviolet radiation. The reaction evolution was monitored as a function of time and the reaction products were characterized by in situ Fourier transform infrared spectroscopy. By optimizing the loading pressures, we observed highly efficient and selective production of polystyrene of different tacticities. Specifically, at relatively low loading pressures, infrared spectra suggest that styrene monomers transform to amorphous atactic polystyrene (APS) with minor crystalline isotactic polystyrene. In contrast, APS was found to be the sole product when polymerization occurs at relatively higher loading pressures. The time-dependent reaction profiles allow the examination of the polymerization kinetics by analyzing the rate constant and activation volume as a function of pressure. As a result, an optimized pressure condition, which allows a barrierless reaction to proceed, was identified and attributed to the very desirable reaction yield and kinetics. Finally, the photoinitiated reaction mechanism and the growth geometry of the polymer chains were investigated from the energy diagram of styrene and by the topology analysis of the crystal styrene. This study shows strong promise to produce functional polymeric materials in a highly efficient and controlled manner.

  9. An analytical derivation of MC-SCF vibrational wave functions for the quantum dynamical simulation of multiple proton transfer reactions: Initial application to protonated water chains

    NASA Astrophysics Data System (ADS)

    Drukker, Karen; Hammes-Schiffer, Sharon

    1997-07-01

    This paper presents an analytical derivation of a multiconfigurational self-consistent-field (MC-SCF) solution of the time-independent Schrödinger equation for nuclear motion (i.e. vibrational modes). This variational MC-SCF method is designed for the mixed quantum/classical molecular dynamics simulation of multiple proton transfer reactions, where the transferring protons are treated quantum mechanically while the remaining degrees of freedom are treated classically. This paper presents a proof that the Hellmann-Feynman forces on the classical degrees of freedom are identical to the exact forces (i.e. the Pulay corrections vanish) when this MC-SCF method is used with an appropriate choice of basis functions. This new MC-SCF method is applied to multiple proton transfer in a protonated chain of three hydrogen-bonded water molecules. The ground state and the first three excited state energies and the ground state forces agree well with full configuration interaction calculations. Sample trajectories are obtained using adiabatic molecular dynamics methods, and nonadiabatic effects are found to be insignificant for these sample trajectories. The accuracy of the excited states will enable this MC-SCF method to be used in conjunction with nonadiabatic molecular dynamics methods. This application differs from previous work in that it is a real-time quantum dynamical nonequilibrium simulation of multiple proton transfer in a chain of water molecules.

  10. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  11. Ion transport and selectivity in biomimetic nanopores with pH-tunable zwitterionic polyelectrolyte brushes.

    PubMed

    Zeng, Zhenping; Yeh, Li-Hsien; Zhang, Mingkan; Qian, Shizhi

    2015-10-28

    Inspired by nature, functionalized nanopores with biomimetic structures have attracted growing interests in using them as novel platforms for applications of regulating ion and nanoparticle transport. To improve these emerging applications, we study theoretically for the first time the ion transport and selectivity in short nanopores functionalized with pH tunable, zwitterionic polyelectrolyte (PE) brushes. In addition to background salt ions, the study takes into account the presence of H(+) and OH(-) ions along with the chemistry reactions between functional groups on PE chains and protons. Due to ion concentration polarization, the charge density of PE layers is not homogeneously distributed and depends significantly on the background salt concentration, pH, grafting density of PE chains, and applied voltage bias, thereby resulting in many interesting and unexpected ion transport phenomena in the nanopore. For example, the ion selectivity of the biomimetic nanopore can be regulated from anion-selective (cation-selective) to cation-selective (anion-selective) by diminishing (raising) the solution pH when a sufficiently small grafting density of PE chains, large voltage bias, and low background salt concentration are applied.

  12. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  13. The dark and bright sides of an enzyme: a three dimensional structure of the N-terminal domain of Zophobas morio luciferase-like enzyme, inferences on the biological function and origin of oxygenase/luciferase activity.

    PubMed

    Prado, R A; Santos, C R; Kato, D I; Murakami, M T; Viviani, V R

    2016-05-11

    Beetle luciferases, the enzymes responsible for bioluminescence, are special cases of CoA-ligases which have acquired a novel oxygenase activity, offering elegant models to investigate the structural origin of novel catalytic functions in enzymes. What the original function of their ancestors was, and how the new oxygenase function emerged leading to bioluminescence remains unclear. To address these questions, we solved the crystal structure of a recently cloned Malpighian luciferase-like enzyme of unknown function from Zophobas morio mealworms, which displays weak luminescence with ATP and the xenobiotic firefly d-luciferin. The three dimensional structure of the N-terminal domain showed the expected general fold of CoA-ligases, with a unique carboxylic substrate binding pocket, permitting the binding and CoA-thioesterification activity with a broad range of carboxylic substrates, including short-, medium-chain and aromatic acids, indicating a generalist function consistent with a xenobiotic-ligase. The thioesterification activity with l-luciferin, but not with the d-enantiomer, confirms that the oxygenase activity emerged from a stereoselective impediment of the thioesterification reaction with the latter, favoring the alternative chemiluminescence oxidative reaction. The structure and site-directed mutagenesis support the involvement of the main-chain amide carbonyl of the invariant glycine G323 as the catalytic base for luciferin C4 proton abstraction during the oxygenase activity in this enzyme and in beetle luciferases (G343).

  14. Inference of reaction rate parameters based on summary statistics from experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin

    Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

  15. Inference of reaction rate parameters based on summary statistics from experiments

    DOE PAGES

    Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin; ...

    2016-10-15

    Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

  16. Protein oxidation and peroxidation

    PubMed Central

    Davies, Michael J.

    2016-01-01

    Proteins are major targets for radicals and two-electron oxidants in biological systems due to their abundance and high rate constants for reaction. With highly reactive radicals damage occurs at multiple side-chain and backbone sites. Less reactive species show greater selectivity with regard to the residues targeted and their spatial location. Modification can result in increased side-chain hydrophilicity, side-chain and backbone fragmentation, aggregation via covalent cross-linking or hydrophobic interactions, protein unfolding and altered conformation, altered interactions with biological partners and modified turnover. In the presence of O2, high yields of peroxyl radicals and peroxides (protein peroxidation) are formed; the latter account for up to 70% of the initial oxidant flux. Protein peroxides can oxidize both proteins and other targets. One-electron reduction results in additional radicals and chain reactions with alcohols and carbonyls as major products; the latter are commonly used markers of protein damage. Direct oxidation of cysteine (and less commonly) methionine residues is a major reaction; this is typically faster than with H2O2, and results in altered protein activity and function. Unlike H2O2, which is rapidly removed by protective enzymes, protein peroxides are only slowly removed, and catabolism is a major fate. Although turnover of modified proteins by proteasomal and lysosomal enzymes, and other proteases (e.g. mitochondrial Lon), can be efficient, protein hydroperoxides inhibit these pathways and this may contribute to the accumulation of modified proteins in cells. Available evidence supports an association between protein oxidation and multiple human pathologies, but whether this link is causal remains to be established. PMID:27026395

  17. Simplification of reversible Markov chains by removal of states with low equilibrium occupancy.

    PubMed

    Ullah, Ghanim; Bruno, William J; Pearson, John E

    2012-10-21

    We present a practical method for simplifying Markov chains on a potentially large state space when detailed balance holds. A simple and transparent technique is introduced to remove states with low equilibrium occupancy. The resulting system has fewer parameters. The resulting effective rates between the remaining nodes give dynamics identical to the original system's except on very fast timescales. This procedure amounts to using separation of timescales to neglect small capacitance nodes in a network of resistors and capacitors. We illustrate the technique by simplifying various reaction networks, including transforming an acyclic four-node network to a three-node cyclic network. For a reaction step in which a ligand binds, the law of mass action implies a forward rate proportional to ligand concentration. The effective rates in the simplified network are found to be rational functions of ligand concentration. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Specific Function of the Met-Tyr-Trp Adduct Radical and Residues Arg-418 and Asp-137 in the Atypical Catalase Reaction of Catalase-Peroxidase KatG*

    PubMed Central

    Zhao, Xiangbo; Khajo, Abdelahad; Jarrett, Sanchez; Suarez, Javier; Levitsky, Yan; Burger, Richard M.; Jarzecki, Andrzej A.; Magliozzo, Richard S.

    2012-01-01

    Catalase activity of the dual-function heme enzyme catalase-peroxidase (KatG) depends on several structural elements, including a unique adduct formed from covalently linked side chains of three conserved amino acids (Met-255, Tyr-229, and Trp-107, Mycobacterium tuberculosis KatG numbering) (MYW). Mutagenesis, electron paramagnetic resonance, and optical stopped-flow experiments, along with calculations using density functional theory (DFT) methods revealed the basis of the requirement for a radical on the MYW-adduct, for oxyferrous heme, and for conserved residues Arg-418 and Asp-137 in the rapid catalase reaction. The participation of an oxyferrous heme intermediate (dioxyheme) throughout the pH range of catalase activity is suggested from our finding that carbon monoxide inhibits the activity at both acidic and alkaline pH. In the presence of H2O2, the MYW-adduct radical is formed normally in KatG[D137S] but this mutant is defective in forming dioxyheme and lacks catalase activity. KatG[R418L] is also catalase deficient but exhibits normal formation of the adduct radical and dioxyheme. Both mutants exhibit a coincidence between MYW-adduct radical persistence and H2O2 consumption as a function of time, and enhanced subunit oligomerization during turnover, suggesting that the two mutations disrupting catalase turnover allow increased migration of the MYW-adduct radical to protein surface residues. DFT calculations showed that an interaction between the side chain of residue Arg-418 and Tyr-229 in the MYW-adduct radical favors reaction of the radical with the adjacent dioxyheme intermediate present throughout turnover in WT KatG. Release of molecular oxygen and regeneration of resting enzyme are thereby catalyzed in the last step of a proposed catalase reaction. PMID:22918833

  19. Functional role of a distal (3'-phosphate) group of CoA in the recombinant human liver medium-chain acyl-CoA dehydrogenase-catalysed reaction.

    PubMed Central

    Peterson, K L; Srivastava, D K

    1997-01-01

    The X-ray crystallographic structure of medium-chain acyl-CoA dehydrogenase (MCAD)-octenoyl-CoA complex reveals that the 3'-phosphate group of CoA is confined to the exterior of the protein structure [approx. 15 A (1.5 nm) away from the enzyme active site], and is fully exposed to the outside solvent environment. To ascertain whether such a distal (3'-phosphate) fragment of CoA plays any significant role in the enzyme catalysis, we investigated the recombinant human liver MCAD (HMCAD)-catalysed reaction by using normal (phospho) and 3'-phosphate-truncated (dephospho) forms of octanoyl-CoA and butyryl-CoA substrates. The steady-state kinetic data revealed that deletion of the 3'-phosphate group from octanoyl-CoA substrate increased the turnover rate of the enzyme to about one-quarter, whereas that from butyryl-CoA substrate decreased the turnover rate of the enzyme to about one-fifth; the Km values of both these substrates were increased by 5-10-fold on deletion of the 3'-phosphate group from the corresponding acyl-CoA substrates. The transient kinetics for the reductive half-reaction, oxidative half-reaction and the dissociation 'off-rate' (of the reaction product from the oxidized enzyme site) were all found to be affected by deletions of the 3'-phosphate group from octanoyl-CoA and butyryl-CoA substrates. A cumulative account of these results reveals that, although the 3'-phosphate group of acyl-CoA substrates might seem 'useless' on the basis of the structural data, it has an essential functional role during HMCAD catalysis. PMID:9271097

  20. Solvent-free iodination of organic molecules using the I(2)/urea-H(2)O(2) reagent system.

    PubMed

    Pavlinac, Jasminka; Zupan, Marko; Stavber, Stojan

    2007-02-21

    Introduction of iodine under solvent-free conditions into several aromatic compounds activated toward electrophilic functionalization was found to proceed efficiently using elemental iodine in the presence of a solid oxidizer, the urea-H(2)O(2) (UHP) adduct. Two types of iodo-functionalization through an electrophilic process were observed: iodination of an aromatic ring, and side-chain iodo-functionalization in the case of arylalkyl ketones. Two reaction routes were established based on the required substrate : iodine : oxidizer ratio for the most efficient iodo-transformation, and the role of UHP was elucidated in each route. The first, requiring a 1 : 0.5 : 0.6 stoichiometric ratio of substrate to iodine to UHP, followed the atom economy concept in regard to iodine and was valid in the case of aniline, 4-t-Bu-phenol, 1,2-dimethoxy benzene, 1,3-dimethoxy benzene, 1,2,3-trimethoxy benzene, 1,2,4-trimethoxy benzene, 1,3,5-trimethoxy benzene, 1-indanone and 1-tetralone. The second reaction route, where a 1 : 1 : 1 stoichiometric ratio of substrate : I(2) : UHP was needed for efficient iodination, was suitable for side-chain iodo-functionalization of acetophenone and methoxy-substituted acetophenones. Moreover, addition of iodine to 1-octene and some phenylacetylenic derivatives was found to proceed efficiently without the presence of any oxidizer and solvent at room temperature.

  1. Standard Gibbs free energies of reactions of ozone with free radicals in aqueous solution: quantum-chemical calculations.

    PubMed

    Naumov, Sergej; von Sonntag, Clemens

    2011-11-01

    Free radicals are common intermediates in the chemistry of ozone in aqueous solution. Their reactions with ozone have been probed by calculating the standard Gibbs free energies of such reactions using density functional theory (Jaguar 7.6 program). O(2) reacts fast and irreversibly only with simple carbon-centered radicals. In contrast, ozone also reacts irreversibly with conjugated carbon-centered radicals such as bisallylic (hydroxycylohexadienyl) radicals, with conjugated carbon/oxygen-centered radicals such as phenoxyl radicals, and even with nitrogen- oxygen-, sulfur-, and halogen-centered radicals. In these reactions, further ozone-reactive radicals are generated. Chain reactions may destroy ozone without giving rise to products other than O(2). This may be of importance when ozonation is used in pollution control, and reactions of free radicals with ozone have to be taken into account in modeling such processes.

  2. Predicting gaseous reaction rates of short chain chlorinated paraffins with ·OH: overcoming the difficulty in experimental determination.

    PubMed

    Li, Chao; Xie, Hong-Bin; Chen, Jingwen; Yang, Xianhai; Zhang, Yifei; Qiao, Xianliang

    2014-12-02

    Short chain chlorinated paraffins (SCCPs) are under evaluation for inclusion in the Stockholm Convention on persistent organic pollutants. However, information on their reaction rate constants with gaseous ·OH (kOH) is unavailable, limiting the evaluation of their persistence in the atmosphere. Experimental determination of kOH is confined by the unavailability of authentic chemical standards for some SCCP congeners. In this study, we evaluated and selected density functional theory (DFT) methods to predict kOH of SCCPs, by comparing the experimental kOH values of six polychlorinated alkanes (PCAs) with those calculated by the different theoretical methods. We found that the M06-2X/6-311+G(3df,2pd)//B3LYP/6-311 +G(d,p) method is time-effective and can be used to predict kOH of PCAs. Moreover, based on the calculated kOH of nine SCCPs and available experimental kOH values of 22 PCAs with low carbon chain, a quantitative structure-activity relationship (QSAR) model was developed. The molecular structural characteristics determining the ·OH reaction rate were discussed. logkOH was found to negatively correlate with the percentage of chlorine substitutions (Cl%). The DFT calculation method and the QSAR model are important alternatives to the conventional experimental determination of kOH for SCCPs, and are prospective in predicting their persistence in the atmosphere.

  3. Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

    PubMed Central

    Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

    2016-01-01

    A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

  4. "Clickable" Polymeric Nanofibers through Hydrophilic-Hydrophobic Balance: Fabrication of Robust Biomolecular Immobilization Platforms.

    PubMed

    Kalaoglu-Altan, Ozlem I; Sanyal, Rana; Sanyal, Amitav

    2015-05-11

    Fabrication of hydrophilic polymeric nanofibers that undergo facile and selective functionalization through metal catalyst-free Diels-Alder "click" reaction in aqueous environment is outlined. Electrospinning of copolymers containing an electron-rich furan moiety, hydrophobic methyl methacrylate units and hydrophilic poly(ethylene glycol)s as side chains provide specifically functionalizable yet antibiofouling fibers that remain stable in aqueous media due to appropriate hydrophobic hydrophilic balance. Efficient functionalization of these nanofibers is accomplished through the Diels-Alder reaction by exposing them to maleimide-containing molecules and ligands. Diels-Alder conjugation based functionalization is demonstrated through attachment of fluorescein-maleimide and a maleimide tethered biotin ligand. Biotinylated nanofibers were utilized to mediate immobilization of the protein streptavidin, as well as streptavidin coated quantum dots. Facile fabrication from readily available polymers and their effective functionalization under mild and reagent-free conditions in aqueous media make these "clickable" nanofibers attractive candidates as functionalizable scaffolds for various biomedical applications.

  5. Ketimine modifications as a route to novel amorphous and derived semicrystalline poly(arylene ether ketone) homo- and copolymers

    NASA Technical Reports Server (NTRS)

    Mohanty, D. K.; Lowery, R. C.; Lyle, G. D.; Mcgrath, J. E.

    1987-01-01

    A series of amine terminal amorphous poly(arylene ether ketone) oligomers of controlled molecular weights (2-15 K) were synthesized. These oligomers have been found to undergo 'self-crosslinking' reactions upon heating above 220 C, via the reaction of the terminal amine groups with the in-chain keto carbonyl functionalities. The resulting networks are ductile, chemically resistant, and nonporous. The networks obtained via generated ketimine functionality were characterized by solid state NMR. They have also been found to be remarkably stable toward hydrolysis. Ketimine functional bishalide monomers have also been synthesized. Such monomers have been utilized to synthesize a wide variety of amorphous poly(arylene ether) ketimine polymers. A high molecular weight hydroquinone functional poly(arylene ether) ketimine has been acid treated to regenerate a poly(arylene ether ketone) backbone in solution. This novel procedure thus allows for the synthesis of important matrix resins under relatively mild conditions.

  6. Body weight-supported training in Becker and limb girdle 2I muscular dystrophy.

    PubMed

    Jensen, Bente R; Berthelsen, Martin P; Husu, Edith; Christensen, Sofie B; Prahm, Kira P; Vissing, John

    2016-08-01

    We studied the functional effects of combined strength and aerobic anti-gravity training in severely affected patients with Becker and Limb-Girdle muscular dystrophies. Eight patients performed 10-week progressive combined strength (squats, calf raises, lunges) and aerobic (walk/run, jogging in place or high knee-lift) training 3 times/week in a lower-body positive pressure environment. Closed-kinetic-chain leg muscle strength, isometric knee strength, rate of force development (RFD), and reaction time were evaluated. Baseline data indicated an intact neural activation pattern but showed compromised muscle contractile properties. Training (compliance 91%) improved functional leg muscle strength. Squat series performance increased 30%, calf raises 45%, and lunges 23%. Anti-gravity training improved closed-kinetic-chain leg muscle strength despite no changes in isometric knee extension strength and absolute RFD. The improved closed-kinetic-chain performance may relate to neural adaptation involving motor learning and/or improved muscle strength of other muscles than the weak knee extensors. Muscle Nerve 54: 239-243, 2016. © 2016 Wiley Periodicals, Inc.

  7. Thermodynamics of enzyme-catalyzed esterifications: II. Levulinic acid esterification with short-chain alcohols.

    PubMed

    Altuntepe, Emrah; Emel'yanenko, Vladimir N; Forster-Rotgers, Maximilian; Sadowski, Gabriele; Verevkin, Sergey P; Held, Christoph

    2017-10-01

    Levulinic acid was esterified with methanol, ethanol, and 1-butanol with the final goal to predict the maximum yield of these equilibrium-limited reactions as function of medium composition. In a first step, standard reaction data (standard Gibbs energy of reaction Δ R g 0 ) were determined from experimental formation properties. Unexpectedly, these Δ R g 0 values strongly deviated from data obtained with classical group contribution methods that are typically used if experimental standard data is not available. In a second step, reaction equilibrium concentrations obtained from esterification catalyzed by Novozym 435 at 323.15 K were measured, and the corresponding activity coefficients of the reacting agents were predicted with perturbed-chain statistical associating fluid theory (PC-SAFT). The so-obtained thermodynamic activities were used to determine Δ R g 0 at 323.15 K. These results could be used to cross-validate Δ R g 0 from experimental formation data. In a third step, reaction-equilibrium experiments showed that equilibrium position of the reactions under consideration depends strongly on the concentration of water and on the ratio of levulinic acid: alcohol in the initial reaction mixtures. The maximum yield of the esters was calculated using Δ R g 0 data from this work and activity coefficients of the reacting agents predicted with PC-SAFT for varying feed composition of the reaction mixtures. The use of the new Δ R g 0 data combined with PC-SAFT allowed good agreement to the measured yields, while predictions based on Δ R g 0 values obtained with group contribution methods showed high deviations to experimental yields.

  8. Prediction of crosslink density of solid propellant binders. [curing of elastomers

    NASA Technical Reports Server (NTRS)

    Marsh, H. E., Jr.

    1976-01-01

    A quantitative theory is outlined which allows calculation of crosslink density of solid propellant binders from a small number of predetermined parameters such as the binder composition, the functionality distributions of the ingredients, and the extent of the curing reaction. The parameter which is partly dependent on process conditions is the extent of reaction. The proposed theoretical model is verified by independent measurement of effective chain concentration and sol and gel fractions in simple compositions prepared from model compounds. The model is shown to correlate tensile data with composition in the case of urethane-cured polyether and certain solid propellants. A formula for the branching coefficient is provided according to which if one knows the functionality distributions of the ingredients and the corresponding equivalent weights and can measure or predict the extent of reaction, he can calculate the branching coefficient of such a system for any desired composition.

  9. Single chain technology: Toward the controlled synthesis of polymer nanostructures

    NASA Astrophysics Data System (ADS)

    Lyon, Christopher

    A technique for fabricating advanced polymer nanostructures enjoying recent popularity is the collapse or folding of single polymer chains in highly dilute solution mediated by intramolecular cross-linking. We term the resultant structures single-chain nanoparticles (SCNP). This technique has proven particularly valuable in the synthesis of nanomaterials on the order of 5 -- 20 nm. Many different types of covalent and non-covalent chemistries have been used to this end. This dissertation investigates the use of so-called single-chain technology to synthesize nanoparticles using modular techniques that allow for easy incorporation of functionality or special structural or characteristic features. Specifically, the synthesis of linear polymers functionalized with pendant monomer units and the subsequent intramolecular polymerization of these monomer units is discussed. In chapter 2, the synthesis of SCNP using alternating radical polymerization is described. Polymers functionalized with pendant styrene and stilbene groups are synthesized via a modular post-polymerization Wittig reaction. These polymers were exposed to radical initiators in the presence (and absence) of maleic anhydride and other electron deficient monomers in order to form intramolecular cross-links. Chapter 3 discusses templated acyclic diene metathesis (ADMET) polymerization using single-chain technology, starting with the controlled ring-opening polymerization of a glycidyl ether functionalized with an ADMET monomer. This polymer was then exposed to Grubbs' catalyst to polymerize the ADMET monomer units. The ADMET polymer was hydrolytically cleaved from the template and separated. Upon characterization, it was found that the daughter ADMET polymer had a similar degree of polymerization, but did not retain the low dispersity of the template. Chapter 4 details the synthesis of aldehyde- and diol-functionalized polymers toward the synthesis of SCNP containing dynamic, acid-degradable acetal cross-links. SCNP fabrication with these materials is beyond the scope of this dissertation.

  10. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  11. Highly porous and mechanically strong ceramic oxide aerogels

    NASA Technical Reports Server (NTRS)

    Johnston, James C. (Inventor); Leventis, Nicholas (Inventor); Ilhan, Ulvi F. (Inventor); Meador, Mary Ann B. (Inventor); Fabrizio, Eve F. (Inventor)

    2012-01-01

    Structurally stable and mechanically strong ceramic oxide aerogels are provided. The aerogels are cross-linked via organic polymer chains that are attached to and extend from surface-bound functional groups provided or present over the internal surfaces of a mesoporous ceramic oxide particle network via appropriate chemical reactions. The functional groups can be hydroxyl groups, which are native to ceramic oxides, or they can be non-hydroxyl functional groups that can be decorated over the internal surfaces of the ceramic oxide network. Methods of preparing such mechanically strong ceramic oxide aerogels also are provided.

  12. Highly porous and mechanically strong ceramic oxide aerogels

    NASA Technical Reports Server (NTRS)

    Fabrizio, Eve F. (Inventor); Leventis, Nicholas (Inventor); Ilhan, Ulvi F. (Inventor); Meador, Mary Ann B. (Inventor); Johnston, James C. (Inventor)

    2010-01-01

    Structurally stable and mechanically strong ceramic oxide aerogels are provided. The aerogels are cross-linked via organic polymer chains that are attached to and extend from surface-bound functional groups provided or present over the internal surfaces of a mesoporous ceramic oxide particle network via appropriate chemical reactions. The functional groups can be hydroxyl groups, which are native to ceramic oxides, or they can be non-hydroxyl functional groups that can be decorated over the internal surfaces of the ceramic oxide network. Methods of preparing such mechanically strong ceramic oxide aerogels also are provided.

  13. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction.

    PubMed

    Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M

    2016-01-19

    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.

  14. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  15. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  16. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  18. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  19. A parallel algorithm for step- and chain-growth polymerization in molecular dynamics.

    PubMed

    de Buyl, Pierre; Nies, Erik

    2015-04-07

    Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

  20. A parallel algorithm for step- and chain-growth polymerization in molecular dynamics

    NASA Astrophysics Data System (ADS)

    de Buyl, Pierre; Nies, Erik

    2015-04-01

    Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

  1. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  2. Pyrene-Functionalized PTMA by NRC for Greater π-π Stacking with rGO and Enhanced Electrochemical Properties.

    PubMed

    Zhang, Kai; Hu, Yuxiang; Wang, Lianzhou; Monteiro, Michael J; Jia, Zhongfan

    2017-10-11

    Nitroxide radical polymers can undergo both excellent electrochemical redox reactions and a rapid "click" coupling reaction with carbon-centered radicals (i.e., nitroxide radical coupling (NRC) reaction). In this work, we report a strategy to functionalize poly(2,2,6,6,-tetramethylpiperidinyl-1-oxyl methacrylate) (PTMA) with pyrene side groups through a rapid and near quantitative NRC reaction. This resulted in P(TMA-co-PyMA) random copolymers with near quantitative amounts of pyrene along the PTMA chain for greater π-π interaction with rGO, while the nitroxide radicals on the polymer could simultaneously be used for energy storage. These copolymers can bind with reduced graphene oxide (rGO) and form layered composites through noncovalent π-π stacking, attaining molecular-level dispersion. Electrochemical performance of the composites with different polymer contents (24, 35, and 45 wt %), tested in lithium ion batteries, indicated that the layered structures consisting of P(TMA-co-PyMA) maintained greater capacities at high C-rates. This simple and efficient strategy to synthesize pyrene-functionalized polymers will provide new opportunities to fabricate many other polymer composite electrodes for desired electrochemical performance.

  3. UV-Induced [2+2] Grafting-To Reactions for Polymer Modification of Cellulose.

    PubMed

    Conradi, Matthias; Ramakers, Gijs; Junkers, Thomas

    2016-01-01

    Benzaldehyde-functional cellulose paper sheets have been synthesized via tosylation of cellulose (Whatman No 5) followed by addition of p-hydroxy benzaldehyde. Via UV-induced Paterno-Büchi [2+2] cycloaddition reactions, these aldehyde functional surfaces are grafted with triallylcyanurate, trimethylolpropane allyl ether, and vinyl chloroacetate. In the following, allyl-functional polymers (poly(butyl acrylate), pBA, Mn = 6990 g mol(-1) , Đ = 1.12 and poly(N-isopropyl acrylamide), pNIPAAm, Mn = 9500 g mol(-1) , Đ = 1.16) synthesized via reversible addition fragmentation chain transfer polymerization are conjugated to the celloluse surface in a UV-induced grafting-to approach. With pBA, hydrophobic cellulose sheets are obtained (water contact angle 116°), while grafting of pNIPAAm allows for generation of "smart" surfaces, which are hydrophilic at room temperature, but that become hydrophobic when heated above the characteristic lower critical solution temperature (93° contact angle). The Paterno-Büchi reaction has been shown to be a versatile synthetic tool that also performs well in grafting-to approaches whereby its overall performance seems to be close to that of radical thiol-ene reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. The Function of Neuroendocrine Cells in Prostate Cancer

    DTIC Science & Technology

    2013-04-01

    integration site. We then performed deep sequencing and aligned reads to the genome. Our analysis revealed that both histological phenotypes are derived from...lentiviral integration site analysis . (B) Laser capture microdissection was performed on individual glands containing both squamous and...lentiviral integration site analysis . LTR: long terminal repeat (viral DNA), PCR: polymerase chain reaction. (D) Venn diagrams depict shared lentiviral

  5. Total Syntheses of (±)-Ovalicin, C4(S*)-Isomer, and Its C5-Analogs and Anti-trypanosomal Activities∥

    PubMed Central

    Hua, Duy H.; Zhao, Huiping; Battina, Srinivas K.; Lou, Kaiyan; Jimenez, Ana L.; Desper, John; Perchellet, Elisabeth M.; Perchellet, Jean-Pierre H.; Chiang, Peter K.

    2008-01-01

    Total syntheses of (±)-ovalicin, its C4(S*)-isomer 44, and C5-side chain intermediate 46 were accomplished via an intramolecular Heck reaction of (Z)-3-(t-butyldimethylsilyloxy)-1-iodo-1,6-heptadiene and a catalytic amount of palladium acetate. Subsequent epoxidation, dihydroxylation, methylation and oxidation led to (3S*,5R*,6R*)-5-methoxy-6-(t-butyldimethylsilyloxy)-1-oxaspiro[2.5]octan-4-one (2), a reported intermediate. The addition of a side chain with cis-1-lithio-1,5-dimethyl-1,4-hexadiene (27) followed by oxidation afforded (±)-ovalicin. The functional group manipulation afforded a number of regio- and stereoisomers, which allow the synthesis of analogs for bioevaluation. The structure of 44 was firmly established via a single-crystal X-ray analysis. The stereochemistry at C4 generated from the addition reactions of alkenyllithium with ketones 2, 40, and 45 is dictated by C6-alkoxy functionality. Anti-trypanosomal activities of various ovalicin analogs and synthetic intermediates were evaluated, and C5-side chain analog, 46, shows the strongest activity. Compound 44 shows antiproliferative effect against HL-60 tumor cells in vitro. Compounds 46 and a precursor, (3S*,4R*,5R*,6R*)-5-methoxy-4-[(E)-1’,5’-dimethylhexa-1’,4’–dienyl)]-6-(t-butyldimethylsilyloxy)-1-oxaspiro[2.5]octan-4-ol (28), may be explored for the development of anti-parasitic drugs. PMID:18356059

  6. Patchy micelles based on coassembly of block copolymer chains and block copolymer brushes on silica particles.

    PubMed

    Zhu, Shuzhe; Li, Zhan-Wei; Zhao, Hanying

    2015-04-14

    Patchy particles are a type of colloidal particles with one or more well-defined patches on the surfaces. The patchy particles with multiple compositions and functionalities have found wide applications from the fundamental studies to practical uses. In this research patchy micelles with thiol groups in the patches were prepared based on coassembly of free block copolymer chains and block copolymer brushes on silica particles. Thiol-terminated and cyanoisopropyl-capped polystyrene-block-poly(N-isopropylacrylamide) block copolymers (PS-b-PNIPAM-SH and PS-b-PNIPAM-CIP) were synthesized by reversible addition-fragmentation chain transfer polymerization and chemical modifications. Pyridyl disulfide-functionalized silica particles (SiO2-SS-Py) were prepared by four-step surface chemical reactions. PS-b-PNIPAM brushes on silica particles were prepared by thiol-disulfide exchange reaction between PS-b-PNIPAM-SH and SiO2-SS-Py. Surface micelles on silica particles were prepared by coassembly of PS-b-PNIPAM-CIP and block copolymer brushes. Upon cleavage of the surface micelles from silica particles, patchy micelles with thiol groups in the patches were obtained. Dynamic light scattering, transmission electron microscopy, and zeta-potential measurements demonstrate the preparation of patchy micelles. Gold nanoparticles can be anchored onto the patchy micelles through S-Au bonds, and asymmetric hybrid structures are formed. The thiol groups can be oxidized to disulfides, which results in directional assembly of the patchy micelles. The self-assembly behavior of the patchy micelles was studied experimentally and by computer simulation.

  7. Oxidative versus Non-oxidative Decarboxylation of Amino Acids: Conditions for the Preferential Formation of Either Strecker Aldehydes or Amines in Amino Acid/Lipid-Derived Reactive Carbonyl Model Systems.

    PubMed

    Zamora, Rosario; León, M Mercedes; Hidalgo, Francisco J

    2015-09-16

    Comparative formation of both 2-phenylethylamine and phenylacetaldehyde as a consequence of phenylalanine degradation by carbonyl compounds was studied in an attempt to understand if the amine/aldehyde ratio can be changed as a function of reaction conditions. The assayed carbonyl compounds were selected because of the presence in the chain of both electron-donating and electron-withdrawing groups and included alkenals, alkadienals, epoxyalkenals, oxoalkenals, and hydroxyalkenals as well as lipid hydroperoxides. The obtained results showed that the 2-phenylethylamine/phenylacetaldehyde ratio depended upon both the carbonyls and the reaction conditions. Thus, it can be increased using electron-donating groups in the chain of the carbonyl compound, small amounts of carbonyl compound, low oxygen content, increasing the pH, or increasing the temperature at pH 6. Opposed conditions (use of electron-withdrawing groups in the chain of the carbonyl compound, large amounts of carbonyl compound, high oxygen contents, low pH values, and increasing temperatures at low pH values) would decrease the 2-phenylethylamine/phenylacetaldehyde ratio, and the formation of aldehydes over amines in amino acid degradations would be favored.

  8. Ring-rearrangement metathesis of nitroso Diels-Alder cycloadducts.

    PubMed

    Vincent, Guillaume; Kouklovsky, Cyrille

    2011-03-01

    Strained nitroso Diels-Alder bicyclo[2.2.1] or [2.2.2] adducts functionalized with alkene side chains of diverse length undergo a ring-rearrangement metathesis process with external alkenes and Grubbs II or Hoveyda-Grubbs II ruthenium catalysts, under microwave irradiation or classical heating, to deliver cis-fused bicycles of various ring sizes, which contain a N-O bond. These scaffolds are of synthetic relevance for the generation of molecular diversity and to the total synthesis of alkaloids. The observation of unexpected reactions, such as epimerization or one-carbon homologation of the alkene side chain, is also reported. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Electrophilic Cleavage and Functionalization of Polyisobutylenes Bearing Unsaturations in the Backbone and Synthesis of Polymers for this Process

    NASA Astrophysics Data System (ADS)

    Campbell, Christopher Garrett

    Polyisobutylene is a polymer of high commercial and academic interest due to its low cost of synthesis, high gas barrier properties, and high chemical and oxidative stability. Polyisobutylene (PIB) can only be synthesized by the cationic polymerization of isobutylene (IB). Commercial processes are currently only capable of producing monofunctional PIB or copolymers thereof. The living cationic polymerization of isobutylene is capable of producing difunctional telechelic PIB, but at the expense of difficultly or expensively synthesized initiators. Thus there exists a need for new synthetic routes for multifunctional PIBs, which can be adopted on a commercial scale. In the first project, we demonstrated a new reaction, which is a subset of the Friedel Crafts alkylation reaction, in which the alkylating carbocation undergoes a cleavage reaction prior to reaction with the aromatic substrate. This reaction was discovered by the observation that when a PIB containing a large amount of coupled fraction was subjected to a mixture of protic and Lewis acids (HCl/TiCl4) in the presence of an alkoxybenzene compound, the coupled fraction was quantitatively converted to its constituent monofunctional chains, which became functionalized by the alkoxybenzene. In the second project, a commercial polymer, poly(isobutylene- co-isoprene) (butyl rubber) was used as a substrate upon which the aforementioned electrophilic cleavage and functionalization reaction was performed. The goal of this project was to degrade a high molecular weight, main-chain olefin-containing copolymer of isobutylene into low molecular weight difunctional telechelic polyisobutylenes. This general process, though not necessarily proceeding by the aforementioned novel chemical reaction, has been described in the literature as "constructive degradation." Though we were unable to synthesize truly telechelic polyisobutylenes by this method, we were able to demonstrate this method as a viable route to low molecular weight multifunctional PIBs. In the third project, we attempted to synthesize a random copolymer, previously reported by Kennedy et al., of isobutylene and 2,4-dimethyl-1,3-pentadiene (DMPD). The interest in this copolymer was based on its structural similarity to the coupled PIB mentioned in the first project. However, we found that these two monomers are not well suited to the creation of random copolymers due to a large difference in reactivity ratios. The project presented in this chapter was then redirected toward the structural characterization of the products of attempted copolymerization and of the homo-polymerization of DMPD. In the fourth project, we investigated the copolymer of isobutylene and beta-pinene as a substrate for the aforementioned cleavage/functionalization reaction. We were able to synthesize high molecular weight copolymers of these two monomers via slurry polymerization catalyzed by either TiCl4 or ethylaluminum dichloride (EADC), and though the degradation and functionalization kinetics were much slower than for butyl rubber, we did observe a drastic decrease in molecular weight accompanied by functionalization of the polymer, thus proving this chemistry is applicable to copolymers of isobutylene other than butyl rubber.

  10. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  11. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  12. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  13. Functionalization of diamond nanoparticles using "click" chemistry.

    PubMed

    Barras, Alexandre; Szunerits, Sabine; Marcon, Lionel; Monfilliette-Dupont, Nicole; Boukherroub, Rabah

    2010-08-17

    The paper reports on covalent linking of different alkyne-containing (decyne, ethynylferrocene, and N-propargyl-1-pyrenecarboxamide) compounds to azide-terminated nanodiamond (ND) particles. Azide-terminated particles (ND-N(3)) were obtained from amine-terminated nanodiamond particles (ND-NH(2)) through the reaction with 4-azidobenzoic acid in the presence of a carbodiimide coupling agent. Functionalized ND particles with long alkyl chain groups can be easily dispersed in various organic solvents without any apparent precipitation after several hours. The course of the reaction was followed using Fourier transform infrared (FT-IR) spectroscopy, UV/vis spectroscopy, fluorescence, cyclic voltammetry, thermogravimetric analysis (TGA), and particle size measurements. The surface loading of pyrene bearing a terminal acetylene group was found to be 0.54 mmol/g. Because of its gentle nature and specificity, the chemistry developed in this work can be used as a general platform for the preparation of functional nanoparticles for various applications.

  14. Electron Transfer Dissociation: Effects of Cation Charge State on Product Partitioning in Ion/Ion Electron Transfer to Multiply Protonated Polypeptides

    PubMed Central

    Liu, Jian; McLuckey, Scott A.

    2012-01-01

    The effect of cation charge state on product partitioning in the gas-phase ion/ion electron transfer reactions of multiply protonated tryptic peptides, model peptides, and relatively large peptides with singly charged radical anions has been examined. In particular, partitioning into various competing channels, such as proton transfer (PT) versus electron transfer (ET), electron transfer with subsequent dissociation (ETD) versus electron transfer with no dissociation (ET,noD), and fragmentation of backbone bonds versus fragmentation of side chains, was measured quantitatively as a function of peptide charge state to allow insights to be drawn about the fundamental aspects of ion/ion reactions that lead to ETD. The ET channel increases relative to the PT channel, ETD increases relative to ET,noD, and fragmentation at backbone bonds increases relative to side-chain cleavages as cation charge state increases. The increase in ET versus PT with charge state is consistent with a Landau-Zener based curve-crossing model. An optimum charge state for ET is predicted by the model for the ground state-to-ground state reaction. However, when the population of excited product ion states is considered, it is possible that a decrease in ET efficiency as charge state increases will not be observed due to the possibility of the population of excited electronic states of the products. Several factors can contribute to the increase in ETD versus ET,noD and backbone cleavage versus side-chain losses. These factors include an increase in reaction exothermicity and charge state dependent differences in precursor and product ion structures, stabilities, and sites of protonation. PMID:23264749

  15. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  16. Short-Chain PEG Mixed-Monolayer Protected Gold Clusters Increase Clearance and Red Blood Cell Counts

    PubMed Central

    Simpson, Carrie A.; Agrawal, Amanda C.; Balinski, Andrzej; Harkness, Kellen M.; Cliffel, David E.

    2011-01-01

    Monolayer-protected gold nanoparticles have great potential as novel building blocks for the design of new drugs and therapeutics based on the easy ability to multifunctionalize them for biological targeting and drug activity. In order to create nanoparticles that are biocompatible in vivo, poly-ethylene glycol functional groups have been added to many previous multifunctionalized particles to eliminate non-specific binding. Recently, monolayer-protected gold nanoparticles with mercaptoglycine functionalities were shown to elicit deleterious effects on the kidney in vivo that were eliminated by incorporating a long-chain, mercapto-undecyl-tetraethylene glycol, at very high loadings into a mixed monolayer. These long-chain PEGs induced an immune response to the particle presumably generating an anti-PEG antibody as seen in other long-chain PEG-ylated nanoparticles in vivo. In the present work, we explore the in vivo effects of high and low percent ratios of a shorter chain, mercapto-tetraethylene glycol, within the monolayer using simple place-exchange reactions. The shorter chain PEG MPCs were expected to have better water solubility due to elimination of the alkyl chain, no toxicity, and long-term circulation in vivo. Shorter chain lengths at lower concentrations should not trigger the immune system into creating an anti-PEG antibody. We found that a 10% molar exchange of this short chain PEG within the monolayer met three of the desired goals: high water solubility, no toxicity, and no immune response as measured by white blood cell counts, but none of the short chain PEG mixed monolayer compositions enabled the nanoparticles to have a long circulation time within the blood as compared to mercapto-undecyl-ethylene glycol, which had a residence time of 4 weeks. We also compared the effects of a hydroxyl versus a carboxylic acid terminal functional group on the end of the PEG thiol on both clearance and immune response. The results indicate that short-chain length PEGs, regardless of termini, increase clearance rates compared to the previous long-chain PEG studies while carboxylated-termini increase red blood cell counts at high loadings. Given these findings, short-chain, alcohol-terminated PEG, exchanged at 10% was identified as a potential nanoparticle for further in vivo applications requiring short circulation lifetimes with desired features of no toxicity, no immune response, and high water solubility. PMID:21473648

  17. Characterizing differences between MSCs and TM cells: Toward autologous stem cell therapies for the glaucomatous trabecular meshwork.

    PubMed

    Snider, Eric J; Vannatta, R Taylor; Schildmeyer, Lisa; Stamer, W Daniel; Ethier, C Ross

    2018-03-01

    Glaucoma, a leading cause of blindness, is characterized by an increase in intraocular pressure, which is largely determined by resistance to aqueous humour outflow through the trabecular meshwork (TM). In glaucoma, the cellularity of the TM is decreased, and, as a result, stem cell therapies for the TM represent a potential therapeutic option for restoring TM function and treating glaucoma patients. We here focus on adipose derived mesenchymal stem cells (MSCs) as a potential autologous cell source for TM regenerative medicine applications and describe characterization techniques at the messenger (reverse transcription-quantitative polymerase chain reaction), protein (western blotting, flow cytometry), and functional (contractility, phagocytosis) levels to distinguish MSCs from TM cells. We present a panel of 12 transcripts to allow: (a) suitable normalization of reverse transcription-quantitative polymerase chain reaction results across cell types and after exposure to potential differentiation stimuli; (b) distinguishing MSCs from TM cells; (c) distinguishing subtypes of TM cells; and (d) distinguishing TM cells from those in neighbouring tissue. At the protein level, dexamethasone induction of myocilin was a robust discriminating factor between MSCs and TM cells and was complemented by other protein markers. Finally, we show that contractility and phagocytosis differ between MSCs and TM cells. These methods are recommended for use in future differentiation studies to fully define if a functional TM-like phenotype is being achieved. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Versatility of Alkyne-Modified Poly(Glycidyl Methacrylate) Layers for Click Reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Soto-Cantu, Dr. Erick; Lokitz, Bradley S; Hinestrosa Salazar, Juan Pablo

    2011-01-01

    Functional soft interfaces are of interest for a variety of technologies. We describe three methods for preparing substrates with alkyne groups, which show versatility for 'click' chemistry reactions. Two of the methods have the same root: formation of thin, covalently attached, reactive interfacial layers of poly(glycidyl methacrylate) (PGMA) via spin coating onto silicon wafers followed by reactive modification with either propargylamine or 5-hexynoic acid. The amine or the carboxylic acid moieties react with the epoxy groups of PGMA, creating interfacial polymer layers decorated with alkyne groups. The third method consists of using copolymers comprising glycidyl methacrylate and propargyl methacrylate (pGP).more » The pGP copolymers are spin coated and covalently attached on silicon wafers. For each method, we investigate the factors that control film thickness and content of alkyne groups using ellipsometry, and study the nanophase structure of the films using neutron reflectometry. Azide-terminated polymers of methacrylic acid and 2-vinyl-4,4-dimethylazlactone synthesized via reversible addition-fragmentation chain transfer polymerization were attached to the alkyne-modified substrates using 'click' chemistry, and grafting densities in the range of 0.007-0.95 chains nm{sup -2} were attained. The maximum density of alkyne groups attained by functionalization of PGMA with propargylamine or 5-hexynoic acid was approximately 2 alkynes nm{sup -3}. The alkyne content obtained by the three decorating approaches was sufficiently high that it was not the limiting factor for the click reaction of azide-capped polymers.« less

  19. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  1. Understanding disordered and unfolded proteins using single-molecule FRET and polymer theory.

    PubMed

    Hofmann, Hagen

    2016-11-17

    Understanding protein folding and the functional properties of intrinsically disordered proteins (IDPs) requires detailed knowledge of the forces that act in polypeptide chains. These forces determine the dimensions and dynamics of unfolded and disordered proteins and have been suggested to impact processes such as the coupled binding and folding of IDPs, or the rate of protein folding reactions. Much of the progress in understanding the physical and chemical properties of unfolded and intrinsically disordered polypeptide chains has been made possible by the recent developments in single-molecule fluorescence techniques. However, the interpretation of the experimental results requires concepts from polymer physics in order to be understood. Here, I review some of the theories used to describe the dimensions of unfolded polypeptide chains under varying solvent conditions together with their more recent application to experimental data.

  2. Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

    PubMed Central

    Liu, Rui; Liang, Xiao; Xiang, Dandan; Guo, Yirong; Liu, Yihua; Zhu, Guonian

    2016-01-01

    Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv) antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb) against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL) to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples. PMID:27338340

  3. Amyloid fibril formation by the chain B subunit of monellin occurs by a nucleation-dependent polymerization mechanism.

    PubMed

    Sabareesan, A T; Udgaonkar, Jayant B

    2014-02-25

    Proteins possessing very different structures, or even no structure, form amyloid fibrils that are very similar in internal structure. This suggests that the mechanisms by which amyloid fibrils form might be very similar, irrespective of whether the fibrils are associated with disease or with normal cellular function, or even if they have no physiological importance. In this context, it is important to have a model protein system whose amyloid fibril formation is robust in its reproducibility, which can reveal the fundamentals of the amyloid fibril reaction that may be applicable to all proteins. In this study, the aggregation mechanism of amyloid fibril formation by chain B of the heterodimeric protein monellin has been elucidated in detail. It is shown that the aggregation reaction meets all the stringent kinetic criteria of a homogeneous nucleation-dependent polymerization mechanism, which is valid over a wide range of protein concentrations. Quantitative analyses of the kinetic data using one approach based on features of the entire kinetic curve, and another based on only the initial rate of aggregation, indicate that the thermodynamic nucleus is a dimer. Spherical oligomers are observed by atomic force microscopy to form transiently early during fibril formation but are off-pathway to the direct fibril formation pathway. It is shown that amyloid fibril formation can be prevented by the addition of chain A of monellin at early stages of chain B aggregation: the two free chains combine to form native monellin, which leads to the dissociation of early aggregates.

  4. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  5. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  6. Actinomyces israelii in radicular cysts: a molecular study.

    PubMed

    Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

    2017-05-01

    To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. REACTOR CONTROL

    DOEpatents

    Ruano, W.J.

    1957-12-10

    This patent relates to nuclear reactors of the type which utilize elongited rod type fuel elements immersed in a liquid moderator and shows a design whereby control of the chain reaction is obtained by varying the amount of moderator or reflector material. A central tank for containing liquid moderator and fuel elements immersed therein is disposed within a surrounding outer tank providing an annular space between the two tanks. This annular space is filled with liquid moderator which functions as a reflector to reflect neutrons back into the central reactor tank to increase the reproduction ratio. Means are provided for circulating and cooling the moderator material in both tanks and additional means are provided for controlling separately the volume of moderator in each tank, which latter means may be operated automatically by a neutron density monitoring device. The patent also shows an arrangement for controlling the chain reaction by injecting and varying an amount of poisoning material in the moderator used in the reflector portion of the reactor.

  8. Mechanics of responsive polymers via conformationally switchable molecules

    NASA Astrophysics Data System (ADS)

    Brighenti, Roberto; Artoni, Federico; Vernerey, Franck; Torelli, Martina; Pedrini, Alessandro; Domenichelli, Ilaria; Dalcanale, Enrico

    2018-04-01

    Active materials are those capable of giving some physical reaction under external stimuli coming from the environment such as temperature, pH, light, mechanical stress, etc. Reactive polymeric materials can be obtained through the introduction of switchable molecules in their network, i.e. molecules having two distinct stable conformations: if properly linked to the hosting polymer chains, the switching from one state to the other can promote a mechanical reaction of the material, detectable at the macroscale, and thus enables us to tune the response according to a desired functionality. In the present paper, the main aspects of the mechanical behavior of polymeric materials with embedded switchable molecules-properly linked to the polymer's chains-are presented and discussed. Starting from the micro mechanisms occurring in such active material, a continuum model is developed, providing a straightforward implementation in computational approaches. Finally, some experimental outcomes related to a switchable molecules (known as quinoxaline cavitands) added to an elastomeric PDMS under chemical stimuli, are presented and quantitatively discussed through the use of the developed mechanical framework.

  9. Intracellular signal propagation in a two-dimensional autocatalytic reaction model.

    PubMed

    Castiglione, F; Bernaschi, M; Succi, S; Heinrich, R; Kirschner, M W

    2002-09-01

    We study a simple reaction scheme in a two-dimensional lattice of particles or molecules with a refractory state. We analyze the dynamics of the propagating front as a function of physical-chemical properties of the host medium. The anisotropy of the medium significantly affects the smoothness of the wave front. Similarly, if particles or molecules may diffuse slowly to neighboring sites, then the front wave is more likely to be irregular. Both situations affect the ability of the whole system to relax to the original state, which is a required feature in the biological cells. Attempts to map this simple reaction scheme to reactions involved in the intracellular pathways suggest that, in some cases, signal transduction might take both connotation of a random walk and a propagating wave, depending on the local density of the medium. In particular, a sufficient condition for the appearance of waves in high-density regions of the media, is the existence of at least one autocatalytic reaction in the chain of reactions characterizing the pathway.

  10. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  11. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  13. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  14. Chemical construction and structural permutation of neurotoxic natural product, antillatoxin: importance of the three-dimensional structure of the bulky side chain

    PubMed Central

    INOUE, Masayuki

    2014-01-01

    Antillatoxin 1 is a unique natural product that displays potent neurotoxic and neuritogenic activities through activation of voltage-gated sodium channels. The peptidic macrocycle of 1 was attached to a side chain with an exceptionally high degree of methylation. In this review, we discuss the total synthesis and biological evaluation of 1 and its analogues. First we describe an efficient synthetic route to 1. This strategy enabled the unified preparation of nine side chain analogues. Structure-activity relationship studies of these analogues revealed that subtle side chain modification leads to dramatic changes in activity, and detailed structural analyses indicated the importance of the overall size and three dimensional shape of the side chain. Based on these data, we designed and synthesized a photoresponsive analogue, proving that the activity of 1 was modulated via a photochemical reaction. The knowledge accumulated through these studies will be useful for the rational design of new tailor-made molecules to control the function and behavior of ion channels. PMID:24522155

  15. Summary of Research/Publications

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Summary of research/publications include:(1) Comment on broadening of water microwave lines by collisions with helium atoms; (2) Calculations of ion-molecule deuterium fractionation reactions involving HD; (3) Ab initio predictions on the rotational spectra of carbon-chain carbene molecules; (4) Theoretical IR spectra of ionized naphthalene; (5) Improved collisional excitation rates for interstellar water; (6) Calculations on the competition between association and reaction for C3H+ + H2; (7) Theoretical infrared spectra of some model polycyclic aromatic hydrocarbons: effect of ionization; (8) Calculations concerning interstellar isomeric abundance ratios for C3H and C3H2; (9) New calculations on the ion-molecule processes C2H2+ + H2 C2H3+ + H and C2H2+ + H2 C2H4+; (10) Anisotropic rigid rotor potential energy function for H2O-H2; (11) A correlated ab initio study of linear carbon-chain radicals CnH (n=2-7); (12) Ab initio characterization of MgCCH, MgCCH+, and MgC2 and pathways to their formation in the interstellar medium; (13) Why HOC+ is detectable in interstellar clouds: The rate of the reaction between HOC+ and H2; (14) A correlated ab initio study of the X 2A 1 and A 2E states of MgCH3; (15) On the stability of interstellar carbon clusters: The rate of the reaction between C3 and O; and (16) The rate of the reaction between CN and C2H2 at interstellar temperatures.

  16. Multitasking mesoporous nanomaterials for biorefinery applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kandel, Kapil

    2013-01-01

    Mesoporous silica nanoparticles (MSNs) have attracted great interest for last two decades due to their unique and advantageous structural properties, such as high surface area, pore volume, stable mesostructure, tunable pore size and controllable particle morphology. The robust silica framework provides sites for organic modifications, making MSNs ideal platforms for adsorbents and supported organocatalysts. In addition, the pores of MSNs provide cavities/ channels for incorporation of metal and metal oxide nanoparticle catalysts. These supported metal nanoparticle catalysts benefit from confined local environments to enhance their activity and selectivity for various reactions. Biomass is considered as a sustainable feedstock with potentialmore » to replace diminishing fossil fuels for the production of biofuels. Among several strategies, one of the promising methods of biofuel production from biomass is to reduce the oxygen content of the feedstock in order to improve the energy density. This can be achieved by creating C-C bonds between biomass derived intermediates to increase the molecular weight of the final hydrocarbon molecules. In this context, pore size and organic functionality of MSNs are varied to obtain the ideal catalyst for a C-C bond forming reaction: the aldol condensation. The mechanistic aspects of this reaction in supported heterogeneous catalysts are explored. The modification of supported organocatalyst and the effect of solvent on the reaction are rationalized. The significance of two functional surfaces of MSNs is exploited by enzyme immobilization on the external surface and organo catalyst functionalization on the internal surface. Using this bifunctional catalyst, the tandem conversion of small chain alcohols into longer chain hydrocarbon molecules is demonstrated. The ability to incorporate metal and metal oxide nanoparticles in the pores and subsequent functionalization led to develop organic modified magnetic MSNs (OM-MSNs) for applications in microalgae biorefinery. Two different integrated biorefinery systems are highlighted. (i) OM-MSNs are used to harvest microalgae and selectively sequester free fatty acids (FFAs). (ii) OM-MSNs are shown to selectively sequester FFAs and convert them into diesel-range liquid hydrocarbon fuels. A similar MSN supported metal nanoparticle catalyst is demonstrated to transform FFAs into green diesel with even greater activity and selectivity. The incorporation of a different organic functional group into MSN provides a selective adsorbent for separation and purification of α-tocopherol from microalgae oil. The functional group with electron deficient aromatic rings demonstrated high sequestration capacity and selectivity of {alpha}-tocopherol.« less

  17. Guaiacol hydrodeoxygenation mechanism on Pt(111): insights from density functional theory and linear free energy relations.

    PubMed

    Lee, Kyungtae; Gu, Geun Ho; Mullen, Charles A; Boateng, Akwasi A; Vlachos, Dionisios G

    2015-01-01

    Density functional theory is used to study the adsorption of guaiacol and its initial hydrodeoxygenation (HDO) reactions on Pt(111). Previous Brønsted-Evans-Polanyi (BEP) correlations for small open-chain molecules are inadequate in estimating the reaction barriers of phenolic compounds except for the side group (methoxy) carbon-dehydrogenation. New BEP relations are established using a select group of phenolic compounds. These relations are applied to construct a potential-energy surface of guaiacol-HDO to catechol. Analysis shows that catechol is mainly produced via dehydrogenation of the methoxy functional group followed by the CHx (x<3) removal of the functional group and hydrogenation of the ring carbon, in contrast to a hypothesis of a direct demethylation path. Dehydroxylation and demethoxylation are slow, implying that phenol is likely produced from catechol but not through its direct dehydroxylation followed by aromatic carbon-ring hydrogenation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. In vitro Fab display: a cell-free system for IgG discovery

    PubMed Central

    Stafford, Ryan L.; Matsumoto, Marissa L.; Yin, Gang; Cai, Qi; Fung, Juan Jose; Stephenson, Heather; Gill, Avinash; You, Monica; Lin, Shwu-Hwa; Wang, Willie D.; Masikat, Mary Rose; Li, Xiaofan; Penta, Kalyani; Steiner, Alex R.; Baliga, Ramesh; Murray, Christopher J.; Thanos, Christopher D.; Hallam, Trevor J.; Sato, Aaron K.

    2014-01-01

    Selection technologies such as ribosome display enable the rapid discovery of novel antibody fragments entirely in vitro. It has been assumed that the open nature of the cell-free reactions used in these technologies limits selections to single-chain protein fragments. We present a simple approach for the selection of multi-chain proteins, such as antibody Fab fragments, using ribosome display. Specifically, we show that a two-chain trastuzumab (Herceptin) Fab domain can be displayed in a format which tethers either the heavy or light chain to the ribosome while retaining functional antigen binding. Then, we constructed synthetic Fab HC and LC libraries and performed test selections against carcinoembryonic antigen (CEA) and vascular endothelial growth factor (VEGF). The Fab selection output was reformatted into full-length immunoglobulin Gs (IgGs) and directly expressed at high levels in an optimized cell-free system for immediate screening, purification and characterization. Several novel IgGs were identified using this cell-free platform that bind to purified CEA, CEA positive cells and VEGF. PMID:24586053

  19. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  20. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  1. Reactions driving conformational movements (molecular motors) in gels: conformational and structural chemical kinetics.

    PubMed

    Otero, Toribio F

    2017-01-18

    In this perspective the empirical kinetics of conducting polymers exchanging anions and solvent during electrochemical reactions to get dense reactive gels is reviewed. The reaction drives conformational movements of the chains (molecular motors), exchange of ions and solvent with the electrolyte and structural (relaxation, swelling, shrinking and compaction) gel changes. Reaction-driven structural changes are identified and quantified from electrochemical responses. The empirical reaction activation energy (E a ), the reaction coefficient (k) and the reaction orders (α and β) change as a function of the conformational energy variation during the reaction. This conformational energy becomes an empirical magnitude. E a , k, α and β include and provide quantitative conformational and structural information. The chemical kinetics becomes structural chemical kinetics (SCK) for reactions driving conformational movements of the reactants. The electrochemically stimulated conformational relaxation model describes empirical results and some results from the literature for biochemical reactions. In parallel the development of an emerging technological world of soft, wet, multifunctional and biomimetic tools and anthropomorphic robots driven by reactions of the constitutive material, as in biological organs, can be now envisaged being theoretically supported by the kinetic model.

  2. New synthesis of maleic anhydride modified polyolefins and their applications

    NASA Astrophysics Data System (ADS)

    Lu, Bing

    Maleic anhydride (MA) modified polyolefins are the most useful commercial functional polyolefins. The current technology of producing MA modified polyolefins, mainly free radical modification, usually results in low MA graft contents, extensive side reactions, and poor control of graft structures. In this thesis, we show a new synthetic route for preparing MA modified polyolefins with excellent control of polymer structures and MA concentrations. The synthesis is based on the "reactive" polyolefin copolymers, i.e. polyolefins containing p-methylstyrene or alkylborane groups. The p-methylstyrene copolymers lead to selectively grafting reactions on the p-methyl groups, greatly reducing the side reactions on the polyolefin backbone. The MA graft content was proportional to the concentration of p-methylstyrene. In the borane approach, under controlled selective oxidation, the alkylborane containing PP polymers formed the "stable" polymeric radical in situ which initiated the graft-from reaction. By varying the monomer concentrations of MA and styrene, reaction time and temperature, a broad range of MA modified PP polymers were prepared from a single MA terminated or grafted PP to a very long SMA segment blocked or grafted PP, and there is no detectable side reaction on the PP backbone. MA modified polyolefins were investigated in the applications of glass fiber reinforced PP, elastomer toughened Nylon, and polyolefin/Nylon blends. The MA modified polyolefin compatibilizers showed the significant improved mechanical properties and morphology of the blends. The effectiveness of compatibilization depends on the MA concentration, molecular weight of the polyolefin segments, the structure of the compatibilizers, and the composition of the blend. By amidation or imidation reaction of MA modified PP with amine terminated PP, long chain branched PP polymers were also prepared. The results of IR, GPC, intrinsic viscosity and DSC studies clearly indicate the formation of long chain branched PP.

  3. Biotin-Functionalized Semiconducting Polymer in an Organic Field Effect Transistor and Application as a Biosensor

    PubMed Central

    Kim, Zin-Sig; Lim, Sang Chul; Kim, Seong Hyun; Yang, Yong Suk; Hwang, Do-Hoon

    2012-01-01

    This report presents biotin-functionalized semiconducting polymers that are based on fluorene and bithiophene co-polymers (F8T2). Also presented is the application of these polymers to an organic thin film transistor used as a biosensor. The side chains of fluorene were partially biotinylated after the esterification of the biotin with corresponding alcohol-groups at the side chain in F8T2. Their properties as an organic semiconductor were tested using an organic thin film transistor (OTFT) and were found to show typical p-type semiconductor curves. The functionality of this biosensor in the sensing of biologically active molecules such as avidin in comparison with bovine serum albumin (BSA) was established through a selective decrease in the conductivity of the transistor, as measured with a device that was developed by the authors. Changes to the optical properties of this polymer were also measured through the change in the color of the UV-fluorescence before and after a reaction with avidin or BSA. PMID:23112654

  4. FabQ, a Dual-Function Dehydratase/Isomerase, Circumvents the Last Step of the Classical Fatty Acid Synthesis Cycle

    PubMed Central

    Bi, Hongkai; Wang, Haihong; Cronan, John E.

    2015-01-01

    SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938

  5. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  6. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  7. Effect of Water Chemistry and Hydrodynamics on Nitrogen Transformation Activity and Microbial Community Functional Potential in Hyporheic Zone Sediment Columns

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yuanyuan; Liu, Chongxuan; Nelson, William C.

    Nitrogen (N) transformation in hyporheic zone (HZ) is an important component in N-cycling in ecosystems. A column study was conducted to investigate N transformation in a HZ sediment with a focus on how characteristic HZ properties including water chemistry, fluid residence time, and dynamic groundwater and surface water exchange affect on N transformation. Metagenomic and quantitative polymerase chain reaction (qPCR) analyses were performed to evaluate the dynamic changes in microbial community structure and its function in response to N transformation. The results indicated that N transformation in the HZ sediment was collectively controlled by microbial community functions including: denitrification, dissimilatorymore » nitrate reduction to ammonium (DNRA), nitrification, and anaerobic ammonium oxidation (anammox). However, the spatial distribution of the microbial community functions and associated biogeochemical reaction rates and products changed quickly in response to experimental perturbation, and was influenced by various factors including water chemistry (dissolved O2 and N species), desorption of sediment associated organic carbon, ion exchange reactions of NH4+, and fluid residence time. The results of this study implied that the microbial community in the HZ would exhibit strong function zonation along N and O gradients, which in turn would control the rates and products of N transformation.« less

  8. Enzymes involved in branched-chain amino acid metabolism in humans.

    PubMed

    Adeva-Andany, María M; López-Maside, Laura; Donapetry-García, Cristóbal; Fernández-Fernández, Carlos; Sixto-Leal, Cristina

    2017-06-01

    Branched-chain amino acids (leucine, isoleucine and valine) are structurally related to branched-chain fatty acids. Leucine is 2-amino-4-methyl-pentanoic acid, isoleucine is 2-amino-3-methyl-pentanoic acid, and valine is 2-amino-3-methyl-butanoic acid. Similar to fatty acid oxidation, leucine and isoleucine produce acetyl-coA. Additionally, leucine generates acetoacetate and isoleucine yields propionyl-coA. Valine oxidation produces propionyl-coA, which is converted into methylmalonyl-coA and succinyl-coA. Branched-chain aminotransferase catalyzes the first reaction in the catabolic pathway of branched-chain amino acids, a reversible transamination that converts branched-chain amino acids into branched-chain ketoacids. Simultaneously, glutamate is converted in 2-ketoglutarate. The branched-chain ketoacid dehydrogenase complex catalyzes the irreversible oxidative decarboxylation of branched-chain ketoacids to produce branched-chain acyl-coA intermediates, which then follow separate catabolic pathways. Human tissue distribution and function of most of the enzymes involved in branched-chain amino acid catabolism is unknown. Congenital deficiencies of the enzymes involved in branched-chain amino acid metabolism are generally rare disorders. Some of them are associated with reduced pyruvate dehydrogenase complex activity and respiratory chain dysfunction that may contribute to their clinical phenotype. The biochemical phenotype is characterized by accumulation of the substrate to the deficient enzyme and its carnitine and/or glycine derivatives. It was established at the beginning of the twentieth century that the plasma level of the branched-chain amino acids is increased in conditions associated with insulin resistance such as obesity and diabetes mellitus. However, the potential clinical relevance of this elevation is uncertain.

  9. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  10. Formylbenzene diazonium hexafluorophosphate reagent for tyrosine-selective modification of proteins and the introduction of a bioorthogonal aldehyde

    PubMed Central

    Gavrilyuk, Julia; Ban, Hitoshi; Nagano, Masanobu; Hakamata, Wataru; Barbas, Carlos F.

    2012-01-01

    4-Formylbenzene diazonium hexafluorophosphate (FBDP) is a novel bench-stable crystalline diazonium salt that reacts selectively with tyrosine to install a bioorthogonal aldehyde functionality. Model studies with N-acyl-tyrosine methylamide allowed us to identify conditions optimal for tyrosine ligation reactions with small peptides and proteins. FBDP-based conjugation was used for the facile introduction of small molecule tags, poly(ethylene) glycol chains (PEGylation), and functional small molecules onto model proteins and to label the surface of living cells. PMID:23181702

  11. Formylbenzene diazonium hexafluorophosphate reagent for tyrosine-selective modification of proteins and the introduction of a bioorthogonal aldehyde.

    PubMed

    Gavrilyuk, Julia; Ban, Hitoshi; Nagano, Masanobu; Hakamata, Wataru; Barbas, Carlos F

    2012-12-19

    4-Formylbenzene diazonium hexafluorophosphate (FBDP) is a novel bench-stable crystalline diazonium salt that reacts selectively with tyrosine to install a bioorthogonal aldehyde functionality. Model studies with N-acyl-tyrosine methylamide allowed us to identify conditions optimal for tyrosine ligation reactions with small peptides and proteins. FBDP-based conjugation was used for the facile introduction of small molecule tags, poly(ethylene glycol) chains (PEGylation), and functional small molecules onto model proteins and to label the surface of living cells.

  12. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  13. {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd elastic scattering and systematic investigation of elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.

    2011-06-15

    The elastic scattering cross sections for the reactions {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd at energies above and below the Coulomb barrier are presented to provide a sensitive test for the {alpha}-nucleus optical potential parameter sets. Additional constraints for the optical potential are taken from the analysis of elastic scattering excitation functions at backward angles which are available in literature. Moreover, the variation of the elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chain is investigated by the study of the ratios of the {sup 106,110,116}Cd({alpha},{alpha}){sup 106,110,116}Cd scattering cross sections at E{sub cm{approx_equal}}15.6and18.8 MeV and the ratio of themore » {sup 110}Cd({alpha},{alpha}){sup 110}Cd and {sup 112}Sn({alpha},{alpha}){sup 112}Sn reaction cross sections at E{sub cm{approx_equal}}18.8 MeV, respectively. These ratios are sensitive probes for the {alpha}-nucleus optical potential parametrizations. The potentials under study are a basic prerequisite for the prediction of {alpha}-induced reaction cross sections (e.g., for the calculation of stellar reaction rates in the astrophysical p or {gamma} process).« less

  14. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  15. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  16. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  17. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  18. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  19. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  20. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  1. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  2. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  3. Monte Carlo Simulation of Endlinking Oligomers

    NASA Technical Reports Server (NTRS)

    Hinkley, Jeffrey A.; Young, Jennifer A.

    1998-01-01

    This report describes initial efforts to model the endlinking reaction of phenylethynyl-terminated oligomers. Several different molecular weights were simulated using the Bond Fluctuation Monte Carlo technique on a 20 x 20 x 20 unit lattice with periodic boundary conditions. After a monodisperse "melt" was equilibrated, chain ends were linked whenever they came within the allowed bond distance. Ends remained reactive throughout, so that multiple links were permitted. Even under these very liberal crosslinking assumptions, geometrical factors limited the degree of crosslinking. Average crosslink functionalities were 2.3 to 2.6; surprisingly, they did not depend strongly on the chain length. These results agreed well with the degrees of crosslinking inferred from experiment in a cured phenylethynyl-terminated polyimide oligomer.

  4. Scope and mechanism in palladium-catalyzed isomerizations of highly substituted allylic, homoallylic, and alkenyl alcohols.

    PubMed

    Larionov, Evgeny; Lin, Luqing; Guénée, Laure; Mazet, Clément

    2014-12-03

    Herein we report the palladium-catalyzed isomerization of highly substituted allylic alcohols and alkenyl alcohols by means of a single catalytic system. The operationally simple reaction protocol is applicable to a broad range of substrates and displays a wide functional group tolerance, and the products are usually isolated in high chemical yield. Experimental and computational mechanistic investigations provide complementary and converging evidence for a chain-walking process consisting of repeated migratory insertion/β-H elimination sequences. Interestingly, the catalyst does not dissociate from the substrate in the isomerization of allylic alcohols, whereas it disengages during the isomerization of alkenyl alcohols when additional substituents are present on the alkyl chain.

  5. Synthesis, reactivity and application studies for different biolubricants

    PubMed Central

    2014-01-01

    Vegetable oils have different unique properties owing to their unique chemical structure. Vegetable oils have a greater ability to lubricate and have higher viscosity indices. Therefore, they are being more closely examined as base oil for biolubricants and functional fluids. In spite of their many advantages, vegetable oils suffer from two major drawbacks of inadequate oxidative stability and poor low-temperature properties, which hinder their utilization as biolubricant base oils. Transforming alkene groups in fatty acids to other stable functional groups could improve the oxidative stability, whereas reducing structural uniformity of the oil by attaching alkyl side chains could improve the low-temperature performance. In that light, the epoxidation of unsaturated fatty acids is very interesting as it can provide diverse side chains arising from the mono- or di-epoxidation of the unsaturated fatty acid. Oxirane ring opening by an acid-catalyzed reaction with a suitable reagent provides interesting polyfunctional compounds. PMID:24612780

  6. Chemical wiring and soldering toward all-molecule electronic circuitry.

    PubMed

    Okawa, Yuji; Mandal, Swapan K; Hu, Chunping; Tateyama, Yoshitaka; Goedecker, Stefan; Tsukamoto, Shigeru; Hasegawa, Tsuyoshi; Gimzewski, James K; Aono, Masakazu

    2011-06-01

    Key to single-molecule electronics is connecting functional molecules to each other using conductive nanowires. This involves two issues: how to create conductive nanowires at designated positions, and how to ensure chemical bonding between the nanowires and functional molecules. Here, we present a novel method that solves both issues. Relevant functional molecules are placed on a self-assembled monolayer of diacetylene compound. A probe tip of a scanning tunneling microscope is then positioned on the molecular row of the diacetylene compound to which the functional molecule is adsorbed, and a conductive polydiacetylene nanowire is fabricated by initiating chain polymerization by stimulation with the tip. Since the front edge of chain polymerization necessarily has a reactive chemical species, the created polymer nanowire forms chemical bonding with an encountered molecular element. We name this spontaneous reaction "chemical soldering". First-principles theoretical calculations are used to investigate the structures and electronic properties of the connection. We demonstrate that two conductive polymer nanowires are connected to a single phthalocyanine molecule. A resonant tunneling diode formed by this method is discussed. © 2011 American Chemical Society

  7. Combinatorial approaches to gene recognition.

    PubMed

    Roytberg, M A; Astakhova, T V; Gelfand, M S

    1997-01-01

    Recognition of genes via exon assembly approaches leads naturally to the use of dynamic programming. We consider the general graph-theoretical formulation of the exon assembly problem and analyze in detail some specific variants: multicriterial optimization in the case of non-linear gene-scoring functions; context-dependent schemes for scoring exons and related procedures for exon filtering; and highly specific recognition of arbitrary gene segments, oligonucleotide probes and polymerase chain reaction (PCR) primers.

  8. Silane cross-linkable ethylene-propylene elastomer compositions prepared by reactive processing

    NASA Astrophysics Data System (ADS)

    Kozawa, Eiji; Nakajima, Yasuo; Kim, Jae Kyung

    2015-05-01

    Thermoplastic Elastomers (TPEs) have received attention as the alternative materials of EPDM due to an advantage for mass production. In recent years, by the progress of polymerization technology, Ethylene-propylene Elastomer (EP), one of the TPEs, is beginning to be applied to many products because of its good properties as rubber. However, as much as a complete replacement for EPDM, it is not provided with sufficient properties. In such circumstance, we found that EP's performance properties can be further enhanced via chemical modification such as cross-linking. The advent of a newer technique, involving the grafting of organo-functional silane onto the polymer chain in the reaction extrusion process is more attractive due to various industrial advantages. Although the functionalization of the EP by silane grafting through reactive processing is very useful, the silane grafting process of EP has a difficulty. It is most likely a consequence of the nature of the PP chain scission (β-scission), which is the dominant reaction in PP when subjected to free radicals at elevated temperature during processing. Therefore, the objective of our current work is to investigate a reactive extrusion process for the silane cross-linkable EP while minimizing the degradation, as well as evaluate the properties of the modified polymer.

  9. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    PubMed

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Formation of nucleoside 5'-polyphosphates from nucleotides and trimetaphosphate

    NASA Technical Reports Server (NTRS)

    Lohrmann, R.

    1975-01-01

    Nucleoside 5'-polyphosphates (N5PP) formed when solutions of nucleoside 5'-phosphates (N5P) and trimetaphosphate (TMP) are dessicated at room temperature are studied by paper chromatography, electrophoresis, and metal catalytic reactions. Divalent Mg ion exhibited superior catalytic function to other divalent metal ions in the reaction. Major reaction products are indicated. The importance of the N5PP series, TMP, and N5-triphosphate as substrates of RNA and DNA synthesis, and under postulated prebiotic conditions likely to obtain during prebiological ages of the earth, is emphasized and discussed. Alternate drying and wetting, evaporation from a prebiotic puddle, concentration of solubles in the remaining liquid phase, metal catalysis, and the role of these substances in the formation of amino acids and long-chain polyphosphates are considered.

  11. Immobilization of lipases in hydrophobic chitosan for selective hydrolysis of fish oil: The impact of support functionalization on lipase activity, selectivity and stability.

    PubMed

    Urrutia, P; Arrieta, R; Alvarez, L; Cardenas, C; Mesa, M; Wilson, L

    2018-03-01

    The objective of this paper was to carry out an integral study of the use of hydrophobic chitosan as a low-cost support for immobilizing lipases and their further application in the selective hydrolysis of fish oil. Chitosan functionalized with different alkyl chains (C4, C8, C12) were characterized by FTIR, TGA, SEM, and Rose Bengal adsorption. Lipase B from Candida antarctica (CalB) and lipase from Rhizomucor miehei (RML) were immobilized obtaining a higher expressed activity at a longer alkyl chain length of support. Biocatalyst thermal stability showed that the impact of the alkyl chain length on enzyme stabilization varied according to the lipase source. The biocatalysts were applied in menhaden oil hydrolysis. Total polyunsaturated fatty acids released after 30 h of reaction with lipases immobilized in butyl, octyl and dodecyl-chitosan was 60, 107, and 90 mM for CalB biocatalysts, and 560, 392, and 50 mM for RML biocatalysts, respectively. Selectivity of CalB was not affected by the alkyl chain, while in the case of RML, a higher selectivity to cis-4,7,10,13,16,19-docohexaenoic acid release was obtained with dodecyl-chitosan. In conclusion, the adequate functionalization of chitosan varied according to lipase source, affecting their activity, stability and performance in the hydrolysis of fish oil. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  13. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  14. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  15. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  16. A new polyester based on allyl α-hydroxy glutarate as shell for magnetite nanoparticles

    NASA Astrophysics Data System (ADS)

    Nan, Alexandrina; Feher, Ioana Coralia

    2017-12-01

    Allyl side-chain-functionalized lactide was synthesized from commercially available glutamic acid and polymerized by ring opening polymerization using 4-dimethylaminopyridine as an organocatalyst in the presence of magnetic nanoparticles. The resulting magnetic nanostructures coated with the allyl-containing polyester were then functionalized with cysteine by thiol-ene click reaction leading to highly functionalized magnetic nano-platforms of practical interest. The polyester precursors were characterized by nuclear magnetic resonance and mass spectrometry. The morphology of magnetic nanostructures based on the functionalized polyester was determined by transmission electron microscopy TEM, while the chemical structure was investigated by FT-IR. TGA investigations and the magnetic properties of the magnetic nanostructures are also described.

  17. Selective and Orthogonal Post-Polymerization Modification using Sulfur(VI) Fluoride Exchange (SuFEx) and Copper-Catalyzed Azide–Alkyne Cycloaddition (CuAAC) Reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oakdale, James S.; Kwisnek, Luke; Fokin, Valery V.

    2016-06-10

    Functional polystyrenes and polyacrylamides, containing combinations of fluorosulfate, aromatic silyl ether, and azide side chains, were used as scaffolds to demonstrate the postpolymerization modification capabilities of sulfur(VI) fluoride exchange (SuFEx) and CuAAC chemistries. Fluorescent dyes bearing appropriate functional groups were sequentially attached to the backbone of the copolymers, quantitatively and selectively addressing their reactive partners. Furthermore, this combined SuFEx and CuAAC approach proved to be robust and versatile, allowing for a rare accomplishment: triple orthogonal functionalization of a copolymer under essentially ambient conditions without protecting groups.

  18. On the mobility of iron particles embedded in elastomeric silicone matrix

    NASA Astrophysics Data System (ADS)

    Rabindranath, R.; Böse, H.

    2013-02-01

    In this contribution the rheological and magnetorheological properties of different polydimethylsiloxane (PDMS) based magnetorheological elastomers (MRE) are presented and discussed. In order to investigate the mobility of the iron particles with respect to the rheological characteristics, the iron particles were silanized with vinyltrimethoxysilane to enable a reaction between the modified particle and the cross-linking agent of the silicone elastomer. In addition, the vinyl-functionalized particles were further modified by the coupling of the superficial vinyl groups with a long-chain hydride terminated PDMS, which enables a reaction pathway with the vinyl terminated PDMS. On the other hand, the iron particles were treated with surfactants such as fatty acids, calcium and aluminum soaps, respectively, prior to vulcanization in order to increase the mobility of the iron particles in the elastomeric matrix. It was found, that both, the modification with the long-chain hydride terminated PDMS as well as the treatment with surfactants lead to an increase of the storage modulus G', the loss modulus G" and the loss factor tan δ in the magnetic field. It is concluded that both modifications, the coupling with long-chain hydride terminated PDMS as well as the treatment with surfactants, provide a greater mobility of the iron particles and hence a greater friction represented by the increase of the loss factor tan δ. Consequently it is assumed that untreated iron particles are less mobile in the rubber matrix due to covalent bonding with the silicone components, most likely due to the reaction of the hydroxyl groups on the metal surface with the silane groups of the cross-linking agent.

  19. Long-time behavior and Turing instability induced by cross-diffusion in a three species food chain model with a Holling type-II functional response.

    PubMed

    Haile, Dawit; Xie, Zhifu

    2015-09-01

    In this paper, we study a strongly coupled reaction-diffusion system describing three interacting species in a food chain model, where the third species preys on the second one and simultaneously the second species preys on the first one. An intra-species competition b2 among the second predator is introduced to the food chain model. This parameter produces some very interesting result in linear stability and Turing instability. We first show that the unique positive equilibrium solution is locally asymptotically stable for the corresponding ODE system when the intra-species competition exists among the second predator. The positive equilibrium solution remains linearly stable for the reaction diffusion system without cross diffusion, hence it does not belong to the classical Turing instability scheme. But it becomes linearly unstable only when cross-diffusion also plays a role in the reaction-diffusion system, hence the instability is driven solely from the effect of cross diffusion. Our results also exhibit some interesting combining effects of cross-diffusion, intra-species competitions and inter-species interactions. Numerically, we conduct a one parameter analysis which illustrate how the interactions change the existence of stable equilibrium, limit cycle, and chaos. Some interesting dynamical phenomena occur when we perform analysis of interactions in terms of self-production of prey and intra-species competition of the middle predator. By numerical simulations, it illustrates the existence of nonuniform steady solutions and new patterns such as spot patterns, strip patterns and fluctuations due to the diffusion and cross diffusion in two-dimension. Published by Elsevier Inc.

  20. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  1. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  2. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  3. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  4. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  5. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  6. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  7. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  8. Synthesis and fabrication of sized-controlled nanoparticles: Using surface self-assemblies as building blocks for developing supralattices on nanocomposite materials

    NASA Astrophysics Data System (ADS)

    Yee, Chanel Kitmon

    2001-10-01

    A general one-phase synthesis for self-assembling thiols onto gold, platinum, palladium and iridium nanoparticles using tetrahydrofuran (THF) as the solvent, and lithium triethylborohydride (superhydride) as the reducing agent, is presented. Using the same synthetic procedure gold nanoparticles functionalized with 11-hydroxyundecane-1-thiol and 4'-bromo-4-mercaptobiphenyl were prepared to show that the availability and reflexibility of this method could lead to surface fabrication with various type of facial moieties. Alkyl selenide- and alkyl thiolate-functionalized gold nanoparticles were also prepared by the same method at 6°C. The properties were compared to their counterparts made at 25°C. The formation of the Se-Au bond and S-Au bonds was investigated by transmission Fourier transform infrared spectroscopy (FTIR), while the bond nature in each case was examined by x-ray photoelectron spectroscopy (XPS). Particle size was determined by Transmission Electron Microscopy (TEM), and further confirmed by ultraviolet spectroscopy (UV). Superparamagnetic Fe and Fe2O3 nanoparticles were synthesized by ultrasound irradiation and post-fabricated with alkyl sulfonic acids of various chain lengths and octadecyl phosphonic acid. TEM reveals nanoparticles of 5--10 mn in diameter. FTIR spectra suggest that the alkyl chains are packed in a solid-like assembly with packing disorder increasing with the decreasing chain length. The octadecyl sulfonic acid coating displays the lowest magnetization within the sulfonic acid series, which may be explained by the high packing and ordering of the alkyl chains on the particle surface. The smallest value of magnetization in the OPA case suggests that the spin-state of surface Fe3+ ions is affected by the bonded surfactant, and that the phosphonate empty d-orbitals increase magnetic interactions between neighboring Fe3+ spins. To build superstructures beyond the monolayer level, a general route for the attachment of amino-terminated biomolecules to nanoparticles was proposed. Thiophene thiolate-functionalized platinum nanoparticles were prepared and reacted with nitrosonium tetrafluoroborate to provide the nitroso-functionalized nanoparticles. The reaction of the nitroso group with primary amines to yield strong N=N bonds might provide a general route for the attachment of amino-terminated biomolecules to nanoparticles. The attachment of two cytidine molecules to platinum nanoparticles was accomplished, and experimental data were provided to demonstrate the intended grafting reaction.

  9. Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

    PubMed

    Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

    2017-11-01

    In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

  10. Formation of pyroglutamic acid from N-terminal glutamic acid in immunoglobulin gamma antibodies.

    PubMed

    Chelius, Dirk; Jing, Kay; Lueras, Alexis; Rehder, Douglas S; Dillon, Thomas M; Vizel, Alona; Rajan, Rahul S; Li, Tiansheng; Treuheit, Michael J; Bondarenko, Pavel V

    2006-04-01

    The status of the N-terminus of proteins is important for amino acid sequencing by Edman degradation, protein identification by shotgun and top-down techniques, and to uncover biological functions, which may be associated with modifications. In this study, we investigated the pyroglutamic acid formation from N-terminal glutamic acid residues in recombinant monoclonal antibodies. Almost half the antibodies reported in the literature contain a glutamic acid residue at the N-terminus of the light or the heavy chain. Our reversed-phase high-performance liquid chromatography-mass spectrometry method could separate the pyroglutamic acid-containing light chains from the native light chains of reduced and alkylated recombinant monoclonal antibodies. Tryptic peptide mapping and tandem mass spectrometry of the reduced and alkylated proteins was used for the identification of the pyroglutamic acid. We identified the formation of pyroglutamic acid from N-terminal glutamic acid in the heavy chains and light chains of several antibodies, indicating that this nonenzymatic reaction does occur very commonly and can be detected after a few weeks of incubation at 37 and 45 degrees C. The rate of this reaction was measured in several aqueous buffers with different pH values, showing minimal formation of pyroglutamic acid at pH 6.2 and increased formation of pyroglutamic acid at pH 4 and pH 8. The half-life of the N-terminal glutamic acid was approximately 9 months in a pH 4.1 buffer at 45 degrees C. To our knowledge, we showed for the first time that glutamic acid residues located at the N-terminus of proteins undergo pyroglutamic acid formation in vitro.

  11. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  12. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  13. Interfacial and Alloying Effects on Activation of Ethanol from First-Principles

    DOE PAGES

    An, Wei; Men, Yong; Wang, Jinguo; ...

    2017-02-24

    Here, we present a first-principles density-functional theory study of ethanol activation at oxide/Rh(111) interface and the alloying effect on mitigating carbon deposition, which are essential to direct ethanol fuel cell (DEFC) anode reaction and steam reforming of ethanol (SRE) reaction. Our calculated results show that charge can transfer from Rh(111) substrate to MO x chain (e.g., MoO 3 and MnO 2), or from MO x chain (e.g., MgO, SnO 2, ZrO 2, and TiO 2) to Rh(111) substrate. The OH-binding strength is increased exponentially with M δ+ charge ranging from 1.4 to 2.2, which renders MnO 2/Rh(111) and MgO/Rh(111) interfacesmore » weaker OH-binding, and thereby enhanced oxidizing functionality of OH* for promoting ethanol oxidation reaction (EOR) at DEFC anode. For efficient C–C bond breaking, a large number of Rh ensemble sizes are critically needed at the interface of MO x/Rh(111). We found that Rh 1Au 3 near surface alloy has the weakest C* and CO* binding, followed by Rh 1Cu 3 and Rh 1Pd 3 near surface alloys, while Rh 1Ir 3 and Rh 1Ru 3 surface alloys have C* and CO* binding strength similar to that of pure Rh metal. The general implication of this study is that by engineering alloyed structure of weakened C* and CO* binding complemented with metal oxides of weakened OH-binding, high-performance DEFC anode or SRE catalysts can be identified.« less

  14. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  16. Pyrolysis Pathways of Sulfonated Polyethylene, an Alternative Carbon Fiber Precursor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Younker, Jarod M; Saito, Tomonori; Hunt, Marcus A

    2013-01-01

    Sulfonated polyethylene is an emerging precursor for the production of carbon fibers. Pyrolysis of sulfonated polyethylene was characterized by thermogravimetric analysis (TGA). n-heptane-4-sulfonic acid (H4S) was selected as a model compound for the study of sulfonated polyethylene. Density functional theory and conventional transition state theory were used to determine the rate constants of pyrolysis for H4S from 300-1000 K. Multiple reaction channels from two different mechanisms were explored: 1) internal five-centered elimination (Ei 5) and 2) radical chain reaction. The pyrolysis of H4S was simulated with kinetic Monte Carlo (kMC) to obtain TGA plots that compared favorably to experiment. Wemore » observed that at tem- peratures < 550 K, the radical mechanism was dominant and yielded the trans-alkene, whereas cis-alkene was formed at higher temperatures from the internal elimination. The maximum rates of % mass loss became independent of initial OH radical concentration at 440-480 K. Experimentally, the maximum % mass loss occurred from 440-460 K (heating rate dependent). Activation energies derived from the kMC-simulated TGAs of H4S (26-29 kcal/mol) agreed with experiment for sulfonated polyethylene ( 31 kcal/mol). The simulations revealed that in this region, decomposition of radical HOSO2 became competitive to H abstraction by HOSO2, making OH the carrying radical for the reaction chain. The maximum rate of % mass loss for internal elimination was observed at temperatures > 600 K. Low-scale carbonization utilizes temperatures < 620 K; thus, internal elimination will not be competitive. Ei5 elimination has been studied for sulfoxides and sulfones, but this represents the first study of internal elimination in sulfonic acids. Nonlinear Arrhenius plots were found for all bimolecular reactions. The most significant nonlinear behavior was observed for reactions where the barrier was small. For reactions with low activation barriers, nonlinearity was traced to conflicting trends between the exponential temperature dependence of the energetic term and the temperature dependence of the vibrational partition function of the transitional modes.« less

  17. Effect of Heterogeneous Chemical Reactions on the Köhler Activation of Aqueous Organic Aerosols.

    PubMed

    Djikaev, Yuri S; Ruckenstein, Eli

    2018-05-03

    We study some thermodynamic aspects of the activation of aqueous organic aerosols into cloud droplets considering the aerosols to consist of liquid solution of water and hydrophilic and hydrophobic organic compounds, taking into account the presence of reactive species in the air. The hydrophobic (surfactant) organic molecules on the surface of such an aerosol can be processed by chemical reactions with some atmospheric species; this affects the hygroscopicity of the aerosol and hence its ability to become a cloud droplet either via nucleation or via Köhler activation. The most probable pathway of such processing involves atmospheric hydroxyl radicals that abstract hydrogen atoms from hydrophobic organic molecules located on the aerosol surface (first step), the resulting radicals being quickly oxidized by ubiquitous atmospheric oxygen molecules to produce surface-bound peroxyl radicals (second step). These two reactions play a crucial role in the enhancement of the Köhler activation of the aerosol and its evolution into a cloud droplet. Taking them and a third reaction (next in the multistep chain of relevant heterogeneous reactions) into account, one can derive an explicit expression for the free energy of formation of a four-component aqueous droplet on a ternary aqueous organic aerosol as a function of four independent variables of state of a droplet. The results of numerical calculations suggest that the formation of cloud droplets on such (aqueous hydrophilic/hydrophobic organic) aerosols is most likely to occur as a Köhler activation-like process rather than via nucleation. The model allows one to determine the threshold parameters of the system necessary for the Köhler activation of such aerosols, which are predicted to be very sensitive to the equilibrium constant of the chain of three heterogeneous reactions involved in the chemical aging of aerosols.

  18. Degradable polymeric nanoparticles by aggregation of thermoresponsive polymers and ``click'' chemistry

    NASA Astrophysics Data System (ADS)

    Dworak, Andrzej; Lipowska, Daria; Szweda, Dawid; Suwinski, Jerzy; Trzebicka, Barbara; Szweda, Roza

    2015-10-01

    This study describes a novel approach to the preparation of crosslinked polymeric nanoparticles of controlled sizes that can be degraded under basic conditions. For this purpose thermoresponsive copolymers containing azide and alkyne functions were obtained by ATRP of di(ethylene glycol) monomethyl ether methacrylate (D) and 2-aminoethyl methacrylate (A) followed by post polymerization modification. The amino groups of A were reacted with propargyl chloroformate or 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, which led to two types of copolymers. Increasing the temperature of aqueous solutions of the mixed copolymers caused their aggregation into spherical nanoparticles composed of both types of chains. Their dimensions could be controlled by changing the concentration and heating rate of the solutions. Covalent stabilization of aggregated chains was performed by a ``click'' reaction between the azide and alkyne groups. Due to the presence of a carbamate bond the nanoparticles undergo pH dependent degradation under mild basic conditions. The proposed procedure opens a route to new carriers for the controlled release of active species.This study describes a novel approach to the preparation of crosslinked polymeric nanoparticles of controlled sizes that can be degraded under basic conditions. For this purpose thermoresponsive copolymers containing azide and alkyne functions were obtained by ATRP of di(ethylene glycol) monomethyl ether methacrylate (D) and 2-aminoethyl methacrylate (A) followed by post polymerization modification. The amino groups of A were reacted with propargyl chloroformate or 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, which led to two types of copolymers. Increasing the temperature of aqueous solutions of the mixed copolymers caused their aggregation into spherical nanoparticles composed of both types of chains. Their dimensions could be controlled by changing the concentration and heating rate of the solutions. Covalent stabilization of aggregated chains was performed by a ``click'' reaction between the azide and alkyne groups. Due to the presence of a carbamate bond the nanoparticles undergo pH dependent degradation under mild basic conditions. The proposed procedure opens a route to new carriers for the controlled release of active species. Electronic supplementary information (ESI) available: GPC-MALLS chromatograms for P(D-co-A)_1 and P(D-co-A)_2 copolymers, absorbance spectra of P(D-co-A)_1, P(D-co-A)_2, P(D-co-A_Pr) and P(D-co-A_Az) after reaction with ninhydrine. See DOI: 10.1039/c5nr04448k

  19. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  20. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  1. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

    PubMed

    Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

    2013-05-07

    We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

  2. Gelation-driven selection in dynamic covalent C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 C/CN exchange.

    PubMed

    Liang, Chunshuang; Kulchat, Sirinan; Jiang, Shimei; Lehn, Jean-Marie

    2017-10-01

    Knoevenagel barbiturate derivatives bearing long alkyl chains were proven to form organogels in suitable solvents based on supramolecular interactions. Their reaction with imines allows for component exchange through CC/CN recombination. The effect of various parameters (solvents, chain length, and temperature) on the CC/CN exchange reaction has been studied. Mixing Knoevenagel compound K and imine I-16 in a 1 : 1 ratio generated a constitutional dynamic library containing the four constituents K , I-16 , K'-16 , and I' . The reversible exchange reaction was monitored by 1 H-NMR, showing marked changes in the fractions of the four constituents on sol-gel interconversion as a function of temperature. The library composition changed from statistical distribution of the four constituents in the sol state to selective amplification of the gel forming K'-16 constituent together with that of its agonist I' . The process amounts to self-organization driven component selection in a constitutional dynamic organogel system undergoing gelation. This process displays up-regulation of the gel-forming constituent by component redistribution through reversible covalent connections.

  3. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

    PubMed

    Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-06-23

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

  4. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  5. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  6. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  7. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  8. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  9. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  10. Mitochondrial respiratory chain complexes as sources and targets of thiol-based redox-regulation.

    PubMed

    Dröse, Stefan; Brandt, Ulrich; Wittig, Ilka

    2014-08-01

    The respiratory chain of the inner mitochondrial membrane is a unique assembly of protein complexes that transfers the electrons of reducing equivalents extracted from foodstuff to molecular oxygen to generate a proton-motive force as the primary energy source for cellular ATP-synthesis. Recent evidence indicates that redox reactions are also involved in regulating mitochondrial function via redox-modification of specific cysteine-thiol groups in subunits of respiratory chain complexes. Vice versa the generation of reactive oxygen species (ROS) by respiratory chain complexes may have an impact on the mitochondrial redox balance through reversible and irreversible thiol-modification of specific target proteins involved in redox signaling, but also pathophysiological processes. Recent evidence indicates that thiol-based redox regulation of the respiratory chain activity and especially S-nitrosylation of complex I could be a strategy to prevent elevated ROS production, oxidative damage and tissue necrosis during ischemia-reperfusion injury. This review focuses on the thiol-based redox processes involving the respiratory chain as a source as well as a target, including a general overview on mitochondria as highly compartmentalized redox organelles and on methods to investigate the redox state of mitochondrial proteins. This article is part of a Special Issue entitled: Thiol-Based Redox Processes. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Atom Transfer Radical Polymerization of Functionalized Vinyl Monomers Using Perylene as a Visible Light Photocatalyst

    PubMed Central

    Theriot, Jordan C.; Ryan, Matthew D.; French, Tracy A.; Pearson, Ryan M.; Miyake, Garret M.

    2016-01-01

    A standardized technique for atom transfer radical polymerization of vinyl monomers using perylene as a visible-light photocatalyst is presented. The procedure is performed under an inert atmosphere using air- and water-exclusion techniques. The outcome of the polymerization is affected by the ratios of monomer, initiator, and catalyst used as well as the reaction concentration, solvent, and nature of the light source. Temporal control over the polymerization can be exercised by turning the visible light source off and on. Low dispersities of the resultant polymers as well as the ability to chain-extend to form block copolymers suggest control over the polymerization, while chain end-group analysis provides evidence supporting an atom-transfer radical polymerization mechanism. PMID:27166728

  12. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  13. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  14. Chemical Modification of Polysaccharides

    PubMed Central

    Cumpstey, Ian

    2013-01-01

    This review covers methods for modifying the structures of polysaccharides. The introduction of hydrophobic, acidic, basic, or other functionality into polysaccharide structures can alter the properties of materials based on these substances. The development of chemical methods to achieve this aim is an ongoing area of research that is expected to become more important as the emphasis on using renewable starting materials and sustainable processes increases in the future. The methods covered in this review include ester and ether formation using saccharide oxygen nucleophiles, including enzymatic reactions and aspects of regioselectivity; the introduction of heteroatomic nucleophiles into polysaccharide chains; the oxidation of polysaccharides, including oxidative glycol cleavage, chemical oxidation of primary alcohols to carboxylic acids, and enzymatic oxidation of primary alcohols to aldehydes; reactions of uronic-acid-based polysaccharides; nucleophilic reactions of the amines of chitosan; and the formation of unsaturated polysaccharide derivatives. PMID:24151557

  15. Thermoswitchable Janus Gold Nanoparticles with Stimuli-Responsive Hydrophilic Polymer Brushes.

    PubMed

    Niu, Xiaoqin; Ran, Fen; Chen, Limei; Lu, Gabriella Jia-En; Hu, Peiguang; Deming, Christopher P; Peng, Yi; Rojas-Andrade, Mauricio D; Chen, Shaowei

    2016-05-03

    Well-defined thermoswitchable Janus gold nanoparticles with stimuli-responsive hydrophilic polymer brushes were fabricated by combining ligand exchange reactions and the Langmuir technique. Stimuli-responsive polydi(ethylene glycol) methyl ether methacrylate was prepared by addition-fragmentation chain-transfer polymerization. The polymer brushes were then anchored onto the nanoparticle surface by interfacial ligand exchange reactions with hexanethiolate-protected gold nanoparticles, leading to the formation of a hydrophilic (polymer) hemisphere and a hydrophobic (hexanethiolate) one. The resulting Janus nanoparticles showed temperature-switchable wettability, hydrophobicity at high temperatures, and hydrophilicity at low temperatures, due to thermally induced conformational transition of the polymer ligands. The results further highlight the importance of interfacial engineering in the deliberate functionalization of nanoparticle materials.

  16. Do dihydroxymagnesium carboxylates form Grignard-type reagents? A theoretical investigation on decarboxylative fragmentation.

    PubMed

    Ruf, Alexander; Kanawati, Basem; Schmitt-Kopplin, Philippe

    2018-03-27

    Dihydroxymagnesium carboxylates [(OH) 2 MgO 2 CR] were probed for decarboxylation on a theoretical level, by utilizing both Møller-Plesset perturbation theory (MP2) and density functional theory (B3LYP-DFT) computations. This study is connected to the question of whether this recently introduced, astrobiologically relevant chemical class may form Grignard-type reagent molecules. To extract trends for a broad molecular mass range, different linear alkyl chain lengths between C 4 and C 11 were computed. The forward energy barrier for decarboxylation reactions increases linearly as a function of the ligand's chain length. Decarboxylation-type fragmentations of these organomagnesium compounds seem to be improbable in non-catalytic, low energetic environments. A high forward energy barrier (E MP2  > 55 kcal mol -1 ) towards a described transition state restricts the release of CO 2 . Nevertheless, we propose the release of CO 2 on a theoretical level, as been revealed via an intramolecular nucleophilic attack mechanism. Once the challenging transition state for decarboxylation is overcome, a stable Mg-C bond is formed. These mechanistic insights were gained by help of natural bond orbital analysis. The Cα atom (first carbon atom in the ligand chain attached to the carboxyl group) is thought to prefer binding towards the electrophilic magnesium coordination center, rather than towards the electrophilic CO 2 -carbon atom. Additionally, the putatively formed Grignard-type OH-bearing product molecules possess a more polarized Mg-C bond in comparison to RMgCl species. Therefore, carbanion formation from OH-bearing Grignard-type molecules is made feasible for triggering C-C bond formation reactions. Graphical abstract This study asks whether recently introduced, astrobiologically dihydroxymagnesium carboxylates form Grignard-type reagent molecules via decarboxylative fragmentation.

  17. Exact dynamic properties of molecular motors

    NASA Astrophysics Data System (ADS)

    Boon, N. J.; Hoyle, R. B.

    2012-08-01

    Molecular motors play important roles within a biological cell, performing functions such as intracellular transport and gene transcription. Recent experimental work suggests that there are many plausible biochemical mechanisms that molecules such as myosin-V could use to achieve motion. To account for the abundance of possible discrete-stochastic frameworks that can arise when modeling molecular motor walks, a generalized and straightforward graphical method for calculating their dynamic properties is presented. It allows the calculation of the velocity, dispersion, and randomness ratio for any proposed system through analysis of its structure. This article extends work of King and Altman ["A schematic method of deriving the rate laws of enzyme-catalyzed reactions," J. Phys. Chem. 60, 1375-1378 (1956)], 10.1021/j150544a010 on networks of enzymatic reactions by calculating additional dynamic properties for spatially hopping systems. Results for n-state systems are presented: single chain, parallel pathway, divided pathway, and divided pathway with a chain. A novel technique for combining multiple system architectures coupled at a reference state is also demonstrated. Four-state examples illustrate the effectiveness and simplicity of these methods.

  18. Long-range electron tunneling.

    PubMed

    Winkler, Jay R; Gray, Harry B

    2014-02-26

    Electrons have so little mass that in less than a second they can tunnel through potential energy barriers that are several electron-volts high and several nanometers wide. Electron tunneling is a critical functional element in a broad spectrum of applications, ranging from semiconductor diodes to the photosynthetic and respiratory charge transport chains. Prior to the 1970s, chemists generally believed that reactants had to collide in order to effect a transformation. Experimental demonstrations that electrons can transfer between reactants separated by several nanometers led to a revision of the chemical reaction paradigm. Experimental investigations of electron exchange between redox partners separated by molecular bridges have elucidated many fundamental properties of these reactions, particularly the variation of rate constants with distance. Theoretical work has provided critical insights into the superexchange mechanism of electronic coupling between distant redox centers. Kinetics measurements have shown that electrons can tunnel about 2.5 nm through proteins on biologically relevant time scales. Longer-distance biological charge flow requires multiple electron tunneling steps through chains of redox cofactors. The range of phenomena that depends on long-range electron tunneling continues to expand, providing new challenges for both theory and experiment.

  19. On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

    PubMed

    Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

    2017-09-01

    Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Highly sensitive antibody-aptamer sensor for vascular endothelial growth factor based on hybridization chain reaction and pH meter/indicator.

    PubMed

    Xu, Huifeng; Kou, Fangxia; Ye, Hongzhi; Wang, Zongwen; Huang, Suixin; Liu, Xianxiang; Zhu, Xi; Lin, Zhenyu; Chen, Guonan

    2017-12-01

    Vascular endothelial growth factor (VEGF) is a crucial signaling protein for the tumor growth and metastasis, which is also acted as the biomarkers for various diseases. In this research, we fabricate an aptamer-antibody sensor for point-of-care test of VEGF. Firstly, target VEGF is captured by antibody immobilized on the microplate, and then binds with aptamer to form the sandwich structure. Next, with the assist of glucose oxidase (GOx)-functionalized ssDNAs, hybridization chain reaction occurs using the aptamer as the primer. Thus, GOx are greatly gathered on the microplate, which catalyzes the oxidization of glucose, leading to the pH change. As a result, the detect limit at a signal-to-noise was estimated to be 0.5pg/mL of target by pH meter, and 1.6pg/mL of VEGF was able to be distinguished by naked eyes. Meanwhile, this method has been used assay VEGF in the serum with the satisfactory results. Copyright © 2017. Published by Elsevier B.V.

  1. Novel surface-active oligofructose fatty acid mono-esters by enzymatic esterification.

    PubMed

    van Kempen, Silvia E H J; Boeriu, Carmen G; Schols, Henk A; de Waard, Pieter; van der Linden, Erik; Sagis, Leonard M C

    2013-06-01

    This article describes the synthesis of a series of oligofructose monoesters with fatty acids of different chain length (C8, C12, C16 and C18) to obtain food-grade surfactants with a range of amphiphilicity. Reactions were performed in a mixture of DMSO/Bu(t)OH (10/90 v/v) at 60°C and catalysed by immobilised Candida antarctica lipase B. MALDI-TOF-MS analysis showed that the crude reaction products were mixtures of unmodified oligofructose and mostly mono-esters. The conversion into mono-esters increased with the length of the fatty acid chain, reflecting the specificity of the lipase towards more lipophilic substrates. Reverse phase solid phase extraction was used to fractionate the products, which lead to sufficient purity (>93%) of the fatty acid esters for functionality testing. It was shown that derivatives of longer (C16 and C18) fatty acids were more efficient in lowering surface tension and gave a much higher dilatational modulus than derivatives of the shorter (C8 and C12) fatty acids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Design and preparation of bi-functionalized short-chain modified zwitterionic nanoparticles.

    PubMed

    Hu, Fenglin; Chen, Kaimin; Xu, Hong; Gu, Hongchen

    2018-05-01

    An ideal nanomaterial for use in the bio-medical field should have a distinctive surface capable of effectively preventing nonspecific protein adsorption and identifying target bio-molecules. Recently, the short-chain zwitterion strategy has been suggested as a simple and novel approach to create outstanding anti-fouling surfaces. In this paper, the carboxyl end group of short-chain zwitterion-coated silica nanoparticles (SiO 2 -ZWS) was found to be difficult to functionalize via a conventional EDC/NHS strategy due to its rapid hydrolysis side-reactions. Hence, a series of bi-functionalized silica nanoparticles (SiO 2 -ZWS/COOH) were designed and prepared by controlling the molar ratio of 3-aminopropyltriethoxysilane (APTES) to short-chain zwitterionic organosiloxane (ZWS) in order to achieve above goal. The synthesized SiO 2 -ZWS/COOH had similar excellent anti-fouling properties compared with SiO 2 -ZWS, even in 50% fetal bovine serum characterized by DLS and turbidimetric titration. Subsequently, SiO 2 -ZWS/COOH 5/1 was chosen as a representative and then demonstrated higher detection signal intensity and more superior signal-to-noise ratios compare with the pure SiO 2 -COOH when they were used as a bio-carrier for chemiluminescence enzyme immunoassay (CLEIA). These unique bi-functionalized silica nanoparticles have many potential applications in the diagnostic and therapeutic fields. Reducing nonspecific protein adsorption and enhancing the immobilized efficiency of specific bio-probes are two of the most important issues for bio-carriers, particularly for a nanoparticle based bio-carrier. Herein, we designed and prepared a bi-functional nanoparticle with anti-fouling property and bio conjugation capacity for further bioassay by improving the short-chain zwitterionic modification strategy we have proposed previously. The heterogeneous surface of this nanoparticle showed effective anti-fouling properties both in model protein solutions and fetal bovine serum (FBS). The modified nanoparticles can also be successfully functionalized with a specific antibody for CLEIA assay with a prominent bio-detection performance even in 50% FBS. In this paper, we also investigated an unexpectedly fast hydrolysis behavior of NHS-activated carboxylic groups within the pure short-chain zwitterionic molecule that led to no protein binding in the short-chain zwitterion modified nanoparticle. Our findings pave a new way for the designing of high performance bio-carriers, demonstrating their strong potential as a robust platform for diagnosis and therapy. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  3. Randomizing Genome-Scale Metabolic Networks

    PubMed Central

    Samal, Areejit; Martin, Olivier C.

    2011-01-01

    Networks coming from protein-protein interactions, transcriptional regulation, signaling, or metabolism may appear to have “unusual” properties. To quantify this, it is appropriate to randomize the network and test the hypothesis that the network is not statistically different from expected in a motivated ensemble. However, when dealing with metabolic networks, the randomization of the network using edge exchange generates fictitious reactions that are biochemically meaningless. Here we provide several natural ensembles of randomized metabolic networks. A first constraint is to use valid biochemical reactions. Further constraints correspond to imposing appropriate functional constraints. We explain how to perform these randomizations with the help of Markov Chain Monte Carlo (MCMC) and show that they allow one to approach the properties of biological metabolic networks. The implication of the present work is that the observed global structural properties of real metabolic networks are likely to be the consequence of simple biochemical and functional constraints. PMID:21779409

  4. Annihilation of photochemical reactivity of photo-alignment layer.

    PubMed

    Hong, S H; Hwang, Y J; Lee, S G; Shin, D M

    2008-09-01

    The gas-polymer and liquid-polymer interfacial reactions of photosensitive polyimide can annihilate photo-reactive carbon-carbon double bonds, which remain after photo-alignment process. The annihilation processes dramatically affect voltage holding ratio and reorientation of photo-active functional groups. Photochemical dimerizations were identified using UV-visible and FT-IR spectroscopy. Polyimide films containing cinnamate groups were irradiated by linear polarized ultra violet (LPUV) light. Schadt et al. claims that the photo-alignment results from the anisotropy depletion of the cinnamate side chains as a consequence of the (2+2) cycloaddition reactions. The photo-aligned polyimide induces the orientation of nematic liquid crystals perpendicular to the polarization axis. However, the un-reacted photo-sensitive functional groups generate problems such as image sticking and reduced contrast ratio. Voltage holding ratio and photo-fading observed from photo-alignment layer can be dramatically improved by annihilation process of remnant photoreactive groups.

  5. The Role of Glycine Residues 140 and 141 of Subunit B in the Functional Ubiquinone Binding Site of the Na+-pumping NADH:quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Neehaul, Yashvin; Turk, Erin; Chahboun, Najat; DeMicco, Jessica M.; Hellwig, Petra; Barquera, Blanca

    2012-01-01

    The Na+-pumping NADH:quinone oxidoreductase (Na+-NQR) is the main entrance for electrons into the respiratory chain of many marine and pathogenic bacteria. The enzyme accepts electrons from NADH and donates them to ubiquinone, and the free energy released by this redox reaction is used to create an electrochemical gradient of sodium across the cell membrane. Here we report the role of glycine 140 and glycine 141 of the NqrB subunit in the functional binding of ubiquinone. Mutations at these residues altered the affinity of the enzyme for ubiquinol. Moreover, mutations in residue NqrB-G140 almost completely abolished the electron transfer to ubiquinone. Thus, NqrB-G140 and -G141 are critical for the binding and reaction of Na+-NQR with its electron acceptor, ubiquinone. PMID:22645140

  6. Towards thiol functionalization of vanadium pentoxide nanotubes using gold nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lavayen, V.; O'Dwyer, C.; Cardenas, G.

    2007-04-12

    Template-directed synthesis is a promising route to realize vanadate-based 1-D nanostructures, an example of which is the formation of vanadium pentoxide nanotubes and associated nanostructures. In this work, we report the interchange of long-chained alkyl amines with alkyl thiols. This reaction was followed using gold nanoparticles prepared by the Chemical Liquid Deposition (CLD) method with an average diameter of {approx}0.9nm and a stability of {approx}85 days. V{sub 2}O{sub 5} nanotubes (VOx-NTs) with lengths of {approx}2{mu}m and internal hollow diameters of 20-100nm were synthesized and functionalized in a Au-acetone colloid with a nominal concentration of {approx}4x10{sup -3}mol dm{sup -3}. The interchangemore » reaction with dodecylamine is found only to occur in polar solvents and incorporation of the gold nanoparticles is not observed in the presence of n-decane.« less

  7. Synthesis of hydrogel via click chemistry for DNA electrophoresis.

    PubMed

    Finetti, Chiara; Sola, Laura; Elliott, Jim; Chiari, Marcella

    2017-09-01

    This work introduces a novel sieving gel for DNA electrophoresis using a classical click chemistry reaction, the copper (I)-catalyzed azide-alkyne cycloaddition (CuAAC), to cross-link functional polymer chains. The efficiency of this reaction provides, under mild conditions, hydrogels with near-ideal network connectivity and improved physical properties. Hydrogel formation via click chemistry condensation of functional polymers does not involve the use of toxic monomers and UV initiation. The performance of the new hydrogel in the separation of double stranded DNA fragments was evaluated in the 2200 TapeStation system, an analytical platform, recently introduced by Agilent that combines the advantages of CE in terms of miniaturization and automation with the simplicity of use of slab gel electrophoresis. The click gel enables addition of florescent dyes prior to electrophoresis with considerable improvement of resolution and separation efficiency over conventional cross-linked polyacrylamide gels. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  9. An optimized chemical synthesis of human relaxin-2.

    PubMed

    Barlos, Kostas K; Gatos, Dimitrios; Vasileiou, Zoe; Barlos, Kleomenis

    2010-04-01

    Human gene 2 relaxin (RLX) is a member of the insulin superfamily and is a multi-functional factor playing a vital role in pregnancy, aging, fibrosis, cardioprotection, vasodilation, inflammation, and angiogenesis. RLX is currently applied in clinical trials to cure among others acute heart failure, fibrosis, and preeclampsia. The synthesis of RLX by chemical methods is difficult because of the insolubility of its B-chain and the required laborious and low yielding site-directed combination of its A (RLXA) and B (RLXB) chains. We report here that oxidation of the Met(25) residue of RLXB improves its solubility, allowing its effective solid-phase synthesis and application in random interchain combination reactions with RLXA. Linear Met(O)(25)-RLX B-chain (RLXBO) reacts with a mixture of isomers of bicyclic A-chain (bcRLXA) giving exclusively the native interchain combination. Applying this method Met(O)(25)-RLX (RLXO) was obtained in 62% yield and was easily converted to RLX in 78% yield, by reduction with ammonium iodide. Copyright (c) 2010 European Peptide Society and John Wiley & Sons, Ltd.

  10. Ionizable side chains at catalytic active sites of enzymes.

    PubMed

    Jimenez-Morales, David; Liang, Jie; Eisenberg, Bob

    2012-05-01

    Catalytic active sites of enzymes of known structure can be well defined by a modern program of computational geometry. The CASTp program was used to define and measure the volume of the catalytic active sites of 573 enzymes in the Catalytic Site Atlas database. The active sites are identified as catalytic because the amino acids they contain are known to participate in the chemical reaction catalyzed by the enzyme. Acid and base side chains are reliable markers of catalytic active sites. The catalytic active sites have 4 acid and 5 base side chains, in an average volume of 1,072 Å(3). The number density of acid side chains is 8.3 M (in chemical units); the number density of basic side chains is 10.6 M. The catalytic active site of these enzymes is an unusual electrostatic and steric environment in which side chains and reactants are crowded together in a mixture more like an ionic liquid than an ideal infinitely dilute solution. The electrostatics and crowding of reactants and side chains seems likely to be important for catalytic function. In three types of analogous ion channels, simulation of crowded charges accounts for the main properties of selectivity measured in a wide range of solutions and concentrations. It seems wise to use mathematics designed to study interacting complex fluids when making models of the catalytic active sites of enzymes.

  11. Ionizable Side Chains at Catalytic Active Sites of Enzymes

    PubMed Central

    Jimenez-Morales, David; Liang, Jie

    2012-01-01

    Catalytic active sites of enzymes of known structure can be well defined by a modern program of computational geometry. The CASTp program was used to define and measure the volume of the catalytic active sites of 573 enzymes in the Catalytic Site Atlas database. The active sites are identified as catalytic because the amino acids they contain are known to participate in the chemical reaction catalyzed by the enzyme. Acid and base side chains are reliable markers of catalytic active sites. The catalytic active sites have 4 acid and 5 base side chains, in an average volume of 1072 Å3. The number density of acid side chains is 8.3 M (in chemical units); the number density of basic side chains is 10.6 M. The catalytic active site of these enzymes is an unusual electrostatic and steric environment in which side chains and reactants are crowded together in a mixture more like an ionic liquid than an ideal infinitely dilute solution. The electrostatics and crowding of reactants and side chains seems likely to be important for catalytic function. In three types of analogous ion channels, simulation of crowded charges accounts for the main properties of selectivity measured in a wide range of solutions and concentrations. It seems wise to use mathematics designed to study interacting complex fluids when making models of the catalytic active sites of enzymes. PMID:22484856

  12. Synthesis, magnetic properties and electronic structure of the S  =  ½ uniform spin chain system InCuPO5

    NASA Astrophysics Data System (ADS)

    Koteswararao, B.; Hazra, Binoy K.; Rout, Dibyata; Srinivasarao, P. V.; Srinath, S.; Panda, S. K.

    2017-07-01

    We have studied the structural and magnetic properties and electronic structure of the compound InCuPO5 synthesized by a solid state reaction method. The structure of InCuPO5 comprises S  =  ½ uniform spin chains formed by corner-shared CuO4 units. Magnetic susceptibility (χ(T)) data show a broad maximum at about 65 K, a characteristic feature of one-dimensional (1D) magnetism. The χ(T) data are fitted to the coupled S  =  ½ Heisenberg antiferromagnetic (HAFM) uniform chain model that gives the intra-chain coupling (J/k B) between nearest-neighbor Cu2+ ions as  -100 K and the ratio of inter-chain to intra-chain coupling (J‧/J) as about 0.07. The exchange couplings estimated from the magnetic data analysis are in good agreement with the values computed from the electronic structure calculations based on the density functional theory  +  Hubbard U (DFT  +  U) approach. The combination of theoretical and experimental analysis confirms that InCuPO5 is a candidate material for weakly coupled S  = ½ uniform chains. A detailed theoretical analysis of the electronic structure further reveals that the system is insulating with a gap of 2.4 eV and a local moment of 0.70 µ B/Cu.

  13. Remote carboxylation of halogenated aliphatic hydrocarbons with carbon dioxide

    NASA Astrophysics Data System (ADS)

    Juliá-Hernández, Francisco; Moragas, Toni; Cornella, Josep; Martin, Ruben

    2017-05-01

    Catalytic carbon-carbon bond formation has enabled the streamlining of synthetic routes when assembling complex molecules. It is particularly important when incorporating saturated hydrocarbons, which are common motifs in petrochemicals and biologically relevant molecules. However, cross-coupling methods that involve alkyl electrophiles result in catalytic bond formation only at specific and previously functionalized sites. Here we describe a catalytic method that is capable of promoting carboxylation reactions at remote and unfunctionalized aliphatic sites with carbon dioxide at atmospheric pressure. The reaction occurs via selective migration of the catalyst along the hydrocarbon side-chain with excellent regio- and chemoselectivity, representing a remarkable reactivity relay when compared with classical cross-coupling reactions. Our results demonstrate that site-selectivity can be switched and controlled, enabling the functionalization of less-reactive positions in the presence of a priori more reactive ones. Furthermore, we show that raw materials obtained in bulk from petroleum processing, such as alkanes and unrefined mixtures of olefins, can be used as substrates. This offers an opportunity to integrate a catalytic platform en route to valuable fatty acids by transforming petroleum-derived feedstocks directly.

  14. Polymerization and Structure of Bio-Based Plastics: A Computer Simulation

    NASA Astrophysics Data System (ADS)

    Khot, Shrikant N.; Wool, Richard P.

    2001-03-01

    We recently examined several hundred chemical pathways to convert chemically functionalized plant oil triglycerides, monoglycerides and reactive diluents into high performance plastics with a broad range of properties (US Patent No. 6,121,398). The resulting polymers had linear, branched, light- and highly-crosslinked chain architectures and could be used as pressure sensitive adhesives, elastomers and high performance rigid thermoset composite resins. To optimize the molecular design and minimize the number of chemical trials in this system with excess degrees of freedom, we developed a computer simulation of the free radical polymerization process. The triglyceride structure, degree of chemical substitution, mole fractions, fatty acid distribution function, and reaction kinetic parameters were used as initial inputs on a 3d lattice simulation. The evolution of the network fractal structure was computed and used to measure crosslink density, dangling ends, degree of reaction and defects in the lattice. The molecular connectivity was used to determine strength via a vector percolation model of fracture. The simulation permitted the optimal design of new bio-based materials with respect to monomer selection, cure reaction conditions and desired properties. Supported by the National Science Foundation

  15. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  16. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  17. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  18. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  19. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  20. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  1. Improving TCO-Conjugated Antibody Reactivity for Bioorthogonal Pretargeting

    NASA Astrophysics Data System (ADS)

    Chu, Tina Tingyi

    Cancer remains a major cause of death because of its unpredictable progression. Utilizing bioorthogonal chemistry between trans-cyclooctene (TCO) and tetrazine to target imaging agents to tumors in two subsequent steps offers a more versatile platform for molecular imaging. This is accomplished by pretargeting TCO-modified primary antibody to cell surface biomarkers, followed by delivery of tetrazine-modified imaging probes. In previous work, it has been established that TCO-tetrazine chemistry can be applied to in vivo imaging, resulting in precise tumor detection. However, most TCO modifications on an antibody are not reactive because they are buried within hydrophobic domains. To expose and improve the reactivity, Rahim et al. incorporated a polyethylene glycol (PEG) linker through a two-step reaction with DBCO-azide, which successfully maintained 100% TCO functionality. In this project, various types of linkers were studied to improve the reactivity in a single step. Three primary types of linkers were studied: hydrophilic PEG chains, hydrophobic short linkers, and amphiphilic linkers. Our results show that PEG chain alone can only maintain 40% TCO reactivity. Unexpectedly, a short alkyl chain (valeric acid) provided superior results, with 60% TCO reactivity. Lengthening the alkyl chain did not improve results further. Finally, an amphiphilic linker containing valeric acid and PEG performed worse than either linker type alone, at ˜30% functionality. We conclude that our previous 100% functional TCO result obtained with the two-step coupling may have stemmed from generation of the DBCO/azide cycloaddition product. Future work will explore factors such as rigidity of linker structure, polarity, or charges.

  2. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  3. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  4. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  5. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  6. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  7. Design and integration of an all-in-one biomicrofluidic chip

    PubMed Central

    Liu, Liyu; Cao, Wenbin; Wu, Jingbo; Wen, Weijia; Chang, Donald Choy; Sheng, Ping

    2008-01-01

    We demonstrate a highly integrated microfluidic chip with the function of DNA amplification. The integrated chip combines giant electrorheological-fluid actuated micromixer and micropump with a microheater array, all formed using soft lithography. Internal functional components are based on polydimethylsiloxane (PDMS) and silver∕carbon black-PDMS composites. The system has the advantages of small size with a high degree of integration, high polymerase chain reaction efficiency, digital control and simple fabrication at low cost. This integration approach shows promise for a broad range of applications in chemical synthesis and biological sensing∕analysis, as different components can be combined to target desired functionalities, with flexible designs of different microchips easily realizable through soft lithography. PMID:19693370

  8. A Motif in the Clathrin Heavy Chain Required for the Hsc70/Auxilin Uncoating Reaction

    PubMed Central

    Rapoport, Iris; Boll, Werner; Yu, Anan; Böcking, Till

    2008-01-01

    The 70-kDa heat-shock cognate protein (Hsc70) chaperone is an ATP-dependent “disassembly enzyme” for many subcellular structures, including clathrin-coated vesicles where it functions as an uncoating ATPase. Hsc70, and its cochaperone auxilin together catalyze coat disassembly. Like other members of the Hsp70 chaperone family, it is thought that ATP-bound Hsc70 recognizes the clathrin triskelion through an unfolded exposed hydrophobic segment. The best candidate is the unstructured C terminus (residues 1631–1675) of the heavy chain at the foot of the tripod below the hub, containing the sequence motif QLMLT, closely related to the sequence bound preferentially by the substrate groove of Hsc70 (Fotin et al., 2004b). To test this hypothesis, we generated in insect cells recombinant mammalian triskelions that in vitro form clathrin cages and clathrin/AP-2 coats exactly like those assembled from native clathrin. We show that coats assembled from recombinant clathrin are good substrates for ATP- and auxilin-dependent, Hsc70-catalyzed uncoating. Finally, we show that this uncoating reaction proceeds normally when the coats contain recombinant heavy chains truncated C-terminal to the QLMLT motif, but very inefficiently when the motif is absent. Thus, the QLMLT motif is required for Hsc-70–facilitated uncoating, consistent with the proposal that this sequence is a specific target of the chaperone. PMID:17978091

  9. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  10. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  11. The effect of Pd ensemble structure on the O2 dissociation and CO oxidation mechanisms on Au—Pd(100) surface alloys

    NASA Astrophysics Data System (ADS)

    Oǧuz, Ismail-Can; Mineva, Tzonka; Guesmi, Hazar

    2018-01-01

    The reactivity of various Pd ensembles on the Au—Pd(100) alloy catalyst toward CO oxidation was investigated by using density functional theory (DFT). This study was prompted by the search for efficient catalysts operating at low temperature for the CO oxidation reaction that is of primary environmental importance. To this aim, we considered Pd modified Au(100) surfaces including Pd monomers, Pd dimers, second neighboring Pd atoms, and Pd chains in a comparative study of the minimum energy reaction pathways. The effect of dispersion interactions was included in the calculations of the O2 dissociation reaction pathway by using the DFT-D3 scheme. The addition of the dispersion interaction strongly improves the adsorption ability of O2 on the Au—Pd surface but does not affect the activation energy barriers of the Transitions States (TSs). As for O2 to dissociate, it is imperative that the TS has lower activation energy than the O2 desorption energy. DFT-D3 is found to favor, in some cases, O2 dissociation on configurations being identified from uncorrected DFT calculations as inactive. This is the case of the second neighboring Pd configuration for which uncorrected DFT predicts positive Gibbs free energy (ΔG) of the O2 adsorption, therefore an endergonic reaction. With the addition of D3 correction, ΔG becomes negative that reveals a spontaneous O2 adsorption. Among the investigated Au—Pd (100) ensembles, the Pd chain dissociates most easily O2 and highly stabilizes the dissociated O atoms; however, it has an inferior reactivity toward CO oxidation and CO2 formation. Indeed, CO strongly adsorbs on the palladium bridge sites and therefore poisoning the surface Pd chain. By contrast, the second neighboring Pd configuration that shows somewhat lower ability to dissociate O2 turns out to be more reactive in the CO2 formation step. These results evidence the complex effect of Pd ensembles on the CO oxidation reaction. Associative CO oxidation proceeds with high energy barriers on all the considered Pd ensembles and should be excluded, in agreement with experimental observations.

  12. The molecular genetic basis of mitochondrial malfunction in bladder tissue following outlet obstruction.

    PubMed

    Levin, Robert M; Hudson, Alan P

    2004-08-01

    Bladder dysfunction following partial outlet obstruction is a frequent consequence of benign prostatic hyperplasia and an increasingly common problem given the aging of the general population. Recent studies from this and other groups have begun to elucidate the molecular bases for the well described physiological malfunctions that characterize this clinical entity. We summarized and synthesized that information. Using modern methods of molecular genetics, including real-time polymerase chain reaction, real-time reverse transcriptase-polymerase chain reaction and others, as well as traditional experimental techniques such as electron microscopy we and others examined the transcriptional profile, morphology, etc of bladder smooth muscle mitochondria in experimental models of outlet obstruction. Data from many studies have demonstrated that aberrant gene expression in the mitochondrial and mitochondria related nuclear genetic systems underlies the loss of compliance and other attributes of bladder dysfunction following outlet obstruction. Such aberrant transcriptional characteristics engender loss of function in the electron transport and oxidative phosphorylation systems. Morphological studies of mitochondria in the animal model systems support this conclusion. In large part the loss of function in bladder smooth muscle following outlet obstruction results from the attenuation of mitochondrial energy production. In this article we reviewed and synthesized all available experimental observations relevant to this problem and we suggest future lines of inquiry that should prove fruitful in developing new strategies to treat the condition.

  13. Directing enzyme devolution for biosynthesis of alkanols and 1,n-alkanediols from natural polyhydroxy compounds.

    PubMed

    Dai, Lu; Tao, Fei; Tang, Hongzhi; Guo, Yali; Shen, Yaling; Xu, Ping

    2017-11-01

    Primordial enzymes are proposed to possess broad specificities. Through divergence and evolution, enzymes have been refined to exhibit specificity towards one reaction or substrate, and are thus commonly assumed as "specialists". However, some enzymes are "generalists" that catalyze a range of substrates and reactions. This property has been defined as enzyme promiscuity and is of great importance for the evolution of new functions. The promiscuities of two enzymes, namely glycerol dehydratase and diol dehydratase, were herein exploited for catalyzing long-chain polyols, including 1,2-butanediol, 1,2,4-butanetriol, erythritol, 1,2-pentanediol, 1,2,5-pentanetriol, and 1,2,6-hexanetriol. The specific activities required for catalyzing these six long-chain polyols were studied via in vitro enzyme assays, and the catalytic efficiencies were increased through protein engineering. The promiscuous functions were subsequently applied in vivo to establish 1,4-butanediol pathways from lignocellulose derived compounds, including xylose and erythritol. In addition, a pathway for 1-pentanol production from 1,2-pentanediol was also constructed. The results suggest that exploiting enzyme promiscuity is promising for exploring new catalysts, which would expand the repertoire of genetic elements available to synthetic biology and may provide a starting point for designing and engineering novel pathways for valuable chemicals. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  14. Electromagnetic Basis of Metabolism and Heredity

    NASA Technical Reports Server (NTRS)

    Freund, Friedemann; Stolc, Viktor

    2016-01-01

    Living organisms control their cellular biological clocks to maintain functional oscillation of the redox cycle, also called the "metabolic cycle" or "respiratory cycle". Organization of cellular processes requires parallel processing on a synchronized time-base. These clocks coordinate the timing of all biochemical processes in the cell, including energy production, DNA replication, and RNA transcription. When this universal time keeping function is perturbed by exogenous induction of reactive oxygen species (ROS), the rate of metabolism changes. This causes oxidative stress, aging and mutations. Therefore, good temporal coordination of the redox cycle not only actively prevents chemical conflict between the reductive and oxidative partial reactions; it also maintains genome integrity and lifespan. Moreover, this universal biochemical rhythm can be disrupted by ROS induction in vivo. This in turn can be achieved by blocking the electron transport chain either endogenously or exogenously by various metabolites, e.g. hydrogen sulfide (H2S), highly diffusible drugs, and carbon monoxide (CO). Alternatively, the electron transport in vivo can be attenuated via a coherent or interfering transfer of energy from exogenous ultralow frequency (ULF) and extremely low frequency (ELF) electromagnetic (EM) fields, suggesting that-on Earth-such ambient fields are an omnipresent (and probably crucially important) factor for the time-setting basis of universal biochemical reactions in living cells. Our work demonstrated previously un-described evidence for quantum effects in biology by electromagnetic coupling below thermal noise at the universal electron transport chain (ETC) in vivo.

  15. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Sensing Size through Clustering in Non-Equilibrium Membranes and the Control of Membrane-Bound Enzymatic Reactions

    PubMed Central

    Vagne, Quentin; Turner, Matthew S.; Sens, Pierre

    2015-01-01

    The formation of dynamical clusters of proteins is ubiquitous in cellular membranes and is in part regulated by the recycling of membrane components. We show, using stochastic simulations and analytic modeling, that the out-of-equilibrium cluster size distribution of membrane components undergoing continuous recycling is strongly influenced by lateral confinement. This result has significant implications for the clustering of plasma membrane proteins whose mobility is hindered by cytoskeletal “corrals” and for protein clustering in cellular organelles of limited size that generically support material fluxes. We show how the confinement size can be sensed through its effect on the size distribution of clusters of membrane heterogeneities and propose that this could be regulated to control the efficiency of membrane-bound reactions. To illustrate this, we study a chain of enzymatic reactions sensitive to membrane protein clustering. The reaction efficiency is found to be a non-monotonic function of the system size, and can be optimal for sizes comparable to those of cellular organelles. PMID:26656912

  17. Mechanistic studies of a novel C-S lyase in ergothioneine biosynthesis: the involvement of a sulfenic acid intermediate

    PubMed Central

    Song, Heng; Hu, Wen; Naowarojna, Nathchar; Her, Ampon Sae; Wang, Shu; Desai, Rushil; Qin, Li; Chen, Xiaoping; Liu, Pinghua

    2015-01-01

    Ergothioneine is a histidine thio-derivative isolated in 1909. In ergothioneine biosynthesis, the combination of a mononuclear non-heme iron enzyme catalyzed oxidative C-S bond formation reaction and a PLP-mediated C-S lyase (EgtE) reaction results in a net sulfur transfer from cysteine to histidine side-chain. This demonstrates a new sulfur transfer strategy in the biosynthesis of sulfur-containing natural products. Due to difficulties associated with the overexpression of Mycobacterium smegmatis EgtE protein, the proposed EgtE functionality remained to be verified biochemically. In this study, we have successfully overexpressed and purified M. smegmatis EgtE enzyme and evaluated its activities under different in vitro conditions: C-S lyase reaction using either thioether or sulfoxide as a substrate in the presence or absence of reductants. Results from our biochemical characterizations support the assignment of sulfoxide 4 as the native EgtE substrate and the involvement of a sulfenic acid intermediate in the ergothioneine C-S lyase reaction. PMID:26149121

  18. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  19. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  20. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  1. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  2. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  3. Photo-oxidation degradation mechanisms in P3HT for organic solar cells: Insights from first-principles simulations

    NASA Astrophysics Data System (ADS)

    Leung, Kevin; Sai, Na; Zador, Judit; Henkelman, Graeme

    2014-03-01

    Photo-oxidation is one of the leading chemical degradation mechanisms in polymer solar cells. In this work, using hybrid density functional theory and periodic boundary condition, we investigate reaction pathways that may lead to the sulfur oxidation in poly(3-hexylthiophene)(P3HT) as a step toward breaking the macromolecule backbone. We calculate energy barriers for reactions of P3HT backbone with oxidizing radicals suggested by infrared spectroscopy (IR) and XPS studies. Our results strongly suggest that an attack of hydroxyl radical on sulfur as proposed in the literature is unlikely to be thermodynamically favored. On the other hand, a reaction between the alkylperoxyl radical and the polymer backbone may provide low barrier reaction pathways to photo-oxidation of conjugated polymers with side chains. Our work paves way for future studies using ab-initio calculations in a condensed phase setting to model complex chemical reactions relevant to photochemical stability of novel polymers. Supported by the Energy Frontier Research Center funded by the U.S. DOE Office of Basic Energy Sciences under Award #DE-SC0001091.

  4. Versatile On-Resin Synthesis of High Mannose Glycosylated Asparagine with Functional Handles

    PubMed Central

    Chen, Rui; Pawlicki, Mark A.; Tolbert, Thomas J.

    2013-01-01

    Here we present a synthetic route for solid phase synthesis of N-linked glycoconjugates containing high mannose oligosaccharides which allows the incorporation of useful functional handles on the N-terminus of asparagine. In this strategy, the C-terminus of an Fmoc protected aspartic acid residue is first attached to a solid phase support. The side chain of aspartic acid is protected by a 2-phenylisopropyl protecting group, which allows selective deprotection for the introduction of glycosylation. By using a convergent on-resin glycosylamine coupling strategy, an N-glycosidic linkage is successfully formed on the free side chain of the resin bound aspartic acid with a large high mannose oligosaccharide, Man8GlcNAc2, to yield N-linked high mannose glycosylated asparagine. The use of on-resin glycosylamine coupling provides excellent glycosylation yield, can be applied to couple other types of oligosaccharides, and also makes it possible to recover excess oligosaccharides conveniently after the on-resin coupling reaction. Useful functional handles including an alkene (p-vinylbenzoic acid), an alkyne (4-pentynoic acid), biotin, and 5-carboxyfluorescein are then conjugated onto the N-terminal amine of asparagine on-resin after the removal of the Fmoc protecting group. In this way, useful functional handles are introduced onto the glycosylated asparagine while maintaining the structural integrity of the reducing end of the oligosaccharide. The asparagine side chain also serves as a linker between the glycan and the functional group and preserves the native presentation of N-linked glycan which may aid in biochemical and structural studies. As an example of a biochemical study using functionalized high mannose glycosylated asparagine, a fluorescence polarization assay has been utilized to study the binding of the lectin Concanavalin A (ConA) using 5-carboxyfluorescein labeled high mannose glycosylated asparagine. PMID:24326091

  5. Aggregation, adsorption, and surface properties of multiply end-functionalized polystyrenes.

    PubMed

    Ansari, Imtiyaz A; Clarke, Nigel; Hutchings, Lian R; Pillay-Narrainen, Amilcar; Terry, Ann E; Thompson, Richard L; Webster, John R P

    2007-04-10

    The properties of polystyrene blends containing deuteriopolystyrene, multiply end-functionalized with C8F17 fluorocarbon groups, are strikingly analogous to those of surfactants in solution. These materials, denoted FxdPSy, where x is the number of fluorocarbon groups and y is the molecular weight of the dPS chain in kg/mol, were blended with unfunctionalized polystyrene, hPS. Nuclear reaction analysis experiments show that FxdPSy polymers adsorb spontaneously to solution and blend surfaces, resulting in a reduction in surface energy inferred from contact angle analysis. Aggregation of functionalized polymers in the bulk was found to be sensitive to FxdPSy structure and closely related to surface properties. At low concentrations, the functionalized polymers are freely dispersed in the hPS matrix, and in this range, the surface excess concentration grows sharply with increasing bulk concentration. At higher concentrations, surface excess concentrations and contact angles reach a plateau, small-angle neutron scattering data indicate small micellar aggregates of six to seven F2dPS10 polymer chains and much larger aggregates of F4dPS10. Whereas F2dPS10 aggregates are miscible with the hPS matrix, F4dPS10 forms a separate phase of multilamellar vesicles. Using neutron reflectometry (NR), we found that the extent of the adsorbed layer was approximately half the lamellar spacing of the multilamellar vesicles. NR data were fitted using an error function profile to describe the concentration profile of the adsorbed layer, and reasonable agreement was found with concentration profiles predicted by the SCFT model. The thermodynamic sticking energy of the fluorocarbon-functionalized polymer chains to the blend surface increases from 5.3kBT for x = 2 to 6.6kBT for x = 4 but appears to be somewhat dependent upon the blend concentration.

  6. Activating catalysts with mechanical force.

    PubMed

    Piermattei, Alessio; Karthikeyan, S; Sijbesma, Rint P

    2009-05-01

    Homogeneously catalysed reactions can be 'switched on' by activating latent catalysts. Usually, activation is brought about by heat or an external chemical agent. However, activation of homogeneous catalysts with a mechanical trigger has not been demonstrated. Here, we introduce a general method to activate latent catalysts by mechanically breaking bonds between a metal and one of its ligands. We have found that silver(I) complexes of polymer-functionalized N-heterocyclic carbenes, which are latent organocatalysts, catalyse a transesterification reaction when exposed to ultrasound in solution. Furthermore, ultrasonic activation of a ruthenium biscarbene complex with appended polymer chains results in catalysis of olefin metathesis reactions. In each case, the catalytic activity results from ligand dissociation, brought about by transfer of mechanical forces from the polymeric substituents to the coordination bond. Mechanochemical catalyst activation has potential applications in transduction and amplification of mechanical signals, and mechanically initiated polymerizations hold promise as a novel repair mechanism in self-healing materials.

  7. Adiabatic coarse-graining and simulations of stochastic biochemical networks

    PubMed Central

    Sinitsyn, N. A.; Hengartner, Nicolas; Nemenman, Ilya

    2009-01-01

    We propose a universal approach for analysis and fast simulations of stiff stochastic biochemical networks, which rests on elimination of fast chemical species without a loss of information about mesoscopic, non-Poissonian fluctuations of the slow ones. Our approach is similar to the Born–Oppenheimer approximation in quantum mechanics and follows from the stochastic path integral representation of the cumulant generating function of reaction events. In applications with a small number of chemical reactions, it produces analytical expressions for cumulants of chemical fluxes between the slow variables. This allows for a low-dimensional, interpretable representation and can be used for high-accuracy, low-complexity coarse-grained numerical simulations. As an example, we derive the coarse-grained description for a chain of biochemical reactions and show that the coarse-grained and the microscopic simulations agree, but the former is 3 orders of magnitude faster. PMID:19525397

  8. Stability analysis and stabilization strategies for linear supply chains

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi; Helbing, Dirk

    2004-04-01

    Due to delays in the adaptation of production or delivery rates, supply chains can be dynamically unstable with respect to perturbations in the consumption rate, which is known as “bull-whip effect”. Here, we study several conceivable production strategies to stabilize supply chains, which is expressed by different specifications of the management function controlling the production speed in dependence of the stock levels. In particular, we will investigate, whether the reaction to stock levels of other producers or suppliers has a stabilizing effect. We will also demonstrate that the anticipation of future stock levels can stabilize the supply system, given the forecast horizon τ is long enough. To show this, we derive linear stability conditions and carry out simulations for different control strategies. The results indicate that the linear stability analysis is a helpful tool for the judgement of the stabilization effect, although unexpected deviations can occur in the non-linear regime. There are also signs of phase transitions and chaotic behavior, but this remains to be investigated more thoroughly in the future.

  9. Supercoil Formation During DNA Melting

    NASA Astrophysics Data System (ADS)

    Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

    2009-03-01

    Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

  10. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  11. Green process for green materials: viable low-temperature lipase-catalysed synthesis of renewable telechelics in supercritical CO2.

    PubMed

    Curia, S; Barclay, A F; Torron, S; Johansson, M; Howdle, S M

    2015-12-28

    We present a novel near-ambient-temperature approach to telechelic renewable polyesters by exploiting the unique properties of supercritical CO(2) (scCO(2)). Bio-based commercially available monomers have been polymerized and functional telechelic materials with targeted molecular weight prepared by end-capping the chains with molecules containing reactive moieties in a one-pot reaction. The use of scCO(2) as a reaction medium facilitates the effective use of Candida antarctica Lipase B (CaLB) as a catalyst at a temperature as low as 35°C, hence avoiding side reactions, maintaining the end-capper functionality and preserving the enzyme activity. The functionalized polymer products have been characterized by (1)H nuclear magnetic resonance spectroscopy, matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry, gel permeation chromatography and differential scanning calorimetry in order to carefully assess their structural and thermal properties. We demonstrate that telechelic materials can be produced enzymatically at mild temperatures, in a solvent-free system and using renewably sourced monomers without pre-modification, by exploiting the unique properties of scCO(2). The macromolecules we prepare are ideal green precursors that can be further reacted to prepare useful bio-derived films and coatings. © 2015 The Author(s).

  12. New biobased high functionality polyols and their use in polyurethane coatings.

    PubMed

    Pan, Xiao; Webster, Dean C

    2012-02-13

    High-functionality polyols for application in polyurethanes (PUs) were prepared by epoxide ring-opening reactions from epoxidized sucrose esters of soybean oil-epoxidized sucrose soyates-in which secondary hydroxyl groups were generated from epoxides on fatty acid chains. Ester polyols were prepared by using a base-catalyzed acid-epoxy reaction with carboxylic acids (e.g., acetic acid); ether polyols were prepared by using an acid-catalyzed alcohol-epoxy reaction with monoalcohols (e.g., methanol). The polyols were characterized by using gel permeation chromatography, FTIR spectroscopy, (1)H NMR spectroscopy, differential scanning calorimetry (DSC), and viscosity measurements. PU thermosets were prepared by using aliphatic polyisocyanates based on isophorone diisocyanate and hexamethylene diisocyanate. The properties of the PUs were studied by performing tensile testing, dynamic mechanical analysis, DSC, and thermogravimetric analysis. The properties of PU coatings on steel substrates were evaluated by using ASTM methods to determine coating hardness, adhesion, solvent resistance, and ductility. Compared to a soy triglyceride polyol, sucrose soyate polyols provide greater hardness and range of cross-link density to PU thermosets because of the unique structure of these macromolecules: well-defined compact structures with a rigid sucrose core coupled with high hydroxyl group functionality. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Mild and modular surface modification of cellulose via hetero Diels-Alder (HDA) cycloaddition.

    PubMed

    Goldmann, Anja S; Tischer, Thomas; Barner, Leonie; Bruns, Michael; Barner-Kowollik, Christopher

    2011-04-11

    A combination of reversible addition-fragmentation chain transfer (RAFT) polymerization and hetero Diels-Alder (HDA) cycloaddition was used to effect, under mild (T ≈ 20 °C), fast, and modular conditions, the grafting of poly(isobornyl acrylate) (M(n) = 9800 g mol(-1), PDI = 1.19) onto a solid cellulose substrate. The active hydroxyl groups expressed on the cellulose fibers were converted to tosylate leaving groups, which were subsequently substituted by a highly reactive cyclopentadienyl functionality (Cp). By employing the reactive Cp-functionality as a diene, thiocarbonyl thio-capped poly(isobornyl acrylate) synthesized via RAFT polymerization (mediated by benzyl pyridine-2-yldithioformiate (BPDF)) was attached to the surface under ambient conditions by an HDA cycloaddition (reaction time: 15 h). The surface-modified cellulose samples were analyzed in-depth by X-ray photoelectron spectroscopy, scanning electron microscopy, elemental analysis, Fourier transform infrared (FT-IR) spectroscopy as well as Fourier transform infrared microscopy employing a focal plane array detector for imaging purposes. The analytical results provide strong evidence that the reaction of suitable dienophiles with Cp-functional cellulose proceeds under mild reaction conditions (T ≈ 20 °C) in an efficient fashion. In particular, the visualization of individual modified cellulose fibers via high-resolution FT-IR microscopy corroborates the homogeneous distribution of the polymer film on the cellulose fibers.

  14. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE PAGES

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  15. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  16. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  17. Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

    PubMed

    Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

    2013-10-17

    Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

  18. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  19. A Bullet-Block Experiment that Explains the Chain Fountain

    NASA Astrophysics Data System (ADS)

    Pantaleone, J.; Smith, R.

    2018-05-01

    It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

  20. Radiation induced decomposition of chlorinated phenols in water

    NASA Astrophysics Data System (ADS)

    Getoff, N.; Solar, S.

    Experiments with 4-Cl-phenol as a model compound for pesticides were performed under steady-state conditions using deoxygenated solutions as well as such saturated with air, oxygen or oxygen mixed with ozone. The yield of Cl -ions serviced as an indicator for the degradation process. As main products of the first step of decomposition were identified: polyhydroxybenzenes, aldehydes and acids. The yield of aldehydes was studied as a function of the absorbed dose and substrate concentration. In the presence of ozone a chain-reaction of the oxidative pollutant degradation takes place. Transient absorption spectra and kinetics obtained by preliminary pulse radiolysis studies of 4-Cl-phenol in the presence of oxygen as well as probable reaction mechanisms are also presented.

  1. Chemically modified electrodes by nucleophilic substitution of chlorosilylated platinum oxide surfaces

    NASA Astrophysics Data System (ADS)

    Chen, Chun-Hsien; Hutchison, James H.; Postlethwaite, Timothy A.; Richardson, John N.; Murray, R. W.

    1994-07-01

    Chlorosilylated platinum oxide electrode surfaces can be generated by reaction of SiCl4 vapor with an electrochemically prepared monolayer of platinum oxide. A variety of nucleophilic agents (such as alcohols, amines, thiols, and Grignard reagents) can be used to displace chloride and thereby functionalize the metal surface. Electroactive surfaces prepared with ferrocene methanol as the nucleophile show that derivatization by small molecules can achieve coverages on the order of a full monolayer. Surfaces modified with long-chain alkyl groups efficiently block electrode reactions of redox probes dissolved in the contacting solution, but other electrochemical (double layer capacitance and surface coverage) and contact angle measurements suggest that these molecule films are not highly ordered, self-assembled monolayers.

  2. [Effect of calcium cations on acid-base properties and free radical oxidation of dopamine and pyrocatechol].

    PubMed

    Lebedev, A V; Ivanova, M V; Timoshin, A A; Ruuge, E K

    2008-01-01

    Ca2+-induced increase in the rate of pyrocatechol and dopamine oxidation by dioxygen and Ca2+-dependent acid-base properties of the catechols were studied by potentiometric titration, UV/Vis-spectrophotometry, EPR-spectroscopy, and by measurement of oxygen consumption. The effect of Ca2+ on the chain reactions of oxidation can be explained by additional deprotonation (decrease in pKai) of the catechols that accelerates one electron transport to dioxygen and formation of calcium semiquinonate, undergoing further oxidation. The described Ca2+-dependent redox-conversion of ortho-phenols proposes that an additional function of calcium in the cell can be its involvement in free radical oxidoreductive reactions at pH > pKai.

  3. Functionalization of reduced graphene oxide by electroactive polymer for biosensing applications

    NASA Astrophysics Data System (ADS)

    Nguyen, Le Huy; Dzung Nguyen, Tuan; Hoang Tran, Vinh; Thu Huyen Dang, Thi; Tran, Dai Lam

    2014-09-01

    A novel biosensing platform was designed by the functionalizing reduced graphene oxide sheets (rGO) with electroactive copolymer juglone. The composite film showed well-defined, stable electroactivity in a biocompatible buffer medium. Square wave voltammetry is used to record the redox signal for DNA hybridization. Current increase upon hybridization (signal-on) evidenced that short DNA target as well as polymerase chain reaction (PCR), so called ‘real sample’ products, related to different lineages of Mycobacterium tuberculosis strain. The signal-on reached ∼40% with 1 nM of short DNA (25 mer) target, while PCR product (Africanum, EAI and Beijing strains) produced a current change of ∼20%.

  4. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    DTIC Science & Technology

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  5. Highly porous ceramic oxide aerogels having improved flexibility

    NASA Technical Reports Server (NTRS)

    Meador, Mary Ann B. (Inventor); Nguyen, Baochau N. (Inventor)

    2012-01-01

    Ceramic oxide aerogels incorporating periodically dispersed flexible linkages are provided. The flexible linkages impart greater flexibility than the native aerogels without those linkages, and have been shown to reduce or eliminate the need for supercritical CO.sub.2-mediated drying of the corresponding wet gels. The gels may also be polymer cross-linked via organic polymer chains that are attached to and extend from surface-bound functional groups provided or present over the internal surfaces of a mesoporous ceramic oxide particle network via appropriate chemical reactions.

  6. Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

    NASA Astrophysics Data System (ADS)

    Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

    Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

  7. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  8. Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

    PubMed

    Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

    2014-02-07

    An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

  9. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  10. The Compact and Biologically Relevant Structure of Inter-α-inhibitor Is Maintained by the Chondroitin Sulfate Chain and Divalent Cations.

    PubMed

    Scavenius, Carsten; Nikolajsen, Camilla Lund; Stenvang, Marcel; Thøgersen, Ida B; Wyrożemski, Łukasz; Wisniewski, Hans-Georg; Otzen, Daniel E; Sanggaard, Kristian W; Enghild, Jan J

    2016-02-26

    Inter-α-inhibitor is a proteoglycan of unique structure. The protein consists of three subunits, heavy chain 1, heavy chain 2, and bikunin covalently joined by a chondroitin sulfate chain originating at Ser-10 of bikunin. Inter-α-inhibitor interacts with an inflammation-associated protein, tumor necrosis factor-inducible gene 6 protein, in the extracellular matrix. This interaction leads to transfer of the heavy chains from the chondroitin sulfate of inter-α-inhibitor to hyaluronan and consequently to matrix stabilization. Divalent cations and heavy chain 2 are essential co-factors in this transfer reaction. In the present study, we have investigated how divalent cations in concert with the chondroitin sulfate chain influence the structure and stability of inter-α-inhibitor. The results showed that Mg(2+) or Mn(2+), but not Ca(2+), induced a conformational change in inter-α-inhibitor as evidenced by a decrease in the Stokes radius and a bikunin chondroitin sulfate-dependent increase of the thermodynamic stability. This structure was shown to be essential for the ability of inter-α-inhibitor to participate in extracellular matrix stabilization. In addition, the data revealed that bikunin was positioned adjacent to both heavy chains and that the two heavy chains also were in close proximity. The chondroitin sulfate chain interacted with all protein components and inter-α-inhibitor dissociated when it was degraded. Conventional purification protocols result in the removal of the Mg(2+) found in plasma and because divalent cations influence the conformation and affect function it is important to consider this when characterizing the biological activity of inter-α-inhibitor. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Dissolution of covalent adaptable network polymers in organic solvent

    NASA Astrophysics Data System (ADS)

    Yu, Kai; Yang, Hua; Dao, Binh H.; Shi, Qian; Yakacki, Christopher M.

    2017-12-01

    It was recently reported that thermosetting polymers can be fully dissolved in a proper organic solvent utilizing a bond-exchange reaction (BER), where small molecules diffuse into the polymer, break the long polymer chains into short segments, and eventually dissolve the network when sufficient solvent is provided. The solvent-assisted dissolution approach was applied to fully recycle thermosets and their fiber composites. This paper presents the first multi-scale modeling framework to predict the dissolution kinetics and mechanics of thermosets in organic solvent. The model connects the micro-scale network dynamics with macro-scale material properties: in the micro-scale, a model is developed based on the kinetics of BERs to describe the cleavage rate of polymer chains and evolution of chain segment length during the dissolution. The micro-scale model is then fed into a continuum-level model with considerations of the transportation of solvent molecules and chain segments in the system. The model shows good prediction on conversion rate of functional groups, degradation of network mechanical properties, and dissolution rate of thermosets during the dissolution. It identifies the underlying kinetic factors governing the dissolution process, and reveals the influence of different material and processing variables on the dissolution process, such as time, temperature, catalyst concentration, and chain length between cross-links.

  12. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  13. Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

    PubMed

    Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

    2013-08-22

    Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

  14. FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

    PubMed Central

    Ekstedt, Richard D.; Stollerman, Gene H.

    1960-01-01

    Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

  15. Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

    PubMed

    Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

    2014-05-28

    3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

  16. Contribution to an effective design method for stationary reaction-diffusion patterns.

    PubMed

    Szalai, István; Horváth, Judit; De Kepper, Patrick

    2015-06-01

    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

  17. Intact carbohydrate structures as part of the melanoidin skeleton.

    PubMed

    Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

    2002-03-27

    Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

  18. Measuring Fission Chain Dynamics Through Inter-event Timing of Correlated Particles

    NASA Astrophysics Data System (ADS)

    Monterial, Mateusz

    Neutrons born from fission may go on to induce subsequent fissions in self-propagating series of reactions resulting in a fission chain. Fissile materials comprise all isotopes capable of sustaining nuclear fission chain reactions, and are therefore a necessary prerequisite for the construction of a nuclear weapon. As a result the accountancy and characterization of fissile material is of great importance for national security and the international community. The rate at which neutrons "multiply" in a fissile material is a function of the composition, total mass, density, and shape of the object. These are key characteristics sought out in areas of nuclear non-proliferation, safeguards, treaty verification and emergency response. This thesis demonstrates a novel technique of measuring the underlying fission chain dynamics in fissile material through temporal correlation of neutrons and gamma rays emitted from fission. Fissile material exhibits key detectable signatures through the emission of correlated neutrons and gamma rays from fission. The Non-Destructive Assay (NDA) community has developed mature techniques of assaying fissile material that detect these signatures, such as neutron counting by thermal capture based detectors, and gamma-ray spectroscopy. An alternative use of fast organic scintillators provides three additional capabilities: (1) discrimination between neutrons and gamma-ray pulses (2) sub-nanosecond scale timing between correlated events (3) measurement of deposited neutron energy in the detector. This thesis leverages these capabilities into to measure a new signature, which is demonstrated to be sensitive to both fissile neutron multiplication and presence of neutronically coupled reflectors. In addition, a new 3D imaging method of sources of correlated gamma rays and neutrons is presented, which can improve estimation of total source volume and localization.

  19. PEGylated-nanoliposomal clusterin for amyloidogenic light chain-induced endothelial dysfunction.

    PubMed

    Guzman-Villanueva, Diana; Migrino, Raymond Q; Truran, Seth; Karamanova, Nina; Franco, Daniel A; Burciu, Camelia; Senapati, Subhadip; Nedelkov, Dobrin; Hari, Parameswaran; Weissig, Volkmar

    2018-06-01

    Light chain (AL) amyloidosis is a disease associated with significant morbidity and mortality arising from multi-organ injury induced by amyloidogenic light chain proteins (LC). There is no available treatment to reverse the toxicity of LC. We previously showed that chaperone glycoprotein clusterin (CLU) and nanoliposomes (NL), separately, restore human microvascular endothelial function impaired by LC. In this work, we aim to prepare PEGylated-nanoliposomal clusterin (NL-CLU) formulations that could allow combined benefit against LC while potentially enabling efficient delivery to microvascular tissue, and test efficacy on human arteriole endothelial function. NL-CLU was prepared by a conjugation reaction between the carboxylated surface of NL and the primary amines of the CLU protein. NL were made of phosphatidylcholine (PC), cholesterol (Chol) and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol)-2000] (DSPE-PEG 2000 carboxylic acid) at 70:25:5 mol%. The protective effect of NL-CLU was tested by measuring the dilation response to acetylcholine and papaverine in human adipose arterioles exposed to LC. LC treatment significantly reduced the dilation response to acetylcholine and papaverine; co-treatment of LC with PEGylated-nanoliposomal CLU or free CLU restored the dilator response. NL-CLU is a feasible and promising approach to reverse LC-induced endothelial damage.

  20. Recent Developments in the Synthesis of Biomacromolecules and their Conjugates by Single Electron Transfer-Living Radical Polymerization.

    PubMed

    Lligadas, Gerard; Grama, Silvia; Percec, Virgil

    2017-04-10

    Single electron transfer-living radical polymerization (SET-LRP) represents a robust and versatile tool for the synthesis of vinyl polymers with well-defined topology and chain end functionality. The crucial step in SET-LRP is the disproportionation of the Cu(I)X generated by activation with Cu(0) wire, powder, or nascent Cu(0) generated in situ into nascent, extremely reactive Cu(0) atoms and nanoparticles and Cu(II)X 2 . Nascent Cu(0) activates the initiator and dormant chains via a homogeneous or heterogeneous outer-sphere single-electron transfer mechanism (SET-LRP). SET-LRP provides an ultrafast polymerization of a plethora of monomers (e.g., (meth)-acrylates, (meth)-acrylamides, styrene, and vinyl chloride) including hydrophobic and water insoluble to hydrophilic and water soluble. Some advantageous features of SET-LRP are (i) the use of Cu(0) wire or powder as readily available catalysts under mild reaction conditions, (ii) their excellent control over molecular weight evolution and distribution as well as polymer chain ends, (iii) their high functional group tolerance allowing the polymerization of commercial-grade monomers, and (iv) the limited purification required for the resulting polymers. In this Perspective, we highlight the recent advancements of SET-LRP in the synthesis of biomacromolecules and of their conjugates.

  1. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  2. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOEpatents

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  3. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    NASA Technical Reports Server (NTRS)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  4. Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

    PubMed

    Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2017-05-02

    Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  7. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  8. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  9. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  10. Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

    PubMed Central

    Brownholland, David P.

    2017-01-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

  11. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  12. METHOD OF OPERATING NUCLEAR REACTORS

    DOEpatents

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  13. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  14. Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

    NASA Astrophysics Data System (ADS)

    Nakazumi, Tomoka; Hara, Yusuke

    2017-09-01

    We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

  15. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  16. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    PubMed

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  17. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    PubMed Central

    Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

  18. The plant cell-wall enzyme AtXTH3 catalyses covalent cross-linking between cellulose and cello-oligosaccharide

    NASA Astrophysics Data System (ADS)

    Shinohara, Naoki; Sunagawa, Naoki; Tamura, Satoru; Yokoyama, Ryusuke; Ueda, Minoru; Igarashi, Kiyohiko; Nishitani, Kazuhiko

    2017-04-01

    Cellulose is an economically important material, but routes of its industrial processing have not been fully explored. The plant cell wall - the major source of cellulose - harbours enzymes of the xyloglucan endotransglucosylase/hydrolase (XTH) family. This class of enzymes is unique in that it is capable of elongating polysaccharide chains without the requirement for activated nucleotide sugars (e.g., UDP-glucose) and in seamlessly splitting and reconnecting chains of xyloglucan, a naturally occurring soluble analogue of cellulose. Here, we show that a recombinant version of AtXTH3, a thus far uncharacterized member of the Arabidopsis XTH family, catalysed the transglycosylation between cellulose and cello-oligosaccharide, between cellulose and xyloglucan-oligosaccharide, and between xyloglucan and xyloglucan-oligosaccharide, with the highest reaction rate observed for the latter reaction. In addition, this enzyme formed cellulose-like insoluble material from a soluble cello-oligosaccharide in the absence of additional substrates. This newly found activity (designated “cellulose endotransglucosylase,” or CET) can potentially be involved in the formation of covalent linkages between cellulose microfibrils in the plant cell wall. It can also comprise a new route of industrial cellulose functionalization.

  19. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  20. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  1. Interaction of a chick skin collagen fragment (alpha1-CB5) with human platelets. Biochemical studies during the aggregation and release reaction.

    PubMed

    Chiang, T M; Beachey, E H; Kang, A H

    1975-09-10

    The denatured alpha1(I) chain and the cyanogen bromide peptide, alpha1(I)-CB5, of chick skin collagen cause the release of serotonin and leakage of lactic dehydrogenase from human platelets in a manner similar to the release reaction mediated by adenosine diphosphate and native collagen. These peptides also cause a decrease in the level of adenosine 3':5'-monophosphate (cAMP) in platelets. Adenylate cyclase activity of platelets is partially inhibited by these peptides as well as by native collagen, ADP, and epinephrine, but cAMP phosphodiesterase activity is unaltered by these substances. In contrast, the level of platelet guanosine 3':5'-monophosphate (cGMP) is increased by the collagen peptides as well as the other aggregating agents. The increase is associated with increased guanylate cyclase, but normal cGMP phosphodiesterase activities of platelets. Optical rotatory and viscometric measurements of the alpha1 chains and alpha1-CB5 of chick skin in 0.01 M phosphate/0.15 M sodium chloride, pH 7.4, at various temperatures as a function of time indicate that no detectable renaturation occurs at 37 degrees for at least 30 min of observation. Molecular sieve chromatography of alpha1-CB5 in the phosphate buffer at 37 degrees shows that its elution position is identical to that performed under denaturing conditions (at 45 degrees) with no evidence of higher molecular weight aggregates, and the alpha1-CB5 glycopeptide fraction eluting from the column at the position of its monomer retains the platelet aggregating activity. Additionally, electron microscopic examination of the platelet-rich plasma that had been reacted with these peptides fail to show any ordered collagen structures. These data indicate that the denatured alpha1 chain and alpha1-CB5 glycopeptide of chick skin collagen mediate platelet aggregation through the "physiologic" release reaction in a manner similar to that induced by other aggregating agents such as ADP, epinephrine, or native collagen, and support the conclusion that the aggregating activity of the alpha1 chain and alpha1-CB5 is not likely to be due to the formation of polymerized products.

  2. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  3. Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

    PubMed

    Winkelmann, Kurt; Calhoun, Robert L; Mills, German

    2006-12-28

    Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

  4. Distinct phylogenetic relationships and biochemical properties of Arabidopsis ovarian tumor-related deubiquitinases support their functional differentiation

    PubMed Central

    Radjacommare, Ramalingam; Usharani, Raju; Kuo, Chih-Horng; Fu, Hongyong

    2014-01-01

    The reverse reaction of ubiquitylation is catalyzed by different classes of deubiquitylation enzymes (DUBs), including ovarian tumor domain (OTU)-containing DUBs; experiments using Homo sapiens proteins have demonstrated that OTU DUBs modulate various cellular processes. With the exception of OTLD1, plant OTU DUBs have not been characterized. We identified 12 Arabidopsis thaliana OTU loci and analyzed 11 of the encoded proteins in vitro to determine their preferences for the ubiquitin (UB) chains of M1, K48, and K63 linkages as well as the UB-/RUB-/SUMO-GST fusions. The A. thaliana OTU DUBs were shown to be cysteine proteases and classified into four groups with distinct linkage preferences: OTU1 (M1 = K48 > K63), OTU3/4/7/10 (K63 > K48 > M1), OTU2/9 (K48 = K63), and OTU5/11/12/OTLD1 (inactive). Five active OTU DUBs (OTU3/4/7/9/10) also cleaved RUB fusion. OTU1/3/4 cleaved M1 UB chains, suggesting a possible role for M1 chains in plant cellular signaling. The different substrate specificities of the various A. thaliana OTU DUBs indicate the involvement of distinct structural elements; for example, the OTU1 oxyanion residue D89 is essential for cleaving isopeptide bond-linked chains but dispensable for M1 chains. UB-binding activities were detected only for OTU2 and OTLD1, with distinct linkage preferences. These differences in biochemical properties support the involvement of A. thaliana OTU DUBs in different functions. Moreover, based on the established phylogenetic tree, plant- and H. sapiens-specific clades exist, which suggests that the proteins within these clades have taxa-specific functions. We also detected five OTU clades that are conserved across species, which suggests that the orthologs in different species within each clade are involved in conserved cellular processes, such as ERAD and DNA damage responses. However, different linkage preferences have been detected among potential cross-species OTU orthologs, indicating functional and mechanistic differentiation. PMID:24659992

  5. Functionalized Congeners of P2Y1 Receptor Antagonists:

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Castro, Sonia; Maruoka, Hiroshi; Hong, Kunlun

    2010-01-01

    The P2Y{sub 1} receptor is a prothrombotic G protein-coupled receptor (GPCR) activated by ADP. Preference for the North (N) ring conformation of the ribose moiety of adenine nucleotide 3',5'-bisphosphate antagonists of the P2Y{sub 1} receptor was established by using a ring-constrained methanocarba (a bicyclo[3.1.0]hexane) ring as a ribose substitute. A series of covalently linkable N{sup 6}-methyl-(N)-methanocarba-2'-deoxyadenosine-3',5'-bisphosphates containing extended 2-alkynyl chains was designed, and binding affinity at the human (h) P2Y{sub 1} receptor determined. The chain of these functionalized congeners contained hydrophilic moieties, a reactive substituent, or biotin, linked via an amide. Variation of the chain length and position of anmore » intermediate amide group revealed high affinity of carboxylic congener 8 (K{sub i} 23 nM) and extended amine congener 15 (K{sub i} 132 nM), both having a 2-(1-pentynoyl) group. A biotin conjugate 18 containing an extended {epsilon}-aminocaproyl spacer chain exhibited higher affinity than a shorter biotinylated analogue. Alternatively, click coupling of terminal alkynes of homologous 2-dialkynyl nucleotide derivatives to alkyl azido groups produced triazole derivatives that bound to the P2Y{sub 1} receptor following deprotection of the bisphosphate groups. The preservation of receptor affinity of the functionalized congeners was consistent with new P2Y{sub 1} receptor modeling and ligand docking. Attempted P2Y{sub 1} antagonist conjugation to PAMAM dendrimer carriers by amide formation or palladium-catalyzed reaction between an alkyne on the dendrimer and a 2-iodopurine-derivatized nucleotide was unsuccessful. A dialkynyl intermediate containing the chain length favored in receptor binding was conjugated to an azide-derivatized dendrimer, and the conjugate inhibited ADP-promoted human platelet aggregation. This is the first example of attaching a strategically functionalized P2Y receptor antagonist to a PAMAM dendrimer to produce a multivalent conjugate exhibiting a desired biological effect, i.e., antithrombotic action.« less

  6. Tested Demonstrations.

    ERIC Educational Resources Information Center

    Gilbert, George L., Ed.

    1983-01-01

    Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

  7. Novel extracellular medium-chain-length polyhydroxyalkanoate depolymerase from Streptomyces exfoliatus K10 DSMZ 41693: a promising biocatalyst for the efficient degradation of natural and functionalized mcl-PHAs.

    PubMed

    Martínez, Virginia; de Santos, Patricia Gómez; García-Hidalgo, Javier; Hormigo, Daniel; Prieto, M Auxiliadora; Arroyo, Miguel; de la Mata, Isabel

    2015-11-01

    Cloning and biochemical characterization of a novel extracellular medium-chain-length polyhydroxyalkanoate (mcl-PHA) depolymerase from Streptomyces exfoliatus K10 DSMZ 41693 are described. The primary structure of the depolymerase (PhaZSex2) includes the lipase consensus sequence (serine-histidine-aspartic acid) which is known for serine hydrolases. Secondary structure analysis shows 7.9 % α-helix, 43.9 % β-sheet, 19.4 % β-turns, and 31.2 % random coil, suggesting that this enzyme belongs to the α/β hydrolase fold family, in agreement with other PHA depolymerases and lipases. The enzyme was efficiently produced as an extracellular active form in Rhodococcus and purified by two consecutive hydrophobic chromatographic steps. Matrix-assisted laser desorption-time-of-flight (MALDI-TOF) analysis of the purified enzyme revealed a monomer of 27.6 kDa with a midpoint transition temperature of 44.2 °C. Remarkably, the activity is significantly enhanced by low concentrations of nonionic and anionic detergents and thermal stability is improved by the presence of 10 % glycerol. PhaZSex2 is an endo-exohydrolase that cleaves both large and small PHA molecules, producing (R)-3-hydroxyoctanoic acid monomers as the main reaction product. Markedly, PhaZSex2 is able to degrade functionalized polymers containing thioester groups in the side chain (PHACOS), releasing functional thioester-based monomers and oligomers demonstrating the potentiality of this novel biocatalyst for the industrial production of enantiopure (R)-3-hydroxyalkanoic acids.

  8. Extending enzyme molecular recognition with an expanded amino acid alphabet

    PubMed Central

    Windle, Claire L.; Simmons, Katie J.; Ault, James R.; Trinh, Chi H.; Nelson, Adam

    2017-01-01

    Natural enzymes are constructed from the 20 proteogenic amino acids, which may then require posttranslational modification or the recruitment of coenzymes or metal ions to achieve catalytic function. Here, we demonstrate that expansion of the alphabet of amino acids can also enable the properties of enzymes to be extended. A chemical mutagenesis strategy allowed a wide range of noncanonical amino acids to be systematically incorporated throughout an active site to alter enzymic substrate specificity. Specifically, 13 different noncanonical side chains were incorporated at 12 different positions within the active site of N-acetylneuraminic acid lyase (NAL), and the resulting chemically modified enzymes were screened for activity with a range of aldehyde substrates. A modified enzyme containing a 2,3-dihydroxypropyl cysteine at position 190 was identified that had significantly increased activity for the aldol reaction of erythrose with pyruvate compared with the wild-type enzyme. Kinetic investigation of a saturation library of the canonical amino acids at the same position showed that this increased activity was not achievable with any of the 20 proteogenic amino acids. Structural and modeling studies revealed that the unique shape and functionality of the noncanonical side chain enabled the active site to be remodeled to enable more efficient stabilization of the transition state of the reaction. The ability to exploit an expanded amino acid alphabet can thus heighten the ambitions of protein engineers wishing to develop enzymes with new catalytic properties. PMID:28196894

  9. Microarray expression profiling in adhesion and normal peritoneal tissues.

    PubMed

    Ambler, Dana R; Golden, Alicia M; Gell, Jennifer S; Saed, Ghassan M; Carey, David J; Diamond, Michael P

    2012-05-01

    To identify molecular markers associated with adhesion and normal peritoneal tissue using microarray expression profiling. Comparative study. University hospital. Five premenopausal women. Adhesion and normal peritoneal tissue samples were obtained from premenopausal women. Ribonucleic acid was extracted using standard protocols and processed for hybridization to Affymetrix Whole Transcript Human Gene Expression Chips. Microarray data were obtained from five different patients, each with adhesion tissue and normal peritoneal samples. Real-time polymerase chain reaction was performed for confirmation using standard protocols. Gene expression in postoperative adhesion and normal peritoneal tissues. A total of 1,263 genes were differentially expressed between adhesion and normal tissues. One hundred seventy-three genes were found to be up-regulated and 56 genes were down-regulated in the adhesion tissues compared with normal peritoneal tissues. The genes were sorted into functional categories according to Gene Ontology annotations. Twenty-six up-regulated genes and 11 down-regulated genes were identified with functions potentially relevant to the pathophysiology of postoperative adhesions. We evaluated and confirmed expression of 12 of these specific genes via polymerase chain reaction. The pathogenesis, natural history, and optimal treatment of postoperative adhesive disease remains unanswered. Microarray analysis of adhesions identified specific genes with increased and decreased expression when compared with normal peritoneum. Knowledge of these genes and ontologic pathways with altered expression provide targets for new therapies to treat patients who have or are at risk for postoperative adhesions. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  10. A direct comparison between gas state and atomised liquid state precursor in the deposition of functional coatings by pin corona plasma

    NASA Astrophysics Data System (ADS)

    Herbert, P. A. F.; Jaroszyńska-Wolińska, J.

    2011-07-01

    An atmospheric pressure non-thermal equilibrium pin corona plasma jet was used to deposit polymeric coatings from monomer precursor in both vapour and liquid aerosol states to allow a direct comparison of the quality and performance of the as-deposited coatings, specifically with respect to the achievement of soft plasma polymerisation (SPP) where the coating exhibits minimal fragmentation or damage to the monomer molecule while, at the same time, being highly cross-linked. A long chain perfluorocarbon molecule was introduced into the helium plasma and coatings deposited at rates of up to 50 nm/min. XPS, FTIR, contact angle and ellipsometric measurements indicated that a controlled polymerisation reaction had taken place in the case of the vapour deposited samples through the vinyl group of the monomer, with only minor fragmentation of the functional perfluoro chain. Furthermore, a high level of cross-linking was achieved and the coatings were stable to a toluene wash. In contrast, while the liquid deposition samples showed good retention of monomer molecular structure, they exhibited negligible cross-linking and were readily removed by immersion in toluene rendering them functionally useless.

  11. Phosphatidylkojibiosyl Diglyceride: metabolism and function as an anchor in bacterial cell membrane.

    PubMed

    Pieringer, R A

    1975-07-01

    The recently discovered phosphoglycolipid, phosphatidylkojibiosyl diglyceride (PKD), was first observed as a biosynthetic by-product of glycosyl diglyceride metabolism in Streptococcus faecalis (faecium) ATCC 9790. Its structure is 1, 2-diacyl-3-O-alpha-Dglucopyranosyl-6'-O-phosphoryl- [1'', 2''-diacyl-3''-O-sn-glycerol]-alpha-D-glucopyranosyl)-sn-glycerol. The biosynthesis of phosphatidyl-kojibiosyl diglyceride occurs by a novel transphosphatidylation reaction in which a phosphatidyl glycerol to the primary alcohol function at the 6 position of the internal glucose of kojibiosyl diglyceride. The reaction is catalyzed by a membrane-derived enzyme. Phosphatidyl-kojibiosyl diglyceride is bound covalently through a phosphodiester bond to the polyglycerol phosphate moiety of membrane lipoteichoic acid from S. faecalis. Phosphatidylkojibiosyl diglyceride has four nonpolar long chain fatty acyl groups and appears to have the necessary physico-chemical properties to anchor the long hydrophilic glycerol phosphate polymer of lipoteichoic acid to the hydrophobic enviroment of the membrane of S. faecalis and probably other gram-positive bacteria as well.

  12. Different Functions of Phylogenetically Distinct Bacterial Complex I Isozymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spero, Melanie A.; Brickner, Joshua R.; Mollet, Jordan T.

    NADH:quinone oxidoreductase (complex I) is a bioenergetic enzyme that transfers electrons from NADH to quinone, conserving the energy of this reaction by contributing to the proton motive force. While the importance of NADH oxidation to mitochondrial aerobic respiration is well documented, the contribution of complex I to bacterial electron transport chains has been tested in only a few species. Here, we analyze the function of two phylogenetically distinct complex I isozymes in Rhodobacter sphaeroides, an alphaproteobacterium that contains well-characterized electron transport chains. We found that R. sphaeroides complex I activity is important for aerobic respiration and required for anaerobic dimethylmore » sulfoxide (DMSO) respiration (in the absence of light), photoautotrophic growth, and photoheterotrophic growth (in the absence of an external electron acceptor). Our data also provide insight into the functions of the phylogenetically distinct R. sphaeroides complex I enzymes (complex I A and complex I E) in maintaining a cellular redox state during photoheterotrophic growth. We propose that the function of each isozyme during photoheterotrophic growth is either NADH synthesis (complex I A) or NADH oxidation (complex I E). The canonical alphaproteobacterial complex I isozyme (complex I A) was also shown to be important for routing electrons to nitrogenase-mediated H 2 production, while the horizontally acquired enzyme (complex I E) was dispensable in this process. Unlike the singular role of complex I in mitochondria, we predict that the phylogenetically distinct complex I enzymes found across bacterial species have evolved to enhance the functions of their respective electron transport chains. Cells use a proton motive force (PMF), NADH, and ATP to support numerous processes. In mitochondria, complex I uses NADH oxidation to generate a PMF, which can drive ATP synthesis. This study analyzed the function of complex I in bacteria, which contain more-diverse and more-flexible electron transport chains than mitochondria. We tested complex I function in Rhodobacter sphaeroides, a bacterium predicted to encode two phylogenetically distinct complex I isozymes. R. sphaeroides cells lacking both isozymes had growth defects during all tested modes of growth, illustrating the important function of this enzyme under diverse conditions. We conclude that the two isozymes are not functionally redundant and predict that phylogenetically distinct complex I enzymes have evolved to support the diverse lifestyles of bacteria.« less

  13. Different Functions of Phylogenetically Distinct Bacterial Complex I Isozymes

    DOE PAGES

    Spero, Melanie A.; Brickner, Joshua R.; Mollet, Jordan T.; ...

    2016-02-01

    NADH:quinone oxidoreductase (complex I) is a bioenergetic enzyme that transfers electrons from NADH to quinone, conserving the energy of this reaction by contributing to the proton motive force. While the importance of NADH oxidation to mitochondrial aerobic respiration is well documented, the contribution of complex I to bacterial electron transport chains has been tested in only a few species. Here, we analyze the function of two phylogenetically distinct complex I isozymes in Rhodobacter sphaeroides, an alphaproteobacterium that contains well-characterized electron transport chains. We found that R. sphaeroides complex I activity is important for aerobic respiration and required for anaerobic dimethylmore » sulfoxide (DMSO) respiration (in the absence of light), photoautotrophic growth, and photoheterotrophic growth (in the absence of an external electron acceptor). Our data also provide insight into the functions of the phylogenetically distinct R. sphaeroides complex I enzymes (complex I A and complex I E) in maintaining a cellular redox state during photoheterotrophic growth. We propose that the function of each isozyme during photoheterotrophic growth is either NADH synthesis (complex I A) or NADH oxidation (complex I E). The canonical alphaproteobacterial complex I isozyme (complex I A) was also shown to be important for routing electrons to nitrogenase-mediated H 2 production, while the horizontally acquired enzyme (complex I E) was dispensable in this process. Unlike the singular role of complex I in mitochondria, we predict that the phylogenetically distinct complex I enzymes found across bacterial species have evolved to enhance the functions of their respective electron transport chains. Cells use a proton motive force (PMF), NADH, and ATP to support numerous processes. In mitochondria, complex I uses NADH oxidation to generate a PMF, which can drive ATP synthesis. This study analyzed the function of complex I in bacteria, which contain more-diverse and more-flexible electron transport chains than mitochondria. We tested complex I function in Rhodobacter sphaeroides, a bacterium predicted to encode two phylogenetically distinct complex I isozymes. R. sphaeroides cells lacking both isozymes had growth defects during all tested modes of growth, illustrating the important function of this enzyme under diverse conditions. We conclude that the two isozymes are not functionally redundant and predict that phylogenetically distinct complex I enzymes have evolved to support the diverse lifestyles of bacteria.« less

  14. Structural symmetry breaking of silicon containing polymers and their relation with electrical conductivity and Raman active vibrations

    NASA Astrophysics Data System (ADS)

    Cabrera, Alejandro; González, Carmen; Tagle, Luis; Terraza, Claudio; Volkmann, Ulrich; Barriga, Andrés; Ramos, Esteban; Pavez, Maximiliano

    2011-03-01

    The incorporation of silicon into the polymeric main chain or side groups can provide an enhancement in chemical, physical and mechanical properties. We report an efficient method for the synthesis of polymers containing silicon in the main chain, from the polycondensation reactions of four optically active carboxylic diacid. The solubility of the polymers, the molecular weight, the glass transition and the thermal stability were studied by standard techniques. Raman spectroscopy was used to probe the conformation of stretching modes as function of the temperature. The conductivity measurements indicated that the alignment of the molecules is a crucial parameter for electrical performance. When the polymers were exposed to iodine, charge transfer increased their mobility and decreased their optical band gaps. These novel properties highlight the possibility to generate alternative active opto-electronics polymers.

  15. Catalytic behavior of ‘Pt-atomic chain encapsulated gold nanotube’: A density functional study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nigam, Sandeep, E-mail: snigam@barc.gov.in; Majumder, Chiranjib

    2016-05-23

    With an aim to design novel material and explore its catalytic performance towards CO oxidation, Pt atomic chain was introduced inside gold nanotube (Au-NT). Theoretical calculations at the level of first principles formalism was carried out to investigate the atomic and electronic properties of the composite. Geometrically Pt atoms prefer to align in zig-zag fashion. Significant electronic charge transfer from inside Pt atoms to the outer wall Au atoms is observed. Interaction of O{sub 2} with Au-NT wall follows by injection of additional electronic charge in the anti-bonding orbital of oxygen molecule leading to activation of the O-O bond. Furthermore » interaction of CO molecule with the activated oxygen molecule leads to spontaneous oxidation reaction and formation of CO{sub 2}.« less

  16. Site-specific quantitative analysis of cardiac mitochondrial protein phosphorylation.

    PubMed

    Lam, Maggie P Y; Lau, Edward; Scruggs, Sarah B; Wang, Ding; Kim, Tae-Young; Liem, David A; Zhang, Jun; Ryan, Christopher M; Faull, Kym F; Ping, Peipei

    2013-04-09

    We report the development of a multiple-reaction monitoring (MRM) strategy specifically tailored to the detection and quantification of mitochondrial protein phosphorylation. We recently derived 68 MRM transitions specific to protein modifications in the respiratory chain, voltage-dependent anion channel, and adenine nucleotide translocase. Here, we have now expanded the total number of MRM transitions to 176 to cover proteins from the tricarboxylic acid cycle, pyruvate dehydrogenase complex, and branched-chain alpha-keto acid dehydrogenase complex. We utilized the transition set to analyze endogenous protein phosphorylation in human heart, mouse heart, and mouse liver. The data demonstrate the potential utility of the MRM workflow for studying the functional details of mitochondrial phosphorylation signaling. This article is part of a Special Issue entitled: From protein structures to clinical applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Ubiquitin enzymes in the regulation of immune responses.

    PubMed

    Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo

    2017-08-01

    Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.

  18. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  19. Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

    DOE PAGES

    Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

    2015-10-27

    In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

  20. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

    2015-07-15

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

  1. Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

    PubMed

    Brownholland, David P; Covey, Douglas F

    2017-05-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  3. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  4. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  5. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  6. Total integrated slidable and valveless solid phase extraction-polymerase chain reaction-capillary electrophoresis microdevice for mini Y chromosome short tandem repeat genotyping.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok

    2016-04-15

    A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Synthetic neutron camera and spectrometer in JET based on AFSI-ASCOT simulations

    NASA Astrophysics Data System (ADS)

    Sirén, P.; Varje, J.; Weisen, H.; Koskela, T.; contributors, JET

    2017-09-01

    The ASCOT Fusion Source Integrator (AFSI) has been used to calculate neutron production rates and spectra corresponding to the JET 19-channel neutron camera (KN3) and the time-of-flight spectrometer (TOFOR) as ideal diagnostics, without detector-related effects. AFSI calculates fusion product distributions in 4D, based on Monte Carlo integration from arbitrary reactant distribution functions. The distribution functions were calculated by the ASCOT Monte Carlo particle orbit following code for thermal, NBI and ICRH particle reactions. Fusion cross-sections were defined based on the Bosch-Hale model and both DD and DT reactions have been included. Neutrons generated by AFSI-ASCOT simulations have already been applied as a neutron source of the Serpent neutron transport code in ITER studies. Additionally, AFSI has been selected to be a main tool as the fusion product generator in the complete analysis calculation chain: ASCOT - AFSI - SERPENT (neutron and gamma transport Monte Carlo code) - APROS (system and power plant modelling code), which encompasses the plasma as an energy source, heat deposition in plant structures as well as cooling and balance-of-plant in DEMO applications and other reactor relevant analyses. This conference paper presents the first results and validation of the AFSI DD fusion model for different auxiliary heating scenarios (NBI, ICRH) with very different fast particle distribution functions. Both calculated quantities (production rates and spectra) have been compared with experimental data from KN3 and synthetic spectrometer data from ControlRoom code. No unexplained differences have been observed. In future work, AFSI will be extended for synthetic gamma diagnostics and additionally, AFSI will be used as part of the neutron transport calculation chain to model real diagnostics instead of ideal synthetic diagnostics for quantitative benchmarking.

  8. Expression characteristics of long noncoding RNA uc.322 and its effects on pancreatic islet function.

    PubMed

    Zhao, Xiaoqin; Rong, Can; Pan, Fenghui; Xiang, Lizhi; Wang, Xinlei; Hu, Yun

    2018-06-28

    Increasing evidence indicates that long noncoding RNAs (lncRNAs) perform special biological functions by regulating gene expression through multiple pathways and molecular mechanisms. The aim of this study was to explore the expression characteristics of lncRNA uc.322 in pancreatic islet cells and its effects on the secretion function of islet cells. Bioinformatics analysis was used to detect the lncRNA uc.322 sequence, location, and structural features. Expression of lncRNA uc.322 in different tissues was detected by quantitative polymerase chain reaction analyses. Quantitative polymerase chain reaction, Western blot analysis, adenosine triphosphate determination, glucose-stimulated insulin secretion, and enzyme-linked immunosorbent assay were used to evaluate the effects of lncRNA uc.322 on insulin secretion. The results showed that the full-length of lncRNA uc.322 is 224 bp and that it is highly conserved in various species. Bioinformatics analysis revealed that lncRNA uc.322 is located on chr7:122893196-122893419 (GRCH37/hg19) within the SRY-related HMG-box 6 gene exon region. Compared with other tissues, lncRNA uc.322 is highly expressed in pancreatic tissue. Upregulation of lncRNA uc.322 expression increases the insulin transcription factors pancreatic and duodenal homeobox 1 and Forkhead box O1 expression, promotes insulin secretion in the extracellular fluid of Min6 cells, and increases the adenosine triphosphate concentration. On the other hand, knockdown of lncRNA uc.322 has opposite effects on Min6 cells. Overall, this study showed that upregulation of lncRNA uc.322 in islet β-cells can increase the expression of insulin transcription factors and promote insulin secretion, and it may be a new therapeutic target for diabetes. © 2018 Wiley Periodicals, Inc.

  9. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  10. Cytochromes and iron sulfur proteins in sulfur metabolism of phototrophic bacteria

    NASA Technical Reports Server (NTRS)

    Fischer, U.

    1985-01-01

    Dissimilatory sulfur metabolism in phototrophic sulfur bacteria provides the bacteria with electrons for photosynthetic electron transport chain and, with energy. Assimilatory sulfate reduction is necessary for the biosynthesis of sulfur-containing cell components. Sulfide, thiosulfate, and elemental sulfur are the sulfur compounds most commonly used by phototrophic bacteria as electron donors for anoxygenic photosynthesis. Cytochromes or other electron transfer proteins, like high-potential-iron-sulfur protein (HIPIP) function as electron acceptors or donors for most enzymatic steps during the oxidation pathways of sulfide or thiosulfate. Yet, heme- or siroheme-containing proteins themselves undergo enzymatic activities in sulfur metabolism. Sirohemes comprise a porphyrin-like prosthetic group of sulfate reductase. eenzymatic reactions involve electron transfer. Electron donors or acceptors are necessary for each reaction. Cytochromes and iron sulfur problems, are able to transfer electrons.

  11. Synthesis of functionalized imidazolidine-2-thiones via NHC/base-promoted aza-benzoin/aza-acetalization domino reactions.

    PubMed

    Di Carmine, Graziano; Ragno, Daniele; De Risi, Carmela; Bortolini, Olga; Giovannini, Pier Paolo; Fantin, Giancarlo; Massi, Alessandro

    2017-10-25

    A strategy for the synthesis of biologically relevant 5-hydroxy-imidazolidine-2-thione derivatives is presented. A novel class of α-sulfonylamines have been suitably prepared (46-81% yield) as precursors of formal benzylidenethiourea acceptors; these are generated in situ and intercepted by N-heterocyclic carbene (NHC)-activated aldehydes affording open-chain aza-benzoin-type adducts, which in turn undergo an intramolecular aza-acetalization reaction in a one-pot fashion. A thiazolium salt/triethylamine couple proved to be the more effective system to trigger the domino sequence giving the target heterocycles in good yields (45-97%) and diastereoselectivities (up to 99 : 1 dr). The multigram scale synthesis and elaboration of a selected 5-hydroxy-imidazolidine-2-thione compound is also described.

  12. Regio- and stereodivergent antibiotic oxidative carbocyclizations catalysed by Rieske oxygenase-like enzymes

    NASA Astrophysics Data System (ADS)

    Sydor, Paulina K.; Barry, Sarah M.; Odulate, Olanipekun M.; Barona-Gomez, Francisco; Haynes, Stuart W.; Corre, Christophe; Song, Lijiang; Challis, Gregory L.

    2011-05-01

    Oxidative cyclizations, exemplified by the biosynthetic assembly of the penicillin nucleus from a tripeptide precursor, are arguably the most synthetically powerful implementation of C-H activation reactions in nature. Here, we show that Rieske oxygenase-like enzymes mediate regio- and stereodivergent oxidative cyclizations to form 10- and 12-membered carbocyclic rings in the key steps of the biosynthesis of the antibiotics streptorubin B and metacycloprodigiosin, respectively. These reactions represent the first examples of oxidative carbocyclizations catalysed by non-haem iron-dependent oxidases and define a novel type of catalytic activity for Rieske enzymes. A better understanding of how these enzymes achieve such remarkable regio- and stereocontrol in the functionalization of unactivated hydrocarbon chains will greatly facilitate the development of selective man-made C-H activation catalysts.

  13. Nanobiostructure of fibrous-like alumina functionalized with an analog of the BP100 peptide: Synthesis, characterization and biological applications.

    PubMed

    Torres, L M F C; Braga, N A; Gomes, I P; Almeida, M T; Santos, T L; de Mesquita, J P; da Silva, L M; Martins, H R; Kato, K C; Dos Santos, W T P; Resende, J M; Pereira, M C; Bemquerer, M P; Rodrigues, M A; Verly, R M

    2018-03-01

    The functionalization of alumina nanoparticles of specific morphology with antimicrobial peptides (AMP) can be a promising strategy for modeling medical devices and packaging materials for cosmetics, medicines or food, since the contamination by pathogens could be reduced. In this paper, we show the synthesis of a fibrous-like alumina nanobiostructure, as well as its functionalization with the peptide EAAA-BP100, an analog of the antimicrobial peptide BP100. The antibacterial activity of the obtained material against some bacterial strains is also investigated. The covalent binding of the peptide to the nanoparticles was promoted by a reaction between the carboxyl group of the glutamate side chain (E1) of the peptide and the amino groups of the alumina nanoparticles, previously modified by reaction with 3-aminopropyltrietoxysilane (APTES). The functionalized nanoparticles were characterized by zeta potential measurements, Fourier transform infrared spectroscopy, and other physicochemical techniques. Although the obtained alumina nanobiostructure shows a relatively low degree of substitution with EAAA-BP100, antibacterial activities against Escherichia coli and Salmonella typhimurium strains are appreciably higher than the activities of the free peptide. The obtained results can affect the design of new hybrid nanobiomaterials based on nanoparticles functionalized with AMP. Copyright © 2018. Published by Elsevier B.V.

  14. Functional role of R462 in the degradation of hyaluronan catalyzed by hyaluronate lyase from Streptococcus pneumoniae.

    PubMed

    Li, Fengxue; Xu, Dingguo

    2015-08-01

    Hyaluronan lyase from Streptococcus pneumoniae can degrade hyaluronic acid, which is one of the major components in the extracellular matrix. Hyaluronan can regulate water balance, osmotic pressure, and act as an ion exchange resin. Followed by our recent work on the catalytic reaction mechanism and substrate binding mode, we in this work further investigate the functional role of active site arginine residue, R462, in the degradation of hyaluronan. The site directed mutagenesis simulation of R462A and R462Q were modeled using a combined quantum mechanical and molecular mechanical method. The overall substrate binding features upon mutations do not have significant changes. The energetic profiles for the reaction processes are essentially the same as that in wild type enzyme, but significant activation barrier height changes can be observed. Both mutants were shown to accelerate the overall enzymatic activity, e.g., R462A can reduce the barrier height by about 2.8 kcal mol(-1), while R462Q reduces the activation energy by about 2.9 kcal mol(-1). Consistent with the active site model calculated using density functional theory, our results can support that the positive charge on R462 guanidino side chain group plays a negative role in the catalysis. Finally, the functional role of R462 was proposed to facilitate the formation of initial enzyme-substrate complex, but not in the subsequent catalytic degradation reaction. Graphical Abstract Degradation of hyaluronan catalyzed by hyaluronate lyase from Streptococcus pneumoniae.

  15. Methanol Cannon Demonstrations Revisited.

    ERIC Educational Resources Information Center

    Dolson, David A.; And Others

    1995-01-01

    Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

  16. Addressing fluorogenic real-time qPCR inhibition using the novel custom Excel file system 'FocusField2-6GallupqPCRSet-upTool-001' to attain consistently high fidelity qPCR reactions

    PubMed Central

    Ackermann, Mark R.

    2006-01-01

    The purpose of this manuscript is to discuss fluorogenic real-time quantitative polymerase chain reaction (qPCR) inhibition and to introduce/define a novel Microsoft Excel-based file system which provides a way to detect and avoid inhibition, and enables investigators to consistently design dynamically-sound, truly LOG-linear qPCR reactions very quickly. The qPCR problems this invention solves are universal to all qPCR reactions, and it performs all necessary qPCR set-up calculations in about 52 seconds (using a pentium 4 processor) for up to seven qPCR targets and seventy-two samples at a time – calculations that commonly take capable investigators days to finish. We have named this custom Excel-based file system "FocusField2-6GallupqPCRSet-upTool-001" (FF2-6-001 qPCR set-up tool), and are in the process of transforming it into professional qPCR set-up software to be made available in 2007. The current prototype is already fully functional. PMID:17033699

  17. Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

    NASA Astrophysics Data System (ADS)

    Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

    2017-09-01

    It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

  18. Functional Stability of a Mixed Microbial Consortium Producing PHA From Waste Carbon Sources

    NASA Astrophysics Data System (ADS)

    Coats, Erik R.; Loge, Frank J.; Smith, William A.; Thompson, David N.; Wolcott, Michael P.

    Polyhydroxyalkanoates (PHAs) represent an environmentally effective alternative to synthetic thermoplastics; however, current production practices are not sustainable. In this study, PHA production was accomplished in sequencing batch bioreactors utilizing real wastewaters and mixed microbial consortia from municipal activated sludge as inoculum. Polymer production reached 85, 53, and 10% of the cell dry weight from methanol-enriched pulp and paper mill foul condensate, fermented municipal primary solids, and biodiesel wastewater, respectively. Using denaturing gradient gel electrophoresis of 16S-rDNA from polymerase chain reaction-amplified DNA extracts, distinctly different communities were observed between and within wastewaters following enrichment. Most importantly, functional stability was maintained despite differing and contrasting microbial populations.

  19. A practical teaching course in directed protein evolution using the green fluorescent protein as a model.

    PubMed

    Ruller, Roberto; Silva-Rocha, Rafael; Silva, Artur; Cruz Schneider, Maria Paula; Ward, Richard John

    2011-01-01

    Protein engineering is a powerful tool, which correlates protein structure with specific functions, both in applied biotechnology and in basic research. Here, we present a practical teaching course for engineering the green fluorescent protein (GFP) from Aequorea victoria by a random mutagenesis strategy using error-prone polymerase chain reaction. Screening of bacterial colonies transformed with random mutant libraries identified GFP variants with increased fluorescence yields. Mapping the three-dimensional structure of these mutants demonstrated how alterations in structural features such as the environment around the fluorophore and properties of the protein surface can influence functional properties such as the intensity of fluorescence and protein solubility. Copyright © 2011 Wiley Periodicals, Inc.

  20. Molecular Characterization and Functional Analysis of a Ferritin Heavy Chain Subunit from the Eri-Silkworm, Samia cynthia ricini

    PubMed Central

    Yu, Hai-Zhong; Zhang, Shang-Zhi; Ma, Yan; Fei, Dong-Qiong; Li, Bing; Yang, Li-Ang; Wang, Jie; Li, Zhen; Muhammad, Azharuddin; Xu, Jia-Ping

    2017-01-01

    Ferritins are conserved iron-binding proteins that are primarily involved in iron storage, detoxification and the immune response. Despite the importance of ferritin in organisms, little is known about their roles in the eri-silkworm (Samia cynthia ricini). We previously identified a ferritin heavy chain subunit named ScFerHCH in the S. c. ricini transcriptome database. The full-length S. c. ricini ferritin heavy chain subunit (ScFerHCH) was 1863 bp and encoded a protein of 231 amino acids with a deduced molecular weight of 25.89 kDa. Phylogenetic analysis revealed that ScFerHCH shared a high amino acid identity with the Bombyx mori and Danaus plexippus heavy chain subunits. Higher ScFerHCH expression levels were found in the silk gland, fat body and midgut of S. c. ricini by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blotting. Injection of Staphylococcus aureus and Pseudomonas aeruginosa was associated with an upregulation of ScFerHCH in the midgut, fat body and hemolymph, indicating that ScFerHCH may contribute to the host’s defense against invading pathogens. In addition, the anti-oxidation activity and iron-binding capacity of recombinant ScFerHCH protein were examined. Taken together, our results suggest that the ferritin heavy chain subunit from eri-silkworm may play critical roles not only in innate immune defense, but also in organismic iron homeostasis. PMID:29036914

  1. Asymmetric synthesis of propargylamines as amino acid surrogates in peptidomimetics

    PubMed Central

    Wünsch, Matthias; Schröder, David; Fröhr, Tanja; Teichmann, Lisa; Hedwig, Sebastian; Janson, Nils; Belu, Clara; Simon, Jasmin; Heidemeyer, Shari; Holtkamp, Philipp; Rudlof, Jens; Klemme, Lennard; Hinzmann, Alessa; Neumann, Beate; Stammler, Hans-Georg

    2017-01-01

    The amide moiety of peptides can be replaced for example by a triazole moiety, which is considered to be bioisosteric. Therefore, the carbonyl moiety of an amino acid has to be replaced by an alkyne in order to provide a precursor of such peptidomimetics. As most amino acids have a chiral center at Cα, such amide bond surrogates need a chiral moiety. Here the asymmetric synthesis of a set of 24 N-sulfinyl propargylamines is presented. The condensation of various aldehydes with Ellman’s chiral sulfinamide provides chiral N-sulfinylimines, which were reacted with (trimethylsilyl)ethynyllithium to afford diastereomerically pure N-sulfinyl propargylamines. Diverse functional groups present in the propargylic position resemble the side chain present at the Cα of amino acids. Whereas propargylamines with (cyclo)alkyl substituents can be prepared in a direct manner, residues with polar functional groups require suitable protective groups. The presence of particular functional groups in the side chain in some cases leads to remarkable side reactions of the alkyne moiety. Thus, electron-withdrawing substituents in the Cα-position facilitate a base induced rearrangement to α,β-unsaturated imines, while azide-substituted propargylamines form triazoles under surprisingly mild conditions. A panel of propargylamines bearing fluoro or chloro substituents, polar functional groups, or basic and acidic functional groups is accessible for the use as precursors of peptidomimetics. PMID:29234470

  2. Unraveling reaction pathways and specifying reaction kinetics for complex systems.

    PubMed

    Vinu, R; Broadbelt, Linda J

    2012-01-01

    Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

  3. Anti-knock quality of sugar derived levulinic esters and cyclic ethers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tian, Miao; McCormick, Robert L.; Luecke, Jon

    Here, the objective of this paper is to investigate the anti-knock quality of sugar-derived levulinic esters (methyl levulinate (ML) and ethyl levulinate (EL)) and cyclic ethers (furfuryl ethyl ether (FEE) and ethyl tetrahydrofurfuryl ether (ETE)). To this end, combustion experiments were carried out in both an engine and a constant volume autoignition device. The results from both apparati demonstrate that ML, EL and FEE have superior anti-knock quality than the reference Euro95 gasoline. ETE, conversely, performed markedly worse than the reference fuel on both setups and might therefore be a more appropriate fuel for compression ignition engines. The main reasonmore » of the distinctions in anti-knock quality can be found in the molecular structure of the neat biofuels. ML and EL are levulinic esters, with a ketone (C=O) functionality and an ester (C(=O)-O) group on the carbon chain. They can readily produce stable intermediates during the auto-ignition process, thereby slowing down the overall reaction rate. The unsaturated cyclic ether (FEE) has very strong ring C-H bonds. However, the saturated cyclic ether (ETE) has weak ring C-H bonds, which facilitate more readily ring opening reactions. Long side chains on the cyclic ethers further accelerate the reaction rate. Importantly for future research, our results suggest that IQT and engine experiments are interchangeable setups with respect to qualitative anti-knock quality evaluation of novel compounds.« less

  4. Development and validation of a multiplex quantitative polymerase chain reaction assay for the detection of Mollicutes impurities in human cells, cultured under good manufacturing practice conditions, and following European Pharmacopoeia requirements and the International Conference on Harmonization guidelines.

    PubMed

    Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto

    2012-07-01

    The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.

  5. Anti-knock quality of sugar derived levulinic esters and cyclic ethers

    DOE PAGES

    Tian, Miao; McCormick, Robert L.; Luecke, Jon; ...

    2017-04-22

    Here, the objective of this paper is to investigate the anti-knock quality of sugar-derived levulinic esters (methyl levulinate (ML) and ethyl levulinate (EL)) and cyclic ethers (furfuryl ethyl ether (FEE) and ethyl tetrahydrofurfuryl ether (ETE)). To this end, combustion experiments were carried out in both an engine and a constant volume autoignition device. The results from both apparati demonstrate that ML, EL and FEE have superior anti-knock quality than the reference Euro95 gasoline. ETE, conversely, performed markedly worse than the reference fuel on both setups and might therefore be a more appropriate fuel for compression ignition engines. The main reasonmore » of the distinctions in anti-knock quality can be found in the molecular structure of the neat biofuels. ML and EL are levulinic esters, with a ketone (C=O) functionality and an ester (C(=O)-O) group on the carbon chain. They can readily produce stable intermediates during the auto-ignition process, thereby slowing down the overall reaction rate. The unsaturated cyclic ether (FEE) has very strong ring C-H bonds. However, the saturated cyclic ether (ETE) has weak ring C-H bonds, which facilitate more readily ring opening reactions. Long side chains on the cyclic ethers further accelerate the reaction rate. Importantly for future research, our results suggest that IQT and engine experiments are interchangeable setups with respect to qualitative anti-knock quality evaluation of novel compounds.« less

  6. High-resolution melting analysis of sequence variations in the cytidine deaminase gene (CDA) in patients with cancer treated with gemcitabine.

    PubMed

    Raynal, Caroline; Ciccolini, Joseph; Mercier, Cédric; Boyer, Jean-Christophe; Polge, Anne; Lallemant, Benjamin; Mouzat, Kévin; Lumbroso, Serge; Brouillet, Jean-Paul; Evrard, Alexandre

    2010-02-01

    Gemcitabine (2',2'-difluorodeoxycytidine) is a major antimetabolite cytotoxic drug with a wide spectrum of activity against solid tumors. Hepatic elimination of gemcitabine depends on a catabolic pathway through a deamination step driven by the enzyme cytidine deaminase (CDA). Severe hematologic toxicity to gemcitabine was reported in patients harboring genetic polymorphisms in CDA gene. High-resolution melting (HRM) analysis of polymerase chain reaction amplicon emerges today as a powerful technique for both genotyping and gene scanning strategies. In this study, 46 DNA samples from gemcitabine-treated patients were subjected to HRM analysis on a LightCycler 480 platform. Residual serum CDA activity was assayed as a surrogate marker for the overall functionality of this enzyme. Genotyping of three well-described single nucleotide polymorphisms in coding region (c.79A>C, c.208G>A and c.435C>T) was successfully achieved by HRM analysis of small polymerase chain reaction fragments, whereas unknown single nucleotide polymorphisms were searched by a gene scanning strategy with longer amplicons (up to 622 bp). The gene scanning strategy allowed us to find a new intronic mutation c.246+37G>A in a female patient displaying marked CDA deficiency and who had an extreme toxic reaction with a fatal outcome to gemcitabine treatment. Our work demonstrates that HRM-based methods, owing to their simplicity, reliability, and speed, are useful tools for diagnosis of CDA deficiency and could be of interest for personalized medicine.

  7. Intramolecular Hydroamination of Unbiased and Functionalized Primary Aminoalkenes Catalyzed by a Rhodium Aminophosphine Complex

    PubMed Central

    Julian, Lisa D.; Hartwig, John F.

    2010-01-01

    We report a rhodium catalyst that exhibits high reactivity for the hydroamination of primary aminoalkenes that are unbiased toward cyclization and that possess functional groups that would not be tolerated in hydroaminations catalyzed by more electrophilic systems. This catalyst contains an unusual diaminophosphine ligand that binds to rhodium in a κ3-P,O,P mode. The reactions catalyzed by this complex typically proceed at mild temperatures (room temperature to 70 °C), occur with primary aminoalkenes lacking substituents on the alkyl chain that bias the system toward cyclization, occur with primary aminoalkenes containing chloride, ester, ether, enolizable ketone, nitrile, and unprotected alcohol functionality, and occur with primary aminoalkenes containing internal olefins. Mechanistic data imply that these reactions occur with a turnover-limiting step that is different from that of reactions catalyzed by late transition metal complexes of Pd, Pt, and Ir. This change in the turnover-limiting step and resulting high activity of the catalyst stem from favorable relative rates for protonolysis of the M-C bond to release the hydroamination product vs reversion of the aminoalkyl intermediate to regenerate the acyclic precursor. Probes for the origin of the reactivity of the rhodium complex of L1 imply that the aminophosphine groups lead to these favorable rates by effects beyond steric demands and simple electron donation to the metal center. PMID:20839807

  8. Application of AlkBGT and AlkL from Pseudomonas putida GPo1 for Selective Alkyl Ester ω-Oxyfunctionalization in Escherichia coli

    PubMed Central

    Eggink, Gerrit; Weusthuis, Ruud A.

    2016-01-01

    ABSTRACT The enzyme system AlkBGT from Pseudomonas putida GPo1 can efficiently ω-functionalize fatty acid methyl esters. Outer membrane protein AlkL boosts this ω-functionalization. In this report, it is shown that whole cells of Escherichia coli expressing the AlkBGT system can also ω-oxidize ethyl nonanoate (NAEE). Coexpression of AlkBGT and AlkL resulted in 1.7-fold-higher ω-oxidation activity on NAEE. With this strain, initial activity on NAEE was 70 U/g (dry weight) of cells (gcdw), 67% of the initial activity on methyl nonanoate. In time-lapse conversions with 5 mM NAEE the main product was 9-hydroxy NAEE (3.6 mM), but also 9-oxo NAEE (0.1 mM) and 9-carboxy NAEE (0.6 mM) were formed. AlkBGT also ω-oxidized ethyl, propyl, and butyl esters of fatty acids ranging from C6 to C10. Increasing the length of the alkyl chain improved the ω-oxidation activity of AlkBGT on esters of C6 and C7 fatty acids. From these esters, application of butyl hexanoate resulted in the highest ω-oxidation activity, 82 U/gcdw. Coexpression of AlkL only had a positive effect on ω-functionalization of substrates with a total length of C11 or longer. These findings indicate that AlkBGT(L) can be applied as a biocatalyst for ω-functionalization of ethyl, propyl, and butyl esters of medium-chain fatty acids. IMPORTANCE Fatty acid esters are promising renewable starting materials for the production of ω-hydroxy fatty acid esters (ω-HFAEs). ω-HFAEs can be used to produce sustainable polymers. Chemical conversion of the fatty acid esters to ω-HFAEs is challenging, as it generates by-products and needs harsh reaction conditions. Biocatalytic production is a promising alternative. In this study, biocatalytic conversion of fatty acid esters toward ω-HFAEs was investigated using whole cells. This was achieved with recombinant Escherichia coli cells that produce the AlkBGT enzymes. These enzymes can produce ω-HFAEs from a wide variety of fatty acid esters. Medium-chain-length acids (C6 to C10) esterified with ethanol, propanol, or butanol were applied. This is a promising production platform for polymer building blocks that uses renewable substrates and mild reaction conditions. PMID:27084021

  9. Silicon nitride boundary lubrication: Effect of oxygenates

    NASA Astrophysics Data System (ADS)

    Gates, Richard S.; Hsu, Stephen M.

    1995-07-01

    A ball-on-three-flat (BTF) wear tester was used to investigate the boundary lubricating characteristics of oxygenates on a commercial silicon nitride. A wide variety of oxygen-containing compounds containing hydroxyl functioal groups were more effective compared to a base case of neat paraffin oil. Decreases of up to 58% in friction coefficient, and 95% in wear were obtained. In most cases, films were obseved in and around the wear scar, suggesting chemical reactions had taken place in the contact. Additional wear tests, conducted using neat shorter-chain linear primary alcohols, i.e., 6-10 carbons, demonstrated boundary lubrication protection, with longer chain length providing better antiwear performance. A study of several C8 compounds with specific oxygen-containing functional groups (primary alcohol, secondary alcohols, acid, aldehyde, and ketone) demonstrated that the primary alcohol had the strongest boundary lubricating effect. Varying the amount of water in the alcohols had little effect on friction and wear, suggesting that the boundary lubrication effects observed were not merely due to dissolved water in these fluids, but some characteristic chemical interaction with the hydroxyl functional group of the alcohols and acids.

  10. Central catalytic domain of BRAP (RNF52) recognizes the types of ubiquitin chains and utilizes oligo-ubiquitin for ubiquitylation

    PubMed Central

    Hanada, Kazuharu; Ohsawa, Noboru

    2017-01-01

    Really interesting new gene (RING)-finger protein 52 (RNF52), an E3 ubiquitin ligase, is found in eukaryotes from yeast to humans. Human RNF52 is known as breast cancer type 1 susceptibility protein (BRCA1)-associated protein 2 (BRAP or BRAP2). The central catalytic domain of BRAP comprises four subdomains: nucleotide-binding α/β plait (NBP), really interesting new gene (RING) zinc finger, ubiquitin-specific protease (UBP)-like zinc finger (ZfUBP), and coiled-coil (CC). This domain architecture is conserved in RNF52 orthologs; however, the domain's function in the ubiquitin system has not been delineated. In the present study, we discovered that the RNF52 domain, comprising NBP–RING–ZfUBP–CC, binds to ubiquitin chains (oligo-ubiquitin) but not to the ubiquitin monomers, and can utilize various ubiquitin chains for ubiquitylation and auto-ubiquitylation. The RNF52 domain preferentially bound to M1- and K63-linked di-ubiquitin chains, weakly to K27-linked chains, but not to K6-, K11-, or K48-linked chains. The binding preferences of the RNF52 domain for ubiquitin-linkage types corresponded to ubiquitin usage in the ubiquitylation reaction, except for K11-, K29-, and K33-linked chains. Additionally, the RNF52 domain directly ligated the intact M1-linked, tri-, and tetra-ubiquitin chains and recognized the structural alterations caused by the phosphomimetic mutation of these ubiquitin chains. Full-length BRAP had nearly the same specificity for the ubiquitin-chain types as the RNF52 domain alone. Mass spectrometry analysis of oligomeric ubiquitylation products, mediated by the RNF52 domain, revealed that the ubiquitin-linkage types and auto-ubiquitylation sites depend on the length of ubiquitin chains. Here, we propose a model for the oligomeric ubiquitylation process, controlled by the RNF52 domain, which is not a sequential assembly process involving monomers. PMID:28768733

  11. Synthesis of hydrophilic carbon nanotubes by grafting poly(methyl methacrylate) via click reaction and its effect on poly(vinylidene fluoride)-carbon nanotube composite membrane properties1

    NASA Astrophysics Data System (ADS)

    Ma, Wenzhong; Zhao, Yuchen; Li, Yuxue; Zhang, Peng; Cao, Zheng; Yang, Haicun; Liu, Chunlin; Tao, Guoliang; Gong, Fanghong; Matsuyama, Hideto

    2018-03-01

    Surface modification of azide-decorated multiwalled carbon nanotubes (MWCNTs) with well-defined alkyne-terminated poly(methyl methacrylate) (PMMA) chains was accomplished via the combination of reversible addition fragmentation chain transfer (RAFT) and "click" chemistry. Successful attachment of PMMA onto MWCNT was confirmed by Fourier transform infrared spectroscopy, thermogravimetric analysis (TGA), gel permeation chromatography, Raman spectroscopy, and transmission electron microscopy. The highest grafting percentage (GP) of the PMMA chains (GP = 23.3%) was calculated using TGA. The effect of the PMMA-grafted-MWCNTs (MWCNTs-g-PMMA) content on the performance of the poly(vinylidene fluoride) (PVDF)-MWCNTs-g-PMMA composite membrane was studied. The MWCNTs-g-PMMA was found to be well dispersed in the PVDF composite membrane matrix because of the excellent compatibility between the PMMA and PVDF chains. The composite membranes showed improved porosity, hydrophilicity, water flux, β-PVDF content, and mechanical properties at an optimal amount of 2 wt% MWCNTs-g-PMMA incorporated in the PVDF membrane matrix. In contrast, the hydroxyl functionalized MWCNTs (MWCNTs-OH) showed limited enhancement in the water flux and mechanical strength, which is mainly due to the poor dispersion of MWCNT because of the weak interaction between the MWCNT and PVDF chains. This study reveals the excellent prospect of the MWCNT-based ultrafiltration membrane with enhanced properties in water treatment applications.

  12. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    PubMed

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  13. Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

    PubMed

    Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

    This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  14. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  15. Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

    PubMed

    Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

    2006-10-12

    [reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

  16. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    PubMed

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  17. A computational study of pyrolysis reactions of lignin model compounds

    Treesearch

    Thomas Elder

    2010-01-01

    Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

  18. Reaction of oxygen with the respiratory chain in cells and tissues.

    PubMed

    Chance, B

    1965-09-01

    This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate of ATP production falls and energy conservation previously under the control of the ADP concentration will now be controlled by the diffusion of oxygen to the respiratory enzymes in the mitochondria. Under these conditions the rate of reaction of cytochrome oxidase with oxygen and the reaction of cytochromes with one another become of key importance. The rise of ADP and the depletion of energy reserves evoke glycolytic activity, and failure of biological function may result.

  19. Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

    NASA Astrophysics Data System (ADS)

    Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

    2005-12-01

    Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

  20. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    NASA Astrophysics Data System (ADS)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  1. On-Surface Domino Reactions: Glaser Coupling and Dehydrogenative Coupling of a Biscarboxylic Acid To Form Polymeric Bisacylperoxides.

    PubMed

    Held, Philipp Alexander; Gao, Hong-Ying; Liu, Lacheng; Mück-Lichtenfeld, Christian; Timmer, Alexander; Mönig, Harry; Barton, Dennis; Neugebauer, Johannes; Fuchs, Harald; Studer, Armido

    2016-08-08

    Herein we report the on-surface oxidative homocoupling of 6,6'-(1,4-buta-1,3-diynyl)bis(2-naphthoic acid) (BDNA) via bisacylperoxide formation on different Au substrates. By using this unprecedented dehydrogenative polymerization of a biscarboxylic acid, linear poly-BDNA with a chain length of over 100 nm was prepared. It is shown that the monomer BDNA can be prepared in situ at the surface via on-surface Glaser coupling of 6-ethynyl-2-naphthoic acid (ENA). Under the Glaser coupling conditions, BDNA directly undergoes polymerization to give the polymeric peroxide (poly-BDNA) representing a first example of an on-surface domino reaction. It is shown that the reaction outcome varies as a function of surface topography (Au(111) or Au(100)) and also of the surface coverage, to give branched polymers, linear polymers, or 2D metal-organic networks. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Chemical sensors from the cooperative actuation of multistep electrochemical molecular machines of polypyrrole: potentiostatic study. Trying to replicate muscle’s fatigue signals

    NASA Astrophysics Data System (ADS)

    Beaumont, Samuel; Otero, Toribio F.

    2018-07-01

    Polypyrrole film electrodes are constituted by multielectronic electrochemical molecular machines (every polymeric molecule) counterions and water, mimicking the intracellular matrix of muscular cells. The influence of the electrolyte concentration on the reversible oxidation/reduction of polypyrrole films was studied in NaCl aqueous solutions by consecutive square potential waves. The consumed redox charge and the consumed electrical energy change as a function of the concentration. That means that the extension (the consumed charge) of the reaction involving conformational, or allosteric, movements of the reacting polymeric chains (molecular machines) responds to (senses) the chemical energy of the reaction ambient. A theoretical description of the attained empirical results is presented getting the sensing equations and the concomitant sensitivities. Those results could indicate the origin and nature of the neural signals sent to the brain from biological haptic muscles working by cooperative actuation of the actin-myosin molecular machines driven by chemical reactions and sensing, simultaneously, the fatigue state of the muscle.

  3. Quantification of diesel exhaust gas phase organics by a thermal desorption proton transfer reaction mass spectrometer

    NASA Astrophysics Data System (ADS)

    Erickson, M. H.; Wallace, H. W.; Jobson, B. T.

    2012-02-01

    A new approach was developed to measure the total abundance of long chain alkanes (C12 and above) in urban air using thermal desorption with a proton transfer reaction mass spectrometer (PTR-MS). These species are emitted in diesel exhaust and may be important precursors to secondary organic aerosol production in urban areas. Long chain alkanes undergo dissociative proton transfer reactions forming a series of fragment ions with formula CnH2n+1. The yield of the fragment ions is a function of drift conditions. At a drift field strength of 80 Townsends, the most abundant ion fragments from C10 to C16 n-alkanes were m/z 57, 71 and 85. The PTR-MS is insensitive to n-alkanes less than C8 but displays an increasing sensitivity for larger alkanes. Higher drift field strengths yield greater normalized sensitivity implying that the proton affinity of the long chain n-alkanes is less than H2O. Analysis of diesel fuel shows the mass spectrum was dominated by alkanes (CnH2n+1), monocyclic aromatics, and an ion group with formula CnH2n-1 (m/z 97, 111, 125, 139). The PTR-MS was deployed in Sacramento, CA during the Carbonaceous Aerosols and Radiative Effects Study field experiment in June 2010. The ratio of the m/z 97 to 85 ion intensities in ambient air matched that found in diesel fuel. Total diesel exhaust alkane concentrations calculated from the measured abundance of m/z 85 ranged from the method detection limit of ~1 μg m-3 to 100 μg m-3 in several air pollution episodes. The total diesel exhaust alkane concentration determined by this method was on average a factor of 10 greater than the sum of alkylbenzenes associated with spark ignition vehicle exhaust.

  4. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  5. Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

    PubMed

    Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

    2018-05-15

    A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

  6. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  7. Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

    PubMed

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

    2007-04-01

    Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

  8. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  9. Grafting of functionalized polymer on porous silicon surface using Grignard reagent

    NASA Astrophysics Data System (ADS)

    Tighilt, F.-Z.; Belhousse, S.; Sam, S.; Hamdani, K.; Lasmi, K.; Chazalviel, J. N.; Gabouze, N.

    2017-11-01

    Recently, considerable attention has been paid to the manipulation and the control of the physicochemical properties of porous silicon surfaces because of their crucial importance to the modern microelectronics industry. Hybrid structures consisting of deposited polymer on porous silicon surfaces are important to applications in microelectronics, photovoltaics and sensors (Ensafi et al., 2016; Kashyout et al., 2015; Osorio et al.; 2015; Hejjo et al., 2002) [1-4]. In many cases, the polymer can provide excellent mechanical and chemical protection of the substrate, changes the electrochemical interface characteristics of the substrate, and provides new ways to the functionalization of porous silicon surfaces for molecular recognition and sensing. In this work, porous silicon surface was modified by anodic treatment in ethynylmagnesium bromide electrolyte leading to the formation of a polymeric layer bearing some bromine substituents. Subsequently, the formed polymer is functionalized with amine molecules containing functional groups (carboxylic acid or pyridine) by a substitution reaction between bromine sites and amine groups (Hofmann reaction). The chemical composition of the modified porous silicon surfaces was investigated and the grafting of polymeric chains and functional groups on the porous silicon surface was confirmed by Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS) which displayed the principal characteristic peaks attributed to the different functional groups. Furthermore, the surface of the material was examined by scanning electron microscopy (SEM).

  10. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  11. Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

    NASA Technical Reports Server (NTRS)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

    1997-01-01

    Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

  12. A Hierarchy of Homodesmotic Reactions for Thermochemistry

    PubMed Central

    Schleyer, Paul v. R.

    2009-01-01

    Chemical equations that balance bond types and atom hybridization to different degrees are often used in computational thermochemistry, for example, to increase accuracy when lower levels of theory are employed. We expose the widespread confusion over such classes of equations and demonstrate that the two most widely used definitions of “homodesmotic” reactions are not equivalent. New definitions are introduced and a consistent hierarchy of reaction classes (RC1 – RC5) for hydrocarbons is constructed: isogyric (RC1) ⊇ isodesmic (RC2) ⊇ hypohomodesmotic (RC3) ⊇ homodesmotic (RC4) ⊇ hyperhomodesmotic (RC5). Each of these successively conserves larger molecular fragments. The concept of isodesmic bond separation reactions is generalized to all classes in this hierarchy, providing a unique sectioning of a given molecule for each reaction type. Several ab initio and density functional methods are applied to the bond separation reactions of 38 hydrocarbons containing five or six carbon atoms. RC4 and RC5 reactions provide bond separation enthalpies with errors consistently less than 0.4 kcal mol−1 across a wide range of theoretical levels, performing significantly better than the other reaction types and far superior to atomization routes. Our recommended bond separation reactions were demonstrated by determining the enthalpies of formation (at 298 K) of 1,3,5-hexatriyne (163.7 ± 0.4 kcal mol−1), 1,3,5,7-octatetrayne (217.6 ± 0.6 kcal mol−1), the larger polyynes C10H2 through C26H2, and an infinite acetylenic carbon chain. PMID:19182999

  13. ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

    PubMed Central

    Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

    2014-01-01

    ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

  14. The hydrodeoxygenation of bioderived furans into alkanes.

    PubMed

    Sutton, Andrew D; Waldie, Fraser D; Wu, Ruilian; Schlaf, Marcel; Silks, Louis A Pete; Gordon, John C

    2013-05-01

    The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.

  15. The hydrodeoxygenation of bioderived furans into alkanes

    NASA Astrophysics Data System (ADS)

    Sutton, Andrew D.; Waldie, Fraser D.; Wu, Ruilian; Schlaf, Marcel; ‘Pete' Silks, Louis A.; Gordon, John C.

    2013-05-01

    The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.

  16. Theoretical Study of the Structure, Stability and Oxygen Reduction Activity of Ultrathin Platinum Nanowires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matanovic, Ivana; Kent, Paul; Garzon, Fernando

    2012-10-10

    We use density functional theory to study the difference in the structure, stability and catalytic reactivity between ultrathin, 0.5- 1.0 nm diameter, platinum nanotubes and nanowires. Model nanowires were formed by inserting an inner chain of platinum atoms in small diameter nanotubes. In this way more stable, nonhollow structures were formed. The difference in the electronic structure of platinum nanotubes and nanowires was examined by inspecting the density of surface states and band structure. Furthermore, reactivity towards the oxygen reduction reaction of platinum nanowires was addressed by studying the change in the chemisorption energies of oxygen and hydroxyl groups, inducedmore » by inserting the inner chain of platinum atoms into the hollow nanotubes. Both ultrathin platinum nanotubes and nanowires show distinct properties compared to bulk platinum. Nanotubes with diameters larger than 1 nm show promise for use as oxygen reduction catalysts.« less

  17. Resonant electron capture by aspartame and aspartic acid molecules.

    PubMed

    Muftakhov, M V; Shchukin, P V

    2016-12-30

    The processes for dissociative electron capture are the key mechanisms for decomposition of biomolecules, proteins in particular, under interaction with low-energy electrons. Molecules of aspartic acid and aspartame, i.e. modified dipeptides, were studied herein to define the impact of the side functional groups on peptide chain decomposition in resonant electron-molecular reactions. The processes of formation and decomposition of negative ions of both aspartame and aspartic acid were studied by mass spectrometry of negative ions under resonant electron capture. The obtained mass spectra were interpreted under thermochemical analysis by quantum chemical calculations. Main channels of negative molecular ions fragmentation were found and characteristic fragment ions were identified. The СООН fragment of the side chain in aspartic acid is shown to play a key role like the carboxyl group in amino acids and aliphatic oligopeptides. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Preparation of low digestible and viscoelastic tigernut (Cyperus esculentus) starch by Bacillus acidopullulyticus pullulanase.

    PubMed

    Li, Xiaolei; Fu, Jingchao; Wang, Yujuan; Ma, Fumin; Li, Dan

    2017-09-01

    Tigernut starch is an underutilized food resource. In this study, pullulanase (PUL) hydrolysis was used to change its physiochemical properties for different food applications. The content of low digestible fractions, resistant starch and slow digestible starch, in PUL modified tigernut starch significantly increased from 2.03% to 25.08% (P<0.05) using 100U/g starch of PUL in the debranching reaction. The paste or dispersion of PUL modified tigernut starch had a significantly decreased viscoelasticity (P<0.05), but the paste still exhibited a typical property of pseudoplasticity. Molecular weight, amylopectin A B2 and B3 chain of PUL modified starch were lower, while amylose content, amylopectin B1 chain were higher than those of natural tigernut starch. The low digestible and viscous tigernut starch is highly valued as a component in some functional foods. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Total synthesis of mycobacterial arabinogalactan containing 92 monosaccharide units

    NASA Astrophysics Data System (ADS)

    Wu, Yong; Xiong, De-Cai; Chen, Si-Cong; Wang, Yong-Shi; Ye, Xin-Shan

    2017-03-01

    Carbohydrates are diverse bio-macromolecules with highly complex structures that are involved in numerous biological processes. Well-defined carbohydrates obtained by chemical synthesis are essential to the understanding of their functions. However, synthesis of carbohydrates is greatly hampered by its insufficient efficiency. So far, assembly of long carbohydrate chains remains one of the most challenging tasks for synthetic chemists. Here we describe a highly efficient assembly of a 92-mer polysaccharide by the preactivation-based one-pot glycosylation protocol. Several linear and branched oligosaccharide/polysaccharide fragments ranging from 5-mer to 31-mer in length have been rapidly constructed in one-pot manner, which enables the first total synthesis of a biologically important mycobacterial arabinogalactan through a highly convergent [31+31+30] coupling reaction. Our results show that the preactivation-based one-pot glycosylation protocol may provide access to the construction of long and complicated carbohydrate chains.

  20. Ubiquitin enzymes in the regulation of immune responses

    PubMed Central

    Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo

    2017-01-01

    Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749

  1. A One-Step Route to CO2 -Based Block Copolymers by Simultaneous ROCOP of CO2 /Epoxides and RAFT Polymerization of Vinyl Monomers.

    PubMed

    Wang, Yong; Zhao, Yajun; Ye, Yunsheng; Peng, Haiyan; Zhou, Xingping; Xie, Xiaolin; Wang, Xianhong; Wang, Fosong

    2018-03-26

    The one-step synthesis of well-defined CO 2 -based diblock copolymers was achieved by simultaneous ring-opening copolymerization (ROCOP) of CO 2 /epoxides and RAFT polymerization of vinyl monomers using a trithiocarbonate compound bearing a carboxylic group (TTC-COOH) as the bifunctional chain transfer agent (CTA). The double chain-transfer effect allows for independent and precise control over the molecular weight of the two blocks and ensures narrow polydispersities of the resultant block copolymers (1.09-1.14). Notably, an unusual axial group exchange reaction between the aluminum porphyrin catalyst and TTC-COOH impedes the formation of homopolycarbonates. By taking advantage of the RAFT technique, it is able to meet the stringent demand for functionality control to well expand the application scopes of CO 2 -based polycarbonates. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Higher risk of cytomegalovirus reactivation in human immunodeficiency virus-1-infected patients homozygous for MICA5.1.

    PubMed

    Moenkemeyer, Maren; Heiken, Hans; Schmidt, Reinhold E; Witte, Torsten

    2009-03-01

    Infection with cytomegalovirus (CMV) induces surface expression of major histocompatibility complex (MHC)-class-I-chain-related A (MICA), a ligand for NKG2D. This leads to improved recognition and elimination of infected cells by natural killer (NK) as well as CD8+ T cells. The MICA5.1 allele codes for a truncated protein. This study was performed to test whether impaired expression of a functional MICA protein would influence the susceptibility to severe CMV reactivation in immunocompromised individuals. In this study, the frequency of MICA5.1 was assessed by polymerase chain reaction in 230 Caucasian human immunodeficiency virus (HIV)-1-infected patients and in 219 healthy controls. Patients co-infected with hepatitis C virus (HCV) and GB virus-C served as controls. MICA5.1 allele was analyzed by polymerase chain reaction. Association of MICA5.1 homozygosity and risk of CMV reactivation was calculated by Pearson chi2 test. Comparison of patients with and without a history of CMV disease manifestation revealed that homozygous MICA5.1 genotype was present in a significantly higher frequency in patients with CMV reactivation (33%) than in those without (16%; p 0.032; odds ratio 0.330). The percentage was similar in HIV-1-infected patients and healthy controls. Furthermore, there was no difference in the frequency of MICA5.1 with respect to infection with HCV and GB virus-C. Our study provides the first in vivo demonstration of an association between homozygous MICA5.1 genotype and susceptibility to CMV reactivation in immunocompromised individuals.

  3. Structural and kinetic mapping of side-chain exposure onto the protein energy landscape.

    PubMed

    Bernstein, Rachel; Schmidt, Kierstin L; Harbury, Pehr B; Marqusee, Susan

    2011-06-28

    Identification and characterization of structural fluctuations that occur under native conditions is crucial for understanding protein folding and function, but such fluctuations are often rare and transient, making them difficult to study. Native-state hydrogen exchange (NSHX) has been a powerful tool for identifying such rarely populated conformations, but it generally reveals no information about the placement of these species along the folding reaction coordinate or the barriers separating them from the folded state and provides little insight into side-chain packing. To complement such studies, we have performed native-state alkyl-proton exchange, a method analogous to NSHX that monitors cysteine modification rather than backbone amide exchange, to examine the folding landscape of Escherichia coli ribonuclease H, a protein well characterized by hydrogen exchange. We have chosen experimental conditions such that the rate-limiting barrier acts as a kinetic partition: residues that become exposed only upon crossing the unfolding barrier are modified in the EX1 regime (alkylation rates report on the rate of unfolding), while those exposed on the native side of the barrier are modified predominantly in the EX2 regime (alkylation rates report on equilibrium populations). This kinetic partitioning allows for identification and placement of partially unfolded forms along the reaction coordinate. Using this approach we detect previously unidentified, rarely populated conformations residing on the native side of the barrier and identify side chains that are modified only upon crossing the unfolding barrier. Thus, in a single experiment under native conditions, both sides of the rate-limiting barrier are investigated.

  4. Structural and kinetic mapping of side-chain exposure onto the protein energy landscape

    PubMed Central

    Bernstein, Rachel; Schmidt, Kierstin L.; Harbury, Pehr B.; Marqusee, Susan

    2011-01-01

    Identification and characterization of structural fluctuations that occur under native conditions is crucial for understanding protein folding and function, but such fluctuations are often rare and transient, making them difficult to study. Native-state hydrogen exchange (NSHX) has been a powerful tool for identifying such rarely populated conformations, but it generally reveals no information about the placement of these species along the folding reaction coordinate or the barriers separating them from the folded state and provides little insight into side-chain packing. To complement such studies, we have performed native-state alkyl-proton exchange, a method analogous to NSHX that monitors cysteine modification rather than backbone amide exchange, to examine the folding landscape of Escherichia coli ribonuclease H, a protein well characterized by hydrogen exchange. We have chosen experimental conditions such that the rate-limiting barrier acts as a kinetic partition: residues that become exposed only upon crossing the unfolding barrier are modified in the EX1 regime (alkylation rates report on the rate of unfolding), while those exposed on the native side of the barrier are modified predominantly in the EX2 regime (alkylation rates report on equilibrium populations). This kinetic partitioning allows for identification and placement of partially unfolded forms along the reaction coordinate. Using this approach we detect previously unidentified, rarely populated conformations residing on the native side of the barrier and identify side chains that are modified only upon crossing the unfolding barrier. Thus, in a single experiment under native conditions, both sides of the rate-limiting barrier are investigated. PMID:21670244

  5. Prediction of FAD binding sites in electron transport proteins according to efficient radial basis function networks and significant amino acid pairs.

    PubMed

    Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen

    2016-07-30

    Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.

  6. Testing Geometrical Discrimination within an Enzyme Active Site: Constrained Hydrogen Bonding in the Ketosteroid Isomerase Oxyanion Hole

    PubMed Central

    Sigala, Paul A.; Kraut, Daniel A.; Caaveiro, Jose M. M.; Pybus, Brandon; Ruben, Eliza A.; Ringe, Dagmar; Petsko, Gregory A.; Herschlag, Daniel

    2009-01-01

    Enzymes are classically proposed to accelerate reactions by binding substrates within active site environments that are structurally preorganized to optimize binding interactions with reaction transition states rather than ground states. This is a remarkably formidable task considering the limited 0.1 – 1 Å scale of most substrate rearrangements. The flexibility of active site functional groups along the coordinate of substrate rearrangement, the distance scale on which enzymes can distinguish structural rearrangement, and the energetic significance of discrimination on that scale remain open questions that are fundamental to a basic physical understanding of enzyme active sites and catalysis. We bring together high resolution X-ray crystallography, 1H and 19F NMR spectroscopy, quantum mechanical calculations, and transition state analog binding measurements to test the distance scale on which non-covalent forces can constrain side chain and ligand relaxation or translation along a specific coordinate and the energetic consequences of such geometric constraints within the active site of bacterial ketosteroid isomerase (KSI). Our results strongly suggest that packing and binding interactions within the KSI active site can constrain local side chain reorientation and prevent hydrogen bond shortening by 0.1 Å or less. Further, this constraint has substantial energetic effects on ligand binding and stabilization of negative charge within the oxyanion hole. These results provide evidence that subtle geometric effects, indistinguishable in most X-ray crystallographic structures, can have significant energetic consequences and highlight the importance of using synergistic experimental approaches to dissect enzyme function. PMID:18808119

  7. Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1.

    PubMed

    Pan, Ling; Pasternak, David A; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W; Pan, Ying-Xian

    2017-01-01

    The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3' or 5' splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function.

  8. Evaluation of reference gene suitability for quantitative expression analysis by quantitative polymerase chain reaction in the mandibular condyle of sheep.

    PubMed

    Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin

    2015-10-01

    Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.

  9. Spin Transfer in Polymer Degradation of Abnormal Linkage

    NASA Astrophysics Data System (ADS)

    Yu, Tianrong; Tian, Chuanjin; Liu, Xizhe; Wang, Jia; Gao, Yang; Wang, Zhigang

    2017-07-01

    The degradation of polymer materials plays an important role in production and life. In this work, the degradation mechanism of poly-α-methylstyrene (PAMS) tetramers with abnormal linkage was investigated by using density functional theory (DFT). Calculated results indicate that the head-to-head and the tail-to-tail reactions needed to overcome the energy barriers are about 0.15 eV and about 1.26 eV, respectively. The broken C-C bond at the unsaturated end of the chain leads to the dissociation of alpha-methylstyrene (AMS) monomers one by one. Furthermore, the analyses of bond characteristics are in good agreement with the results of energy barriers. In addition, the spin population analysis presents an interesting net spin transfer process in depolymerization reactions. We hope that the current theoretical results provide useful help to understand the degradation mechanism of polymers.

  10. Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

    NASA Astrophysics Data System (ADS)

    Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2016-09-01

    Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

  11. Transcription Analysis of the Beta-Glucosidase Precursor in Wild-Type and l-4i Mutant Bombyx mori (Lepidoptera: Bombycidae).

    PubMed

    Kang, Lequn; Huang, Fei; Wu, Fan; Zhao, Qiaoling

    2015-01-01

    Lethal fourth-instar larvae (l-4i) mutant of Bombyx mori, a recently discovered novel mutant, die from energy depletion due to genetic mutation. Beta-glucosidase is a common digestive enzyme that hydrolyzes cellulose in the diet to provide energy. In this study, the mRNA expression profiles of B. mori beta-glucosidase precursor (BmpreBG) were characterized by reverse transcription polymerase chain reaction and quantitative real-time polymerase chain reaction. The transcription level of BmpreBG varied in different tissues and developmental stages, except in the pupa and moth, which are the no-diet period. Remarkably, the mRNA expression level of BmpreBG was sharply reduced in l-4i but not in the wild type, which suggested that the digestive function of the mutant was severely damaged. This was consistent with the l-4i phenotypic traits of not eating mulberries, lack of energy, and ultimate death. 5'-rapid amplification of cDNA ends showed, for the first time, that BmpreBG has a 160-bp 5'-untranslated region. These findings suggested that B. mori β-glucosidase precursor was involved in the death process of l-4i mutant larvae. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  12. Microarray Analysis of Differential Gene Expression Profile Between Human Fetal and Adult Heart.

    PubMed

    Geng, Zhimin; Wang, Jue; Pan, Lulu; Li, Ming; Zhang, Jitai; Cai, Xueli; Chu, Maoping

    2017-04-01

    Although many changes have been discovered during heart maturation, the genetic mechanisms involved in the changes between immature and mature myocardium have only been partially elucidated. Here, gene expression profile changed between the human fetal and adult heart was characterized. A human microarray was applied to define the gene expression signatures of the fetal (13-17 weeks of gestation, n = 4) and adult hearts (30-40 years old, n = 4). Gene ontology analyses, pathway analyses, gene set enrichment analyses, and signal transduction network were performed to predict the function of the differentially expressed genes. Ten mRNAs were confirmed by quantificational real-time polymerase chain reaction. 5547 mRNAs were found to be significantly differentially expressed. "Cell cycle" was the most enriched pathway in the down-regulated genes. EFGR, IGF1R, and ITGB1 play a central role in the regulation of heart development. EGFR, IGF1R, and FGFR2 were the core genes regulating cardiac cell proliferation. The quantificational real-time polymerase chain reaction results were concordant with the microarray data. Our data identified the transcriptional regulation of heart development in the second trimester and the potential regulators that play a prominent role in the regulation of heart development and cardiac cells proliferation.

  13. HOX genes in human lung: altered expression in primary pulmonary hypertension and emphysema.

    PubMed

    Golpon, H A; Geraci, M W; Moore, M D; Miller, H L; Miller, G J; Tuder, R M; Voelkel, N F

    2001-03-01

    HOX genes belong to the large family of homeodomain genes that function as transcription factors. Animal studies indicate that they play an essential role in lung development. We investigated the expression pattern of HOX genes in human lung tissue by using microarray and degenerate reverse transcriptase-polymerase chain reaction survey techniques. HOX genes predominantly from the 3' end of clusters A and B were expressed in normal human adult lung and among them HOXA5 was the most abundant, followed by HOXB2 and HOXB6. In fetal (12 weeks old) and diseased lung specimens (emphysema, primary pulmonary hypertension) additional HOX genes from clusters C and D were expressed. Using in situ hybridization, transcripts for HOXA5 were predominantly found in alveolar septal and epithelial cells, both in normal and diseased lungs. A 2.5-fold increase in HOXA5 mRNA expression was demonstrated by quantitative reverse transcriptase-polymerase chain reaction in primary pulmonary hypertension lung specimens when compared to normal lung tissue. In conclusion, we demonstrate that HOX genes are selectively expressed in the human lung. Differences in the pattern of HOX gene expression exist among fetal, adult, and diseased lung specimens. The altered pattern of HOX gene expression may contribute to the development of pulmonary diseases.

  14. HOX Genes in Human Lung

    PubMed Central

    Golpon, Heiko A.; Geraci, Mark W.; Moore, Mark D.; Miller, Heidi L.; Miller, Gary J.; Tuder, Rubin M.; Voelkel, Norbert F.

    2001-01-01

    HOX genes belong to the large family of homeodomain genes that function as transcription factors. Animal studies indicate that they play an essential role in lung development. We investigated the expression pattern of HOX genes in human lung tissue by using microarray and degenerate reverse transcriptase-polymerase chain reaction survey techniques. HOX genes predominantly from the 3′ end of clusters A and B were expressed in normal human adult lung and among them HOXA5 was the most abundant, followed by HOXB2 and HOXB6. In fetal (12 weeks old) and diseased lung specimens (emphysema, primary pulmonary hypertension) additional HOX genes from clusters C and D were expressed. Using in situ hybridization, transcripts for HOXA5 were predominantly found in alveolar septal and epithelial cells, both in normal and diseased lungs. A 2.5-fold increase in HOXA5 mRNA expression was demonstrated by quantitative reverse transcriptase-polymerase chain reaction in primary pulmonary hypertension lung specimens when compared to normal lung tissue. In conclusion, we demonstrate that HOX genes are selectively expressed in the human lung. Differences in the pattern of HOX gene expression exist among fetal, adult, and diseased lung specimens. The altered pattern of HOX gene expression may contribute to the development of pulmonary diseases. PMID:11238043

  15. Phylogeny of Rieske/cytb Complexes with a Special Focus on the Haloarchaeal Enzymes

    PubMed Central

    Baymann, Frauke; Schoepp-Cothenet, Barbara; Lebrun, Evelyne; van Lis, Robert; Nitschke, Wolfgang

    2012-01-01

    Rieske/cytochrome b (Rieske/cytb) complexes are proton pumping quinol oxidases that are present in most bacteria and Archaea. The phylogeny of their subunits follows closely the 16S-rRNA phylogeny, indicating that chemiosmotic coupling was already present in the last universal common ancestor of Archaea and bacteria. Haloarchaea are the only organisms found so far that acquired Rieske/cytb complexes via interdomain lateral gene transfer. They encode two Rieske/cytb complexes in their genomes; one of them is found in genetic context with nitrate reductase genes and has its closest relatives among Actinobacteria and the Thermus/Deinococcus group. It is likely to function in nitrate respiration. The second Rieske/cytb complex of Haloarchaea features a split cytochrome b sequence as do Cyanobacteria, chloroplasts, Heliobacteria, and Bacilli. It seems that Haloarchaea acquired this complex from an ancestor of the above-mentioned phyla. Its involvement in the bioenergetic reaction chains of Haloarchaea is unknown. We present arguments in favor of the hypothesis that the ancestor of Haloarchaea, which relied on a highly specialized bioenergetic metabolism, that is, methanogenesis, and was devoid of quinones and most enzymes of anaerobic or aerobic bioenergetic reaction chains, integrated laterally transferred genes into its genome to respond to a change in environmental conditions that made methanogenesis unfavorable. PMID:22798450

  16. Hypothalamic amenorrhea in a Camurati-Engelmann disease--a case report.

    PubMed

    Meczekalski, Blazej; Czyzyk, Adam; Podfigurna-Stopa, Agnieszka; Rydzewski, Bogdan; Sroczynski, Jakub; Lipinska, Małgorzata; Sokalski, Jerzy; Krawczynski, Maciej; Jamsheer, Aleksander; Katulski, Krzysztof; Genazzani, Alessandro

    2013-05-01

    A case report of a patient diagnosed with Camurati-Engelmann Disease (CED) in association with the functional hypothalamic amenorrhea disturbances. CED is a very rare genetically determined disorder classified as a type of bone dysplasia. Case report. Department of Gynecological Endocrinology, 3rd grade Medical University Hospital. Twenty-one years old female patient with CED admitted to the hospital because of primary amenorrhea. Her history revealed skeletal deformities and hearing impairment. Clinical examination, ultrasound, laboratory evaluations (including serum gonadotropins (FSH, LH) at basal state and after stimulation with gonadotropin-releasing hormone, serum basal estradiol) radiological studies (X-ray of the head, the lumbar spine and lower extremities; a computed tomography of the head), G-banding karyotype, polymerase chain reaction and DNA sequencing. Hormonal serum evaluations were made using an enzyme-linked immunosorbent assay. The exon 4 of the transforming growth factor beta 1 gene was amplified by a polymerase chain reaction and the product was directly sequenced. The hormonal analysis was characteristic for the hypogonadotropic hypogonadism. Radiological and molecular analyses confirmed CED diagnosis. The hypothalamic amenorrhea in a patient with CED may be explained as a consequence of fat hypotrophy and very low body mass index. Therefore, impairment within hypothalamic-pituitary axis in patients with CED should be treated with special attention.

  17. Novel route of synthesis for cellulose fiber-based hybrid polyurethane

    NASA Astrophysics Data System (ADS)

    Ikhwan, F. H.; Ilmiati, S.; Kurnia Adi, H.; Arumsari, R.; Chalid, M.

    2017-07-01

    Polyurethanes, obtained by the reaction of a diisocyanate compound with bifunctional or multifunctional reagent such as diols or polyols, have been studied intensively and well developed. The wide range modifier such as chemical structures and molecular weight to build polyurethanes led to designs of materials that may easily meet the functional product demand and to the extraordinary spreading of these materials in market. Properties of the obtained polymer are related to the chemical structure of polyurethane backbone. A number polyurethanes prepared from biomass-based monomers have been reported. Cellulose fiber, as a biomass material is containing abundant hydroxyl, promising material as chain extender for building hybrid polyurethanes. In previous researches, cellulose fiber was used as filler in synthesis of polyurethane composites. This paper reported a novel route of hybrid polyurethane synthesis, which a cellulose fiber was used as chain extender. The experiment performed by reacting 4,4’-Methylenebis (cyclohexyl isocyanate) (HMDI) and polyethylene glycol with variation of molecular weight to obtained pre-polyurethane, continued by adding micro fiber cellulose (MFC) with variation of type and composition in the mixture. The experiment was evaluated by NMR, FTIR, SEM and STA measurement. NMR and FTIR confirmed the reaction of the hybrid polyurethane. STA showed hybrid polyurethane has good thermal stability. SEM showed good distribution and dispersion of sorghum-based MFC.

  18. IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

    PubMed

    Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

    1999-09-01

    Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

  19. Wavelength-Selective Light-Responsive DASA-Functionalized Polymersome Nanoreactors.

    PubMed

    Rifaie-Graham, Omar; Ulrich, Sebastian; Galensowske, Nikolas F B; Balog, Sandor; Chami, Mohamed; Rentsch, Daniel; Hemmer, James R; Read de Alaniz, Javier; Boesel, Luciano F; Bruns, Nico

    2018-06-27

    Transient activation of biochemical reactions by visible light and subsequent return to the inactive state in the absence of light is an essential feature of the biochemical processes in photoreceptor cells. To mimic such light-responsiveness with artificial nanosystems, polymersome nanoreactors were developed that can be switched on by visible light and self-revert fast in the dark at room temperature to their inactive state. Donor-acceptor Stenhouse adducts (DASAs), with their ability to isomerize upon irradiation with visible light, were employed to change the permeability of polymersome membranes by switching polarity from a nonpolar triene-enol form to a cyclopentenone with increased polarity. To this end, amphiphilic block copolymers containing poly(pentafluorophenyl methacrylate) in their hydrophobic block were synthesized by reversible addition-fragmentation chain-transfer (RAFT) radical polymerization and functionalized either with a DASA that is based on Meldrum's acid or with a novel fast-switching pyrazolone-based DASA. These polymers were self-assembled into vesicles. Release of hydrophilic payload could be triggered by light and stopped as soon as the light was turned off. The encapsulation of enzymes yielded photoresponsive nanoreactors that catalyzed reactions only if they were irradiated with light. A mixture of polymersome nanoreactors, one that switches in green light, the other switching in red light, permitted specific control of the individual reactions of a reaction cascade in one pot by irradiation with varied wavelengths, thus enabling light-controlled wavelength-selective catalysis. The DASA-based nanoreactors demonstrate the potential of DASAs to switch permeability of membranes and could find application to switch reactions on and off, on demand, e.g., in microfluidics or in drug delivery.

  20. Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

    PubMed Central

    Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

    2012-01-01

    Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

  1. Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

    PubMed

    Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

    2006-05-01

    Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

  2. Microbial community structure and functioning in marine sediments associated with diffuse hydrothermal venting assessed by integrated meta-omics.

    PubMed

    Urich, Tim; Lanzén, Anders; Stokke, Runar; Pedersen, Rolf B; Bayer, Christoph; Thorseth, Ingunn H; Schleper, Christa; Steen, Ida H; Ovreas, Lise

    2014-09-01

    Deep-sea hydrothermal vents are unique environments on Earth, as they host chemosynthetic ecosystems fuelled by geochemical energy with chemolithoautotrophic microorganisms at the basis of the food webs. Whereas discrete high-temperature venting systems have been studied extensively, the microbiotas associated with low-temperature diffuse venting are not well understood. We analysed the structure and functioning of microbial communities in two diffuse venting sediments from the Jan Mayen vent fields in the Norwegian-Greenland Sea, applying an integrated 'omics' approach combining metatranscriptomics, metaproteomics and metagenomics. Polymerase chain reaction-independent three-domain community profiling showed that the two sediments hosted highly similar communities dominated by Epsilonproteobacteria, Deltaproteobacteria and Gammaproteobacteria, besides ciliates, nematodes and various archaeal taxa. Active metabolic pathways were identified through transcripts and peptides, with genes of sulphur and methane oxidation, and carbon fixation pathways highly expressed, in addition to genes of aerobic and anaerobic (nitrate and sulphate) respiratory chains. High expression of chemotaxis and flagella genes reflected a lifestyle in a dynamic habitat rich in physico-chemical gradients. The major metabolic pathways could be assigned to distinct taxonomic groups, thus enabling hypotheses about the function of the different prokaryotic and eukaryotic taxa. This study advances our understanding of the functioning of microbial communities in diffuse hydrothermal venting sediments. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Surface-Initiated Polymerization with Poly(n-hexylisocyanate) to Covalently Functionalize Silica Nanoparticles.

    PubMed

    Vatansever, Fatma; Hamblin, Michael R

    2017-02-01

    New methods are needed for covalent functionalization of nanoparticles-surface with organic polymer coronas to generate polymeric nanocomposite in a controlled manner. Here we report the use of a surface-initiated polymerization approach, mediated by titanium (IV) catalysis, to grow poly( n -hexylisocyanate) chains from silica surface. Two pathways were used to generate the interfacing in these nano-hybrids. In the first one, the nanoparticles was "seeded" with SiCl4, followed by reaction with 1,6-hexanediol to form hydroxyl groups attached directly to the surface via O-Si-O bonding. In the second pathway, the nanoparticles were initially exposed to a 9:1 mixture of trimethyl silyl chloride and chlorodimethyl octenyl silane which was then followed by hydroboration of the double bonds, to afford hydroxyl groups with a spatially controlled density and surface-attachment via O-Si-C bonding. These functionalized surfaces were then activated with the titanium tetrachloride catalyst. In our approach, thus surface tethered catalyst provided the sites for n -hexyl isocyanate monomer insertion, to "build up" the surface-grown polymer layers from the "bottom-up". A final end-capping, to seal off the chain ends, was done via acetyl chloride. Compounds were characterized by FT-IR, 1H-NMR, GC-MS, GPC, and thermogravimetric analyses.

  4. Surface-Initiated Polymerization with Poly(n-hexylisocyanate) to Covalently Functionalize Silica Nanoparticles

    PubMed Central

    Vatansever, Fatma; Hamblin, Michael R.

    2017-01-01

    New methods are needed for covalent functionalization of nanoparticles-surface with organic polymer coronas to generate polymeric nanocomposite in a controlled manner. Here we report the use of a surface-initiated polymerization approach, mediated by titanium (IV) catalysis, to grow poly(n-hexylisocyanate) chains from silica surface. Two pathways were used to generate the interfacing in these nano-hybrids. In the first one, the nanoparticles was “seeded” with SiCl4, followed by reaction with 1,6-hexanediol to form hydroxyl groups attached directly to the surface via O-Si-O bonding. In the second pathway, the nanoparticles were initially exposed to a 9:1 mixture of trimethyl silyl chloride and chlorodimethyl octenyl silane which was then followed by hydroboration of the double bonds, to afford hydroxyl groups with a spatially controlled density and surface-attachment via O-Si-C bonding. These functionalized surfaces were then activated with the titanium tetrachloride catalyst. In our approach, thus surface tethered catalyst provided the sites for n-hexyl isocyanate monomer insertion, to “build up” the surface-grown polymer layers from the “bottom-up”. A final end-capping, to seal off the chain ends, was done via acetyl chloride. Compounds were characterized by FT-IR, 1H-NMR, GC-MS, GPC, and thermogravimetric analyses. PMID:28989336

  5. Selection of single chain antibody fragments binding to the extracellular domain of 4-1BB receptor by phage display technology.

    PubMed

    Bagheri, Salman; Yousefi, Mehdi; Safaie Qamsari, Elmira; Riazi-Rad, Farhad; Abolhassani, Mohsen; Younesi, Vahid; Dorostkar, Ruhollah; Movassaghpour, Ali Akbar; Sharifzadeh, Zahra

    2017-03-01

    The 4-1BB is a surface glycoprotein that pertains to the tumor necrosis factor-receptor family. There is compelling evidence suggesting important roles for 4-1BB in the immune response, including cell activation and proliferation and also cytokine induction. Because of encouraging results of different agonistic monoclonal antibodies against 4-1BB in the treatment of cancer, infectious, and autoimmune diseases, 4-1BB has been suggested as an attractive target for immunotherapy. In this study, single chain variable fragment phage display libraries, Tomlinson I+J, were screened against specific synthetic oligopeptides (peptides I and II) designed from 4-1BB extracellular domain. Five rounds of panning led to selection of four 4-1BB specific single chain variable fragments (PI.12, PI.42, PII.16, and PII.29) which showed specific reaction to relevant peptides in phage enzyme-linked immunosorbent assay. The selected clones were successfully expressed in Escherichia coli Rosetta-gami 2, and their expression was confirmed by western blot analysis. Enzyme-linked immunosorbent assay experiments indicated that these antibodies were able to specifically recognize 4-1BB without any cross-reactivity with other antigens. Flow cytometry analysis demonstrated an acceptable specific binding of the single chain variable fragments to 4-1BB expressed on CCRF-CEM cells, while no binding was observed with an irrelevant antibody. Anti-4-1BB single chain variable fragments enhanced surface CD69 expression and interleukin-2 production in stimulated CCRF-CEM cells which confirmed the agonistic effect of the selected single chain variable fragments. The data from this study have provided a rationale for further experiments involving the biological functions of anti-4-1BB single chain variable fragments in future studies.

  6. Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

    PubMed

    Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

    2016-08-08

    Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

  7. Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

    USDA-ARS?s Scientific Manuscript database

    Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

  8. Functional characterization of an invertase inhibitor gene involved in sucrose metabolism in tomato fruit.

    PubMed

    Zhang, Ning; Jiang, Jing; Yang, Yan-li; Wang, Zhi-he

    2015-10-01

    In this study, we produced tomato plants overexpressing an invertase inhibitor gene (Sly-INH) from tomato, using a simple and efficient transient transformation system. Compared with control plants, the expression of Sly-INH was highly upregulated in Sly-INH overexpressing plants, as indicated by real-time polymerase chain reaction (PCR). Physiological analysis revealed that Sly-INH inhibited the activity of cell wall invertase (CWIN), which increased sugar accumulation in tomato fruit. Furthermore, Sly-INH mediated sucrose metabolism by regulating CWIN activity. Our results suggest that invertase activity is potentially regulated by the Sly-INH inhibitor at the post-translational level, and they demonstrate that the transient transformation system is an effective method for determining the functions of genes in tomato.

  9. Deep-Earth reactor: nuclear fission, helium, and the geomagnetic field.

    PubMed

    Hollenbach, D F; Herndon, J M

    2001-09-25

    Geomagnetic field reversals and changes in intensity are understandable from an energy standpoint as natural consequences of intermittent and/or variable nuclear fission chain reactions deep within the Earth. Moreover, deep-Earth production of helium, having (3)He/(4)He ratios within the range observed from deep-mantle sources, is demonstrated to be a consequence of nuclear fission. Numerical simulations of a planetary-scale geo-reactor were made by using the SCALE sequence of codes. The results clearly demonstrate that such a geo-reactor (i) would function as a fast-neutron fuel breeder reactor; (ii) could, under appropriate conditions, operate over the entire period of geologic time; and (iii) would function in such a manner as to yield variable and/or intermittent output power.

  10. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    PubMed

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  12. Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

    NASA Astrophysics Data System (ADS)

    Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

    2017-06-01

    A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

  13. [Research of Human-mouse Chimeric Antibodies Against Ebola Virus Nucleoprotein].

    PubMed

    Zhou, Rongping; Sun, Lina; Liu, Yang; Wu, Wei; Li, Chuan; Liang, Mifang; Qiu, Peihong

    2016-01-01

    The Ebola virus is highly infectious and can result in death in ≤ 90% of infected subjects. Detection of the Ebola virus and diagnosis of infection are extremely important for epidemic control. Presently, Chinese laboratories detect the nucleic acids of the Ebola virus by real-time reverse transcription-polymerase chain reaction (RT-PCR). However, such detection takes a relatively long time and necessitates skilled personnel and expensive equipment. Enzyme-linked immunosorbent assay (ELISA) of serum is simple, easy to operate, and can be used to ascertain if a patient is infected with the Ebola virus as well as the degree of infection. Hence, ELISA can be used in epidemiological investigations and is a strong complement to detection of nucleic acids. Cases of Ebola hemorrhagic fever have not been documented in China, so quality-control material for positive serology is needed. Construction and expression of human-mouse chimeric antibodies against the nucleoprotein of the Ebola virus was carried out. Genes encoding variable heavy (VH) and variable light (VL) chains were extracted and amplified from murine hybridoma cells. Genes encoding the VH and VL chains of monoclonal antibodies were amplified by RT-PCR. According to sequence analyses, a primer was designed to amplify functional sequences relative to VH and VL chain. The eukaryotic expression vector HL51-14 carrying some human antibody heavy chain- and light chain-constant regions was used. IgG antibodies were obtained by transient transfection of 293T cells. Subsequently, immunological detection and immunological identification were identified by ELISA, immunofluorescence assay, and western blotting. These results showed that we constructed and purified two human- mouse chimeric antibodies.

  14. Stimuli-Responsive DNA-Based Hydrogels: From Basic Principles to Applications.

    PubMed

    Kahn, Jason S; Hu, Yuwei; Willner, Itamar

    2017-04-18

    The base sequence of nucleic acids encodes structural and functional information into the DNA biopolymer. External stimuli such as metal ions, pH, light, or added nucleic acid fuel strands provide triggers to reversibly switch nucleic acid structures such as metal-ion-bridged duplexes, i-motifs, triplex nucleic acids, G-quadruplexes, or programmed double-stranded hybrids of oligonucleotides (DNA). The signal-triggered oligonucleotide structures have been broadly applied to develop switchable DNA nanostructures and DNA machines, and these stimuli-responsive assemblies provide functional scaffolds for the rapidly developing area of DNA nanotechnology. Stimuli-responsive hydrogels undergoing signal-triggered hydrogel-to-solution transitions or signal-controlled stiffness changes attract substantial interest as functional matrices for controlled drug delivery, materials exhibiting switchable mechanical properties, acting as valves or actuators, and "smart" materials for sensing and information processing. The integration of stimuli-responsive oligonucleotides with hydrogel-forming polymers provides versatile means to exploit the functional information encoded in the nucleic acid sequences to yield stimuli-responsive hydrogels exhibiting switchable physical, structural, and chemical properties. Stimuli-responsive DNA-based nucleic acid structures are integrated in acrylamide polymer chains and reversible, switchable hydrogel-to-solution transitions of the systems are demonstrated by applying external triggers, such as metal ions, pH-responsive strands, G-quadruplex, and appropriate counter triggers that bridge and dissociate the polymer chains. By combining stimuli-responsive nucleic acid bridges with thermosensitive poly(N-isopropylacrylamide) (pNIPAM) chains, systems undergoing reversible solution ↔ hydrogel ↔ solid transitions are demonstrated. Specifically, by bridging acrylamide polymer chains by two nucleic acid functionalities, where one type of bridging unit provides a stimuli-responsive element and the second unit acts as internal "bridging memory", shape-memory hydrogels undergoing reversible and switchable transitions between shaped hydrogels and shapeless quasi-liquid states are demonstrated. By using stimuli-responsive hydrogel cross-linking units that can assemble the bridging units by two different input signals, the orthogonally-triggered functions of the shape-memory were shown. Furthermore, a versatile approach to assemble stimuli-responsive DNA-based acrylamide hydrogel films on surfaces is presented. The method involves the activation of the hybridization chain-reaction (HCR) by a surface-confined promoter strand, in the presence of acrylamide chains modified with two DNA hairpin structures and appropriate stimuli-responsive tethers. The resulting hydrogel-modified surfaces revealed switchable stiffness properties and signal-triggered catalytic functions. By applying the method to assemble the hydrogel microparticles, substrate-loaded, stimuli-responsive microcapsules are prepared. The signal-triggered DNA-based hydrogel microcapsules are applied as drug carriers for controlled release. The different potential applications and future perspectives of stimuli responsive hydrogels are discussed. Specifically, the use of these smart materials and assemblies as carriers for controlled drug release and as shape-memory matrices for information storage and inscription and the use of surface-confined stimuli-responsive hydrogels, exhibiting switchable stiffness properties, for catalysis and controlled growth of cells are discussed.

  15. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  16. Palladium-Catalyzed Allylic C-H Bond Functionalization of Olefins

    NASA Astrophysics Data System (ADS)

    Liu, Guosheng; Wu, Yichen

    Transition metal-mediated carbon-hydrogen bond cleavage and functionalization is a mechanistically interesting and synthetically attractive process. One of the important cases is the removal of a allylic hydrogen from an olefin by a PdII salt to yield a π-allylpalladium complex, followed by nucleophilic attack to efficient produce allylic derivatives. In contrast to the well-known allylic acetoxylation of cyclohexene, the reaction of open-chain olefins is fairly poor until recent several years. Some palladium catalytic systems have been reported to achieve allylic C-H functionalization, including acetoxylation, amination and alkylation of terminal alkenes. In the most of cases, ligand is crucial to the success of the transformation. This review surveys the recent development of palladium-catalyzed allylic C-H functionalziation of alkenes. These results promise a significant increase in the scope of olefin transformation.

  17. Hydrolysis of the amorphous cellulose in cotton-based paper.

    PubMed

    Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

    2008-04-01

    Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

  18. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  19. [The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

    PubMed

    D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

    1993-01-01

    The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

  20. Three-Dimensional Polypeptide Architectures Through Tandem Catalysis and Click Chemistry

    NASA Astrophysics Data System (ADS)

    Rhodes, Allison Jane

    Rapid renal clearance, liver accumulation, proteolytic degradation and non-specificity are challenges small molecule drugs, peptides, proteins and nucleic acid therapeutics encounter en route to their intended destination within the body. Nanocarriers (i.e. dendritric polymers, vesicles, and micelles) of approximately 100 nm in diameter, shuttle small molecule drugs to their desired location through passive (EPR effect) and active (ligand-mediated) targeting, maximizing therapeutic efficiency. Polypeptide-based polymers are water-soluble, biocompatible, non-toxic and are therefore excellent candidates for nanocarriers. Dendritic polymers, including dendrimers, cylindrical brushes, and star polymers, are the newest class of nanomedicine drug delivery vehicles. The synthesis and characterization of dendritic polymers is challenging, with tedious and costly procedures. Dendritic polymers possess peripheral pendent functional groups that can potentially be used in ligand-mediated drug delivery vehicles and bioimaging applications. More specifically, cylindrical brushes are dendritic polymers where a single linear polymer (primary chain) has polymer chains (secondary chains) grafted to it. Recently, research groups have shown that cylindrical brush polymers are capable of nanoparticle and supramolecular structure self-assembly. The facile preparation of high-density brush copolypeptides by the "grafting from" approach will be discussed. This approach utilizes a novel, tandem catalytic methodology where alloc-alpha-aminoamide groups are installed within the side-chains of the alpha-amino-N-carboxyanhydride (NCA) monomer serving as masked initiators. These groups are inert during cobalt initiated NCA polymerization, and give alloc-alpha-aminoamide substituted polypeptide main-chains. The alloc-alpha-aminoamide groups are activated in situ using nickel to generate initiators for growth of side-chain brush segments. This method proves to be efficient, yielding well-defined, high-density brushes for applications in drug delivery and imaging. Here, we also report a method for the synthesis of soluble, well-defined, azido functionalized polypeptides in a straightforward, 3-step synthesis. Homo and diblock azidopolypeptides were prepared with controlled segment lengths via living polymerization using Co(PMe3)4 initiator. Through copper azide alkyne click chemistry (CuAAC) in organic solvent, azidopolypeptides were regioselectively and quantitatively modified with carboxylic acid (pH-responsive), amino acid and sugar functional groups. Finally, the advances towards well-defined hyperbranched polypeptides through alpha-amino-acid-N-thiocarboxyanhydrides (NTAs) will be discussed. Within the past 10 years, controlled NCA (alpha-amino acid-N-carboxyanhydride) ring-opening polymerization (ROP) has emerged, expanding the application of copolypeptide polymers in various drug delivery and tissue engineering motifs. Modification of NCA monomers to the corresponding alpha-amino-acid-N-thiocarboxyanhydride (NTA) will diversify ROP reactions, leading to more complex polypeptides (such as hyperbranched polymers), in addition to the possibility of performing these polymerizations under ambient conditions, which would greatly expand their potential utility. The project focuses on the preparation of hyperbranched polypeptides with well-defined architectures and controlled branching density in a one-pot reaction. This will be accomplished by taking advantage of the different selectivities of Co(PMe3)4 and depeNi(COD) polymerization initiators, and by exploiting the reactivity difference between NCA and the more stable NTA monomers.

Top